RU2247781C2 - Method for assay of mononucleotide changes in known nucleic acid sequences - Google Patents

Abstract

FIELD: molecular biology, medicine, biochemistry.

SUBSTANCE: invention proposes a method for assay of mononucleotide changes in the known sequences of nucleic acids. Method involves hybridization with PCR-amplified matrix DNA and the following ligation a tandem on its consisting of tetranucleotide that comprises the diagnosed change and two oligonucleotides of the size 8-10 nucleotides being one of that is immobilized on surface of a solid-phase carrier through a 5'-phosphate linker, and the second oligonucleotide is labeled by 3'-end with biotin label. Then tetranucleotide is hybridized with the matrix DNA chain between two oligonucleotides directly that can be ligated with immobilized oligonucleotide through the 5'-end and with non-immobilized oligonucleotide through the 3'-end. The ligation product is detected by its transformation to enzyme label through the complex with high-affinity enzymatic catalyst followed by development of enzyme label in the presence of chromogenic, luminogenic or fluorogenic substrates. Applying a method provides preparing the simple and highly selective agent used for detection of known changes in gene structure.

EFFECT: improved assay method.

8 cl, 3 dwg, 30 ex

Description

The invention relates to molecular biology, in particular to the development of tests for the detection of known changes in the structure of genes, and can be used for: gene diagnostics, including prenatal, known hereditary diseases; genotyping of known single nucleotide polymorphisms (SNPs); genotyping of viruses and other microorganisms; sequencing-specific identification of PCR DNA fragments.

Currently, to determine single nucleotide substitutions, there are a number of methods that can be divided into two main groups:

I. Methods for detecting unknown SNPs ("single-nucleotide polymorphisms") in the genome or large parts thereof;

II. Methods for determining known SNPs, i.e. for SNP typing — in the analysis of populations, in the search for “candidate genes” in studying the relationships of genotype and phenotype, for the detection of known point mutations, etc.

The methods of the first and second groups differ fundamentally and, as a rule, cannot replace each other in solving a particular problem.

Depending on the purpose, the existing practical methods II for determining known single nucleotide substitutions can be divided into two subgroups:

1) Methods for large-scale SNP-typing - differ in minimizing manual labor, multiplex technologies (typing for many SNPs at the same time), automatic reading and software processing of results and have two main versions - “chip” and “microtiter plate” (the tablet). In essence, these are quantitative technologies, because they practically do not give unambiguously alternative (yes or no), which do not require statistical processing of direct answers.

2) Methods for determining point mutations for the purpose of medical diagnostics, screening populations or genomes by a limited number of specific SNP markers - allow technologies with a greater share of manual labor, but require the simplicity of reading the result and relatively low cost.

The invention relates to group II-2) and allows the determination of a single nucleotide substitution in nucleic acid, i.e. establish not only the availability, but also the specific version of such a replacement. Despite the great diversity, other methods in this subgroup are intended primarily for research laboratories, as to obtain an answer they require, as a rule, either the use of a radioactive label, or an additional electrophoretic analysis in a gel, or a highly professional interpretation of ambiguous results. With the exception of such universal methods as allele-specific hybridization of oligonucleotide probes (ASOH) [1], minisequencing (SBE) [2], allele-specific PNR (PASA) [3] or ligation of oligonucleotide probes (OLA) [4], the rest the methods are not universal with respect to any nucleotide sequences and can be used to detect only a limited number of specific mutations. A common drawback of these universal methods is also their sensitivity to non-compliance with the exact experimental conditions, the insufficiently high level of selectivity of single nucleotide substitutions and, therefore, the need for statistical processing of the analysis results.

The closest to the claimed method, the prototype is a method of ligation of oligonucleotide probes, - OLA ("oligonucleotide ligation assay"), in a modification with a high level of selectivity, when a tandem of three short oligonucleotides, a tetramer and two oligomers flanking it 8 -10 n., Which is as follows [5].

Three single-stranded oligodeoxyribonucleotide probes were constructed — tetranucleotide pN ₄ , 5'-flanking oligonucleotide pN _8-10 and 3'-flanking oligonucleotide pN * _8-10, length 8-10 N. - so that the combined nucleotide sequence of the tandem pN _8-10 + pN ₄ + pN * _{8-10 is} strictly complementary to the continuous sequence of the diagnosed region in the nucleic acid, in which the variant nucleotide is located in the hybridization site with the tetramer. For a particular diagnosed site, one variant of the flanking oligonucleotide sequences is synthesized, but several (2-4) variants of the pN ₄ tetramer sequence are complementary to different alleles of the proposed single nucleotide substitution.

A ³² P-radioactive label is introduced into the 3'-flanking oligonucleotide using the polynucleotide kinase enzyme: (5 ') ³² pN * _8-10 .

These sets of three tandem probes, pN _8-10 + pN ₄ + ³² pN * _8-10 , differing in tetramer variants, are incubated in parallel in a homogeneous solution containing the necessary buffer components in the presence of the DNA ligase enzyme and the denatured PCR DNA fragment, containing the diagnosed variant nucleotide.

Between the three tandem probes, which are in complex with the DNA matrix, enzymatic ligation occurs:

pN _8-10 + pN ₄ + ³² pN * _8-10 ⇒ pN _8-10 -pN ₄ - ³² pN * _8-10 , ([ ³² p] -pN _20-24 )

with the formation of a 20-24-unit ³² P-radioactive (signal) product only in that sample in which the tetrameric tandem member is fully complementary to the corresponding site of the diagnosed DNA sequence. The tandems in the remaining samples, containing any other variants of the tetranucleotide, are practically not ligated with DNA ligase and do not give a signal product (more precisely, the signal ligation product is formed two orders of magnitude less). A signal product is formed if the tandem hybridization complexes of three probes with a diagnosed matrix sequence do not contain mismatches in the central, tetranucleotide, tandem duplex, and are not formed in the presence of any non-complementary nucleotide pair (mismatch) in any of the four nucleotide positions of the tetranucleotide duplex. The high specificity of ligation on the DNA matrix of tandems pN _8-10 + pN ₄ + pN * _8-10 is due to both the high selectivity of the binding of the complementary tetramer to the matrix in the presence of flanking oligomers and the increased selectivity of the enzyme, since any mismatch in the tetranucleotide tandem duplex pN _8-10 + pN ₄ + pN * _8-10 is located near the ligated sites.

At the end of the ligation reaction, the reaction mixture is heated at 100 ° C for 5 minutes to inactivate the DNA ligase and the destruction of hydrogen bonds.

A distinctive feature of the signal product is that it has a size of 20-24 N. and [ ³² p] is radioactive.

To separate the signal product from the residual precursor probes, parallel post-reaction mixtures were separated by denaturing polyacrylamide gel electrophoresis (20%).

Identification of the signal product in the gel is carried out according to the radioactive label [ ³² r]: after separation, the EF gel is autoradiographed onto an X-ray film and the sections of the gel containing the radioactive signal ligation product of 20-24 N are determined by autoradiogram. The radioactivity of the gel regions containing the signal product is detected in a scintillation counter according to the Cherenkov method. The degree of ligation (%) is calculated as the ratio of the radioactivity of the portion of the gel containing the signal product of ligation to the total radioactivity in the corresponding track.

By the presence of a radioactive signal product of size 20-24 N. determine the “active" variant of the tetranucleotide, indicating the allele of the diagnosed DNA sequence.

The disadvantages of this method are:

1. Ligation of probes is traditionally carried out in a homogeneous environment. All components and probes precursors necessary for the reaction are present in the buffer solution, and at the end of the ligation, also the reaction product. This necessitates an adequate analysis of the complex post-reaction mixture to identify the ligation product.

2. To identify the ligation product, the latter must be differentiated from the precursor probes according to the principle that underlies the differences between the precursors and the ligation product. The radioactive ligation product in a homogeneous medium interferes with the radioactive residual precursor probe. In this method, the only difference between the ligation product and all its predecessors is in molecular weight. To separate the ligation product by molecular weight, they are forced to use such a long and laborious method as the separation of oligonucleotides by PAA gel electrophoresis under denaturing conditions.

3. To detect the signal product of ligation after its separation, a radioactive label is used - the phosphorus-32 isotope, belonging to group B in terms of radiotoxicity and requiring working conditions in class III of radiation hazard.

4. The detection of a radioactive ligation product (signal product) requires a quantitative approach and is carried out either by determining the radioactivity of the corresponding gel zones in a scintillation radioactivity counter according to the Cherenkov method, or by scanning autoradiographic replicas of gels with subsequent computer analysis of the blackening densities of the x-ray film in the zones of radioactive products, t. e. detection of the ligation signal product requires appropriate hardware and software.

An object of the invention is to simplify the known method while maintaining its high selectivity for use in wide practice.

The technical task is solved by the proposed method, which consists in the following.

Three single-stranded oligodeoxyribonucleotide probes are constructed - pN ₄ tetranucleotide, 5'-flanking oligonucleotide pN _8-10 and 3'-flanking oligonucleotide pN * _8-10, length 8-10 N. - so that the combined nucleotide sequence of the tandem pN _8-10 + pN ₄ + pN * _{8-10 is} strictly complementary to the continuous sequence of the diagnosed region in the nucleic acid, in which the variant nucleotide is located in the hybridization site with the tetramer. For a particular diagnosed site, one variant of the flanking oligonucleotide sequences pN _8-10 and pN * _{8-10 is} synthesized, but several (2-4) sequence variants of the pN ₄ tetramer are complementary to different alleles of the diagnosed replacement.

The 5'-flanking oligonucleotide - pN _8-10 - is covalently immobilized via a 5'-phosphate linker onto the surface of the solid phase support P:

pN _8-10 + P⇒ P ~ pN _8-10 .

The reporter group (Rep) is covalently introduced into the 3'-flanking oligonucleotide - pN * _8-10 - at its 3'-end:

pN * _8-10 + Rep⇒ pN * _8-10 Rep.

Sets of three tandem probes, P ~ pN _8-10 + pN ₄ + pN * _8-10 Rep, differing in tetramer variants, are incubated in parallel in a ligase buffer in a heterophase medium in the presence of a DNA ligase enzyme and a denatured PCR DNA fragment containing the variant nucleotide. In addition to P ~ pN _8-10 , which is solid-phase, all other components of the ligation reaction mixtures — the remaining oligonucleotide probes, the enzyme, the DNA matrix, and the components of the ligase buffer — are components of the liquid phase.

Enzymatic ligation occurs between three tandem probes in complex with the DNA template

P ~ pN _8-10 + pN ₄ + pN * _8-10 Rep⇒ P ~ pN _8-10 -pN ₄ -pN * _8-10 Rep (P ~ pN _20-24 Rep)

with the formation on the surface of the solid-phase carrier P (and only there) of a 20-24-unit “signal” ligation product with a reporter group (P ~ pN _20-24 Rep) only in that sample in which the tetrameric tandem member is fully complementary to the corresponding site of the diagnosed sequence DNA The tandems in the remaining samples, containing any other variants of the tetranucleotide, are not ligated with DNA ligase and do not give a 20-24-unit product with a reporter group (more precisely, they give three orders of magnitude less) - in such samples, the solid-phase carrier remains without a reporter group.

At the end of the ligation reaction, the reaction mixture is heated in the presence of 20 mM EDTA-Na at 100 ° C for 5 minutes to inactivate the DNA ligase and break the hydrogen bonds.

A distinctive feature of the “signal” ligation product is that it has a size of 20-24 N., the whole is covalently immobilized on a solid-phase carrier and incorporates a reporter group.

To separate the “signal” ligation product in the solid-phase carrier, the latter is separated from all components of the liquid phase by intensive washing, which does not preserve any non-covalent bonds.

Identification of the “signal” product of ligation on a solid-phase support is carried out by means of a reporter group (Rep), which is first converted to an enzyme label (> E) through an affinity complex of a high-affinity agent specific for a reporter group A conjugated to enzymatic catalyst E. For this, the washed solid-phase support is maintained in a heterogeneous medium with a solution containing conjugate AE, for affinity binding of the conjugate to a reporter group:

R ~ pN _20-24 Rep + AE⇒ R ~ pN _20-24 Rep: AE (R ~ pN _20-24 > E)

As a result, the “signal” ligation product on a solid-phase support acquires an enzyme label (by nature an enzymatic catalyst), which makes it possible to visualize the “signal” product. For visualization, the enzyme label is “displayed” - it is incubated for 30-60 minutes in the presence of specific enzymatic substrates, which, under the influence of the enzymatic catalyst, are converted in the places where the enzyme label is localized into products with signaling properties, which is expressed in staining of the carrier. The stained carrier is detected with the naked eye or with appropriate signal devices. If necessary, the medium can be scanned (photographed).

The presence of the color of the solid-phase carrier determines the “active” variant of the tetranucleotide, indicating the allele of the diagnosed DNA sequence. If the tested DNA has any complementary mismatch with the sequence of the tetranucleotide member of the tandem, ligation and specific subsequent fixation of the enzyme label on the solid-phase carrier does not occur - the latter does not stain. The nature of the nucleotide mismatch within the tetranucleotide duplex is established by parallel ligation of tandems with known different variants of the pN ₄ sequence; in this case, the carrier is stained only in one case — with that variant pN ₄ , which is fully complementary to the corresponding region of the diagnosed matrix sequence.

The proposed method is universal for any established nucleic acid sequences. Since the determination of single nucleotide substitutions by this method is carried out on the basis of the presence or absence, in response to allelic variants of the tetranucleotide, a signal detected visually (color of the carrier), i.e. the method works as a highly specific heterogeneous test, it received the working name “TSOLA test system” (hereinafter - “TSOLA”, from “three short oligonucleotides ligation assay”).

The defining differences from the prototype are:

1) the 5'-flanking oligonucleotide - pN _8-10 - is pre-covalently immobilized through a 5'-phosphate linker on the surface of the solid-phase support P, as a result of which the oligonucleotide P ~ pN _8-10 becomes part of the solid phase. Derivatives of methacrylate, acrolein, acrylamide or acrylhydrazide polymers, as well as their copolymers, capron (nylon), lavsan, modified non-porous glass or silica gel of any shape (granules, membranes, microplate cells, films, gels, fiber, plates).

2) In the 3'-flanking oligonucleotide - pN * _8-10 - the reporter group (Rep) - pN * _8-10 Rep is covalently introduced at its 3'-end, which eliminates the need for the use of radioisotopes.

3) Ligation of probes is carried out not in a homogeneous solution, but in a heterophasic medium in which the solid phase is the 5'-flanking oligonucleotide precursor P ~ pN _8-10 ; and the other precursor probes are present in the liquid phase - the tetramer pN ₄ and the 3'-flanking oligonucleotide pN * _8-10 Rep, as well as all the buffer components necessary for the ligation reaction, the diagnosed DNA matrix and the DNA ligase enzyme. At the end of the ligation, the “signal” ligation product with the reporter group is covalently immobilized on a solid-phase carrier (P ~ pN _20-24 Re), which allows its separation without any preliminary analysis and eliminates the need for electrophoresis in a PAA gel in denaturing conditions.

4) To identify the immobilized ligation product, an enzyme label, which is not dangerous for widespread use, is used in contrast to the radioactive label. The latter is introduced into the immobilized “signal” ligation product at the site of the reporter group. The enzyme label is an enzymatic catalyst E conjugated to a reporter group-specific high affinity agent A. As reporter group and the corresponding specific high affinity agent (A), any high affinity pairs of [Rep: A] chemical and natural compounds with a dissociation constant are used the affinity complex K _{d is} not more than 10 ^-15 , mainly such as [biotin: streptavidin (or ExtrAvidin)], [digoxigenin: antidigoxygenin antibody] and other pairs [antigen (hapten): antibody]. The enzyme label contains as an enzymatic catalyst E a predominantly enzyme (or its derivative) peroxidase, alkaline phosphatase, β-D-galactosidase, or any other catalyst capable of generating products with specific properties of signaling properties - chromatic, luminescent, fluorescent.

5) In the presence of specific substrates, during the process under the conditional name “manifestation”, the enzyme label in the “signal” ligation product develops color, chemiluminescent or fluorescent staining of the solid-phase carrier in the zones of localization of the ligation product, which is a specific signal for the presence of the product. For the “manifestation" of the enzyme label with visual detection of a specific signal, enzyme-specific precipitating chromogenic substrates are used as substrates - mainly 3,3'-diaminobenzidine (DAB), 4-chloro-1-naphthol (4C1N), 5-bromo-4- chloro-3-indolylphosphate / p-nitrotetrazolium blue (BCIP / NBT); both precipitating and non-precipitating enzyme-specific substrates, chromogenic, luminogenic or fluorogenic - mainly 3.3 ', 5.5'-tetramethylbenzidine (TMB), p-nitrophenyl phosphate (pNPP), 5-aminosalicylic acid (5AS) are used for measuring detection ), 4-methylumbelliferyl phosphate (4-MUP).

In addition, the separation of the ligation product from the dissolved residual precursor probes in the post-reaction mixture is carried out by simple washing of the solid phase carrier, which simplifies the method. After washing, only the covalently immobilized “signal” ligation product (P ~ pN _20-24 Rep) and the residual first octamer precursor (P ~ pN _8-10 ), which further does not interfere with the “signal” product, are preserved on the carrier, t. to. does not have a reporter group.

The nature of the signal generated by the enzyme label (staining of the carrier), the high selectivity of ligation of short probes on a solid-phase carrier, and the associated unambiguity of direct alternative answers (“yes” / “no”) provide the possibility of visual detection of a specific signal, which, unlike the prototype, requires quantitative analysis and associated hardware and software. All these parameters of the proposed method allow using it as a simple and reliable test, available for widespread use.

Figure 1 presents the above scheme of ligation of the tandem of oligonucleotides and the identification of the “signal” ligation product in TSOLA, specified in terms of the length of the probes, reporter group (Bio biotin residue), enzyme label (streptavidin-alkaline phosphatase conjugate) and chromogenic precipitating substrates (BCIP + NBT), where M is the region of diagnosed matrix DNA. The remaining designations are indicated in the text of the description.

- нуклеотидные позиции, комплементарные тандему TSOLA. Х - некомплементарные позиции.Figure 2 presents a scanned image of a tablet illustrating the results of TSOLA for examples 1-13,17,19, where M0 - M7 are model single-stranded DNA with a length of 20 N.: M0 is the correct target DNA that does not have mismatches in tandem hybridization complexes of TSOLA ; M1-M4 — target DNAs having one mismatch in the TSOLA hybridization complexes — with the 1-4th, respectively, nucleotide position of the tetramer; M5 — target DNA having a mismatch with a 3'-terminal base of an immobilized octamer; M6 is a DNA target having a mismatch with a 5'-terminal base of a biotinylated octamer; M7 is a DNA target with a mismatch with an internal, fifth, base of a biotinylated octamer; ... / M0 -... / M4 - products of symmetric PCR amplification of DNA with different sizes and sequences: 184 / M0 - regular target DNA with a length of 184 bp, without mismatches in the tandem hybridization complexes TSOLA; ... / M1 -... / M4 - DNA targets of the indicated length, TSOLA hybridization complexes of which have one mismatch - with the 1-4th, respectively, nucleotide position of the central, tetrameric, tandem member.

- nucleotide positions complementary to the TSOLA tandem. X - non-complementary positions.

Figure 3 presents an illustration of the result of the TSOLA test for the presence of a single nucleotide substitution for three PCR DNA samples of 184 bp in size, one of which is heterozygous and the other homozygous. Testing was performed as described in examples 27-30. 1 - homozygous DNA sample, in position, hybridizing with the 1st nucleotide of the tetrameric member of the tandem, base G (examples 27-28); 2 - homozygous DNA sample, has the replacement G⇒ A in the position, hybridizing with the 1st nucleotide of the tetrameric member of the tandem (examples 29-30); 3-heterozygous sample. Homozygous samples give a positive signal (staining) only with the corresponding tetranucleotide sequence, alternatively. A heterozygous sample gives a positive signal with each of the allelic tetranucleotides.

The invention is illustrated by the following examples of specific embodiments of the invention.

We investigated TSOLA test systems with different sequences of target DNA and oligonucleotides. To simulate a mismatch at a specific position in the TSOLA complexes, a single nucleotide substitution was introduced into the template DNA sequence or into the tetramer sequence.

Example 1. The solid-phase carrier was a non-porous methacrylate granules with a 5'-flanking tandem octanucleotide immobilized on the surface — P ~ pN ₈ (P ~ pGCATCAAG). The density of immobilization of the octanucleotide is 1 μmol / g. The composition of the liquid medium: 10.0 μM tetranucleotide pN ₄ (pCAGC) and biotinylated 3'-flanking octanucleotide pN ₈ * bio (pTCCAGGCAp ~ bio); 10 nM DNA template M0 (figure 2); 1.5 units / μl of T4 DNA ligase in standard ligase buffer. The sample contained 0.5 mg dry weight of the carrier and 15 μl of a liquid medium.

1) The components of a liquid medium (total volume 15 μl) were added to a TE-washed buffer and a well-drained carrier (0.5 mg dry weight), the mixture was stirred and incubated at 37 ° C for 30 min.

2) At the end of the ligation, the sample was diluted with 20 mM EDTA-Na (pH ~ 8) and heated at 100 ° C for 5 min.

3) The carrier was washed from the biotinylated precursor octamer with sodium citrate buffer (SSC) by flow filtration using a water-jet pump (“Dot” filtration) or 3-4-fold reprecipitation in a benchtop centrifuge (“Eppendorf”).

4) The carrier was kept with a solution of streptavidin conjugate and alkaline phosphatase in diluted SSC buffer (1 μg / ml) for 30 min at room temperature and washed as described for step 3.

5) The carrier was “developed” for 60 minutes at room temperature in the presence of precipitating chromogenic BCIP / NBT substrates ("Sigma") under standard conditions recommended by the company.

The formation of the signal product was recorded visually by the presence of a purplish-blue color of the carrier.

The test result is positive: the carrier was stained; a ligation product was detected. Conclusion: the sequence of the diagnosed region of the DNA template is complementary to the sequence of the used variant of the tetranucleotide.

Example 2. The experiment was carried out as described in example 1, but M1 (X = A) was used as the DNA template. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 3. The experiment was carried out as described in example 1, but M1 (X = T) was used as the DNA template. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 4. The experiment was carried out as described in example 1, but M1 (X = C) was used as the DNA template. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 5. The experiment was carried out as described in example 1, but M2 (X = A) was used as the DNA template. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 6. The experiment was carried out as described in example 1, but M2 (X = C) was used as the DNA template. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 7. The experiment was carried out as described in example 1, but M2 (X = G) was used as the DNA template. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 8. The experiment was carried out as described in example 1, but M3 (X = A) was used as the DNA template. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 9. The experiment was carried out as described in example 1, but M3 (X = T) was used as the DNA template. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 10. The experiment was carried out as described in example 1, but M3 (X = G) was used as the DNA template. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 11. The experiment was performed as described in example 1, but M4 (X = A) was used as the DNA template. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 12. The experiment was carried out as described in example 1, but M4 (X = T) was used as the DNA template. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 13. The experiment was performed as described in example 1, but M4 (X = C) was used as the DNA template. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 14. The experiment was carried out as described in example 1, but M5 (X = T) was used as the DNA template. The test result is positive: the carrier was stained; a ligation product was detected. Conclusion: the sequence of the diagnosed region of the DNA template is complementary to the sequence of the used variant of the tetranucleotide.

Example 15. The experiment was carried out as described in example 1, but M6 (X = T) was used as the DNA template. The test result is positive: the carrier was stained; a ligation product was detected. Conclusion: the sequence of the diagnosed region of the DNA template is complementary to the sequence of the used variant of the tetranucleotide.

Example 16. The experiment was carried out as described in example 1, but M7 (X = T) was used as the DNA template. The test result is positive: the carrier was stained; a ligation product was detected. Conclusion: the sequence of the diagnosed region of the DNA template is complementary to the sequence of the used variant of the tetranucleotide.

Example 17. The experiment was carried out as described in example 1, but there was no tetranucleotide (-pN ₄ ). The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: incomplete TSOLA test system.

Example 18. The experiment was carried out as described in example 1, but there was no DNA ligase. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: incomplete TSOLA test system.

Example 19. The experiment was carried out as described in example 1, but there was no DNA target (-M). The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: incomplete TSOLA test system.

The results of examples 1-13,17,19 are reflected in figure 2.

Example 20. The experiment was carried out as described in example 1. The composition of the liquid medium: 10.0 μm biotinylated octanucleotide pN ₈ * bio; 10 μM tetranucleotide pN ₄ ; 100 nM heat-denatured 184 / M0 DNA template; 3 units / μl of T4 DNA ligase, in standard ligase buffer. The test result is positive: the carrier was stained; a ligation product was detected. Conclusion: the sequence of the diagnosed region of the DNA template is complementary to the sequence of the used variant of the tetranucleotide.

Example 21. The experiment was carried out as described in example 20, but 220 / M2 was used as the DNA template. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 22. The experiment was carried out as described in example 20, but 135 / M3 was used as the DNA template. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 23. The experiment was carried out as described in example 20, but 112 / M4 was used as the DNA template. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 24. The experiment was carried out as described in example 20, but the immobilized oligonucleotide P ~ pN ₉ had a length of 9 N., biotinylated oligonucleotide pN ₁₀ * bio - 10 N. and 341 / M0 was used as the DNA template. The test result is positive: the carrier was stained; a ligation product was detected. Conclusion: the sequence of the diagnosed portion of the DNA template is complementary to the sequence of the used variant of the tetranucleotide.

Example 25. The experiment was carried out as described in example 24, but 341 / M1 was used as the DNA template. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 26. The experiment was carried out as described in example 20, but the immobilized oligonucleotide P ~ pN ₁₀ had a length of 10 N., biotinylated oligonucleotide pN ₉ * bio - 9 N. and 341 / M0 was used as the DNA template. The test result is positive: the carrier was stained; a ligation product was detected. Conclusion: the sequence of the diagnosed region of the DNA template is complementary to the sequence of the used variant of the tetranucleotide.

Example 27. The solid-phase support P was a nylon membrane (Hiu Kalur, Estonia, pore size 0.2 μm) in the form of a disk ~ 3 mm in diameter with a 5'-flanking octanucleotide immobilized on the surface - P ~ pN ₈ (77 ~ pCAATACCT) . The density of immobilization of the octanucleotide was 5 nmol / cm ² . The composition of the liquid medium: 10 μm tetranucleotide pN ₄ (pCGGC); 10 μM octanucleotide pN ₈ * Rep with the residue of digoxigenin (hapten) as a reporter group (pCCTTCTCA ~ Dig); 0.1 μM heat-denatured matrix 184 / M0 ( ^5' -... TGAGAAGGGCCGAGGTATTG ...); 3 units / μl of T4 DNA ligase, in standard ligase buffer.

1) Disks were placed in microplate cells with TE buffer for wetting, washed 1 time with TE buffer and thoroughly drained by aspiration of the buffer.

2) 30 μl of liquid medium was applied to the disks in the cells and incubated at 37 ° C for 15 minutes.

3) The reaction was stopped by the addition of 150 μl of 25 mM EDTA-Na, pH ~ 8.

4) Disks in the cells were washed several times with hot (~ 80-90 ° C) distilled water with thorough drainage at the end of each wash.

5) 150 μl of 0.1 M PBS-T, pH 7.4, containing 15 mM NaN ₃ and 0.2 mg / ml BSA was added to the wells. Composition 0.1 M PBS-T, pH 7.4 per 1 liter: NaCl - 8.0 g, KH ₂ PO ₄ - 0.2 g; Na ₂ HPO ₄ · 12H ₂ O - 2.8 g; KCl - 0.2 g; Tween-20 - 0.05% (v / v). After 10 minutes, the discs were drained by aspiration of the buffer.

6) Added 30 μl of a solution of horseradish peroxidase conjugate (HRP) with anti-digoxigenin antibody (AntiDig) in 0.1 M PBS-T, pH 7.4, containing 1.0 μg / ml AntiDig-PX; 15 mM NaN ₃ ; 0.2 mg / ml BSA. Incubated 1 hour at 37 ° C.

7) Disks in the cells were washed 5 times with 200 μl of 0.1 M PBS-T, pH 7.4 with thorough drainage.

8) For development, 60 μl of a substrate solution containing 50 mM Tris-HCl, pH 7.4; 0.5 mg / ml 3,3'-diaminobenzidine (DAB); 2 mM H ₂ O ₂ . Manifestation was continued at room temperature for 60 minutes and was stopped by adding 1-2 drops of 2 M H ₂ SO ₄ .

The test result is positive: the carrier was stained; a ligation product was detected. Conclusion: for the DNA sample 184 / M0, the G allele is determined

Example 28. The experiment was carried out as described in example 27, but the composition of the tetranucleotide pN ₄ - pTGGC. The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 29. The experiment was carried out as described in example 27, but the DNA matrix was 184 / M1 ( ^5' -... TGAGAAGGGCCAAGGTATTG ...). The test result is negative: the medium was not stained; the ligation product was absent. Conclusion: the sequence of the diagnosed portion of the DNA template is not complementary to the sequence of the used variant of the tetranucleotide.

Example 30. The experiment was carried out as in example 27, but the DNA matrix 184 / M1 (example 30) and the tetranucleotide pTGGC were used. The test result is positive: the carrier was stained; a ligation product was detected. Conclusion: for the DNA sample 184 / M1, the allele A.

The results of examples 27-30 are shown in figure 3 (1, 2).

Thus, the proposed method is universal for any established nucleic acid sequences, is highly selective and is available for use in wide practice.

We present an additional example illustrating the irreproducibility of the claimed method when immobilizing not through the 5'-terminal phosphate linker of the 5'-flanking tandem oligonucleotide, but through the 3'-phosphate linker of the 3'-flanking tandem oligonucleotide:

Rep ~ pN _8-10 + pN ₄ + pN * _8-10 ~ P

Example (31).

The solid-phase carrier was non-porous methacrylate granules immobilized on the surface through the 3'-terminal phosphate linker with the 3'-flanking octanucleotide tandem -pN ₈ * ~ P (pTCCAGGCAp ~ P). The density of the immobilization of octanucleotide -1 μmol / g The composition of the liquid medium: 10.0 μM tetranucleotide pN ₄ (pCAGC), 10.0 μM biotinylated at the 5'-terminal phosphate group of the 5'-flanking octanucleotide Bio ~ pN ₈ (Bio ~ pGCATCAAG); 10 nM 5'-TGCCTGGAGCTGCTTGATGC complementary DNA template (MO, Figure 2); 1.5 units / μl of T4 DNA ligase, in standard ligase buffer. The sample contained 0.5 mg dry weight of the carrier and 15 μl of a liquid medium.

The experiment was carried out as described in example 1:

1) Liquid components (total volume 15 μl) were added to the TE-washed buffer and a well-drained carrier (0.5 mg dry weight), the mixture was stirred and incubated at 37 ° С for 30 min.

2) At the end of the ligation, the sample was diluted with 20 mM EDTA-Na (pH ~ 8) and heated at 100 ° C for 5 min.

3) The carrier was washed from the biotinylated octamer precursor with sodium citrate buffer (SSC) by flow filtration using a water-jet pump ("Dot" - filtration) or 3-4-fold reprecipitation in a benchtop centrifuge ("Eppendorf")

4) The carrier was kept with a solution of streptavidin conjugate and alkaline phosphatase in diluted SSC buffer (1 μg / ml) for 30 min at room temperature and washed as described for step 3.

5) The carrier was "developed" for 60 minutes at room temperature in the presence of precipitating chromogenic BCIP / NBT substrates ("Sigma") under standard conditions recommended by the company.

The formation of the signal product was recorded visually by the presence of a purplish-blue color of the carrier.

The test result is unsatisfactory: the carrier has only slightly changed the tint; the ligation product is not significantly detected. Conclusion: enzymatic ligation does not occur for steric reasons, the technical result is not achieved.

Sources of information

1. Ivanov I.B., Ershov G.M., Barsky V.E., Belgovsky A.I., Kirillov E.V., Kreindlin E.Ya., Parinov S.V., Mologina N.V., Mirzabekov A.D. Diagnosis of genetic mutations on oligonucleotide microarrays. // Molecular biology. 1997.V.31. No. 1. S.159-167.

2. Syvanen AC. From gels to chips: "minisequencing" primer extension for analysis of point mutations and single nucleotide polymorphisms. // Hum Mutat. 1999. Vol.13. No. 1. P.1-10.

3. Suzuki Y, Sekiya T, Hayashi K. Allele-specific polymerase chain reaction: a method for amplification and sequence determination of a single component among a mixture of sequence variants. // Anal. Biochem. 1991. Vol. 192. No. 1. P.82-84.

4. lannone M.A., Taylor J.D., Chen J., Li M.S., Rivers P., Slentz - Kesler K.A., Weiner M.P. Multiplexed single nucleotide polymorphism genotyping by oligonucleotide ligation and flow cytometry. // Cytometry. 2000. Vol. 39. P.131-140.

5. Pyshniy D. V., Krivenko A. A., Lokhov S. G., Ivanova E. M., Dymshits G. M., Zarytova V. F. Interaction of derivatives of short oligonucleotides with nucleic acids. V. Ligation of short oligonucleotides in tandem on a complementary DNA matrix. VI. Discrimination of mismatch-containing complexes during ligation of the tandem of short oligonucleotides on a DNA matrix. // Bioorgan, chemistry. 1998.V.24. No. 1. S.25-31, 32-37.

Claims (8)

1. A method for determining single nucleotide substitutions in known nucleic acid sequences, including enzymatic ligation with DNA ligase of different variants of a continuous tandem of three short oligonucleotides - variant tetranucleotide, 5`-flanking and 3`-flanking non-variant oligonucleotides 8-10 n long, located in perfect hybridization complexes with a PCR amplified template DNA strand sequence containing the putative diagnosed replacement at the tetran hybridization site leotide, followed by separation of the “signal” ligation product immobilized on a solid support, indicating, in accordance with the tetranucleotide variant, the nature of the diagnosed substitution, identifying it by the biotin reporter group by converting the latter into an enzyme label through a complex with a streptavidin agent highly conjugated to the reporter group conjugated to enzyme alkaline phosphatase, and “manifestation” of the enzyme label in the presence of precipitating chromogenic substrate BCIP / NBT (5-bromo-4-chloro 3- indolylphosphate / p-nitrotetrazolium-blue) with visual detection, characterized in that the immobilized signal product is obtained by hybridization and ligation of the tandem in a heterophasic system in which one of the reagents, a 5` flanking oligonucleotide, is covalently immobilized on a solid support before carrying out the reactions immobilization of the oligonucleotide is carried out through a 5`-phosphate linker, the reporter group is attached to the 3`-end of the immobilized flanking oligonucleotide, for visual detection of the “signal” pro the ligation product, the enzyme label is “shown” in the presence of different variants of precipitating chromogenic substrates, and for measuring detection, in the presence of different variants of precipitating or non-precipitating, chromogenic, luminogenic or fluorogenic substrates. 2. The method according to claim 1, characterized in that the carrier is used derivatives of polymers of methacrylate, acrolein, acrylamide or acrylhydrazide, as well as their copolymers, capron, lavsan, modified non-porous glass or silica gel. 3. The method according to claim 1, characterized in that the solid-phase carrier is used in the form of granules, latex, microplate cells, films, membranes, gels, fibers or plates. 4. The method according to claim 1, characterized in that the separation of the immobilized “signal” ligation product is carried out directly from the ligation reaction mixture by washing the solid phase carrier. 5. The method according to claim 1, characterized in that they also use combinations of the reporter group and the corresponding specific high affinity agent, such as biotin: ExtrAvidin, or any high affinity pair of chemical and natural compounds with the dissociation constant of the affinity complex K _d not more than 10 ^-15 or selected from the group of antigen (hapten): antibody. 6. The method according to claim 1, characterized in that for the enzyme label, peroxidase or β-D-galactosidase enzymes are also used. 7. The method according to claim 1, characterized in that 3.3'-diaminobenzidine (DAB) or 4-chloro-1-naphthol (4C1N) is also used as precipitating substrates. 8. The method according to claim 1, characterized in that tetramethylbenzidine (TMB), p-nitrophenyl phosphate (pNPP), 5-aminosalicylic acid (5AS), 4-methylumbelliferyl phosphate (4-MUP) are used as non-precipitating substrates.

Images