RU2311927C2 - COMBINATORIAL FRAGMID LIBRARY OF HUMAN SINGLE-STRANDED ANTIBODIES ENRICHED WITH ANTIBODIES AGAINST VARIOLOVACCINE VIRUS, RECOMBINANT FRAGMID pHEN-2A8 DNA CONTAINING UNIQUE GENE OF HUMAN SINGLE-STRANDED ANTIBODY, CAPABLE OF NEUTRALIZING VARIOLOVACCINE VIRUS AND COWPOX VIRUS, AND ARTIFICIAL HUMAN SINGLE-STRANDED 2A8 ANTIBODY CAPABLE OF NEUTRALIZING VARIOLOVACCINE VIRUS AND COWPOX VIRUS - Google Patents

Abstract

FIELD: biotechnology, protein engineering.

SUBSTANCE: claimed library represents E.coli TGI cells wherein each cell contains fragmid DNA providing biosynthesis of filamentous bacteriophages exposing unique human single-stranded antibody on surface thereof. Also disclosed is recombinant fragmid pHEN-2A8 DNA containing artificial gene of human single-stranded antibody under control of lactose operon promoter providing synthesis of human single-stranded antibody in composition of chimerical protein with membrane pIII protein of M13 bacteriophage in E.coli cells. Also disclosed is method for production of artificial human single-stranded 2A8 antibody by using such fragmid DNA.

EFFECT: fragmid library useful in medicine.

3 cl, 7 dwg, 10 ex

Description

The invention relates to biotechnology, protein and genetic engineering and is an immune combinatorial phagmid single-chain human antibody library constructed in vitro based on genes encoding the variable domains of human immunoglobulins vaccinated with vaccinia virus; pHEN-2A8 recombinant phagemid DNA selected from this library, containing genetically engineered artificial human single-chain antibody gene under the control of the lactose operon promoter, which ensures the synthesis of a single-chain human antibody in E. coli cells with the chimeric protein p3 envelope protein of bacteriophage M13 capable of to neutralize orthopoxviruses, as well as single-chain human antibody 2A8 exposed on the surface of the filamentous bacteriophage M13 as part of the envelope protein p3, capable of neutralize vaccinia virus and cowpox virus.

The genus Orthopoxvirus includes complex DNA-containing viruses that replicate in the cytoplasm of vertebrate and invertebrate cells. Orthopoxviruses include monkeypox and smallpox viruses of monkeys, which are the causative agents of severe generalized diseases of humans and primates, smallpox viruses of cows and smallpox vaccines that can cause local damage in humans, as well as a number of other viruses (ectromelia viruses, camelpox, etc.) pathogenic for mammals [1]. It should be noted that in people with weakened immune status, vaccinia and cow pox viruses can cause serious illness or even a generalized infection.

Using the vaccinia virus, by the end of the 70s of the last century, the eradication of smallpox was carried out as part of the WHO global program. In connection with the cessation of the natural transmission of smallpox virus, mass vaccination with smallpox vaccine was then stopped. However, despite the eradication of smallpox, there are reasons why orthopoxviruses continue to be a source of biohazard for humans, and the spontaneous or deliberate spread of smallpox or monkeypox can be facilitated by the fact that at present most of the population is not immune to these viruses. In addition, the resumption of mass vaccination with vaccinia virus in the United States confirmed the inevitability of post-vaccination complications in some cases, especially since the majority of vaccinated adults were not vaccinated with vaccinia in childhood.

A number of post-vaccination complications, as well as diseases that occur in people with a weakened immune system when infected with the smallpox virus of cows, can be prevented by the use of human vaccine immunoglobulin [1], but this drug is expensive and inaccessible, in addition, the use of drugs derived from human blood is always accompanied by a known biological risk. An alternative to vaccine immunoglobulin could be human monoclonal antibodies (MCAs) specific for orthopoxviruses. However, using traditional hybridoma technology, it is extremely difficult to obtain stable cell lines with a high level of human MCA production.

One of the modern methods for producing human MCA is the selection of their variable domains from combinatorial phage libraries of single-chain human antibodies, followed by their combination with constant domains of human immunoglobulins. To date, full-length human antibodies against a number of antigens, including viral agents, have been constructed in this way [2, 3].

A combinatorial antibody library is a collection of bacterophages, each of which exhibits on its surface a unique single-chain antibody in the composition of the enveloped phage protein [4]. Most often, combinatorial libraries are constructed on the basis of filamentous bacteriophages Escherichia coli - M13, fd. Phage display technology allows the construction of single-chain antibody libraries with a huge molecular diversity of 10 ⁴ to 10 ⁹ different antibodies. The physical cohesion of the antibody and the genetic material encoding it makes it possible to quickly analyze antigen-specific molecules, making it possible to select antibodies specific for the target antigen [5].

One way of constructing phage libraries is by randomly combining in vitro variable domains of heavy chains with variable domains of light chains (Vh and Vl, respectively), the genes of which are derived from mRNA from human mononuclear cells. Moreover, if a person has suffered a viral disease or was immunized with the appropriate vaccine, the antibody library constructed on the basis of his Vh and Vl genes will obviously contain antibodies against the target viral agent and the probability of selection of neutralizing or protective antibodies will increase sharply. Therefore, to obtain therapeutic antibodies against orthopoxvirus, including smallpox virus, at the first stage, it is necessary to construct a combinatorial phagemid library of single-chain human antibodies based on the Vh and Vl genes of human lymphocytes immunized with vaccinia virus.

Earlier in the USA, a phage library of antibody Fab fragments was created on the basis of human immunoglobulin genes vaccinated with vaccinia virus [6]. However, a necessary condition for the presence of antigen-binding properties of Fab fragments is the conformationally correct interaction of the V _h C _h and V _l C _l chains forming Fab domains, which does not always occur during their synthesis in E. coli cells. More stable are single chain antibodies (scFv - single chain antibody fragments), consisting of the variable domains of the heavy and light chains of immunoglobulins, united by a flexible peptide linker (Gly ₄ Ser) _n [7]. An immune library of human single chain antibodies against orthopoxviruses is not described.

An object of the invention is to create a combinatorial phagemid library of single-chain human antibodies, based on genes encoding the variable domains of human immunoglobulins immunized with vaccinia virus, and to obtain using a phage display a single-chain human antibody exposed on the surface of bacteriophage M13K07 as part of envelope protein p3 and capable of neutralizing infectivity of orthopoxviruses.

The goals are achieved by the synthesis of cDNA fragments encoding the variable domains of immunoglobulins, based on mRNA isolated from lymphocytes of people immunized with the vaccinia virus; combining fragments of cDNA encoding the variable domains of the heavy and light chains in DNA sequences encoding single-chain human antibodies; embedding the obtained genes (DNA sequences) encoding single chain antibodies into the pHEN2 phagemid and transforming the resulting phagemids of E. coli TG1 cells; selection from the obtained phagmid collection of recombinant phagmid DNA containing a unique gene of a single-chain human antibody capable of neutralizing orthopoxviruses; obtaining a single-chain human antibody exposed on the surface of bacteriophage M13K07 as part of the envelope protein p3 and capable of neutralizing the infection of orthopoxviruses.

Oligonucleotide primers used to construct a combinatorial phage library of single-chain human antibodies [8]:

1. HuJH1-2FOR 5'TGAGGAGACGGTGACCAGGGTGCC;

2. HuJH3FOR 5'TGAAGAGACGGTGACCATTGTCCC;

3. HuJH4-5FOR 5'TGAGGAGACGGTGACCAGGGTTCC;

4. HuJH6FOR 5'TGAGGAGACGGTGACCGTGGTCCC;

5. HuVH1aBACK 5'CAGGTGCAGCTGGTGCAGTCTGG;

6. HuVH3aBACK 5'GAGGTGCAGCTGGTGGAGTCTGG;

7. HuVH5aBACK 5'GAGGTGCAGCTGTTGCAGTCTGC;

8. HuJk1FOR 5'ACGTTTGATTTCCACCTTGGTCCC;

9. HuJk2FOR 5'ACGTTTGATCTCCAGCTTGGTCCC;

10. HuJk3FOR 5'ACGTTTGATATCCACTTTGGTCCC;

11. HuJk4FOR 5'ACGTTTGATCTCCACCTTGGTCCC;

12. HuJk5FOR 5'ACGTTTAATCTCCAGTCGTGTCCC;

13. HuJλFOR 5'ACCTAGGACGGTGACCTTGGTCCC;

14. HuJλ2-3 FOR 5'ACCTAGGACGGTCAGCTTGGTCCC;

15. HuJλ4-5FOR 5'ACCTAAAACGGTGAGCTGGGTCCC;

16. HuVk1aBACK 5'GACATCCAGATGACCCAGTCTCC;

17. HuVk2aBACK 5'GATGTTGTGATGACTCAGTCTCC;

18. HuVk3aBACK 5'GAAATTGTGTTGACGCAGTCTCC;

19. HuJλlBACK 5'CAGTCTGTGTTGACGCAGCCGCC;

20. HuJλ2BACK 5 'CAGTCTGCCCTGACTCAGCCTGC;

21. HuJλ3aBACK 5 'TCCTATGTGCTGACTCAGCCACC;

22. HuJλ3bBACK 5'TCTTCTGAGCTGACTCAGGACCC;

23. RhuJH1 5'GCACCCTGGTCACCGTCTCCTCAGGTGGCGGTGGCTCT;

24. RhuJH3 5'GGACAATGGTCACCGTCTCTTCAGGTGGCGGTGGCTCT;

25. RhuJH4-5 5'GAACCCTGGTCACCGTCTCCTCAGGTGGCGGTGGCTCT;

26. RhuJH6 5'GGACCACGGTCACCGTCTCCTCAGGTGGCGGTGGCTCT;

27. HuVH1aBACKSfi 5'GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCC CAGGTGCAGCTGGTGCAGTCTGG;

28. HuVH3aBACKSfi 5'GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCC CAGGTGCAGCTGGTGGAGTCTGG;

29. HuVH5aBACKSfi 5'GTCCTCGCAACTGCGGCCCAGCCGGCCATGGCC CAGGTGCAGCTGTTGCAGTCTGC;

30. RhuVklaB 5'GGAGACTGGGTCTCCTGGATGTCAGATCCGCCGCCACCCGA;

31. RhuVk2aB 5'GGAGACTGAGTCATCACAACATCAGATCCGCCGCCACCCGA;

32. RhuVk3aB 5'GGAGACTGCGTCAACACAATTTCAGATCCGCCGCCACCCGA;

33. RhuVlB1 5'GGCGGCTGCGTCAACACAGACTGAGATCCGCCGCCACCCGA;

34. RhuVlB2 5'GCAGGCTGAGTCAGAGCAGACTGAGATCCGCCGCCACCCGA;

35. RhuVlB3a 5'GGTGGCTGAGTCACCACATAGGAAGATCCGCCGCCACCCGA;

36. RhuVlB3b 5'GGGTCCTGAGTCAGCTCAGAAGAAGATCCGCCGCCACCCGA;

37. HuJk1FORNot 5'GAGTCATTCTCGACTTGCGGCCGCACGTTTGATTTCCACCTTGGTCCC;

38. HuJk2FORNot 5'GAGTCATTCTCGACTTGCGGCCGCACGTTTGATCTCCA GCTTGGTCCC;

39. HuJk3FORNot 5'GAGTCATTCTCGACTTGCGGCCGCACGTTTGATATCCA CTTTGGTCCC;

40. HuJk4FORNot 5'GAGTCATTCTCGACTTGCGGCCGCACGTTTGATCTCCA CCTTGGTCCC;

41. NuJk5FORNot 5'GAGTCATTCTCGACTTGCGGCCGCACGTTTAATCTCCA GTCGTGTCCC;

42. HuJl1FORNot 5 'GAGTCATTCTCGACTTGCGGCCGCACCTAGGACGGTGACCTTGGTCCC;

43. НuJl2-3FORNot 5'GAGTCATTCTCGACTTGCGGCCGCACCTAGGACGGTCAGCTTGGTCCC;

44. NuJl4-5FORNot 5'GAGTCATTCTCGACTTGCGGCCGCACCTAAAACGGTGAGCTGGGTCCC.

At the first stage, lymphocytes are isolated from the blood of four donors immunized with the vaccinia virus. After each vaccine, an antibody titer against vaccinia virus is monitored for each donor by enzyme immunoassay. To increase the likelihood of selecting specific antibodies in the library under construction, blood is taken for subsequent cell isolation when the maximum titer of antibodies against vaccinia virus in serum is reached.

Blood in an amount of 100 ml is immediately mixed with an anticoagulant and diluted with an equal volume of phosphate-buffered saline (PBS). Peripheral blood lymphocytes are isolated by centrifugation in a density gradient ficol-triombrast. For this, the resulting blood solution is layered on a solution of ficol-triombrast in a volume ratio of 3: 1 and then centrifuged at 1500 g for 30 minutes. Interphase mononuclear cells are harvested and washed several times with sterile PBS. To further isolate RNA, cells are lysed in a solution of 4 M guanidine isothiocyanate.

Then, total RNA is isolated using TRIzol reagent according to standard methods. The resulting RNA is used as a template for the synthesis of the first cDNA strand in the reverse transcription reaction using the M-MuLV enzyme reverse transcriptase. As primers, oligo-dT and statistical hexaoligonucleotides are used.

For the synthesis of the second chain, specific oligonucleotides are used as primers. The choice of oligonucleotides for amplification of DNA fragments encoding the variable domains of the heavy and light chains of immunoglobulins is due to the primary structure of these domains. They are bounded at the edges by conserved FR1 regions and J-segments, which are highly conserved in the 3'-region. Moreover, each family of immunoglobulins is characterized by their conservative sequences of FR1 regions and 3'-terminal fragments of J-segments. The corresponding oligonucleotides can be used as primers for amplification of cDNA of B-lymphocytes.

For amplification of the variable domains of immunoglobulin heavy chains, primers 1-4 are used that are complementary to mRNA sequences encoding J-segments of immunoglobulin heavy chains, as well as primers 5-7 corresponding to mRNA sequences encoding FR1 regions of immunoglobulin heavy chains. For amplification of the variable domains of light chains (kappa and lambda), primers 8-15 are used that are complementary to mRNA sequences encoding J-segments of immunoglobulin light chains, as well as primers 16-22 corresponding to mRNA sequences encoding FR1-regions of immunoglobulin light chains. Such sets of oligonucleotides allow amplification of the variable domains of immunoglobulin genes that are most widely represented in the body.

Amplification of variable fragments is carried out in a polymerase chain reaction (PCR) using Taq and Vent DNA polymerases at annealing temperature of primers 55 ° C.

At the second stage, using the nucleotide sequence encoding the flexible peptide linker Ser (Gly ₄ Ser) ₂ AlaArgGlySerGly ₄ Ser, the variable fragments of the heavy and light chains of human immunoglobulins are combined into DNA sequences encoding single-chain human antibodies (Fig. 1). An oligonucleotide encoding the reverse linker sequence linkApaLI: 5 'AGATCCGCCGCCACCCGAGACCCCGGTGCACTGCCGCCACCACCAGAGCCACCGCCACCTGA and containing the ApaLI restriction endonuclease site (in bold) is used.

Association is carried out in several stages. First, linkApaLI oligonucleotides are completed by PCR using sequences 23-26 encoding the 3 ′ ends of the immunoglobulin heavy chain variable domains. Then, the obtained completed linker by PCR is combined with heavy chains using primers 27-29 containing the SfiI restriction site from the 5'-end.

In the case of light chains, the linkApaLI linker, completed with oligonucleotides 23-26, is extended with sequences complementary to the 5'-ends of the variable domains of light chains. For this, primers 30-36 are used. Then, the linker completed at both ends is combined with light chains using primers 23-26 and primers 37-44 containing the NotI restriction site.

The obtained DNA fragments are amplified, purified by electrophoresis in a 1.5% agarose gel and treated with ApaLI restriction endonuclease. Thus prepared DNA fragments encoding the variable domains of the heavy and light chains are combined in a ligation reaction using T4 phage DNA ligase. The obtained DNA fragments encoding single-chain human antibodies with a length of about 800 bp are amplified using primers 27-29 and 37-44 containing SfiI and NotI restriction sites, respectively.

At the third stage, the obtained genes encoding single-chain human antibodies are inserted into the vector phagemid pHEN2 (MRC, United Kingdom). This phagemid can be replicated like a normal plasmid, and due to the presence of ori of the M13K07 phage and in the case of co-transfection of E. coli cells with the help of the M13K07 helper phage, it can be packed into phage particles. Between the sequences encoding the embeddable single-chain antibody and the p13 protein of bacteriophage M13K07, there is a TAG stop codon, which is translated as glutamic acid residue in supE strains of E. coli, therefore the pHEN2 phagemid provides a rather high level of expression of single-chain antibody genes in supE strains of E. coli in the composition of the chimeric protein with the envelope protein pIII of the bacteriophage M13K07. When complementing in the absence of an assistant phage, one copy of the recombinant protein will be included in the phage particle, which does not affect the infectivity of the latter. In addition, during the transformation of non-suppressor strains of E. coli, this phagemid allows the production of secreted antibodies in the form of individual molecules, without a shell protein.

DNA fragments encoding single chain antibodies and pHEN2 phagemid DNA are treated with SfiI and NotI restriction endonucleases and combined in a ligation reaction using T4 phage DNA ligase. The result is a collection of phagemid DNAs, each of which contains, under the control of the lactose operon promoter, a unique single-chain human antibody gene in the composition of a chimeric protein with envelope protein pIII of bacteriophage M13K07.

The recombinant phagemid DNA pHEN-2A8 obtained from the described phagemid collection contains the unique gene of a single-chain human antibody capable of neutralizing orthopoxviruses (vaccinia virus and vaccinia virus of cows), characterized by the following features:

- has a molecular weight of 3.46 MDa and a size of 5258 bp .;

- Unique recognition sites by restriction endonucleases having the following coordinates: HindIII-235, SfiI-328, NotI-1091, EcoRI-2382.

- contains an artificial single-chain human antibody gene obtained by genetic engineering methods, which, under the control of the lactose operon promoter in E. coli cells, synthesizes a single-chain human antibody as a part of a chimeric protein with envelope protein p3 of phage M13K07, capable of neutralizing orthopoxviruses;

consists of the following elements:

- SfiI / NotI, a 4495 bp phagemid pHEN2 vector fragment (MRC, UK) containing the Lac promoter, the E. coli operon, E. coli ori, phage M 13 ori, the TAG suppressible stop codon, protein gene fragment pIII phage M 13, β-lactamase gene (bla);

- SfiI / NotI - fragment size of 763 bp, including the artificial gene of a single-chain human antibody capable of neutralizing orthopoxviruses, in which the variable domain of the heavy chain is connected to the variable domain of the light chain of the human immunoglobulin using a DNA sequence encoding a flexible peptide linker Ser (Gly ₄ Ser) ₂ AlaArgGlySerGly ₄ Ser, and having the nucleotide sequence shown in Fig.6;

contains:

- Lac promoter - E. coli operon;

- genetic marker: β-lactamase (bla) gene, which determines the resistance of ampicillin to bacterial cells transformed with the phagemid pHEN-2A8;

- Unique recognition sites by restriction endonucleases having the following coordinates: HindIII-235, SfiI-328, NotI-1091, EcoRI-2382.

The phagemid pHEN-2A8 is shown in FIG. 2.

The obtained phagemid collection was used to transform cells of the suppressor strain of E. coli TG1 using the BIORAD Gene Pulser ™ electroporator. Transformed cells are plated on 2 × YT agar medium containing 100 μg / ml ampicillin and 1.5% glucose and grown at 30 ° C. overnight. The grown cells are harvested and stored in 2 × YT medium containing 30% glycerol at -70 ° C. The resulting cell population is the target library of human single chain antibodies.

To obtain antibodies against orthopoxviruses, for example, vaccinia virus, affinity enrichment of the library with specific clones is carried out using vaccinia virus as an antigen, followed by selection of individual clones capable of producing bacteriophages that display single-chain human antibodies against vaccinia virus on their surface.

To do this, an aliquot of transformed cells is thawed, grown to a mid log phase and infected with helper phage M13K07, and a population of filamentous bacteriophages is obtained, each of which exhibits on its surface a unique single-chain human antibody in the form of a chimeric protein with envelope protein pIII of phage M13K07.

The affinity enrichment of the library is carried out in three consecutive rounds. To carry out a round of enrichment, vaccinia virus (Elstree strain) is sorbed in the wells of a polystyrene plate at a concentration of 100 μg / ml. At the end of sorption, the sites of non-specific binding are saturated with a 5% solution of skimmed milk powder, after which an aliquot (10 ¹¹ PFU) of the library is added to each well as a collection of filamentous bacteriophages. Non-specifically bound phage particles are removed by washing, and phages carrying single chain antibodies capable of binding to the vaccinia virus are eluted with antigen solution and triethylamine solution. The resulting eluates infect the culture of E. coli TG1 cells in an exponential growth stage to amplify the eluted phage antibodies.

The second and third rounds of affinity enrichment are carried out similarly. In this case, the concentration of vaccinia virus is reduced to 50 and 20 μg / ml, respectively. The degree of enrichment of the library with antibodies specific for the vaccinia virus is checked using indirect enzyme-linked immunosorbent assay (TIFA) for the ability of populations of phage antibodies obtained from each round of affinity enrichment to bind the vaccinia virus (Fig. 3). In this case, phage antibodies are isolated as described in Example 6. As a negative control, the binding of phage antibody populations to skimmed milk powder is used.

Next, from a population of phage antibodies enriched against vaccinia virus, monoclonal phage antibodies specifically binding the vaccinia virus are selected using TIFA. The vaccinia virus is adsorbed onto 96-well immunological plates (Medpolymer, Russia) at a concentration of 3 μg / ml. Non-specific binding sites are blocked with a solution of 3% bovine serum albumin (BSA, Sigma, USA) in phosphate buffer, pH 7.2. Then, phage antibodies isolated as described in Example 6, diluted in PBS with a buffer containing 0.1% Tween, were added to the wells and incubated for 1 hour at 37 ° C. After washing, polyclonal anti-M13 mouse antibodies were added to the wells at a dilution of 1: 2000, and then an antispecific alkaline phosphatase conjugate (Sigma, USA) at a dilution of 1: 4000. Paranitrophenyl phosphate is used as a chromogen. The control of nonspecific binding is the binding of the virus to the phage helper M13K07, which does not carry antibody fragments on its surface. As a negative control, the binding of phage antibodies to BSA is used. Clones that showed a signal whose value is 3 or more times greater than the non-specific binding control and the negative control are selected as positive.

Selected phage antibodies are isolated and tested using TIFA by serial dilution of the antigen or antibody. Moreover, as antigens for a more complete characterization of the studied antibodies, in addition to the vaccinia virus, other orthopoxviruses, for example, the vaccinia virus of cows (Fig. 4), can be used.

A standard virus-neutralizing activity assay is carried out for all phage antibodies specifically binding the vaccinia virus. During this assay, the ability to inhibit plaque formation by the vaccinia virus and cow pox viruses on the monolayer of Vero E6 cells is tested. As a negative control, the bacteriophage helper M13K07 is used, which does not carry a single chain antibody on its surface. The ability to neutralize viral infectivity is assessed by the neutralization titer, which is defined as the dilution of phage antibodies, showing a decrease in the number of viral plaques by at least 50% (figure 5).

Next, the determination of the nucleotide sequences of genes encoding single-chain antibodies that neutralize viral infectivity is carried out. For amplification of Vh and Vl fragments, phagemid DNAs isolated by alkaline lysis [9] and oligonucleotide primers: LMB 5'-CAGGAAACAGTCATGAC, pHEN-SEQ 5'-CTATGGGGCCCCATTCA are used as a template. Amplification is carried out by PCR using Taq and Vent DNA polymerases at annealing temperature of LMB primers and pHEN-SEQ of 55 ° C.

The nucleotide sequences of the purified Vh and Vl fragments are determined in both directions using the CEQ ™ 2000XL DNA Analysis System ("Beckman") and the "F" CEQ DTCS Kit. Nucleotide and deduced amino acid sequences are analyzed using IgBLAST and V-base databases. Figure 6 shows the nucleotide sequence of a unique single-chain human antibody gene having virus-neutralizing activity against vaccinia virus and vaccinia virus of cows, as well as the amino acid sequence of this recombinant antibody 2A8.

The invention consists in the following:

- an immune combinatorial phage library of human single-chain antibodies was constructed based on genes encoding the variable domains of human immunoglobulins vaccinated with vaccinia virus;

- from the obtained immune phage library, pHEN-2A8 phagmid DNA containing a unique gene of a single-chain human antibody capable of neutralizing orthopoxviruses (vaccinia virus and smallpox virus) was selected;

- isolated phage single-chain antibody 2A8, exposed on the surface of the filamentous bacteriophage M13K07 as part of the envelope protein p3, capable of neutralizing orthopoxviruses (vaccinia virus and cow pox virus).

The invention is illustrated by the following figures:

Figure 1. Scheme for the construction of DNA fragments encoding single-chain human antibodies. The diagram shows: the genes of the variable domains of the heavy (Vh) and light (Vl) chains of immunoglobulins; restriction endonucleases ApaLI, SfiI, and NotI; annealing sites for LinkApaLI primers, 23-26, 27-29, 30-36, 37-44.

Figure 2. Scheme of the pHEN-2A8 phagemid containing the single-chain antibody gene 2A8. The sites for restriction endonucleases HindIII, SfiI, ApaLI, NotI and EcoRI are indicated; lactose operon promoter P lac Z; RBS ribosome landing site; genes of the variable domains of the heavy (Vh) and light (Vl) chains of immunoglobulins, suppressed stop codon amber TAG; pIII protein gene fragment; ori replication ColE1; ori phage M13; ampicillin resistance gene Ap ^r .

Figure 3. Binding of phage antibody populations after rounds of selection to smallpox vaccine virus (BOB).

Figure 4. The binding of phage single chain antibodies 2A8 with various orthopoxviruses in successive dilutions of antigens (A) and antibodies (B). Designations: BOB - vaccinia virus, WOK - smallpox virus in cows.

Figure 5. Neutralization of vaccinia and smallpox viruses infectiousness by phage single-chain antibody 2A8 (row 1, 3) and helper phage M13K07 (row 2, 4). Designations: BOB - vaccinia virus; WOK - cowpox virus.

6. The nucleotide and its corresponding amino acid sequence of single-chain human antibodies 2A8.

For a better understanding of the invention, the following are examples of its specific implementation.

Example 1. Isolation of mononuclear cells from the peripheral blood of donors immunized with vaccinia virus.

In the selection process, the blood is immediately mixed with an anticoagulant and then diluted with an equal volume of PBS. Lymphocytes from peripheral blood are isolated by centrifugation in a density gradient ficol-triombrast prepared by mixing a 9% solution of ficol and a 32.8% solution of triombrust in a volume ratio of 24 to 10, respectively. The density of the resulting solution is 1.077 g / cm. Next, a blood solution is layered on a solution of ficol-triombrast in a volume ratio of 3: 1 and then centrifuged at 1500 g for 30 minutes. Interphase mononuclear cells are harvested and washed several times with sterile PBS. The cell pellet is lysed in a solution of the following composition: 4M guanidine isothiocyanate, 50 mM Tris-HCl, pH 7.6, 10 mM EDTA, 2% sodium lauryl sarcosylate, 1% β-mercaptoethanol.

Example 2. Isolation of RNA from a peripheral blood lymphocyte lysate and cDNA synthesis.

Total RNA was isolated from cell lysate using TRIzol reagent (Sigma, USA). For this, 1 ml of TRIzol is added to 200 μl of lysed cell pellet and stirred for 30 min at 30 ° C. Then, 100 μl of chloroform was added to the lysate, shaken vigorously and incubated at -40 ° C for 20 minutes. Then the suspension is centrifuged for 5 min at 10,000 g, 4 ° C. The aqueous phase is transferred to a clean tube with 5 μl of 10% dextran, without capturing the interphase. 600 μl of isopropanol are added to the same tube, stirred and left for 30 min at -20 ° C. After that, the mixture is centrifuged for 30 min at 12000 g, the aqueous phase is taken, mixed with 400 μl of cold 70% ethanol and centrifuged for 5 min at 12000 g, 4 ° C. After removing the supernatant from the tube, the precipitate is dried, dissolved in 30 μl of water and used as a template for cDNA synthesis.

The cDNA synthesis is carried out in a volume of 25 μl. For this, 3-5 μg of RNA is mixed with the required amount of DEPC-treated water, 800 ng of randomized hexaoligonucleotides and the same amount of oligo-dT are added. The resulting mixture was incubated for 10 min at 65 ° C, then transferred to ice, and 0.5 μl of RNAzin, 0.8 μl of 25 mM dNTP and 2.5 μl of ten-fold reverse transcription buffer containing 50 mM Tris-HCl pH 8 were added. 3, 3 mM MgCl ₂ , 75 mM KCl, 10 mM DTT. The mixture is incubated for 3-5 min at 25 ° C, 200 units of M-MuLV reverse transcriptase are added and incubated for another 5 min at 25 ° C, and then 5 min at 37 ° C, 60 min at 42 ° C and 10 min at 70 ° FROM. After this, the reaction mixture was cooled on ice, diluted to 80 μl and stored at -70 ° C before further use.

Example 3. The synthesis of DNA fragments encoding the variable domains of the heavy and light chains of human immunoglobulins.

The synthesis of DNA fragments encoding the variable domains of immunoglobulins is carried out using primers 1-4 and 5-7 in the case of heavy chains, and 8-15 and 16-22 in the case of light chains (primer sequences are given above). The 100 μl reaction mixture contains 15 pmol of the indicated primers, 0.01% BSA, 2.5 mM MgCl ₂ , dNTP mixture (0.25 mM each), 20 mM Tris-HCl pH 8.8, 10 mM KCl, 10 mm (NH ₄ ) ₂ SO ₄ , 2 mm MgCl ₂ , 0.1% Triton X-100, 5 μl of diluted cDNA solution and 1 unit. Act. DNA polymerases Taq and Vent. In total, 25 cycles of PCR are carried out according to the scheme: 94 ° C / 1 min, 55 ° C / 35 sec, 72 ° C / 50 sec. Amplification products are analyzed on a 1.5% agarose gel. In the case of Vh chains, a strip of about 340 bp, and in the case of Vl chains, a strip of about 325 bp. cut out and extracted from the gel.

Example 4. The combination of cDNA fragments encoding the variable domains of the heavy and light chains of human immunoglobulins, in the genes of single-chain antibodies.

a) The completion of the linker sequence by DNA fragments encoding the N-ends of the Vh domains of immunoglobulins.

A 50 μl PCR reaction mixture contains 15 pmol of primers 23-26 and 15 pmol of linkApaLI primer, 0.01% BSA, 2.5 mM MgCl ₂ , dNTP mixture (no 0.25 mM each), 20 mM Tris-HCl pH 8.8, 10 mM KCl, 10 mM (NH ₄ ) ₂ SO ₄ , 2 mM MgCl ₂ , 0.1% Triton X-100 and 1 unit. Act. DNA polymerases Taq and Vent. In total, 5 cycles are carried out according to the scheme: 94 ° C / 1 min, 56 ° C / 30 sec, 72 ° C / 50 sec, then another 20 cycles according to the scheme 94 ° C / 1 min, 68 ° C / 20 sec, 72 ° C / 60 sec. Amplification product about 100 bp in size cut out and extracted from 1.5% agarose gel.

b) Association of DNA fragments encoding Vh domains with a linker sequence.

A 25 μl reaction mixture contains 100 ng DNA fragments encoding the Vh domains and a complete linker, 0.01% BSA, 2.5 mM MgCl ₂ , dNTP mixture (0.25 mM each), 20 mM Tris-HCl pH 8.8, 10 mM KCl, 10 mM (NH ₄ ) ₂ SO ₄ , 2 mM MgCl ₂ , 0.1% Triton X-100 and 0.5 units. Act. DNA polymerases Taq and Vent. A total of 15 cycles of PCR are carried out according to the scheme: 94 ° C / 1 min, 57 ° C / 2 min, 72 ° C / 1 min.

c) Amplification of DNA fragments encoding the Vh domains with a linker, with the introduction of the site for the restriction endonuclease SfiI, necessary for further cloning.

The reaction mixture for PCR with a volume of 50 μl contains 15 pmol of primers 27-29 and 15 pmol of linkApaLI primer, dNTP mixture (0.25 mm each), 20 mm Tris-HCl pH 8.8, 10 mm KCl, 10 mm (NH ₄ ) ₂ SO ₄ , 2 mm MgCl ₂ , 0.1% Triton X-100 and 1 unit. Act. DNA polymerases Taq and Vent. Heated to 94 ° C, the reaction mixture was added 5 μl from a PCR mixture in which the Vh domain and the linker were combined. In total, 5 cycles are carried out according to the scheme: 94 ° C / 1 min, 57 ° C / 30 sec, 72 ° C / 55 sec, and then another 15 cycles according to the scheme: 94 ° C / 1 min, 68 ° C / 20 sec, 72 ° C / 50 sec. The amplification product was analyzed on a 1.5% agarose gel. A fragment about 460 bp in size. cut out and extracted from the gel.

d) Completion of the linker sequence by DNA fragments encoding the N-ends of the Vl domains of immunoglobulins.

The linker, previously completed with DNA fragments encoding the C-ends of the Vh domains, is extended by sequences encoding the N-ends of the Vl domains of immunoglobulins by PCR. For this, primers 23-26 and 30-36 are used. The reaction mixture with a volume of 50 μl contains 15 pmol of the indicated primers, dNTP mixture (0.25 mM each), 20 mM Tris-HCl pH 8.8, 10 mM KCl, 10 mM (NH ₄ ) ₂ SO ₄ , 2 mM MgCl ₂ , 0.1% Triton X-100 and 1 unit. Act. DNA polymerases Taq and Vent. In total, 5 cycles of PCR are carried out according to the scheme: 94 ° C / 1 min, 56 ° C / 30 sec, 72 ° C / 50 sec, and then another 20 cycles according to the scheme 94 ° C / 1 min, 68 ° C / 20 sec, 72 ° C / 60 sec. Amplification product about 100 bp in size cut out and extracted from 1.5% agarose gel.

e) Combining DNA fragments encoding the Vl domains with an extended linker sequence.

The reaction mixture for PCR with a volume of 25 μl contains 100 ng Vl chains and a linker, 0.01% BSA, 2.5 mm MgCl ₂ , dNTP mixture (0.25 mm each), 20 mm Tris-HCl pH 8.8, 10 mm KCl, 10 mm (NH ₄ ) ₂ SO ₄ , 2 mm MgCl ₂ , 0.1% Triton X-100 and 0.5 units. Act. DNA polymerases Taq and Vent. A total of 15 cycles are carried out according to the scheme: 94 ° C / 1 min, 57 ° C / 2 min, 72 ° C / 1 min.

f) Amplification of DNA fragments encoding the Vl domains with a linker, with the introduction of the site for NotI restriction endonuclease, necessary for further cloning.

Amplification of a DNA fragment encoding Vl with a linker is carried out using primers 23-26 and primers 37-44. The reaction mixture for PCR with a volume of 50 μl contains 15 pmol of the indicated primers, dNTP mixture (no 0.25 mM each), 20 mM Tris-HCl pH 8.8.10 mM KCl, 10 mM (NH ₄ ) ₂ SO ₄ , 2 mM MgCl ₂ , 0.1% Triton X-100 and 1 unit. Act. DNA polymerases Taq and Vent. 5 μl of a PCR mixture containing DNA fragments encoding Vl domains combined with an extended linker sequence is added to a reaction mixture heated to 94 ° C. In total, 5 cycles are carried out according to the scheme: 94 ° C / 1 min, 57 ° C / 30 sec, 72 ° C / 55 sec, and then another 15 cycles according to the scheme: 94 ° C / 1 min, 68 ° C / 20 sec, 72 ° C / 50 sec. The amplification product was analyzed on a 1.5% agarose gel. A fragment of about 450 bp cut out and extracted from the gel.

g) Combining DNA constructs "Vh-linker" and "Vl-linker" in a single DNA sequence encoding single-chain antibodies.

0.5 μg of the Vh and Vl fragments combined with the linker are treated with the restriction endonuclease ApaLI for 1 hour at 37 ° C. After restriction is complete, the mixture is heated for 10 min at 70 ° C and EDTA up to 15 mM is added. Then the DNA fragments are purified using silica gel. To this end, 3-4 volumes of buffer containing 6 M guanidine isothiocinate, 150 mM NaAc pH 5.5 and 0.5% Triton X-100 are added to the restriction mixture. Then, isopropanol is added to the resulting solution (0.5-1 volume from the initial volume of the restriction mixture) and 10-15 μl of silica gel (SiO _{2 is} pre-soaked in 1-2 M HCl for several hours, then washed with water to a neutral pH, moreover , the ratio of the volume of sediment SiO ₂ to the aqueous phase is approximately 2: 1). The resulting mixture was incubated for 10 min at room temperature while shaking, then centrifuged for 30 sec at 11 thousand g. The supernatant is removed and the precipitate is washed twice with a buffer containing 80% ethanol, 10 mM Tris HCl pH 7.6 and 1 mM EDTA, then centrifuged for 30 sec at 11 thousand g. After removal of the supernatant, the precipitate was dried and an elution buffer containing 10 mM Tris HCl pH 8.8 was added. The resulting mixture was incubated for 5-10 min at 42 ° C, stirring every two minutes, then centrifuged for 5 min at 12 thousand g and the supernatant containing DNA was collected without capturing the precipitate.

The DNA fragments thus purified are combined using a ligation reaction in a volume of 40 μl using T4 phage DNA ligase under standard conditions. Then the obtained DNA fragments encoding 27-29 and 37-44. The PCR reaction mixture contains 15 pmol of the indicated primers dNTP mixture (0.25 mM each), 20 mM Tris-HCl pH 8.8, 10 mM KCl, 10 mM (NH ₄ ) ₂ SO ₄ , 2 mM MgCl ₂ , 0.1% Triton X-100 and 1 unit. Act. DNA polymerases Taq and Vent. 3 μl of the ligase mixture is added to the PCR mixture heated to 94 ° C and 20 PCR cycles are carried out according to the scheme: 94 ° C / 1 min, 56 ° C / 30 sec, 72 ° C / 1 min 10 sec. The amplification product was analyzed on a 1.5% agarose gel, fragment about 800 bp in size. cut out and extracted from the gel.

Example 5. Cloning of genes encoding single-chain human antibodies in the pHEN2 phagemid.

The obtained set of DNA fragments encoding single-chain antibodies, as well as 10 μg of pHEN2 phagemid DNA, were treated with restriction endonucleases SfiI and NotI, and then they were purified using silica gel as described in Example 4 (g).

Treated with the indicated restriction endonucleases, DNA fragments encoding single chain antibodies and pHEN2 phagemid DNA are combined in a ligation reaction in the ratio of 100 ng to 200 ng, respectively. A total of 4 such reactions are carried out under standard conditions using T4 phage DNA ligase; each reaction is carried out in a volume of 25 μl.

5 μl of the ligase mixture is used to transform competent cells of the suppressor strain of E. coli TG1 using the BIORAD Gene Pulser electroporator (BIORAD, USA). A total of 20 electroporations are performed. Transformed cells are plated on 2 × YT agar medium containing 100 μg / ml ampicillin and 1.5% glucose and grown at 30 ° C. overnight. The grown cells are harvested and stored in 2 × YT medium containing 30% glycerol at -70 ° C. The resulting population of cells, each of which contains a unique phagemid, is a cell variant of the immune phagemid library of single-chain human antibodies.

To determine the number of independent transformants, ten-fold dilutions of an aliquot of a suspension of transformed cells are seeded. The total number of independent transformants is 3 · 10 ⁷ , which is the calculated title of the library.

To test the quality of the library, the phagemid DNAs of 50 clones are analyzed for the presence of inserts encoding single chain antibodies. 48 out of 50 phagemid DNAs contain inserts; therefore, at least 95% of the library clones contain a DNA fragment encoding a single-chain antibody (evaluation criterion χ ² ).

Fagmid DNA is isolated from several clones by alkaline lysis [7]. The DNA structures of the resulting phagemids are analyzed by restriction endonucleases HindIII, SfiI, ApaLI, NotI and EcoRI.

Example 6. Obtaining a population of filamentous bacteriophages, each of which exhibits on its surface a unique single-chain human antibody in the form of a chimeric protein with envelope protein p3 of phage M13K07.

An aliquot of the cell version of the resulting human single chain antibody library containing about 10 ¹⁰ clones (25 μl) was inoculated in 50 ml of 2 × YT medium containing 100 μg / ml ampicillin and 1% glucose, and grown with constant stirring at 37 ° C to OD ₆₀₀ = 0.5. After that, the resulting culture is infected with helper phage M13K07 (Pharmacia Biotech, Sweden), adding it in a ratio of 1:20 (number of bacterial cells: number of phage particles), and incubated for 30 min at 37 ° C. Then 20 ml of the culture precipitated by centrifugation for 10 min at 3300 g. The pellet was resuspended in 10 ml of 2 × YT containing 100 μg / ml of ampicillin and 25 μg / ml of kanamycin, and the suspension was transferred in 200 ml of 2 × YT containing 100 μg / ml of ampicillin and 25 μg / ml kanamycin. The culture is incubated overnight with constant stirring at 30 ° C. The next day, E. coli cells were pelleted by centrifugation at 10,800 g for 10 min in a Beckman J2-21 centrifuge, 1/5 of the PEG / NaCl solution (20% PEG6000 and 2.5 M NaCl) was added to the supernatant, mixed well and incubated for 1 h on ice. After that, the suspension is centrifuged at 10,800 g for 30 minutes. The resulting precipitate was dissolved in 40 ml of pH 7.2 phosphate-buffered saline (PBS) and 8 ml of PEG / NaCl solution added, incubated in ice for at least 20 minutes and bacteriophages were precipitated in a Beckman J2-21 centrifuge at 3300 g 30 minutes. The supernatant, along with the PEG / NaCl residues, was carefully removed and the pellet resuspended in 2 ml of sterile PBS. To remove residual bacterial cells, the phage suspension is centrifuged at 3300 g for 10 minutes. The output of phage particles is approximately 10 ¹² -10 ¹³ plaque forming units (PFU).

Example 7. Affinity enrichment of the resulting library with phage antibodies specific for vaccinia virus.

The affinity enrichment of the library is carried out in three consecutive rounds. To conduct the first round of selection in the wells of a 96-well plate (Medpolymer, Russia), the vaccinia virus was sorbed at a concentration of 100 μg / ml in PBS and incubated overnight at room temperature. The next day after removal of the antigen, the wells are washed three times with PBS and the nonspecific binding sites are saturated with a 5% solution of skimmed milk powder in PBS buffer for 2 hours at 37 ° C. In addition, a 5% skimmed milk powder solution is sorbed into additional wells as a negative control. After this, the wells were washed three times with PBS and 10 ¹¹ PFU of phage library in 100 μl of PBS solution with 0.1% Tween-20 was added to each well. The plates are incubated for 1.5 hours with constant stirring at 37 ° C, after which the wells of the plate are washed 20 times with a solution of PBS with 0.1% Tween-20, and then 20 times with PBS.

Elution of bound bacteriophages is carried out using antigen. For this, 100 μl of a suspension of vaccinia virus in PBS at a concentration of 100 μg / ml are added to the wells and incubated for 30 minutes at 37 ° C with stirring. For additional phage elution, 100 μl of 100 mM triethylamine are added to the wells, stirred for 2–3 minutes, and the eluted phages are transferred to 350 μl of 1M Tris-HCl, pH 7.4.

To obtain a phage repertoire, an exponential growth E. coli TG1 cell culture (10 ml for each eluate) is infected with the obtained phage eluates (400 μl), incubated for 30 min at 37 ° C, then centrifuged for 10 min at 3000 g. Precipitation was resuspended in 1 ml of 2 × YT and plated on plates with agar medium 2 × YT containing 100 μg / ml ampicillin and 1% glucose. The plates are incubated overnight at 30 ° C. The grown cells are harvested and stored in 2 × YT medium containing 30% glycerol at -70 ° C.

Amplification of bacteriophages selected after the first round is carried out as described in Example 6 using the combined glycerol effluents from both elutions.

The second and third rounds of affinity enrichment are carried out similarly. In this case, the concentration of vaccinia virus is reduced to 50 and 20 μg / ml, respectively.

The degree of enrichment of the library with antibodies specific for the vaccinia virus is checked using indirect TIFA according to the ability of the phage antibody populations obtained from each round of affinity enrichment to bind the vaccinia virus (Fig. 3). For this, the vaccinia virus is adsorbed onto 96-well immunological plates (Medpolymer, Russia) in an amount of 300 ng per well. Non-specific binding sites are blocked with a solution of 3% BSA (Sigma, USA) in phosphate buffer, pH 7.2. Then, phage antibodies isolated as described in Example 6, diluted in PBS with a buffer containing 0.1% Tween, are added to the wells and incubated for 1 hour at 37 ° C. After washing, anti-M13 mouse serum was added to the wells at a dilution of 1: 2000, and then an antispecific alkaline phosphatase conjugate (Sigma, USA) at a dilution of 1: 4000. Paranitrophenyl phosphate is used as a chromogen. As a negative control, the binding of phage antibodies to skim milk is used. The results are shown in figure 3.

Example 8. The selection of clones capable of producing antibodies that bind the vaccinia virus.

To obtain monoclonal phage antibodies, individual E. coli TG1 colonies from the virus-enriched vaccinia virus vaccine are transferred from agar medium to 2 × YT liquid medium containing 100 μg / ml ampicillin and 1% glucose and grown to a density of 0.5 at OD ₆₀₀ . Then the cells are infected with helper phage M13K07, precipitated by centrifugation of 3300 g, 10 min, and the cell pellet is resuspended in a medium containing 100 μg / ml ampicillin and 50 μg / ml kanamycin. Cells were cultured at 30 ° C with stirring overnight and then pelleted by centrifugation at 10,800 g, 10 min.

The supernatant containing phage antibodies is tested for the ability to bind to the vaccinia virus by ELISA. The vaccinia virus is sorbed into the wells of 96-well immunological plates (Medpolymer, Russia) at a concentration of 3 μg / ml. Non-specific binding sites are blocked with a solution of 3% BSA (Sigma, USA) in phosphate buffer, pH 7.2. Then, supernatants diluted in PBS with a buffer containing 0.1% Tween in a volume ratio of 1: 1 were added to the wells and incubated for 1 hour at 37 ° C. After washing, anti-M13K07 mouse serum was introduced into the wells at a dilution of 1: 2000, and then an antispecific alkaline phosphatase conjugate (Sigma, USA) at a dilution of 1: 4000. Paranitrophenyl phosphate is used as a chromogen. The control of nonspecific binding is the binding of the virus to the phage helper M13K07, which does not carry antibody fragments on its surface. As a negative control, the binding of phage antibodies to BSA is used. The results are shown in figure 4

Subsequently, phage antibodies were isolated from supernatants that showed a signal whose value was 3 or more times greater than the non-specific binding control and the negative control by precipitation with PEG / NaCl solution and subsequent centrifugation, as described in Example 6.

Example 9. Enzyme-linked immunosorbent assay binding of phage antibodies 2A8 with vaccinia virus and smallpox virus in cows.

a) TIFA in serial dilution of antigen.

Serial dilutions of vaccinia virus and cowpox virus, starting from 300 ng per well, are sorbed into wells of 96-well immunological plates in 1: 5 increments (Medpolymer, Russia). Non-specific binding sites are blocked with a solution of 3% BSA (Sigma, USA) in phosphate buffer, pH 7.2. Then, phage particles carrying the 2A8 antibody on their surface in the amount of 10 ¹⁰ PFU per well in PBS buffer containing 0.1% Tween are added to the wells and incubated for 1 hour at 37 ° C. After washing, polyclonal anti-M13K07 rabbit antibodies at a dilution of 1: 12000 and then an antispecific alkaline phosphatase conjugate (Sigma, USA) at a dilution of 1: 4000 were added to the wells. Paranitrophenyl phosphate is used as a chromogen.

b) TIFA in serial dilution of antibodies.

The vaccinia virus and cowpox virus are sorbed into the wells of 96-well immunological plates (Medpolymer, Russia) at a concentration of 300 ng per well. Non-specific binding sites are blocked with a solution of 3% BSA (Sigma, USA) in phosphate buffer, pH 7.2. Then serial dilutions of phage antibody 2A8 are added to the wells in PBS buffer (step 1: 5), starting at 10 ¹⁰ PFU per well containing 0.1% Tween, and incubated for 1 hour at 37 ° C. After washing, anti-M13K07 mouse serum was introduced into the wells at a dilution of 1: 2000, and then an antispecific alkaline phosphatase conjugate (Sigma, USA) at a dilution of 1: 4000. Paranitrophenyl phosphate is used as a chromogen. As a negative control, the binding of phage antibodies to BSA is used.

The experimental results are shown in figure 4

Example 10. The study of the neutralizing activity of phage antibodies 2A8.

The virus suspension is diluted to about 50 PFU per well and mixed with an equal volume of phage antibodies of the appropriate dilution. Antibodies are sequentially diluted in PBS buffer in 1: 5 increments starting from a concentration of 10 ¹² phage particles. The mixture is incubated at 37 ° C for 1 hour. Aliquots of each mixture were applied to a monolayer of Vero E6 cells in 24-well plates at 37 ° C for 1 hour, then washed off. Then the wells are covered with MEM medium containing 2% FBS and 0.24% agarose. Viable cells are stained 3-4 days after infection, visualizing plaques. The bacteriophage helper M13K07, which does not carry a single chain antibody on its surface, is used as a negative control. The neutralization titer is defined as the dilution of phage antibodies, in which there is a 50% reduction in the number of plaques.

The results are shown in figure 5

Information sources

1. Fenner F., Wittek R., Dumbel K. The Orthopoxviruses. San Diego, New York, Berkeley, Boston, London, Sydney, Tokyo, Toronto: Academic Press, Inc. 1989.

2. O'Connell D, Becerril B, Roy-Burman A, Daws M, Marks JD. Phage versus phagemid libraries for generation of human monoclonal antibodies. J Mol Biol. 2002 321 (1): 49-56.

3. A A den Broeder, LAB Joosten, T Saxne, D Heinegard, H Fenner, A M M Miltenburg, W L H Frasa, L J van Tits, W A Buurman, P L C M van Riel, L B A van de Putte and P Barrera. Long term anti-tumor necrosis factor omionotherapy in rheumatoid arthritis: effect on radiological course and prognostic value of markers of cartilage turnover and endothelial activation. Annals of the Rheumatic Diseases. 2002, 61: 311-318

4. Hoogenboom H.R. and Winter G. By-passing immunization: Human antibodies from synthetic repertoires of germline VH gene segments rearranged in vitro // J. Mol. Biol. - 1992 .-- Vol.227. - P.381-388.

5. US patent No. 6265169, CL. C 12 Q 1/68, publ. 2001 year

6.C.Schmaijohn, Y. Cul, S. Kerby, D. Pennok, K.Spik.// Virology, 1999, v. 288, p. 189-200.

7. Huston J.S., Mudgett-Hunter M., Nai M.S., McCartney J., Warren F., Haber E., Opperman H. Protein engineering of single-chain Fv analogs and fusion proneins.// Meth. Enzymology. 1990. v.203. p. 46-89.

8. Kay B.K., Winter J., MacCafferty, J., Phage display of peptides and proteins: a laboratory manual.// antibodies: filamentous phage displaying antibody variable domains.// Academic Press, Inc. 1996.

9. Bimboim H.C. and Doly J. A rapid aikalin extraction procedure for screening recombinant plasmid DNA.// Nucl. Acids Res. 1979.v.7. p.1513-1523.

Claims (3)

1. A combinatorial library of phagemids encoding single-chain human antibodies against vaccinia virus, which is E. coli TG1 cells, each of which contains recombinant phagemid DNA, which provides biosynthesis of filamentous bacteriophages, exposing a unique single-chain human antibody on its surface, which is a chimeric protein with a shell protein pIII of filamentous bacteriophage M13, constructed by randomly combining in vitro as a part of recombinant phagemid DNA variable domains is heavy x chains with variable domains of the light chains of immunoglobulins, the genes of which are obtained on the basis of mRNA from peripheral blood lymphocytes of people immunized with the vaccinia virus. 2. Recombinant phagmid DNA pHEN-2A8, selected from the combinatorial phagemid library according to claim 1, containing a unique single-chain human antibody gene capable of neutralizing vaccinia virus and vaccinia virus of cows, is characterized by the following features: has a molecular weight of 3.46 MDa and a size of 5258 bp; contains a gene of human single-chain antibody obtained by genetic engineering methods, which, under the control of the lactose operon promoter in E. coli cells, synthesizes a single-chain human antibody as part of a chimeric protein with envelope protein p3 of phage M13K07, capable of neutralizing vaccinia virus and smallpox virus in cows; consists of the following elements: 4495 bp SfiI / NotI - vector fragment of the pHEN2 phagemid (MRC, UK) containing the Lac promoter - the E. coli operon, E. coli ori, ori phage M 13, the suppressed TAG stop codon, the gene fragment of the pIII phage protein M 13, β-lactamase (bla) gene; SfiI / NotI, a 763 bp fragment containing the artificial gene of a single chain human antibody capable of neutralizing smallpox vaccine virus and smallpox virus, in which the variable domain of the heavy chain is connected to the variable domain of the human immunoglobulin light chain using a DNA sequence encoding a flexible peptide linker Ser (Gly ₄ Ser) ₂ AlaArgGlySerGly ₄ Ser, and having the nucleotide sequence shown in Fig.6; contains promoter of the Lac operon of E. coli; genetic marker: β-lactamase (bla) gene, which determines the resistance of ampicillin to bacterial cells transformed with the phagemid pHEN-2A8; unique recognition sites of restriction endonucleases having the following coordinates: HindIII-235, SfiI-328, NotI-1091, EcoRI-2382. 3. The method of obtaining artificial single-chain human antibodies 2A8 having the amino acid sequence shown in Fig.6 and capable of neutralizing vaccinia virus and smallpox virus of cows, which consists in the fact that E. coli TG1 cells carrying the pHEN-2A8 fagmid DNA according to claim 2 are transfected with helper phage M13K07, resulting in filamentous bacteriophages that express target antibodies on their surface.

Images