RU2324940C1 - Method of prediction of cystic echinococcosis course in children - Google Patents
Method of prediction of cystic echinococcosis course in children Download PDFInfo
- Publication number
- RU2324940C1 RU2324940C1 RU2007107565/15A RU2007107565A RU2324940C1 RU 2324940 C1 RU2324940 C1 RU 2324940C1 RU 2007107565/15 A RU2007107565/15 A RU 2007107565/15A RU 2007107565 A RU2007107565 A RU 2007107565A RU 2324940 C1 RU2324940 C1 RU 2324940C1
- Authority
- RU
- Russia
- Prior art keywords
- children
- echinococcosis
- development
- val
- cystic
- Prior art date
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Предлагаемое изобретение относится к медицине, а именно к медицинской паразитологии, и может быть использовано для выявления групп риска к заболеванию цистным эхинококкозом детей.The present invention relates to medicine, namely to medical parasitology, and can be used to identify risk groups for cystic echinococcosis in children.
Цистный эхинококкоз (ЦЭ) - широко распространенное в мире тяжелое зооантропонозное заболевание, характеризующееся развитием кист в печени, легких, селезенке и других органах. Ключевым звеном патогенеза ЦЭ является проникновение онкосфер Е. granulosus в организм человека, однако клиническая реализация инвазии, ее последующее течение, развитие осложнений зависят от предрасполагающих факторов, многие из которых генетически детерминированы (Озерецковская Н.Н. Цестодозы-зоонозы - неотложная глобальная проблема. // Мед. паразитол. и пар. болезни. 2001. С.52-59). К числу наиболее актуальных аспектов проблемы профилактики эхинококкозов относятся вопросы своевременного выявления предрасполагающих факторов, среди которых наиболее важными являются эндогенный фон и неблагоприятное воздействие компонентов окружающей среды.Cystic echinococcosis (CE) is a widespread severe zoo anthroponous disease in the world, characterized by the development of cysts in the liver, lungs, spleen and other organs. The key element in the pathogenesis of CE is the penetration of the oncospheres of E. granulosus into the human body, however, the clinical realization of the invasion, its subsequent course, and the development of complications depend on predisposing factors, many of which are genetically determined (Ozeretskovskaya N.N. Cestodoses-zoonoses is an urgent global problem. / / Medical parasitol. And steam diseases. 2001. S. 52-59). Among the most relevant aspects of the problem of prevention of echinococcosis are issues of timely identification of predisposing factors, among which the most important are the endogenous background and the adverse effects of environmental components.
Имеется немало доказательств того, что люди значительно чаще заражаются эхинококкозом, чем заболевают ее клинической формой (абортивная форма заболевания развивается в 99% случаев). Известны случаи бессимптомного течения эхинококковой болезни или со слабо выраженными симптомами невыявленного эхинококкоза, которые заканчиваются полным выздоровлением (Тумольская Н.И. Клинические аспекты проблемы эхиноккозов и пути се решения // Мед паразитол. 1992. №5-6. С.5-9.). Биологическая сущность этих явлений пока только начинает изучаться.There is a lot of evidence that people are much more likely to become infected with echinococcosis than to become ill with its clinical form (an abortive form of the disease develops in 99% of cases). There are known cases of an asymptomatic course of echinococcal disease or with mild symptoms of undiagnosed echinococcosis, which end with a complete recovery (Tumolskaya NI Clinical aspects of the problem of echinococcosis and ways to solve it // Med parasitol. 1992. No. 5-6. S.5-9. ) The biological essence of these phenomena is only just beginning to be studied.
Исследования показали, что интенсивность инвазии в очаге определяется в большой степени особенностями индивидуальной восприимчивости к заболеванию. В этой связи особую актуальность представляет определение прогностических критериев среди генетических маркеров риска.Studies have shown that the intensity of invasion in the outbreak is determined to a large extent by the characteristics of individual susceptibility to the disease. In this regard, the determination of prognostic criteria among genetic risk markers is of particular relevance.
К числу возможных генетических маркеров относятся гены биотрансформации ксенобиотиков, контролирующих процессы обезвреживания и выведения из организма экзо- и эндотоксикантов. Биотрансформация ксенобиотиков в классическом варианте представлена 3-этапным процессом. Первый этап - фаза 1 обеспечивается ферментами суперсемейства цитохромов Р450, локализованными в основном в мембранах эндоплазматического ретикулума клеток печени и легких (Баранов B.C., Баранова Е.В., Иващенко Т.Э., Асеев М.В. Геном человека и гены «предрасположенности». // СПб. - 2000. - 272 с.). Цитохром CYP1A1 участвует в биотрансформации многих лекарств, метаболизме полиароматических углеводородов, в том числе и некоторых канцерогенов. Гены, контролирующие синтез цитохромов Р450, отличаются значительным полиморфизмом. Генный (мутационный) полиморфизм CYP1A1 обусловлен однонуклеотидной транзицией (A-G) 7 экзона (A4889G), сопровождающейся аминокислотной заменой изолейцина (Ile) на валин (Val) в 462 кодоне молекулы цитохрома Р450. Согласно данным литературы появление аллеля Val, приводит к повышению активности и индуцибельности фермента, что может вызвать увеличение в организме концентрации промежуточных, часто токсических метаболитов (Баранов B.C., Баранова Е.В., Иващенко Т.Э., Асеев М.В. Геном человека и гены «предрасположенности». // СПб. - 2000. - 272 с.). Встречается у 7% европеоидов, среди населения Республики Башкортостан частота его составляет 4-8% (Янбаева Д.Г., Корытина Г.Ф., Загидуллин Ш.З., Викторова Т.В. Полиморфизм генов биотрансформации ксенобиотиков и антиоксидантной защиты. // Молекулярная медицина. - 2005. - №2. - С.58-64.).Possible genetic markers include xenobiotic biotransformation genes that control the processes of neutralizing and eliminating exo- and endotoxicants from the body. The biotransformation of xenobiotics in the classical version is represented by a 3-stage process. The first stage - phase 1 is provided by enzymes of the superfamily of cytochromes P450, localized mainly in the membranes of the endoplasmic reticulum of liver and lung cells (Baranov BC, Baranova EV, Ivaschenko TE, Aseev MV The human genome and the “predisposition” genes . // SPb. - 2000. - 272 p.). Cytochrome CYP1A1 is involved in the biotransformation of many drugs, the metabolism of polyaromatic hydrocarbons, including some carcinogens. Genes that control the synthesis of P450 cytochromes are characterized by significant polymorphism. The gene (mutation) polymorphism of CYP1A1 is due to the single nucleotide transformation (A-G) of 7 exon (A4889G), accompanied by the amino acid replacement of isoleucine (Ile) with valine (Val) in the 462 codon of the P450 cytochrome molecule. According to the literature, the appearance of the Val allele leads to an increase in the activity and inducibility of the enzyme, which can cause an increase in the concentration of intermediate, often toxic metabolites in the body (Baranov BC, Baranova E.V., Ivaschenko T.E., Aseev M.V. Human genome and genes of “predisposition.” // St. Petersburg. - 2000. - 272 p.). It occurs in 7% of Caucasians, among the population of the Republic of Bashkortostan its frequency is 4-8% (Yanbaeva D.G., Korytina G.F., Zagidullin Sh.Z., Viktorova T.V. Polymorphism of xenobiotics biotransformation genes and antioxidant protection. / / Molecular medicine. - 2005. - No. 2. - P.58-64.).
Известен способ выявления эхинококкоза по серологическим реакциям (РЛА, РНГА, ELISA и др.), дополненный инструментальными методами (УЗИ, КТ, МРТ). Чувствительность, специфичность, разрешающая способность этих исследований недостаточна для выявления ранних стадий развития ларвоцист (Ахмедов И.Г., Османов А.О. // Хирургия, 2002, №9, с.28).A known method for the detection of echinococcosis by serological reactions (RLA, RNGA, ELISA, etc.), supplemented by instrumental methods (ultrasound, CT, MRI). The sensitivity, specificity, resolution of these studies is insufficient to identify the early stages of development of the larvocyst (Akhmedov I.G., Osmanov A.O. // Surgery, 2002, No. 9, p. 28).
Таким образом, разработанные в настоящее время клинические, иммунологические, инструментальные методы не позволяют достоверно прогнозировать развитие эхинококковых кист, поскольку имеют следующие недостатки:Thus, the currently developed clinical, immunological, instrumental methods do not allow to reliably predict the development of echinococcal cysts, since they have the following disadvantages:
- отсутствие диагностических маркеров болезни на ранних этапах развития патологии из-за разнообразия клинических проявлений;- lack of diagnostic markers of the disease in the early stages of the development of pathology due to the variety of clinical manifestations;
- недостаточно эффективные инструментальные методы при выявлении мелких кист;- insufficiently effective instrumental methods in identifying small cysts;
- недостаточно чувствительные серологические реакции;- insufficiently sensitive serological reactions;
Авторами в научно-медицинской и патентной литературе не обнаружено сведений об известности способа прогнозирования кист у инвазированных эхинококком детей.The authors in the medical and patent literature did not find information about the fame of the method for predicting cysts in children invaded by echinococcus.
Нами выявлено, что среди детей, больных эхинококкозом, значительна доля лиц носителей полиморфной аллели Val гена CYP1A1 (χ2=14,21; р=0,001, OR=6,81).We found that among children with echinococcosis, a significant proportion of individuals are carriers of the polymorphic Val allele of the CYP1A1 gene (χ2 = 14.21; p = 0.001, OR = 6.81).
Таким образом, генетическое тестирование полиморфизма Ile462Val 7 экзона гена CYP1A1 детей инвазированных эхинококком, позволяет с большой вероятностью (OR=6,81) прогнозировать возможность клинической манифестации до появления первых симптомов болезни.Thus, genetic testing of the Ile462Val 7 exon polymorphism of the exon of the CYP1A1 gene in children invaded by echinococcus allows a high probability (OR = 6.81) to predict the possibility of clinical manifestation before the onset of the first symptoms of the disease.
Метод доступен по реактивам и оборудованию.The method is available for reagents and equipment.
Техническим результатом изобретения является получение критериев прогнозирования развития клинической формы эхинококкоза у детей на основе выявления молекулярно-генетических маркеров.The technical result of the invention is to obtain criteria for predicting the development of the clinical form of echinococcosis in children based on the identification of molecular genetic markers.
Способ осуществляется следующим образом.The method is as follows.
Материалом для исследования служат образцы ДНК, выделенные из лимфоцитов периферической венозной крови у больных эхинококкозом детей методом фенольно-хлороформной экстракции, описанным Mathew C.C. (The isolation of high molecular weight eucariotic DNA // Methods in Molecular Biology / Ed. J.M. Walker. - New York., London. - 1984. - Vol.2. - P.31-34).The material for the study is DNA samples isolated from peripheral venous blood lymphocytes in children with echinococcosis of children by the phenol-chloroform extraction method described by Mathew C.C. (The isolation of high molecular weight eucariotic DNA // Methods in Molecular Biology / Ed. J. M. Walker. - New York., London. - 1984. - Vol.2. - P.31-34).
1. Кровь в пробирке с консервантом тщательно перемешивают и переливают в центрифужный стакан на 100 мл, туда же добавляют 50 мл охлажденного лизирующего буфера, содержащего 320 мМ сахарозы, 1% раствор тритона Х-100, 5 мМ MgCl2, 10 мМ трисHCl (pH 7,6).1. Blood in a test tube with preservative is thoroughly mixed and poured into a 100 ml centrifuge beaker, 50 ml of chilled lysis buffer containing 320 mM sucrose, 1% Triton X-100 solution, 5 mM MgCl 2 , 10 mM Tris HCl (pH) are added there. 7.6).
2. Смесь центрифугируют 20 мин при 4000 об/мин.2. The mixture is centrifuged for 20 minutes at 4000 rpm.
3. Надосадочную жидкость сливают, к получившемуся осадку приливают 8 мл 25 мМ ЭДТА, pH 8.0, суспендируют.3. The supernatant is drained, 8 ml of 25 mM EDTA, pH 8.0 are poured onto the resulting precipitate, and suspended.
4. К суспензии добавляют 0,8 мл 10% SDS и протеиназу К (концентрация - 10 мг/ мл). Смесь для лизиса оставляют на ночь в термостате при температуре 38°С.4. To the suspension add 0.8 ml of 10% SDS and proteinase K (concentration - 10 mg / ml). The lysis mixture is left overnight in an incubator at a temperature of 38 ° C.
Экстракцию ДНК осуществляют в следующем порядке.DNA extraction is carried out in the following order.
1. Для депротеинизации к лизату добавляют 0.5 мл 5М перхлората натрия и 8 мл фенола, насыщенного 1 М трисHCl до pH 7,8.1. For deproteinization, 0.5 ml of 5M sodium perchlorate and 8 ml of phenol saturated with 1 M Tris HCl are added to the lysate to a pH of 7.8.
2. Смесь центрифугируют при 3000 об/мин в течение 10 мин.2. The mixture is centrifuged at 3000 rpm for 10 minutes.
3. Отбирают водную фазу, содержащую ДНК, РНК и не денатурированные белки.3. Select the aqueous phase containing DNA, RNA and non-denatured proteins.
4. Отобранную фазу обрабатывают смесью фенол-хлороформа (1:1), а затем - хлороформом.4. The selected phase is treated with a mixture of phenol-chloroform (1: 1), and then with chloroform.
5. Препараты осаждают двумя объемами 96% этанола.5. The preparations are precipitated with two volumes of 96% ethanol.
6. Образовавшийся осадок ДНК растворяют в 1,5 мл деионизированной Н2O; раствор хранят при 20°C.6. The resulting DNA precipitate is dissolved in 1.5 ml of deionized H 2 O; the solution is stored at 20 ° C.
В дальнейшем полученную ДНК используют в качестве матрицы полимеразной цепной реакции (ПЦР) для амплификации нужного фрагмента.Subsequently, the obtained DNA is used as a polymerase chain reaction (PCR) template for amplification of the desired fragment.
Анализ полиморфизма Ile462Val 7 экзона гена CYP1A1 проводят методом ПЦР/ПДРФ (полиморфизм длин рестрикционных фрагментов) с использованием локусспецифических олигонуклеотидных праймеров (El-Zein R., Zwischenberger J.B., Wood Т.О., Abdel-Rahman S.Z., Brekelbaum C., Au W.W. Combined genetic polymorphism and risk for development of lung cancer // Mutat. Res. - 1997. - Vol.381. - N 2 - P.189-200):The analysis of the Ile462Val 7 exon polymorphism of the CYP1A1 gene is carried out by PCR / RFLP (restriction fragment length polymorphism) using locus-specific oligonucleotide primers (El-Zein R., Zwischenberger JB, Wood T.O., Abdel-Rahman SZ, Brekelbaum C. Combined genetic polymorphism and risk for development of lung cancer // Mutat. Res. - 1997. - Vol. 381. - N 2 - P.189-200):
F. 5'GAACTGCCACTTGAGCTGTCT3' иF. 5'GAACTGCCACTTGAGCTGTCT3 'and
R. 5'GAAAGACCTCCCAGCGGTCA3'.R. 5'GAAAGACCTCCCAGCGGTCA3 '.
Схема ПЦР следующая. Реакционная смесь содержит 2,5 мкл 10×ПЦР-буфера (60 мМ Tris-HCl pH 8.5), 1,5 мМ MgCl2, 25 мМ KCl, 10 мМ 2-меркаптоэтанола; 0.1% тритон Х-100), 1 мкл смеси 5 мМ каждого dNTP, по 1 мкл соответствующих праймеров, примерно 200 нг геномной ДНК, 1 ед. Taq-полимеразы с добавлением деионизированной воды до объема 25 мкл.The PCR scheme is as follows. The reaction mixture contains 2.5 μl of 10 × PCR buffer (60 mm Tris-HCl pH 8.5), 1.5 mm MgCl 2 , 25 mm KCl, 10 mm 2-mercaptoethanol; 0.1% Triton X-100), 1 μl of a mixture of 5 mM of each dNTP, 1 μl of the corresponding primers, approximately 200 ng of genomic DNA, 1 unit Taq polymerase with the addition of deionized water to a volume of 25 μl.
После амплификации ПЦР-продукты подвергают гидролизу эндонуклеазой рестрикции HincII в стандартных условиях. Фрагменты ДНК разделяют электрофоретически в 7-8% ПААГ, окрашивают раствором бромида этидия и анализируют в проходящем ультрафиолетовом свете на трансиллюминаторе. Анализ полиморфизма Ile462Val 7 экзона гена CYP1A1 выполняют в стандартных условиях по ранее описанной методике (El-Zein R., Zwischenberger J.B., Wood Т.G., Abdel-Rahman S.Z., Brekelbaum C., Au W.W. Combined genetic polymorphism and risk for development of lung cancer // Mutat. Res. - 1997. - Vol.381. - N 2 - P.189-200). При наличии генотипа lie/lie формируются фрагменты размером 139 и 48 пар нуклеотидов (п.н.); при генотипе Ile/Val формируются фрагменты 139, 120, 48 и 19 п.н.; при генотипе Val/Val формируются фрагменты 120, 48 и 19 п.н.After amplification, the PCR products are hydrolyzed with a HincII restriction endonuclease under standard conditions. DNA fragments are separated electrophoretically in 7-8% PAG, stained with ethidium bromide solution and analyzed in transmitted ultraviolet light on a transilluminator. Analysis of the Ile462Val 7 exon polymorphism of the CYP1A1 gene is performed under standard conditions according to the previously described methodology (El-Zein R., Zwischenberger JB, Wood T.G., Abdel-Rahman SZ, Brekelbaum C., Au WW Combined genetic polymorphism and risk for development of lung cancer // Mutat. Res. - 1997. - Vol. 381. - N 2 - P.189-200). In the presence of the lie / lie genotype, fragments of 139 and 48 pairs of nucleotides are formed (bp); with the Ile / Val genotype fragments 139, 120, 48 and 19 bp are formed; with the Val / Val genotype fragments of 120, 48, and 19 bp are formed
Для количественной оценки предрасположенности к развитию эхинококкоза для вышеуказанного генетического маркера мы вычислили показатель относительного риска (relative ratio - RR) и соотношения шансов (odds ratio - OR). Для этого использовали формулу, предложенную Бландом (Bland, J.M. The odds ratio / J.M.Bland, D.G.Altman // Br. Med. J. - 2000. - Vol.320. - P.1468):To quantify the predisposition to the development of echinococcosis for the above genetic marker, we calculated the ratio of relative risk (relative ratio - RR) and odds ratio (odds ratio - OR). For this, the formula proposed by Bland was used (Bland, J.M. The odds ratio / J.M. Bland, D.G. Altman // Br. Med. J. - 2000. - Vol. 320. - P.1468):
OR=(a×d)/(b×c)OR = (a × d) / (b × c)
где a - число лиц с наличием, b - с отсутствием маркера (аллеля Val гена CYP1A1) среди больных эхинококкозом; c и d - число лиц соответственно с наличием и отсутствием маркера среди здоровых индивидов. Повышенный риск развития констатировали при OR>1, RR>2.where a is the number of individuals with, b is the absence of a marker (Val allele of the CYP1A1 gene) among patients with echinococcosis; c and d are the number of individuals, respectively, with the presence and absence of a marker among healthy individuals. An increased risk of development was observed at OR> 1, RR> 2.
Нами были исследованы дети (N=72), больные цистным эхинококкозом. Возраст пациентов - от 4 до 16 лет. Основную долю обследованных лиц составили дети школьного (69%) возраста. По половому составу распределение было следующим: 57% мальчики, 43% девочки. Поражение печени наблюдалось у 48% пациентов, легкого - 28%, сочетанное поражение легкого и печени - 23%. Установлено, что распределение частот генотипов гена CYP1A1 у больных эхинококкозом существенно отличалось от контроля. При изучении полиморфизма A-G гена CYP1A1 у больных ЦЭ выявлено, что частота встречаемости гомозигот Ile/Ile составляет 73,5% (в контроле 95,2%), гетерозигот Ile/Val составляет - 22,3% (в контроле 4,0%), гомозигот Val/Val - 4,2% (в контроле 0,5%). Частота носителей аллеля Val составляет 26,5%, в 4 раза больше чем в контроле (χ2=14,21; OR=6,81; p=0,001). Показатель относительного риска развития эхинококкоза для лиц носителей аллеля Val гена CYP1A1 оказался равным RR=2,21.We have studied children (N = 72) with cystic echinococcosis. The age of patients is from 4 to 16 years. The main share of the examined persons was children of school age (69%). The distribution by gender was as follows: 57% boys, 43% girls. Liver damage was observed in 48% of patients, lung - 28%, combined lung and liver damage - 23%. It was found that the frequency distribution of the CYP1A1 gene genotypes in patients with echinococcosis significantly differed from the control. When studying the AG polymorphism of the CYP1A1 gene in patients with CE, it was found that the frequency of occurrence of Ile / Ile homozygotes is 73.5% (in the control 95.2%), Ile / Val heterozygotes is 22.3% (in the control 4.0%) , Val / Val homozygotes - 4.2% (in the control 0.5%). The carrier frequency of the Val allele is 26.5%, 4 times more than in the control (χ2 = 14.21; OR = 6.81; p = 0.001). The relative risk of developing echinococcosis for individuals carrying the Val allele of the CYP1A1 gene was RR = 2.21.
Полученные результаты показывают, что наличие полиморфного аллеля Val гена CYP1A1 в генотипе является предрасполагающим фактором к развитию клинической формы цистного эхинококкоза у детей, поэтому его можно использовать в качестве генетического маркера риска.The results show that the presence of the polymorphic Val allele of the CYP1A1 gene in the genotype is a predisposing factor to the development of the clinical form of cystic echinococcosis in children, therefore, it can be used as a genetic risk marker.
Пример 1. У девочки З., 5 лет при массовом обследовании методом ИФА (иммуноферментный анализ) выявлена положительная реакция. Проведено исследование по предложенной методике. Установлено: является носителем аллеля Val гена CYP1A1. В отношении развития эхинококковых кист прогноз неблагоприятный.Example 1. The girl Z., 5 years old, during a mass examination by ELISA (enzyme-linked immunosorbent assay) revealed a positive reaction. A study on the proposed methodology. Found: is a carrier of the Val allele of the CYP1A1 gene. In relation to the development of echinococcal cysts, the prognosis is poor.
После обследования (УЗИ, КТ) выявлена эхинококковая киста печени, малых размеров.After examination (ultrasound, CT) revealed echinococcal cyst of the liver, small size.
Пример 2. У девочки М., 7 лет, брат поступил в хирургическое отделение с диагнозом: эхинококковая киста правого легкого. Девочке проведено исследование по предложенной методике. Установлено: является носителем генотипа Ile/Ile гена CYP1A1. В отношении развития эхинококковых кист прогноз благоприятный.Example 2. In a girl M., 7 years old, her brother was admitted to the surgical department with a diagnosis of echinococcal cyst of the right lung. The girl conducted a study according to the proposed methodology. Found: is a carrier of the Ile / Ile genotype of the CYP1A1 gene. In relation to the development of echinococcal cysts, the prognosis is favorable.
Через год проведено исследование УЗИ. Признаков развивающейся кисты эхинококка у пациентки не обнаружено.A year later, an ultrasound study was performed. Signs of a developing cyst of echinococcus in the patient were not found.
Claims (1)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2007107565/15A RU2324940C1 (en) | 2007-02-28 | 2007-02-28 | Method of prediction of cystic echinococcosis course in children |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2007107565/15A RU2324940C1 (en) | 2007-02-28 | 2007-02-28 | Method of prediction of cystic echinococcosis course in children |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| RU2324940C1 true RU2324940C1 (en) | 2008-05-20 |
Family
ID=39798896
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| RU2007107565/15A RU2324940C1 (en) | 2007-02-28 | 2007-02-28 | Method of prediction of cystic echinococcosis course in children |
Country Status (1)
| Country | Link |
|---|---|
| RU (1) | RU2324940C1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101949926A (en) * | 2010-08-04 | 2011-01-19 | 浙江大学 | Human echinococcosis colloidal gold immunochromatographic assay urine testing quick diagnosis test paper card |
| RU2601902C1 (en) * | 2015-10-05 | 2016-11-10 | Государственное бюджетное образовательное учреждение высшего профессионального образования "Башкирский государственный медицинский университет" Министерства здравоохранения Российской Федерации | Method for prediction of effectiveness of prevention by albendazole of postoperative recurrent of cistic echinococcosis |
-
2007
- 2007-02-28 RU RU2007107565/15A patent/RU2324940C1/en not_active IP Right Cessation
Non-Patent Citations (1)
| Title |
|---|
| MAHMOUD MS, EZZAT HM, Detection of hydatid antigen in human cyst fluid by reverse latex agglutination test. J Egypt Soc Parasitol. 1999; 29(3):805-15, найдено в PubMed, PMID: 12561920. SILES-LUCAS MM, GOTTSTEIN BB. Molecular tools for the diagnosis of cystic and alveolar echinococcosis. Trop Med Int Health. 2001 Jun; 6(6):463-75, найдено в PubMed, PMID: 11422961. POLAT P et al. Hydatid disease from head to toe. Radiographics. 2003 Mar-Apr; 23(2):475-94; quiz 536-7, найдено в PubMed, PMID: 12640161. FILICE С, BRUNETTI E, Use of PAIR in human cystic echinococcosis. Acta Trop. 1997 Apr 1; 64(1-2):95-107, найдено в PubMed, PMID: 9095291. * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101949926A (en) * | 2010-08-04 | 2011-01-19 | 浙江大学 | Human echinococcosis colloidal gold immunochromatographic assay urine testing quick diagnosis test paper card |
| RU2601902C1 (en) * | 2015-10-05 | 2016-11-10 | Государственное бюджетное образовательное учреждение высшего профессионального образования "Башкирский государственный медицинский университет" Министерства здравоохранения Российской Федерации | Method for prediction of effectiveness of prevention by albendazole of postoperative recurrent of cistic echinococcosis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hogervorst et al. | Rapid detection of BRCA1 mutations by the protein truncation test | |
| US20140255936A1 (en) | Detecting frontotemporal dementia and amyotrophic lateral sclerosis | |
| Sarker et al. | Molecular analysis of glucose-6-phosphate dehydrogenase gene mutations in Bangladeshi individuals | |
| Alharbi et al. | Screening for genetic mutations in LDLR gene with familial hypercholesterolemia patients in the Saudi population. | |
| KR20110094041A (en) | Gene sensitive to normal-tension glaucoma disease, and use thereof | |
| RU2324940C1 (en) | Method of prediction of cystic echinococcosis course in children | |
| Mhmoud | Association of toll-like receptors 1, 2, 4, 6, 8, 9 and 10 genes polymorphisms and susceptibility to pulmonary tuberculosis in Sudanese patients | |
| RU2393772C1 (en) | Method of predicting development of recurrent invasive urinary bladder cancer | |
| TWI351436B (en) | Method for detecting a risk of the development of | |
| Ruan et al. | The SNPs of three immunity genes in striped catfish, Pangasianodon hypophthalmus are associated with resistance against infection of Aeromonas hydrophila | |
| ES2934557T3 (en) | Major histocompatibility complex single nucleotide polymorphisms | |
| WO2015016392A1 (en) | New causative gene for amyotrophic lateral sclerosis | |
| Sidhwani et al. | ACE2 (angiotensin converting enzyme) polymorphisms and susceptibility of severe SARS-CoV-2 in subset of Pakistani population | |
| RU2387383C1 (en) | Method of detecting predisposition and resistance to development of cyst echinococcosis in children | |
| PVSN et al. | Association of the NOTCH4 gene polymorphism with schizophrenia in the Indian population | |
| RU2307349C1 (en) | Method of predicting combined affection of organs by cystic echinococcosis in children | |
| JP2019024455A (en) | Methods for determining tuberculosis onset risk specific to genetic lineage of mycobacterium tuberculosis | |
| CN107475367B (en) | Mutant gene for evaluating breast cancer risk and detection kit thereof | |
| RU2348039C1 (en) | Method for prediction of suppuration of unicameral echinococcus cyst in noninvasive children | |
| RU2283494C1 (en) | Method for predicting the development of toxic hepatitis at chemotherapy of multiple myeloma | |
| JP7088519B2 (en) | How to test for scoliosis | |
| WO2015037681A1 (en) | Test method for evaluating the risk of anti-thyroid drug-induced agranulocytosis, and evaluation kit | |
| RU2368325C1 (en) | Method of prognosing development of type 1 sugar diabetes in populations of bashkortostan peoples | |
| WO2007145326A1 (en) | Method for determination of inflammatory disease | |
| RU2601902C1 (en) | Method for prediction of effectiveness of prevention by albendazole of postoperative recurrent of cistic echinococcosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| MM4A | The patent is invalid due to non-payment of fees |
Effective date: 20090301 |