RU2198219C2 - Dna fragment preparing from arabidopsis thaliana, its subfragment or combination of subfragments, sequence of chimeric dna and its usage, replicon (versions) - Google Patents

Abstract

FIELD: molecular biology, genetic engineering. SUBSTANCE: incorporation of promoter DNA fragments able to stimulate nematode-induced nodular-root and cystophorous transcription DNA sequences bound with their in plant allows to confer resistance against nematodes for wide spectrum of plants again. These DNA fragments can be used in agriculture. EFFECT: valuable properties of DNA fragments. 16 cl, 8 dwg, 4 tbl, 10 ex

Description

 The invention relates to regulatory DNA sequences that can be used to express DNA sequences in plant cells. The present invention also relates to chimeric DNA comprising said regulatory DNA sequences operably linked to DNA expressed in plant cells, as well as to plants containing such chimeric DNA in their cells. Further, the invention relates to methods for producing plants that are resistant or at least susceptible to plant parasitic nematodes or their action, as well as to cells, plants and their parts.

 International patent application WO 92/17054 describes a method for identifying and subsequently isolating nematode-responsive DNA regulatory sequences from Arabidopsis thaliana.

 In accordance with WO 92/21757, several regulatory DNA sequences were isolated from Lycopersicon esculentum that respond to the nodular-root nematode Meloidogyne incognita.

 Some of these regulatory sequences (LEMMI's for Lycopersicon esculentum - Meloidogyne incognita) are stimulated, while others are suppressed by the nematode. It is not known whether any of the induced regulatory sequences are stimulated by a wider range of nematodes.

 Another regulatory sequence induced by the nodular-root nematode Meloidogyne incognita is described in WO 93/06710. The disadvantage of this regulatory sequence of TobRb7 is that it is not activated by a number of cystic nematodes, including the species Heterodera and Globodera. This makes the TobRB7 sequence unsuitable for use in chimeric constructs intended, for example, to impart cystic nematode resistance to potatoes.

 The aim of this invention is to obtain regulatory DNA sequences that can be induced by both cystic and nodular root nematodes and which can be used to express foreign DNA sequences under their control within the nematode’s nutritional structure, preferably, but not necessarily, substantially site-specific way.

 The present invention provides a DNA fragment derived from Arabidopsis thaliana that is capable of stimulating nodular-root and cystic nematode-induced transcription of an associated DNA sequence when reintroduced into a plant. In accordance with the present invention, sequences represented by nucleotides 1-2163 in SEQ ID No: 4 are preferred. Also provided are parts or variants of the DNA fragment of this invention, capable of stimulating nodular-root and cystic nematode-induced transcription of the associated DNA sequence upon re-introduction into the plant. Another preferred aspect of the present invention includes a regulatory DNA fragment that is essentially site-specific for nematode nutrition.

 Other embodiments of the invention relate to chimeric DNA sequences comprising, in the direction of transcription, the regulatory DNA fragment of the invention and the DNA sequence expressed under its transcriptional control, naturally not under the transcriptional control of said DNA fragment. Preferred among the chimeric DNA sequences of the present invention are those in which the expressed DNA sequence causes the production of a plant cell disrupting substance such as barnase. In a further embodiment of the invention, the plant cell disrupting substance comprises RNA complementary to RNA necessary for cell viability. In a further embodiment of the invention, the expressed DNA sequence causes the production of a substance that is toxic to the inducing nematode.

 Further, the present invention relates to the use in a replicon comprising a microorganism of DNA containing such a replicon, as well as plant cells incorporating in their genome the chimeric DNA sequence of the present invention. Further useful embodiments of the invention relate to the root system of a plant essentially consisting of cells in accordance with this invention, as well as to adult plants essentially consisting of cells in accordance with this invention, preferably a dicotyledonous plant, more preferably a potato plant to the plant. Also provided are plants whose root system is grafted in accordance with this invention, as well as parts of plants, including seeds, flowers, tubers, roots, leaves, fruits, pollen and wood, as well as crops including such plants.

 The present invention also includes the use of a DNA fragment of the invention to identify sub-fragments capable of stimulating the transcription of an associated DNA sequence in a plant. Also contemplated is the use of a chimeric DNA sequence of the invention for transforming plants. Further, the present invention provides for the use of a fragment, part or variant of regulatory DNA in accordance with this invention to obtain hybrid sequences of regulatory DNA.

 The following drawings illustrate the invention.

 Figure 1. Schematic plasmid map of the binary vector pMOG 23.

 Figure 2. Schematic plasmid map of the binary vector pMOG 800.

 Figure 3. Schematic plasmid map of the binary vector pMOG 553.

 Figure 4. Schematic plasmid map of the binary vector pMPG 819.

 Figure 5. Schematic plasmid map of the binary vector pMOG 849.

 6. Expression profiles outside the nematode feeding sites of several transformed lines of Arabidopsis thaliana pMOG 849.

 FIG. 7. Schematic representation of a gene that destroys and neutralizes a nematode feeding site in a two-component system for constructing plants resistant to nematodes.

 Fig. 8. Schematic plasmid map of the binary vector pMDG 893.

 Some methods of implementing the present invention, as well as the meanings of various expressions, are described in more detail below.

 The present invention relates to regulatory DNA sequences that can be obtained from Arabidopsis thaliana, induced by nodular-root and cystic nematodes, very preferably expressing any associated DNA within special nematode nutritional structures of the plant root. Such a nematode feeding structure is used by the invading nematode as a food source, while the nematode induces a change in plant tissue, forming either a giant cell (nodular-root nematodes) or syncytium (cystic nematodes). A method for isolating regulatory DNA sequences has been described and claimed in the previous application, WO 92/17054, incorporated herein by reference.

 In principle, the regulatory DNA sequences of the invention can be used to express any foreign DNA in any selected plant by placing said DNA under the control of said regulatory DNA sequences and transforming the plants with the resulting chimeric DNA sequence using known methods. Foreign DNA is expressed by root infection with various nodular-root nematodes, such as Meloidogyne incognita, and cystic nematodes, such as Heterodera schachtii and Globodera pallida (a more detailed, but in no way limiting list is presented in Table 2). Foreign DNA can advantageously consist of a gene encoding a substance that is toxic or inhibitory to a plant parasitic nematode to produce plants with reduced susceptibility to plant parasitic nematodes. Numerous examples of such toxic substances exist, such as endotoxins of Bacillus thuringiensis (e.g., EP 0352052), lectins, and the like.

 A more preferred approach for obtaining plants with reduced susceptibility to plant parasitic nematodes is to destroy the specialized nutritional structure of plant roots by expressing a phytotoxic substance under the control of regulatory DNA sequences in accordance with this invention. The general principles of this approach have been described and claimed in International Patent Applications WO 92/21757, WO 93/10251 and WO 94/10320, incorporated herein by reference. For the sequence, a phytotoxic substance will hereinafter be referred to as a substance that destroys the nematode feeding site (NFS).

 Although the regulatory DNA sequences of this invention are essentially specific for the nematode nutritional structure, possibly due to expression in non-target (i.e., non-NFS) tissue, substances that destroy the nematode nutritional site under their control do the opposite effect on the viability and / or crop of plants. Moreover, it was found that the regulatory DNA sequences in accordance with this invention are active during the tissue culture phase in the transformation procedure, necessitating the use of a neutralizing agent during this phase. Therefore, in order to reduce or eliminate the (potential) side effect, it is highly preferable to use a chimeric construct that destroys the nematode feeding site in accordance with this invention in combination with a neutralizing gene construct. Details of the so-called two-component nematode-resistant plant construction approach are described in WO 93/10251. According to this approach, a compound that destroys a nematode feeding site (coding sequence A) is placed under the control of a promoter that is at least active at the nematode feeding site and preferably inactive or slightly active outside the specified site, while an undesirable phytotoxic effect outside the nematode feeding the site is neutralized with a neutralizing compound (coding sequence B), expressed at least in those tissues where the destructive substance is produced, except The nematode feeding site.

 According to a two-component approach, a suitable promoter A is defined as a promoter directing the expression of the direct coding sequence within the nematode feeding site at a level sufficient to impair the metabolism and / or functioning and / or viability of the nematode feeding site, while this promoter should be preferred, but not necessarily inactive in tissues outside the specified site; at least, it should not be active outside the nematode feeding site at such a level that the activity of the destructive substance encoded by coding sequence A cannot be sufficiently neutralized by the products of coding sequence B.

 Properties of regulatory DNA sequences in accordance with this invention, in particular fragments 4, 2.1 and 1.5, etc. # 1164, make them extremely useful in a two-component approach, as the following Examples show. Obviously, in regulatory DNA sequences in accordance with this invention, numerous mutations are possible, such as deletions, additions and changes in the nucleotide sequence and / or combinations thereof, which do not alter the properties of these sequences in such a way as to be important for their intended use. Therefore, such mutations are included in the scope of the present invention.

 Moreover, as is well known to those skilled in the art, the regulatory regions of plant genes consist of various sub-regions with interesting properties in terms of gene expression. Examples of sub-sites in this description are enhancers, as well as "silencers" of transcription. These elements can act in a general (constitutive) way or in a tissue-specific way. As shown in the examples, some deletions can be carried out in regulatory DNA sequences in accordance with this invention, and sub-fragments can be examined for expression profiles of associated DNA. Various sub-fragments thus obtained, or even combinations thereof, may prove useful in constructing nematode resistance or in other uses including the expression of foreign DNA in plants. The use of DNA sequences in accordance with this invention to identify functional sub-regions and their subsequent use to stimulate or suppress gene expression in plants is also within the scope of the present invention.

 In the context of the present invention, the terms “nematode feeding site depleting substance” and “neutralizing substance” encompass a series of selected compounds encoded by DNA whose gene products (protein or RNA or antisense RNA) are harmful to metabolism and / or functioning and / or the viability of the nematode feeding site or its organelles. Known substances that neutralize such compounds that are capable of simultaneously suppressing the activity of the latter, while expressing in the same cell as a destructive substance. Preferred combinations of destructive and neutralizing agents are, for example, barnase / barstar from Bacillus amyloliquefaciens (Hartley, 1988, J. Mol. Biol. 202, 913-915), restriction endonucleases / corresponding methylases, such as EcoRI from E. coli (Green et al., 1981, J. Biol. Chem. 256, 2143-2153) and EcoRI methylases or similar combinations as described in the review of restriction modification systems, type II (Wilson, 1991, Nucl. Acid Res. 19, 2539-2566 ), bacteriocins, and corresponding immune proteins, for example, colicin E3 / immunity protein from E. coli (Lau et al. 1985, Nucl. Acid Res. 12, 8733-8745), or any gene encoding destructive a substance that can be neutralized by simultaneously producing desensitizing RNA under the control of promoter B, such as DNA sequences encoding a diphtheria toxin chain A (Czako & An, 1991, Plant Physiol. 95, 687-692), to RNases such as RNase T1, ribonucleases or proteases and ribozymes against mRNA encoding phytotoxic proteins.

 In accordance with another aspect of the present invention, combinations of destructive and neutralizing substances respectively comprise genes that inhibit an endogenous gene encoding a protein or polypeptide product necessary for cell viability, and, as a neutralizing gene, a gene encoding a protein or polypeptide product capable of replace the function of an endogenous protein or polypetid product. Such destructive genes can be selected from the group consisting of (a) genes encoding ribozymes against an endogenous RNA transcript, (b) genes that, when transcribed, produce RNA transcripts that are complementary or at least partially complementary to RNA transcripts of the endogenous genes required for cell viability, a method known as desensitizing inhibition of gene expression (described in EP-A 240208), or (c) genes that, when transcribed, produce RNA transcripts that are identical or at least At least very similar to the transcripts of endogenous genes necessary for cell viability, there is still an unknown method of inhibiting gene expression called cosuppression (described by Napoli C. et al., 1990, The Plant Cell 2, 279-289).

 In a preferred embodiment of the invention, desensitizing genes are used to inhibit the expression of endogenous genes necessary for cell viability, wherein these genes are expressed in nematode nutritional structures using the regulatory DNA sequences of the invention fused in the opposite direction to the indicated desensitizing gene.

 The destructive effect caused by the desensitizing gene, which is an inhibitor for the vital endogenous gene, is neutralized by expression of the neutralizing compound B, the expression being under the control of promoter B as described, and said compound B is a protein or polypeptide product that is identical or similar to a protein or a polypeptide encoded by an endogenous vital gene and capable of replacing the function of an endogenous gene product in a host plant. Preferably, the nucleotide sequence of the RNA transcript encoded by the neutralizing gene is divergent with the endogenous vital transcript of the RNA gene in order to avoid a possible cosuppressive effect. Therefore, it is preferable that the neutralizing gene encodes a protein or polypeptide with essentially the same function as the endogenous vital gene, but through an intermediate divergent RNA transcript; neutralizing genes that meet this description can be obtained by screening a database for genes derived from various plant species or even from various non-plant species such as yeast, animal eukaryotes, or prokaryotes. Preferably, the nucleotide sequence identity of the transcripts encoded by the destructive desensitizing transgene and the neutralizing sensitizing transgene is less than 90%, preferably less than 80%, even more preferably said neutralizing sensitizing transgene encodes a protein or polypeptide gene product whose amino acid sequence is not identical to the sequence of the destroyed gene product, the identity of the transcripto nucleotide sequence Encoded by the neutralizing transgene is less than 75%.

 The target genes for desensitizing destructive genes are selected from genes encoding the enzymes necessary for cell viability, also called housekeeping enzymes, the core of which should preferably be encoded as single-copy genes, although a small gene family is also suitable for the purpose of the invention . Moreover, the effect of desensitizing expression of these genes should not be nullified by diffusion or translocation from other cells or organelles of enzyme products usually synthesized by such enzymes. Preferably, genes encoding membrane translocating enzymes are chosen because they are involved in establishing chemical gradients across organelle membranes. The inhibition of such proteins as a result of desensitizing expression, by definition, cannot be prevented by the diffusion of substrates across the membrane in which these proteins are located. The translocated compound is not limited to organic molecules, it can also be of an inorganic nature, for example P, H, OH, or electrons.

 Preferably, membrane-translocated enzymes should be present in organelles, the number of which increases during parasitism, thereby showing the important role of such organelles in cells, including a nematode feeding site. Specific examples of such organelles include mitochondria, endoplasmic reticulum, and plasmodesma (Hussey et al., 1992 Protoplasma 167; 55-65, Magmusson & Golinowski 1991 Can. J. Botany 69; 44-52). The list of target enzymes is shown in Table 1 as an example, however, the invention is not limited to the enzymes included in this table. More detailed lists are given in series such as Biochemistry of Plants (Eds. Stumpf & Conn, 1988-1991, Vols. 1-16 Academic Press) or Encyclopedia of Plant Physiology (New Series, 1976, Springer-Verlag, Berlin).

 The genes encoding these enzymes were isolated in only a few cases, so the number of gene copies is unknown, the necessary criteria are described in this invention.

 Suitable promoter B means a promoter directing expression in essentially all cells in which the coding sequence A is expressed, provided that it does not direct expression within the nematode nutritional structure or is ineffective. (The expression "essentially all cells" means at least those cells that must be viable for normal plant growth and / or development necessary for the commercial use of such plants.) An example of plants in which the destructive effect is not neutralized in literally all the cells of the host plant and which are nevertheless viable and suitable for commercial use, are plants expressing the destructive gene of the invention in stamen cells; this can lead to the formation of male sterile plants, which is even considered a commercially attractive property of some crops. Suitable type B promoter samples can be obtained from plants or plant viruses, or can be chemically synthesized. Regulatory sequences may also include enhancer sequences, for example, those present in the 35S promoter of cauliflower mosaic virus (Kau et al., 1987, Science, 236, 1299-1302), and mRNA stabilizing sequences, such as Alfalfa PHK4 mosaic virus leader sequences (Brederobe et al., 1980, Nucl. Acids Res. 8, 2213-2223) or any other sequences functioning in a similar manner.

 Alternatively, to ensure expression in all or almost all plant tissues, promoter B / coding sequence B may be complemented by a second promoter B 'coding sequence B having an expression configuration partially overlapping or fully complementary to the B / coding sequence B promoter, provided that that neither promoter B nor promoter B ′ direct expression at the nematode feeding site. Hybrid promoters, including various promoters (parts thereof), connected to provide the desired expression configuration in accordance with this description, are also included in the scope of the present invention.

 Preferably, promoter B is a 35S promoter of cauliflower mosaic virus or its derivatives, which is generally considered a strong constitutive promoter in plant tissues (Odell et al. 1985 Nature 313, 810-812). Another preferred example of promoter B is the strong root promoter rolD (Leach & Aoyagi 1991 Plant Sci. 19, 69-76) from plasmid pRia4 Agrobacterium rhizogenes; 5 'ORF15 flanking portion (Slighton et al., 1986, J. Biol. Chem. 261, 108-121). The suitability of other constitutive promoters, such as the nopaline synthase promoter (Bevan, 1984, Nucl. Acids Ees. 12, 8711-8721) or the noric mosaic virus promoter (EP-A 426641) for use as promoter B can be determined by fusion with genes -markers, such as GUS (Jefferson, 1987, Plant Mol. Biol. Reporter 5, 387-405), transferring these constructs to plants and histochemical analysis of such transgenic plants after PPN infection.

 Other regulatory sequences, such as termination sequences and polyadenylation signals, include any sequences that have the same effect on plants, their choice depends on the level of specialist in this field. An example of such sequences is the flanking region of the 3 ′ gene of nopalin synthase (nos) Agrobacterium tumefaciens (Bevan, 1984, Nucl. Acids Res. 12, 8711-8721).

 Further details of the two-component approach can be found in WO 93/10251 (incorporated herein by reference).

 The choice of plant species is primarily determined by the amount of damage after PPN infection caused to agriculture and the susceptibility of plant species to transformation. Plant births that suffer from PPN and which may become significantly less susceptible to PPN when using the present invention include, but are not limited to, the births listed in Table 2.

 Types of nematodes in the context of this invention include all plant-parasitic nematodes that modify host cells in special feeding structures from migratory ectoparasites (e.g. Xiphiniema spp.) To more commonly settled sedentary endoparasites (e.g. Heteroderidae, Meloidogynae or Rotylenchulinae). The list of parasitic nematodes is shown in Table 2, however, the present invention is not limited to the species included in this table. More detailed listings are provided by Zuckerman et al. (eds., in: Plant Parasitic Nematodes, Vol. I 1971, Hew York, pp. 139-162).

 In the context of this invention, a plant with a reduced susceptibility to plant parasitic nematodes (PPN) is considered a plant with a statistically significant decrease in the number of adult female individuals on the surface of the plant roots when compared with control plants. A susceptibility / resistance classification according to the number of maturing females is standard practice for both cystic and nodular root nematodes (e.g. LaMondia, 1991, Plant Disease 75, 453-454; Omwega et al., 1990, Phytopathol. 80, 745-748).

 The nematode nutritional structure in accordance with this invention includes an initial nutritional cell, i.e. a cell, or a very limited number of cells, which are destined to become a nematode feeding structure after inducing an invading nematode.

 The destructive effect of the nematode feeding site in accordance with this invention is not limited to the side effects only on the nematode feeding site; It also implies a destructive effect on the development of nematodes through direct interaction.

 There are several ways of introducing recombinant DNA containing DNA sequences into host plants, as described in this invention. Such methods include, but are not limited to, transforming protoplasts using the calcium / polyethylene glycol method, electroporation and microinjection, or particle bombardment (coated) (Potrykus, 1990, Bio / Technol. 8, 535-542).

 In addition to these so-called direct DNA transformation methods, vector transformation systems such as viral vectors (e.g., from cauliflower mosaic virus) and bacterial vectors (e.g., from the genus Agrobacterium) are widely used (Potrykus, 1990, Bio / Technol. 8 535-542). After selection and / or screening, transformed protoplasts, cells or parts of plants can be regenerated into whole plants using known methods (Horsch et al., 1985, Science 225, 1229-1231). The choice of transformation and / or regeneration methods is not relevant for the present invention.

 According to a preferred embodiment of the present invention, a so-called binary vector system (described in EP-A 120516) is used using Agrobacterium strains containing a helper plasmid with virulence genes and a compatible plasmid, a binary vector containing a gene transfer construct. This vector can replicate in both E. coli and Agrobacterium; the vector used in this case is obtained from the binary vector Bin19 (Bevan., 1984, Nucl. Acids Res. 12, 8711-8721). The binary vectors used in this example contain between the right and left T-DNA border sequences the identical NPTII gene encoding kanamycin resistance (Bevan, 1984, Nucl. Acids Res. 12, 8711-8721) and a multiple cloning site for cloning to desired gene constructs.

 Recent scientific studies show that, in principle, monocotyledonous plants can be transformed and that fertile transgenic plants can be regenerated from transformed cells. The development of reproducible cultural systems for these cultures, together with effective methods of introducing genetic material into plant cells, facilitates transformation. Currently, preferred methods for transforming monocotyledonous plants are micronucleating bombardment of explants or suspended cells and direct DNA uptake or electroporation (Shimamoto, et al., 1989, Nature 338, 274-276). Transgenic corn plants are obtained by introducing the Streptomyces hygroscopicus barrier gene encoding phosphinotricin acetyltransferase (an enzyme that inactivates the phosphinotricin herbicide) into embryogenic cells of a suspended corn culture using microparticle bombardment (Gordon-Kamm, 1990, Plant Cell, 2, 603. The introduction of genetic material into aleuron protoplasts of other monocotyledonous crops such as wheat and oats has been described (Lee, 1989, Plant Mol. Biol. 13, 21-30). Wheat plants are regenerated from an embryogenic suspended culture by selecting only old, compact and nodular embryogenic corn tissues for planting embryogenic suspended cultures (Vasil, 1990, Bio / Technol. 8, 429-434). Recently, a method for transforming rice using Agrobacterium (WO 95/16031) has also been described. The combination of transformation systems for these crops makes it possible to apply the present invention to monocotyledonous plants. These methods can also be used to transform and regenerate dicotyledonous plants.

 The following examples are intended to be illustrative only and not to limit the scope of this invention.

EXPERIMENTAL PART
DNA treatments
All DNA procedures are carried out in accordance with standard methods described in Maniatis (Molecular Cloning, A Laboratory Manual 2nd Edition, Cold Spring Harbor Laboratory, 1990).

Transformation of Arabidopsis
Transformation is carried out using co-cultivation of Arabidopsis thaliana root segments (ecotype C24) and an Agrobacterium strain MOG101 containing a suitable binary vector as described by Valvekens et al. (1988, Proc. Nat. Acad. Sci. USA 85, 5536-5540), as follows:
Arabidopsis seeds are vernalized for 7 days at 4 ^{° C.} until germination. Seeds are surface sterilized for 2 minutes in 70% EtOH, transferred to 5% NaOCl / 0.5% NaDodSO ₄ for 15 minutes, washed 5 times with sterile distilled water and placed in 150x25 mm Petri dishes containing germination medium (GM ) (Table 3). Petri dishes are sealed with gas-tight medical tape (Urgopore, Chenove France). Plants are grown at 22 ^o C, using the following cycle: 16 hours in the light and 8 hours in the dark. The same room conditions for growing are used for tissue culture procedures. All plant media are buffered with 2- (N-morpholino) ethanesulfonic acid at 0.5 g / L (pH 5.7: use 1 M KOH), fixed with 0.8% Difco Bacto agar and autoclaved at 121 ^o C for 15 minutes. Hormones and antibiotics are dissolved in dimethyl sulfoxide and water, respectively, and added to the medium after sterilization in an autoclave and cooling to 65 ^o C.

 Intact roots are incubated for 3 days on a fixed 0.5 / 0.05 medium (table 3). Then the roots are crushed into small pieces of approximately 0.5 cm in size (hereinafter referred to as “root explants”) and transferred into 10 ml of a liquid medium of 0.5 / 0.05; add 0.5-1.0 ml daily culture of Agrobacterium. Root explants and bacteria are mixed by gentle shaking for approximately 2 minutes.

Root explants are then blotted onto sterile filter paper to remove most of the liquid medium and cultivated for 48 hours on 0.5 / 0.05 agar. Then the explants are washed in a 0.5 / 0.05 liquid medium containing 1000 mg of vancomycin (Sigma) per liter. The pieces are blotted and then incubated on 0.15 / 5 agar (Table 3), supplemented with 750 mg of vancomycin and 50 mg of kanamycin per liter. Three weeks after infection with agrobacteria containing a chimeric neogen, green, kanamycin-resistant calli (Km ^R ) form against the background of yellowish root explants. At this stage, the root grafts are transferred to fresh 0.15 / 5 agar containing only 500 mg of vancomycin and 50 mg of kanamycin per liter. Three weeks later, most of the green calluses form shoots. Transformed shoots are transferred to 150x25 mm Petri dishes containing germination medium to obtain roots or seeds, or both. In these Petri dishes, many regenerants form seeds without root formation. The roots of the plant can also be transferred to the soil to obtain seeds. The starting root material is prepared as follows: 6 sterilized Arabidopsis thaliana C24 seeds are germinated in 50 ml of germination medium (250 ml Elenmeyer flask) in a rotary shaker (100 rpm) in a growing room for 9 days with dim lighting. Transgenic plants are regenerated from shoots grown on a selection medium (50 mg / l kanamycin), cause root formation and transferred to germination medium or soil.

Potato transformation
To transform Solanum tuberosum var. Kardal use the protocol described by Hoekema et al. 1989 Bio / Technology 7, 273-278, with some modifications.

The peeled, surface-sterilized potato tubers are cut into 2 mm slices. Circles 1 cm in diameter are cut along the circumference of the slices. The slices are collected in WM (Murashige & Skoog medium) containing 1 mg / L thiamine HCl, 0.5 mg / L pyridoxine HCl, 0.5 mg / L nicotinic acid, 100 mg / L myo-inositol, 30 g / l sucrose, 0.5 g / l MES pH 5.8). Inoculate with the strain Agrobacterium tumefaciens EHA105 (Hood et al. 1993 Transgenic Research 2, 208-218), replacing WM with 100 ml of fresh WM containing a resuspended pellet 10 ml of Agrobacterium culture freshly grown in LB + corresponding antibiotic to OD ₆₀₀ 0.5-0-0 , 7. After incubation of the tuberous circles for 20 minutes in a bacterial suspension, they are transferred to fixed CM (WM supplemented with 8 g / l agar, 3.5 mg / l zeatin riboside, 0.03 mg / l indoleacetic acid) at a density of 20 explants per cup Petrie. After 2 days, the mugs were transferred to PM (CM supplemented with 200 mg / L cefotaxime, 100 mg / L vancomycin) for selection against Agrobacteria. After 3 days, the mugs are transferred to plates with medium that induces shoots (SM supplemented with 250 mg / L carbenicillin, 100 mg / L kanamycin) at a density of 10 explants per Petri dish to select for regeneration of the transformed shoots. After 2 weeks, the tissue circles are transferred to fresh shoot-inducing medium, and after another 3 weeks they are transferred to SEM (SIM with 10 x lower hormone concentration). After 8-9 weeks after co-cultivation, the shoots are large enough to cut them off from the callus tissue and transfer to glass tubes (Sigma, Cat. Nr. C5916) containing 10 ml of RM (WM containing 0.5 x MS salt, 0, 5 x vitamins, 10 g / l sucrose, 100 mg / l cefotaxime, 50 mg / l vancomycin and 50 mg / l kanamycin) for in vitro root formation and vegetative propagation.

Nematode management, cultivation and infection of plant roots
The surface of Arabidopsis seeds is sterilized and then seeded in Petri dishes (diameter 9 cm) on B5 medium containing 20 g / l glucose and 20 mg / l kanamycin. After 3 days at 4 ^{° C., the} plates are incubated for 2 weeks in a growth chamber at 22 ^{° C.} and the following cycle: 16 hours in the light and 8 hours in the dark. Kanamycin-resistant plants are then transferred to earth-filled translucent plastic tubes (30x15x120 mm, Kelder plastibox bv, the Netherlands). The tubes are placed at an angle of 60 ^o to the vertical axis so that the roots grow on the underside of the tubers. This allows you to visually monitor the infection process and facilitates the removal of the root system from the soil for GUS analysis. After another 2 weeks, infection is carried out by injecting a suspension containing 500 second stage Heterodera schachtii larvae (in 3 ml H ₂ O) onto the root system or 300 second stage Meloidogyne incognita larvae onto the root system.

Similarly, potato shoots that take root in a kanamycin-containing RM medium are transferred into translucent plastic tubes filled with earth (30x15x120 mm, Kelder plastibox bv, The Netherlands) and grown under slope for another two weeks at 22 ^o C and the following cycle: 16 hours in the light and 8 hours in the dark. Infection is carried out by injecting a suspension containing 500 second-stage Globodera pallida larvae (in 3 ml of H ₂ O) onto the root system, into the soil.

GUS analysis
GUS activity is determined at various times during the infection process, thoroughly washing the root systems to remove most of the adherent soil and incubating them in X-Glyc solution (1 mg / ml X-Gluc, 50 mM NaPO ₄ (pH 7), 1 mM K ₄ Fe (CN) ₆ , 1 mM K K ₃ Fe (CN) ₆ , 10 mM EDTA, 0.1% Triton x 100) at 37 ^{° C.} overnight. After removal of chlorophyll from the tissue by incubation of 70% ethanol for several hours, GUS spots are observed under a microscope.

Example 1
Construction of the binary vector pMOG800
The binary vector pMOG800 is a derivative of pMOG23 (FIG. 1, hosted by the Centraal Bureau voor schiimmelcultures, Oosterstraat 1, Baarn, The Netherlands, January 29, 1990, under the number CBS 102.90), in which an additional site is introduced into the polylinker between EcoRI and SmaI restriction KpnI. Between the left and right borders of T-DNA, this plasmid contains the kanamycin resistance gene for selection of transgenic plant cells (figure 2). A sample of E. coli DH5 alpha receiving pMOG 800 is available from the Centraal Bureau voor Schimmelcultures, Oosterstraat 1, Baarn, The Netherlands, August 12, 1993, numbered GBS 414.93.

Example 2
Construction of the GUS pMOG553 construct without promoter
The construction of this vector is described by Goddijn et al. 1993 Plant J. 4, 863-873. There is an error in this link: the design contains the 35S terminator of the cauliflower mosaic virus behind the β-glucuronidase gene instead of the indicated nopaline synthase terminator. The sequence between the T-DNA boundaries of this binary vector is located in the EMBL database under registration number X84105. pMOG553 carries a HygR marker for plant transformation (FIG. 3).

Example 3
Identification and isolation of the captured preferred nematode feeding site promoter fragment in Arabidopsis thaliana
The binary vector pMOG553 is mobilized by crossbreeding with the Agrobacterium tumefaciens strain MOG101. The resulting strain is used to transform the root of Arabidopsis. In this way, more than 1100 transgenic lines of the Arabidopsis plant are obtained. Transgenic plants are grown to maturity, give them the opportunity to self-pollinate, and the resulting seeds (S1) are harvested and vernalized. Then the seeds S1 germinated in a nutrient solution (Goddijn et al. 1993 Plant J. 4, 863-873), fixed with 0.6% agar, 10 mg / l hygromycin, and stored at 4 ^o C for a four-day period of swelling. On the fifth day, the cups are transferred to a room with room temperature and moderate lighting (1000 lux, 16 hours in the light and 8 hours in the dark) for germination. 14-day-old seedlings are transferred to pot soil placed in inclined translucent plastic tubes (30x15x120 mm) for further cultivation at 5000 lux (20 ^° C). Growing plants in this way leads to the formation of a root system on the lower part of the tubers in the space between the soil and the test tube. After two weeks, the roots are infected with nematodes, as described in the Experimental part. Several times after inoculation (lasting 2-14 days), the root systems are analyzed for GUS activity, as described in the Experimental part. The pMOG 553 # 1164 line is identified as a line showing sufficiently strong GUS expression inside syncytia and giant cells induced by Heterodera schachtii and Meloidogyne incognita, respectively. In uninfected control plants (as well as in infected plants) of this line, very weak GUS expression is found in some cells at the base of young lateral roots and in some green parts of the plant.

 It was determined that in line 1164 this phenotype is cleaved in a 1: 3 ratio; this means that the GUS construct is present at one locus on the genome. The presence of only one copy of T-DNA is confirmed by southern analysis. A fragment containing 1.5 tp the captured promoter sequence adjacent to the open reading frame is isolated by an inverted polymerase chain reaction. The genomic DNA of this line is cleaved with the restriction enzyme MscI, which produces only one cleavage at this GUS coding region and is combined. As a result of hydrolysis of circular DNA by SnaBI enzyme, a linear fragment is obtained with known GUB sequences at the ends and a flanking plant sequence between them. This fragment is amplified using the GUSinv5 primer kit (5 'CTT TCC CAC CAA CGC TGA TC 3' SEQ ID NO: 1) and GUS7 (5 'GTA ATG CTC TAC ACC ACG CCG 3' SEQ ID NO: 2), cloned into a multicopy vector and sequenced (see below). To clone this amplified fragment again ahead of the GUS, the plant sequence is again amplified from the Arabidopsis genomic DNA using GUSinv5 and 1164XBM primers (5 'TST AGA GGA TCC TGG CCA TAC AAA TCA ACG TTT AC 3' SEQ ID NO: 3). To reduce the level of errors, pfu DNA polymerase with corrective activity is used. Primer 1164XBM introduces the BamHI site at the 5 'end of the promoter, which allows cloning of 1480 bp The BamHI fragment containing the promoter, back before the GUS in the pMOG 819 construct, without changing the sequence between the open GUS reading frame and the plant promoter.

Example 4
Design constructs GUS pMOG 819 without promoter
This vector is constructed by cloning the coding region of the GUS intron (Vancanneyt et al. 1990, Mol. Gen. Genet. 220; 245-250) pMOG 553 as a BamHI-EcoRI fragment in the polylinker pMOG 800. The binary vector pMOG 819 (Fig. 4) serves for the introduction of cloned fragments of the promoter for further analysis of expression after transformation of plants.

Example 5
Analysis of promoter fragments after repeated administration in Arabidopsis
The polymerase chain reaction product from tag 553 # 1164 was cloned back before the GUS gene of the binary vector pMOG 819 to obtain pMOG 849 (FIG. 5). A sample of E. coli DH5α containing pMOG 849 was placed at the Centraal Bureau voor schimmel-cultures, Oosterstraat 1, Baarn, The Netherlands, May 4, 1995, under the number CBS 308.95. To determine the tissue-specific activity of the cloned promoter fragment, the resulting pMOG 849 clone is activated against Agrobacterium tumefaciens and the corresponding strain is used to transform wild-type Arabidopsis tchaliana plants. 24-30 transformants are produced per design. The seeds of the original transformants are collected and grown for infectious analyzes with Heterodera schachtii, as described in the Experimental part. GUS analysis after infection of nematodes shows that 79% of lines transformed with pMOG 849 express a reporter gene in syncytia. Some weak expression is also found on the site of the root lateral branching, in the vascular tissue of the roots and leaves, in the center of the rosette and in some flower tissues. GUS expression outside syncytium varies greatly from line to line (see FIG. 6). Presumably, this difference is the result of the action of the position of the genome on the introduced regulatory sequences. However, an expression pattern is found in most lines, very similar to the originally labeled line 553 # 1164. Even though the activity of the promoter fragment in different lines of pMOG 849 is usually much weaker than the GUS activity inside syncytium, none of the syncytium-positive lines is completely specific for the feeding sites.

 GUS expression is also found in giant cells induced by infection with Meloidogyne incognita in the same lines that express GUS in syncytia induced by Heterodera schachtii. This shows that fragment 1164 can be used almost as a specific promoter of the feeding site for obtaining plants with reduced susceptibility to Meloidogyne incognita and Heterodera schachtii.

 During the tissue culture phase, it was observed that the 1164 regulatory sequence is also active as a promoter, thus suggesting the need to use a neutralizing gene when transferring a fragment of the 1164 promoter to Arabidopsis with a plant cell depleting gene under its control, such as barnase (see Examples 8 and 9).

 A polymerase chain reaction fragment based on 553 # 1164 is used as a probe to isolate the corresponding genomic clone. Genomic fragment containing 2.1 etc. (see SEQ ID NO: 4), then used in a similar approach as described above (pMOG 889 contains genomic 553 # 1164 fused to the GUS intron). Again, nematode-induced GUS expression can be observed in syncytia and giant cells after nematode infection of Arabidopsis roots with H. Schachtii and M. incognita, respectively.

Example 6
The definition of the sequence of the promoter tag pMOG 553 # 1164
The sequence of genomic clone 1164 by the method of "walking" the primer on CsCl purified DNA using an ALF Pharmacia automatic sequencer. The procedure is described by Voss et al. (1992) Mol. Cell. Biol. 3, 153-155. The sequence is depicted in SEQ ID NO: 4.

Example 7
Cloning of a subfragment (subfragments) of the promoter
Five sub-fragments of promoter 1164 are prepared by polymerase chain reaction using primers as shown in Table 4. The numbering of the primers is the same as in the sequence listing. For all amplifications, a plaque-forming correcting DNA polymerase unit is used, and pMOG 849 serves as the target DNA. All 5 'end primers contain the XhoI site. Thus, all delegated fragments of the 1164 promoter obtained by polymerase chain reaction can be cloned again in pMOG 819 at the XhoI and BamHI sites located at the multiple cloning site of pMOG 553 and located at the labeled line 1164 between the GUS coding region and the labeled plant sequence. Numbers refer to constructs derived from sub-fragments cloned in pMOG 819; primers 6044-1 to 6044-6 correspond to SEQ ID NO 6-11, respectively.

 After the repeated introduction of these gene cassettes into the expression structures of plants, it is possible to determine the time and the like, as described for fragment 1164 with 1.5 bp in Example 3. Fragments having the desired structures and / or time periods can be subsequently used to direct the expression of foreign DNA sequences (both sense / coding and antisense) and / or used to obtain hybrid promoter constructs. Further analysis allows us to understand some regulatory elements, such as “silencers”, enhancers, etc., and makes it possible to act on the expression structures and / or time periods as desired. An example of the use of promoter fragments in accordance with the present invention to reduce nematode susceptibility is illustrated for a 1164 2.1 kb genomic fragment cloned before barnase. He is also an example of a gene that destroys a nematode feeding site.

Example 8
Cloning fragment 1164 before Barnase
A 2.1 kb genomic DNA fragment containing the labeled 5 ′ sequence from line 1164 is cloned before barnase, an RNase gene obtained from Bacillus amyloliquefaciens to create plants resistant to “settled” plant nematodes. The genomic product is obtained by screening 400,000 clones from the genomic library of the Ecid C24 Arabidopsis ecotype with the product iPCR, 1164 (see Example 3). EcoRI fragment 4 is isolated from one of the hybridizing clones. and subclone it into the multicopy plasmid pKS (Stratagene). Sequence analysis shows that this clone contains 2.1, etc. 5 'sequence before the insertion of T-DNA in lines 1164 and 1.9 etc. 3 'sequence.

 To restore the exact context of the sequence in front of the GUS SnaBI coding region, fragment 546 bp from pMOG 849, encompassing the fusion of the GUS promoter, is cloned into the SnaBI site of the genomic clone. Fragment of HindIII 2325 bp isolated from the resulting clone containing the complete labeled 5 'sequence from the EcoRI genomic subclone. This fragment is cloned before the barnase gene in the pFL8 construct (described below) to form a clone pFL15.

 The fragment containing the barnase coding region was amplified by polymerase chain reaction on pMT416 DNA (Hartley, sub) using primers 5 'CGGACTCTGGATCCGGAAAGTG 3' (SEQ ID NO: 12) and 5 'CTGCTCGAGCCTAGGCACAGGTTATCAACAC 3): These primers introduce the flanking restriction sites BamHI and XhoI to facilitate cloning of the fragment. The fragment is cloned into a multiple cloning site in a vector containing the barstar gene under the control of the Tag promoter (necessary to overcome the toxicity of barnase in bacteria). To eliminate the toxicity of barnase expression in subsequent stages of cloning, the intron ST-LS1 is inserted into the StyI site. In the translational initiation codon, barnases create the NcoI site by a recombinant polymerase chain reaction using 5 'CGGACTCTGGATCCGGAAAGTG 5' primers (SEQ ID NO: 14) and 5 'CTTACTCGAGCCATGGTAAGTTTCTGC 3' (SEQ ID NO: pOG16) resulting in the formation of SEQ ID NO: 15). The untranslated 5 'barnase sequence is further modified to resemble the corresponding sequence in the original pMOG 553 # 1164 line by annealing the following 5' GATCTAGACTCGAGAAGCTTGGATCCCCGGGTAGGTCAGTCCCC 3 'nucleotides (SEQ ID NO: 16) and 5' CATGGGGTCGTCTAG and ligation of the resulting adapter between the BglII site and the HcoI pOG16.1 site, resulting in the formation of a clone pFL8. The adapter introduces the 5 'HindIII site with respect to the coding region of barnase used to insert the 1164 promoter leading to the formation of pFL15. In addition, this procedure leads to the exchange using the adapter of the fragment containing the Tag promoter and the barstar gene.

Example 9
The construction of rolD-B
The pFL11 construct contains the barstar chimeric gene in a binary vector. This construct is cloned as follows. The barstar coding region is in the HindIII / BamHI fragment, in pMT316 construct (Hartley (1988) J. Mol. Biol. 202, 913-915). The HindIII site is converted to the BamHI site, ligating the 5 'AGCTCGGATCCG 3' self-renewing adapter to this site (SEQ ID NO: 18). The resulting BamHI fragment is then cloned between the double amplified CaM V 35S promoter and the nopaline synthase terminator in the pMOG 180 expression cassette described in WO 93/10251, resulting in the formation of pOG30. Using the 5 'GGCTGCTCGAGC 3' adapter (SEQ ID NO: 19), the HindIII site at the end of the 3 'nopaline synthase terminator is converted to the XhoI site, and the EcoRI site at the 5' end of the promoter is converted to the HindIII site using the 5 'AATTGACGAAGCTTCGTC 3' adapter ( SEQ ID NO: 20). The 35S promoter is then replaced by a promoter from the RolD gene of Agrobacterium rhizogenes. This promoter was excised as a HindIII / BamHI fragment from the pDO2 construct obtained from F. Leach (Leach and Aoyagi (1991) Plant Sci. 79, 69-76). The barstar gene, including the promoter and terminator, was digested from the resulting pOG38 clone by hydrolysis of HindIII and XhoI and cloned into the corresponding polylinker sites in pMOG 800, resulting in pFL11.

 Finally, the chimeric gene 1164 of the barnase promoter is cleaved from pFL15 as an EcoRI fragment and cloned into the unique EcoRI pFL11 site between the barstar gene and the NptII marker gene in tandem orientation, resulting in pMOG 893.

Example 10
Transformation of potato plants using pMOG 893 and testing for increased resistance against Globodera pallida
The binary vector pMOG 893 is activated against Agrobacterium tumefaciens and the resulting strain is used to transform tuberous circles from the cultivar of the Kardal potato variety, as described in the experimental part. A total of 98 transgenic lines are obtained. These lines are propagated vegetatively, cutting the shoots into segments containing at least one node, and forming roots in vitro. On the line, 15 plants are checked for increased resistance to Globodera pallida, as described in the Experimental part. Potato plants transformed with pMOG 893 containing the barnase / barstar construct are expected to be less susceptible to Globodera pallida due to the expression of nematode-induced barnase inside the (developing) nematode nutritional structure.

 The above examples serve only to illustrate the present invention, and not to limit it. Numerous modifications that can be readily accomplished by those skilled in the art are within the scope of this invention.

Claims (16)

 1. The DNA fragment obtained from Arabidopsis thaliana, capable of stimulating nematode-induced nodular-root and cystic transcription of the associated DNA sequence when re-introduced into the plant, including the nucleotide sequence represented by nucleotides I-2141 in SEQ ID No: 4.  2. The DNA fragment according to claim 1, having a nucleotide sequence represented by nucleotides 646-2141 in SEQ ID No: 4.  3. The DNA fragment according to claim 1 or 2, essentially being a site-specific for a nematode.  4. A subfragment or combination of subfragments of a DNA fragment according to claim 1 or 2, capable of stimulating nematodes-induced nodular-root and cystic transcription of an associated DNA sequence when reintroduced into a plant.  5. The subfragment of the DNA fragment according to claim 4, essentially being a site-specific nematode food.  6. The chimeric DNA sequence, which is a DNA fragment in the direction of transcription according to any one of claims 1 to 4, and a DNA sequence expressed under its transcriptional control, which in vivo is not under transcriptional control of the specified DNA fragment.  7. The chimeric DNA sequence of claim 6, wherein the expressed DNA sequence causes the production of a substance that destroys plant cells.  8. The chimeric DNA sequence of claim 7, wherein said cell destructive substance is barnase.  9. The chimeric DNA sequence of claim 7, wherein said cell-disrupting substance is RNA complementary to RNA necessary for cell viability.  10. The chimeric DNA sequence according to claim 6, in which the expressed DNA sequence causes the production of a substance toxic to the inducing nematode.  11. The sequence of the chimeric DNA according to any one of claims 6 to 10, characterized in that it is included in the plant cell.  12. A replicon that contains a chimeric DNA sequence according to any one of claims 6 to 10 and at least one restriction endonuclease recognition site for embedding an expressed DNA sequence.  13. The replicon according to item 12, characterized in that it is included in the microorganism.  14. A replicon that contains in the direction of transcription a DNA fragment according to any one of claims 1 to 5 and at least one recognition site for a restriction endonuclease for embedding an expressed DNA sequence under the control of said DNA fragment.  15. The replicon according to 14, characterized in that it is included in the microorganism.  16. The chimeric DNA sequence according to any one of claims 6 to 10, used to transform plants.

Images