RU2242514C2 - Isolated tie-ligand-4 and its isolated fibrinogen-like domain; isolated nucleic acid molecule encoding indicated ligand; vector comprising indicated nucleic acid; method for preparing host-cell transformed with indicated vector; method for preparing tie-ligand-4; conjugate comprising indicated ligand; ligand-body comprising indicated fibrinogen-like domain - Google Patents

Abstract

FIELD: biotechnology, molecular biology, medicine, proteins.

SUBSTANCE: invention describes nucleotide sequence encoding new polypeptide (TIE-ligand-4) that relates to the family of TIE-ligands. Fragment of this nucleotide sequence relating to fibrinogen-like domain of new polypeptide is determined. Vectors comprising nucleic acid fragment with sequence encoding TIE-ligand-4 or its fibrinogen-like domain are constructed and used for transformation of host-cells and preparing corresponding recombinant polypeptides. Application of TIE-ligand-4 as component of conjugate with cytotoxic agent and its fibrinogen-like domain for formation of "ligand-body" is proposed.

EFFECT: improved preparing method, valuable biological and medicinal properties of ligand.

14 cl, 10 dwg, 14 ex

Description

The priority of this claims of the International PCT Application belongs to US No. 08 / 665,926, registered June 19, 1996, USA Provisional Application 60 / 021,087 registered July 2, 1996, and US Provisional Application 60 / 022,999 registered August 2, 1996. This application contains references to various publications . The contents of these publications in full are disclosed by reference provided in this application.

Introduction

The present invention relates mainly to the field of genetic engineering and especially to the field of genes for receptor tyrosine kinases and related ligands, their introduction into recombinant DNA vectors and the production of encoded proteins in recipient strains of microorganisms and recipient eukaryotic cells. More specifically, the present invention relates to new ligands, known as TIE ligand-3 and TIE ligand-4, which bind to the TIE-2 receptor, as well as methods for producing and using new ligands. In addition, the invention relates to nucleic acid sequences encoding TIE ligand-3 and TIE ligand-4, methods for producing nucleic acids and gene products. New TIE ligands, as well as the nucleic acids encoding them, may be useful in the diagnosis and treatment of certain diseases affecting endothelial cells and associated TIE receptors, such as neoplastic diseases, including tumor angiogenesis, wound healing, thromboembolic diseases, atherosclerosis, and inflammatory processes. In addition, ligands can be used to stimulate the proliferation and / or differentiation of hematopoietic stem cells.

The biologically active ligands according to the invention can be used to stimulate cell growth, cell survival, migration, and / or differentiation, and / or stabilization or destabilization of cells expressing the TIE receptor. Biologically active TIE ligands can be used in vitro to maintain TIE receptor expressing cells in culture. Cells and tissues expressing the TIE receptor include, for example, cardiac and vascular endothelial cells, eye lens epithelium and cardiac epicardium and early hematopoietic cells. On the other hand, such ligands can be used to promote cells obtained by genetic engineering in the expression of the TIE receptor. Further, ligands and their related receptors can be used in analytical systems to identify receptor agonists or antagonists.

BACKGROUND OF THE INVENTION

The behavior of the cell, which is responsible for the development, preservation and restoration of differentiated cells and tissues, is regulated, for the most part, using intercellular signals transmitted by growth factors and similar ligands and their receptors. Receptors are located on the cell surface of the responding cells, and they bind peptides or polypeptides, known as growth factors, as well as other hormone-like ligands. The result of this interaction is rapid biochemical changes in the responding cells, as well as fast and continuous regulation of cellular gene expression. Several receptors associated with different cell surfaces can bind specific growth factors.

Phosphorylation of tyrosized residues in proteins using tyrosine kinases is one of the key ways in which signals are transmitted through the plasma membrane. Several currently known tyrosine kinase protein genes encode transmembrane receptors for polypeptide growth factors and hormones such as epidermal growth factor (EGF), insulin, insulin-like growth factor-1 (IGF-1) derived from platelets, growth factors (PDGF-A and - B) and fibroblast growth factors (FGF) (Heldin et al., Cell Regulation, 1, 555-566, 1990; Ulrich, et al., Cell, 61, 243-254, 1990). In each example, these factors exhibit their inherent effect by binding to the extracellular part of their related receptors, which leads to the activation of that part of tyrosine kinase that is located on the cytoplasmic site of the receptor. Endothelial cell growth factor receptors are of particular interest due to the possible involvement of growth factors in some important physiological and pathological processes, such as vascular formation and development, angiogenesis, atherosclerosis, and inflammatory processes (Folkmann, et al., Science, 235, 442-447, 1987 ) Also, the receptors of certain hematopoietic growth factors are tyrosine kinases; they include c-fms, which is a receptor for colony stimulating factor 1 (Sherr, et al., Cell, 41, 665-676, 1985) and c-kit, an immature hematopoietic growth factor receptor reported in the publication (Huang, et al ., Cell, 63, 225-233, 1990).

Receptor tyrosine kinases are divided into evolutionary subfamilies based on the characteristic structure of their ectodomains (Ulrich, et al., Cell, 61, 243-254, 1990). Such subfamilies include kinase similar to the EGF receptor (subclass I) and kinase similar to the insulin receptor (subclass II), each of which contains repeating homologous cysteine-rich sequences in extracellular domains. The only cysteine rich region is also found in the extracellular domains of eph-like kinases (Hirai, et al., Science, 238, 1717-1720, 1987. Lindberg, et al., Mol. Cell. Biol, 10, 6316-6324, 1990; Lhotak, et al., Mol, Cell. Biol., 11, 2496-2502, 1991). PDGF receptors, as well as c-fms and c-kit receptor tyrosine kinases can be grouped into subclass III, while FGF receptors form subclass IV. Typical members of both of these subclasses are extracellular twisted parts stabilized by disulfide bonds within the chains. These so-called immunoglobulin-like folds are found in proteins of the immunoglobulin (Ig) superfamily, which contains a wide variety of other cell surface receptors having either cell-bound or soluble ligands (Williams, et al., Ann. Rev. ImmunoL, 6, 381 -405, 1988).

Receptor tyrosine kinases differ in their specificity and affinity. In general, receptor tyrosine kinases are glycoproteins that consist of (1) an extracellular domain capable of binding specific growth factors; (2) a transmembrane domain, which is usually the α-helical part of the protein; (3) a domain adjacent to the membrane, where the receptor can be regulated by, for example, protein phosphorylation; (4) a tyrosine kinase domain, which is an enzymatic component of the receptor; and (5) the carboxyl terminal tail, which at many receptors is involved in the recognition of substrates for tyrosine kinases.

Processes such as alternative splicing and the alternative selection of a gene promoter or polyadenylation sites have been reported to contribute to the production of several different polypeptides from the same gene. These polypeptides contain or do not contain the various domains listed above. As a result, some extracellular domains can be expressed as separate, secreted proteins, and some forms of the receptor may not have a tyrosine kinase domain and contain only the extracellular domain included in the plasma membrane via the transmembrane domain plus a short carboxyl terminal tail.

The gene encoding the transmembrane tyrosine kinase of endothelial cells was originally identified by RT-PCR as an unknown homologous tyrosine kinase cDNA fragment from human leukemic cells described in Partanen, et al., Proc. Natl. Acad. Sci. USA 87, 8913-8917, 1990. This gene and its encoded protein are called “TIE”, which means “tyrosine kinase with Ig and EGF-homologous domains” (Partanen, et al., Mol. Cell. Biol., 12, 1698- 1707, 1992).

It has been reported that tie mRNA is present in all human and mouse embryonic tissues. When checking it turned out, tie-mRNA is localized in the endothelial cells of the heart and blood vessels. In particular, tie-mRNA is located on the endothelium of blood vessels and endocardial cells of 9.5-18.5-day-old mouse embryos. Increased tie-expression was found in the process of neovascularization associated with the development of ovarian follicles and granulation of tissues in skin wounds. Thus, it is believed that TIEs play a role in angiogenesis, which is an important point in the development of treatment for solid tumors and some other angiogenesis-dependent diseases, such as diabetic retinopathy, psoriasis, atherosclerosis, and arthritis.

Two structurally similar rat TIE receptor proteins have been reported to be encoded by different genes with similar expression profiles. One gene, called tie-1, represents the rat homologue of the human tie (Maisonpierre, et al., Oncogene, 8, 1631-1637, 1993). Another gene, tie-2, may be the rat homologue of the mouse tek gene, which, like tie, is reported to be erepressed in the mouse exclusively in endothelial cells and their putative precursors (Dumont et al., Oncogene, 8, 1293-1301, 1993 ) The human tie-2 homolog is described in Ziegler, U.S. Patent No. 5.447,860, which was issued on September 5, 1995, where it is designated as “ork”. This document in its entirety is included in the present description.

It was found that both genes are widely expressed in endothelial cells of embryonic and postpartum tissues. Significant levels of tie-2 transcripts are also found in other embryonic cell populations, including the lens epithelium, cardiac epicardium, and mesenchyme regions (Maisonpierre, et al., Oncogene, 8, 1631-1637, 1993).

The predominant expression of the TIE receptor in the vascular endothelium suggests that TIE plays a role in the development and maintenance of the vascular system. His participation was noted in the determination, proliferation, differentiation of endothelial cells and cell migration and transformation into vascular elements. Analysis of mouse embryos characterized by deficiency in TIE-2 illustrates its importance in angiogenesis, especially in the formation of the vasculature in endothelial cells. In a mature vascular system, TIEs can function in the survival processes of endothelial cell conservation and in response to pathogenic effects.

TIE receptors are also expressed in immature hematopoietic stem cells, B cells, and a subpopulation of megakaryotic cells, thus suggesting the role of the ligands that bind these receptors in the early stages of hematopoiesis in the differentiation of megakaryocytes (Iwama et al., Biochem. Biophys. Res. Communications. 195, 301-309, 1993; Hashiyama et al., Blood, 87, 93-101, 1996; Batard et al., Blood, 87, 2212-2220, 1996).

Applicants previously identified an angiogenic factor, which was originally named ligand-1 TIE-2 (TL1), but is also referred to as angiopoietin-1 (Ang1), which transmits signals through the TIE-2 receptor and is essential for the normal development of the vascular system in the mouse. Using homologous screening, applicants also identified Ang1 called ligand-2 TIE-2 (TL2), or angiopoietin-2 (Ang2), which exists as an antagonist of Ang1 and TIE-2 receptor. For a description of the cloning and sequencing of TL1 (Ang1) and TL2 (Ang2), as well as for methods for their preparation and use, reference is made here to PCT International Application No. WO 96/11269, published April 18, 1996, and PCT International Application No. WO 96 / 31598, published October 10, 1996, both at Regeneron Pharmaceuticals, Inc .; and S. Davis et al., Cell, 87, 1161-1169, 1969, each of which is incorporated herein by reference. The absence of Ang1 causes serious vascular abnormalities in the developing mouse embryo. Ang1 and Ang2 provide naturally occurring positive and negative regulators of angiogenesis. Positive or negative regulation of TIE-2 probably leads to different results, depending on the combination of simultaneously acting angiogenic signals.

Summary of invention

The present invention provides a composition comprising TIE ligand-3 or TIE ligand-4, essentially free of other proteins. The invention also provides an isolated nucleic acid molecule encoding a TIE ligand-2 and an isolated nucleic acid molecule encoding a TIE ligand-4. An isolated nucleic acid may be DNA, cDNA or RNA. The invention also provides a vector containing an isolated nucleic acid molecule encoding TIE ligand-3 or TIE ligand-4. The invention further provides a host-vector system for production in a corresponding host cell of a polypeptide having the biological activity of TIE ligand-3 or TIE ligand-4. A suitable host cell may be a bacterial, yeast, insect or mammalian cell. The invention also discloses a method for producing a polypeptide having the biological activity of TIE ligand-3 or TIE ligand-4, which includes growing cells of the host-vector system under conditions that allow to obtain polypeptides and allocate them in this way.

An invention describing an isolated nucleic acid molecule encoding a TIE ligand-3 or TIE ligand-4 further discloses the construction of a ligand, fragment or derivative thereof, or other molecule that is a receptor agonist or antagonist as a therapeutic agent for treating patients suffering from disorders involving cells, tissues and organs that express the TIE receptor. The present invention also provides an antibody that specifically binds to a similar therapeutic molecule. The antibody may be monoclonal or polyclonal. The invention also discloses a method of using such a monoclonal or polyclonal antibody to determine the amount of a therapeutic molecule in a sample taken from a patient in order to control the course of therapy.

The present invention also provides an antibody that specifically binds TIE ligand-3 or TIE ligand-4. The antibody may be monoclonal or polyclonal. Thus, the invention discloses therapeutic compositions comprising an antibody that specifically binds TIE ligand-3 or TIE ligand-4 and a pharmaceutically acceptable carrier. The invention also discloses a method of inhibiting the growth of a blood vessel in a mammal by administering an effective amount of a therapeutic composition comprising an antibody that specifically binds TIE ligand-3 or TIE ligand-4 in a pharmaceutically acceptable carrier.

The invention further discloses a therapeutic composition comprising a TIE ligand-3 or TIE ligand-4 in a pharmaceutically acceptable carrier. The invention also discloses a method of stimulating neovascularization in a patient by administering an effective amount of a therapeutic composition comprising TIE ligand-3 or TIE ligand-4 in a pharmaceutically acceptable carrier. In one embodiment, the method can be used to stimulate wound healing. In another embodiment, the method can be used to treat ischemia. In a further embodiment, TIE ligand-3 or TTE ligand-4 is used either alone or in combination with other hematopoietic factors to stimulate the proliferation or differentiation of hematopoietic stem cells, B cells or megakaryocytes.

Alternatively, the invention provides that TIE ligand-3 or TIE ligand-4 can be combined with a cytotoxic agent and a therapeutic composition prepared from them. The invention further relates to a receptor body that specifically binds TIE ligand-3 or TIE ligand-4. The invention further discloses therapeutic compositions comprising a receptor body that specifically binds TIE ligand-3 or TIE ligand-4 in a pharmaceutically acceptable carrier. The invention also discloses a method of inhibiting the growth of a blood vessel in a mammal by administering an effective amount of a therapeutic composition comprising a receptor body that specifically binds TIE ligand-3 or TIE ligand-4 in a pharmaceutically acceptable carrier.

The invention also relates to a TIE receptor antagonist, as well as a method for inhibiting the biological activity of a TIE ligand-3 or TIE ligand-4 in a mammal, comprising administering to the mammal an effective amount of a TIE antagonist. According to the invention, the antagonist may be a TIE ligand-3 or TIE ligand-4, as described herein, an antibody or other molecule capable of specific binding of the TIE ligand-3 or TIE ligand-4 receptor, or TIE receptor, or the body of a ligand containing the fibrinogen-like domain of TIE ligand-3 or TIE ligand-4.

Brief Description of the Figures

Figures 1A and 1B show the body of the TIE-2 receptor (TP TIE-2 inhibits the development of blood vessels in the chorioallantoid membrane of the chicken embryo (HAM). One piece of absorbing gelatin film (Gelfoam), soaked with 6 μg TP, is immediately placed under the HAM of 1-day chicken embryo. After a further 3 days of incubation, the 4-day-old embryos and surrounding CAMs are removed and examined. Figure 1A: embryos treated with ENK-1-TP (rENK-1 ecto / hIgGl Fc) were viable and had normally developed blood vessels in the surrounding their HAM Figure 1B: all embryos treated with TIE-2-TP (rTIE-2 e cto / h IgG1 Fc), died, decreased in size and were almost completely devoid of surrounding blood vessels.

Figure 2 is a schematic representation of the hypothetical role of TIE-2 / TIE ligands in angiogenesis. TL1 is marked as (•), TL2 as (*), TIE-2 as (T), VEGF as ([]), and fik-1 (VEGF receptor) as (Y).

Figure 3 is a schematic representation of TIE-2 ligands showing supercoiled and fibrinogen-like domains and the construction of multimers of fibrinogen-like domains using anti-myc antibodies as labels, as well as Fc labeling.

Figure 4 is a typical binding curve of TIE-2IgG with immobilized TL1 in a quantitative analysis of binding in a cell-free medium.

Figure 5 is a typical curve showing the binding of a TIE-2 ligand body 1 containing the fibrinogen-like ligand domain linked to the immunoglobulin IgG Fc domain (TLl-fFc) to the immobilized TIE-2 ectodomain in a quantitative analysis of binding in a cell-free medium.

Figure 6A-6B shows the nucleotide and their corresponding amino acid (single-letter code) TIE ligand-3 sequences. Coding sequences begin at position 47. The fibrinogen-like domain begins at position 929.

Figure 7 is a comparison of the amino acid sequences of the TIE ligand family. mAng3 = mTL3 = murine TIE ligand-3; hAng4 = hTL4 = human TIE ligand-4; hAngl = hTLl = human TIE-2 ligand 1; mAngl = mTLl = murine TIE-2 ligand 1; mAng2 = mTL2 = mouse TIE-2 ligand; hAng2 = mTL2 = human TIE-2 ligand 2. Underlined regions indicate conserved regions of homology among family members.

Figure 8F-8C - nucleotide and their corresponding amino acid (single-letter code) sequence of the TIE ligand-4. The arrow indicates the position of nucleotide 569.

Figure 9 - BIAcore analysis to evaluate the binding of angiopoietin-4 to TIE1 and TIE2 receptors. BIAcore binding assays of the indicated angiopoietins or chimeric angiopoietins, including angiopoietin-4 or Ang4Chim, with BIAcore chips coated with immobilized TIE1 and TIE2 receptors were performed in competition with excess amounts of either an irrelevant soluble receptor (TrkB, T1 or TIE2 receptors.

Figure 10 - Activation of the TIE2 receptor using Ang4Chim. Three cell lines (EAhy926, bEND, and MG 3T3) were exposed to Ang4Chim, and TIE2 phosphorylation was determined.

Detailed Description of the Invention

As described in detail below, applicants have isolated and identified new ligands related to the TIE-2 ligands that bind the TIE-2 receptor. New ligands that can be purified from natural material or made recombinantly are referred to herein as TIE ligand-3 (TL3) and TIE ligand-4 (TL4). Other members of the TIE ligand family are referred to herein as TIE ligand I (TL1), also known as angiopoietin-1 (Ang1) and TIE-2 ligand 2 (TL2), also known as angiopoietin-2 (Ang2). The applicants here describe a family of TIE ligands and identify conserved regions of homology among family members. New TL3 and TL4 ligands should be tested to determine whether they have functions and uses similar to those of the known TLI (Ang1) and TL2 (Ang2) ligands in angiogenesis and hematopoiesis.

The present invention includes new ligands and their amino acid sequences, as well as their functionally equivalent variants containing naturally occurring allelic variations, as well as proteins or peptides containing substituents, divisions or included mutations of the described sequences that bind the TIE receptor and act as their agonists or antagonists. Such variants include those in which amino acid residues are replaced by residues in a sequence leading to an imperceptible change. For example, one or more amino acid residues in a sequence can be replaced by another amino acid (s) of a similar polarity, which acts as a functional equivalent, leading to an imperceptible change. The amino acid substituents in the sequence may be selected from other members of the group to which the amino acid belongs. For example, a group of non-polar (hydrophobic) amino acids includes alanine, leucine, isoleucine, valine, proline, phenylalanine, toptophan and methionine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine. Positively charged (basic) amino acids include arginium, lysine and histidine. Negatively charged (acidic) amino acids include aspartic and glutamic acids.

Also included in the scope of the invention are proteins or fragments thereof or their derivatives that exhibit the same biological activity as the TIE ligand-3 or TIE ligand-4 described herein, and derivatives that are modified in different ways during or after translation her, proteolytic cleavage, binding to an antibody molecule or other cellular ligand, etc. Functionally equivalent molecules also include molecules that contain modifications that include N-terminal modifications resulting from expression in a single recombinant host, such as, for example, N-terminal methylation, which occurs in certain bacterial (e.g., E. Coli) expression systems . Functional equivalents also include mutants in which the substituted amino acid is cysteine in order to increase the stability of the molecules and prevent the formation of undesired cross-links.

The present invention also includes a nucleotide sequence that encodes a protein described herein as TIE ligand-3, a nucleotide sequence that encodes a protein described herein as TIE ligand-4, as well as host cells including yeast, bacterial, viral cells and cells mammals that are genetically engineered to produce protein by transfection, transduction, infection, electroporation, or microinjection of a nucleic acid encoding TIE ligand-3 or TIE ligand-4 described herein in a suitable expressing vector. The present invention also includes the introduction of a nucleic acid encoding a TIE ligand-3 or TIE ligand-4 by gene therapy methods as described, for example, in Finkel and Epstein FASEB J., 9, 843-851, 1995; Guzman et al., PNAS, USA, 91, 10732-10736, 1994.

It will be understood by those skilled in the art that the present invention includes DNA and RNA sequences that hybridize to a correspondingly obtained sequence encoding TIE ligand-3 or TIE ligand-4 with moderate accuracy, as described, for example, by Sambrook et al., Molecular Cloning: A Laboratory Manual, 2 ed. Vol. 1, pp. 101-104, Cold Spring Harbor Laboratory Press, 1989. Thus, the nucleic acid molecule of the invention comprises one sequence derived from the amino acid sequence encoding TIE ligand-3 or TIE ligand-4, obtained as described herein, and a molecule with a nucleic acid sequence that hybridizes to a similar nucleic acid sequence, as well as a nucleic acid sequence that is made from the above sequences using a genetic code, but which encodes there is a ligand that binds a TIE receptor and has an amino acid sequence and other primary, secondary and tertiary characteristics that sufficiently reproduce the ligand described here, so as to give the molecule the same biological activity as TIE ligand-3 or TIE ligand -4 described here.

Thus, the present invention includes an isolated and purified nucleic acid molecule containing a nucleotide sequence encoding a mammalian TIE ligand-3, where the nucleotide sequence is selected from the group consisting of:

a) the nucleotide sequence containing the coding region of the TIE ligand-3 of mammals, as shown in figa-6B;

b) a nucleotide sequence containing the coding region of the fibrinogen-like domain of TIE ligand-3, as shown in figa-6B;

c) a nucleotide sequence that moderately severely hybridizes to the nucleotide sequence (a) or (b) and which encodes a ligand that binds a TIE receptor;

and

d) a nucleotide sequence which, if not for the degeneracy of the genetic code, should hybridize with c) the nucleotide sequence (a), (b) or (c) and which encodes a ligand that binds the TIE receptor.

Further, the present invention includes isolated and purified TIE ligand-3, encoded by an isolated nucleic acid molecule according to the invention. The invention also discloses a vector that comprises an isolated nucleic acid molecule comprising a sequence encoding mammalian TIE ligand-3.

The present invention also includes an isolated and purified nucleic acid molecule containing a nucleotide sequence encoding a human TIE ligand-4, where the nucleotide sequence is selected from the group consisting of:

(a) a nucleotide sequence containing the coding region of human TIE ligand-4, included in the vector and designated as hTL-4, deposited July 2, 1996 (ATCC Accession No. 98095);

(b) the nucleotide sequence containing the coding region of the fibrinogen-like domain of TIE ligand-4 included in the vector and designated as hTL-4, deposited July 2, 1996 (ATCC Accession No. 98095);

(c) a nucleotide sequence that hybridizes under moderately stringent conditions to the nucleotide sequence of (a) or (b) and which encodes a ligand that binds a TIE receptor; and

(d) a nucleotide sequence which, if not for the degeneracy of the genetic code, should hybridize with the nucleotide sequence (a), (b) or (c), which encodes a ligand that binds the TIE receptor.

Further, the present invention includes an isolated and purified nucleic acid molecule containing a nucleotide sequence encoding a human TIE ligand-4, where the nucleotide sequence is selected from the group consisting of:

(a) a nucleotide sequence containing the coding region of human TIE ligand-4, as shown in figa-8C;

(b) the nucleotide sequence containing the coding region of the fibrinogen-like domain of TIE ligand-4, human, as shown in figa-8C;

(c) a nucleotide sequence that hybridizes under moderately stringent conditions to the nucleotide sequence of (a) or (b) and which encodes a ligand that binds a TIE receptor; and

(d) a nucleotide sequence that, as a result of degeneration of the genetic code, differs from a nucleotide sequence (a), (b) or (c) that encodes a TIE-2 ligand that binds a TIE receptor.

Further, the present invention provides isolated and purified TIE ligand-4 encoded by an isolated nucleic acid molecule according to the invention. The invention also relates to a vector that includes an isolated nucleic acid molecule containing a nucleotide sequence encoding human TIE ligand-4.

Any of the methods known for those skilled in the art to introduce DNA fragments into a vector can be used to construct expression vectors encoding TIE ligand-3 or TIE ligand-4 using appropriate transcriptional / translational control signals and protein coding sequences. These methods may include recombinant DNA and in vivo synthesis and recombination methods (genetic recombination). The expression of the nucleotide sequence encoding a TIE ligand-3 or TIE ligand-4 or their peptide fragments can be regulated using a second nucleotide sequence that is associated with a sequence encoding a TIE ligand-3 or TIE ligand-4, such that the TIE ligand-3 or TIE ligand-4 protein or peptide is expressed in host cells transformed with a recombinant DNA molecule. For example, the expression of TIE ligand-3 or TIE ligand-4 described herein can be controlled by any promoter / enhancer element known in the art. Promoters that can be used to control ligand expression include, but are not limited to, a long terminal repeat, as described in Squinto et al., Cell, 65, 1-20, 1991; SV40 early promoter region (Bernoist and Chambon, Nature, 290, 304-310), CMV promoter, 5'-terminal repeat of M-MulV, dromotor enclosed in a long 3'-terminal repeat of Routh sarcoma virus (Yamamoto et al., Cell, 22, 787-797, 1980) herpes thymidine kinase promoter (Wagner et al., Proc. Natl. Acad, Sci. USA, 78, 144-145, 1981), adenovirus promoter, metallothionoin gene regulatory sequences (Brinster et al ., Nature, 296, 39-42, 1982) expressing prokaryotic vectors, such as the β-lactamase promoter (Villa-Kamaroff et al., Proc. Natl. Acad, Sci. USA, 75, 3727-3731, 1978), or tac promoter (DeBoer et al., Proc. Natl. Acad, Sci. USA, 80, 21-25, 1983), see also “Useful ki from recombinant bacteria "in Scientific American, 242, 74-94, 1980; promoter elements from yeast or other fungi, such as the Gal 4 promoter, the ADH promoter (alcohol dehydrogenase), the PGK promoter (phosphoglycyrinkinase), the alkaline phosphatase promoter, and the following transcriptional control regions of animals that exhibit tissue specificity and are used in transgenic animals; a control region of the elastase I gene that is active in pancreatic acinar cells (Swift et al., Cell, 38, 639-646, 1984; Ornitz et al., Cold Spring Harbor Symp. Quant. Biol., 50, 399-409, 1986 ; MacDonald, Hepatology, 7, 425-515, 1987); a control region of the insulin gene that is active in pancreatic beta cells (Hanahan, Nature, 315, 115-122, 1985); a control region of an immunoglobulin gene that is active in lymphoid cells (Grosscheld et al., Cell, 38, 647-658, 1984; Adames et al., Nature, 318, 533-538, 1985; Alexander et al., Mol. Cell. Biol., 7, 1436-1444, 1987); the control region of the mouse mammary tumor virus, which is active in testicular cells, breast cells, lymphoid and mast cells (Leder et al .. Cell, 45, 485-495, 1986); the control region of the albumin gene that is active in the liver (Pinkert et al., Genes and Devel, 1, 268-276, 1987), the control region of the alpha-fetoprotein gene that is active in the liver (Krumlauf et al., Mol. Cell. Biol ., 5, 1639-1648, 1985; Hammer et al., Science, 235, 53-58, 1987); the control region of the alpha 1-antitrypsin gene, which is active in the liver (Kelsey et al., Genes and DeveL, 1, 161-171, 1987), the control region of the beta-globin gene, which is active in myeloid cells (Mogram et al., Nature , 315, 338-340, 1985; Kollias et al., Cell, 46, 89-94, 1986); a control region of the myelin base protein gene that is active in oligodendrocytes in the brain (Readhead et al., Cell, 48, 703-712, 1987); the control region of the myosin light chain-2 gene, which is active in skeletal muscle (Shani, Nature, 314, 283-286, 1985), and the control region of the gonadotropic releasing hormone, which is active in the hypothalamus (Mason et al., Science, 234, 1372 -1378, 1986). The invention further includes the preparation of antisense compounds that exhibit the ability to specifically hybridize to an RNA sequence encoding a TIE ligand-3 or TIE ligand-4 to modulate its expression (Ecker, U.S. Patent No. 5,166,195, issued November 24, 1992).

Thus, according to the invention, expression vectors capable of replication in a bacterial or eukaryotic host containing a nucleic acid encoding the TIE ligand-3 or TIE ligand-4 described herein are used to transform host cells that will directly express such nucleic acid to produce TIE ligand-3 or TIE ligand-4, which can then be converted into a biologically active form. As discussed herein, a biologically active form includes a form capable of binding to the TIE receptor and inducing a biological effect, such as a differentiation function, or affect the phenotype of a cell expressing the receptor. Such biologically active forms may, for example, cause phosphorylation of the tyrosine case domain of the TIE receptor. Otherwise, the biological activity of the ligand can manifest itself through the action of the ligand as an antagonist to the TIE receptor. In alternative embodiments, the active form of TIE ligand-3 or TIE ligand-4 is a form that can recognize the TIE receptor and thereby act as a target for the receptor, which is used both in diagnosis and therapy. In accordance with such options, the active form does not force any expressing TIE cell to make any changes in the phenotype.

Expression vectors containing gene inserts can be identified using 4 main methods:

(a) DNA-DNA hybridization; (b) the presence or absence of a “marker” of gene functions; (c) expression of the inserted sequences; and (d) detection by PCR. In the first method, the presence of a foreign gene inserted into the expression vector can be detected by DNA-DNA hybridization using samples containing sequences homologous to the inserted gene encoding TIE ligand-3 or TIE ligand-4. In the second method, a recombinant vector in the host system can be identified and selected based on the presence or absence of certain functions of “marker” genes (for example, thymidine kinase activity, resistance to antibiotics, phenotype transformation, impaired body formation in baculovirus, etc.) caused by the introduction of foreign genes in vector. For example, if a nucleic acid encoding a TIE ligand-3 or TIE ligand-4 is inserted into the marker gene sequence of a vector, then the recombinants containing the insert can be identified by the absence of marker gene function. In a third method, recombinant expression vectors can be identified by analyzing a foreign gene product expressed by a recombinant. Such assays can be based, for example, on the physical or functional properties of the gene product TIE-ligand-3 or TIE-ligand-4, for example, on the binding of the ligand to the TIE receptor or part thereof, and the receptor can be labeled, for example, with a defined antibody or part of it, or by binding to antibodies obtained against the protein TIE-ligand-3 or TIE-ligand-4 or against its part. Cells of the present invention can either transiently, or preferably constitutively or continuously express, the TIE ligand-3 or TIE ligand-4 described herein. In a fourth method, DNA nucleotide primers can be prepared according to a tie-specific DNA sequence. These primers can then be used for PCR of the tie gene fragment (PCR Protocols: A Guide To Methoda and Applications, Edited by Michael A. Innis et al., Academic Press, 1990).

The recombinant ligand can be purified by a method that subsequently allows the formation of a stable biological active protein. Preferably, the ligand is secreted into the culture medium from which it can be isolated. Conversely, the ligand can be isolated from cells either as soluble proteins or as inclusion bodies, from which it can be quantitatively extracted with 8 M guanidine hydrochloride and dialyzed in accordance with a well-known method. For further purification of the ligand, affinity chromatography, suitable ion exchange chromatography, hydrophobic interaction chromatography, reverse phase chromatography or gel filtration can be used.

In further embodiments of the invention, as described in more detail in timers, a recombinant gene encoding a TIE ligand-3 or TIE ligand-4 can be used to inactivate an endogenous gene by homologous recombination and thereby create a cell, tissue or animal lacking coding TIE ligand-3 or TIE ligand-4. As a non-limiting example of the invention, a recombinant gene encoding a TIE ligand-3 or TIE ligand-4 can be obtained by genetic engineering so that it contains an inserted mutation, for example, a neo-gene that will inactivate the native gene, encoding encoding TIE ligand-3 or TIE ligand-4. Such a construct, under the control of a suitable promoter, can be introduced into a cell, such as an embryonic stem cell, using a method such as transfection, transduction or injection. Cells containing the construct can then be selected based on G 418 resistance. Cells that lack the intact gene encoding TIE ligand-3 or TIE ligand-4 can be identified, for example, by Southern blotting, PCR, Northern blotting or expression analysis. Cells lacking the intact gene encoding TIE ligand-3 or TIE ligand-4 can be fused to the embryo cells at an early stage of development to produce transgenic animals that lack such a ligand. A similar animal can be used to control specific in vivo processes associated with the ligand.

The present invention also provides antibodies to the TIE ligand-3 or TIE ligand-4 described herein, which are used to determine the ligand, for example, for diagnostic purposes. To obtain monoclonal antibodies against TIE ligand-3 or TIE ligand-4, you can use any technique that provides the production of antibody molecules using cell strains in culture. In the scope of the present invention are, for example, a hybridoma technique originally developed by Kohler and Milstein (Nature, 256, 495-497, 1975), as well as a triomeric technique, a hybridoma technique with a human B cell (Kozbor et al., Immunology Today, 4 , 72, 1983) and the EBV hybridoma technique for the production of human monoclonal antibodies (Cole et al., In “Monoclonal Antibodies and Cancer Therapy.” Alan R. Inc. Pp. 77-96, 1985).

Monoclonal antibodies may include human monoclonal antibodies or chimeric human-mouse (or other types) monoclonal antibodies. Human monoclonal antibodies can be obtained using any of the numerous techniques known in the art (e.g., Teng et al., Proc. Natl. Acad. Sci. USA, 80, 7308-7312, 1983; Kozbor et al., Immunology Today, 4, 72, 1983; Olsson et al., Meth. Enzymol., 92, 3-16, 1982). The resulting chimeric antibody molecules may contain a murine antigen binding domain with human constant regions (Morrison et al., Proc. Natl. Acad .. Sci. USA, 81, 6851, 1984; Takeda et al., Nature, 314, 452, 1985 )

To obtain polyclonal antibodies; to the epitopes of TIE ligand-3 or TIE ligand-4 described herein, various procedures known in the art can be used. To produce antibodies from various animal hosts, including, but not limited to, the invention; for example, rabbits, mice and rats can be immunized by administering a TIE ligand-3 or TIE ligand-4 or a fragment thereof and produced. Various adjuvants are used to enhance the host-specific immune response, which include, but are not limited to, Freund's adjuvant (complete or incomplete), mineral gels, such as aluminum hydroxide, surfactants such as lysolecithin, pluronic polyols, polyanions, peptides , oil emulsions, highly specific hemocyanins [induce a highly specific immune response], dinitrophenols and applicable human adjuvants such as BCG (Bacille Calmette-Guerin) and Corynebacterium parvum.

A molecular clone of an antibody to a selected epitope of TIE ligand-3 or TIE ligand-4 can be obtained using known techniques. Recombinant DNA methodology (Maniatis et al., Molecular Cloning, A Laboratory Mainuai, Cold Spring Harbor, New York) can be used to construct nucleic acid sequences that encode a monoclonal antibody molecule or its antigen binding region.

The present invention relates to antibody molecules, as well as fragments of such antibody molecules. Antibody fragments that contain the idiotype of the molecule can be produced using known techniques. For example, such fragments, by way of non-limiting example, include an E (ab ') ₂ fragment, which can be obtained by cleaving the antibody molecule with pepsin; Fab'-fragments, which can be obtained by reducing the disulfide bridges of the F (ab ') ₂ fragment, and Fab-fragments, which can be obtained by treating the antibody molecule with papain and a reducing agent. Antibody molecules can be purified using known techniques, for example, immunoabsorption or immune affinity chromatography, chromatographic methods such as HPLC (high performance liquid chromatography), or a combination of these methods.

The present invention further includes an immunoassay to evaluate the amount of TIE ligand-3 or TIE ligand-4 in a biological sample based on

a) contacting the biological sample with at least one antibody that specifically binds TIE ligand-3 or TIE ligand-4 so that the antibody complexes with any of these ligands present in the sample; and

b) measuring the amount of the complex and thereby measuring the amount of TIE ligand-3 or TIE ligand-4 in a biological sample.

The present invention further includes a method for measuring the amount of TIE receptor in a biological sample based on

a) contacting the biological sample with at least one ligand according to the invention so that the ligand forms a complex with the TIE receptor; and

b) measuring the amount of the complex and thereby measuring the amount of the TIE receptor in the biological sample.

The present invention also discloses the use of TIE ligand-3 or TIE ligand-4 to support the survival and / or growth and / or migration and / or differentiation of cells expressing a TIE receptor. Thus, the ligand can be used as an additive to maintain, for example, endothelial cells in culture.

Further, the discovery by applicants of additional ligands for the TIE receptor facilitates the utilization of systems used to identify TIE receptor agonists or antagonists. Such systems may be useful in identifying molecules that can stimulate or inhibit angiogenesis. For example, in one embodiment, TIE receptor antagonists can be identified as test molecules that can interfere with the interaction of a TIE receptor with a biologically active TIE ligand-3 or TIE ligand-4. Such antagonists are identified by their ability 1) to block the binding of the biologically active TIE ligand-3 or TIE ligand-4 to the receptor, as was verified, for example, using the BIAcore biosensor technique (BIAcore; Pharmacia Biosensor, Piscataway, NJ); or 2) block the ability of a biologically active TIE ligand-3 or TIE ligand-4 to elicit a biological response. Such biological responses include, by way of non-limiting example, phosphorylation of the TIE receptor or its components with a direct sequence (reading in the forward direction from 5 ′ to 3 ′) of the signal transduction pathway, or the survival, growth, or differentiation of cells carrying the TIE receptor.

In one embodiment, the growth of cells obtained by genetic engineering techniques for expressing a TIE receptor may depend on the addition of TIE ligand-3 or TIE ligand-4. Such cells are useful systems for identifying additional TIE receptor agonists or antagonists that can inhibit the activity of TIE ligand-3 or TIE ligand-4 on such cells. Alternatively, autocrine cells created by genetic engineering to coexpress TIE ligand-3 and receptor, or TIE ligand-4 and receptor, are useful systems for analyzing potential agonists or antagonists.

Therefore, the present invention discloses a method of introducing a TIE receptor into cells that do not usually express this receptor, thereby allowing these cells to exhibit deep and easily distinguishable responses to the ligand that binds this receptor. The type of response evoked depends on the cells used, and not on the specific receptor introduced into the cell. You can select the appropriate cell lines to obtain the most favorable response for analysis, as well as for the detection of molecules that can act on tyrosine kinase receptors. The molecules can be of any type, including, but not limited to, peptide and non-peptide molecules that can act in the described systems according to a receptor-specific method.

One of the more useful systems under development includes the introduction of a TIE receptor (or a chimeric receptor containing the extracellular domain of another receptor tyrosine kinase, such as trkC, and the intracellular domain of the TIE receptor) into the fibroblast line (e.g., NIH3T3 cells), thus such a receptor, which normally does not mediate proliferative or other responses, can be analyzed after introduction into fibroblasts by a variety of well-established methods for quantifying the influence of fibroblast growth factors (e.g., thymidine exclusion or other methods for assessing proliferation (see Van Zoelen, 1990, “Using Biological Assays to Determine Polypeptide Growth Factors” in Progress Factor Research, vol. 2, pp. 131-152; Zhan and M. Goldfarb, Mol. Cell. Biol., Vol. 6, pp. 3541-3544, 1986) These assays have the added advantage that any preparation can be analyzed on a cell line with an inserted receptor, as well as on a line of parent cells without a receptor; only specific effects on the cell line with the receptor should be evaluated as mediated by the introduced receptor. Similar cells can be further created by genetic engineering techniques to express TIE ligand-3 or TIE ligand-4, thereby creating an autocrine system used to analyze molecules that act as antagonists / agonists of this interaction. Thus, the present invention provides host cells comprising a nucleic acid encoding a TIE ligand-3 or TIE ligand-4 and a nucleic acid encoding a TIE receptor.

The interaction of a TIE receptor with a TIE ligand-3 or TIE ligandan-4 also provides a useful system for identifying small molecules of TIE receptor agonists or antagonists. For example, fragments, mutants or derivatives of TIE ligand-3 or TIE ligand-4 can be identified when they bind to the TIE receptor, but do not cause any other biological activity. In addition, the characterization of TIE ligand-3 or TIE ligand-4 helps to determine the active parts of the molecule. Further, the identification of the ligand contributes to the determination of the crystal structure of the receptor / ligand complex using x-ray diffraction analysis, thereby facilitating the identification of the binding site on the receptor. Knowledge of the binding site will give an idea of the rational design of new agonists and antagonists.

The specific binding of the test molecule to the TIE receptor can be evaluated in various ways. For example, the true binding of a test molecule to TIE expressing cells can be determined or measured by determining or measuring (i) the test molecule bound to the surface of intact cells; (ii) a test molecule crosslinked with a TIE protein in cell lysates; or (iii) an in vitro TIE-linked test molecule. The specific interaction between the test molecule and TIE can be evaluated using reagents that reveal the unique properties of this interaction.

As a specific non-limiting example of the invention, the methods of the invention can be used as follows. Consider the case where TIE ligand-3 or TIE ligand-4 needs to be measured in a sample. A sample of varying degrees of dilution (test molecule) in parallel with a negative control (NC) not containing the activity of TIE ligand-3 or TIE ligand-4, and a positive control (PC) containing a known amount of TIE ligand-3 or TIE- ligand-4 can be applied to cells that express TIE in the presence of labeled activity of TIE ligand-3 or TIE ligand-4 (in this example, a radioiodinated ligand). The amount of TIE ligand-3 or TIE ligand-4 in the test sample can be estimated by determining the amount of ¹²⁵ I-labeled TIE ligand-3 or ¹²⁵ I-labeled TIE ligand-4, which is associated with the control in each of the dilutions and then by comparing the values in the sample with a standard curve. The more TIE ligand-3 or TIE ligand-4 in the sample, the less ¹²⁵ I-labeled ligand that will bind to TIE.

The amount of ¹²⁵ I-labeled bound ligand can be determined by measuring the amount of radioactivity per cell or by cross-linking TIE ligand-3 or TIE ligand-4 with cell surface proteins using DSS as described (Meakin and Shooter, Neuron, 6, 153-163, 1991), and by determining the amount of labeled protein in cell extracts, using, for example, polyacrylamide gel electrophoresis with sodium dodecyl sulfate (SDS), which can detect labeled protein having a size corresponding to TIE receptor / TIE ligand complexes -3 or TIE recipe / TIE-ligand-4. The specific interaction of the test molecule with TIE can then be tested by adding an unlabeled control ligand to the different dilution system that does not bind the TIE receptor and therefore should not have a significant effect on competition between the labeled TIE ligand-3 or TIE ligand-4 and the test molecule for binding to TIE. In addition, it can be expected that a molecule capable of disrupting the binding of the TTE receptor to the TIE ligand-3 or TIE ligand-4, such as, as a non-limiting example, an anti-TIE antibody or receptor body TIE body, as described here , violates the competition between ¹²⁵ I-labeled TIE ligand-3 or ¹²⁵ I-labeled TIE ligand-4 and the test molecule for binding to the TIE receptor.

Labeled TIE ligand-3 or TIE ligand-4 includes, but is not limited to, TIE ligand-3 or TIE ligand-4 covalently or non-covalently linked to a radioactive substance, a fluorescent substance, a substance with enzymatic activity, a substance that may serve as a substrate for the enzyme (enzymes and substrates are preferred, the reaction between which is colorimetrically controlled) or a substance that can be detected using an antibody molecule, which is preferably labeled.

In addition, the specific binding of a test molecule to TIE can be evaluated based on the secondary biological effects of binding of a TIE ligand-3 or TIE ligand-4 to a TIE receptor, including, but not limited to cell growth and / or differentiation or direct expression of an early gene or phosphorylation of TIE. For example, the ability of a test molecule to induce differentiation can be tested in cells that lack tie and in comparative cells that express tie; differentiation in tie-expressing cells, but not in comparative cells where there is no tie, should indicate a specific interaction of the test molecule with TIE. A similar analysis can be performed by determining the direct induction of an early gene (e.g., fos and jun) in tie-minus and tie-plus cells or by determining TIE phosphorylation using a standard phosphorylation assay known in the art. Such an assay may be useful in identifying agonists or antagonists that noncompetitively bind to TIE.

Similarly, the present invention discloses a method for identifying a molecule that has the biological activity of a TIE ligand-3 or TIE ligand-4, comprising (i) maintaining a cell expressing tie with a test molecule; (ii) determining the specific binding of the test molecule to the TIE receptor, in which specific binding to TIE positively correlates with TIE-like activity. Specific binding can be determined either by direct binding analysis or by using the secondary biological effects of binding, as discussed above. A similar method can be especially useful in identifying new members of the TIE ligand family or in the pharmaceutical industry, in screening a large mass of peptide and non-peptide molecules (eg, peptidomimetics) for biological activity associated with TIE. In a preferred specific non-limiting embodiment of the invention, it is possible to prepare a multi-well plate with cell cultures containing, in alternating rows of PC12 (or fibroblasts, see Infra) cells that are either tie-minus or genetically engineered to be tie-plus. A variety of test molecules can then be added so that each column of the tablet or part thereof contains different test molecules. A test for the presence or absence of growth and / or differentiation may then be performed in each well. In this way, an extremely large number of test molecules can be tested for similar activity.

In further embodiments, the invention provides methods for determining or measuring TIE ligand-like activity or identifying a molecule having similar activity, comprising (i) in vitro maintaining the test molecule with the TIE receptor protein under conditions that allow binding and (ii) determining the binding of the test molecule to TIE receptor protein, in which the binding of the test molecule to the TIE receptor correlates with TIE ligand-like activity. According to similar methods, the TIE receptor can be significantly purified or uncleaned, can be attached to a solid support (for example, an affinity column or ELISA) or can be incorporated into an artificial membrane. The binding of the test molecule to the TIE receptor can be evaluated using any method known in the art. In preferred embodiments, the binding of the test molecule can be determined or measured by evaluating its ability to compete with the labeled known TIE ligand for binding to the TIE receptor.

The present invention also discloses a method for determining the ability of a test molecule to function as antagonists of TIE ligand-like activity, comprising determining the ability of a molecule to inhibit the binding of a TIE ligand to a TIE receptor on a cell that expresses a receptor. Such an antagonist may or may not interfere with the binding of the TIE receptor to the TIE ligand-3 or TIE ligand-4. The binding of TIE ligand-3 or TIE ~ ligand-4 to the TIE receptor results in biological and biochemical effects, including, but not limited to, cell survival or proliferation, cell transformation, direct early gene induction, or TIE phosphorylation.

The present invention further discloses a method for identifying antibodies or other molecules capable of neutralizing a ligand or blocking binding to a receptor, as well as molecules identified by this method. A non-limiting example of an embodiment is an assay that is conceptually similar to an ELISA assay. For example, the body of a TIE receptor may be bound to a solid support, such as a plastic multi-well plate. As a control, a known amount of TIE ligand-3 or TIE ligand-4, which is labeled myc, can be introduced into the well, and any labeled TIE ligand-3 or TIE ligand-4 receptor binding body can be identified by a reporter antibody directed against the tag mus. The system can be used to screen test samples for molecules that are capable of i) binding to the labeled ligand and ii) binding to the receptor body and thereby block binding to the receptor body using the labeled ligand. For example, a test sample containing a molecule of interest along with a known amount of labeled ligand can be introduced into the well, and the amount of labeled ligand that binds to the receptor body can be measured. By comparing the amount of bound labeled ligand in the test sample with the amount in the control, samples containing molecules capable of blocking ligand binding to the receptor can be identified. The identified molecules of interest can be distinguished using methods well known to those skilled in the art.

If a blocking ligand binding molecule is found, one skilled in the art should know how to perform secondary analyzes to determine whether the blocking molecule binds to a receptor or a ligand, as well as analyzes to determine whether the blocking molecule can neutralize the biological activity of the ligand. For example, by using a binding assay that uses the BIAcore biosensor technique (or equivalent), in which either the TIE receptor body, or TIE ligand-3 or TIE ligand-4, or the ligand body is covalently attached to a solid support (e.g. carboxymethyldextran on a gold surface), one skilled in the art can determine whether a blocking molecule binds specifically to a ligand, a ligand body, or a receptor body. To determine whether a blocking molecule can neutralize the biological activity of a ligand, one skilled in the art can perform a phosphorylation assay (see Example 5 in International Application No. WO 96/31598 published October 10, 1996) or, conversely, a functional bioanalysis such as cell survival through the use of primary cultures, such as endothelial cells. Conversely, the blocking molecule that binds to the receptor body may be an agonist, and one skilled in the art should know how to determine this by appropriately identifying additional TIE receptor agonists.

The invention further discloses compositions in which the TIE ligand is the receptor binding domain of the TIE ligand-3 or TIE ligand-4 described herein. For example, TIE-2 ligand 1 contains a supercoiled domain and a fibrinogen-like domain. It is believed that the fibrinogen-like domain of TIE-2 ligand 2 starts at or near the same amino acid sequence as in ligand 1 (FRDCA). The fibrinogen-like domain is believed to begin at or near the amino acid sequence that is encoded by nucleotides starting at position 929, as shown in FIGS. 6A-6B. The multimerization of supercoiled domains during ligand production interferes with purification. As described in Example 7, applicants have found, however, that the fibrinogen-like domain contains a TIE-2 receptor binding domain. Monomeric forms of the fibrinogen-like domain do not seem to bind the receptor. Studies using a mus-labeled fibrinogen-like domain that “forms clusters” and using anti-myc antibodies show binding of the TIE-2 receptor (Methods for preparing cluster-assembled ligands and ligand bodies are described in Davis et al., Science, 266, 816-819, 1994). Based on these data, the applicants obtained “ligand bodies” that contain the fibrinogen-like domain of TIE-2 ligands associated with the IgG Fc domain (“fFc 's”). These dimer-forming ligand bodies efficiently bind the TIE-2 receptor. Accordingly, the present invention discloses the preparation of TIE ~ ligand-3 or TIE-ligand-4 ligand bodies that can be used as target agents in diagnostics or therapy, such as target agents for tumors and / or associated vasculature where TIE- antagonist.

The present invention further relates to the development of a ligand, fragment or derivative thereof, or other molecule that is a receptor agonist or antagonist, as a therapeutic agent for treating patients suffering from disorders in cells, tissues or organs that express a TIE receptor. Such molecules can be used in the treatment of humans or animals or in diagnostics.

Since the TIE receptor is identified in association with endothelial cells and, as demonstrated here, blocking of the TIE-2 ligand 1 seems to inhibit the formation of the vascular system, applicants expected that TIE ligand-3 or TIE ligand-4 could be used to induce this formation in diseases or disorders where a similar formation of the vascular system is indicated. Similar diseases or disorders include wound healing, ischemia, and diabetes. Ligands can be tested in animal models and used as therapeutic agents, as described for other agents, such as vascular endothelial growth factor (VEGF), another endothelial cell specific factor that is antigenic (Ferrara et al., US Patent No. 5,332,671, published July 26, 1994). Link Ferrara, as well as other studies, describe the results of an in vitro and in vivo study that can be used to demonstrate the effect of an angiogenic factor in increasing blood flow to an ischemic myocardium, enhancing wound healing, and in other cases of therapeutic use where neoangiogenesis occurs (Sudo et al., European Patent Application 0550296 A2, published July 7, 1993; Banai et al., Circulatioin, 89, 2183-2189, 1994; Unger et al., Am.J. PhysioL, 266 <H1588-1595, 1994; Lazarous et al., Circulation, 91, 145-153, 1995). According to the invention, TIE ligand-3 or TIE ligand-4 can be used alone or in combination with one or more additional pharmaceutically active compounds, such as, for example, VEGF or basic fibroblast growth factor (FGF), as well as with cytokines, neurotrophins etc.

Conversely, TIE receptor antagonists, such as receptor bodies, as described herein in Examples 2 and 3, and TIE-2 ligand-2, as described in Example 9 in International Application No. WO 96/31598, published October 10, 1996, should be used. to prevent or weaken the formation of the vascular system, thereby preventing or attenuating, for example, tumor growth. These agents can be used alone or in combination with other compositions, such as anti-VEGF antibodies, which have been shown to be used in the treatment of conditions whose treatment is to block angiogenesis. We expected that the TIE ligand-3 or TIE ligand-4 described herein could also be used in combination with agents such as cytokine antagonists, such as IL-6 antagonists, which are known to inhibit inflammation.

For example, applicants have determined that TIE ligands are expressed in tumor cells or cells closely associated with tumors. For example, TIE-2-ligand-2 appears to be strongly linked to tumor endothelial cells. ” Accordingly, this and other TIE antagonists may be useful in preventing or attenuating tumor growth. In addition, TIE ligands or body ligands can be used to deliver toxins to a receptor-carrying cell. Otherwise, other molecules, such as growth factors, cytokines, or nutrients, can be delivered to cells carrying the TIE receptor via TIE ligands or ligand bodies. TIE ligands or ligand bodies, such as TIE ligand-3 or TIE ligand-4, can be used as diagnostic reagents for determining the TIE receptor in vivo and in vitro. In cases where the disease state is associated with the TIE receptor, TIE ligands or ligand bodies, such as TIE ligand-3 or TIE ligand-4, can be used as diagnostic reagents for determining the disease using, for example, tissue staining or Full body imaging. Such reagents include radioisotopes, fluorochromes, dyes, enzymes, and biotin. Such diagnostic agents or target agents can be prepared as described in publications Alitalo et al., WO 95/26364, published October 5, 1995, and Burrows F. and P. Thorpe, PNAS USA, 90, 8996-9000, 1993, which included in this description.

In other embodiments, TIE ligands, such as TIE ligand-3 or TIE ligand-4 described herein, are used as hematopoietic factors. A variety of hematopoietic factors and their receptors are involved in the proliferation and / or differentiation and / or migration of various types of cells contained in the blood. Since TIE receptors are expressed in early hematopoietic cells, the expressed TIE ligands seem to play a comparative role in the proliferation or differentiation or migration of these cells. Thus, TIE-containing compositions can be prepared, analyzed, tested in biological systems in vivo and in vitro and used as therapeutic agents, as described in any of the following references: Sousa, U.S. Patent No. 4,810,643, Lee et al., Proc. Natl. Acad. Sci. USA 82, 4360-4364, 1985; Wong et al., Science, 228, 810-814, 1985, Yokota et al., Proc. Natl. Acad. Sci. USA, 81, 1070, 1984; Bosselman et al., WO 9105795, published May 2, 1991, entitled “Stem Cell Fandor,” Krikness et al., WO 95/19985, published July 27, 1995, called “Hematopoietic Ripening Factor”). Accordingly, TIE ligand-3 or TIE ligand-4 can be used to diagnose or treat conditions in which normal hematopoiesis is suppressed, including but not limited to anemia, thrombocytopenia, leukopenia, and granulocytopenia. In a preferred embodiment, TIE ligand-3 or TIE ligand-4 can be used to stimulate differentiation of blood cell precursors in situations where the patient has a disease, such as Acquired Immune Deficiency Syndrome (AIDS), which causes a decrease in normal blood cell levels, or in clinical settings where an increase in hematopoietic populations, such as in combination with a bone marrow transplant, or in the treatment of aplasia or suppression of myelocytes caused by radiation, chemical treatment and chemotherapy. The TIE ligand-3 or TIE ligand-4 according to the invention can be used only or in combination with another pharmaceutically active agent, such as, for example, cytokines, neurotrophins, interleukins, etc. In a preferred embodiment, the ligand can be used in connection with any of the above factors, which are known to cause proliferation of stem cells or other hematopoietic precursors or factors acting on late cells in the hematopoietic pathway of metabolism, including, but not limited to, the hematopoietic maturation factor, thrombopoietic factor stem cell, erythropoietin, G-CFS, GM-CFS, etc.

Alternatively, TIE receptor antagonists are used to diagnose or treat patients in whom the inhibition of the hematopoietic pathway of metabolism is desirable, for example, for the treatment of myeloproliferative or other proliferative disorders of the blood-forming organs, such as thrombocytosis, erythrocytosis and leukemia. In such embodiments, treatment may include using a therapeutically effective amount of TIE ligand-3 or TIE ligand-4, TIE antibody, TIE receptor body, TIE ligand-3 or TIE ligand-4 conjugate, or receptor body or fFC, as described here.

The present invention also discloses pharmaceutical compositions containing TIE ligand-3 or TIE ligand-4 or the body of the ligands described herein, peptide fragments thereof or their derivatives in a pharmacologically acceptable carrier. Proteins TIE-ligand-3 or TIE-ligand-4, peptide fragments or derivatives can be assigned systemically or locally. Any suitable route of administration known in the art can be used to include, by way of non-limiting example, intravenous, subshell, intra-arterial, intranasal, oral, subcutaneous, intraperitoneal, or via local injection or surgical implant. The invention also discloses methods for the sustained release of the administered preparations.

The present invention also provides an antibody that specifically binds a similar therapeutic molecule. The antibody may be monoclonal or polyclonal. The invention also discloses a method of using such a monoclonal or polyclonal antibody to measure the amount of a therapeutic molecule in a sample taken from a patient in order to control the course of therapy.

The invention further provides a therapeutic composition comprising a TIE ligand-3 or TIE ligand-4, or a ligand body and a cytotoxic agent conjugated or connected to it. In one embodiment, the cytotoxic agent may be a radioisotope or toxin.

The invention also provides an antibody that specifically binds TIE ligand-3 or TIE ligand-4. The antibody may be monoclonal or polyclonal.

The invention further discloses a method for purifying a TIE ligand-3 or TIE ligand-4, comprising:

a) binding of at least one binding TIE substrate to a solid matrix;

b) incubating the substrate a) with a cell lysate to form a complex of the substrate with any of TIE ligand-3 or TIE ligand-4;

c) washing the solid matrix; and

d) elution of the TIE ligand-3 or TIE ligand-4 from the bound substrate.

The substrate may be any substance that specifically binds TIE ligand-3 or TIE ligand-4. In one embodiment, the substrate is selected from the group consisting of anti-TIE ligand-3 or TIE ligand-4 antibodies, TIE receptor, and TIE body receptor. The invention further claims a receptor body that is specifically a TIE ligand-3 or TIE ligand-4, as well as a therapeutic composition comprising a receptor body in a pharmaceutically acceptable carrier and a method for blocking human blood vessel growth, comprising administering an effective amount of the therapeutic composition.

In addition, the present invention discloses a method for identifying a cell that expresses a TIE receptor, which comprises contacting the cell with a labeled TIE ligand-3 or TTE ligand-4 or a ligand body under conditions allowing binding of the labeled ligand to the TIE receptor, and determining whether the labeled ligand binds to the TIE receptor, thereby identifying the cell as expressing the TIE receptor. The present invention provides a therapeutic composition comprising a TIE ligand-3 or TIE ligand-4 or a ligand body and a cytotoxic agent associated therewith. The cytotoxic agent may be a radioisotope or toxin.

The invention also discloses a method for determining expression of a TIE ligand-3 or TIE ligand-4 by a cell, which comprises obtaining m-RNA from a cell, contacting the obtained m-RNA with a labeled nucleic acid molecule encoding a TIE ligand-3 or TIE ligand- 4 under hybridization conditions, determining the presence of hybridized mRNA with a labeled molecule, thereby determining the expression of TIE ligand-3 or TIE ligand-4 in the cell.

In addition, the invention discloses a method for determining the expression of TIE ligand-3 or TTE ligand-4 in tissue sections, which comprises contacting tissue sections with a labeled nucleic acid molecule encoding a TIE ligand-3 or TIE ligand-4 under hybridization conditions, determining the presence of mRNA hybridized to the labeled molecule, and thereby determining the expression of TIE ligand-3 or TIE ligand-4 in tissue sections.

EXAMPLE 1. Identification of ABAE cell line as reporter cells for TIE-2 receptor

Adult BAE cells are registered with the European Bank for Cell Culture as ECACC # 92010601 (See PNAS 75, 2621, 1978). Northern analysis (RNA) found the average levels of tie-2 ABAE transcripts of the cell line (endothelial cells of the arteries of adult cattle) in accordance with in situ hybridization results that showed the only localization of tie-2 RNA in vascular endothelial cells. Therefore, we tested cell lysates for the presence of TIE-2 protein, as well as the degree of phosphorylation of this protein for tyrosine residues under normal growth conditions, compared with growth conditions in serum-free medium.

ABAE cell lysates were collected and immunoprecipitated, followed by Western blotting of immunoprecipitated proteins with TIE-2-specific and phosphotyrosine-specific antisera. The exclusion or inclusion of TIE-2 peptides as specific blocking molecules in the process of TIE-2 immunoprecipitation allows identification. TIE-2 as a protein with mol. weighing about 150 kDa, in which stationary levels of phosphotyrosine are reduced to almost undetectable levels by pre-growing cells in serum-free medium.

A cell culture was grown and cell lysates were harvested as follows. Low passage ABDE cells were seeded as a monolayer in plastic Petri dishes (Falcon) with a density of 2 × 10 ⁶ cells / 150 mm plate and grown in Dulbecco modified Eagle medium (DMEM) containing 10% calf serum, 2 mM L-glutamine and 1% of penicillin and streptomycin in an atmosphere of 5% CO ₂ . Prior to the collection of cell lysates, cells were kept in a DMEM medium with glutamine, penicillin and streptomycin, but without serum, for 24 hours, after which the medium was shocked and the plates were washed with cold phosphate buffered saline (PBS) containing sodium orthovanadate, sodium fluoride, sodium benzamidine . Cells were lysed in a small volume of this buffer, additionally containing 1% NP40 detergent and protease inhibitors of PMSF and aprotinin. Insoluble residues were removed from the lysates by centrifugation at 14,000 × G for 10 min at 4 ° C, the supernatants were immunoprecipitated with an antiserum specific for TIE-2 receptor in the presence or absence of blocking peptides added to the lysate at a concentration of 20 μg / ml. The immunoprecipitating proteins were separated by polyacrylamide gel electrophoresis (7.5% Laemmli) and then transferred by electrophoresis to a PVDF membrane and incubated with antisera specific for the TIE-2 protein and phosphotyrosine. TIE-2 protein was determined visually by incubating the membrane with NKR-linked secondary antiserum, followed by treatment with ECL reagent (Amersham).

EXAMPLE 2. Cloning and expression of the body of the TIE-2 receptor for the study of TIE-2 ligand interactions based on affinity

An expression construct has been created that produces a secreted protein consisting of the whole extracellular portion of rat TIE-2, a receptor inserted into the constant region of human gamma-1 immunoglobulin (IgGl Fc). The inserted protein is called TIE-2 “receptor body” (RB), and is expected to exist in solution as a dimer formed by disulfide bonds between individual (IgGl Fc) tail units. The Fc portion of TIE-2 RB is prepared as follows. The DNA fragment encoding the Fc portion of human IgGl that spans the distance from the “hinge region” to the carboxyl end of the protein was amplified from the human placenta c-DNA by PCR with oligonucleotides of the correspondingly published human IgGl sequence; the resulting DNA fragment was cloned into a plasmid vector. The corresponding restriction DNA fragments from the plasmid encoding the full length of the TIE-2 receptor and from the human IgGl Fc plasmid were ligated to any portion of the short fragment produced by PCR that was designed to insert the TIE protein coding sequences into the reading frame -2 and human Fc fragment of IgGl. Thus, the obtained TIE-2 ectodomain Fc fusion protein exactly replaces the IgGl Fc fragment in the region surrounding the TIE-2 transmembrane and cytoplasmic domains. An alternative method for producing receptor bodies is described in (Goodwill, et al., Cell, 73, 447-456, 1993).

Milligram amounts of the body of the TIE-2 receptor were obtained by cloning a TIE-2 RB DNA fragment into the baculovirus pVL1393 vector and subsequently infecting the Spodoptera flugiperda insect cell line SF-21AE. You can also use the cell line SF-9 (ATCC Accession No. CRL-1711) or the cell line BT1-TN-5b1-4. DNA encoding the body of the TIE-2 receptor was cloned as an Eco RI-Notl fragment into the baculovirus transfer plasmid PVL1393. Plasmid DNA was purified by centrifugation in a density gradient of cesium chloride, recombined in viral DNA by mixing 3 μg of plasmid DNA with 0.5 μg of Baculo-Gold DNA (Pharmigenigen), followed by injection into liposomes using 30 μg of lipofectin (GIBCO-BRL ) A mixture of DNA liposomes was added to SF-21AE cells (2 × 10 ⁶ cells / 60 mm cup) in TMN-FH medium (modified insect cell medium, Grace) (GIBCO-BRL) for 5 hours at 27 ° C subsequent incubation at 27 ° C for 5 days in a modified medium containing 5% fetal calf serum. Tissue culture medium was collected to purify bands of recombinant viruses, which was performed using the previously described methods (O'Reilly, DR, LK Milier, and VALuckow, Baculovirus Expression Vectors - A Laboratory Manual, 1992, New York: WH Freeman) except the agarose coating containing 125 μg / ml X-gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside; GIBCO-BRL). After 5 days of incubation at 27 ° C, non-recombinant bands were calculated using a positive chromogenic reaction with X-gal substrate, the position of these bands was noted. Recombinant bands were developed by adding a second coating containing 100 μg / ml MTT (3- [4,5-dimethylthiazol-2-yl] 2,5-diphenyltetrazolium bromide; Sigma). Bands of putative recombinant viruses were selected and purified using multiple lane isolation cycles to ensure homogeneity. Viral lines were obtained using a successive set of passages purified from bands of virus. Lines for the low passage of a single viral clone (vTIE-2 receptor body) were obtained.

SF-21AE cells were grown in serum-free medium SF-900 II, GIBCO BSL) containing 1 X solution with antibiotic and antifungal agent (GIBCO BRL) and 25 mg / L gentamicin (GIBCO BRL). Pluronic F-68 was added as a surfactant to a final concentration of 1 g / L. Cultures (4 L) were grown in a bioreactor (Artisan Cell Station System) for at least three days before infection. Cells were grown at 27 ° C with a gas supply of up to 50% dissolved oxygen at a gas supply rate of 80 ml / min (aeration at the spray ring). Mixing was carried out using a water mixer at a speed of 100 rpm. Cells were harvested in a medium logarithmic growth phase (approximately 2 × 10 ⁶ cells / ml), concentrated by centrifugation and infected with 5 band-forming units of the vTIE-2 receptor body per cell. The cells and inoculum were brought to 400 ml with fresh medium, and the virus was adsorbed for 2 hours at 27 ° C in a rotating flask. The culture was then resuspended in 8 liter fresh serum-free medium, and the cells were incubated in a bioreactor using the previously described conditions.

Culture media from SF-21AE cells infected with vTIE-2 receptor body were separated by centrifugation (500 × g, 10 minutes) 72 hours after infection. The pH of the cell supernatants was adjusted to 8.0 with NaOH. Then, EDTA was added to a final concentration of 10 mmol, and the supernatant was again adjusted to pH 8.0. Supernatants were filtered (0.45 μm, Millipore) and placed in a column with A protein (protein A sepharose 4 fast flow or HiTrap protein A, Pharmacia). The column was washed with PBS containing 0.5 M NaCl until the absorbance measured at 280 nm decreased to the baseline. The column was washed with PBS and eluted with 0.5 M acetic acid. Column fractions were immediately neutralized and eluted into tubes containing 1 M Tris pH 9.0. Fraction peaks containing the TIE-2 receptor body were pooled and dialyzed against PBS.

EXAMPLE 3. Demonstration in favor of the fact that TIE-2 plays a decisive role in the development of the vascular network

An understanding of the functions of TIE-2 was achieved by introducing an “excess” of the soluble body of the TIE-2 receptor into the developing system. The potential ability of the body of the TIE-2 receptor to bind and thereby neutralize the available TIE-2 ligand leads to the observed violation of the normal development of the vascular network and thereby characterizes the ligand. In order to check whether the body of the TIE-2 ligand can be used to impair vascular network resilience in an early chicken embryo, small pieces of a bioabsorbable film were moistened with the body of the TIE-2 receptor and introduced immediately under the chorioallantoid membrane to precisely lateral positions with respect to the primary embryo .

In the early chicken embryo, the upper surface of the yolk from the small disc of the cells develops, which is covered by the chorioallantoid membrane (HAM). Endothelial cells developing in the embryo for the formation of the vasculature come from both extra-intraembryonic cell sources. Endothelial cells produced outside the embryo, which represent the main source of endothelial cells in the embryo, originate from mesenchymal intergrowths that are located laterally around the inherent chorioallantoid membrane directly below it. Once these mesenchyme cells mature, they become the source of a common precursor, both endothelial and hematopoietic cell lines, called hemangioblast. In turn, hemangioblast leads to a mixed population of angioblasts (precursors of endothelial cells) and hematoblasts (polypotent hematopoietic precursor). The formation of the primordia of the circulatory system begins when the progeny of the endothelial cells separate to form a vessel, one cell thick, which surrounds the primary blood cells. The proliferation and migration of these cellular components ultimately leads to the formation of an extensive network of blood-filled microvessels under the CAM, which encompasses the embryo, connecting with limited, intraembryonic-produced vascular elements.

Fertilized eggs obtained from Spafas Inc. (Boston, MA) were incubated at 99.5 ° F with 55% relative humidity. After 24 hours of development, the egg membrane was wiped with 70% ethanol and a 1.5 mm hole was made in the top at the dull corner of each egg with a drill. The casing was removed so that airspace appeared directly above the embryo. Small rectangular pieces of sterile Gelfoam (gel film) (Upjohn) were cut with a scalpel and soaked in equal concentrations with either TIE-2 or ENK-1 receptor body. The ENK-1 receptor body was obtained as described in Example 2 using the ENK-1 extracellular domain instead of the TIE-2 extracellular domain (Maisonpierre et al., Oncogene, 8, 3277-3288, 1993). Each piece of film absorb approximately 6 μg of protein in 30 μl. Sterile surgical forceps were used to make a small hole in the CAM at a position a few millimeters laterally to the primary embryo. A large piece of the film moistened with the receptor body was injected under the CAM and the testicular membrane was fixed with adhesive tape. Other eggs at a similar stage were treated parallel to the receptor body of an unrelated nerve cell receptor tyrosine kinase, EHC-1 (Maisonpierre et al., Oncogene, 8, 3277-3288, 1993). Embryos developed 4 days and then checked. Embryos were removed by carefully breaking the membranes in plates with warm PBS and carefully cutting the embryo from the surrounding CHAM. Of the 12 eggs treated with the receptor body, 6-TIE-2 and 5-EHC-1, embryos developed beyond the observation at the beginning of the experiment. Significant differences were noticeable between these developing embryos, as shown in FIGS. 1A and 1B. Those embryos that were treated with the ENK-1 receptor body developed relatively normally. Four of the five treated EHC-1 embryos were visible as judged by the presence of a heartbeat. In addition, the extraembryonic vascular system, which is visible due to the presence of red blood cells, was rich and extended several centimeters laterally under the CAM. In contrast, embryos treated with the body of the TIE-2 receptor were stunted, 2-5 mm in diameter, compared to embryos treated with the body of the ENK-1 receptor, whose diameter was 10 mm in diameter. All embryos treated with TIE-2 by the receptor body died and their VAMs were devoid of blood vessels. The ability of the TIE-2 receptor body to block the development of blood vessels in the chicken proves that the TIE-2 ligand is necessary for the development of the vascular system.

EXAMPLE 4. Design TIE-2 ligand body

The expression construct was designed to produce a secreted protein consisting of the complete sequence of human TIE-2 ligand 1 (TL1) or TIE-2 ligand 2 (TL2) crosslinked with a constant region of human gamma-1 immunoglobulin (IgGl Fc fragment) . These crosslinked proteins are called TIE-2 “ligand bodies” (TL1-Fc and TL2-Fc). The Fc portion of TL1-Fc and TL2-Fc was obtained as follows. A DNA fragment encoding the Fc portion of human IgGl that extends from the “hinge region” to the carboxyl end of the protein was amplified from human lacental cDNA by PCR with oligonucleotides according to the published human IgGl sequence; the resulting DNA fragment was cloned into a plasmid vector. The corresponding restriction DNA fragments from a plasmid encoding the full length of TL1 or TL2 and from human IgGl Fc plasmids were ligated to any portion of the short fragment produced by PCR that was designed to insert TL1 or TL2 coding sequences into the reading frame and human Fc fragment of IgGl.

Milligram amounts of TL2-Fc were obtained by cloning the TDNA fragment into the pVL1393 vector of baculovirus and subsequent infection of the Spodoptera flugiperda insect cell line SF-21AE. You can also use the cell line SF-9 (ATCC Accession No. CRL-1711) or the cell line BTI-TN-5bl-4. DNA encoding TL2-Fc was cloned as an Eco RI-Notl fragment into the baculovirus transfer plasmid PVL1393. Plasmid DNA was recombined into viral DNA by mixing 3 μg of plasmid DNA with 0.5 μg of Baculo-Gold DNA (Farmigenigen), followed by introduction into liposomes using 30 μg of lipofectin (GIBCO-BRL). A mixture of DNA liposomes was added to SF-21AE cells (2 × 10 ⁶ cells / 60 mm cup) in TMN-FH medium (modified insect cell medium, Grace) (GIBCO-BRL) for 5 hours at 27 ° C subsequent incubation at 27 ° C for 5 days in a modified medium containing 5% fetal calf serum. Tissue culture medium was collected to purify bands of recombinant viruses, which was performed using the methods described (O'Reilly, DR, L. K. Miller, and VALuckow, Baculoviros Expression Vectors - A Laboratory Manual, 1992, New York: WH Freeman ) except that the agarose coating contained 125 μg / ml X-gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside; GIBCO-BRL). After 5 days of incubation at 27 ° C, non-recombinant bands were calculated using a positive chromogenic reaction with an X-gal substrate, the position of these bands was noted. Recombinant bands were developed by adding a second coating containing 100 μg / ml MTT (3- [4,5-dimethylthiazol-2-yl] 2,5-diphenyltetrazolium bromide; Sigma). Bands of putative recombinant viruses were selected and purified using multiple lane isolation cycles to ensure homogeneity. Viral lines were obtained using a consistent set of massages of purified virus strips. Lines for low massage of a single viral clone (vTTE-2 receptor body) were obtained.

SF-21AE cells were grown in serum-free medium SF-900 II GIBCO BRL) containing 1 X solution with antibiotic and antifungal agent (CEBCO BRL) and 25 mg / L gentamicin (GIBCO BRL). Pluronic F-68 was added varnish surfactant to a final concentration of 1 g / L.

Cultures (4 L) were grown in a bioreactor (Artisan Cell Station System) for at least three days before infection. Cells were grown at 27 ° C with a gas supply of up to 50% dissolved oxygen at a rate of gas supply of 80 l / min (aeration at the spray ring). Mixing was carried out using a water mixer at a speed of 100 rpm. Cells were harvested in a medium logarithmic growth phase (approximately 2 × 10 ⁶ cells / ml), concentrated by centrifugation and infected with 5 band-forming units of the vTIE-2 receptor body per cell. The cells and inoculum were brought to 400 ml with fresh medium, and the virus was adsorbed for 2 hours at 27 ° C in a rotating flask. The culture was then resuspended in 8 liter fresh serum-free medium, and the cells were incubated in a bioreactor using the previously described conditions.

Culture media from SF-21AE cells infected with vTL2-Fc were separated by centrifugation (500 × g, 10 minutes) 72 hours after infection. The pH of the cell supernatants was adjusted to 8.0 with NaOH. Then, EDTA was added to a final concentration of 10 mmol, and the supernatant was again adjusted to pH 8.0. The supernatants were filtered (0.45 μm, Millipore) and placed in a column with A protein (protean A sepharose 4 fast flow or HiTrap protein A, Pharmacia). The column was washed with PBS containing 0.5 M NaCl until the absorbance measured at 280 nm decreased to the baseline. The column was washed with PBS and eluted with 0.5 M acetic acid. Column fractions were immediately neutralized by elution into tubes containing 1 M Tris pH 9.0. Fraction peaks containing the TIE-2 receptor body were pooled and dialyzed against PBS.

EXAMPLE 5. The receptor / ligand system in angiogenesis

Although the ligand system TIE-2 / TIE seems to play an important role in the biology of endothelial cells, it has not been shown that the system plays a significant active role in the stages of the formation of the vasculature from the early to the intermediate period of development (for example, angioblast or proliferation and migration endothelial cells, tubule formation and other events in the early stages of vascular system modeling). In contrast to receptors for factors that are known to be an intermediate in the development of the vascular system, the late expression pattern of TIE-2 and TL1 during the formation of the vascular system suggests that this system plays a separate role in the later stages of the development of the vascular system, including the structural and functional differentiation and stabilization of new blood vessels. The expression pattern of TIE-2 / TL1 is also consistent with the role in maintaining the structural integrity and / or physiological characteristics of the established vasculature.

TIE ligand 2 (TL2) appears to be a competitive inhibitor of TL1. The spatio-temporal characteristics of TL2 expression suggest that this inhibitory molecule plays multiple situation-dependent roles that are essential for the development of the vascular system or remodeling (e.g., destabilization / differentiation of mature endothelial cells, allowing the formation of new vessels from the existing vasculature, inhibition of inappropriate formation blood vessels and regression / involution of mature blood vessels). Figure 2 is a schematic representation of the hypothetical role of TIE-2 / TIE ligands in angiogenesis. In this figure, TL1 represents (•), TL2 - (*), TIE-2 - (T), VEGF - ([]) and fik -1 (VEGF receptor) - (Y).

EXAMPLE 6. Design and Characterization of CYS-TL1 Mutant

TIE-2 ligands have two main structural domains, one described as a “helical” domain containing an approximate C-terminal 1/3 of the protein and another “fibrinogen-like” domain containing an approximate N-terminal 2/3 of the protein. Although TIE-2 ligands, designated as TL1 and TL2, have similar structural homology, they exhibit different physical and biological properties. Under non-reducing electrophoresis conditions, it can be seen that both proteins form covalent multimeric structures with TL1, which first exists as a trimer, and TL2, which exists as a dimer. Figure 3 is a schematic representation of how TIE-2 ligands can interact with the formation of multimers. Based on the biological activity, it was shown that TL1 is an agonist of the TIE-2 receptor, as was demonstrated by introducing phosphorylation into TIE-2 expressing cells. TL2, on the other hand, appears to be a competitive inhibitor of TL1. Studies of the fact that factors can contribute to the various physical and biological properties of the two molecules have revealed the presence of a cysteine residue (CYS 265) preceding the fibrinogen-like domain in TL1 but not in TL2. This CYS 265 residue in TL1 is encoded by the TGC sequence and is located near nucleotides 1102-1104 at the bond between the helical and fibrinogen-like domains. Since cysteine residues are usually involved in the formation of disulfide bonds, the presence of which can contribute to both the tertiary structure and biological properties of the molecule, it was suggested that the presence of CYS 265 in TL1 may be partially responsible for the different properties of the two molecules. To test this hypothesis, an expression plasmid was constructed that contained mutants in TL1 in which CYS was substituted for an amino acid that did not form disulfide bonds. In addition, a second expression plasmid was constructed in which the cysteine residue occupies the corresponding position in the TL2 mutant in the TL1 / CYS mutant. Both non-mutant and mutant expression plasmids TL1 and TL2 were temporarily transfected into COS cells. Cell supernatants containing recombinant proteins were collected and the samples were subjected to polyacrylamide gel electrophoresis with sodium dodecyl sulfate under both reducing and non-reducing conditions and subsequent Western blotting. Western blotting of both non-mutated and mutated TL1 and TL2 proteins, found that the TL1 / CYS ^- mutant behaves like TL2 that it moves as a dimer and that the TL2 / CYS ⁺ mutant behaves like TL1 in that it is capable of forming trimer, as well as high-order multimers. Interestingly, when the two mutant proteins tested for their ability to induce phosphorylation in TIE-2 expressing cells, TL1 / CYS ^- mutant was able to activate the TIE-2 receptor, whereas the TL2 / CYS ⁺ mutant did not show any activating capacity.

EXAMPLE 7. Construction and characterization of the fibrinogen-like domain of mutants only

In order to check whether the fibrinogen-like domain (F domain) of the TIE-2 ligands has an activating ability, expression plasmids were constructed from which the helical domain was removed, leaving only that part of the DNA sequence that encodes the F domain (starting from the nucleotide 1159, amino acid residue Arg 284). This mutant construct was temporarily transfected into COS cells. The supernatant containing the recombinant protein was collected. The TL1 / F domain mutant was tested for its ability to bind the TIE-2 receptor. The results showed that, as a monomer, the TL1 / F domain mutant is not able to bind TIE-2 at detectable levels. However, when the TL1 / F domain monomer was labeled with myc, followed by cluster formation with an antibody directed against the myc tag, it showed detectable binding to TIE-2. However, this mutant was not able to induce phosphorylation in TIE-2 expressing cell lines. Figure 3 shows a schematic representation of an F-domain construct and its plus and minus ability to bind an antibody cluster.

EXAMPLE 8. Analysis of receptor body binding and ligand binding and competitive analysis

A quantitative analysis of cell-free binding has been developed to determine TIE-2 binding of the receptor body or ligand binding and competition. In a TIE-2 receptor body binding assay, the ligands (purified or partially purified; TLS or TL2) are coated with an ELISA plate (ELISA - immunodetection using a bound form (enzyme). The receptor body is then added at various concentrations, which binds to the immobilized ligand in a dose-dependent manner After 2 hours, excess receptor body is washed away, the amount of receptor bound in the body plate is determined using specific anti-human Fc antibodies that are labeled with alkaline phosphatase. the antibodies are washed, then an AP reaction is carried out using a tinted substrate. A spectrophotometer is used to quantify the results. Figure 4 shows a typical TIE-2-IgG binding curve. This assay was used to evaluate the integrity of the complex after infection of rats and mice. An analysis option can also be used. ligand competition, in which purified or partially purified TIE ligands compete with the immobilized ligand for the receptor body. In a variant of ligand binding and TIE-2 binding competition, the ectodomain is covered with an ELISA plate. Fc-labeled fragments of the fibrinogen-like domain of TIE ligands (TL1-fFc and TL2-fFc) bind to the ectodomain and can be determined using the same anti-human Fc antibodies as described above. Figure 5 shows an example of the binding of TL1-fFc to the TIE-2 ectodomain. This assay can also be used to quantify serum TL1-fFc levels or other samples. If an unlabeled ligand (either purified or crude) is added at the same time as TL1-fFc, competition is established between the labeled ligand fragment and the full-length ligand. The full-length ligand can replace the Fc-labeled fragment and these results fit the competition curve.

EXAMPLE 9. EA.hy926 cell line can be used as a reporter cell line for TIE ligand activity

EA.hy926 is a hybrid cell line obtained by cross-linking HUVEC with an A549 cell line derived from human lung carcinoma (Edgell et al., Proc. Natl. Acad. Sci USA, 80, 3734-3737, 1983). EA.hy926 cells have been found to express significant levels of TIE-2 receptor protein with low levels of phosphotyrosine. The density at which EA.hy926 cells are passaged before they are used for receptor analysis, as well as their degree of adhesion during analysis, can affect TIE-2 receptor content and induction in response to ligand treatment. By choosing the next mode for the growth of these cells, EA.hy926 cells can be used as a dependent system for the analysis of TIE-2 ligand activity.

EA.hy926 cells were seeded at a density of 1.5 × 10 ⁶ cells in a T-75 flask (Faiconware) and fed daily with Dulbecco MEM medium high in glucose, 10% fetal bovine serum, L-glutamine, penicillin and streptomycin and 1x hypoxanthine-aminopterin-thymidine (HAT Gibco / BRL). After 3-4 days of growth, the cells were again passaged at 1.5 × 10 ⁶ cells per 1-75 flask and grown for another 3-4 days. For phosphorylation analysis, the cells obtained as described above were grown in serum-free medium by replacing DMEM culture medium with a high glucose content and incubation for 2-3 hours at 37 ° C. This medium was removed from the flask and samples of conditioned medium or purified ligand were added to the flask in a final volume of 1.5 ml, followed by incubation at 37 ° C for 5 minutes. Flasks were removed from the incubator and placed in an ice container. The medium was removed and 1.25 ml of lysis buffer containing 1% nonidet R-40, 0.5% sodium deoxycholate, 0.1% DDS-Na in 20 mM Tris pH 7.6, 150 mM NaCl, 50 mM NaF, was added, 1 mm sodium orthovanadate, 5 mm benzamidine and 1 mm EDTA, as well as containing protease inhibitors - PMSF, aprotinin and leipeptin. The membranes were solubilized for 10 minutes on ice, the plates were scraped out and the cell lysates were clarified by microcentrifugation at maximum speed for 10 minutes at 4 ° C. The TIE-2 receptor was immunoprecipitated from the clarified supernatant by incubation in the cold with anti-TIE-2 polyclonal antiserum and protein G conjugated with sepharose. Sepharose was washed 3 times with cold lysis buffer and boiled for 5 minutes in Laemmli sample buffer; the sample was subjected to electrophoresis in a 7.5% polyacrylamide gel with DDS-Na. The resolved proteins were transferred onto a PVDF membrane (Lamblia-P) and analyzed by Westem blot using an anti-phosphotyrosine antibody and ECL reagent. A subsequent comparison was made of the total levels of TIE-2 protein on the same blots by extraction of anti-phosphotyrosine antibodies and reincubation with a polyclonal antiserum specific for the TIE-2 ectodomain.

EXAMPLE 10. Isolation and sequencing of cDNA of a clone with a full chain length encoding a mammalian TIE ligand-3

TIE ligand-3 (TL3) was cloned from the mouse BAC genomic library (Research Genetics) by hybridizing library doublets with murine TL1 or TL2 probes corresponding to the complete coding sequence of these genes. Each copy of the library was hybridized using phosphate buffer at 55 ° C. overnight. After hybridization, the filters were washed using 2 × SSC, 0.1% DDS at 60 ° C, followed by exposure to x-ray film. Strong hybridization signals corresponding to murine TL1 or TL2 have been reported. In addition, weakly hybridized murine TL1 or TL2 were identified. The DNA corresponding to these clones was purified, digested with restriction enzymes, and two fragments that hybridized with the original samples were cloned into a bacterial plasmid and sequenced. The sequence of fragments contained two exons with homology to murine TL1 or TL2. Primers specific for these sequences were used as PCR primers to identify tissues containing transcripts corresponding to TL3. The PCR band corresponding to TL3 was identified in the mouse uterine cDNA library at lambda gt-11 (Clontech Laboratories, Inc., Palo Alto, CA).

The strips were placed on a plate at a density of 1.25 × 10 ^6/20 × 20 plate, after standard treatments were made on replica filters (Sambrook et al., Molecular Cloning , A Laboratory Manual, 2 ^{nd Ed., Page 8.46, Cold} Spring Harbor Laboratory, Cold Spring Harbor <New York). Duplicate filters were screened under moderate conditions (2 × SSC, 65 ° C) with 200 bp PCR radioactive assay prepared for the mouse TL3 sequence. Hybridization was carried out at 65 ° C in a solution containing 0.5 mg / ml salmon sperm DNA. The filters were washed in 2 × SSC at 65 ° C and kept on x-ray film for 6 hours. Two positive clones that hybridized into a doublet were selected. EcoRI digestion of DNA-containing phage obtained from these clones indicates the presence of two independent clones with inserts of approximately 1.2 kb and about 2.2 kb. The 2.2 kb EcoRI insert was cloned into the EcoRI pBluescript KS region (Strategene). Sequence analysis showed that the longer clone lacks initiating methionine and a signal peptide, but it encoded sequences homologous to mouse TL1 or TL2. Two TL3-specific PCR primers were synthesized:

US2: cctctgggctcgccagtttgttagg

US1: ccagctggcagatatcagg

The following PCR reactions were performed using expression gene libraries obtained from murine C2cl2ras and MG87 cell lines. In the primary PCR reaction, a specific US2 primer was used together with vector specific oligonucleotides to allow amplification in any orientation. PCR was performed in a volume of 100 ml using 35 cycles of 94 ° C for 1 minute; 42 ° C or 48 ° C for 1 minute; 72 ° C for 1 minute. The secondary PCR reaction included a second specific primer, US1, which is contained in the primary PCR product, along with the same vector oligonucleotides. Secondary reactions were carried out at 30 cycles, using temperatures and times as previously. PCR products were isolated and sequenced. Based on the analysis of sequences obtained from the sum of four independent PCR reactions using two different cDNA libraries, the 5 'end of the TL3 sequence was determined. Northern analysis revealed medium to low levels of mouse TL3 transcript in the mouse placenta. The expression of mouse TL3 consisted of a transcript of approximately 3 kb. The full length of the TL3 coding sequence is shown in Fig.6F-6B.

The murine TL3 sequence can be used to obtain a human clone containing the coding sequence of its human copy by hybridizing either the human gene or cDNA with a probe corresponding to murine TL3, as described previously, for example, in example 8 in International Application No. WO 96 / 31598, published October 10, 1996.

EXAMPLE 11. Isolation of a full length genomic gene clone encoding human TIE-2-ligand-4

TIE ligand-4 (TL4) was cloned from a mouse BAC genomic library (BAC HUMAN (II), Genome Systems Inc.) by hybridization of library doublets or with a radioactive probe of the human TL1 ligand corresponding to the complete TL1 fibrinogen encoding sequence (nucleotides 1153 to 1806 ) or with a radioactive breakdown of the mouse TL3 ligand, corresponding to a segment of 186 nucleotides from the mouse TL3 fibrinogen region (nucleotides 1307 to 1492 in FIGS. 6A-6B). Each sample was labeled by PCR using the appropriate oligonucleotides and standard PCR conditions, except that dCTP was replaced with P ³² dCTP. To separate the sample from free P ³² dCTP, the PCR mixture was subjected to column gel filtration. Each copy of the library was hybridized using phosphate buffer and a radioactive sample at 55 ° C. overnight using standard hybridization conditions. After hybridization, the filters were washed using 2 × SSC, 0.1% DDS-Na at 55 ° C, followed by exposure to x-ray film. Strong hybridization signals corresponding to human TL1 were observed. In addition, signals belonging to weakly hybridized human TL1 and mouse TL3 were observed. The DNA corresponding to these clones was purified using a standard method, then processed with restriction fragments and one fragment that was hybridized with the original samples, cloned into a bacterial plasmid and sequenced. The sequence of the fragment contained one exon with homology to human TL1 and murine TL3 and other members of the TIE ligand family. The primers specific for these sequences can be used as PCR primers to identify tissues containing transcripts corresponding to TL4. The complete sequence of human TL4 can be obtained by sequencing the complete BAC clone contained in the deposited bacterial cells. Exons can be identified by homology to known members of the TIE ligand family, such as TL1, TL2 and TL3. The complete TL4 coding sequence can be determined by splicing together with exons from the TL4 genomic clone, which in turn can be used to produce the TL4 protein. In addition, exons can be used as probes to produce a full-length cDNA clone, which can then be used for the produced TL4 protein. Exons can be identified from the BAC clone sequence by homology to protein domains, such as fibrinogen domains, helical domains, and to protein signals, such as signal peptide sequences. Missing exons from the BAC clone can be obtained by identifying close BAC clones, for example, by using the ends of the deposited BAC clone as samples for screening the human genomic library, including one used here by using the exon sequence contained in the BAC clone for screening a cDNA library, or by performing a 5 ^f or 3 'RACE procedure using polynucleotide primers based on exon TL4 sequences.

Identification of additional members of the TIE ligand family

The new TIE ligand-4 sequence can be used to expediently search for additional members of the TIE ligand family by a method that includes conservative families of significant homology between known members of the family. For example, the alignment of amino acid sequences of TIE ligands reveals several regions of a conserved sequence (see underlined regions of FIG. 7). To identify new TIE ligands, degenerate oligonucleotides based on these sequences can be used in combination with known or new homologous TIE ligand segments.

Highly conserved regions among TL1, TL2, and TL3 can be used to develop degenerative oligonucleotide primers with which cDNAs are used to seed the PCR reaction, cDNA templates can be obtained by reverse transcription of tissue RNAs using oligo-d (T) or other appropriate primers. Aliquots of the PCR reaction products were then subjected to agarose gel electrophoresis. The resulting amplified DNA fragments were cloned by introduction into plasmids, sequenced and DNA sequences were compared with the sequences of all known TIE ligands.

Amplified DNA fragments of the size selected from these PCR reactions were cloned into plasmids introduced into E. coli by electroporation, and the transformed cells were placed on selective agar. Colonies of bacteria from PCR transformation were analyzed by sequencing plasmid DNA, which was purified using a standard method.

Cloned fragments containing a segment of the new TIE ligand can be used as hybridization probes to obtain the full length of cDNA clones from the cDNA gene library. For example, a human TL4 genomic sequence can be used to obtain a human cDNA clone containing the complete coding sequence of human TL4 by hybridizing human cDNA from a gene library with a probe corresponding to human TL4, as described previously.

EXAMPLE 12. Cloning of the complete coding sequence of hTL4

A 5 ′ and 3 ′ coding sequence was obtained from a genomic human TL4 clone encoding a human TIE ligand-4 (hTL-4 Accession No. (98095) by restriction enzyme digestion, Southern blotting and hybridization of the hTL-4 clone with coding sequences from murine TL3 followed by cloning and sequencing of hybridized fragments The coding sequences corresponding to the N-terminal and C-terminal amino acids of hTL-4 were used to construct PCR primers (shown below), which, in turn, were used For PCR amplification of TL4 from human ovarian cDNA, the PCR product band was identified as corresponding to human TL4 using DNA sequencing using an ABI 373A DNA sequencer and the corresponding standard Tag Dideoxy Terminator Cycle Sequencing Kit (Applied Biosystems, Inc., Foster City, CA ). This PCR product was cloned into a pCR-script vector and several plasmid clones were analyzed by sequencing. Thus, the complete sequence encoding the human TL4 ligand was obtained, and is shown in FIGS. 8A-8C. In another embodiment of the invention, the nucleotide at position 569 was replaced from A to G, which led to the replacement of the amino acid from Q to R.

The PCR primers described above were designated as follows:

hTL4atg 5'-gcatgctatctcgagccaccATGCTCTCCCAGCTAGCCATGCTGCAG-3 'hTL4 not 5'

gtgtcgacgcggccgctotagatcagacTTAGATGTCCAAAGGCCGTATCATCAT-3 '

Uppercase letters indicate “tail” sequences added to PCR primers to facilitate cloning of amplified PCR fragments.

EXAMPLE 13. TIE ligand-4 binds to the TIE2 receptor

The actions of angiopoietin-1 (TL-1) and angiopoietin-2 (TL-2) are carried out by binding to the TIE2 receptor tyrosine kinase. Neither TL-1 nor TL-2 binds to a closely related TIE1 receptor for which there is no known ligand. To determine the possibility of binding of angiopoietin-4 (TL-4) to any of the two TIE receptors, two different binding assays were performed, including the binding of angiopoietin-4 or a derivative of angiopoietin-4 to cells expressing TIE receptors or to BIAcore chips, on which are immobilized TIE receptors. The angiopoietin-4 derivative used in this experiment is a chimeric angiopoietin in which the N-terminal and supercoiled segments of angiopoietin-2 are fused to the fibrinogen-like domain of angiopoietin-4 to form Ang4Chim. In both studies, angiopoietin-4 and Ang4Chim bind to the TIE2 receptor, but not to the TIE1 receptor (see Fig. 9, showing the results of BIAcore analysis). In addition, competition for binding to angiopoietin-4 or Ang4Chim was observed using excessive amounts of soluble TIE2 receptors, but not insoluble TIEl receptors or other irrelevant soluble receptors (Fig. 9). Thus, given the specificity of binding to the TIE2 receptor, angiopoietin-4 is a true member of the angiopoietin family.

EXAMPLE 14. TIE ligand-4 activates the TIE2 receptor

It was found that the first two members of the angiopoietin family, angiopoietin-1 (TL-1) and angiopoietin-2 (TL-2), have different activities, namely the first is an activator, and the second is an antagonist of TIE2 receptors expressed by endothelial cells. In order to determine the effects of angiopoietin-4 (TL-4) on TIE2 receptors, three different cell lines (the human endothelial cell line ЕАny926, the mouse endothelial cell line bEND and the murine fibroblasts MG 3T3) were exposed to Ang4Chim and the ability of this molecule to activate TIE2 was determined. As shown in FIG. 10, Ang4Chim could activate TIE2 receptors in all three cell lines.

Deposits

The following was deferred to the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Maryland 20852 in accordance with the Budapest Treaty. The recombinant Autographa californica baculovirus encoding the TIE-2 receptor-body was deferred to ATCC on October 7, 1994 and designated as “vTIE-2 receptor-body” under ATCC catalog number VR2484. E. coli strain DH10B containing the plasmid pBeLoBacll with the introduced human TL-4 genome encoding the human TIE ligand-4 was deposited in ATCC on July 2, 1996 and designated as “hTL-4” under ATCC catalog number 98095.

The present invention is not limited to those specific options that are described here. Indeed, various modifications of the invention, other than those described herein, will be apparent to those skilled in the art based on the foregoing description and the accompanying figures. It is understood that such modifications are included in the scope of the attached claims.

Claims (14)

1. An isolated nucleic acid molecule encoding a TIE ligand-4 having the amino acid sequence shown in FIGS. 8A-8C or its fibrinogen-like domain starting at or within the FQDCA sequence and ending at the C-terminus of the amino acid sequence shown in FIG. .8A-8C. 2. The nucleic acid molecule according to claim 1, where the sequence encoding human TIE ligand-4 is the sequence shown in Fig.8A-8C. 3. A nucleic acid encoding TIE ligand-4, which is contained in the vector of the E. coli strain designated as hTL-4 and deposited under ATCC number 98095. 4. An expression vector that contains a nucleic acid molecule according to claims 1, 2 or 3, operably linked to a regulatory sequence capable of directing its expression in a host cell. 5. The vector according to claim 4, which is a plasmid. 6. Cloning vector containing a nucleic acid encoding TIE ligand-4, which is contained in the E. coli strain designated as hTL-4 and deposited under the number ATCC 98095. 7. An isolated TIE ligand-4 having the amino acid sequence shown in FIGS. 8A-8C is substantially free of other proteins. 8. An isolated fragment of TIE ligand-4, which is its fibrinogen-like domain, starting from or within the FQDCA sequence and ending with the C-terminus of the amino acid sequence shown in Figs. 8A-8C. 9. A method for producing a transformed host cell, which comprises the following steps: a) preparing a competent recipient cell; b) contacting the cell obtained in stage a) with the vector according to claim 4 or 5; and c) maintaining the reaction mixture obtained in stage b) under conditions conducive to the implementation of the transformation process. 10. The method according to claim 9, where the host cell is a bacterial cell, a yeast cell, an insect cell or a mammalian cell. 11. The method of obtaining TIE ligand-4, which includes the cultivation of cells obtained by the method according to claim 9, under conditions that allow the production of TIE ligand-4, and the extraction of thus produced T1E ligand-4. 12. The conjugate containing the ligand according to claim 7 or 8 and a cytotoxic agent conjugated to the ligand in the desired ratio. 13. The conjugate of claim 12, wherein the cytotoxic agent is a radioisotope or toxin. 14. The ligand body, which contains the fibrinogen-like domain of the ligand according to claim 8, connected to the constant region or Fc domain of immunoglobulin. The Convention priority according to claims 1-14 is established from 02.07.1996 in accordance with the application 60/02187, filed with the Patent Office of the Joint Venture TA.

Images