RU2245551C1 - Method for predicting oncological diseases - Google Patents

Abstract

FIELD: medicine, diagnostics.

SUBSTANCE: the present innovation deals with genetic trials, with diagnostic field of oncological diseases due to analyzing DNA by altered status of gene methylation that take part in intracellular regulation of division, differentiating, apoptosis and detoxication processes. One should measure the status of methylation in three genes: p16, E-cadherine and GSTP1 in any human biological samples taken out of blood plasma, urine, lymph nodes, tumor tissue, inter-tissue liquid, ascitic liquid, blood cells and buccal epithelium and other; one should analyze DNA in which modified genes of tumor origin or their components are present that contain defective genes, moreover, analysis should be performed due to extracting and purifying DNA out of biological samples followed by bisulfite treatment of this DNA for modifying unprotected cytosine foundations at keeping 5-methyl cytosine being a protected cytosine foundation followed by PCR assay of bisulfite-treated and bisulfite-untreated genes under investigation and at detecting alterations obtained according to electrophoretic result of PCR amplificates, due to detecting the difference in the number and electrophoretic mobility of corresponding fractions at comparing with control methylated and unmethylated samples containing normal and hypermethylated forms of genes one should diagnose oncological diseases. The method provides higher reliability in detecting tumors, detection of remained tumor cells after operation.

EFFECT: higher efficiency of therapy.

1 cl, 3 dwg, 4 ex

Description

The invention relates to medicine, in particular genetic research, to the field of cancer diagnosis by analyzing deoxyribonucleic acid to change the methylation status of genes involved in the intracellular regulation of division, differentiation, apoptosis and detoxification processes.

A known method for the diagnosis and control of cancer development, including the analysis of amplified DNA from blood plasma (US patent No. 5952170, 1999). The disadvantage of this method is that the analysis of DNA of tumor origin from a single source reduces the sensitivity of the diagnosis of cancer.

It is now known that methylation of genes involved in the intracellular regulation of division, differentiation, apoptosis and detoxification processes is known to lead to disruption of the genome in tumor and some other cells and to malfunctioning of the corresponding tissues (patent US 6492144, Dec. 10, 2002, patent US 5726019, Mar. 10, 1998).

Closest to the proposed diagnostic method is a method for the detection of neoplastic cells, including an analysis of the methylation status of the p16 gene (patent US 5856094, Jan.5, 1999).

The disadvantages of the known method for the diagnosis of cancer is the following:

- in different individuals with the same type of tumors, the hypermethylation of the promoter DNA sections may differ, i.e. the hypermethylation profile for tumors is individual;

- analysis of one gene, for example, p1-6 gene, shows the presence of a tumor in only half of cases in the diagnosis of cancer, in the other half of cases of tumor material, the gene is not hypermethylated, and other genes for regulation of the cell cycle, for example, the E-cadherine gene, are hypermethylated.

In addition, unlike the DNA isolated from the tumor itself in many biological samples also containing DNA of tumor origin, for example, blood plasma of cancer patients, urine, and lymph nodes, the percentage of the hypermethylated form of the p16 gene of tumor origin is low relative to the non-hypermethylated form from normal cells (patent US 6492144, Dec. 10, 2002).

The objective of the proposed method for the diagnosis of cancer is to increase the reliability of detecting tumors, determining the remaining tumor cells in the body after surgical removal of the tumor or other types of treatment, monitoring cancer and early assessment of the effectiveness of the treatment, as well as forecasting the effectiveness of chemotherapy and other types of treatment.

As a result of using the proposed method for the diagnosis of cancer, the survival rate of cancer patients is increased by increasing the accuracy of diagnosis, timely diagnosis and increasing the effectiveness of treatment, analysis of the methylation status of several genes at the same time increases the likelihood of detecting a tumor, and the additional reaction of nested PCR (unsteady PCR) allows to determine the hypermethylated gene p16 with a low ratio of tumor origin DNA to non-swelling DNA cells, as well as the opportunity to assess the dynamics of the disease, that is, the presence of tumor cells after surgical or other treatment, it is early to anticipate the recurrence or spread (metastasis) of the disease and to carry out an early assessment of the effectiveness of treatment, for the possibility of transition and more suitable chemotherapy drugs or other ways of treatment.

The result is achieved in that in the proposed method for the diagnosis of cancer by evaluating the methylation of genes involved in the regulation of cell metabolism, the methylation status of the three p16, E-cadherin and GSTP1 genes is measured simultaneously in any biological samples taken from blood plasma, urine, lymph nodes, tumor tissue, interstitial fluid, ascites fluid, blood cells and buccal epithelium and others, analyze DNA in which modified genes of tumor origin are present in any samples in which tumor cells or their components containing defective genes can enter, and the analysis is carried out by extraction and purification of DNA from biological samples, followed by bisulfite treatment of this DNA to modify unprotected cytosine bases while maintaining 5-methylcytosine, which is a protected cytosine base, followed by PCR analysis genes treated and untreated with bisulfite and when detecting changes obtained by electrophoresis of PCR amplifications by identifying differences in the number and electrophoretic mobility of the respective fractions when compared with control methylated and unmethylated samples containing normal and hypermethylated forms of genes, diagnose cancer.

For control methylated and unmethylated samples, DNA from human tissue cultures containing normal or hypermethylated forms of the p16, E-cadherin, and GSTP1 genes is used.

Biological samples can be obtained from persons examined for cancer or with established cancer before treatment, during treatment before and after surgery, chemotherapy, radiation therapy, biotherapy and others.

DNA extraction is carried out from various biological samples, purification, bisulfite modification and then amplification of this DNA is carried out to determine the DNA gene methylation status by comparative analysis of the studied samples of the person who was diagnosed with control samples, negative controls, DNA from healthy individuals and known human tissue cultures with normal methylation status of the studied genes, as well as positive control of DNA of human tissue cultures, where there is a violation in the methylir status Ania. Various impurities in the extraction and purification of DNA interfere with the subsequent methylation status, since unmethylated cytosine bases are screened and they are recognized as 5-methylcytosines (methylated cytosine bases) in the bisulfite modification reaction, which leads to false positive diagnoses (Ehrlich M. DNA methylation: normal development , inherited diseases, and cancer. J Clin Ligand Assay 2000; 23: 144-8).

For the extraction of DNA in the present invention, modified extraction methods are used for some types of biological samples, which include changing the concentration of proteinase K, the pH of the buffer system and the number of repeated phenolic extracts and using linear polymer for DNA deposition in samples with a low concentration of DNA (for example, blood plasma) polyacrylamide.

The method is as follows.

9 ml of blood is taken from the ulnar vein with a disposable syringe and transferred into a 15 ml polypropylene tube (Finbio or similar tubes) containing 1 ml of a 1% EDTA anticoagulant isotonic solution. The second option: Blood sampling is also carried out using a single vacuum system with EDTA - Monovette from Sarstedt, Germany (permission to use - Ministry of Health of the Russian Federation No. 2000/403 from 08/14/2000).

The first centrifugation is carried out under mild conditions at an acceleration of 315g to maximize the integrity of nucleated cells for 15 minutes at 4 ° C. A 5804R centrifuge with a bakterotor from Eppendorf (Germany) is used. For a given centrifuge, such acceleration is provided at 1500 rpm, or another centrifuge with similar centrifugation conditions may be used. Plasma with a suspension of nucleated cells is transferred to a new tube, trying not to capture the settled red blood cells, centrifuged at 1260g (3000 rpm, 15 min, 4 ° С, a 5804R centrifuge with a back rotor from Eppendorf, Germany) to precipitate nucleated cells. Cell-free plasma is then transferred to a new tube, leaving about 150-200 μl of sediment. The precipitate of nucleated blood elements is resuspended in the remaining amount of plasma, transferred to a 1.5 ml Eppendorf microtube. Centrifuge the plasma tube at 3500g (5000 rpm, 15 min, 4 ° C) to completely precipitate the remaining single cells. Plasma is transferred to a new tube and used for further work or stored at -80 ° C.

Isolation of DNA from biological samples

Isolation of DNA from blood cells by the phenolic method with pre-treatment with proteinase K. (The same method is used to isolate DNA from a precipitate of urine cells, cell cultures).

Sediment of nucleated cells transferred to an Eppendorf type microtube of 1.5 ml was precipitated in an Eppendorf Microspine microcentrifuge (12000 rpm (8000g), 1 min) and kept until DNA isolation at -80 ° С. The cell pellet was resuspended in 200 μl of lysis buffer (10 mM Tris (pH 8.0), 25 mM EDTA (pH 8.0), 0.5% SDS). Resuspend and precipitate by short centrifugation. Add 20 μl of a proteinase K solution (100 μg / ml), mix and incubate overnight at 56 ° C. Protein is extracted from the lysate with phenol balanced buffer (50 mM Tris, pH 8.0, 10 mM EDTA). Centrifuged for 5 min at maximum speed (Eppendorf Minispin), the upper (aqueous) phase is transferred to a new tube. Then, the aqueous phase is extracted (item 5) with a phenol-chloroform mixture with a phenol to chloroform ratio of 10: 1.

Centrifuged for 5 min at maximum speed, transfer the upper (aqueous) phase to a new tube and add an equal volume of chloroform. Shake and centrifuge for 5 minutes at maximum speed. The upper phase is transferred to a new tube. 1/10 volume of a solution of 3 M sodium acetate, pH 5.3, and 2 volumes of cold 96% ethanol cooled to -20 ° C are added. Shake, incubated for 2 hours at -20 ° C. Centrifuged at + 4 ° C for 15 minutes at maximum speed. Carefully remove the supernatant, avoiding labilization of the DNA pellet. The walls of the tube are washed with 70% ethanol, centrifuged if necessary (in case of sediment labilization), alcohol is removed, and the precipitate is dried in air. For storage, the extracted DNA is dissolved in water or TE buffer, stored at -80 ° C.

Isolation of DNA from tissues fixed in paraffin

8-15 μm sections are prepared from biopsy specimens enclosed in waxed blocks. Next, sections of tissue fixed in paraffin are placed in a 1.5 ml Eppendorf microtube, 1 ml of xylene is added and gently shaken (turning the tube up and down several times). Then centrifuged for 5 min at maximum speed, room. temperature. Remove the supernatant with a pipette. If necessary, dewaxing with xylene is repeated. Add 1 ml of 96% ethanol to remove xylene residues and mix gently (turning the tube up and down several times). The alcohol is removed and the washing with alcohol is repeated again. A TE buffer is added to the precipitate, immediately, so that DNA fragments do not have time to elute from the sections, centrifuged and the supernatant is removed.

Resuspend the pellet in lysis buffer (100 mM NaCl, 10 mM Tris (pH 8.0), 25 mM EDTA (pH 8.0), 1.5% SDS), in 3 sections 300 μl. Proteinase K is added at the rate of 50 μg per 100 μl of buffer (usually proteinase is stored in a stock solution of 20 μg / μl). Incubated at 55 ° C for 24-48 hours until complete tissue lysis with periodic stirring. If after 24-hour incubation the tissues were not completely lysed, then add the same amount of proteinase solution.

Proteins are extracted with phenol. In this case, the phenolic fraction remains in the lower phase at the bottom of the tube. Then centrifuged for 5 min at maximum speed. The aqueous phase is transferred to a new tube, and the phenolic phase (lower) is disposed of. Extraction is carried out with a mixture of “phenol-chloroform” with a ratio of phenol to chloroform of 10: 1. It is centrifuged for 5 min at maximum speed, the aqueous phase is transferred to a new tube, and an equal volume of chloroform is added to it. Stirred, centrifuged for 5 minutes at maximum speed. The aqueous phase is transferred to a new tube, the lower phase is disposed of. To the aqueous phase add 1/10 volume of a solution of 3 M sodium acetate, pH 5.2, and 2 volumes of cold 96% ethanol (2 volumes, given the volume of the salt solution). Stirred, incubated for 2 hours at -20 ° C.

Centrifuged at + 4 ° C for 30 minutes at maximum speed (Eppendorf Minispin centrifuge, 13,400 rpm (10000g).

Carefully remove the supernatant, avoiding labilization of the DNA pellet. The walls of the tube are washed with 70% ethanol, centrifuged if necessary (in case of sediment labilization), alcohol is removed, and the precipitate is dried in air. Use. For storage, dissolve in water or TE buffer, store in a refrigerator at -80 ° C.

Isolation of DNA from blood plasma.

DNA was isolated from plasma by the phenol method, after preliminary treatment with proteinase K. Previously, one part of double lysis buffer (1% sodium dodecyl sulfate, 500 mM Tris-Cl, pH 8.0, 20 mM EDTA, pH 8.0, 10 mM NaCl) was added to the plasma and proteinase K to a concentration of 500 μg / ml, then kept overnight at 55 ° C. An equal volume of phenol equilibrated with buffer (50 mM Tris-Cl, pH 8.0, 10 mM EDTA, pH 8.0) was added for protein extraction. Shaken for 5-10 minutes and centrifuged for 10 minutes at 3500g at + 4 ° C. The upper phase containing DNA was collected, and the next deproteinization step was carried out with an equal volume of phenol-chloroform mixture, shaking the mixture for 5-10 minutes, and centrifuged for 10 minutes under the same conditions. The third deproteinization was carried out similarly to the second, but pure chloroform was used. To precipitate DNA, a 10: 1 solution of ammonium acetate in a ratio of 1: 5 was added to the aqueous phase, and linear polyacrylamide purified by double reprecipitation in ethanol at a final concentration of 25 μg / ml was used as a co-precipitant, and alcohol precipitation of DNA was carried out by adding 2 volumes of 96 % ethanol and keeping the mixture at -20 ° C for 2 hours. DNA pellet was collected by centrifugation for 30 minutes.

Next, the precipitate was washed with 1 ml of 70% ethanol and, after centrifugation, was dried in vacuo in an Eppendorf concentrator (model 5301). Then, the precipitate was dissolved in 50 μl of TE buffer (50 mM Tris-Cl, pH 8.0, 10 mM EDTA, pH 8.0) and stored at - 80 ° С.

Bisulfite modification of DNA from biological samples for subsequent methyl-specific PCR genes p16, E-cadherin, GSTP1.

The principle of the method of methyl-specific polymerase reaction.

The method of MS-PCR is based on the bisulfite treatment of the analyzed DNA, which leads to the conversion of unprotected cytosine bases to uracil and the preservation of methyl 5-methylcytosine protected by a methyl group, followed by PCR with primers specific for the modified sequence. (Singal, R., and Ginder, Ginder, G. D. DNA methylation. Blood, 93: 4059-4070, 1999). Considering that proteins can screen cytosine bases and prevent the bisulfite conversion of cytosine to uracil, only DNA preparations isolated using proteinase K were used to exclude false-positive results.

Bisulfite treatment and purification of modified DNA.

The bisulfitation reaction takes place only on single-stranded DNA fragments, for this the DNA is denatured in an alkaline medium. A DNA sample diluted in 18 μl of deionized water was denatured by adding 2 μl of 3 M NaOH. Incubated at 37 ° C, 30 minutes (final concentration of NaOH - 0.3 M).

Bisulfite conversion was carried out by adding 208 μl of 2 M sodium metabisulfite (NaHCO ₃ ), pH 5.0 and 12 μl of 10 mm hydroquinone. The mixture was incubated for 16 hours at 50 ° C. Further, the modified DNA was purified by sorption on fine-porous glass powder from Sigma. To do this, at first 2 volumes of lysis buffer 6 M guanidine isothiocyanate, 0.05 M Tris HCl pH 5.0 were added, carefully shaking the tube on a vortex. 10 μl of a 10% suspension of the sorbent was added (the sorbent was carefully resuspended before addition). Leave the tube at room temperature for 10 minutes, regularly turning the tube over this time at this time every 2 minutes to prevent sorbent settling. The sorbent is precipitated by short-term (30 sec) centrifugation at 100 rpm, and the supernatant is carefully selected. Add 200 μl of 70% ethanol, shake to mix, or peptize until a uniform suspension is obtained. The sorbent is precipitated by short-term (30 sec) centrifugation at 1000 rpm, and the supernatant is carefully selected.

200 μl of 70% ethanol are added to the precipitate for washing and the precipitate is suspended until homogeneous. The sorbent is precipitated by short-term (30 sec) centrifugation at 1000 rpm, and the supernatant is carefully selected. After the last wash, the precipitate is dried in air for 10 minutes. 50 μl of TE buffer is added to the precipitate, mixed and incubated for 10 min at 56 ° C. The sorbent is precipitated by continuous (4 min) centrifugation at 10,000 rpm. Transfer the supernatant containing the DNA preparation to another tube.

They are then freed from sulfonates in the DNA sample. To do this, add 3 M NaOH, incubate for 15 min at 37 ° C. Add 20 μl of a solution of a 10 M solution of ammonium acetate with a pH of 7.0, 1 μl of a solution of 0.2% glycogen and 200 μl of 96% ethanol. Place the tube for 1-2 hours at -20 ° C. Then centrifuged for 15 minutes at maximum speed. Select the supernatant. The precipitate is washed with 200 μl of 70% ethanol, dried at room temperature and dissolved in 50 μl of TE buffer.

Samples are immediately used for PCR or stored at -80 ° C until analysis. Hypermethylation of 3 genes from one DNA sample after bisulfite modification is simultaneously assessed. For the analysis of each gene, 3 μl of DNA is used in the reaction mixture with a final volume of 25 μl.

Methyl Specific Polymerase Chain Reaction (MS-PCR).

MS-PCR was used to amplify the analyzed sequences of the p16, E-cadherin and GSTP1 genes. PCR was performed in an Eppendorf Mastercycler apparatus according to the following general scheme: 22 μl of PCR buffer containing 1 μl of 200 μM of each deoxyribonucleotide triphosphate, 3 μl of a solution of each oligonucleotide primer, 2 μl of 20 mM MgCl ₂ , 10 units was added to 3 μl of DNA. thermophilic DNA polymerase in 2 μl, 5 μl 5x, buffer, 6 μl deionized water (Herman, JG, Graff, JR, Myohanen, S., Nelkin, BD, and Baylin, SB Methylation - specific PCR: a novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad.Sci USA, 93: 9821-9826, 1996).

Further, the PCR modes and primers used for the methylated and unmethylated forms of each analyzed gene are individual.

Analysis of p16 gene methylation status using MS-PCR.

The reaction uses PCR to analyze the modified bisulfite DNA for the presence of methylated and unmethylated alleles of the p16INK4a gene. Primer sequences for p 16 gene hypermethylation analysis

When analyzing the p16 gene of a sample of the analyzed DNA, two 0.5 ml tubes are taken for PCR and in each 3 μl of the solution and the DNA of the test. 22 μl of the reaction mixture was added to one tube, as described above, to amplify a methylated sequence containing 15 pM primer p16Ma in 3 μl, 15 pM primer p16Mb reverse primer in 3 μl, and another 18 μl of the reaction mixture to amplify unmethylated sequence (3 μl p16Ua primer, 3 μl - 15 pM primer p16Ub - reverse primer).

Shake the tubes on a vortex and precipitate by short-term centrifugation, add one drop of mineral oil and place in a thermal cycler for PCR according to the following programs:

For methylated sequence:

1. 94 ° C 5 min

3. 65 ° C 3 min

4. 72 ° C 5 min

For unmethylated sequence:

1. 94 ° C 5 min

3. 57 ° C 3 min

4. 72 ° C 5 min

After amplification, the samples are mixed with electrophoresis paint and applied to a 10% polyacrylamide gel, electrophoresis is carried out until the leading dye reaches the lower edge of the gel. The gel is stained with ethidium bromide for 15 minutes and the result is evaluated by viewing the gel on a transilluminator. The size of the amplified methylated gene is 150 pairs of nucleotides (bp), and the size of the amplified non-methylated gene is 151 bp

To verify the biological sample for analysis, PCR was performed before bisulfite DNA conversion with p16Wa and p16Wb primers, which confirms the suitability of the sample for PCR analysis under the same conditions. 140 bp PCR amplification

In the case of assessing the detection of the hypermethylated form of the p16 gene in a DNA sample from blood plasma, where it can be present in small quantities in the early stages of an oncological disease, nested-PCR (nested PCR) with DNA is used after bisulfite conversion with p16Nb primers, 273 bp. and then 3 μl of the amplification was introduced as usual for the second PCR with primers p16Ma and p16Mb, as described above (150 bp).

E-cadherine Gene Methylation Status Analysis

The reaction uses PCR to analyze the modified bisulfite DNA for the presence of methylated and unmethylated alleles of the E-cadherine gene. E-cadherine gene hypermethylation primer sequences

E-Ma ggT gAA TTT TTA gTT AAT TAg Cgg TAC

E-Mb CAT FFC TAA CCg AAA ACg CCg

Product - 204 bp

E-Ua ggT Agg TgA ATT TTT AgT TAA TTA gTg gTA

E-Ub ACC CAT AAC TAA CCA AAA ACA CCA

Product - 211 bp

When analyzing the E-cadherine gene of a sample of the analyzed DNA, take two 0.5 ml tubes for PCR and in each 3 μl of the solution and the DNA of the test. 22 μl of the reaction mixture was added to one tube, as described above, to amplify a methylated sequence containing 15 pM E-Ma primer, 15 pM E-Mb reverse primer primer, and another 18 μl of the reaction mixture to amplify the unmethylated sequence (15 pM E primer -Ua, 15 pM primer E Ub - reverse primer).

Shake the tubes on a vortex and precipitate by short-term centrifugation, add one drop of mineral oil and place in a thermal cycler for PCR according to the following programs:

Primer annealing - 57 ° С - 40 seconds

Elongation - 72 ° C - 40 seconds

Denaturation - 95 ° C - 50 seconds

35 cycles

After amplification, the samples are mixed with electrophoresis paint and applied to a 10% polyacrylamide gel, electrophoresis is carried out until the leading dye reaches the lower edge of the gel. The gel is stained with ethidium bromide for 15 minutes and the result is evaluated by viewing the gel on a transilluminator. The size of the amplified methylated gene is 204 base pairs (bp), and the size of the amplified non-methylated gene is 211 bp

GSTP1 gene hypermethylation analysis (glutathione S transferase P1)

Hypermethylation analysis is performed using primers proposed by Gesl et al. (Goessi et al., 2001).

In the proposed method, the optimal conditions for MS-PCR are determined and the possibility of false positive results is excluded, given the prospect of studying blood plasma and cell sediment of urine of patients for the differential diagnosis of prostate adenoma and adenocarcinoma, and in some cases also when evaluating oncological processes in hepatomas, breast tumors and others.

As a positive control, a source of DNA with a hypermethylated form of the GSTP1 gene, the human LnCar cell line was used, where the gene is in the hypermethylated form, and as a negative control, the human cell line Du 145, where there is a normal methylation status (Hidefumi Kinoshita, Yan Shi, Carol Sandefur, Lorraine F. Meisner, Chawnshang Chang Methylation of the Androgen Receptor Minimal Promoter Silences Transcription in Human Prostate Cancer (Cancer Res 60, 3623-3630, July 1, 2000) .In addition, DNA samples from patients with prostate adenocarcinoma were used as a positive control. glands with identified m the presence of the hypermethylated form of the GSTP1 gene, provided by Professor Müller (Free University of Berlin).

Time and temperature sequence: for the GSTP1 gene.

1. Activation of polymerase 94 ° C (3 min)

2. Primer annealing

(specific hybridization with sequence

DNA matrix). 59 ° C (30 sec)

2.1. Chain synthesis. Elongation 72 ° C (30 sec)

2.2. Melting. 94 ° C (30 sec)

3. Excessive annealing of 59 ° C (30 sec)

3.1 Excessive synthesis. 72 ° C (30 sec)

Primers for the wild-type sequence of unmodified DNA.

GWS 5 ’- GACGCCCGGGGTGCAGCGGCCGCC 3’ - SENSE

GWA 5 ’- CCGCCCCAGTGCTGAGTCACGGCG 3’ - ANTISENSE

Primers for the unmethylated sequence of modified DNA.

GUS 5 ’- GATGTTTGGGGTGTAGTGGTTGTT 3’ - SENSE

GUA 5 ’- CCACCCCAATACTAAATCACAACA 3’ - ANTISENSE

Primers for the methylated sequence of modified DNA.

GMS 5 ’- TTCGGGGTGTAGCGGTCGTC 3’ - SENSE

GMA 5 ’- GCCCCAATACTAAATCACGACG 3’ - ANTISENSE

Electrophoresis of GSTP1 Gene Amplification Products

Electrophoresis of amplification products was carried out in a 10% polyacrylamide gel, in a vertical apparatus, under conditions as described above. A DNA fragment length marker (MB - 50-Base Pair Ladder 1 mg / ml (in increments of 50 nucleotide pairs) in a well was used.

Electrophoresis was carried out at a constant current of 20 mA. To visualize DNA fragments in the gel, the gel was kept in an aqueous solution of ethidium bromide (Sigma, Molecular Biology Grade) (10 μl of ethidium bromide (10 mg / ml) in 100 ml of distilled water). Then they looked through the gel on a transilluminator and transferred the data to a computer using the GeneScan video system (DNA-Technology).

Diagnosis is as follows.

If the DNA of a biological sample contains a hypermethylated form of one of three genes, two of three genes, or all three genes, then this biological sample may have a tumor origin.

If the DNA from the blood cells does not contain hypermethylated forms of one of the three genes, two of the three genes or all three genes, and the DNA from the blood plasma contains the hypermethylated form of one of the three genes, two of the three genes or all three genes, then this indicates the presence of a tumor in organism.

If DNA from blood plasma contains a hypermethylated form of one of three genes, two of three genes, or all three genes, then this indicates the presence of a tumor in the body.

If the DNA from the tumor contains hypermethylated forms of one of the genes, two of the three genes or all three genes, and the DNA from the blood plasma does not contain the hypermethylated form of one of the three genes, two of the three genes or all three genes, after surgical removal of the tumor or other treatment, this means the absence or presence of a very small number of remaining tumor cells in the body.

If the DNA from the tumor contains hypermethylated forms of one of the three genes, two of the three genes or all three genes, and the DNA from the blood plasma contains the hypermethylated form of the same genes after surgical removal of the tumor or other treatment, this means the presence of the remaining tumor cells in the body .

If the DNA from the tumor contains hypermethylated forms of one of three genes, two of three genes, or all three genes, then this indicates the functional inferiority of the corresponding gene, which is taken into account when prescribing therapeutic agents, the effectiveness of which depends on the condition of the listed genes.

If DNA from blood cells contains hypermethylated forms of one of three genes, two of three genes or all three genes, and DNA from blood plasma contains hypermethylated forms of one of three genes, two of three genes or all three genes, then this indicates the possibility of oncohematological disease .

Figure 1 presents the electrophoregram of the product of MC-PCR promoter gene p16. Use of unsteady PCR to enhance the MS-PCR of the hypermethylated form of the p16 gene in the DNA of biological samples. (Plasma DNA from a patient with stage 1 breast tumor - T ₁ N ₀ M ₀ ).

1 - amplification of DNA from a culture of PC3 human cells (hypermethylated by one allele of the p16 gene), using primers for hypermethylated genes;

2 - DNA amplification from a PC3 human cell culture (hypermethylated one allele of the p16 gene), when using primers for the p16 gene with normal methylation status;

3 - the amplification of the DNA of the blood plasma of a patient with a breast tumor of hypermethylation is not detected when using primers for hypermethylated genes;

1a - amplification of DNA from a PC3 human cell culture (hypermethylated by one allele of the p16 gene), when using primers for hypermethylated genes after preliminary enrichment of non-tested PCR;

2a - amplification of DNA from a PC3 human cell culture (hypermethylated by one allele of the p16 gene), when using primers for the p16 gene with normal methylation status after preliminary enrichment of unsteady PCR;

3a - amplification of the blood plasma of a patient with a breast tumor revealed hypermethylation when using primers for hypermethylated genes after preliminary enrichment of unsteady PCR;

Lad - DNA size markers.

Figure 2 presents the electrophoregram of the amplification product of the E-cadherine gene.

Amplification products of the E-cadherine gene after MS-PCR.

1 - markers of DNA size, bp pairs of nucleotides.

2, 3 - DNA samples of blood cells of a patient with lung cancer, with primers for methylated (2) and unmethylated (3) DNA sequences, respectively.

4, 5 - DNA samples from a PC3 cell culture with normal alleles, with primers for methylated (4) and unmethylated (5) DNA sequences, respectively.

6, 7 — DNA samples from MSF7 cell culture with normal alleles, with primers for methylated (6) and unmethylated (7) DNA sequences, respectively.

Hypermethylated (lane 4) and normal (lane 3) forms of the E-cadherine gene were detected.

8-9 - DNA samples of blood plasma of a patient with lung cancer, with primers for methylated (8) and unmethylated (9) DNA sequences, respectively.

Hypermethylation detected.

Figure 3 presents the electrophoregram of the amplification product of the GSTP1 gene.

1, 2 - samples with DNA of the LnCap cell line (with the hypermethylated GSTP1 gene in both alleles), with primers for the unmethylated and methylated DNA sequences, respectively.

3, 4 - samples with DNA of the cell sediment of the urine of a patient with prostate adenocarcinoma, with primers for methylated and unmethylated DNA sequences, respectively. Hypermethylated (lane 4) and normal (lane 3) forms of the GSTP1 gene were detected.

5 - DNA size markers.

Specific examples of the method for the diagnosis of cancer.

Example 1

Patient A. with cystic-fibrous mastopathy turned to diagnose a possible tumor by analyzing hypermethylated genes of tumor origin. When analyzing the methylation status of the p16 gene, it was revealed that under the conditions of preliminary enrichment of unsteady PCR in the DNA sample from the blood plasma, the hypermethylated form of the p16 gene is detected (Fig. 1). Further clinical examination, biopsy and subsequent surgery morphologically revealed the presence of breast adenocarcinoma in the 1st stage, which confirms the possibility of diagnosis.

Example 2

Patient D. complained of a prolonged coughing period and a slight increase in temperature in the evenings, as well as signs of hepatitis in the blood plasma, revealed a hypermethylated form of the E-cadherine gene, and no E-cadherine gene was detected in the blood cells (Fig. 2). A further examination in the blood plasma revealed a hundred-fold excess of the concentration of cancer antigen, and a lung tumor was detected clinically by computed tomography of the chest. Further, the presence of distant liver metastases was established. It turned out that the patient already has the fourth stage of cancer with distant metastases.

Example 3

Patient B. with prostate adenoma was analyzed for the presence of a hypermethylated form of the GSTP1 gene in DNA from a cell sediment of urine. The presence of a hypermethylated and normal form of the GSTP1 gene in this sample was detected. A subsequent biopsy at several points allowed us to morphologically detect the site of prostate adenocarcinoma in the adenoma (Fig. 3).

Example 4

Patient F. with cystic-fibrous mastopathy was analyzed for the presence of hypermethylated forms of these three genes. The presence of hypermethylated forms of the p16 and GSTP1 gene in blood plasma DNA was detected. No hypermethylated form of the E-cadherine gene was detected. The hypermethylated forms of these three genes were not found in blood cells. Subsequently, the presence of a breast tumor is confirmed by a clinically performed biopsy. Hypermethylated forms of the p16 gene and GSTP1, but not E-cadherine, were also detected in the removed tumor tissue.

The proposed method was studied about 200 samples, in more than 95% of cases, the diagnoses were confirmed by a known solution in the case of a positive analysis.

Our results indicate the possibility of using the proposed method for the diagnosis of cancer in diagnostic laboratories with improved accuracy and cheaper diagnostics using domestic reagents for DNA modification and the prospect of DNA testing of biological samples to assess the methylation status of the three listed genes.

Claims (1)

A method for the diagnosis of cancer, characterized in that the methylation status of the three genes p16, E-cadherine and GSTP1 is simultaneously measured in any biological samples of a person taken from blood plasma, urine, lymph nodes, tumor tissue, interstitial fluid, ascites fluid, blood cells and buccal epithelium, analyze DNA in which modified genes of tumor origin are present in any samples into which tumor cells or their components containing defective genes can enter, and analysis is carried out They are extracted by extraction and purification of DNA from biological samples, followed by bisulfite treatment of this DNA to modify unprotected cytosine bases while preserving 5-methylcytosine, which is a protected cytosine base, by subsequent PCR analysis of the treated and untreated bisulfite studied genes and when detecting changes obtained by electrophoresis PCR amplification, by detecting differences in the number and electrophoretic mobility of the respective fractions when comparing with unmethylated and methylated control samples containing normal and genes hypermethylated form, diagnose cancer.

Images