RU2317995C2 - Method for preparing yeast or gram-positive microorganisms denaturated genome dna associated with cellular envelopes - Google Patents

Abstract

FIELD: biochemistry, molecular biology.

SUBSTANCE: invention proposes a method for isolation of genome DNA from yeast and gram-positive microorganisms associated with cellular envelopes and useful for direct using in PCR-amplification. Method involves treatment of cells with buffer solution of neutral pH containing salt - chaotrop chosen from guanidinium salts at heating followed by isolation of the end product. Before isolation of DNA cellular deposit is treated additionally with a buffer solution containing proteinase K in the concentration 50-100 mcg/ml for 0.5-1.0 h at 37-40°C. Realization of the invention provides enhancing the effectiveness of process in preparing genome DNA and to use microorganisms with extra strength cellular walls for isolation of DNA. Invention can be used in development of test-systems for different designation suggesting using PCR-amplification of DNA from cells of yeast, fungi and microorganisms with extra strength cellular walls.

EFFECT: improved preparing method of DNA.

1 cl, 6 ex

Description

The invention relates to biochemistry, and in particular to methods of DNA extraction, specifically to a method for isolating DNA from yeast cells, fungi and microorganisms with a strong cell wall and can be used for PCR amplification of specific fragments of microbial DNA.

The preparation of biological material for PCR amplification involves the destruction of cells and the release of intracellular DNA, as well as the purification of DNA from protein, lipid and other impurities that can inhibit the DNA polymerase reaction.

A known method of DNA extraction, including the use of lysozyme, sodium dodecyl sulfate, EDTA as inducers of cell wall lysis, followed by deproteinization of the lysate with chloroform or phenol and DNA precipitation with isopropanol (Marmur. J. A. J. Mol. Biol. 1961. 3: 208-218).

It is known to use lytic enzymes (zymolyase, lithicase, etc.) to destroy the cell walls of yeast when obtaining samples of high molecular weight DNA. (Muller P.M., Werner K.E., Kasai M., Francesconi A., Chanock S.J., Walsh T.J. Clim. Microbiol. 1998.36 (6): 1625-1629).

A known method of DNA isolation by destruction of cells of gram-positive microorganisms and yeast using 3% SDS (Polaina J., Adam A.C. Nucleic Acid Res. 1991. 19 (19): 5443).

All of the above methods of DNA extraction are quite laborious, expensive and time consuming.

A known method of DNA extraction, based on the use of buffer solutions containing high concentrations of chaotropic salts such as guanidinium thiocyanate, capable of lysing the shells of many gram-negative microbes (US Pat. US No. 5234809, MKI C12N 01/68, publ. 1993).

The disadvantages of this method are the inability to use cells of microorganisms with a strong cell wall, resistant to the action of chaotropic salts, the duration and complexity of the process.

Known closest to the claimed method for the isolation of genomic DNA from cells of microorganisms, consisting in the fact that the processing of microorganisms having strong cell walls is carried out with a buffer solution containing a chaotropic salt (guanidinium derivatives) at a concentration of 4-8 M when the reaction mixture is heated for 3-7 min (Pat. RF No. 2177035, MKI C12N 15/10, publ. 2001).

The above method is effective against many yeasts, mycelial fungi and some gram-positive microorganisms. However, it is ineffective against many gram-positive bacteria, including soil isolates of Bacillus subtilis, Arthrobacter globiformis and Micrococcus luteus, as well as some natural yeast isolates, which have a very strong and dense cell wall that practically does not let out intracellular proteins during extraction by chaotropic solutions.

The invention solves the problem of increasing the efficiency of the process of obtaining genomic DNA associated with strong cell walls of yeast and gram-positive bacteria.

The problem is solved due to the fact that in the method of isolating genomic DNA from cells of microorganisms and yeast, including treating the cells with a buffer solution with a neutral pH containing a chaotropic salt selected from the group of guanidinium salts, when heated with subsequent isolation of the target product, cells are additionally processed buffer solution containing 50-100 μg / ml proteinase K, for 0.5-1.0 hours at 37-40 ° C.

In the process of treating cells with chaotropic salts and proteinase K in the claimed method, the membrane structures are solubilized, complete denaturation and proteolytic degradation of intracellular proteins and cell wall proteins are achieved, and due to this, complete deproteinization of chromosomal DNA is achieved and the permeability of the cell membrane with respect to macromolecules increases sharply ( DNA). While proteins, peptides, lipids and other components diffuse from the cell, the chromosomal DNA remains inside the cell membrane due to its large length. The mechanism of DNA conservation inside cell walls, presumably, is as follows.

In the process of heat treatment in the presence of chaotropic salts, denaturation (melting) of chromosomal DNA occurs and its partial splitting to single-stranded fragments of 16-25 kb in size Upon subsequent rapid cooling of the solution, the denatured DNA forms a three-dimensional spatial network that is insoluble at room temperature due to complementary interactions — it is not washed out of the cell walls during two washes with distilled water. In the process of subsequent processing of DNA-containing cell membranes with proteinase K at 37-40 ° C, chromosomal DNA is also practically not washed out of cell membranes - DNA loss is less than 1%. Thus, the denatured genomic DNA obtained by the claimed method is strongly associated with cell membranes and is a matrix DNA having the same activity in PCR as denatured genomic DNA that is not associated with cell walls. Moreover, the claimed method for producing template DNA is much simpler, cheaper and more efficient.

It was found that by sequentially treating cells of microorganisms, yeasts and fungi, first with a buffer solution containing a chaotropic salt, and then with a buffer solution (pH 8.0) containing proteinase K, it is possible to obtain matrix DNA samples for a simple, affordable and effective way. PCR from yeast, fungi and gram-positive microorganisms with cell walls of increased density and strength. In addition, the resulting samples - suspensions of DNA-containing cell membranes in 50% ethanol can be stored for a long time both at -20 ° C, and at + 4 ° C or at room temperature.

The method is as follows.

Yeast cells are grown in liquid YPD medium (1.0% yeast extract, 2.0% bactopeptone, 2% glucose, pH 5.3) or on plates with agarized YPD medium (1.5% agar) at 30 ° C, or on media of a different composition. Gram-positive bacteria cells are grown on L-agar plates at 30 or 37 ° C or on liquid and solid media of a different composition.

Yeast or gram-positive bacteria cells are suspended in buffer D at pH 7.0 containing a chaotropic salt of 4 M guanidinium thiocyanate, 25 mM sodium citrate, 0.1 M β-mercaptoethanol, 0.5% sarcosyl, or in D-2 buffer containing 4 M guanidinium thiocyanate, 50 mM Tris-HCl, 10 mM EDTA, 0.1 M β-mercaptoethanol, 0.5% sarcosyl, pH 8.0, or in buffer E containing 8 M guanidinium chloride, 50 mM Tris-HCl, 10 mM EDTA, 0.1 M β-mercaptoethanol, 0.5% sarcosyl, pH 8.0.

Yeast cells (30-50 mg of crude biomass) or 30 mg of raw biomass of gram-positive bacteria are suspended in 300-500 μl of buffer D or D-2 or buffer E and incubated in a boiling water bath for 5-10 minutes or in a temperature range of 50 up to 100 ° C, mainly at 70 ° C for 15-30 minutes Cells are pelleted by centrifugation at 12,000 rpm for 60 seconds on an Eppendorf centrifuge. The supernatant is discarded. Cell pellets are washed twice in 1 ml of distilled or deionized water. After a second wash, cell pellets are suspended in a buffer containing 25 mM Tris-HCl, 10 mM EDTA, 0.5% sarcosyl (or 0.3% SDS) and 50-100 μg / ml proteinase K.

The mixture is incubated for 0.5-1.0 hours at 37-40 ° C, and then centrifuged for 2-3 minutes at 12000 rpm. The supernatant is discarded, and the precipitate is washed twice with 1 ml of distilled water and then suspended in 300 μl of 50% ethanol. The resulting suspension of DNA-containing cell walls (matrix DNA samples) is stored at -20 ° C, either at + 4 ° C, or at room temperature and used directly in PCR amplification experiments. In the resulting suspensions, the titer of cells (DNA-containing cell membranes) is 5 · 10 ⁸ -1 · 10 ⁹ . In the experiment, take 1 μl of undiluted cell suspension or 1 μl of 10 ^-1 -10 ^-2 dilutions per 50 μl of the reaction mixture for PCR.

The invention is illustrated by examples.

Example 1

The yeast cells of S. cerevisiae (strain H 190, IBCh RAS) are grown in YPD liquid medium (1% yeast extract, 2.0% bactopeptone, 2% glucose, pH 5.3).

30 mg of crude biomass of yeast cells are suspended in 400 ml of buffer E and incubated in a boiling water bath for 7 minutes. Cells are pelleted by centrifugation at 12,000 rpm for 60 seconds on an Eppendorf centrifuge. The supernatant is discarded. Cell pellets are washed twice in 1 ml of distilled water. After the second washing, the cell pellets are suspended in a buffer containing 25 mM Tris-HCl, 10 mM EDTA, 0.5% sarcosyl and 50 μg / ml proteinase K. The mixture is incubated for 1 hour at 37 ° C, then centrifuged for 2-3 minutes at 12000 rpm The supernatant was transferred to a clean tube, and the pellet was washed twice with distilled water (1 ml). After two washes with water, supernatants are also retained, and the resulting precipitate is suspended in 300 μl of 50% ethanol.

Example 2

P. pastoris yeast cells (strain GS 115, IBCh RAS) are grown on plates with agarized YPD medium (1.5% agar) at 30 ° C.

50 mg of crude biomass of yeast is suspended in 500 ml of D-2 buffer and incubated in a boiling water bath for 5 minutes. Cells are pelleted by centrifugation at 12,000 rpm for 60 seconds on an Eppendorf centrifuge. The supernatant is discarded. Cell pellets are washed twice with 1 ml of deionized water. After the second washing, the cell pellets are suspended in a buffer containing 25 mM Tris-HCl, 10 mM EDTA, 0.3% SDS and 100 μg / ml proteinase K. The mixture is incubated for 0.5 hours at 37 ° C, then centrifuged for 2-3 minutes at 12000 rpm The supernatant was transferred to a clean tube, the pellet was washed twice with distilled water (1 ml each), and then suspended in 300 μl of 50% ethanol.

Example 3

Cells of clinical yeast isolates belonging to the genera Candida, Trichosporon or Rhodotorula are grown on plates with the appropriate medium at 37 ° C. 40 mg of crude yeast biomass is suspended in 500 ml of D-2 buffer and incubated in a boiling water bath for 5 minutes. Cells are pelleted by centrifugation at 12,000 rpm for 60 seconds on an Eppendorf centrifuge. Supernatants are thrown away. Cell pellets are washed twice in 1 ml of deionized water. After a second wash, the cell pellets are suspended in a buffer containing 25 mM Tris-HCl, 10 mM EDTA, 0.3% SDS and 75 μg / ml proteinase K. The mixture is incubated for 0.5 hours at 37 ° C, then centrifuged for 2-3 minutes. at 12000 rpm Supernatants were transferred to clean tubes, the pellet was washed twice with distilled water (1 ml each) and then suspended in 300 μl of 50% ethanol.

Example 4

Cells of natural isolates of psychrophilic yeast belonging to the genus Leucosporidium are grown on an appropriate nutrient medium at 9-20 ° C for 1-2 weeks.

40 mg of crude yeast biomass is suspended in 500 ml of D-2 buffer and incubated in a boiling water bath for 5 minutes. Cells are pelleted by centrifugation at 12,000 rpm for 60 seconds on an Eppendorf centrifuge. Supernatants are thrown away. Cell pellets are washed twice with 1 ml of deionized water. After the second washing, the cell pellets are suspended in a buffer containing 25 mM Tris-HCl, 10 mM EDTA, 0.3% SDS and 50 μg / ml proteinase K. The mixture is incubated for 0.5 hours at 37 ° C, then centrifuged for 2-3 minutes at 12000 rpm Supernatants were transferred to clean tubes, the pellet was washed twice with distilled water (1 ml each) and then suspended in 300 μl of 50% ethanol.

Example 5

Cells of gram-positive bacteria A.globiformis, B.subtilis (strain VKM B-504) or M. luteus (strain NCIMB 13267) are grown on plates with L-agar at 37 ° C.

30 mg of the crude biomass of microorganism cells are suspended in 500 ml of D-2 buffer and incubated in a boiling water bath for 8 minutes. Cells are pelleted by centrifugation at 12,000 rpm for 60 seconds on an Eppendorf centrifuge. The supernatant is discarded. Cell pellets are washed twice with 1 ml of distilled water. After the second washing, the cell pellets are suspended in a buffer containing 25 mM Tris-HCl, 10 mM EDTA, 0.5% sarcosyl and 50 μg / ml proteinase K. The mixture is incubated for 0.5 hours at 37 ° C, then centrifuged for 2-3 minutes at 12000 rpm The supernatant was transferred to a clean tube, the pellet was washed twice with distilled water (1 ml each), and then suspended in 300 μl of 50% ethanol.

Example 6

Cells of gram-positive bacteria A.globiformis or B.subtilis (strain VKM B-504) are grown on plates with L-agar at 37 ° C.

30 mg of crude biomass of microorganism cells are suspended in 500 ml of D-2 buffer and incubated in an incubator at 70 ° C for 20 minutes. Cells are pelleted by centrifugation at 12,000 rpm for 60 seconds on an Eppendorf centrifuge. The supernatant is discarded. Cell pellets are washed twice with 1 ml of distilled water. After the second washing, the cell pellets are suspended in a buffer containing 25 mM Tris-HCl, 10 mM EDTA, 0.5% sarcosyl and 50 μg / ml proteinase K. The mixture is incubated for 1.0 hour at 37 ° C, then centrifuged for 2-3 minutes. at 12000 rpm The supernatant is transferred to a clean tube, the pellet is washed twice with distilled water (1 ml each). Supernatants after two washes with water are also retained. After a second washing, the precipitates are suspended in 300 μl of 50% ethanol.

All supernatants obtained by treating each cell membrane sample with proteinase K and washing them with water are combined (2.4–2.5 ml is obtained) and the absorbance at 260 and 280 nm was measured in the total solution in order to estimate the amount of extracted proteins ( peptides). Protein concentration was determined by the formula C (mg / ml) = 1.55 E ₂₈₀ - 0,76 E ₂₆₀ (R. Dawson, D. Elliott, W. Elliott, K. Jones // Reference Biokhimik M .: Mir, 1991. P.464).

To study the yield of nucleic acids (NKs) from cells during treatment with proteinase K and water washes, aliquots of the combined supernatants (usually 0.5 ml from 2.5 ml) were selected, 2V 96% ethanol was added to them. The mixture was centrifuged at 12,000 rpm for 5 minutes. The resulting precipitates containing NK are dried in air, dissolved in 30 μl of distilled H ₂ O. The presence of NK in the resulting solutions is tested electrophoretically. For electrophoresis, 10 μl of the solution is applied to each well of the gel.

According to spectrophotometric analysis, the combined supernatants contain a significant amount of protein (peptides) (up to 1 mg or more for each sample). The level of protein extraction depends on the time of incubation of cell walls with proteinase K. These data indicate that proteinase K easily penetrates the cell wall of yeast and bacteria and effectively cleaves proteins denatured during treatment with chaotropic salts to low molecular weight peptides. The latter then easily seep out.

The presence of NK (DNA and RNA) in the combined supernatants after the action of proteinase K was also investigated. As follows from the results of electrophoretic analysis (electrophoresis of the obtained samples in a 1% agarose gel), in supernatants corresponding to the cell membranes of all the studied microorganisms (i.e., yeast all species and gram-positive bacteria) genomic DNA is completely absent. In other words, genomic DNA denatured after boiling with chaotropic salts is practically not lost during subsequent treatment with proteinase K and washing with distilled water (it does not leave the cells). The studied supernatants at the same time contain a certain amount of RNA.

Obtained using proteinase K, cell walls with denatured DNA were further studied in PCR with universal primers for ribosomal RNA genes. In the PCR with cell membranes of gram-positive bacteria, universal primers were used for the conserved regions of the ribosomal RNA genes of eubacteria 27f: (5 ′) AGAGTTTGATCCTGGCTCAG and 1522r: (5 ′) AAGGAGGTGATCCARCCGCA (Johnson JL Similarity analysis of Gerhard, Rget, Wood G. Murge, WA, RNAt. , and NR Krieg (ed.) Methods for general and molecular bacteriology. American Society for Microbiology, Washington, DC 1994. P.683-700).

PCR conditions: denaturation - 93 ° C, 30 s, annealing - 60 ° C, 30 s, synthesis - 72 ° C, 60 s. The number of cycles is 27-33.

Universal primers for conserved 5.8S-R rDNA regions were used in PCR on yeast cell walls: (5 ′) TCGATGAAGAACGCAAGC and LR3: (5 ′) GGTCCGTGTTTCAAGAC (Vilgalys R., Hester M. // J.Bacteriol. 1990. V. 172. P.4238-4246). PCR conditions: denaturation - 93 ° C, 30 seconds, annealing - 55 ° C, 30 seconds, synthesis - 72 ° C, 40 seconds. The number of cycles is 30-35.

Electrophoresis in a 1% agarose gel showed that during PCR with cell envelopes of gram positive bacteria and primers 27f + 1522r in all three cases a DNA fragment of the same size (~ 1500 bp) was formed (in a 50 μl reaction mixture 1 μl of cell suspension was added; the number of PCR cycles in this experiment was 30). Moreover, PCR products were also obtained when the suspension of DNA-containing cell membranes was diluted 100, 1000 times, and the number of cycles was increased to 33. It should be noted that when using DNA-containing cell membranes of the same bacteria obtained by boiling in buffer D for 10 minutes (but without treatment with proteinase K), PCR products could not be obtained at all even at 40 thermal cycles. Thus, after treatment with proteinase K, the resulting cell walls of gram-positive bacteria containing denatured DNA are very effective as matrices in PCR.

Similar results were obtained on the cell walls of yeast. The cell walls of all the studied strains containing denatured DNA are very effective as matrices in PCR. In the presence of primers 5.8SR and LR3 and the corresponding cell walls (i.e., template DNA), the intergenic region (spacer) of IST2 and the D1 / D2 26S region of the rDNA subunit are amplified (Vilgalys R., Hester M. // J. Bacteriol. 1990 V.172. P.4238-4246). The study of the fine structure of rDNA fragments - PCR products (for example, using restriction analysis or sequencing) is used in fungal genosystematics. The size of PCR products for S. cerevisiae and P. pastoris strains in the experiment corresponded to 900 and 500 bp, which is in good agreement with the literature data (Danilevich V.N., Grishin E.V. // Bioorganic chemistry. 2002. T. 28. No. 2. S.156-167).

Thus, the treatment of DNA-containing cell walls of yeast and gram-positive bacteria with proteinase K sharply increases the permeability of their cell walls with respect to DNA, i.e. facilitates the diffusion of DNA fragments from cells to the outside when used as a template in PCR.

Claims (1)

A method of producing a denatured genomic DNA of yeast or gram-positive bacteria associated with cell membranes with matrix activity in PCR, which comprises treating the cells with a neutral pH buffer solution containing a chaotropic salt selected from the group of guanidinium salts by heating, followed by washing of the cell pellet and isolation the target product, characterized in that after washing, the cell pellet is additionally treated with a buffer solution with a pH of 7.5-8.0 containing 50-100 μg / ml protein the basics of K, for 0.5-1.0 hours at 37-40 ° C.