RU2198923C2 - Nucleotide sequence of yarrowia lipolityca gene leu2 (variants), recombinant dna-material (variants), yeast strain yarrowia lipolityca (variants) - Google Patents

Abstract

FIELD: genetic engineering, molecular biology, biotechnology. SUBSTANCE: invention relates to technology of isolation of yeast proteins and nucleotide sequence of gene LEU2 of Yarrowia lipolityca, recombinant DNA-materials each of that comprises except for nucleotide sequence of gene LEU2 of Yarrowia lipolityca the human prorenin or anaphylatoxin gene and to strains of Yarrowia lipolityca transformed with recombinant DNA-material and able to produce human prorenin or anaphylatoxin. Invention provides safety preparing rather high amount of human proteins prorenin and anaphylatoxin in easily separable functional form. EFFECT: improved method of preparing, valuable properties. 19 cl, 8 tbl

Description

 The application is a partial continuation of the application, serial number 789206, filed October 18, 1985

 This invention relates to a technology for the isolation of yeast proteins. More specifically, it relates to recombinant cloning vectors of Yarrowia lipolytica containing foreign DNA encoding the expression and secretion of mammalian proteins (eg, prochymosin) and other polypeptides; expression vectors containing the Y. lipolytica gene promoter (e.g., XRR2 or LEU2), DNA sequences encoding the alkaline protease signal (or pre-signal) sequence, the propeptide region and the XPR2 terminator region, as well as their variants and functional equivalents resulting from degeneration genetic code or the use of other gene components of Y. lipolytica. In addition, the invention relates to yeast transformants carrying the indicated expression and isolation vectors, their use for the production of foreign proteins in their native, functional form and methods for the implementation of the above.

 Economic attractiveness as reliable and providing a sufficiently high yield of a diverse set of proteins or polypeptides of interest to industry (for example, prorennin, bovine growth hormone) or medical purposes (for example, urogastron, tissue plasminogen activator, human anaphylatoxin C5a), and especially as a source , giving a high-quality product in an easily detachable functional form, have led many researchers to apply DNA recombinant technology to micropores to ganisms as "factories" for the production of foreign proteins.

 Extensive research has focused on protein secretion as a potential solution to the difficulties encountered in extracting foreign (heterologous) or exogenous proteins in a biologically active form from intracellular accumulations of them in recombinant host cells, especially from Escherichia coli. In E. coli, a foreign protein is often produced in the cell in the form of refractive inclusion bodies. These proteins usually have low solubility in water and low biological activity or do not have it at all. The extraction of these proteins from refracting inclusion bodies usually requires rigorous chemical treatment, which can be expensive and may result in low yield or inability to obtain the protein in the desired native, biologically active form. In addition, the possibility of protein contamination with undesirable substances produced by E. coli increases due to the need to destroy cells to release refracting bodies. Other organisms besides E. coli also produce foreign proteins in insoluble intracellular form. For example, UK patent 2091271, published July 28, 1982, describes the genetic modification of S. cerevisiae by DNA recombinant technology for the expression of calf rennin or chymosin; these terms are used interchangeably in a patent. In view of these difficulties, they turned to the secretion of these proteins in order to obtain proteins in a native, active configuration.

 Whether a protein is excreted, including foreign proteins, or a polypeptide by a given organism, is presumably dependent on the type of protein. In most eukaryotic cells, part of the protein synthesis apparatus is connected to the endoplasmic reticulum and the amino acid sequence (called the “signal sequence”) at the amino terminus of the growing polypeptide chain serves to control the process of protein overcoming the membrane. The signal sequence is then cleaved proteolytically, giving the active mature protein. In order to accelerate the processes of isolation of foreign proteins, several attempts have been made to use the signal sequences of microorganisms, including Bacillus subtilis, Saccharomyces cerevisiae and mammalian cell cultures. However, these organisms were not ideal.

 The inherent properties of B. subtilis, for example, the isolation of many proteins, including numerous proteases that can degrade the secreted foreign protein, the instability of transformed strains resulting from the loss of foreign DNA, hinder its use.

 Mammalian cells have been successfully modified genetically to express and isolate foreign proteins, but these systems are technologically complex and expensive to process and have no practical use for the commercial production of most proteins.

 Although protein isolation studies have been more successful with S. cerevisiae than with B. subtilis, it appears that S. cerevisiae also has some internal limitations, like a protein isolation system. European Patent Application 0123544, published October 31, 1984, describes the isolation of α-factor genes from S. cerevisiae and the use of their promoting and / or signal peptide parts in combination with a DNA encoding yeast-foreign proteins in a plasmid for transformation of yeast cells capable of producing a single mature protein in cell culture. European application 0088632, published September 14, 1983, describes a method for expressing and isolating a foreign protein in S. cerevisiae. However, it appears that the size of the proteins that S. cerevisiae will efficiently isolate with this and other excretory systems should be limited to about 20,000 daltons. Overcoming this inefficiency of S. cerevisiae as an excretory organism requires many mutational changes that are described by Smith et al. Science 229; 1219-1224 (1985). The only exception in this regard is the observation that Aspergillus enzymes larger than 20,000 can apparently be isolated by S. cerevisiae, but these enzymes are highly glycosylated by S. cerevisiae, which can affect the efficiency of isolation.

 Of particular interest is Yarrowia lipolytica, an industrially important species of yeast used for the production of citric acid and cellular proteins. It can also be used to produce erythritol, mannitol and isopropyl acid. In contrast, S. cerevisiae Y. lipolytica is of particular interest and value because of its ability to efficiently release high molecular weight proteins (alkaline protease, acidic protease and DNAase) into the culture medium, thus providing the potential for the extraction of foreign proteins in their native state without the need destruction of producing cells. In addition, Y. lipolytica quantitatively isolates very few of its own proteins, thus providing the opportunity to obtain the desired foreign protein in a nutrient medium as the dominant variety of proteins and facilitating the extraction of the specified foreign protein.

 Y. lipolytica produces a large amount of extracellular protease. It is the dominant protein secreted by Y. lipolytica. The type of protease (alkaline, acidic or neutral) depends on the Y. lipolytica strain used (Ogrydziak et al. J. Gen. Microbiol. (1982) 128, 1225-1234). A partial analysis of the N-terminal amino acid sequence of an alkaline extracellular protease is described by Ogrydziak et al. (UK. Cit.).

 The pending application, serial 634505, filed July 25, 1984, describes methods for transforming Y. lipolytica and cloning Y. lipolytica genes by complementing mutations. It describes the cloning of the XPR2 gene, which encodes a secreted alkaline protease, by complementing the xrr2 mutations of Y. lipolytica. The method involves transforming the host strain of Y. lipolytica with partial cleavage of BglII from the library of Y. lipolytica genes into the pLD40 vector described in European application 0138508, published April 24, 1985 and which is analogous to the above US application.

 The present invention provides: recombinant cloning vectors of Y. lipolytica containing foreign DNA encoding mammalian proteins and other polypeptides, including plasmids suitable for transforming host Y. lipolytica cells, and in particular integrative expression vectors containing the LEU2 promoter gene, XPR2 promoter gene, alkaline protease preproregions, and XPR2 terminal region; and expression plasmids having a foreign coding sequence with XPR2 release signals further down the reading direction from the LEU2 promoter, which are capable of causing expression and isolation of a foreign protein in transformable Y. lipolytica.

 The invention thus illustrates the process of expression and isolation of finished foreign proteins, especially prorennin and human anaphylatoxin C5a, from genetically modified cell cultures of Y. lipolytica. Establishing the exact identity of the amino acid sequence as well as the DNA sequence for the extracellular alkaline protease of Y. lipolytica suggested that a foreign protein could be expressed and isolated using recombinant DNA technology in cell culture production. In the case of prorennin, the ready-made form of zymogen (rennin precursor) is expressed and secreted.

 It was found that Y. lipolytica can be genetically modified using DNA recombinant technology to obtain transformants capable of expressing and secreting foreign proteins in their native form. This is achieved by constructing vectors carrying the signal sequence or signal and the first (pro1) or both (npo1 + pro2) sequences of the XPR2 gene associated with the structural gene sequence for the foreign protein to be isolated.

 Transformants obtained by integration at the XPR2 locus of a DNA vector containing an XPR2 gene fragment with missing regulatory or structural components at both ends of the gene do not secrete a more alkaline protease, a characteristic not only desirable for the isolation of a foreign protein, but also which can be used to screen for transformants .

 In addition, vectors carrying the XPR2 promoter and sequences for the alkaline protease release signal sequence are capable of inducing the release of a ready foreign protein in a transformed Y. lipolytica cell. Some recombinant DNA vectors of this type can cause expression / isolation, regardless of the integration site in the yeast genome. In general, vectors containing suitable 5 ′ and 3 ′ flanking DNAs induce product expression regardless of the integration site.

 In addition, it was unexpectedly discovered that the integration of a derivative of pBR322 plasmid in the chromosomal DNA of Y. lipolytica creates a region of homology that is able to favor further site-directed integrative transformation. An integrated copy of pBR322 thus serves as a “dock” for incoming transforming DNA. The integration of a resident copy of pBR322 into the chromosomal DNA of Y. lipolytica, despite the fact that pBR322 is not Y. lipolytica DNA, thus creates a known target for integration. Transformed Y. lipolytica recipients containing such a site have two main advantages over recipients who do not have such a site, namely, the presence of a region with a known sequence and a known restriction map as a target for site-directed integration, and the ability to determine using pBR322 as a target for integration, whether the incoming plasmid contains a complete functional unit or gene, or only part of the desired gene. For example, a plasmid containing only the 3 ′ fragment of the XPR2 gene can transform an XPR2-1002 recipient if it contains a wild-type codon and is integrated at the XPR2 locus. However, the same plasmid will not transform the XPR2-1002 host cell to a positive protease phenotype if integrated into pBR322, since it does not contain a whole functional unit.

 Thus, in Y. lipolytica transformants containing a region of homology to a foreign DNA vector, the region containing exogenous DNA serves as a receiving site during the integrative transformation of Y. lipolytica. In addition to pBR322 and its derivatives, cosmids, bacteriophages such as M13 and lambda, synthetically prepared DNA, and conventional plasmids such as PUC13 can be used to prepare docked Y. lipolytica transformants.

 The promoter sequence "LEU2" refers to the untranslated region away from the ATG, which contains most, if not all, of the traits required for expression.

 By the promoter sequence “XPR2” is meant an untranslated region located in the reading direction in front of the signal (or pre-signal) sequence that is necessary for expression. In addition, a signal with or without a sequence from the XPR2 gene can be used to isolate, under the control of Y.lipolytica promoters, other than the XPR2 gene, vectors carrying the LEU2 promoter and sequences for the alkaline protease isolation signal are capable of causing isolation in a transformed Y. lipolytica cell prepared foreign proteins. The human anaphylatoxin C5a, also known as human complementary protein C5a (human C5a), is a bioactive polypeptide fragment generated in vivo as a result of complement container activation. It functions as an immunomodulator in the regulation of certain aspects of humoral and cellular immunoreaction. The primary structure of it and other anaphylatoxins has been studied. A review of chemical, physical, and biological characteristics is presented by Hugli in Complement, edited by H.J. Muller-Eberhard and P.A. Miescher, pp. 73-99, 1985, Springer-Verlag, New York.

 Those skilled in the art will recognize that foreign DNA encoding virtually any known amino acid sequence can be used with the appropriate necessary modifications in the present invention. The methodology described here can be applied with appropriate necessary changes to obtain and isolate any known foreign proteins, the representatives of which are listed in US patent 4532207, published July 30, 1985. In addition, any other Y. lipolytica gene can be used instead of the XPR2 gene. for the isolation of proteins, such as genes for ribonuclease or acidic protease, as well as hybrid genes constructed by combining fragments of two or more of these genes, for example, the signal sequence of the XPR2 gene, etc. the motivating sequence of the ribonuclease gene.

 Functional equivalents of the above DNA or nucleotide sequences are also included within the scope of this invention. The degeneracy of the genetic code makes it possible to replace certain codons with others that encode the same amino acid and, therefore, lead to the same protein. The DNA or nucleotide sequence can vary significantly, since with the exception of methionine and tryptophan, known amino acids can be encoded by more than one codon. So, part or all of the XPR2 gene can be synthesized to obtain a DNA sequence that is significantly different from that shown in figure 3. The encoded amino acid sequence for it will however be preserved. Such functional changes in a given DNA or nucleotide sequence make it possible to promote the isolation and / or processing of foreign proteins encoded by foreign DNA sequences attached to them. All changes in the nucleotide sequence of the XPR2 gene and its fragments allowed by the genetic code are therefore included in this invention. In addition, it is possible to eliminate codons or replace one or more codons with other than degenerate codons to obtain a structurally modified polypeptide, but essentially having the same utility or activity as the polypeptide obtained using an unmodified DNA molecule. These two polypeptides are functionally equivalent, like two DNA molecules causing their appearance, even if the difference between these DNA molecules does not apply to the degeneration of the genetic code. The simplest example of this relates to prorennin A and prorennin B, two allelic forms of prorennin that differ only in the presence of aspartic acid residue at position 286 of prorennin A and glycine residue in this position at prorennin B.

 Using this technique, expression and excretion of foreign mammalian proteins of prorennin and human anaphylatoxin C5a in Y. lipolytica was achieved using expression and isolation signals from Y. lipolytica XPR2 and / or LEU2 genes. The DNA sequences for prorennin and human anaphylatoxin C5a were sewn using synthetic oligonucleotides to the XPR2 gene sequence at sites putative for encoding an alkaline protease signal peptide, or at protease precursor conversion sites designated here as pro1 and pro2, and used to obtain gene constructs which were then introduced into Y. lipolytica by integrative transformation. Recombinant cultures expressed and secreted foreign proteins with molecular weight and immunoreactivity of prorennin and human anaphylatoxin C5a into the nutrient medium. It can be assumed that the prorennin obtained in this way has a native configuration, since after removal of the propeptide it exhibits complete enzymatic activity.

 The term “recombinant DNA material” as used herein includes any material that contains at least one of the following elements: the Y. lipolytica XPR2 gene, signal (or pre-signal), pro1- and pro2- (which together make up the proregion) promoter or its end sequence; the LEU2 promoter or functional equivalents of the above sequences allowed by the degeneracy of the genetic code.

 Representatives of the indicated recombinant DNA material are DNA fragments, plasmids or vectors or transformants containing any or all of the above sequences.

Materials Restriction endonuclease and T4 ligase were obtained from New England Biolabs, bacterial alkaline phosphatase from Bethesda Research Laboratories, T4 polynucleotide kinase from PL-Biochemicals and [gamma- ³² p] ATP from New England Nuclear. All enzymes were used under conditions recommended by the supplier.

Wednesday
GLP medium (glycerol-protease-peptone medium) contained (per liter): 6.7 g of glycerol, 1.6 g of Difco protease-peptone, 1.7 g of Difco nitrogenous yeast base without amino acids and ammonium sulfate, 30 mg of uracil and 0 , 5 ml / l polypropylene glycol with mol. in. 2000 (Polysciences) in 40 mM phosphate buffer (pH 6.8). (Polypropylene glycol was not included when the medium was used to grow cultures for analysis of the rennin enzyme activity). Protease-peptone was separately autoclaved in phosphate buffer.

 DEPD medium (yeast extract-peptone-dextrose) contained (per liter): 5 g of yeast extract, 10 g of peptone and 20 g of dextrose.

E. coli was grown in LB medium at 37 ^° C. LB medium contained (per liter): 10 g of bactotryptone, 10 g of bacterium yeast extract, 10 g of sodium chloride, adjusted to pH 7.5 with sodium hydroxide.

 DNA sequence analysis. DNA fragments from various plasmids described herein were isolated on a polyacrylamide gel and sequenced by the method of Maxam et al. Methods in Enzymology, 65, 499 (1980).

 Binding Procedures. DNA fragments, including cleaved vector plasmids, were coupled by mixing the desired components (DNA fragments with end sections specifically designed to ensure proper pairing) with T4 DNA ligase. Approximately 10 ligase units per μg of amount of vector and introduced fragments were added. The resulting reaction mixture was transformed into competent cells of strains MM294 (ATCC-33625) or HB101 (ATCC-33694) E. coli K12.

Obtaining chemically synthesized DNA. To construct hybrid genes for the expression and isolation of prorennin, eight oligonucleotides were synthesized using the modified phosphoramidate method (Sinha et al., Tetrahedron Letters 24, 5843 (1983) on a Genetic Design 6500 (Watertown, MA) automatic DNA synthesizer and purified on 6M urea 20% polyacrylamide gel Aliquots of complementary oligonucleotides were mixed and crosslinked at 4 ^{° C.} overnight in TE (10 mM Tris-HCl, pH 8.0; 1 mM NaEDTA). Aliquots (about 2 μg) of double-stranded oligonucleotides were phosphorylated in 20 μl of the reaction mixture containing 70 mm Tris (pH 7.6), 10 mM MgCl ₂ , 5 mM dithiothreitol, 5 mM ATP, at 37 ^{° C.} using T4 polynucleotide kinase.

 Obtaining plasmid DNA. Plasmid DNA in large quantities was obtained according to the method of Holmes et al. Anal. Biochem., 114, 195-197 (1981), followed by centrifugation in a density gradient of ethidium bromide-CsCl. Minimal amounts of plasmid DNA were obtained according to the alkaline SDS technique of Birnboim et al., NAR 1, 1513 (1979).

Construction of expression / isolation vectors for prorennin. A series of different constructs was prepared to produce final expression vectors. All stages are presented in the form of a diagram in the attached figures. In general, DNA fragments were isolated by gel electrophoresis and crosslinked with other fragments or digested plasmid DNA in 20 μl of 50 mM Tris-Hcl (pH 7.5), 10 mM MgCl ₂ , 20 mM dithiothreitol, 1 mM ATP, in the presence of 200 units of T4 ligase at 4 ^o C. If partial digestion of DNA with a restriction endonuclease was required, the optimal digestion time was established experimentally.

Identification of prorennin in culture fluid. Yeast transformants containing expression vectors were grown overnight in GLP medium (see above). After centrifugation, 1 ml of a 50% trichloroacetic acid in each 5 ml aliquot of the culture fluid was added to remove the yeast cells and kept at 4 ^{° C. for} 60 minutes. By centrifugation, balls were obtained which were washed twice with 2 ml of cold acetone. The precipitated protein was dissolved in 100 μl of standard SDS buffer and aliquots were electrophoresed on 10% SDS polyacrylamide gels (Laemmli, UK (1970), Nature 227, 680). Proteins released from the gel were electrophoretically transferred onto nitrocellulose (Schleicher and Schuell, 0.22 μm), and prorennin was determined by immunoassay on a gel plate (Hawkes, R. et al. (1982) Anal. Biochem. 119, 142). The filter was coated with rabbit antiprorennin antibody, followed by incubation with goat-rabbit (IgG) conjugated peroxidase antibody (Cappel, Malvern, Pa). Bound antibodies were determined by staining with a mixture of 4-chloro-1-naphthol and hydrogen peroxide.

The activity of prorennin by coagulation of milk in the culture fluid. The culture fluid of various transformants of Y. lipolytica was examined for milk coagulation activity according to the modified method of Ernstrom, J. Dairy Sci. 41, 1664 (1958). In short, the study included measuring the time required to clot buffer skim milk with rennin in activated culture supernatants and comparing the values with the standard for purified rennin. Yeast cultures (25 ml) were grown overnight in GLP. After the cells were removed by centrifugation, 5 ml aliquots of the culture supernatants were dried by freezing in vacuo. Each lyophilized supernatant was resuspended in 300 μl of distilled water. As a control standard, a series of dilutions of purified calf prorennin was prepared. Concentrates of prorennin in the medium and control samples were activated by the addition of approximately 5-10 μl conc. Hcl until a pH of approximately 2 was obtained and incubated for one hour at 22 ^° C. Skim milk was prepared by adding 60 g of skimmed milk powder (Difco) to 500 ml of 41.5 mm sodium acetate (pH 6.3) and 13.6 mm CaCl ₂ and stirring for 20 minutes at 4 ^° C. The substrate was used for analysis immediately after preparation. An aliquot of 60 μl (equivalent to 1 ml of culture supernatant) of each enzyme preparation was added to 1 ml of an aliquot of skim milk at 37 ^° C and coagulation time was recorded.

 Obtaining synthetic oligonucleotides for the C5a gene. The oligodeoxynucleotides used in the synthesis of the C5a structural gene were obtained by a modified phosphoramidate method (Sinha et al., Acc. Cit.) Using a controlled porous glass substrate on a Genetic Design 6500 (Watertown, MA) automatic DNA synthesizer. Upon receipt, 3% (w / v) dichloroacetic acid in dichloromethane was used to remove the trityl group, activation of phosphoramidates with saturated tetrazole in acetonitrile, treatment with diethoxyphosphintetrazolidide and oxidation with an iodine / THF aqueous solution (Matteucci et al., 1981, J. Amer. Chem. Soc. Soc. Soc. Chem. Soc. Soc. . 105, 3183). The total time per add cycle was 14 minutes. Ten 47-mer segments A-J (Fig. 7) were obtained with a 98.8% average yield per stage (by trityl analysis), released according to the method of Matteucci et al., UK. op., ethanol precipitated from 0.3 M sodium acetate and isolated by preparative gel electrophoresis on 10% denatured polyacrylamide-urea gel before crosslinking.

 Assembly, cloning and sequencing of the human C5a gene. 7 shows the amino acid sequence of the desired protein and the location of the synthetic oligonucleotides necessary for the manufacture of a gene encoding the human C5a protein. All oligomers, except A and F, were phosphorylated at their 5'-ends with T4 polynucleotide kinase. Gene assembly included two primary cleavage / crosslinking reactions, including oligomers A, B, I, and J and oligomers C, D, E, F, G, and H. The resulting 94 bp double-stranded DNA fragments and 141 p. they were isolated after electrophoresis on 10% polyacrylamide gel, sewn together, and their product was 235 bp in size. isolated by gel electrophoresis. This DNA fragment containing the structural gene encoding C5a was introduced between the EcoRI and HindIII sites of the DNA of the vector pBR322 and was used to transform cells of E. coli K-12 strain HB101. Restriction analysis of plasmid DNA isolated from 6 transformants showed that 5 of 6 clones contained the correct size EcoRI / HindIII fragment. The nucleotide sequence of the C5a gene region of each of these plasmids was determined by the method of Mach and other Method Enzymol. 65, 499 (1980).

 Construction and characterization of the expression plasmid C5a for E. coli. The procedure for isolating DNA fragments and the conditions for the crosslinking reaction were the same as described by Maniatis et al. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor. The E. coli trp promoter operator was originally derived from ptrpL1 (Edman et al. (1981) Nature 291, 503). Fragment EcoRI 360 bp containing the promoter operator sequence used in the expression plasmid C5a (pC5a-48) was isolated from the plasmid for the expression of prorennin pPFZ-R2 described in European application 0147178, published July 3, 1985

 Identification of C5a in Y. lipolytica culture fluid. The procedure was the same as described above for prorennin, except that the goat anti-C5a and rabbit anti-goat IgG (Cappel) were used in the immunoassay. The goat anti-human C5a antibody was prepared by the method of Manderino et al., J. Immunol. Methods 53, 41-50 (1982).

Vectors
pLD40 - described in European Application 0138508, published April 24, 1985

Microorganisms:
ATCC 20774 - Yarrowia lipolytica PC 30869;
ATCC 20781 - Yarrowia lipolytica DL112-PC-30869, transformant with XPR2;
ATCC 20776 - Yarrowia lipolytica DL-148. Transformant Y. Lipolytica ATCC-20688 with SnaBI digested with pLS-3;
ATCC 20775 - Yarrowia lipolytica DL-144. Transformant Y. Lipolytica ATCC 20688 with unsplit pLS-3;
ATCC 20777 - Transformant Y. lipolytica PC-30869 with SnaBI digested with pC5aX-3;
ATCC 20780 - Transformant Y. lipolytica PC-30869 with SnaBI digested with pXX-33;
ATCC 20794 - Transformant Y. lipolytica PC-30869 with pLD56;
ATCC 20795 - Transformant of Y. lipolytica ATCC 20794 with NruI digested with pLX-34.

 They were deposited in accordance with the Budapest Treaty with the American Type Culture Collection, Rockville, Maryland, a recognized collection guaranteeing invariability of deposits and quick access to them by interested parties if a patent is issued for this application. During the consideration of this application, deposits are available to individuals determined by the Commissioner of the United States Patent and Trademark Office in accordance with 37 CFR 1.14 and 35 USC 122 and in accordance with foreign patent laws in countries where duplicates of this application or subsequent applications based on it are filed . All restrictions on access to deposited microorganisms will be finally lifted after the grant of a patent.

 A taxonomic study of Y. lipolytica ATCC 20774 (identified in the culture collection of Pfizer Inc. as PC 30869) was conducted by Dr. J. R. DeZeeuw, who prepared the following description. Methods recommended by J.L. were used. Lodder in "The Yeasts," Second Edition, N. Holland Publishing Co., Amsterdam, 1970.

 CBS 599, a typical culture for the species Candida lipolytica ("The Yeasts", second edition, N. Holland Publishing Co., Amsterdam, 1970) and CBS 6124, a typical culture for Saccharomycopsis lipolytica in "The Yeasts, third edition, were taken for comparisons. Previously, the species was also compared with Endomycopsis lipolytica. Its intermediate designation is Candida lipolytica. The taxonomic position of the species was established by van der Walt and von Arx, Antonie van Leeuwenhoek, 46, 517-521 (1980). The preferred name is currently Yarrowia lipolytica.

 The cultural, morphological and physiological characteristics of strain PC-30869 are consistent with the standard description of the species indicated as Saccharomycopsis lipolytica in "The Yeasts", third edition, edited by Kreger-van Rij, pp. 406-408, Elsevier Science Publishers BV, Amsterdam, 1984 A comparison of strains of Y.lipolytica are shown in table 1.

 PC-30869 was constructed using genetically recombined suitable mutants Y. lipolytica PC-22208, Pfizer soil isolate and Y. lipolytica PC-30026, subculture NRRL Y-1094. PC-30869 phenotypically differs from its wild-type parents in the following: (1) does not produce an active extracellular alkaline protease, (2) requires biotin for growth, and (3) requires a source of L-leucine.

During the log phase of growth of PC-30869 in yeast extract-peptone-glucose (DEPG) broth, the budding cells are ovoid in shape and have an average size of 2.6 x 5.5 microns. DEPG agar is dominated by pseudo- and true mycelia. Blastospores are present in the majority as solitary in pleural positions. No carotenoid pigments are detected. The culture behaves as a “B" mating haploid in crosses with test strains that are authentic for the species (Table 5). Typical ascosporulation is observed on agar V8. The carbon assimilation features are shown in Table 2. No fermentation. Ammonium ion and urea, but not nitrate, are disposed of as the sole sources of nitrogen (Table 3). Strain PC-30869 requires thiamine and D-biotin vitamins (Table 4). Only thiamine is required for parents of wild-type culture. No growth was observed at 37 ^o C. Table 6 also shows other characteristics of the strains.

 PC-30869 differs from other strains of Y. lipolytica described in the patent literature, as follows from a comparison of their phenotypes (tables 7 and 8).

 ATCC 20228 (Nubel et al. US Pat. No. 4,155,811) detects a wild-type food species similar to the typical strains for the species CBS 599 and CBS 6124. Specifically, it does not need uracil, leucine or biotin for growth and it dilutes gelatin.

 ATCC 20268 (DeZeeuw et al., US Pat. No. 4,407,953), unlike ATCC 20228, requires additional leucine for growth. Like ATCC 20228, it does not need uracil or biotin. It also liquefies gelatin.

 ATCC 20688 (European application 0138508) grows only if uracil and leucine are added to the medium. This need for uracil distinguishes ATCC 20688 from both ATCC 20228 and ATCC 20628. ATCC 20688 does not require biotin and dilutes gelatin.

 Culture PC-30869 is different from all of the above. It needs biotin and leucine for growth, but not uracil. It does not thin gelatin.

 The complete medium contained 16.7 g / l of a vitamin-free bacterium yeast base, plus 100 mg / l of uracil, 100 mg / l of L-leucine, 10 μg / l of D-biotin and 200 μg / l of thiamine • Hcl.

 The medium contained 120 g / l of gelatin and 16.7 g / l of a bacterium-yeast base free of vitamins, plus 100 mg / l of uracil, 100 mg / l of L-leucine, 10 μg / l of D-biotin and 200 μg / l of thiamine • Hcl.

Brief Description of the Drawings
FIG. 1 - Partial linear restriction map of overlapping plasmids pLD 57, pLD 58 and pLD 62 isolated from strain Y. lipolytica DL 112.

 Figure 2 - Samples of synthetic oligonucleotides for the XPR2 gene. From the described sequence for most of the first 25 amino acid residues of the active protease (Ogrydziak et al., Suff. Cit.), The two regions marked I and II make it possible to construct 14-mer oligonucleotide probes with 32-fold or less degeneration. These two sites begin at amino acids 7 and 18, respectively. Four different eight-fold degenerate mixed samples were prepared for each site; they received numbers from 170 to 186, as shown. In the predicted nucleic acid sequence depicted, “X” means all 4 bases, “U” means both purines and “Y” means both pyrimidines.

 Figure 3 - Nucleotide sequence of the XPR2 gene indicating the promoter, pre (from -157 to -136), pro1 (from -135 to -98), pro2 (from -97 to -1), alkaline extracellular protease and terminal sequences.

 FIG. 4 - Designed sequence for the terminator vector pterm 4.

 Figure 5 - Designed sequence and restriction map of the plasmid pLS-3.

 6 - Designed sequence and restriction map of the plasmid pXX-33.

 FIG. 7 - Amino acid sequence of human anaphylatoxin C5a.

 Fig. 8 is a Restriction map of plasmid pC5a-48.

 Figure 9 - Designed sequence and restriction map of the plasmid pC5aX-3.

 Figure 10 - The nucleotide sequence of the LEU2 gene.

 FIG. 11 - Designed sequence and restriction map of the plasmid pLX-34.

XPR2 gene sequence analysis. Analysis of the DNA sequence of the cloned XPR2 gene is carried out by chemical degradation (Mach et al., 1980, Methods Enzymol. 65, 499) on overlapping restriction fragments obtained from plasmids pLD 57, pLD 58, pLD 62 (Figure 1), pLD 84 and pLD 86 (see below). The results showed that the cloned genomic DNA of the yeast does contain a gene for extracellular alkaline protease. The nucleotide sequence of the XPR2 gene and the amino acid sequence of the alkaline protease precursor with its signal sequence deduced from the nucleotide sequence are shown in FIG. 3. A significant part of the amino acid sequence of the extracellular protease was unknown (Ogrydziak et al., UK. Cit.) And is presented here for the first time. Moreover, the sequences required for expression and isolation of the extracellular protease are also described here for the first time. The DNA sequence encoding the alkaline protease, its preceding and signal sequences, consists of 1362 base pairs (Figure 3). The primary structure of this polypeptide chain, derived from the nucleotide sequence, must contain 454 amino acid residues. Alkaline protease is synthesized in the cell in the form of a precursor, which is proteolytically converted into a secreted or ready-made form. Analysis of the N-terminal amino acid sequence derived from the nucleotide sequence showed the presence of a signal peptide in the precursor molecule. This signal peptide contains 22 amino acid residues, and its structural features are similar to those of higher eukaryotes and
prokaryotes (Perlman et al., 1983, J. Mol. Biol. 167, 391). Regions of the predicted amino acid sequence that generally coincide with the known 25 N-terminal amino acids of the mature alkaline protease (Ogrydziak et al., 1982, J. Gen. Microbiol. 128, 1225) are preceded by 157 amino acid residues containing a signal peptide and two trypsin-type cleavage sites (Lys-Arg). These cleavage sites were used to separate the proregion into pro1 (−135 to −98) and pro2 (−97 to −1). See FIG. 3. As follows from the nucleotide sequence, the active alkaline protease has 297 amino acids. Amino acid sequences for various forms of protease, derived from the nucleotide sequence, are in accordance with the size of the purified forms of the enzyme. In addition to the structural sequence of the alkaline protease precursor, approximately 700 bp were determined. 5'-flanking sequence and 600 BP 3'-flanking sequence. Analysis of these sites showed that they contain sequences similar to other eukaryotic promoters and terminators, and they probably play a significant role in the expression of alkaline protease.

 As indicated above, the method of transformation of Y. lipolytica and cloning of Y. lipolytica genes by complementation of mutations, including the cloning of the XPR2 gene, which encodes an alkaline protease, by complementation of the xrr2 mutation, are described in European application 0138508. The technique described therein involves the transformation of the host cell of the strain Y. lipolytica by partial cleavage of the BglII gene library of Y. lipolytica into the vector pLD40. This vector is characterized in that it holds a small segment containing the LEU2 region of Y. lipolytica and the restriction sites of the endonuclease 3EcoRI, 4EcoRV, 6AvaI, 1BgII, 1NcoI, 1ApaI, 1XhoI and 1BstXI. One of the Y. lipolytica XPR2 transformants was used to extract the wild-type gene (pLD84 and pLD86) from Y. lipolytica NRRL Y-1094 for use in the expression / isolation construction vector, as described in Example 1.

 Sequence analysis of the LEU2 gene.

 The DNA sequence analysis of the cloned LEU2 gene in pLD25 (European Application 0138508) was performed by chemical degradation (Mach et al., 1980, Methods Enzymol. 65, 499) on overlapping restriction fragments. Information on the amino acid sequence previously determined for the S. cerevisiae LEU2 gene (Andreadis et al., 1984, J. Biol. Chem. 259, 8059) was used to determine the site encoding beta-isopropylmalate (IPM) dehydrogenase and the correct reading frame. ) A portion of the genomic sequence of Y. lipolytica, which encodes an amino acid sequence homologous to a portion of the protein sequence of S. cerevisiae, has been identified. The nucleotide sequence of the LEU2 gene is 2.8 thousand bp. and the amino acid sequence of beta-IPM dehydrogenase deduced from the nucleotide sequence shown in Fig.10. In addition, the sequences required for expression of Y. lipolytica beta-IPM dehydrogenase are described here for the first time. The DNA sequence encoding this protein, consisting of 405 amino acids, contains 1215 base pairs (Figure 10). In addition to the sequence encoding beta-IPM dehydrogenase, approximately 798 bp were determined. 5'-flanking sequence and 797 bp 3'-flanking sequence, including the codon of the end of translation TAA). Analysis of these sites showed that they contain sequences similar to other eukaryotic promoters and terminators, and that they are essential for expression.

 The 5'-region of the LEU2 Y. lipolytica gene contains a TATATA sequence at a distance of 78 bp. before the start point of the broadcast and at a distance of 30 p. in front of the putative start point for mRNA formation. The second sequence, important for the initiation of transcription in eukaryotes, is the CAAT box, which is located at a distance of 74 bp in the LEU2 gene. in front of the proposed transcription initiation site located at -48 bp from ATG (Figure 10).

 The 3'-region downstream has a sequence of 72 to 120 nucleotides after the stop codon (TAA), homologous to the 5'-TAC .... TA (T) GT sequence. . . . . TTT-3 ', proposed by Zaret et al., Cell 28, 563 (1982), as important for terminating transcription in S. cerevisiae.

EXAMPLE 1
The host strain used was ATCC 20774 (MATB leu2-40 bio-6 xpr2-1002). The transformant XPR2, Y. lipolytica ATCC 20781 was defined as a colony forming a zone on indicator plates with skim milk after plating by imprinting on plates with a lack of leucine. Chromosomal DNA was obtained from the transformant according to the method of the application EP 0138508 and was used to extract the gene secreted protease. The chromosomal DNA was partially digested with the BglII enzyme, crosslinked to form a ring fragment containing the E. coli replicon and the ampicillin resistance gene from the vector, and used to transform E. coli. Chromosomal DNA was also digested with SalI and used in the Southern experiment, which showed that the normal LEU2 region of the transformant was not disturbed (520 bp SalI EcoRI segment of the LEU2 region at the 5'-position to the LEU2 segment contained in pLD40 was used as a test). Since homology is required for the integration of the library plasmid into Y. lipolytica, the XPR2 region must be an integration site. Three overlapping but different plasmids pLD57, pLD58 and pLD62 were originally extracted from Y. lipolytica ATCC 20781. They are depicted in Figure 1. Hybridization with synthetic oligonucleotide samples of the XPR2 gene based on the known sequence of the first 25 amino acid residues of the isolated active protease (FIGS. 2 and 3) showed that the protease isolation gene was cloned. To determine whether the extracted gene is a wild-type or mutant copy, the recipient strain Y. lipolytica was transformed with pLD58. Since no protease positive transformants arose from leucine-independent transformants, it was concluded that pLD58 contains a mutant gene allele.

 The XPR2 gene form present in the wild-type NRRL Y-1094 strain was obtained in an E. coli colony hybridization experiment. As a sample, a PvuI-EcoRI fragment of 2 thousand bp was used, which, as follows from the sequencing data, contains the complete structural gene. From the original Sau3A library of partially cleaved fragments, as described in EP 0138508, NRRL Y-1094 DNA in pLD40, several sample hybridization colonies were obtained. Two of these colonies contained very similar plasmids, designated pLD84 and pLD86, which were used to obtain expression vectors. Both plasmids contained the same 5 ′ end of the XPR2 region — the Sau3A site (which was attached and regenerated the BamHI site of the vector), from which the sequence in FIG. 3 begins. Each contains the entire structural protease gene and the putative transcriptional terminator, and includes approximately 4-5 thousand bp introduced from the XPR2 region of strain NRRL Y-1094. The inclusion in pLD86 additionally contains several hundred base pairs at the 3'-end. Since the 3'-chain to the BglII site (2655 base pairs) was used to construct the expression vector, the two plasmids transmit the same DNA, which is functionally identical to the sequence in FIG. 3.

 Construction of expression / isolation vectors. The plan, designed to obtain expression and isolation of prorennin in Y. lipolytica, involves the construction of various hybrid genes in an integrative cloning vector. A similar approach requires several different plasmids that contain extensive regions of common DNA sequences. In fact, a modulated design scheme was used to combine the vectors with the prorennin gene inserted at position 3 'of the predicted XPR2 site responsible for the signal peptide in front of the putative pro-1 processing site and cleavage site, a well-known active alkaline protease generator. In general, it is desirable that a foreign gene be introduced between yeast sequences for the promoter and expression terminator. It is clear that the N-terminal portion of the sequences of the hybrid gene will vary in different plasmid constructs, however, the sequence of the prorennin structural gene, the XPR2 terminator sequence and the DNA shuttle vector will be the same in each expression plasmid construct. It was anticipated that the same fragments of the prorennin structural gene and plasmid terminator / vector would be used in each expression plasmid construct as described below. Different constructions of plasmids for the expression / isolation of prorennin differ in the region immediately following the XPR2 promoter sequence with the length of the N-terminal sequence of the alkaline protease precursor that precedes the prorennin gene sequence. Therefore, the promoter fragment of each expression plasmid was constructed as a variable sequence in the XPR2-prorennin binding site. All expression / isolation vectors were collected by similar binding reactions containing three components.

 The experimental steps used to construct the pterm 4 terminator vector are depicted in FIG. 4. First, a synthetic binder was attached to a fragment containing the 3'-end of the XPR2 gene, including the end of transcription and polyadenylation signals. Briefly, plasmid pLD84 was digested with KpnI endonuclease and the synthetic double-stranded binding DNA shown in FIG. 4 was coupled. The binding product was digested with endonucleases HindIII and BglII and a fragment of 760 bp introduced into plasmid pLD41, linearized by the same two endonucleases to form pterm 4. Plasmid pterm 4 was identified by its restriction map. The results of a series of restriction endonuclease digestions were analyzed using EcoRV, EcoRI, KpnI, BglII-HindIII and BglII-BclI. Cleavages give suitable fragments confirming the presence of a synthetic binder and the “full” 3 ′ end of the XPR2 gene in the shuttle plasmid pLD41, as described in EP 0138508. A partial map of this 7.3 kb terminator vector shown in Fig.4.

Construction of an expression / isolation plasmid pLS-3. Figure 5 shows the construction of the original plasmid used to isolate prorennin in Y. lipolytica. Its restriction map is presented in figure 5. Construction of a plasmid for the isolation of prorennin was initiated by the preparation of a fragment containing most of the sequence of the structural gene for prorennin. A 1080 bp BclI-BamHI DNA fragment (partial) containing the coding sequence for 6-365 prorennin residues was isolated from the E. coli prorennin expression plasmid pPFZ-84A. (Plasmid pPFZ-84A is a derivative of the plasmid for the expression of prorennin pPFZ-R2, the construction of which is described in application EP 0147178, published July 3, 1985, and was obtained by site-specific mutagenesis using restriction fragment substitution. Specifically, pPFZ-84A differs from pPFZ -R2 only with two base pairs for the amino acid residues of prorennin 214 (Asn -> Asp) and 286 (Asp -> Gly) to encode the so-called prorennin allele A, however, both plasmids contain the necessary sequence for prorennin and are functionally equivalent in this Imere). A fragment of the XPR2 promoter containing the coding sequence for the alkaline protease precursor 1-157 and prorennin 1-5 was prepared as follows. A 870 bp HindIII-AvaI DNA fragment containing the promoter region and the 5'-end of the alkaline protease gene was isolated from the XPR2 subclone of plasmid pLD90. This fragment was associated with a synthetic fragment having the structure:
5 'CCGAGATTCCTGCTTCTTCTAATGCCAAGCGAGCTGAGATCACTAG 3'
3 'CTAAGGACGAAGAAGATTACGGTTCGCTCGACTCTAGTGATCCTAG 5'
reading direction ->
This sequence contains the “sticky” end of AvaI, followed by a sequence encoding the last nine amino acids of an alkaline protease propeptide, followed by a sequence encoding the first four amino acids of prorennin and ending at the BamHI site. A promoter fragment was obtained by a standard binding reaction using a synthetic fragment, a HindIII-AvaI fragment of 870 p. and T4 ligase, followed by cleavage of HindIII and BamHI. The resulting linked sequences were purified by polyacrylamide gel electrophoresis, isolating the corresponding 916 bp HindIII-BamHI DNA fragment. The 3'-end of the hybrid gene was obtained from the terminator plasmid / pterm 4 vector described above. Plasmid pterm 4 was digested with HindIII and BclI and approximately 7.3 thousand bp The HindIII-BclI terminator / DNA fragment of the vector containing the XPR2 terminator, a selective marker of LEU2 and pBR322, was isolated on an agarose gel.

The plasmid for expression / isolation of prorennin pLS-3 was collected by incubation of three DNA fragments (HindIII-BclI-cleaved plasmid pterm 4, HindIII-BamHI promoter of 916 bp and fragments containing the 1080 bp progennin BamHI-BclI gene) constructed as described above in the presence of a T4 ligase (see FIG. 5). The ligation mixture was used to transform E. coli K12 strain MM294 according to CaCl ₂ — the method of Dagert et al., Gene 6, 23-28 (1979). Plasmids were isolated from isolated ampicillin-resistant transformants, and plasmid pLS-3 was identified by its restriction map (Fig. 6A). The XPR2-prorennin site of this plasmid was sequenced to confirm the presence of the desired synthetic DNA sequence and the correct connection of the desired fragments.

 Obtaining pLD90. This plasmid contains a subclone of pLD84. The DNA site from the Pvul site in the XPR2 promoter site to the EcoRI site at the end site was subcloned into the HindIII pBR322 site according to the following procedure. Several micrograms of pLD84 was digested with the two aforementioned restriction enzymes. Then, the Klenow fragment of DNA polymerase I was introduced into the “sticky” ends of the cleaved DNA molecules. Then, HindIII kinase linkers (CAAGCTTG from New England Biolabs) were added to the ends using T4 ligase. Excess linkers were removed and sticky HindIII ends were generated, followed by digestion with the HindIII enzyme. The mixture of DNA molecules was separated on a preparative agarose gel, the desired group with a size of 2 thousand bp was separated, purified and introduced into the binding reaction with the HindIII-digested vector pBR322 treated with bacterial alkaline phosphatase. The binding product was used to transform competent E. coli. The orientation with the EcoRI site of the XPR2 terminator, closer to the EcoRI site pBR322, was named pLD90, and the reverse orientation was called pLD91.

 5 'The end of the XPR2 promoter site that was included in pLS-3 is the PvuI site, approximately 280 bp from the beginning of the region, the sequence of which is indicated in figure 3. It was found that plasmids containing the wild-type protease gene under the control of only this part of the promoter, when integrated into the genome at a site remote from the xpr2 resident locus, do not make the transformant able to produce large amounts of protease (determined from the explanation zones on skim milk plates; .

 It was found that when pLS-3 contains a shortened and therefore "insufficient" promoter, the integrant resulting from recombination between the plasmid and the wild-type XPR2 resident gene will form a complete promoter directing the expression of the prochymosin melting product, but insufficient, however, for expression of the protease. A similar experiment of the type of gene disintegration was performed with the actin gene of S. cerevisiae Shortle et al. (Science 217: 371-373, 1982). As expected, some leucine-independent transformants with pLS-3 were indeed deficient in protease. Protease deficient transformants were more likely needed integrants at the XPR2 locus than unwanted by-products, such as gene converters in leu2. With ATCC recipient strain 20638, it was found that undigested pLS-3 generated 6.5% of the psythease-deficient transformants, while the SnaBI-cleaved plasmid produced approximately 70% of the protease-deficient transformants. The aspect of gene disintegration during this transformation was used in order to avoid the need for a large number of Southern point experiments to find the right integrant among all transformants.

 Plasmids containing the wild-type protease structural gene under the control of the XPR2 promoter starting as indicated in FIG. 3 allow expression of a significant amount of the protease if integrated into Y. lipolytica cells at a site other than the xpr2 locus. However, for the efficient expression of foreign genes by this type of integrands, further modification of this control DNA site may be required.

Isolation of prorennin. Strain ATCC 20688 Y. lipolytica was transformed with undigested pLS-3 DNA and SnaBI-digested pLS-3 DNA to obtain xpr ^- leu ⁺ transformants ATCC 20775 (DL144) and ATCC 20776 (DL148), respectively. These transformed strains were plated in a test tube containing DEPD medium. Cells were grown overnight at 28 ^° C. An aliquot (250 μl) of these cultures was diluted 1: 100 in 25 ml of GLP medium. Cells were grown in a shake flask at 28 ^o C for 16-18 hours until the resulting absorption of 5.0-7.0 at 600 nm and were selected by centrifugation. The resulting culture fluid, or supernatant, was examined for the presence of prorennin by concentrating the supernatant and applying the concentrate to SDS-PAGE. The gel plate was electrophoretically transferred onto nitrocellulose paper in the presence of 20 mM Tris base, 150 mM glycine, 20% methanol at 500 m amp for 2 hours at 4 ^° C. Removal of the protein from the gel plate was checked by Coomassie blue staining.

Nitrocellulose paper was dried at 37 ^° C and calcined at 65 ^° C for 1 hour, then washed in TBS (200 mm NaCl, 50 mm Tris-HCl, pH 7.5). The paper was then incubated at room temperature for 30 minutes in TBS containing 10% horse serum (Gibco, Chagrin Falls, Ohio), followed by incubation in TBS and appropriate dilution of prorennin antibody for 16 hours at room temperature. The paper was then washed three times in TBS, followed by incubation in TBS containing 10% horse serum, followed by incubation for 2 hours in TBS containing 10% horse serum, and the appropriate dilution of goat anti-rabbit IgG antibody coupled with coastal ocellar peroxidase. The paper was then washed three times for 10 minutes in TBS and developed in the presence of 4-chloro-1-naphthol (3 mg / ml in methanol) added at a concentration of 0.5 mg / ml in TBS containing 0.01% hydrogen peroxide . The presence of 40,000 molecular weight prorennins was confirmed in both supernatants.

 After acid activation of concentrated culture supernatants (see above), a significant activity of milk coagulation was present in samples prepared from transformed cultures of ATCC 20775 and 20776 containing pLS-3. As expected, milk clotting activity was not detected in the supernatants of the control culture of the recipient strain of Y. lipolytica ATCC 20688.

 Construction of the expression / isolation plasmid pXX-33. A modification for converting pLS-3 into an improved expression plasmid pXX-33 is depicted in FIG. 6. Such a modification increases the XPR2 promoter region by 280 bp. As with pLS-3, the pXX-33 expression plasmid contains a fusion gene encoding the entire alkali protease prepropeptide (157 amino acid residues) attached to the complete structural gene sequence of prorennin.

Before constructing plasmids for expression / isolation of prorennin with a 280 bp XPR2 promoter sequence more than in pLS-3, it was necessary to subclone a restriction fragment containing the entire alkaline protease gene into the HindIII site. This subclone was assembled by adding synthetic linkers to a restriction fragment isolated from a clone of the XPR2 genomic library pLD86. The construction of this XPR2 subclone with the HindIII site toward 5 ′ was initiated by preparation of a DNA fragment containing the entire alkaline protease gene. 2.3 thousand bp fragment (partial) of EcoRI-BamHI from the genomic region of clone XPR2 pLD-86 was purified by agarose gel electrophoresis and ligated with a synthetic fragment having the sequence
5 'GATCGAAGCTTG 3'
3 'TTCGAACTTAA 5'
This linker sequence contains the sticky end of BamHI (but does not regenerate the BamHI site), followed by the HindIII site and followed by the sticky end of EcoRI. The ligated product was digested with HindIII and inserted into the pb322 site of HindIII. Plasmid pXHP-24 was identified by its restriction map and turned into a source of XPR2 promoter fragments for future expression constructs.

 In the plasmid pXHP-24, the subcloned XPR2 gene contains approximately 280 bp. more than 5 'of the XPR2 promoter sequence than the XPR2 promoter sequence contained in pLS-3. The first promoter fragment was obtained by the standard binding reaction of a synthetic DNA fragment (described above for pLS-3) and a 1150 bp HindIII-AvaI fragment. from pXHP-24 with T4 ligase followed by cleavage of HindIII and BamHI. The resulting linked sequences were purified by gel electrophoresis, isolating the HindIII-BamHI fragment from approximately 1196 bp A second fragment containing sequences encoding the amino acid residues of prorennin 6-151 was obtained from pLS-3 by cleavage of BamHI and XmaI and gel purification of the resulting 440 bp BamHI-XmaI DNA fragment. A third fragment containing the rest of the prorennin gene, the XPR2 terminator, and vector sequences were obtained from pLS-3 by cleavage of HindIII and Xmal and gel purification of a fragment of the HindIII-Xmal vector from approximately 8.0 kb. These three fragments were then ligated using the standard procedure described above. The ligation reaction was used to transform E. coli K12 strain MM294. Plasmids were isolated from transformants selected on the basis of ampicillin resistance, and plasmid pXX-33 was identified by its restriction map (Fig. 6). The protease-prorennin site of this plasmid was sequenced to confirm the correct connection of the desired fragments.

 Y. lipolytica ATCC 20774 was then transformed with SnaBI digested pXX-33 to obtain Y. lipolytica ATCC 20780, and prorennin isolated by transformed cultures into culture broth was analyzed as described above for pLS-3. The presence of prorennin in the culture supernatant was confirmed.

 After acid activation of concentrated culture supernatants (see above), significant coagulation activity was observed in samples prepared from a transformed culture of Y. lipolytica ATCC 20780.

EXAMPLE 2
The wild-type BIO gene corresponding to the bio-6 allele in ATCC 20774 was cloned by complementation as follows. A gene library of partially Sau3A-cleaved chromosomal DNA of Y. lipolytica was constructed, introduced into the BamHI site pLD40 (which is pBR322 plus LEU2 at the EcoRI site), and a large amount of library DNA was prepared as a plasmid preparation of a mixed culture of E. coli (This is the same library that was used to clone the XPR2 gene). Several micrograms of library DNA were digested with the ApaI enzyme (which cleaves one bond in the LEU2 region). This DNA was then used to transform ATCC 20774 (leu2 xpr2 bio), and the transformed mixtures were plated on synthetic medium lacking leucine. Tens of thousands of leucine-independent transformants were obtained. To detect colonies, if any, containing library plasmids including the BIO gene, leucine-independent transformants were imprinted on agar plates containing biotin-selective medium (formulation per liter: 25 mg of destibiotin, 20 g of glucose, 5 g of ammonium sulfate, 1 g KH ₂ PO ₄ , 0.5 mg MgSO ₄ • 7H ₂ O, 0.1 g CaCl ₂ , 0.1 g NaCl, 500 μg boric acid, 400 μg thiamine • Hcl, 400 μg ZnSO ₄ • 7H ₂ O , 400 μg MnSO ₄ • H ₂ O, 200 μg Na ₂ MoO ₄ • 2H ₂ O, 200 μg FeCl ₃ • 6H ₂ O, 100 μg KI and 40 μg CuSO ₄ • 5H ₂ O).

 One of several Y. lipolytica BIO transformants growing on a biotin-selective medium was named DL31. Then, the extraction of the “library” plasmid containing the BIO gene from Y. lipolytica DL31 strain was started. Chromosomal DNA was prepared from the culture of strain DL31. Several micrograms of this chromosomal DNA were digested with the ApaI restriction enzyme in order to excise the "library" plasmid. An aliquot of cleaved DNA was used in the binding reaction to lock an unknown library plasmid. The final product was then used to transform the E. coli culture towards ampicillin resistance by introducing an unknown BIO-containing plasmid into E. coli. A few ampicillin resistant E. coli transformants were obtained. On E. coli transformants, few plasmid preparations were prepared. Restriction cleavages of the plasmid DNA thus obtained show that the unknown BIO-containing plasmid was expected to be equivalent to pLD40 with the introduction of BamHI into the site. This plasmid was originally to be derived from the applicant's gene library and was named pLD51.

 Plasmid pLD56 was formed as a subclone of pLD51 by removing the LEU2 gene from pLD51 as follows. An aliquot of plasmid pLD51 was digested with EcoRI to remove the LEU2 site. Cleaved DNA was used in the DNA binding reaction to close the plasmid. Then, for cloning, E. coli was transformed with a smaller BIO-containing plasmid. One of the ampicillin-resistant transformants of E. coli, as shown, contained the expected smaller plasmid, which was named pLD56. Several restriction digests of pLD56 were performed. The BIO-containing pLD56 segment, which is detected as an insertion into the BamHI site of pBR322, has a length of approximately 3.6 thousand p. n

 A very rough restriction map of the insertion of Y. lipolytica DNA from 3.6 thousand bp in BamHI, the site pBR322 (including pLD56) is described below with the approximate distance in parentheses in base pairs from the start of the insertion in parentheses. The distance estimate was made from a few analyzes on agarose gels and, possibly, contains relatively large quantitative errors: PvuII (800), PvuII (1200), PstI (1800), MluI (2000), PstI (2300), EcoRV (2700), NcoI (3200) (For the SalI orientation, the pBR322 site will precede the sites described and the HindIII site will follow them).

 Strain ATCC 20774 (MATB leu2-40 bio-6 xpr2-1002) was transformed with intact pLD56 (pBR322 plus approximately 3.6 kb Y. lipolytica chromosomal DNA containing the BIO gene). Three different biotin-independent transformants were tested for high-frequency transformation of the NruI-cleaved (target for pBR322) pLD40 (LEU2 on pBR322) relative to the parent strain to determine which of them contained pBR322 resident integrated in the BIO region. All three showed the ability for high-frequency transformation due to the integration of pLD40 into the pBR322 resident. This has been confirmed by Southern point hybridization experiment. One of the three original BIO transformants of Y. lipolytica was named DL118 and was further used as a DNA recipient. This restriction map was required to establish: a) what to use as a BIO-specific hybridization sample (NcoI-PvuII region), b) which enzyme is required to correctly cut plasmid pLD56 (MluI), c) which enzyme cleaves only one bond in the region pBR322 (ClaI) and d) which enzyme does not cleave the plasmid at all (ApaI). Southern hybridization of ClaI and ApaI DNA digests from ATCC 20774 and DL118 (tested with a BIO fragment) showed that, as expected, the DL118 biotin site (when compared with the ATCC 20774 BIO site) was destroyed by the addition of DNA approximately equal in size pLD56. Mlul DL118 DNA digests (assay with pBR322) further showed that the supplement was the same size as intact pLD56.

 Construction of the plasmid expression / isolation of pLX-34. An expression plasmid was constructed that contains a sequence that encodes prorennin with XPR2 release signals (157 amino acid presequences) downstream from the LEU2 promoter. This expression plasmid demonstrates that a promoter other than XPR2 can be used to achieve the isolation of foreign proteins. In addition, this expression vector is capable of inducing expression / isolation, regardless of the integration site in the Y. lipolytica genome. The successful isolation of prorennin with a promoter other than the XPR2 promoter demonstrates the possibility of constructing an expression vector to identify alternative new strong promoters in Y. lipolytica. In addition, this approach can be used to obtain an expression culture with two separate hybrid prorennin genes (one expressed by the LEU2 promoter and the other by the XPR2 promoter) integrated at different sites of the host genome.

T4-лигазой с последующим расщеплением HindIII. Образующиеся связанные последовательности очищали гель-электрофорезом, выделяя фрагмент ДНК HindIII-BglI приблизительно из 360 п.ос. Второй составляющий фрагмент, кодирующий остальную часть препропоследовательности XPR2 и первые 152 аминокислоты прореннина, изолировали из плазмиды экспрессии рХХ-33 (Фиг.6) расщеплением BglI и XmaI и очисткой на геле образующегося фрагмента ДНК из 887 п. ос. Третий фрагмент, содержащий остальную часть гена прореннина, терминатор XPR2 и последовательности вектора, приготовляли расщеплением рХХ-33 HindIII и XmaI и очисткой на геле, выделяя приблизительно 8,5 тыс.п.н. фрагмента вектора. Три фрагмента ДНК лигировали при использовании стандартной методики, описанной выше. Реакцию лигирования использовали для трансформации штамма НВ101 Е. coli K12. Плазмиды изолировали из трансформантов, отобранных на основе устойчивости к ампициллину, и плазмиду pLX-34 идентифицировали по ее рестрикционной карте (фиг.11).The experimental steps used to construct an expression vector that contains a prorennin gene with alkaline protease release signals (157 amino acid XPR2 prepro sequence) expressed by LEU2 promoter sequences are depicted in FIG. 11. The construction of this plasmid was initiated by preparation of a fragment of the LEU2 promoter containing about 300 base pairs of the 5'-untranslated sequence preceding the codon of translation initiation ATG of the beta-isopropyl malate dehydrogenase gene (Figure 10). A 300 bp HindIII-FokI DNA fragment encoding a 270 bp region promoter sequence LEU2 was isolated from the shuttle vector pLD40. This fragment was ligated with a 54 bp synthetic linker having the sequence

T4 ligase followed by HindIII digestion. The resulting linked sequences were purified by gel electrophoresis, isolating a HindIII-BglI DNA fragment of approximately 360 bp The second constituent fragment encoding the rest of the XPR2 prepro sequence and the first 152 prorennin amino acids were isolated from the pXX-33 expression plasmid (Fig. 6) by digestion of BglI and XmaI and gel purification of the resulting DNA fragment from 887 bp. A third fragment containing the rest of the prorennin gene, the XPR2 terminator, and the vector sequences were prepared by digesting with pXX-33 of HindIII and XmaI and gel purification, isolating approximately 8.5 thousand bp. vector fragment. Three DNA fragments were ligated using the standard procedure described above. The ligation reaction was used to transform E. coli K12 strain HB101. Plasmids were isolated from transformants selected on the basis of resistance to ampicillin, and plasmid pLX-34 was identified by its restriction map (Fig. 11).

 Y. lipolytica ATCC 20794 (DL118) was transformed with NruI-digested pLX-34 DNA to obtain Y. lipolytica ATCC 20795 (DL251), and prorennin isolated into the culture fluid by leucine-independent culture transformants was analyzed as described above for pLS-3 . This transformation technique ensured the integration of pLX-34 into the pBR322 sequence previously introduced into the bio locus in the host chromosome (described above). The integration of pLX-34 into this site was confirmed by Southern analysis.

 Use of DL118 as a recipient. Southern hybridization experiments were performed as follows: NruI DNA digests from DL118 transformants (hybridized with a prochymosin probe, for example, when the incoming plasmid was a prochymosin expression plasmid) precisely cut out the introduced plasmid. Several nanograms of the NruI-cleaved transforming plasmid served to verify the correct size of the hybridizing band. Also, MluI digests (MluI do not cleave the transforming plasmid) DNA from these transformants (probe with a 32p-labeled pBR322) showed that the DL118 resident pBR322 sequence was destroyed by the addition of one or more transforming plasmid molecules. This shows that the integration has occurred in the desired site.

Transformative cultures of Y. lipolytica ATCC 20795 (DL251) were grown in DAND medium at 22 ^{° C.} to favor expression of the LEU2 promoter. The presence of prorennin in the culture supernatants was confirmed by an analysis of the coagulability of milk (see above) of acid-activated culture supernatants and was checked by immuno point analysis (see above). These results indicate that this fusion gene is an independent expression unit capable of expression / isolation when integrated into a site other than XPR2 or LEU2. This allows you to construct an expression culture with multiple hybrid genes that are potentially able to increase the level of extracellular prorennin.

EXAMPLE 3
The sequence of the synthetic gene for human C5a. The plan developed to achieve the bacterial production of human anaphylatoxin C5a was similar to the previous methods used for the synthesis and expression of EGF, as described in EP application 00147178. It used the construction of a gene in which the coding sequence for the activated additional component C5a was obtained synthetically. Knowing the amino acid sequence of human C5a, a DNA fragment was constructed encoding information for its 74 amino acids (Fig. 7). The synthetic gene sequence was chosen to maximize utilization of the preferred codon of E. coli and S. cerevisiae and provide several restriction sites with an endonuclease to facilitate determination. This approach allows direct expression of anaphylatoxin in E. coli by introducing an ATG initiation codon for protein synthesis before a triplet encoding the first amino acid of the C5a polypeptide. To facilitate its introduction in the desired orientation into the pBR322 plasmid, a synthetic C5a gene was constructed containing the recognition sites of restriction endonucleases EcoRI and HindIII at their ends. To obtain the final gene sequence of C5a, ten 47-mer were synthesized by the phosphoramidate method and joined into a double-stranded DNA fragment of 235 bp A C5a gene fragment was introduced into the correspondingly digested pBR322, and the cloned gene was identified by restriction analysis of plasmid DNA from randomly selected transformants. Several C5a clones were then analyzed by DNA sequencing to identify the clone with the correct sequence. The desired nucleotide sequence for the C5a gene region was found in 2 of the 5 studied clones.

 Bacterial expression of human C5a. The construction of the C5a expression plasmid was initiated by cleavage of the C5a subclone with an EcoRI restriction endonuclease followed by dephosphorylation by treatment with bacterial alkaline phosphatase. Using an EcoRI DNA fragment from pPFZ-R2 measuring 360 bp containing the trp promoter operator and the sequence of the ribosome binding site, a C5a expression plasmid was constructed. Competent cells of E. coli strain HB101 were transformed with a ligation reaction. Several drug resistant colonies from each transformation were purified and their plasmid DNAs were subjected to restriction endonuclease analysis to identify DNA with the trp promoter in the orientation that would be manifested in transcription of the C5a gene. Multiple isolates from this binding reaction were identified using plasmids containing the anaphylatoxin gene adjacent to the bacterial promoter sequence in the configuration required for direct expression of C5a. The restriction map of the expression plasmid C5a pC5a-48 is shown in Fig. 8.

Expression and isolation of human anaphylatoxin in Y. lipolytica
The expression / isolation vector pC5aX-3 encoding the isolation of human anaphylatoxin C5a was prepared according to the procedure described in Example 1 for pXX-33. Y. lipolytica ATCC 20774 was then transformed with this isolation vector, and human C5a produced by the transformed cultures was analyzed as described above, except that the goat anti-C5a and rabbit anti-goat IgG were used in the immuno point technique. For the plasmid described in this example, the presence of C5a in the culture supernatant was confirmed.

Construction of the expression plasmid / isolation of pC5aX-3
The experimental steps for constructing the plasmid for expression / isolation of anaphylatoxin pC5aX-3 are shown in FIG. 9. This plasmid contains the sequence for the “complete” XPR2 promoter and the 157 amino acid residue propeptide signal, attached to a synthetic sequence encoding 74 C5a amino acid residues. The design plan used for the pC5aX-3 was similar to that used for the pXX-33. First, the rXHP-24 plasmid (or another plasmid containing the desired sequence) was digested with HindIII and AvaI, and the 1150 bp fragment containing the XPR2 promoter was gel purified. A second fragment containing the 3 'end of the XPR2 propeptide and the sequence of the C5a structural gene was obtained by a standard ligation reaction using a HindI-HindIII DNA fragment of approximately 220 bp. from an expression plasmid of E. coli pC5a-48 synthetic fragment with the sequence:
5 'CCGAGATTCCTGCTTCTTCTAATGCCAAGCGA 3'
3 'CTAAGGACGAAGAAGATTACGGTTCGCTTGA 5'
and T4 ligases, followed by cleavage of AvaI and HindIII. The resulting linked sequences were purified by gel electrophoresis, selecting an AvaI-HindIII fragment of about 250 bp. The HindIII-AvaI fragment containing the promoter and the AvaI-HindIII fragment encoding C5a were then ligated with T4 ligase followed by HindIII cleavage. A fragment of approximately 1.4 thousand bp gel purified and used for ligation with HindIII-digested pterm4 (described above). The ligation reaction product was used to transform E. coli K12 strain MM294. Plasmids selected for ampicillin resistance were isolated from the selected transformants and the plasmid pC5aX-3 was identified by its restriction map. Strain Y. lipolytica PC-30869, ATCC 20774 was then transformed with SnaBI-digested pC5aX-3, and anaphylatoxin isolated into the culture medium by transformed cultures was analyzed as described above. The presence of C5a in the culture supernatant was confirmed by the method described above.

 It is known that many proteins that are synthesized by ribosomes linked to the endoplasmic reticulum are produced as glycoproteins. Indeed, glycosylation may affect the release of this protein. N-linked glycosylation of eukaryotic proteins occurs in the tripeptide sequences asparagine-X-threonine and asparagine-X-serine, where X can be any amino acid except possibly asparagine (Hubbard, S. et al. 1981, Ann. Rev. Biochem. 50; 555). The amino acid sequence of prorennin includes two such tripeptide sequences, however, gel electrophoretic analysis of prorennin secreted in Y. lipolytica cultures does not show the presence of glycosylation. In other secreted eukaryotic proteins, not all asparagine-X-threonine / serine sites are glycosylated. Apparently, certain asparagines in the tripeptide sequences are not glycosylated, since they are not available to the corresponding enzymes.

 In the case of human C5a, the amino acid sequence includes a single glycosylation site, or tripeptide sequence (Asn-Ile-Ser), which usually contains a complex oligosaccharide attached to asparagine (Fernandez, H. et al. 1976, J. Immunol. 117, 1688). Part of the C5a molecules secreted into the culture medium of Y. lipolytica seems to be glycosylated, since a wide region of antigenic activity is observed in the high molecular weight part of the immuno point analysis. This heterogeneous electrophoretic mobility is similar to that observed for other secreted proteins and is probably due to differences in the degree of carbohydrate addition. In the present invention, the apparent glycosylation of certain secreted foreign proteins suggests that the expression and secretion of Y. lipolytica will be useful in the production of many commonly glycosylated eukaryotic proteins.

Claims (6)

1. The nucleotide sequence of the LEU2 gene of Yarrowia lipolytica, encoding beta-isopropyl malate dehydrogenase: (see graphic part),
used in the expression of heterologous proteins. 2. The coding sequence of the LEU2 gene of Yarrowia lipolytica: (see graphic part),
used in the expression of heterologous proteins. 3. The nucleotide sequence of the promoter of the LEU2 gene of Yarrowia lipolytica: (see graphic part),
4. The nucleotide sequence of the LEU2 gene terminator Yarrowia lipolytica: (see graphic part),
5. Recombinant DNA material containing the nucleotide sequence described in any one of claims 1 to 4, and the nucleotide sequence of the prorennin gene.  6. Recombinant DNA material containing the nucleotide sequence described in any one of claims 1 to 4, and the nucleotide sequence of the human anaphylatoxin C5a gene.  7. The yeast strain Yarrowia lipolytica, transformed with the recombinant DNA material described in paragraph 5, and capable of producing prorennin.  8. The yeast strain Yarrowia lipolytica, transformed with the recombinant DNA material described in claim 6, and capable of producing human anaphylatoxin C5a.

Images