RU2220979C2 - Polypeptide-ligand flt3 (variants), polynucleotide (variants), expressing vector (variants), strain of cell cho (variants), method for producing polypeptide-ligand flt3 (variants), pharmaceutical composition (variants) - Google Patents

Abstract

FIELD: molecular biology, biotechnology, pharmacy. SUBSTANCE: polynucleotide encoding polypeptide-ligand flt3 is cloned to expressing vector showing functionality in mammalian cells. Polypeptide-ligand flt3 is prepared by culturing the strain cell CHO transfected with vector. Pharmaceutical composition that is able to stimulate proliferation and differentiation of cell-precursors and stem cells contains polypeptide flt3 taken in the effective amount. Invention provides the development of agents used for treatment of patients with anemia, AIDS and cancer diseases. Invention can be used for preparing ligand flt3. EFFECT: improved preparing method, valuable biological and medicinal properties of polypeptide. 18 cl, 4 tbl, 14 ex

Description

 This is partly continuing application of USApplication, 08/209502, filed March 7, 1994, which is partly continuing application of USApplication 08/162 407, filed December 3, 1993, which is partly continuing application of USApplication 08/111758, filed 25 August 1993, which is partly continuing application of USApplication 08/106463, filed August 12, 1993, which in turn is partly continuing application of USApplication 08/068394, filed May 24, 1993, which has been discontinued.

Field of Invention
This invention relates to mammalian flt 3 ligands, nucleic acids encoding such ligands, methods for producing recombinant flt 3 ligands, pharmaceutical compositions containing such ligands, and their use in various therapies.

BACKGROUND OF THE INVENTION
Blood cells, hemocytes, originate from hematopoietic stem cells that differentiate in certain directions of differentiation, i.e., in erythroid, megakaryocytic, granulocytic, monocytic and lymphocytic directions of differentiation. Cytokines that stimulate the proliferation and maturation of progenitor cells are called colony stimulating factors ("CSF"). Some CSFs are produced by T-lymphocytes, including interleukin-3 ("1L-3"), granulocyte-monocytic CSF (CM-CSF), granulocyte CSF (G-CSF) and monocytic CSF (M-CSF). These CSFs affect both mature cells and stem cells. So far, no factors capable of acting predominantly on stem cells have been discovered.

 Tyrosine kinase receptors ("TKR") are growth factor receptors that regulate the proliferation and differentiation of many cells (Yarden, Y.8 Ulrich, A. Annu. Rev. Biochem 57, 443-478, 1988, and Cadena, DL & Gill , GN FASEB J., 6, 2332-2337, 1992). Some TCRs act within the hematopoietic (hematopoietic) system. For example, signal transduction through colony stimulating factor 1 ("CSF-1"), the c-fms receptor regulates monocyte survival, growth, and differentiation (Stanley et al., J. Cell Biochem, 21, 151-159, 1983). The stylus factor SF, also known as mast cell growth factor, stem cell self-maintenance factor or kit-ligand, acting via-kit, stimulates cell proliferation in both myeloid and lymphoid compartments.

 flt 3 (Rosnet et al., Oncogene, 6, 1641-1650, 1991) and flk-2 (Mathhews et al., Cell, 65, 1143-1152, 1991) are varieties of TCR, which refers to c-fms and c -kit receptors. The flk-2 gene product is expressed on hematopoietic and undifferentiated cells (progenitor cells), while the flt 3 gene product has a more general tissue distribution. The flt 3 and flk-2 receptor proteins are similar in amino acid sequence and differ in two amino acid residues in the extracellular domain and differ in a segment of 31 amino acids located near the C-termini (Lyman et al., Oncogene, 8, 815-822, 1993) .

 It was found that flt 3 ligand ("flt 3-L") regulates the growth and differentiation of progenitor cells and stem cells and, apparently, is useful in the clinic in the treatment of hematopoiesis, in particular hypoplastic (aplastic) anemia and myelodysplastic syndromes . In addition, flt 3-L should be useful in allogeneic, syngeneic, or autologous bone marrow transplants in patients undergoing cytoreduction therapy, as well as in cell development.

 Flt 3-L will also be useful in gene therapy and in the mobilization systems of progenitor cells and stem cells.

 Cancer is treated with cytosurgery, which involves the use of ionizing radiation or the introduction of chemical toxins that kill rapidly dividing cells. Side effects usually occur as a result of the cytotoxic effect on normal cells and they may limit the use of cytotoxic therapies. A common side effect is myelosuppression, or damage to bone marrow cells that increase white blood cells, red blood cells, and platelets. As a result of myelosuppression, patients develop cytopenia or a lack of blood cells, which increases the risk of infection and bleeding disorders.

 Cytopenia increases soreness, mortality, and leads to lower doses in cancer treatment. Many clinical researchers have manipulated cytoreduction therapy by dispensing drugs and modifying drug regimens to increase the dosage for cancer therapy while limiting bone marrow damage. One approach uses bone marrow or peripheral blood transplants, in which bone marrow or circulating hematopoietic progenitor cells or stem cells are removed before cytotherapy and then re-infused after therapy to restore hematopoietic function. U.S. Patent 5199942, incorporated herein by reference, describes a method for using GM-CSF, 1L-3, SF, GM-CSF / 1L-3 fusion proteins, erythropoietin ("EPO"), and combinations thereof in autologous transplantation treatment programs.

 High-dose chemotherapy is therapeutically advantageous because it gives an increased frequency of targeted response in patients with metastatic cancer, in particular breast cancer, compared to standard dose therapy. This can lead to longer remission with no signs of illness for some patients, even with a poor prognosis. However, high-dose chemotherapy is toxic and can lead to many clinical complications, such as infections, bleeding disorders, and other effects associated with prolonged periods of myelosuppression.

 Myelodysplastic syndromes are disorders of stem cells characterized by impaired cell maturation, progressive pancytopenia and functional abnormalities of mature cells. They are also characterized by variable degrees of cytopenia, ineffective erythropoiesis and myelopoiesis with bone marrow cells, which are normal or enlarged in number and have an unusual morphology. Benet et al. (B.J. Haematol 1982; 51: 180-199) divided these disorders into 5 subtypes: refractory (persistent) anemia, refractory anemia with annular sideroblasts, refractory anemia with excess blast cells, refractory anemia with excess blast cells during degeneration and chronic myelomonocytic leukemia. Although a significant percentage of these patients develop acute leukemia, most of them die from infectious or hemorrhagic complications. Treatment for these syndromes with retinoids, vitamin A, and cytarabine has not been successful. Most patients suffering from these syndromes are elderly and are not potential candidates for bone marrow transplantation or aggressive anti-leukemia chemotherapy.

 Aplastic anemia is another form of the disease characterized by a bone marrow disorder and severe pancytopenia. In contrast to myelodysplastic syndrome, in this disorder, the bone marrow does not contain cells or contains few cells. Existing treatments include a bone marrow transplant from a tissue-compatible donor or immunosuppressive treatment with antithymocyte globulin (ATG). As in the case of myelodysplastic syndrome, most patients suffering from this syndrome are elderly and bone marrow transplantation or aggressive anti-leukemia chemotherapy are unacceptable to them. In these patients, mortality from infectious and hemorrhagic complications is extremely high.

 Anemia usually occurs in patients with acquired immunodeficiency syndrome (AIDS). This anemia is usually more severe in patients treated with zidovudine. Many important retroviral agents, anti-infective and anti-tumor agents suppress erythropoiesis. Recombinant EPO has been shown to normalize hematocrit and hemoglobin levels, however, this usually requires very high doses. A growth factor that stimulates proliferation in the erythroid direction of differentiation could be used alone or in combination with EPO or other growth factors to treat such patients and reduce the number of blood transfusions required. Growth factor, which could also increase the number of T cells, would find concrete application in the treatment of AIDS patients.

Summary of the invention
This invention relates to the biologically active flt 3 ligand (flt 3-L) as an isolated or homogeneous protein. In addition, the invention relates to isolated DNA encoding flt 3-L and to expression vectors containing cDNA encoding flt 3-L. Within the scope of this invention are host cells that have been transfected or transformed with expression vectors containing cDNA encoding flt 3-L, and methods for producing flt 3-L by culturing such host cells under conditions conducive to the expression of flt 3-L.

 Flt 3-L can be used to prepare pharmaceutical compositions for use in allogeneic, syngeneic and autogenic transplantation methods. Pharmaceutical compositions may contain only flt 3-L or flt 3-L in combination with other growth factors such as interleukins, colony stimulating factors, protein tyrosine kinases and cytokines.

 This invention includes methods of using flt 3-L compositions in gene therapy and in the treatment of patients suffering from myelodysplastic syndrome, aplastic anemia, HIV infection (AIDS) and cancers such as breast cancer, lymphoma, small cell lung cancer, multiple myeloma (Calera's disease), neuroblastoma, acute leukemia, testicular tumors and ovarian cancer.

 This invention also relates to antibodies, in particular monoclonal antibodies immunoreactive with flt-3-L. Fusion proteins containing the soluble portion of flt 3-L and the immunoglobulin constant domain are also included in this invention.

The present invention is also directed to the use of flt 3-L in methods for transplanting peripheral blood progenitor cells or stem cells. Typically, peripheral blood precursor cells or stem cells are removed from the patient before myelosuppressive cytoreduction therapy and then reintroduced to the patient with or after cytoremediation therapy to neutralize the myelosuppressive effects of such therapy. This invention provides the use of an effective amount of flt 3-L in at least one of the following methods:
(i) flt 3-L is administered to a patient before harvesting progenitor cells or stem cells to increase or mobilize the number of such circulating cells in the bloodstream;
(ii) after harvesting the patient’s progenitor cells or stem cells, flt 3-L is used to increase the volume of such cells ex vivo and
(iii) flt 3-L is administered to the patient after transplantation of harvested progenitor cells or stem cells for facilitation and engraftment. The transplantation method of this invention may further include the use of an effective amount of a cytokine in sequential or competitive combination with flt-3-L. Such cytokines include, but are not limited to, interleukins ("1L") 1L-1, 1L-2, 1L-3, 1L-4, 1L-5, 1L-6, 1L-7, 1L-8, 1L-9 , 1L-10, 1L-11, 1L-12, 1L-13, 1L-14 or 1L-15, CSF selected from the group consisting of G-CSF, GM-CSF, M-CSF or GM-CSF / 1L -3-fusion proteins, or other growth factors, such as CSF-1, SF, EPO, leukemia inhibiting factor ("1 1F") or fibroblast growth factor ("FGF"). Flt 3-L is also applicable in the same way for syngeneic or allogeneic transplantation.

 The invention further includes precursors and stem cell growth media containing cell growth media, autologous serum and flt 3-L alone or in combination with a cytokine from the above group.

 In addition, the invention provides the use of flt 3-L to increase the volume of progenitor cells or stem cells collected from umbilical vein blood. This stretching of the cells can be carried out with one flt 3-L or in a sequential or competitive combination with a cytokine from the group described above.

 In addition, the invention provides for the use of flt 3-L in gene therapy. Flt 3-L allows the proliferation and cultivation of early (undifferentiated) hematopoietic progenitor cells or stem cells that must be transfected with exogenous DNA for use in gene therapy. Alternatively, cDNA encoding flt 3-L can be transfected into cells to ultimately deliver its gene product to the target cell or tissue.

 In addition, the invention provides the use of flt 3-L to stimulate the formation of erythroid cells in vivo for the treatment of anemia. Such use involves the administration of flt 3-L to a patient in need of such stimulation of erythroid cells, in combination with or after cytotherapy. This treatment may include the simultaneous administration of another growth factor selected from cytokines from the above group. Preferred cytokines for use in this treatment are EPO, 1L-3, G-CSF and GM-CSF. Such treatment, in particular, is applicable for AIDS patients, in particular for AIDS patients receiving treatment with AZT (azidodeoxythymidine).

 Since flt 3-L stimulates stem cell formation, the flt 3-L of the present invention can affect other non-hematopoietic stem cells carrying flt-3 receptors. Flt 3-L is useful in in vitro fertilization methods and can be used in vivo in the treatment of infertility. In the gut, the flt 3 ligand is useful in treating bowel damage caused by radiation or chemotherapy. Flt 3-L can also be used to treat patients infected with human immunodeficiency virus (H1V, HIV). Such treatment involves the administration of flt 3-L to stimulate in vivo formation, as well as increase the volume of ex vivo T cells and erythroid cells. Such treatment can prevent T-cell deficiency, in particular CD 4-positive T-cells, and can increase the patient’s immune response against this virus, thereby improving the patient’s quality of life. Flt 3-L can be used to stimulate stem cells, which leads to the development of hair follicles, enhancing hair growth.

 In addition, flt 3-L can be bound to a solid phase matrix and used for affinity purification or separation of cells expressing flt 3 on their surface. The invention provides for the separation of cells having a flt 3 receptor on their surface from a mixture of cells in solution by contacting these cells in a mixture with a contact surface having flt 3 binding molecules on it, and separating this surface and solution. After separation, these cells can be grown ex vivo using flt 3-L and administered to the patient.

DETAILED DESCRIPTION OF THE INVENTION
The coding mouse flt 3-L cDNA was isolated and described in SEQ ID 1. The coding human flt 3-L cDNA was isolated and described in SEQ ID 5. This disclosure of cDNA encoding mouse and human flt 3-L makes it possible to construct expressing vectors containing cDNA encoding flt 3-L; host cells transfected or transformed with these expression vectors; obtaining biologically active murine and human flt 3-L in the form of homogeneous proteins; antibodies immunoreactive with murine and human flt 3-L.

 Flt 3-L is useful in enhancing, stimulating the proliferation or growth of cells expressing the flt 3 receptor, including cells that are not homopoietic. Since the flt 3 receptor is found in the brain, placenta, and tissues originating from the nervous system, or tissues of hematopoietic origin and distributed in the ovaries, ovaries, lymph nodes, spleen, thymus and liver of the embryo, it is possible to treat many conditions associated with damage to their tissues . Specific uses of flt 3-L are described below, although the invention is not limited thereto.

 As used herein, the term “flt 3-L” refers to a genus of polypetids that bind and complex independently with the flt 3 receptor found on progenitor cells (undifferentiated cells) and stem cells. The term “flt 3-L” includes proteins having the amino acid sequence 1-231 of SEQ ID 2: or the amino acid sequence 1-235 of SEQ ID: 6, as well as those proteins that have a high degree of similarity or a high degree of identity with the amino acid sequence 1-231 SEQ ID: 2 or with the amino acid sequence 1-235 SEQ ID: 6 and are biologically active and bind to the flt 3 receptor. In addition, this term refers to the biologically active gene products of DNA SEQ ID: 1 or SEQ ID: 5. In addition, the term "flt 3-L" refers to membrane-bound proteins (which include the extracellular region, the membrane region and the intracellular region) and soluble or truncated proteins that contain the original extracellular portion of such a protein, retain biological activity and are able to be secreted. Representative examples of such soluble proteins are those containing the amino acid sequence of 28-163 SEQ ID: 2 and the amino acid sequence of 28-160 SEQ ID: 6.

 The term “biologically active” with respect to flt 3-L means that flt 3-L is capable of binding to flt 3. Alternatively, the term “biologically active” means flt 3-L, which is capable of transducing a stimulating signal to a cell through membrane-bound flt 3.

 "Isolated" means that flt 3-L is not bound to other proteins or polypeptides, for example, as a purified product of a recombinant host cell culture or as a purified extract.

 As used herein, “flt 3-L variant" means a polypeptide substantially homologous to native flt 3-L, but having an amino acid sequence different from that of native flt 3-L (human, mouse, or other mammalian species) due to one or more deletions , insertions or substitutions. Such a variant amino acid sequence is preferably at least 80% identical to the amino acid sequence of native flt 3-L, most preferably identical to at least 90%. The percentage of identity can, for example, be determined by comparing sequence information using the GAR software version 6.0, described by Devereux et al. (Nucl. Acids. Res. 12: 387, 1984) and is available from the University of Wisconsin Genetics Computer Group (UWGCG).

The GAP program uses the primary structure comparative analysis method Nеdleman and Wunsch (J. Mol. Biol. 48: 443, 1970), revised by Smith and Waterman (Adv. Appl. Math. 2: 482, 1981). The preferred "default" parameters for the GAP program are:
(1) a unary comparison matrix (containing a value of 1 for identities and O for negation of identity) for nucleotides and a weight comparison matrix Gribskov and Burgess, Nucl. Acids Res. 14: 6745, 1986, as described by Schartz and Dayhoff, eds., Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, pp. 353-358, 1979;
(2) a penalty of 3.0 for each pass and an additional penalty of 0.10 for each character in each pass and
(3) lack of punishment for end passes. Varieties may contain conservatively substituted sequences, i.e. this amino acid residue is replaced by a residue having similar physicochemical properties. Examples of conservative substitutions are the replacement of one aliphatic residue with another, for example, the replacement of 1le, Val, Leu or Ala with each other, or the replacement of one polar residue with another, for example, a substitution between LyS and Arg; Glu and Asp; or Gln and Asn. Other such conservative substitutions, for example, substitutions of whole regions having similar hydrophobicity characteristics, are well known. Naturally occurring species of flt 3-L are also included in this invention. Examples of such varieties are proteins originating from events of moving mRNA splicing or from proteolytic cleavage of the flt 3-L protein, in which the binding ability of fLt 3-L is maintained. Intermittent mRNA splicing can produce a shortened but biologically active flt 3-L protein, such as the naturally occurring soluble form of this protein, for example. Variations attributed to proteolysis include, for example, cleavage at the N- or C-ends when expressed in different types of host cells, caused by proteolytic removal of one or more terminal amino acids from flt 3-L protein (mainly from 1-5 terminal amino acids) .

The term "autologous or autologous transplantation" is described in USPatent 5199242, incorporated herein by reference. Briefly, the term means a method for transplanting autologous hematopoietic progenitor cells or stem cells, comprising:
(1) collection of hematopoietic progenitor cells or stem cells from a patient before cytotherapy;
(2) an increase in the volume (development) of these undifferentiated hematopoietic cells or stem cells ex vivo with flt 3-L to provide a cell preparation containing increased amounts of hematopoietic progenitor cells or stem cells, and
(3) administering this cellular preparation to a patient with or after cytotherapy. Precursor cells and stem cells can be obtained from collected peripheral blood or bone marrow explants. Sometimes, one or more cytokines selected from the group described above can be combined with flt 3-L to facilitate the proliferation of certain types of hematopoietic cells or to influence the cellular function of the resulting multiplied population of hematopoietic cells. Of the above, SF, 1L-1, 1L-3, EPO, G-CSF, GM-CSF and GM-CSF / 1L-3 fusion proteins are preferred, and G-CSF, GM-CSF and GM-CSF / are particularly preferred. 1L-3 fusion proteins. The term "allogeneic transplantation" means a method in which bone marrow cells or peripheral blood precursor cells or stem cells are removed from a mammal and introduced to another mammal of the same species. The term “syngeneic transplantation” means transplantation of bone marrow by genetically identical mammals.

 The transplantation method of the present invention described above involves a preliminary in vivo procedure, comprising administering flt 3-L alone, either sequentially or in combination with a replenishing growth factor, to a patient to replenish hematopoietic cells in peripheral blood before collection. Suitable hematopoietic cell replenishing factors are listed above and preferred are flt 3-L, SF, 1L-1 and 1L-3.

 The method of the present invention described above sometimes involves the administration of 3-1 alone or in sequential or joint combination with an engraftment growth factor to a patient after transplantation of a cell preparation to facilitate engraftment and enhance the proliferation of engraftment hematopoietic progenitor cells or stem cells from the cell preparation. Suitable engraftment factors are listed above, and GM-CSF, G-CSF, 1L-3, 1L-1, EPO and fused GM-CSF / 1L-3 are preferred.

 The invention further includes mediums for the growth of progenitor cells or stem cells containing mediums for the growth of cells, autologous serum and flt 3-L alone or in combination with a cytokine growth factor from the above cytokines. Preferred growth factors are SF, GM-CSF, 1L-3, 1L-1, G-CSF, EPO and fusion proteins GM-CSF / 1L-3.

 In particular, flt 3-L can be used to stimulate the proliferation of hematopoietic and non-hematopoietic stem cells. Such stimulation is beneficial when specific tissue damage occurs. As such, flt 3-L can be used in the treatment of neurological damage and it can be a growth factor for nerve cells. Flt 3-L could probably be used in in vitro fertilization methods and in the treatment of in vivo infertility conditions. Flt 3-L could be useful in treating intestinal damage caused by radiation or chemotherapy. Since the flt 3 receptor is present on stem cells leading to the development of hair follicles, flt 3-L could probably be used to enhance hair growth.

Since flt 3-L has been shown to stimulate the proliferation of T cells as well as red blood cells (see Examples, infra), flt 3-L is used in the treatment of patients infected with human immunodeficiency virus (H1V, HIV). Such treatment should include the introduction of flt 3-L to stimulate the formation of in vivo as well as ex vivo reproduction of T cells. In addition, flt 3-L can prevent CD 4 ⁺ T cell deficiency. Such treatment can enhance or maintain the patient’s immune response against this virus, thereby improving or maintaining the patient’s quality of life. In addition, such an in vivo treatment would stimulate cells of the erythroid differentiation direction, improving hematocrit and hemoglobin levels. In this case, Flt 3-L can be administered alone or in sequential or simultaneous combination with cytokines selected from the described group.

Flt 3-L is applicable in gene therapy because of its specificity for progenitor cells and stem cells. Gene therapy involves the administration of transfected exogenous DNA cells to the host, which are allowed to take root in it. See, for example, Boggs, International J. Cell Cloning, 8: 80-96 (1990); Kohn et al. , Cancer Invest. 7 (2): 179-192; Lehn, Bone Marrow Trarspl. 5: 287-293 (1990); Verma, Scientific American, pp. 68-84 (1990). Using gene therapy methods known in the art, a method for transferring a gene to a mammal comprises the steps of:
(a) culturing early hematopoietic cells in media containing one flt 3-L or in sequential or simultaneous combination with a cytokine selected from the group described above;
(b) transfecting cultured cells of step (a) with an exogenous gene; and
(c) administration of transfected cells to a mammal. Within the framework of this method, a new method for transfection of progenitor cells or stem cells with a genome is provided, which comprises the described steps (a) and (b). In addition, using the same or similar methods, cDNA encoding flt 3-L can be transfected into such delivery cells to deliver the flt 3-L gene product to target tissues.

 Example 1 describes the construction of a new flt 3: Fc fusion protein useful in flt 3-L screening. Other Fc regions of the antibody can be replaced by the Fc region of human IgGl described in Example 1. Other suitable Pc regions are those that can bind with high affinity to protein A or protein G and include the Fc region of human IgGl or fragments of the Fc region and human or mouse IgGl, for example fragments containing at least a hinge region, so that interchain disulfide bonds will form. The fusion protein flt 3: Fc has the advantage that it is easy to clean. In addition, disulfide bonds form between the Fc regions of two separate chains of the fusion protein, creating dimers. The flt 3: Fc dimeric receptor has been selected for the potential advantage of high affinity flt 3-L binding due to the possibility that this ligand could be multimeric.

 As described supra, an aspect of this invention are soluble flt 3-L polypeptides. Soluble flt 3-1 polypeptides contain the entire extracellular domain or part of the native flt 3-L, but do not contain a transmembrane region that would hold this polypeptide on the cell membrane. The advantage of soluble flt 3-L polypeptides is that they contain a native (or heterologous) signal peptide that is synthesized initially to enhance secretion, but this signal peptide is cleaved by secretion of flt 3-L from the cell. The soluble flt 3-L polypeptides included in this invention retain the ability to bind the flt 3 receptor. In fact, soluble flt 3-L may also contain part of the transmembrane region or part of the cytoplasmic domain or other sequences, provided that the soluble flt 3-L protein may be secreted.

 Soluble flt 3-L can be identified (and can be distinguished from its membrane-bound copies) by determining the intact cells expressing this target protein from the culture medium, for example, by centrifugation and analysis of this medium (supernatant) for the presence of the target protein. The presence of flt 3-L in the medium indicates that this protein was secreted from cells and, therefore, is a soluble form of the target protein.

 Soluble forms of flt 3-L have many advantages over the native bound protein flt 3-L. It is possible to purify such proteins from recombinant host cells, as soluble proteins are secreted from these cells. In addition, soluble proteins are usually more suitable for intravenous administration.

Examples of soluble flt 3-L polypeptides are polypeptides containing a significant portion of the extracellular domain of the native flt 3-L protein. Such soluble mammalian flt 3-L proteins contain amino acids 28-188 of SEQ ID: 2 or amino acids 28-182 of SEQ ID: 6. In addition, trt 3-L truncated soluble proteins containing an incomplete extracellular domain are also included in the invention. Such truncated, soluble proteins are amino acids 28-163 SEQ ID: 2 and amino acids 28-160 SEQ ID: 6. Upon initial expression within the host cell, soluble flt 3-L may further comprise one of the heterologous signal peptides described below, which is functional in the host cells. Alternatively, the protein may contain a native signal peptide such that the mammalian flt 3-L contains amino acids 1-188 of SEQ ID: 2 or amino acids 1-182 of SEQ ID: 6. In one embodiment, soluble flt 3-L was expressed as a fusion protein comprising (from N- to C-terminus) the signal peptide of yeast α-factor, FLAG ^® peptide described below and in USPatent 5,011,912, and soluble flt 3-L, consisting of amino acids 28-188 SEQ ID: 2. This recombinant fusion protein is expressed and secreted in yeast cells. FLAG ^® peptide facilitates purification of the protein, and subsequently may be cleaved from the soluble flt 3-L using bovine mucosal enterokinase. Isolated DNA sequences encoding soluble flt 3-L proteins are included in this invention.

 Shortened flt 3-L, including soluble polypeptides, can be obtained by any of many standard methods. The target DNA sequence can be chemically synthesized using known methods. DNA fragments can also be obtained by restriction enzyme digestion of the full length sequence of cloned DNA and isolated by agarose gel electrophoresis. Linkers containing restriction enzyme cleavage site (s) may be used to insert the target DNA fragment into the expression vector, or the fragment may be cleaved at the cleavage sites naturally present in it. A well-known polymerase chain reaction procedure can also be used to amplify a DNA sequence encoding a target protein fragment. As a further alternative, known mutagenesis methods can also be used to insert a stop codon at a desired point, for example, directly to the right (in the direction 5′-3 ′) of the codon for the last amino acid of the extracellular domain.

 In another approach, enzymatic treatment (eg, exonuclease Bal31) can be used to divide terminal nucleotides from a DNA fragment to obtain a fragment having a specific target end. Among commercially available linkers are linkers that can be ligated to the blunt ends formed upon Bal31 cleavage and which contain restriction enzyme cleavage site (s). Alternatively, oligonucleotides that reconstruct the N- or C-terminus of a DNA fragment to a desired point can be synthesized and ligated with this DNA fragment. The synthesized oligonucleotide may contain a restriction enzyme cleavage site to the left (in the 3'-5 'direction) of the desired coding sequence and the position of the initiation codon (ATG) at the N-terminus of the coding sequence.

 As stated above, this invention provides isolated or homogeneous 3-1 polypeptides, both recombinant and non-recombinant. Varieties and derivatives of native 3-1 proteins that retain the desired biological activity (for example, the ability to bind flt 3) can be obtained using mutations in nucleotide sequences encoding native flt 3-L polypeptides. Changes in the native amino acid sequence can be achieved by any of a number of standard methods. Mutations can be introduced at specific loci by synthesizing oligonucleotides containing a mutant sequence flanked by restriction sites that allow ligation with fragments of the native sequence. After ligation, the resulting reconstituted sequence encodes an analogue having the desired amino acid insertion, substitution or deletion.

 Alternatively, oligonucleotide-directed site-specific mutagenesis methods can be used to provide an altered gene in which target codons can be altered by substitution, deletion or insertion. Examples of methods for providing such changes set forth above are described by Walder et al. (Gene 42: 133, 1986); Bauer et al. (Gene 37:73, 1985); Craik (BioTechniques, January 1985, 12-19); Smith et al. (Genetic Engineering: Principles and Methods, Plenum Press 1981); Kunkel (Proc. Natl. Acad. Sci. USA 82: 488, 1985); Kunkel et al. (Methods in Enzymol. 154: 367, 1987) and U.S. Patent 4518584 and 4737462, incorporated herein by reference.

 Flt 3-L can be modified to produce flt 3-L derivatives by forming covalent or aggregate conjugates with other chemical moieties such as glycosyl groups, lipids, phosphate, acetyl groups and the like. Covalent derivatives of flt 3-L can be prepared by combining these chemical moieties with functional groups on the amino acid side chains of flt 3-L or at the N-terminus or C-terminus of the flt-3-L polypeptide or its extracellular domain. Other flt 3-L derivatives within the scope of this invention include covalent or aggregate conjugates of flt 3-L or fragments thereof with other proteins or polypeptides, for example, by synthesis in recombinant culture as N-terminal or C-terminal fusion proteins. For example, such a conjugate may comprise a signal or leader polypeptide sequence (eg, the Saccharomyces α factor leader leader) at the N-terminus of the flt 3-L polypeptide. The signal or leader peptide co-translationally or post-translationally directs the transport of the conjugate from the place of its synthesis to a place inside or outside the cell membrane or cell wall.

 Fusion flt 3-L polypeptides may contain peptides added to facilitate purification and identification of flt 3-L. Such peptides include, for example, poly-His or antigenic identification peptides described in U.S. Patent 5011912 and in Norr et al., Bio / Technology 6: 1204, 1988.

 In addition, the invention includes flt 3-L polypeptides with or without associated natural glycosylation distribution. Flt 3-L expressed in yeast expression systems or in mammalian expression systems (for example, in COS-7 cells) can be similar to the native flt 3-L polypeptide or differ significantly from it in mol. the mass and distribution of glycosylation depending on the choice of expression system. Expression of flt 3-L polypeptides in bacterial expression systems such as E. coli provides non-glycosylated molecules.

 Equivalent DNA constructs encoding various additions or substitutions of amino acid residues or sequences or deletions of terminal or internal residues or sequences that are not required for biological activity or binding are included in this invention. For example, N-glycosylation sites in the extracellular domain of flt 3-L can be modified to prevent glycosylation, which allows expression of the reduced carbohydrate analogue in mammalian and yeast expression systems. N-glycosylation sites in eukaryotic polypeptides are characterized by the amino acid triplet Asn-X-Y, where X is any amino acid except Pro and Y is Ser or Thr. Mouse and human flt 3-L proteins contain (each) two such triplets at amino acid positions 126-128 and 150-152 of SEQ ID: 6, respectively. Suitable substitutions, additions or deletions in the nucleotide sequence encoding these triplets will prevent the attachment of carbohydrate residues to Asn of the side chain. Changes in a single nucleotide selected in such a way that Asn is replaced by another amino acid, for example, is sufficient to inactivate the N-glycosylation site. Known methods for inactivating N-glycosylation sites in proteins include the methods described in U.S. Patent 5071972 and EP276846, incorporated herein by reference.

In another example, sequences encoding Cys residues that are not essential for biological activity can be changed so that Cys residues are deleted or replaced by other amino acids, which prevents the formation of abnormal disulfide bridges inside the molecules during renaturation. Other equivalents are obtained by modifying adjacent two basic amino acid residues to enhance expression in yeast systems in which KEX2 protease activity is present. EP 212914 describes the use of site-specific mutagenesis to inactivate sites of action of KEX2 proteases in a protein. These sites are inactivated by deletion, addition or substitution of residues to change the pairs of Arg-Arg, Arg-Lys and Lys-Arg to exclude the presence of these adjacent basic residues. Lys-Lys pairs are significantly less susceptible to KEX2 cleavage, and converting Arg-Lys or Lys-Arg pairs to Lys-Lys pairs is a conservative and preferred approach for inactivating KEX2 sites. Both mouse and human flt 3-L contain two KEX2 protease action sites for amino acids 216-217 and 217-218 of SEQ ID: 2 and for amino acids 211-212 and 212-213 of SEQ ID: 6, respectively. Nucleic acid sequences within the scope of the invention include isolated DNA and RNA sequences that hybridize to the native flt 3-L nucleotide sequences described herein under moderate or high stringency conditions and encode biologically active flt 3-L. The conditions of moderate severity described by Sambrook et al. Molecular Cloning: A Laboratory Manual, 2ed. Vol. 1, pp. 1. 101-104, Cold Spring Harbor Laboratory Press, (1989), provide for the use of a pre-wash solution of 5x SSC, 0.5% SDS 1.0 mM EDTA (pH 8.0) and hybridization conditions of approximately 55 ^° C, 5x SSC, during the night. High stringency conditions include higher hybridization and washing temperatures. A qualified person in this field should understand that the temperature and salt concentration in the wash solution can be adjusted, if necessary, in accordance with factors such as the length of the probe.

 Due to the known degeneracy of the genetic code in which more than one codon can encode the same amino acid, the DNA sequence may differ from that shown in SEQ ID: 1 and SEQ ID: 5 and still encode the flt 3-L protein having the amino acid the sequence of SEQ ID: 6, respectively. Such variant DNA sequences may originate from silent mutations (for example, occurring during PCR amplification) or may be the product of nonspecific mutagenesis of the native sequence.

The present invention provides equivalent isolated DNA sequences encoding the biologically active flt 3-1 selected from:
(a) DNA obtained from the coding region of a native mammalian flt 3-L gene;
(b) a cDNA containing the nucleotide sequence shown in SEQ ID: 1 or SEQ ID: 5;
(c) DNA capable of hybridizing with DNA (a) under moderately stringent conditions and encoding the biologically active flt 3-L, and
(d) DNA degenerated as the result of a genetic code relative to DNA defined in (a), (b) or (c), and encoding the biologically active flt 3-L. Flt 3-L proteins encoded by such equivalent DNA sequences are included in this invention.

 DNAs that are equivalent to a DNA sequence of SEQ ID: 1 or SEQ ID: 5 will hybridize under moderately stringent conditions to a native DNA sequence encoding polypeptides containing amino acid sequences of 28-163 SEQ ID: 2 or 28-160 SEQ ID: 6. Examples of flt 3-L proteins encoded by such DNA include, but are not limited to, fragments of flt 3-L (soluble or membrane-bound) and flt 3-L proteins containing inactivated N-glycosylation site (s), inactivated action sites KEX2 proteases or conservative amino acid substitutions described above. Also included in the invention are flt 3-L proteins encoded by DNA obtained from other mammalian species that will hybridize with SEQ ID: 1 or SEQ ID: 5 DNA.

 Varieties with the required ability to bind to the flt 3 receptor can be identified by any suitable test. The biological activity of flt 3-L can, for example, be determined by competition for binding to the ligand binding domain of the flt 3 receptor (i.e., competitive binding assays).

 One type of competitive binding assay for the flt 3-L polypeptide utilizes radiolabeled human flt 3-L and intact cells expressing cell surface flt 3 receptors. Instead of intact cells, soluble flt 3 receptors (such as the flt 3: Fc fusion protein) linked to the solid phase through the interaction of Protein A, Protein G or antibodies to the flt 3 or Fc parts of this molecule with the Fc region of the fusion protein could be used . Another type of competitive binding assay uses radioactively labeled soluble 3 receptors, such as the flt 3: Fc fusion protein, and inactive cells expressing flt 3-L. Alternatively, soluble flt 3-L may be coupled to a solid phase to positively select flt 3 expressing cells.

Competitive binding tests can be performed according to
generally accepted methodology. For example, radiolabeled flt 3-L can be used to compete with the putative flt 3-L homolog to evaluate the binding activity of surface-bound flt-3 receptors. Quantitative results can be obtained using competitive binding tests using a plate for autoradiography or using Sketchard curves used to obtain quantitative results.

 Alternatively, 3-binding proteins, such as flt 3-L and anti-flt 3 antibodies, may be coupled to a solid phase, such as a column chromatography matrix or the like, suitable for identifying, separating or purifying cells expressing flt 3 receptor on their surface. The binding of flt 3-binding proteins to a surface in contact with the solid phase can be accomplished by any method, for example, the construction of a fusion protein flt 3: Fc and its binding to the solid phase through the interaction of Protein A or Protein G. Numerous other methods for fixing proteins with a solid phase are well known in this area and suitable for use in this invention. For example, magnetic microspheres can be coated with flt 3-binding proteins and held in an incubation vessel using a magnetic field. Suspensions of cell mixtures containing hematopoietic progenitor cells or stem cells are brought into contact with a solid phase having flt 3-binding proteins on its surface. Cells having a flt 3 receptor on their surface bind to a fixed flt 3-binding protein, and unbound cells are washed out. This affinity binding method is useful for purification, screening, or separation of such flt 3 expressing cells from a solution. A method for releasing positively selected cells from a solid phase is known in the art and, for example, involves the use of enzymes. Such enzymes are preferably non-toxic and harmless to cells and are preferably directed to cleavage of the binding partner of the cell surface. In the case of flt 3: flt 3-L interactions, the enzyme should preferably cleave the flt 3 receptor, thereby freeing the resulting cell suspension from the “foreign” flt 3-L material. The purified cell population can then be multiplied ex before transplantation to the patient in an amount sufficient to restore the hematopoietic and immune system of the patient.

Alternatively, cell mixtures in which the presence of flt 3 ⁺ cells is suspected may be incubated with the biotinylated flt 3 binding protein first. Incubation periods are usually at least an hour to ensure sufficient binding to flt 3. Then, the resulting mixture is passed through a column packed with avidin-coated beads, resulting in a high affinity of biotin for avidin ensures cell binding to the beads. The use of avidin-coated granules is known in the art. See Berenson et al. J. Cell biochem. 10: 239 (1986). The washing of unbound material and the release of bound cells is accomplished using conventional methods.

 In the methods described above, suitable flt 3-binding proteins are flt 3-L, anti-flt 3 antibodies and other proteins capable of binding to flt 3 with high affinity. A preferred flt 3-binding protein is flt 3-L.

As described above, flt 3-L of this invention can be used to separate cells expressing flt 3 receptors. In an alternative method, flt 3-L or its extracellular domain or fragment thereof can be conjugated to a detectable moiety, such as ¹²⁵ I, to detect expression flt 3 cells. Radioactive labeling using ¹²⁵ I can carry out any of several standard methodologies that give the ¹²⁵ I-flt 3-L functional molecule labeled to high specific activity. An iodinated or biotinylated antibody against the flt 3 region or Fc region of this molecule could be used. You can use another detectable part of the molecule, such as an enzyme capable of catalyzing a colorimetric or fluorometric reaction, avidin or biotin. Cells tested for flt 3 receptor expression can be contacted with labeled flt 3-L. After incubation, unbound flt 3-L is removed and binding is measured using the detectable portion.

Flt 3-L binding characteristics (including variants) can also be determined using conjugated soluble flt 3 receptors (e.g. ¹²⁵ I-flt 3: Fc) in competitive assays similar to those described above. In this case, however, inactive cells expressing flt 3 receptors or soluble flt 3 receptors bound to a solid substrate are used to measure the extent to which a sample containing the putative flt 3-L species competes for binding to soluble flt 3, conjugated to flt 3-L.

 Other methods for determining flt 3-L include the use of antibodies against flt 3-L, cell lines propagating in response to flt 3-L, or recombinant cell lines expressing the flt 3 receptor and propagating in the presence of flt 3-L. For example, the BAF / WHO cell line does not contain the flt 3 receptor and is 1L-3 dependent. (See Hatakeyama et al., Cell 59: 837-845 (1989)). BAF / BOZ cells transfected with an expression vector containing the flt 3 receptor gene multiply in response to either 1L-3 or flt 3-L. An example of a suitable expression vector for transfection of flt 3 is the plasmid pCAV / NOT, see Mosley et al., Cell, 59: 335-348 (1989).

 Flt 3-L polypeptides may exist as oligomers, such as covalently linked or non-covalently linked dimers or trimers. Oligomers can be joined by disulfide bonds formed between cysteine residues on various flt 3-L polypeptides. In one embodiment of the invention, the flt 3-L dimer is formed by fusion of flt 3-L with the Fc region of an antibody (eg, IgGl) so that this does not interfere with the binding of flt 3-L to the flt 3-L-binding domain. The Fc polypeptide is preferably fused to the C-terminus of soluble flt 3-L (containing only the extracellular domain). The general preparation of fusion proteins containing heterologous polypeptides fused to various parts of antibody-derived polypeptides (including the Fc domain) has been described, for example, by Ashkenazi et al. (PNAS USA 88: 10535, 1991) and Byrn et al. (Natury, 344: 677, 1990), incorporated herein by reference. A gene fusion encoding a flt 3-L: Fc fusion protein is inserted into a suitable expression vector. Flt 3-L: Fc fusion proteins can assemble like antibody molecules, after which interchain disulfide bonds are formed between Fc polypeptides to form divalent flt 3-L. If fusion proteins are made from both the heavy and light chains of an antibody, an oligomer flt 3-L with four flt 3-L extracellular regions can be formed. Alternatively, two soluble flt 3-L domains can be joined by a peptide linker.

 Recombinant expression vectors containing DNA encoding flt 3-L can be prepared using well-known methods. These expression vectors include a flt 3-L DNA sequence operably linked to suitable transcriptional or transcriptional regulatory nucleotide sequences derived, for example, from a mammalian gene, microorganism, virus or insect. Examples of regulatory sequences are transcriptional promoters, operators or enhancers, an mRNA ribosome binding site, and suitable sequences that regulate the initiation and termination of transcription and translation. Nucleotide sequences are “operably linked” if the regulatory sequence is functionally related to the flt 3-L DNA sequence. Thus, a promoter nucleotide sequence is operatively linked to a flt 3-L DNA sequence if this promoter nucleotide sequence controls the transcription of this flt 3-L DNA sequence. The ability to replicate in the desired host cells, usually imparted by the start of replication, and the selectable gene by which transformants are identified, can be further integrated into the expression vector.

 In addition, sequences encoding suitable signal peptides that are not naturally associated with flt 3-L can be included in expression vectors. For example, the DNA sequence for the signal peptide (secretory leader) can be fused to the flt 3-L sequence so that flt 3-L is initially translated as a fusion protein containing the signal peptide. A signal peptide that is functional in targeted host cells enhances the secretion of the flt 3-L polypeptide from the cell. This signal peptide can be cleaved from the flt 3-L polypeptide after secretion of flt 3-L from the cell.

 Suitable host cells for expressing flt 3-L polypeptides are prokaryotes, yeast cells, or higher eukaryotic cells. Suitable cloning and expression vectors for use with bacterial, fungal, yeast and mammalian cell hosts are described, for example, in Powels et al. Cloning Vectors: A Laboratory Manual, Elsevier New York (1985). Cell-free translation systems could also be used to produce flt 3-L polypeptides using RNA derived from the DNA constructs described herein.

 Prokaryotes include gram-negative or gram-positive organisms, for example, E. coli or Bacilli. Suitable for transformation prokaryotic host cells include, for example, E. coli, Bacillus subtilis, Salmonella typhimurium and numerous other species within the genera Pseudomonas, Streptomyces and Staphylococcus in a prokaryotic host cell, such as E. coli, the flt 3-L polypeptide may contain an N-terminal methionine residue to facilitate expression of the recombinant polypeptide in the cell of a prokaryotic host. The N-terminal Met can be cleaved from the expressed recombinant flt -3-L polypeptide.

 Expression vectors for use in prokaryotic host cells contain one or more phenotypic selectable marker genes. A phenotypic selectable marker gene is, for example, a gene that encodes a protein that confers antibiotic resistance or that satisfies the requirement of autotrophy. Examples of suitable expression vectors for prokaryotic host cells are vectors derived from commercially available plasmids, such as the cloning vector pBR322 (ATCC 37017), pBR322 contains resistance genes for ampicillin and tetracycline, and therefore provides a simple means for identifying transformed cells. To construct an expression vector using pBR322, a suitable promoter and flt 3-L DNA sequence are inserted into the PBR322 vector. Other commercially available vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and pGEM1 (Promega Biotec, Madison, W1, USA).

Promoter sequences typically used for recombinant expression vectors of prokaryotic host cells include the β-lactamase (penicillinase), lactose promoter system (Chang et al., Nature 275: 615, 1978, and Goeddel et al., Nature 281: 544, 1979 ), the tryptophan promoter system (trp) (Goeddel et al., Nucl. Acids. Res 8: 4057, 1980, and EP-A-36776) and the tac promoter (Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory 412 , 1982). A particularly valuable expression system for a prokaryotic host cell uses the λ P _L phage promoter and the cl857ts thermolabile repressor sequence. Plasmid vectors available from ATCC containing P _L derivatives of the phage λ promoter include plasmid pHUB2 (resident in E. coli strain JMB9 (ATCC 37092)) and pPL c28 (resident in E. coli RR1 (ATCC 53082)).

 Flt 3-L polypeptides can alternatively be expressed in host yeast cells, preferably from the genus Saccharomyces (e.g. S. serevisae). Other yeast genera such as Pichia, K. lactis or Kluyveromyces may also be used. Yeast vectors will often contain a sequence of origin (origin) of replication from a 2μ yeast plasmid, an autonomously replicating sequence (ARS), a promoter region, polyadenylation sequences, transcription termination sequences, and a selectable marker gene. Suitable promoter sequences for yeast vectors include, but are not limited to, promoters for metallothionein, 3-phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem. 255: 2073, 1980) or other glycolytic enzymes (Hess et al., J. Adv. Enzyme Reg 7: 149, 1968, and Hollard et al., Biochem, 17: 4900, 1978), such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, gluco-6-phosphatisomerase, 3-phosphoglytase, 3-phosphoglytase, triosophosphatisomerase, phosphoglucose isomerase and glucokinase. Other suitable vectors and promoters for use in yeast expression are further described in Hitzeman, EP-A-73657 or Fleer et al., Gene, 10: 285: 195 (1991), and Van der Berg et al., Bio / Technology, 8: 135-139 (1990). Another alternative is the glucose repressed ADH2 promoter described by Russel et al., (J. Biol. Chem. 258: 2674, 1982) and Beier et al. (Nature 300: 724, 1982). Shuttle vectors replicated in both yeast and E. coli can be constructed by embedding DNA sequences from pBR322 for selection and replication in E. coli (the ampicillin resistance gene and the onset of replication) in the yeast vectors described above.

 The α-factor yeast leader sequence can be used to direct secretion of the flt 3-L polypeptide. The α-factor leader sequence is often inserted between the promoter sequence and the structural gene sequence. See, for example, Kurjan et al., Cell 30: 933, 1982; Bitter et al., Proc. Natl. Acad. Sci. USA 81: 5330, 1984; U.S. Patent 4546082 and EP 324274. Other leader sequences suitable for facilitating the secretion of recombinant polypeptides from yeast hosts are known to those skilled in the art. The leader sequence can be modified near its 3'-end so that it contains one or more restriction sites. This will facilitate the fusion of the leader sequence with the structural gene.

Yeast transformation protocols are known to those skilled in the art. One such protocol is described by Hinnen et al., Proc. Natl. Acad. Sci. USA 75: 1929, 1978. Protocol of Hinnen et al. selects Trr ⁺ transformants in a selective medium consisting of 0.67% yeast nitrogen base, 0.5% casein amino acids, 2% glucose, 10 μg / ml adenine and 20 μg / ml uracil.

 Yeast host cells transformed with vectors containing the ADH2 promoter sequence can be grown to induce expression in a "rich" medium. An example of a rich medium is a medium consisting of 1% yeast extract, 2% peptone and 1% glucose, supplemented with 80 μg / ml adenine and 60 μg / ml uracil. Depression of the ADN2 promoter occurs when glucose is depleted from the medium.

 Mammalian or insect host cell culture systems could also be used to express recombinant flt 3-L polypeptides. A review of baculovirus systems for producing heterologous proteins in insect cells is given by Luckow and Summers, Bio / Technology 6:47 (1988). Established cell lines derived from mammals may also be used. Examples of suitable mammalian host cell lines are COS-7 lines of monkey kidney cells (ATCC CRL 1651) (Gluzman et al., Cell 23: 175, 1981), L cells, C127 cells, 3T3 cells (ATCC CCL 163), ovarian cells Chinese hamster (CHO), He1a cells and BHK (ATCC CL 10) cell lines and cell line CV -1 / EB N A-1 obtained from the African green monkey CV 1 kidney cell line (ATCC CCL 70) described by McMahan et al . (EMBO J. 10: 2821, 1991).

 Transcriptional and translational regulatory sequences for expression vectors of mammalian host cells can be excised from viral genomes. Commonly used promoter sequences and enhancer sequences are derived from polyoma virus, adenovirus 2, monkey 40 virus (SV 40) and human cytomegalovirus. DNA sequences derived from the SV40 viral genome, for example, the SV40 origin, early and late promoter, enhancer, splicing and polyadenylation sites, can be used to provide other genetic elements for expression of a structural gene sequence in a mammalian host cell. The viral early and late promoters are particularly useful since they can be easily obtained from the viral genome as a fragment that also contains the viral origin of replication (origin) (Fiers et al., Nature 273: 113, 1978). Large or smaller fragments of SV 40 can be used, provided that a sequence of approximately 250 bp is included, extending from the Hind 111 site upstream of the Bgl 1 site localized to the site at the start site of the SV 40 virus replication.

 Examples of expression vectors for use in mammalian host cells can be constructed as described by Okayama and Berg (Mol. Cell Biol. 3: 280, 1983). A valuable system for stably expressing high levels of mammalian cDNA in C127 murine mammary epithelial cells can be constructed essentially as described by Cosman et al. (Mol. Immunol. 23: 935, 1986). A valuable high expression vector, PMLSV N1 / N4, described by Cosman et al. , Nature 312: 768, 1984, was deposited as ATCC 39890. Additional valuable mammalian expression vectors are described in EP-A-0367566 and U.S. Patent Application Serial 07/701415, filed May 16, 1991, incorporated herein by reference. These vectors can be derived from retroviruses. Instead of the native signal sequence, a heterologous signal sequence may be added, for example, the signal sequence for 1L-7 described in U.S. Patent 4965195; the signal sequence for the 1L-2 receptor described in Cosman et al., Nature 312: 768 (1984); signal peptide 1L-4 described in EP 367566; the signal peptide of the receptor 1L-1 type 1, described in 4968607, and the signal peptide of the receptor 1L-1 type 11, described in EP 460846.

 Flt 3-L in the form of an isolated or homogeneous protein according to the invention can be obtained using the recombinant expression systems described above, or purified from naturally occurring cells. Flt 3-L can be purified essentially to homogeneity, as evidenced by a single strip of protein after analysis by SDS polyacrylamide gel electrophoresis (SDS).

 One method for producing flt 3-L involves culturing a host cell transformed with an expression vector containing a DNA sequence encoding flt 3-L under conditions sufficient to enhance expression of flt 3-L. Flt 3-L is then recovered from the culture medium or cell extracts, depending on the expression system used. As is known to those skilled in the art, recombinant protein purification procedures will vary according to factors such as the type of host cell used, or depending on whether or not the recombinant protein is secreted into the culture medium.

 For example, if expression systems that secrete a recombinant protein are used, the culture medium can first be concentrated using a commercially available filter to concentrate the protein, for example an Amicon or Millipore Pellicon ultrafiltration unit. After the concentration step, the concentrate can be applied to a cleaning matrix, such as a gel filtration medium. Alternatively, an anion exchange resin, for example, a matrix or substrate having lateral diethylaminoethyl (DEAE) groups, can be used. Such matrices may be acrylamide, agarose, dextran, cellulose, or other types commonly used in protein purification. Suitable cation exchangers include various insoluble matrices containing sulfopropyl or carboxymethyl groups. Sulfopropyl groups are preferred. Finally, one or more reverse-phase high-resolution liquid chromatography steps (RP-HPL C, HPLC) using hydrophobic RP-HPL C media (eg, silica gel with methyl side or other aliphatic groups) can be used to further purify flt 3 -L. Some or all of the preceding purification steps, in various combinations, are well known and can be used to provide a substantially homogeneous recombinant protein.

 An affinity column containing the ligand binding domain of flt 3 receptors can be used to affinity purify the expressed flpe 3-L polyl peptides. The flt 3-L polypeptides can be removed from the affinity column using conventional methods, for example in a high salt elution buffer, and then dialyzed into a low salt application buffer or by changing the pH or other components depending on the affinity matrix used. Alternatively, the affinity column may contain an antibody that binds flt 3-L. Example 6 describes a procedure for using the flt 3-L of the present invention to generate monoclonal antibodies against flt 3-L.

 A recombinant protein produced in a bacterial culture is usually isolated by initial disruption of the host cells, centrifugation, extraction from the cell pellets in the case of an insoluble polypeptide or supernatant liquid, in the case of a soluble polypeptide, followed by one or more concentrations, salting out, ion exchange, affinity purification or stages of gel filtration chromatography. Finally, RP-HPLC can be used for the final stages of purification. Microbial cells can be destroyed in any standard way, including using cycles of freezing and thawing, destruction by ultrasound, mechanical destruction or using lysing agents of the cells.

 Transformed yeast host cells are preferably used to express flt 3-L as a secreted polypeptide to facilitate purification. The secreted recombinant polypeptide obtained by fermenting the yeast host cells can be purified according to the methods described by Urdal et al. (J. Chromatog 296: 171, 1984). Urdal et al. describe two sequential steps of RP-HPLC for the purification of recombinant human 1L-2 on a preparative HPLC column.

 According to this invention, sense or antisense oligonucleotides can be prepared containing a single-stranded nucleic acid sequence (RNA or DNA) capable of binding to the target flt 3-L mRNA sequence (with the formation of a duplex) or to the flt 3-L sequence in a double-stranded DNA helix (c the formation of a triple helix). The antisense or sense oligonucleotides according to the invention contain a fragment of the flt 3-L cDNA coding region. Such a fragment usually contains at least 14 nucleotides, preferably from about 14 to about 30 nucleotides. The ability to create an antisense or sense oligonucleotide based on a cDNA sequence for a given protein is described, for example, by Stein and Cohen, Cancer Res. 48: 2659, 1988, and Van der Krol et al., BioTechniques 6: 958, 1988.

 The binding of antisense or sense oligonucleotides to target nucleic acid sequences leads to the formation of complexes that block translation (RNA) or transcription (DNA) in one of several ways, including increased degradation of duplexes, premature termination of transcription or translation, or other methods. Thus, antisense oligonucleotides can be used to block the expression of flt 3-L proteins. In addition, antisense and sense oligonucleotides include oligonucleotides having modified sugar phosphodiester structures (or other sugar bonds, such as those described in WO 91/06629), wherein such sugar bonds are resistant to endogenous nucleases. Such oligonucleotides with stable sugar bonds are stable in vivo (i.e., able to withstand degradation by enzymes), but retain the sequence specificity allowing binding to target nucleotide sequences. Other examples of semantic and antisense oligonucleotides include those oligonucleotides that are covalently linked to the organic parts of molecules, as described in WO 90/10448, and other components that increase the affinity of such an oligonucleotide for the target nucleic acid sequence, such as poly- (L-lysine ) In addition, intercalating agents, such as ellipticin, and alkylating agents and metal complexes can be attached to sense or antisense oligonucleotides to modify the binding specificity of the antisense or sense oligonucleotide with respect to the target nucleotide sequence.

Antisense or sense oligonucleotides can be introduced into a cell containing the target nucleic acid sequence by any means of gene transfer, including, for example, CaPO _4- mediated DNA transfection, electroporation, or by using gene transfer vectors such as Epstein-Barr virus. Antisense or sense oligonucleotides are preferably introduced into a cell containing the target nucleic acid sequence by embedding the antisense or sense oligonucleotide in a suitable retroviral vector, followed by contacting the cell with a retroviral vector containing the inserted sequence in vivo or ex vivo. Suitable retroviral vectors include, but are not limited to, the mouse retrovirus M-MuLV N2 (retrovirus derived from M-MuLV) or duplicate vectors designated DCT5A, DCT5B and DST5C (see PCT Application W 90/02656).

 Sense or antisense oligonucleotides can also be introduced into a cell containing the target nucleotide sequence by forming a conjugate with a ligand binding molecule, as described in WO 91/04753. Suitable ligand binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors. Preferably, the conjugation of the ligand binding molecule does not substantially interfere with the ability of the molecule to bind to its corresponding molecule or receptor or block the entry of a sense or antisense oligonucleotide or its conjugated version into a cell.

 Alternatively, a sense or antisense oligonucleotide can be introduced into a cell containing the target nucleic acid sequence by forming an oligonucleotide-lipid complex, as described in WO 90/10448. This complex of sense or antisense oligonucleotide with a lipid is preferably dissociated within the cell by endogenous lipase.

 Flt 3-L polypeptides of the invention can be prepared in accordance with known technological methods used to obtain pharmaceutically applicable compositions. Flt 3-L can be combined in a mixture either as a single active material or with other known active materials with pharmaceutically acceptable diluents (e.g. Tris-HCl, acetate, phosphate), preservatives (e.g. Thimerosal, benzyl alcohol, parabens) , emulsifiers, solvents, adjuvants and / or carriers. Suitable carriers and their prepared forms are described in Remington's Pharmaceutical Sciences, 16th ed. 1980, Mask Publishing Co. In addition, such compositions may contain flt 3-L in complex with polyethylene glycol (PEC), metal ions, or flt 3-L can be incorporated into polymeric compounds such as polyacetic acid, polyglycolic acid, hydrogels, etc., or liposomes, microemulsions, micelles, monolayer or multilayer vesicles, hemolized red blood cells (erythrocyte “shadows”) or spheroblasts. Such compositions will affect the physical state, solubility, stability, in vivo release rate, and in vivo flt 3-L clearance rate. Flt 3-L may also be conjugated to antibodies against tissue-specific receptors, ligands or antigens, or linked to ligands of tissue-specific receptors. In cases where the flt 3 receptor is found on neoplastic cells, flt 3-L can be conjugated to a toxin to use it to deliver this toxin to a specific site, or it can be used to sensitize such neoplastic cells to antitumor agents that are then introduced.

 Flt 3-L can be administered topically, parenterally or by inhalation. The term “parenteral” includes subcutaneous injections, intravenous, intramuscular, intracavitary injection or infusion methods. These compositions typically contain an effective amount of flt 3-L, alone or in bination, with an effective amount of any other active material. Doses and desired drug concentrations contained in the composition may vary depending on many factors, including the intended use, the patient’s body weight and age, and the route of administration. Preliminary doses can be determined in animal tests, and dosages for administration to humans are determined in accordance with methods accepted in the art. Given the above, typical doses of flt 3-L can range from about 10 μg / sq. M to about 1000 μg / sq. The preferred dose range is on the order of approximately 100 to 300 μg / sq. m

 In addition to the above, the following examples illustrate specific options, but do not limit the scope of this invention.

EXAMPLE 1
Obtaining fusion protein flt 3 receptor: Fc
This example describes the cloning of mouse cDNA 3 and the construction of an expression vector encoding a mouse flt 3 receptor fc protein with Fc for use in the detection of cDNA clones encoding flt 3-L. Polymerase chain reaction (PCR), cloning flt 3 cDNA from mouse T cells, was performed using oligonucleotide primers and methods described by Lyman et al., Oncogene 8: 815-822 (1993), incorporated herein by reference. The cDNA sequence and its encoded amino acid sequence of the mouse flt 3 receptor are presented by Rosnet et al., Oncogene 6: 1641-1650 (1991) (hereby incorporated by reference). Mouse protein 3 has an extracellular domain of 542 amino acids, a transmembrane domain of 21 amino acids, and a cytoplasmic domain of 437 amino acids.

Before fusion of mouse flt 3 cDNA with the N-terminus of the cDNA encoding the Fc portion of the human IgGl molecule, an amplified mouse flt 3 cDNA fragment was inserted into the Asp 718-Not 1 pCAV / NOT site described in PCT Application 90/05183. DNA encoding a single chain polypeptide, WO containing Fc region of human IgGl antibody was cloned into the Spel site of vector pBLUESCRIPT SK ^®, commercially available from Stratagene Clonning Systems, La Jolla, California . This plasmid vector can replicate in E. coli and contains a polylinker segment containing 21 unique restriction sites. The unique Bgl 11 site was introduced near the 5th end of the inserted Fc coding sequence, so the Bgl 11 site includes codons for the amino acids three and four Fc polypeptides.

 The Fc-encoded polypeptide extends from the N-terminal hinge region to the native C-terminus, i.e. is essentially a full-sized Fc region of the antibody. Fragments of Fc regions, for example, shortened at the C-terminus, can also be used. These fragments preferably contain multiple cysteine moieties (at least cysteine residues in the hinge region), which makes it possible to form interchain disulfide bonds between parts of the Fc polypeptides of two separate 3: Fc fusion proteins to form the dimers discussed above.

The Asp 718 restriction enzyme digestion site was introduced to the left of the flt 3 coding region. A mouse flt 3 cDNA fragment Asp 718-Not 1 was isolated (containing the entire extracellular region, the transmembrane region, and a small part of the cytoplasmic domain). The above-described Asp 718-Not 1 flt-3 partial cDNA was cloned into the vector pBLUESCRIPT SK ^®, containing the Fc cDNA, such that the cDNA flt 3 located on the left (in the direction of the 3'-5 ') of the Fc cDNA. Single-stranded DNA produced from the resulting fusion gene product was mutagenized according to the method described by Kunkel (Proc. Natl. Acad. Sci. USA 82: 488, 1985) and Kunkel et al. (Methods in Enzymol. 154: 367, 1987), for the exact fusion of the entire extracellular domain of flt 3 with the F sequence. The mutated DNA was sequenced to confirm that the appropriate nucleotides were removed (i.e., the transmembrane region and the partial cytoplasmic domain of the DNA were detected) and that the flt 3 and Fc sequences were in the same reading frame. Then the fused cDNA was excised and inserted into a mammalian expression vector designated sfHAV-EO 409, which was cut with Sal1-Not1 and Sal1 and Asp 718 ends were blunted. The sfHAV-EO vector (also known as p DC406) is described by McMahan et al. (EMBO J., 10; 10: 2821-2832 (1991)).

 Flt 3: Fc fusion proteins are preferably synthesized in a culture of recombinant mammalian cells. The ft 3: Fc containing fusion product expression vector was transfected into CV-1 cells (ATCC CCL 70) and COS-7 cells (ATCC CL 1651) obtained from monkey kidneys. The expression level of flt 3: Fc was relatively low in both CV-1 and COS-7 cells. Therefore, an attempt was made to express in 293 cells (transformed primary human embryonic renal cells, ATCC CRL 1573).

 293 cells transfected with the sfHAV-EO / flt 3: Fc vector were cultured in roller bottles for the unsteady expression of a fusion protein that is secreted into the culture medium via flt 3 signal peptide. The fusion protein was purified on Protein A Sepharose columns, eluted and used for screening cells on the ability to bind flt 3: Fc, as described in Examples 2 and 3.

EXAMPLE 2
Cell Screening for Flt 3: Fc Binding
Approximately 100 different embryonic cells and cell lines fall into the following main categories: embryonic mouse embryonic mouse brain cells, mouse embryonic liver cell lines, rat embryo brain cell lines, human lung cancer (fibroblastoid) cell lines, human and mouse lymphoid and myeloid cell lines tested for flt 3: Fc binding. Cell lines were incubated with flt 3: Fc, then with a biotinylated anti-human Fc antibody, then with streptavidin-phycoerythrin complex (Becton Dickinson). Biotinylated antibodies were purchased from Jackson Immunoresearch Laboratories. Streptavidin binds to a biotin molecule coupled to an anti-human Fc antibody, which in turn binds to the Fc portion of the flt 3: Fc fusion protein. Phycoerythrin, which is a fluorescent phycobilirubin, serves as a detectable label. The fluorescence signal level was measured for each cell type using a FAC Scan ^R flow cytometer (Becton Dickinson). Cell types were identified that were considered positive for flt 3: Fc binding.

EXAMPLE 3
Isolation and cloning of flt 3-L cDNA from murine T cell cDNA library
A murine T cell cDNA library of the P7B-0.3A4 cell line was selected as a possible source of flt 3-L cDNA. P7B-0.3A4 is a mouse T cell clone that is Thy l, 2 ⁺ , CD4 ^- , CD8 ^- , TCRab ^± , CD44 ⁺ . This line was initially cloned at a cell density of 0.33 cells per well in the presence of rHu1L-7 and immobilized anti-CD3 MAb and was grown in continuous culture for more than 1 year with passage once a week in a medium containing 15 ng / ml rHu1L -7. The parent cell line was obtained from SJL / J lymph node cells of mice immunized with 50 nmoles of PLR _139-151 peptide and 100 μg of Mycobacterium tuberculosis H37Ra in incomplete Freund's adjuvant. PLP is a proteolipid protein component of the myelin sheath of the central nervous system. This peptide consisting of amino acids 139-151, as previously shown, is an encephalogen peptide in experimental autoimmune encephalomyelitis (EAE), a mouse model for multiple sclerosis in SJL / J mice (Touhy V.K., Z. Lu, RA Sobel, RALaursen and MBLees; 1989. Identification for SJL mice J. Immunol 142: 1523). After the initial culture in the presence of antigen, the parent cell line, designated PLP7, was in continuous culture with rHu1L-7 (and without antigen) for more than 6 months before cloning.

P7B-0.3A4 propagates only in response to very high concentrations of the peptide PL P _139-151 in the presence of irradiated syngeneic spleen cells and is not encephalogen and alloreactive. This clone propagates in response to immobilized anti-CD3 Mab, 1L-2 and 1L-7, but not 1L-4.

Flt 3: Fc binding was observed on murine T cells and human T cells, and murine T cells (0.3A4 line) were selected due to their ease of growth. A cDNA library of a murine 0.3A4 cell line in sfHAV-EO was prepared as described in McMahan et al. (EMBO J., 10: 10; 2821-2832, 1991). SfHAV-EO is a mammalian expression vector that also replicates to E. coli sfHAV-HO, contains replication origin derived from SV 40, Epstein-Barr virus and pBP322, and is a derivative of HAV-EO described by Dower et al. , J. Immunol. 142: 4314 (1989). SfHAV-EO differs from HAV-EO by the deletion of an intron present in the three-part leader sequence of adenovirus 2 in HAV-EO. Briefly, murine T cell cDNA was cloned into the Sal1 site of sfHAV-EO using an adapter method similar to that described by Aymerle et al. (Nucl. Acids. Res.) 14: 8615, 1986), using the following oligonucleotide adapter pair:
5 'TCGACTGGAACGAGACGACCTCGT 3' SEQ ID: 3
3 'GACCTTGCTCTGCTGGACCA 5' SEQ ID: 4
Double stranded cDNA with blunt ends and arbitrary primers were obtained from 0.3A4 poly (A) ⁺ RNA, mainly as described by Gubler and Hoffman, Gene, 25: 263-269 (1983), using a Pharmacia DNA kit. The above adapters were added to this cDNA as described by Haymerle et al. The low molecular weight material was removed by passing through Sachacrye S-1000 at 65 ^° C and the cDNA was ligated into sfHAV-EO 410, previously cleaved with Sal 1, and ligated with the same pair of oligonucleotides. This vector was designated as sfHAV-EO410. DNA was introduced by electroporation (Dower et al., Nucleic Acids. Res., 16: 6127-6145, 1988) in E. coli DH1OB and after 1 hour of growth at 37 ^° C, the transformed cells were frozen in aliquots of 1 ml in SOC medium ( Hanahan et al., J. Mol. Biol. 166: 557-580, 1983) containing 20% glycerol. One aliquot was titrated to determine the number of ampicillin resistant colonies. The resulting 0.3A4 library had 1.84 million clones.

 Cells of E. coli strain DH1OB transfected with the cDNA library in sfHAV-EO410 were seeded to provide approximately 1600 colonies per plate. Colonies were scraped from each plate, pooled, and plasmid DNA was obtained from each pool. These combined DNAs, representing approximately 1,600 colonies, were then used to transfect the subconfluent (fusion) layer of CV-1 / EBNA-1 cells using DEAE-dextran followed by treatment with chloroquine, similar to the method described by Luthman et al., Nucl. Acids Res. 11: 1295 (1983), and McCutchan et al., J. Natl. Cancer Inst. 41: 351 (1986). The cell line CV-1 / EBNA-1 (ATCC CP1 10478) constitutively expresses EBV nuclear antigen-1, triggered by the earliest CMV enhancer / promoter. CV 1-EBNA-1 was obtained from the African Green Monkey Kidney CV-1 cell line (ATCC CCL 70) as described by McMahan et al. (EMBO J., 10: 2821, 1991).

For transfection of CV-1 / EBNA-1 cells with a cDNA library, these cells were kept in complete medium (Dulbecco's modified Eagle's medium (DMEM) containing 10% (v / v) fetal calf serum (FCS), 50 E / ml of penicillin, 50 U / ml of streptomycin, 2 mM 1-glutamine), and plated at a density of 2x10 ⁵ cells / well on single-chamber glass slides (Lab-Tec). Glasses were pretreated with 1 ml of human fibronectin (10 μg / ml in PBS) for 30 minutes and then washed 1 time with PBS. The medium was removed from the attached cell layer and replaced with 1.5 ml of complete medium containing 66.6 μM chloroquine sulfate. 2/10 ml of DNA solution (2 μg DNA, 0.5 mg / ml DEAE-dextran in complete medium containing chloroquine) was then added to these cells and incubated for 5 hours. After incubation, the medium was removed and the cells were shock treated by adding complete medium containing 10% DMSO for 2.5-20 minutes and then replacing this solution with fresh complete medium. Cells were cultured for 2-3 days to express the inserted sequences.

Transfected monolayers of CV-1 / EBNA-1 cells were analyzed for expression of flt 3-L using slide autoradiography described by Gearing et al. (EMBO J., 8: 3667, 1989). Transfected C-1 / EVPA-1 cells (attached to a camera-slides) were washed once with skimmed milk powder binding medium (BM-NFDM) (1640 PPM1 medium containing 25 mg / ml bovine serum albumin (BSA), 2 mg / ml sodium azide, 20 mM HEPES, pH 7.2, and 50 mg / ml skimmed milk powder). The cells were then incubated with flt 3: Fc in BM-NFDM (1 μg / ml) for 1 hour at room temperature. After incubation, the cell monolayers in the slides with cameras were washed 3 times with BM-NFDM to remove the unbound flt 3: Fc fusion protein and then incubated with 40 ng / ml ¹²⁵ I-mouse anti-human Fc antibodies (described below) (dilution 1: 50) for 1 hour at room temperature. Cells were washed 3 times with BM-NFDM, then 2 times with phosphate buffered saline (PBS) to remove unbound ¹²⁵ I-mouse anti-human Fc antibodies. Cells were fixed by incubation for 30 minutes at room temperature in 2.5% glutaraldehyde in PBS, pH 7.3, washed twice in PBS and dried in air. Slides with cells containing cells were kept on a Phophorimager (Molecular Dynamics) overnight, then immersed in a Kodak GTNB-2 photographic emulsion (6x dilution in water) and kept in the dark for 3-5 days at 4 ^{° C.} in a lightproof boxing. Slides were then developed for approximately 4 minutes in a Kodak D19 developer (40 g / 500 ml water), washed with water and fixed in an Agfa 433C fixer. These slides were individually examined under a microscope at 25-40x magnification and positive cells expressing flt 3-L were identified by the presence of silver autographic granules of silver against a light background.

Mouse antibodies against human Fc were obtained from Jackson Laboratories. These antibodies showed minimal binding to Fc bound to the Fc γ receptor. Antibodies were labeled using the method with Chloramine T. Briefly, a Sephadex G-25 column was prepared according to the manufacturer. The column was pretreated with 10 volumes of a PBS column containing 1% bovine serum albumin to reduce the non-specific adsorption of antibodies with a column and resin, then unbound bovine serum albumin from the column with 5 volumes of PBS without bovine serum albumin. 10 μg of antibodies (dissolved in 10 μl PBS) was added to a microfuge tube to 50 μl of 50 mM sodium phosphate buffer (pH 7.2), 2.0 kCi Na ¹²⁵ I was added without carrier and the solution was mixed well. 15 μl of a freshly prepared solution of chloramine T (2 mg / ml in 0.1 M sodium phosphate buffer, pH 7.2) was added and the mixture was incubated for 30 minutes at room temperature. Then this mixture was immediately applied to a Sephadex G-25 column. After that, the radiolabeled antibodies were eluted from the column, collecting 100-150 μl fractions of the eluate. Bovine serum albumin was added to the eluted fractions,
containing radioactively labeled antibodies, to a final concentration of 1%. Radioiodination gave specific activity in the range of 5-10x10 ¹⁵ imp / nmol protein.

 Using a slide autoradiography approach, approximately 1840000 cDNAs were screened in pools of approximately 1600 cDNAs until analysis of a single transfectant pool revealed a plurality of cells that were clearly positive for flt 3: Fc binding. This pool was then divided into 500 pools and again screened by slide autoradiography and a positive pool was identified. This pool was divided into 100 pools and again screened. Separate colonies from this pool were screened until a clone (clone 6C) was identified that directed the synthesis of a surface protein with detectable flt 3: Fc binding activity. This clone was isolated and its 0.88 kb cDNA insertion was sequenced.

 The nucleotide and encoded amino acid sequence of the coding region of the mouse flt 3-L clone 6C cDNA is shown in SEQ IDs 1 and 2. The cDNA insertion is 0.88 kb in length. An open reading frame within this sequence could encode a protein of 231 amino acids. Thus, DNA and encoded amino acid sequences for an open reading frame of 231 amino acids are presented in SEQ ID: 1 and: 2. Protein SEQ ID 2 is a transmembrane type protein with an N-terminal signal peptide (amino acids 1-27), an extracellular domain (amino acids 28-188), a transmembrane domain (amino acids 189-211) and a cytoplasmic domain (amino acids 212-231). The predicted pier. the mass of the native protein after cleavage of the signal sequence is 23164 daltons. Mature protein has an estimated p1 of 9.372. There are 56 bp 5'-non-coding sequence and 126 bp 3'-non-coding sequences that flank the coding region, including added cDNA adapters. The cloning procedure described above also gave a 5H clone of the mouse flt 3 ligand, which is identical to clone 6C, starting at nucleotide 49 and at nucleotide 545 (corresponding to amino acid 163) SEQ ID: 1. Clone 5H is completely different from this point further and is another construction obtained with the participation of splicing.

 The sfHAV-EO410 vector, containing flt 3-L cDNA in E. coli DH1OB cells, was deposited with ATCC, Rockville, MD USA, on April 20, 1993 and received accession number ATCC 69286. The deposition was performed according to the Budapest Treaty conditions.

EXAMPLE 4
Cloning of cDNA encoding human flt 3-L
cDNA encoding human flt 3-L was cloned from a human clone cDNA library of 22 λgt 10 t cells with arbitrary primers as described by Sims et al., PNAS, 86: 8946-8950 (1989). The library was screened with Ple 1 fragment of 413 bp corresponding to the extracellular domain of murine flt 3-L (nucleotides 103-516 SEQ ID: 1). An arbitrary fragment was primed, hybridized overnight with library filters at 55 ^° C, in an oligo-prehybridization buffer. The fragment was then washed at 55 ^{° C.} at 2xSSC / 0.1% SDS for 1 hour, then 1x SSC / 0.1% SDS for 1 hour, and then 0.5xSSC / 1% SDS for 1 hour. DNA from positive phage plaques was extracted and insertions were amplified by PCR using oligonucleotides specific for phage processes. This DNA was then sequenced and the sequence of clone 9 is shown in SEQ ID: 5. Additional human flt 3-L cDNA was isolated from the same λgt 10 cDNA library with arbitrary primers, as described above, by screening this library with a fragment of the extracellular domain of a mouse cDNA clone 5 containing a cDNA sequence mainly corresponding to nucleotides 128-541 SEQ ID: 1.

 Sequencing of clone 9 cDNA from 988 bp found an open reading frame of 705 bp surrounded by 29 bp 5'-non-coding sequence and 250 bp 3'-non-coding sequence. The 3'-non-coding region does not contain a poly-A tail. There was no stop codon reading frame to the left of the initiating methionine. An open reading frame encodes a transmembrane protein of type 1 of 235 amino acids, as shown by amino acids 1-235 of SEQ ID: 6. This protein has an N-terminal signal peptide of 26 or 27 amino acids. There is a slightly greater likelihood that the N-terminal signal peptide has a length of 26 amino acids than 27 amino acids. The signal peptide is followed by an extracellular domain of 156 or 155 amino acids (for signal peptides of 26 and 27 amino acids, respectively); followed by a transmembrane domain of 23 amino acids and a cytoplasmic domain of 30 amino acids. Human flt 3-L has only 72% identical amino acids and 78% similar amino acids compared to murine flt 3-L. The pBLU-ESCRIPT SK (-) vector containing human flt 3-L clone 9 cDNA was deposited with ATCC, Rackville, Maryland, USA, on August 6, 1993 and received accession ATCC 69382. The deposition was performed according to the conditions of the Budapest Treaty.

EXAMPLE 5
Expression of flt 3-L in yeast
To express soluble flt 3-L in yeast, synthetic oligonucleotide primers were used for amplification using PCR (Mullis and Faloona, Meth. Enzymol. 155: 335-350, 1987) of the entire extracellular coding domain of flt 3-L between the end of the signal peptide and the beginning of the transmembrane segment. 5'-primer (5'-AATTGGTACCTTTTGGATAAAAGAGACTACAAGGACGACGATGACAAGACACCTGACTGTTACTTCAGCCA-3 ') SEQ ID: 7 encoded a portion of the α-factor leader and antigenic octapeptide, FL AG sequence, fused in the frame of the 3-L-predicted ft. 3'-oligonucleotide (5'-ATATGGATCCCTACTGCCTGGGCCGAGCCTCTGGGAG-3 ') SEQ ID: 8 created the termination codon after Gln-189, just in the proposed transmembrane region. This polymerized chain reaction generated DNA fragment was ligated into a yeast expression vector (for expression in K. lactis) that directs the secretion of the recombinant product into the yeast medium (Fleer et al., 107: 285-195 (1991) and Van den Berg et al. Bio / Technology, 8: 135-139 (1990)). The FLAG: flt 3-L fusion protein was purified from yeast broth by affinity chromatography as previously described (Norr et al., BioTechnology 6: 1204-1210, 1988).

EXAMPLE 6
Monoclonal antibodies to flt 3-L
This example illustrates a method for producing monoclonal antibodies to flt 3-L. Flt 3-L is expressed in mammalian host cells, such as COS-7 or CV-1 / EBNA-1 cells, and is purified by flt 3: Fc affinity chromatography. Purified flt 3-L, a fragment thereof, such as an extracellular domain, synthetic peptides or cells expressing flt 3-L, can be used to obtain monoclonal antibodies against flt 3-L using conventional methods, for example, methods described in US Patent 4411993. Briefly, mice were immunized with flt 3-L as an immunogen, emulsified in Freund's complete adjuvant, and injected in amounts of 10 to 100 μg subcutaneously or intraperitoneally. After 10-12 days, the immunized animals were re-immunized with additional flt 3-L emulsified in Freund's incomplete adjuvant. Mice were periodically immunized repeatedly after this according to the immunization schedule 1 time per week or 1 time in two weeks. Serum samples were periodically taken by retroorbital bloodletting or tail tip cutting for analysis against anti-flt 3-L antibodies using dot blot analysis, EL1SA (enzyme-linked immunosorbent assay) or inhibition of flt 3 binding.

 After detecting a sufficient antibody titer, the positive animals were given one final intravenous injection of flt 3-L in saline. After 3-4 days, the animals were killed, spleen cells were excised and fused with murine myeloma cells, for example NS 1 or preferably P3x63Ag8.653 (ATCC CRL 1580). The fusion produces hybridoma cells that are plated on a variety of microtiter plates in an HAT (hypoxanthine, aminopterin and thymidine) selective medium to inhibit the proliferation of unfused cells, myeloma hybrids, and spleen cell hybrids.

 Hybridoma cells were screened by ELISA for reactivity against purified flt 3-L using adapted methods described in Engval et al. Immunochem 8: 871, 1971, and U.S. Patent 4703004. A preferred screening method is the antibody capture method described in Beckmann et al. (J. Immunol. 144: 4212, 1990). Positive hybridoma cells can be injected intraperitoneally into syngeneic BALB / c mice to form ascites containing high concentrations of anti-flt 3-L monoclonal antibodies. Alternatively, hybridoma cells can be grown in vitro in flasks or roller bottles in various ways. Monoclonal antibodies formed in murine ascites can be purified by precipitation with ammonium sulfate, and then gel filtration chromatography. Alternatively, affinity chromatography based on binding of antibodies to Protein A or Protein G, as well as flt 3-L binding affinity chromatography can also be used.

EXAMPLE 7
Use flt 3-L alone and in combination with 1L-7 or 1L-3
This example demonstrates the stimulation and proliferation of AA4.1 ⁺ embryonic liver cells under the influence of compositions containing flt 3-L and 1L-7, as well as the stimulation and proliferation of c-kit-positive (c-kit ⁺ ) cells under the influence of compositions containing flt 3-L and 1L-3.

AA4.1-positive (AA4.1 ⁺ ) expression cells were isolated from the liver of 14-day-old C57BL / 6 mouse embryos by panning cells in plastic Petri dishes (Optilux 100 mm) (Falcon 1001, Oxrard CA). The plates were coated overnight at 4 ^{° C.} in PBS plus 0.1% fetal bovine serum (FBS) containing 10 μg / ml AA4.1 antibodies (McKearn et al., J. Immunol. 132: 232-339, 1984 ) and then washed extensively with PBS plus 1% FBS before use. A suspension of individual liver cells was added at a concentration of 10 ⁷ cells per dish in PBS with 1% FBS and the cells were allowed to adhere to the dishes for 2 hours at 4 ^° C. Then the dishes were washed extensively and the adherent cells were collected by scraping for analysis or further use as described below. tests for hematopoiesis. FACS analysis using AA4.1 antibodies showed more than 95% AA4.1 ⁺ cell population.

C-kit ⁺ pluripotent stem cells were purified from the bone marrow of adult mice (de Vries et al., J. Exp. Med., 176: 1503-1509, 1992, and Visser and de Vries, Methods in Cell Biol., Submitted). Low density cells (≤1.078 g / cm ³ ) positive for wheat germ agglutinin lectin and negative for antigens recognized by B220 and 15-1. 4.1 (Visser et al., Meth. In Cell Biol., 33: 451-468, 1990) monoclonal antibodies could be divided into subpopulations of cells expressing and not expressing c-kit using biotinylated Steele factor. The c-kit ⁺ fraction has been shown to contain pluripotent hematopoietic stem cells (de Vries et al., Science 255: 989-991; Visser and de Vries, Methods in Cell Biol., 1993, Submitted, and Ware et al., 1993 , Submitted).

AA4.1 ⁺ embryonic liver cells were cultured in recombinant 1L-7 (US Patent 4,965,195) at 100 ng / ml and recombinant flt 3-L at 250 ng / ml. Flt 3-L was used in three different forms in these experiments:
(1) as present on fixed transfected flt 3-L CV1 / EBNA cells;
(2) as concentrated culture supernatants from the same transfected flt 3-1L CV1 / EBNA cells; and
(3) in the form of a purified and isolated polypeptide preparation from the yeast supernatant described in Example 5.

Hematopoiesis Tests
Proliferation of c-kit ⁺ stem cells, embryonic hepatic AA4.1 ⁺ cells was analyzed in [ ³ H] -thymidine incorporation tests described generally by de Vries et al., J. Exp. Med., 173: 1205-1211, 1991. The purified c-kit ⁺ stem cells were cultured at 37 ^{° C.} in a fully humidified atmosphere of 6.5% CO ₂ and 7% O ₂ in air for 96 hours. Recombinant mouse 1L-3 was used at a final concentration of 100 ng / ml. These cells were then pulsedly labeled with 2 μCi per well of [ ³ H] -thymidine (81 Ci / mmol; Amersham Corp., Arlington Heights, 1L) and incubated for another 24 hours. AA4.1 ⁺ cells (approximately 20,000 cells per well) were incubated in 1L-7, flt 3-L and flt 3-L + 1L-7 for 48 hours and then pulse-labeled with [ ³ H] -thymidine for 6 hours. The results of flt 3-L and 1L-7 are shown in Table I and the results of flt 3-L and 1L-3 are shown in Table II.

 The combination of flt 3-L and 1L-7 gave a response that was about 4 times higher than with one flt 3-L, and about 40 times higher than with one 1L-7.

The culture supernatant from CV1 / EBNA cells transfected with flt 3-L cDNA stimulated c-kit ⁺ stem cells approximately 18 times more than the culture supernatant of CV1 / EBNA cells transfected with a single expression vector. Addition of 1L-3 to the flt 3-L containing the supernatant gave a synergistic effect in which approximately twice as much proliferation was observed than would be expected if the actions were additive.

EXAMPLE 8
Construction of fusion protein flt 3-L: Fc
This example describes a method for constructing a fusion protein containing the extracellular region of flt 3-L and the Fc domain of human immunoglobulin. These methods are basically the same as those described in Example 1 for constructing a flt 3: Fc fusion protein.

Before fusion of the flt 3-L cDNA with the N-terminus of the cDNA encoding the Fc part of the human IgGl molecule, a 3-1 cDNA fragment was inserted into the Asp 718-Not1 site of the pCAV / NOT vector described in PCT Application WO 90/05183. DNA encoding a single chain polypeptide containing the Fc region of a human IgGl antibody was cloned into the Spe1 site of the vector pBLUESCRIPT SK ^R , which is commercially available from Stratagene Cloning Systems, La Jolla California. This plasmid vector can replicate in E. coli and contains a polylinker segment containing 21 unique restriction sites. Then, the unique Bgl 11 site was inserted near the 5'-end of the inserted Fc coding sequence so that the Bgl 11 site includes codons for amino acids 3 and 4 of the Fc polypeptide.

 The Fc encoded polypeptide extends from the N-terminal hinge region from the native C-terminus, i.e. represents essentially the full-size Fc region of the antibody. You can also use fragments of Fc regions, for example, shortened at the C-end. These fragments preferably contain many cysteine residues (at least in the hinge region), which makes it possible to form interchain disulfide bonds between the parts of the Fc polypeptides of two separate fusion proteins to form dimers.

The Asp 718-Stu1 partial flt 3-L cDNA in pCAV / NOT can be cloned into the Asp 718-Spe1 site of the pBLUESCRIPT SK ^R vector containing Fc cDNA, such that the flt 3-L cDNA is located 3'-5 'from cDNA Fc. The sequence of single-stranded DNA obtained from the generated fusion gene can be subjected to a specific matrix-directed mutagenesis described by Kunkel (pr. Natl. Acad Sci, USA 82: 488, 1985) and Kunkel et al. (Methods in Enzymol. 154: 367, 1987), for the exact fusion of the entire extracellular domain of flt 3-L with the F sequence. The resulting DNA can then be sequenced to confirm that the appropriate nucleotides have been removed (i.e. the transmembrane region and the partial cytoplasmic region have been deleted) and that the flt 3-L and Fc sequences are in the same reading frame. The fused cDNA is then cut out and inserted into the mammalian expression vector pCAV / NOT, which is digested with Asp 718-Not 1, by conventional methods.

 Flt 3-L: Fc fusion proteins are preferably synthesized in a culture of recombinant mammalian cells. The flt 3-L: Fc-containing expression product containing vector is then transfected into CV-1 cells (ATCC CCL 70) or COS-7 cells (ATCC CRL 1651). Expression is also possible in 293 cells (transformed human embryonic renal cells, ATCC CRL 1573).

 293 cells transfected with the pCAV / NOT / flt 3-L: Fc vector are cultured in roller bottles for the short-term expression of a fusion protein that is secreted into the culture medium via the flt 3-L signal peptide. Fusion protein can be purified on Protein A-Sepharose columns.

EXAMPLE 9
Obtaining transgenic mice, superproducing flt 3-L
This example describes the procedure used to obtain transgenic mice, superproducing flt 3-L. Superproducing flt 3-L transgenic mice were examined to determine the biological effects of overexpression. Mouse pronuclei (B16 / J) were microinjected with deoxyribonucleic acid (DNA) flt 3-L according to the method described by Cordon et al., Science 214: 1244-1246 (1981). In general terms, fertilized mouse eggs with visible Pronuclei were first placed on the injection chamber and held in place with a small pipette. An injection pipette was then used to inject the gene encoding flt 3-L (clone 6C) into the oocyte pronuclei. Then, the injected eggs or (i) were transferred to the oviduct of 0.5 day s. pseudopregnant female; (ii) were cultured in vitro to the two-cell stage (overnight) and transferred to the oviduct of 0.5 day s. a pseudopregnant female or (iii) was cultured in vitro to the blastocyst stage and transferred to the uterus 2.5 days after pseudopregnant female. Preferably, the first two options can be used, since they avoid cultivation, and preferably about 20-30 microinjected eggs should be used for transfer to females to avoid small offspring.

EXAMPLE 10
Flt 3-L stimulates proliferation of erythroid cells in the spleen
This example describes the effect of flt 3-L on the formation of erythroid cells in the spleen of transgenic mice. Transgenic mice were prepared according to the procedures of Example 9. Mice were killed and a single cell suspension was prepared from each inactive spleen. The suspended cells were untwisted and then resuspended in 10 ml of medium containing PBS and 1% fetal bovine serum. Cell counting was performed using a hemocytometer. Each cell sample was counted with Trypan Blue dye to obtain the total number of viable cells per 1 ml of medium according to the following formula: (RBC + WBC) / ml, where RBC is the number of red blood cells and WBC is the number of white blood cells. Then, each sample was counted with Turk stain to obtain the total number of leukocytes per 1 ml of medium. The total number of red blood cells per 1 ml was calculated for each sample by subtracting the total number of leukocytes per 1 ml from the total number of viable cells per 1 ml. These results are shown in the following Table III.

 As can be seen from the data of Table III, the numbers of leukocytes per 1 ml were approximately the same as in the control mice. However, the numbers of red blood cells from the spleens of two transgenic mice were approximately 2–3 times higher than those observed in control mice. Flt 3-L stimulates an increase in the direction of differentiation in erythroid cells, possibly through stimulation of erythroid progenitor cells, through stimulation of cells producing erythropoietin, or by blocking the mechanism that inhibits erythropoiesis.

EXAMPLE 11
Flt 3-L stimulates the proliferation of T cells and early B cells
Bone marrow from 9-week-old transgenic mice obtained according to Example 9 was screened for the presence of various markers of T and B cell phenotypes using antibodies immunoreactive with such markers. The following markers were examined: marker B220, specific for the line of differentiation of B cells; surface Ig M marker (sIgM) specific for mature B cells; marker S7 (CD43), which is a marker of early b-cells; stem cell antigen-1 marker (SCA-1), which is a marker of activated T cells and B cells; CD4, which is a marker of helper T cells and certain stem cells, and a Mac-1 marker specific for macrophages. Bone marrow was screened using well-known antibodies against such markers. The following Table 1U shows the data obtained from bone marrow screening. Two transgenic mice from the same offspring were analyzed compared to a normal mouse from the same offspring (control) and an unrelated normal mouse (control).

The data presented above show that the overproduction of flt 3-L in mice leads to an increase in the number of B cells, as can be seen from the increase in B220 ⁺ cells and SCA-1 ⁺ cells. Analysis of B220 ⁺ cells using FACS (cell sorter with excitation of fluorescence) showed an increase in the number of proB cells (HSA ^- , S7 ⁺ ). The increase in CD4 ⁺ cells showed an approximately 2-fold increase in the number of T cells and stem cells. A decrease in cells having a SIgM marker indicates that flt 3-L does not stimulate proliferation of mature B cells. These data indicate that flt 3-L increases the number of cells with the phenotype of stem cells, T cells, or early B cells and does not stimulate the proliferation of mature B cells or macrophages.

EXAMPLE 12
Thymus analysis (thymus gland from super-producing flt 3-L mice
This example describes the analysis of the thymus from transgenic mice obtained according to the procedure of Example 9. Six adult mice of approximately 3 months of age were killed. Thymus was removed from each mouse and a single cell suspension was prepared.

FACS analysis showed that there was no general change in the number of cells and that the mice did not detect changes in the ratios of maturing thymocytes when using markers: CD 4 VS. CD8; CD3VS. αβTCR (T-cell receptor) and CD3 γδTCR (T-cell receptor). However, a change in the ratios of certain types of cells within the CD4 ^- and CD8 ^- compartment (i.e., the earliest cells with respect to development; each of these represents approximately 2-3% of all thymus cells). In particular, CD4 ^- and CD8 ^- cells in the thymus develop in three stages. Stage 1 is a cell having Pgp-1 ⁺⁺ , HSA ⁺ and 1L-2 receptor-negative ("1L-2R ^- ") markers. After stage 1, thymus cells develop to stage 2, consisting of cells having Pgp-1 ⁺ , HSA ⁺⁺ and 1L-2R ⁺⁺ markers, and then to stage 3, characterized by cells having Pgp-1 ^+/- , HSA ^{+ +} and 1L-2R ^are markers. Thymus cells in stage 2 decreased in number by approximately 50%, while the population of cells in stage 3 was proportionally increased. These data suggest that flt 3-L acts on the transition of thymus cells from stage 2 to stage 3 of their development, which indicates that flt 3-L is active on early T cells.

EXAMPLE 13
The use of flt 3-L in peripheral stem cell transplantation
This example describes a method for using flt 3-L in autologous (autologous) transplantation of peripheral stem cells (PSC) or peripheral blood progenitor cells (PBMC). Typically, transplantation of PBMC and PSC is performed on patients whose bone marrow is unsuitable for collection due to, for example, pathology or malignant damage.

Prior to cell collection, it may be desirable to mobilize or increase the amounts of circulating PBRS and PSC. Mobilization can improve the collection of PBMC and PCS and is achieved by intravenous administration of flt 3-L patients before collecting such cells. Other growth factors, such as CSF-1, GM-MSF, SF, G-CSF, EPO, 1L-1, 1L-2, 1L-3, 1L-4, 1L-5, 1L-6, 1L-7, 1L-8, 1L-9, 1L-10, 1L-11, 1L-12, 1L-13, 1L-14, 1L-15, GM-CSF / 1L-3-fused proteins, L1F, FGF and combinations thereof, may also be administered in sequential or simultaneous combination with flt 3-L. Mobilized or non-mobilized PBRS and PCC are harvested using an aferase procedure known in the art. See, for example, Bishop et al., Blood, vol. 83, 2, pp. 610-616 (1994). Briefly, PBRS and PCC are assembled using standard devices, for example, a Haemonetics Model V50 apheresis device (Haemonetics, Braintree, MA). Four-hour cell sampling is usually carried out no more than 5 times a week until approximately 6.5x10 ⁸ mononuclear cells (MNC) are collected per 1 kg of patient weight. Aliquots of the collected PBMC and PSC are analyzed for granulocyte macrophage colony forming units (CFu-GM) by diluting approximately 1: 6 with Hank's balanced salt solution without calcium or magnesium (HBSS) and layering on lymphocyte separation medium (Organon Teknika Durham, North Carolina) . After centrifugation, the MNC at the interphase is collected, washed and resuspended in HBSS. Aliquots of 1 ml containing approximately 300,000 MNC, modified McCoy 5A medium, 0.3% agar, 200 U / ml recombinant human GM-CSF, 200 U / ml recombinant human 1L-3 and 200 U / ml recombinant human G-CSF , cultivated at 37 ^o With 5% CO ₂ in fully humidified air for 14 days. Sometimes flt 3-L or fused GM-CSF / 11-3 molecules (P1XU 321) can be added to these cultures. These cultures were stained with Wright's dye and CF u -GM colonies were evaluated using a dissecting magnifier (Ward et al., Exp. Hematol, 16: 358 (1988). Alternatively, CFu-GM colonies can be evaluated using CD 34 / CD 33 flow cytometry method. (Siena et al., Blood, vol. 77, 2, pp. 400-409, 1991) or any other method known in the art.

 CFu-GM containing cultures were frozen in a freezer at a controlled freezing rate (e.g., Cryo. Med, Mt. Clemens, M1), then stored in the liquid nitrogen vapor phase. As a cryoprotectant, 10% dimethyl sulfoxide can be used. After completion of all collections from the CFu-GM patient, the containing cultures were thawed and pooled. Thawed harvested cells were either re-infused intravenously to the patient or propagated ex vivo before re-infusion. Ex vivo enlargement of the combined cells can be performed using flt 3-L as a growth factor, either alone or in combination with other cytokines mentioned above. Methods for such ex vivo volume expansion are well known in the art. Cells that are enlarged or underestimated are re-infused to the patient intravenously. To facilitate the engraftment of the transplanted cells, flt 3-L was administered simultaneously with or after repeated infusion. Flt 3-L was administered alone or sequentially or in combination with other cytokines selected from the above list.

EXAMPLE 14
Purification of hematopoietic progenitor cells or stem cells using flt 3-L
This Example describes a method for purifying progenitor cells and stem cells from a suspension containing a mixture of cells. Cells from bone marrow and peripheral blood are harvested using conventional procedures. These cells are suspended in standard media and then centrifuged to remove red blood cells and neutrophils. Cells located during the interphase between the two phases (also known as white blood cell) are recovered and resuspended. These cells are predominantly mononuclear and represent the bulk of the early hematopoietic progenitor cells and stem cells. Then, the resulting cell suspension is incubated with biotinylated flt 3-L for a time sufficient for the interaction of flt 3-L: flt 3-L. Typically, incubation periods of at least 1 hour are sufficient. After incubation, the cell suspension is passed by gravity through a column packed with avidin-coated granules. Such columns are well known in the art, see Berenson et al., J. Cell Biochem. 10: 239 (1986). The column was washed with PBS to remove unbound material. Target cells were released from the granules and freed from flt 3-L using conventional methods.

Claims (18)

1. The selected flt3 ligand polypeptide containing amino acids 1-235 of the sequence of SEQ ID NO: 6, or amino acids 28-235 of the sequence of SEQ ID NO: 6, or amino acids 1-182 of the sequence of SEQ ID NO: 6, or amino acids 1-160 of the sequence of SEQ ID NO: 6, or amino acids 28-182 of the sequence of SEQ ID NO: 6, or amino acids 28-160 of the sequence of SEQ ID NO: 6. 2. The polypeptide according to claim 1, containing amino acids 1-235 of the sequence of SEQ ID NO: 6. 3. The polypeptide according to claim 2, containing amino acids 28-160 or 28-182 of the sequence of SEQ ID NO: 6. 4. The selected polynucleotide encoding a flt3 ligand polypeptide containing a nucleic acid with a nucleotide sequence corresponding to amino acid sequence 28-160 of the sequence SEQ ID NO: 6. or amino acids 28-182 of the sequence SEQ ID NO: 6, or amino acids 1-160 of the sequence SEQ ID NO: 6, or amino acids 1-182 of the sequence SEQ ID NO: 6, or amino acids 28-235 of the sequence SEQ ID NO: 6, or amino acids 1-235 of the sequence of SEQ ID NO: 6. 5. An isolated polynucleotide containing a nucleic acid encoding a flt3 ligand polypeptide selected from the group consisting of (a) a polynucleotide containing SEQ ID NO: 5; (b) the polynucleotide sequence of SEQ ID NO: 5, which encodes a soluble flt3 ligand polypeptide comprising amino acids 28-182 or amino acids 28-160 of the sequence SEQ ID NO: 6, wherein the soluble flt3 ligand polypeptide is biologically active; and (c) a polynucleotide sequence which, due to the degeneracy of the genetic code, encodes a flt3 ligand having the amino acid sequence of the polypeptides encoded by the polynucleotide sequences of subparagraphs (a) or (b). 6. An isolated polynucleotide containing a nucleic acid encoding a flt3 ligand polypeptide containing amino acids 1-235 of the sequence SEQ ID NO: 6, where the polynucleotide sequence is a cDNA insert contained in pBLUESCRIPT SK (-) vector having registration number ATCC 69382. 7. An expression vector functional in mammalian cells containing the polynucleotide sequence of claim 4, operably linked to a heterologous promoter sequence. 8. An expression vector functional in mammalian cells, comprising the polynucleotide sequence of claim 5, operably linked to a heterologous promoter sequence. 9. An expression vector functional in mammalian cells containing the polynucleotide sequence of claim 6, operably linked to a heterologous promoter sequence. 10. The cell line of CHO transfected with the vector according to claim 7, for the production of flt3 ligand. 11. A line of CHO cells transfected with the vector of claim 8 to produce flt3 ligand. 12. A cell line of CHO transfected or transformed with the nucleotide sequence of claim 9, for producing flt3 ligand. 13. A method of producing a flt3 ligand polypeptide, comprising cultivating a CHO cell line of claim 10 under conditions conducive to expression, and recovering the polypeptide from the culture medium. 14. A method of producing a flt3 ligand polypeptide, comprising cultivating a CHO cell line according to claim 11 under conditions conducive to expression, and recovering the polypeptide from the culture medium. 15. A method of producing a flt3 ligand polypeptide, comprising culturing the CHO cell line of claim 12 under conditions conducive to expression, and recovering the polypeptide from the culture medium. 16. A pharmaceutical composition having the property of stimulating the proliferation and differentiation of progenitor cells and stem cells, characterized in that it contains an effective amount of the flt3 ligand polypeptide according to claim 1 and a pharmaceutically acceptable carrier, excipient or diluent. 17. A pharmaceutical composition having the property of stimulating the proliferation and differentiation of progenitor cells and stem cells, characterized in that it contains an effective amount of the flt3 ligand polypeptide according to claim 2 and a pharmaceutically acceptable carrier, excipient or diluent. 18. The selected polypeptide containing amino acids 1-235 of the sequence SEQ ID NO: 6, which corresponds to the polynucleotide sequence representing the cDNA insert contained in the vector pBLUESCRIPT SK (-), having registration number ATCC 69382.

Images