RU2317330C2 - RECOMBINANT PLASMID DNA pcL37 ENCODING POLYPEPTIDE WITH PROPERTIES OF HUMAN LIGHT CHAIN OF ANTIBODY AGAINST SMALLPOX VIRUS VACCINE, RECOMBINANT PLASMID DNA pcH37 ENCODING POLYPEPTIDE WITH PROPERTIES OF HEAVY CHAIN OF INDICATED ANTIBODY AND THEIR USING - Google Patents

Abstract

FIELD: biotechnology, genetic engineering.

SUBSTANCE: invention describes recombinant plasmid DNAs constructed in vitro that comprise artificial genes for light and heavy chains of full-scale human antibody prepared by genetic engineering methods. These genes are created on basis of variable fragments of light and heavy chains of recombinant antibody 1F4 and constant human genes IgG1, cytomegalovirus promoter and polyadenylation site BGH. Plasmids provide biosynthesis of recombinant full-scale human antibodies of class IgG1 in mammalian cells. These antibodies interact specifically with smallpox vaccine virus. The affinity constant for prepared recombinant antibodies is 3.54 x 10⁹ ± 0.38 x 10⁹ M^-1. Plasmids are used by combined transfection of human cells HEK 293T. Prepared full-scale recombinant antibody against protein of size 27 kDa of smallpox virus vaccine can be used as a base for creature of pharmaceutical preparations used for diagnosis of some post-vaccine complications caused by smallpox virus vaccine. Also, preparations will comprise decreased therapeutic doses of immunoglobulins that will provide minimal undesirable immune response in patients after administration of the preparation.

EFFECT: valuable medicinal properties of plasmid DNA.

4 cl, 7 dwg, 6 ex

Description

The invention relates to biotechnology, in particular to genetic engineering, and is an in vitro-engineered recombinant plasmid DNA containing the genetically engineered artificial genes of the light and heavy chains of a full-sized human antibody, created on the basis of variable fragments of light and heavy chains of the recombinant 1F4 antibody from phage library of single-chain human antibodies, and constant genes of human IgG1, the cytomegalovirus promoter and the BGH polyadenylation saiga ivayuschih biosynthesis in human cells HEK 293 T recombinant full-length human IgG1 class antibodies specifically interacting with vaccinia virus. The affinity constant for the obtained recombinant antibodies is 3.54 · 10 ⁹ ± 0.38 · 10 ⁹ M ^-1 .

Currently, there are no means of effective treatment of orthopoxvirus infections. The only way to deal with them is vaccination with vaccinia virus. The vaccination of smallpox vaccines provides a fairly reliable protection, but is accompanied by a local inflammatory-necrotic reaction followed by scarring and a pronounced general reaction of the body (fever, malaise, lymphadenitis, etc.) [1, 2]. In addition, smallpox vaccination is often accompanied by serious post-vaccination complications, the likelihood of occurrence of which is especially high among people with reduced immune status [1, 3]. Some of the vaccine-related complications can be prevented by the use of human vaccine immunoglobulin [4], but this drug is expensive and inaccessible, and the use of drugs obtained from human blood is always accompanied by a known biological risk. An alternative to vaccine immunoglobulin could be human monoclonal antibodies (MCAs) specific for orthopoxviruses. However, hybridoma technology does not guarantee stable cell lines.

One of the modern approaches is the construction of these MCAs from the specific specific domains of human IgG, selected from combinatorial phage libraries of human antibodies and constant domains of human immunoglobulin. To date, such antibodies have been engineered against a number of antigens, including viral agents [5, 6, 7].

Published information about obtaining a full-sized human antibodies against orthopoxviruses with an affinity constant of about 1 · 10 ⁸ M ^-1 [8, prototype]. It should be noted that for use in medical practice, it is necessary to choose antibodies with the highest possible affinity. This allows you to reduce the therapeutic dose of the drug immunoglobulins, which leads to a decrease in the unwanted side immune response to the administered drug in patients.

An object of the invention is to obtain two polypeptides with the properties of full-sized light and heavy chains of human immunoglobulin, forming in mammalian cells an IgG1 class antibody that interacts with vaccinia virus, having an affinity constant of more than 1 · 10 ⁸ M ^-1 .

The problem is solved by constructing two recombinant plasmid DNAs, one of which, pcL37, encodes the synthesis of a polypeptide with the light chain properties of a full-sized monoclonal human antibody, the other, pcH37, encodes a synthesis of a polypeptide with the heavy chain properties of a full-sized monoclonal human antibody. Joint transfection with pcL37 and pcH37 plasmids of human cells of the HEK 293 T line provides the synthesis of a polypeptide with the properties of a full-sized human IgG1 class antibody that specifically interacts with the vaccinia virus. The value of the affinity constant for the obtained full-sized human antibody 1F4 is 3.54 · 10 ⁹ ± 0.38 · 10 ⁹ M ^-1 .

The transient biosynthesis of target polypeptides is ensured by the presence of the cytomegalovirus promoter and the BGH polyadenylation site in plasmids pcL37 and pcH37.

The following genetic engineering source constructs serve as the initial genetic material for constructing the target plasmids:

a) phagemid pHen1F4 containing the gene of a single-chain human antibody that interacts with the vaccinia virus [9];

b) plasmids pBVK14a2 and pBVK1-6 containing leader sequences, respectively, of the heavy and light chains of monoclonal murine antibodies MKA F10 [10];

c) the plasmid pCIgG1 containing the gene C _H 1-C _H 2 -C _H 3 domains of the human IgG1 heavy chain, cloned between the sites of Ara I and XhoI [11];

d) the plasmid pCkap containing the kappa domain gene of the human IgG light chain [11].

The primary sequence of variable regions of a single chain antibody in the pHen1F4 phagemid was first established. Using polymerase chain reaction (PCR) in the presence of the corresponding oligonucleotide primers, the leader sequence from the light chain of MCA F10 and the kappa domain of the light chain of human IgG with the variable fragment of the light chain of clone 1F4 were combined and a similar combination of the leader sequence from the heavy chain of MCA F10 and human C _H 1-C _H 2-C _H 3 IgG1 domains with the heavy chain variable region of a single chain antibody 1F4.

Oligonucleotide primers for constructing the genes of the light and heavy chains of a human antibody against vaccinia virus (in the direction 5′-3 ′).

1. CCTTC CCTAGG TCGGACTGTGGCTG

2. CTCATGGGTCTTCTGAGCTGACTC

3. CTCAGAAGACCCATGAGCACCAG

4. AAGCTGGCTAGCCACTTCTTAG

5. AAGCTG GCTAGC AGGCAAGG

6. CCTTC GGGCCC TTGGTGGAGGCACTCGAGACGGTGACC

7. CCAAGCACAGGTGCAGCTGGTGGAG

8. CTGCACCTGTGCTTGGGCACTTTG

9. CCATTCAGATCCTCTTCTGA

The assembly of the light chain gene consists of the following steps:

1. The combination of the variable region of the light chain of single-chain antibodies 1F4 with the leader sequence of the light chain of murine antibodies F10.

For this, in the first step, PCR amplifies the leader sequence using pBVK1-6 [10] as a template in the presence of primers 3 and 5, as well as the variable region of the light chain of a single chain antibody 1F4 encoded by plasmid pHen1F4 in the presence of primers 2 and 9. Amplification products after isolation on agarose, they are combined and used as a template for the second scab PCR in the presence of primers 5 and 9. The resulting fragment containing the variable region with a leader sequence is treated with XmaJI restriction endonuclease.

2. Cloning of the kappa domain gene of the human IgG light chain into plasmid pSK (+) with the simultaneous introduction of the Xma JI site at the 5-end of the gene.

The kappa domain gene cloned into the pcDNA3.1 plasmid contains the XhoI site at the 3 ′ end. To combine it with the gene encoding the variable region of the light chain integrated into the pHen1F4 phagemid, it is necessary to enter the XmaJI site at the 5′-end, since this unique site ends in the variable region. Amplification is carried out in the presence of primers 1 and BGH (Invitrogen), amplification products are treated with XhoI restriction endonuclease and inserted into the pSK (+) plasmid at the EcoRV and XhoI sites. The result is the plasmid pSKCl.

3. Assembling a full-sized light chain gene.

Plasmid pSKCl was digested with restriction enzymes SmaI and XmaJI and combined in the ligation reaction with the fragment obtained in step 1. E. coli cells were transformed with the obtained plasmid pSKl-l. Clone screening is performed using restriction analysis. Clones containing the full-sized light chain gene are analyzed by sequencing. Then, from the intermediate plasmid pSKl-l thus obtained, upon processing with the restriction endonucleases NheI and XhoI, a DNA fragment containing the full-size light chain gene is obtained and inserted into the expression plasmid pcDNA3.1 (+) (Invitrogen) treated with the same restriction enzymes. The resulting target recombinant plasmid pcL37 was analyzed by hydrolysis with endonucleases HaeIII, NheI, XmaJI and XhoI. The nucleotide sequence of the gene encoding the hybrid protein was confirmed by sequencing, which was carried out according to the method and using the Cycle ReaderTM DNA Sequencing Kit (Fermentas, Lithuania) [12]. The nucleotide sequence of the light chain gene and the amino acid sequence of the recombinant polypeptide encoded by it are shown in figure 1.

The recombinant plasmid DNA pcL37, encoding the synthesis in mammalian cells of a polypeptide with the light chain properties of a full-sized monoclonal human antibody that interacts with the vaccinia virus, is characterized by the following features:

- has a molecular weight of 4.03 MDa and a size of 6108 bp .;

- encodes a hybrid protein in which the variable domain of the light chain of a single-chain human antibody 1F4 is combined with the constant domain of the kappa chain of human IgG;

- consists of the following elements:

a) NheI / XhoI - vector fragment of plasmid pcDNA3.1 (+) (Invitrogen) with a size of 5338 bp containing the CMV promoter enhancer, polyadenylation site and BGH transcription termination site, β-lactamase gene (bla), gene for resistance to neomycin;

b) NheI / XhoI - fragment of the intermediate plasmid pSKI with a size of 770 bp, including an artificial gene encoding a polypeptide with the properties of the light chain of a full-sized monoclonal human antibody that interacts with the vaccinia virus;

- contains:

a) the cytomegalovirus (CMV) promoter and enhancer of transcription;

b) an artificial gene encoding a hybrid protein in which the variable domain of the light chain of a single-chain human antibody 1F4 is combined with the constant domain of the kappa chain of human IgG;

d) unique recognition sites by restriction endonucleases having the following coordinates: Bg1II - 12, NheI - 895, XmaJI - 1294, XhoI - 1665.

The assembly of the heavy chain gene is carried out as follows:

1. At the first stage, the leader sequence of the F10 MCA heavy chain is amplified in the presence of primers 8 and 4, as well as the variable region of the heavy chain of antibody 1F4, using the pHen1F4 phagemid as a template, in the presence of primers 7 and 6 (Ara) with simultaneous introduction of saigas for endonuclease restriction of ApaI, which is present at the 5′-end of the constant region of IgG1. Amplification products are analyzed by agarose gel electrophoresis; bands of the desired size are cut out, DNA is extracted from the gel, combined and used as a template for the second stage PCR in the presence of primers 4 and 6. The resulting fragment containing the variable region with the leader sequence is treated with restriction endonucleases NheI and ApaI, purified by agarose gel electrophoresis and after isolation from the agarose gel, they are used in a further ligation reaction.

2. The full-sized heavy chain gene is obtained by three-component ligation of the fragment obtained in the previous step with the ApaI-XhoI fragment of the pCIgG1 plasmid containing the gene encoding the C _H 1 -C _H 2-C _H 3 human IgG1 domains bounded by the ApaI and XhoI sites , with the vector part of the plasmid pcDNA3.1 treated with restriction endonucleases NheI and XhoI.

The obtained target recombinant plasmid pcH37 was analyzed by hydrolysis of restriction endonucleases HaeIII, NheI, ApaI and XhoI. The structure of the gene encoding the hybrid protein is confirmed by sequencing, which is carried out according to the method and using the kit Cycle ReaderTM DNA Sequencing Kit (Fermentas, Lithuania). The nucleotide sequence of the heavy chain gene and the amino acid sequence of the recombinant polypeptide encoded by it are shown in figure 2.

Recombinant plasmid DNA pcH37 encoding the synthesis in mammalian cells of a polypeptide with the heavy chain properties of a full-sized monoclonal human antibody interacting with the vaccinia virus is characterized by the following features:

- has a molecular weight of 4.57 MDa and a size of 6911 bp .;

- encodes a hybrid protein in which the variable domain of the heavy chain of a single-chain human antibody 1F4 is combined with the constant domain of the heavy chain of human IgG;

- consists of the following elements:

a) NheI / XhoI - vector fragment of plasmid pcDNA3.1 (+) (Invitrogen) with a size of 5338 bp containing the CMV promoter enhancer, polyadenylation site and BGH transcription termination site, β-lactamase gene (bla), gene for resistance to neomycin;

b) ApaI / XhoI - fragment of the intermediate plasmid pCIgG1 with a size of 1126 bp, including the gene C _H 1-C _H 2-C _H 3 domains of human IgG1;

c) NheI / ApaI - 447 bp fragment obtained as a result of amplification and encoding the leader sequence of the heavy chain of the F10 antibody and the variable region of the heavy chain of the antibody 1F4;

- contains:

a) the cytomegalovirus (CMV) promoter and enhancer of transcription;

b) an artificial gene encoding a hybrid protein in which the variable domain of the heavy chain of a single-chain human antibody 1F4 is combined with a constant domain of human IgG1;

- as genetic markers, the β-lactamase gene (bla), which determines the resistance of bacterial cells transformed with plasmid pcH37 to ampicillin, and the neomycin resistance gene for selection of mammalian cells transfected with plasmid pcH37;

- Unique recognition sites by restriction endonucleases having the following coordinates: Bg1II - 12, NheI - 895, ApaI - 1338, XhoI - 1320 and 2468.

The invention consists in the following:

- Genetically engineered plasmids pcL37 and pcH37, encoding the artificial genes for light and heavy chains of a full-sized human antibody, created on the basis of variable fragments of the light and heavy chains of single-chain human antibodies 1F4, constant IgG1 genes, the cytomegalovirus promoter and the BGH4 polyadenylation site.

- The engineered genes determine the biosynthesis of polypeptides in mammalian cells with the properties of the light and heavy chains of a human antibody, which combine into an IgG1 class antibody directed against the vaccinia virus.

To obtain recombinant polypeptides with the properties of the full-sized light and heavy chains of a human immunoglobulin that form an IgG1 class antibody that interacts with vaccinia virus, pcL37 and pcH37 plasmids, HEK 293T cells are transfected, followed by isolation using Protein Gemar affinity chromatography on a column target protein. The specificity of the obtained full-sized human antibodies was demonstrated by immunoblot analysis of vaccinia virus proteins (see example 5). The affinity of the obtained antibody in the binding reaction with vaccinia virus was determined by ELISA and has a constant value of 3.54 · 10 ⁹ ± 0.38 · 10 ⁹ M ^-1 , which is 30 times higher than in the prototype (see example 6).

The invention is illustrated by the following figures:

Figure 1. The nucleotide sequence and the amino acid sequence encoded by it of the NheI / XhoI fragment of the plasmid pcL37 encoding a polypeptide with the properties of the light chain of a human antibody against vaccinia virus. The recognition sites of restriction endonucleases are emphasized. The initiating and terminating codons are in bold.

Figure 2. The nucleotide sequence and the amino acid sequence encoded by it of the NheI / XhoI fragment of the plasmid pcN37 encoding a polypeptide with the properties of the heavy chain of a human antibody against vaccinia virus. The recognition sites of restriction endonucleases are emphasized. The initiating and terminating codons are in bold.

Figure 3. Physical map of plasmid pcL37. Recognition sites of restriction endonucleases are indicated. Pcmv - cytomegalovirus promoter; S is the signal sequence; Vl, k — variable and constant regions of the recombinant antibody light chain gene; BGHpA is a bovine growth hormone polyadenylation site.

Figure 4. Physical map of the plasmid pcH37. Restriction endonucleases sites are indicated. Pcmv - cytomegalovirus promoter; S is the signal sequence; Vh, const. - variable and constant regions of the recombinant antibody heavy chain gene; BGHpA is a bovine growth hormone polyadenylation site.

Figure 5. Electrophoregram of the purified target antibody in a 13% polyacrylamide gel. Lanes: 1 — 1F4 full-length antibody not treated with 2-mercaptoethanol; 2 - full-length antibody 1F4 treated with 2-mercaptoethanol; 3 - molecular weight standards.

6. Electrophoregram of vaccinia virus proteins separated electrophoretically in a denaturing 12% polyacrylamide gel: A - staining of Coomassie vaccinia virus proteins R-250 (1), B - immunoblotting with re-MKA 1F4 (2), with anti-human conjugate (anti-human) with alkaline phosphatase (3), M - molecular weight standards.

7. Determination of affinity constant using indirect enzyme immunoassay. The titration schedule of the obtained recombinant antibody is shown. Smallpox vaccine virus is absorbed into the solid phase at a concentration of 2.5 μg / ml. The recombinant human antibody is applied in serial dilutions in 1: 3 increments, the initial concentration is 5.5 μg / ml, and is shown to be an antispecific alkaline phosphatase conjugate at a dilution of 1/10000. The value of the affinity constant was: K _af = 3.54 × 10 ⁹ ± 0.38 × 10 ⁹ M ^-1 .

For a better understanding of the invention, the following are examples of its specific implementation.

Example 1. Construction of recombinant plasmid DNA pcL37.

a) Combining the variable region of the light chain of a single chain antibody 1F4 with the leader sequence of the light chain of murine MCA F10.

Amplification of the leader sequence is carried out in a volume of 100 μl. The reaction mixture contains 100 ng pBVK1-6, 50 pmol of primers 3 and 5, dNTP mixture (0.2 mM each), 10 mM Tris-HCl, pH 8.8, 10 mM KCl, 2.5 mM MgSO _4, 2.5 units of act. Pfu DNA polymerase (Stratagene) and 1 unit Taq DNA polymerase (Fermentas). Spend 25 cycles according to the scheme: 95 ° C / 40 sec, 45 ° C / 40 sec, 72 ° C / 1 min. The reaction products are analyzed by electrophoresis in a 1% agarose gel; strip length of about 96 bp cut out, the DNA is extracted from the gel. Amplification of the variable region of the light chain is carried out in a volume of 100 μl in the presence of 100 ng pHen1F4, 50 pmoles of primers 2 and 9, dNTP mixtures (0.2 mM each), 10 mM Tris-HCl, pH 8.8, 10 mM KCl, 2.5 mM MgSO _4, 2.5 units Pfu DNA polymerase (Stratagene) and 1 unit Taq DNA polymerase (Fermentas). Spend 25 cycles according to the scheme: 95 ° C / 40 sec, 45 ° C / 40 sec, 72 ° C / 1 min. The reaction products are analyzed by electrophoresis in a 1% agarose gel; strip length of about 360 bp cut out, the DNA is extracted from the gel, combined with the previously obtained fragment and used as a matrix in the second stage of PCR, which is carried out under the same conditions in the presence of primers 5 and 9. The amplification product is about 450 bp long. treated with restriction endonuclease XmaJI in accordance with the procedure described in [13]. The reaction products are analyzed by electrophoresis in a 1% agarose gel; a strip of the desired length is cut out, DNA is extracted from the gel.

b) Cloning of the kappa domain gene of the human IgG light chain into plasmid pSK (+) with the simultaneous introduction of the XmaJI site at the 5′-end of the gene.

The kappa domain gene is amplified in 100 μl of the reaction mixture in the presence of 100 ng pCkap, 50 pmoles of primers 1 and BGH, dNTP mixtures (0.2 mM each), 10 mM Tris-HCl, pH 8.8, 10 mM KCl, 2.5 mM MgSO _{4 ,} 2.5 units Pfu DNA polymerase (Stratagene) and 1 unit Taq DNA polymerase (Fermentas). Spend 25 cycles according to the scheme: 95 ° C / 40 sec, 43 ° C / 40 sec, 72 ° C / 1 min. The reaction products are analyzed by electrophoresis in a 1% agarose gel; a strip with a length of about 440 bp cut out, DNA is extracted from the gel and treated with XhoI restriction endonuclease. Then, 5 μg of pSK (+) plasmid DNA (Stratagene, USA) is treated with restriction endonucleases EcoRV and XhoI, the reaction products are analyzed by electrophoresis on a 0.8% agarose gel, the vector DNA strip is excised and the DNA is extracted from the gel. The resulting 440 bp PCR fragment and the vector part of the plasmid pSK (+) is combined in the ligation reaction in 20 μl of the reaction mixture under standard conditions [13]. 5 μl of the reaction mixture was used to transform competent XL-1 Blue cells (Stratagene, USA). Transformants are plated on LB agar containing 100 μg / ml ampicillin. During cell sieving, 100 μl of a 0.1 M IPTG solution and 20 μl of a 4% X-Gal solution are added to the agar surface. Plasmid DNA is isolated from the grown white clones and analyzed by restriction endonucleases EcoRV, XmaJI and XhoI. The nucleotide sequence of the inserted fragment in the selected clones was confirmed by sequencing using the Cycle ReaderTM DNA Sequencing Kit (Fermentas, Lithuania) as described in [12]. The result is an intermediate plasmid pSKCl.

c) Assembly of a full-sized light chain gene.

5 μg of the plasmid pSKCl was treated with restriction enzymes SmaI and XmaJI, and the reaction products were analyzed by 0.8% agarose gel electrophoresis. A strip with the linearized vector part of the plasmid is cut out, DNA is extracted from the gel and combined in the ligation reaction with 1 μg of the fragment obtained in step a) in 15 μl of the reaction mixture according to the standard procedure [13]. 5 μl of the reaction mixture was used to transform competent E. coli XL-1 Blue cells (Stratagene, USA). Transformants are plated on LB agar containing 100 μg / ml ampicillin. Screening for plasmid DNA from clones is performed by restriction analysis using restriction endonucleases XmaJI, NheI and XhoI. Clones containing a full-sized light chain gene are analyzed by sequencing as described above. 10 μg of the intermediate plasmid pSKl-1 thus obtained was treated with restriction endonucleases NheI and XhoI, the reaction products were analyzed by electrophoresis on a 1% agarose gel, a DNA band about 775 bp in length. cut out and DNA extracted from the gel. The obtained DNA fragment was combined in a ligation reaction with 1 μg of DNA of the expression plasmid pcDNA3.1 (+) (Invitrogen) treated with the same restriction endonucleases. Transformation and analysis of clones is carried out as described above. The resulting recombinant plasmid pcL37 (FIG. 3) was analyzed by hydrolysis with the endonucleases HaeIII, NheI, XmaJI and XhoI. The structure of the gene encoding the fusion protein is confirmed by sequencing (FIG. 1).

Example 2. Construction of recombinant plasmid DNA pcN37.

a) Combining the variable region of the heavy chain of the antibody 1F4 with the leader sequence of the heavy chain of murine MCA F10. Amplification of the leader sequence is carried out in a volume of 100 μl. The reaction mixture contains 100 ng pBVK14a2, 50 pmol of primers 8 and 4, dNTP mixture (0.2 mM each), 10 mM Tris-HCl, pH 8.8, 10 mM KCl, 2.5 mM MgSO _4, 2.5 units of act. Pfu DNA polymerase (Stratagene) and 1 unit Taq DNA polymerase (Fermentas). In total, 25 cycles are carried out according to the scheme: 95 ° C / 40 sec, 45 ° C / 40 sec, 72 ° C / 1 min. The reaction products are analyzed on a 1% agarose gel; strip length of about 90 bp cut out, the DNA is extracted from the gel. Amplification of the variable region of the heavy chain is carried out in a volume of 100 μl in the presence of 100 ng pHen1, 50 pmoles of primers 6 and 7, dNTP mixtures (0.2 mM each), 10 mM Tris-HCl, pH 8.8, 10 mM KCl, 2.5 mM MgSO _4, 2.5 units Pfu DNA polymerase (Stratagene) and 1 unit Taq DNA polymerase (Fermentas). Spend 25 cycles according to the scheme: 95 ° C / 40 sec, 45 ° C / 40 sec, 72 ° C / 1 min. The reaction products are analyzed by electrophoresis in a 1% agarose gel; a strip with a length of about 390 bp cut out, the DNA is extracted from the gel, combined with the previously obtained fragment and used as a matrix in the second stage of PCR, which is carried out under the same conditions in the presence of primers 4 and 6. The amplification product is about 465 bp long. treated with restriction endonucleases NheI and ApaI, the reaction products are analyzed by agarose gel electrophoresis. A strip of about 460 bp is cut out, DNA is extracted from the gel.

b) Assembly of the full-sized gene of the heavy chain. 10 μg of plasmid pCIgG1 is treated with restriction enzymes ApaI and XhoI, the reaction products are analyzed by electrophoresis on a 1% agarose gel. A strip of about 1130 bp in length containing the C _H 1-C _H 2-C _H 3 human IgG1 gene is excised, DNA is extracted from the gel. Then, 5 μg of pcDNA3.1 (+) plasmid (Invitrogen) was treated with restriction endonucleases NheI and XhoI, the reaction products were analyzed by 0.8% agarose gel electrophoresis, the band with the linearized vector part of the plasmid was excised, DNA was extracted from the gel. Then 1 mg of ApaI-XhoI fragment, 1 μg. the linearized vector portion and 0.5 μg of the PCR fragment obtained in step a) are combined in the ligation reaction in 20 μl according to the standard procedure [13]. 5 μl of the reaction mixture was used to transform competent E. coli XL-1 Blue cells (Stratagene, USA). Transformants are plated on LB agar containing 100 μg / ml ampicillin. Clone screening is performed by restriction analysis using restriction endonucleases ApaI, NheI and XhoI. The resulting recombinant plasmid pcH37 (FIG. 4) was analyzed by restriction endonucleases HaeIII, NheI and XhoI. Clones containing the full-length heavy chain gene are analyzed by sequencing as described above.

Example 3. Expression of full-sized human antibodies in a human cell line.

Transient expression of full-sized human antibodies against vaccinia virus is carried out as a result of transfection of human cells of the HEK293T line obtained with expression plasmids containing the light and heavy chain genes of antibodies. For this, before transfection, HEK293T cells were cultured at 37 ° C in an atmosphere of 5% CO ₂ in DMEM medium (Gibco BRL) containing 10% bovine fetal serum. Cells are seeded on 60 mm plates and grown to a density of 90-95%, followed by transfection.

Transfection is as follows. Ten micrograms of plasmid DNA (5 μg of pcL37 plasmid DNA and 5 μg of pcH37 plasmid DNA) was diluted in 500 μl of DMEM medium. At the same time, 25 μl of LipofectAmine 2000 Reagent (Gibco BRL) solution was mixed with 500 μl of DMEM medium. Both solutions were combined and incubated for 20 minutes at room temperature. After incubation, the DNA-LipofectAmine solution was added to DMEM medium and the resulting mixture was used as a culture medium for HEK293T cells.

After transfection, cells are grown for 72 hours without replacing the culture medium. Upon completion of the incubation, the culture medium is collected and centrifuged for 5 minutes at 1,500 rpm. The supernatant is separated and used to isolate antibodies.

Example 4. Isolation of recombinant antibodies using affinity chromatography.

150 ml of culture fluid is applied to a column containing 1 ml of Protein G Sepharose (Amersham) media equilibrated with PBS buffer. The column is washed with 10 ml of the same buffer and the recombinant protein is eluted with 0.1 M glycine-HCl, pH 2.7, collecting 0.5 ml fractions. 50 μl of 2 M Tris-HCl, pH 8.0, is immediately added to each fraction to neutralize. Fractions containing recombinant protein are analyzed by polyacrylamide gel electrophoresis, pooled and dialyzed against PBS buffer. Purified recombinant antibodies are characterized by fractionation in 12% SDS-PAGE, preparing samples for application to the gel in the presence and absence of 2-mercaptoethanol (Fig. 5).

Example 5. The specificity of the obtained recombinant antibodies is confirmed using immunoblot analysis of vaccinia virus proteins (Fig.6). The vaccinia virus proteins are separated electrophoretically in a 12% SDS polyacrylamide gel, transferred to a 0.45 μm nitrocellulose filter (Millipore, USA), which, after blocking non-specific binding sites with a solution of 3% BSA (Sigma, USA), is incubated with the studied antibody . Bound antibodies are detected by the addition of an alkaline phosphatase conjugate (Sigma, USA) at a dilution of 1: 10000. Imaging of the immune complex is carried out by adding 5-bromo-3-indolo phosphate (Carl Roth GmbH, Germany) and nitrotetrazole blue (Sigma, USA). The results show the specificity of binding of the engineered full-length antibody to a protein of about 27 kDa vaccinia virus (FIG. 6).

Example 6. Determination of the affinity constant of the obtained recombinant full-sized antibodies in the binding reaction with vaccinia virus. The affinity constant is determined by ELISA. The viral preparation is adsorbed onto the solid phase at a concentration of 250 ng / well, and after blocking the sites of nonspecific binding with a solution of 2% bovine serum albumin (BSA, Sigma, USA), they are incubated with the obtained recombinant antibody added in successive dilutions starting from a concentration of 5.5 μg / ml in 1: 3 dilution steps. The immune complex is detected by the addition of an antispecific conjugate of alkaline phosphatase (Sigma, USA) at a dilution of 1: 10000. As a chromogen, para-nitophenyl phosphate ("ICN", USA) is used. As a negative control in parallel experiments, the binding of the resulting recombinant antibody to BSA is tested. The experimental results show the ability of the obtained recombinant antibody to bind the vaccinia virus and the lack of interaction between the obtained antibody and BSA. The value of the affinity constant is calculated by the least squares method according to the formula:

where x is the concentration of antibodies in solution, R is the concentration of the sorbed antigen, k is the affinity constant, A is the normalization factor. The value of the affinity constant for the recombinant human antibody 1F4 is 3.54 × 10 ⁹ ± 0.38 × 10 ⁹ M ^-1 (Fig.7). Such an antibody can be considered high affinity.

Thus, plasmids containing artificial genes for the light and heavy chains of a full-sized human antibody were constructed based on variable fragments of the light and heavy chains of human 1F4 single chain antibodies, human IgG1 constant genes, the cytomegalovirus promoter, and the BGH4 polyadenylation site. The transient transformation of eukaryotic cells of the HEK293T line causes biosynthesis into polypeptides with the properties of the light and heavy chains of a human antibody, which are combined into an IgG1 class antibody that specifically interacts with the 27 kPa protein of the vaccinia virus, with K _af = 3.54 × 10 ⁹ ± 0.38 × 10 ⁹ M ^-1 , which is 30 times higher than in the prototype.

The resulting full-length recombinant antibody against the 27 kDa protein of the vaccinia virus can serve as the basis for the creation of pharmaceuticals for the diagnosis and treatment of a number of vaccine-related complications caused by the vaccinia virus. In this case, the preparations will contain reduced therapeutic doses of immunoglobulins, which will minimize the undesirable immune response to the administered drug in patients.

Information sources

1. Vorobiev A.A., Podkuyko V.N., Maksimov V.A. Oral vaccination against smallpox (return of vaccination against smallpox). News. RAMS. 2003. N 1. S.5-9.

2. Marennikova S. S., Schelkunov S. N. Pathogenic for humans orthopoxviruses - M., 1998.

3. Dumbel K. and Hug F. The virology of variola minor. Correlation of laboratory tests with the geographic distribution and human virulence of variola isolates. Amer. J. Epidemiol. - 1986. - Vol. 123. - P.403-415.

4. Fenner P., Wittek R., Dumbell K.R. The Orthopoxviruses. Acad. Press, Inc., San Diego, 1989.

5. Kim S., Jang M., Stapleton J., Yoon S., Kim K-S., Jeong E-S., Hong H. Neutralizing human monoclonal antibodies to hepatitis A virus recovered by phage display. Virology. 2004. Vol. 318. P.598-607.

6. Kausmally L., Waalen K., Lobersli I., Hvattum E., Bemtsen G., Michaelsen T., Brekke O.H. Neutralizing human antibodies to varicella-zoster virus (VZV) derived from a VZV patient recombinant antibody library. J. Gen. Virol. 2004. Vol. 85. P.3493-3500.

7. Williamson R.A., Burioni R., Sanna P.P., Partridge L.J., Barbas C.F., Burton D.R. Human monoclonal antibodies against a plethora of viral pathogens from single combinatorial libraries. Proc. Natl. Acad. Sci. 1993. Vol. 90. P.4141-4145

8. International application WO No. 03068151, cl. S07K 16/08, publ. 08.21.2003.

9. Morozova VV, Tikunova N.V., Batanova T.A., Yun T.E., Bovshik E.I., Zhirakovskaya E.V., Voronina V.V., Bobko D.I., Belanov E.F., Ilyichev A.A., Sandakhchiev L.S. Human mini antibodies against orthopoxviruses. Vestnik RAMS, 2004, No. 8. p.22-27.

10. Radko B.V., Boitchenko V.E., Nedospasov S.A. and Korobko V.G. Characterization of the genes encoding variable light and heavy chains of the high-affinity monoclonal antibody against human tumor necrosis factor. Russian Journal of Immunology, 2002, v. 7 (4), p. 371-374.

11. Aliev T.K., Panina A.A., Petrovskaya L.E., Shingarova L.N., Radko B.V., Nedospasov S.A., Korobko V.G., Zavyalova G.A., Zavyalov V.P. Design and Expression of Humanized Monoclonal Antibody F10 that Neutralizes Human Tumor Necrosis Factor-a. Clinical Immunology, 2002, v. 103 (3), Part 2, p. S90.

12. CycleReader DNA Sequencing Kit # K1711, Fermentas. Sequencing Protocol.

13. Sambrook J., Fritsch E., Maniatis T. Molecular Cloning. A Laboratory manual. 2 ^nd ed. Cold Spring Harbor, NY 1989.

14. Varfolomeev S.D., Gurevich K.G. Biokinetics: Practical Course. M .: FAIR-PRESS, 1999.

Claims (3)

1. Recombinant plasmid DNA pcL37, encoding the synthesis in mammalian cells of a polypeptide with the properties of the light chain of a full-sized human monoclonal antibody interacting with the vaccinia virus, size 6108 BP and a molecular weight of 4.03 Mda, including: NheI / XhoI is a 5338 bp pcDNA3.1 (+) plasmid vector fragment containing the cytomegalovirus (CMV) promoter and transcription enhancer, polyadenylation site and BGH transcription termination site, β-lactamase gene (bla) and gene neomycin resistance; NheI / XhoI is a 770 bp fragment containing an artificial gene encoding a hybrid polypeptide in which the light chain variable domain of a single chain antibody 1F4 obtained from a combinatorial phage library of human single chain antibodies is connected to the constant domain of the human IgG kappa chain, having the nucleotide sequence shown in figure 1; genetic markers: β-lactamase (bla) gene, which determines the resistance of bacterial cells transformed with plasmid pcL37 to ampicillin; neomycin resistance gene for selection of mammalian cells transfected with plasmid pcL37; unique recognition sites by restriction endonucleases having the following coordinates: Bg1II - 12, NheI - 895, XmaJI - 1294, XhoI - 1665. 2. Recombinant plasmid DNA pcH37 encoding the synthesis in mammalian cells of a polypeptide with heavy chain properties of a full-sized human monoclonal antibody interacting with the vaccinia virus, size 6911 bp and a molecular weight of 4.57 Mda, including: NheI / XhoI is a 5338 bp pcDNA3.1 (+) plasmid vector fragment containing the cytomegalovirus (CMV) promoter and transcription enhancer, polyadenylation site, BGH transcription termination site, β-lactamase gene (bla) and gene neomycin resistance; ApaI / XhoI - fragment of plasmid rSIgC1 intermediate size 1126 bp comprising the gene of C _H 1-C _H 2-C _H 3 domains of human IgG1; NheI / ApaI is a 447 bp fragment containing an artificial gene encoding the F10 antibody heavy chain leader sequence and the 1F4 single chain antibody variable region derived from a combinatorial phage library of human single chain antibodies having the nucleotide sequence shown in FIG. 2 ; genetic markers: β-lactamase gene (bla), which determines the resistance of ampicillin to bacterial cells transformed with plasmid pcH37; neomycin resistance gene for selection of mammalian cells transformed with plasmid pcH37; unique recognition sites by restriction endonucleases having the following coordinates: Bg1II - 12, NheI - 895, ApaI - 1338, XhoI - 1320 and 2468. 3. The use of recombinant plasmid DNA pcL37 and pcH37, characterized in paragraphs 1 and 2, to obtain a recombinant full-sized human IgGI antibodies, interacting with vaccinia virus having an affinity constant of 3.54 · 10 ⁹ ± 0.38 · 10 ⁹ M ^{- 1} , by co-transfection with the indicated plasmid DNA of human HEK 293T cells.

Images