RU2196176C2 - Analogue hin47 of haemophilus with reduced protease activity - Google Patents

Abstract

FIELD: immunology, microbiology, genetic and protein engineering. SUBSTANCE: invention relates to immunogens and antigens of Haemophilus species. Isolated and purified analogue of Hin47 protein from Haemophilus influenzae exhibits decreased protease activity that is less 10% of activity of natural protein Hin47 but the same immunogenic properties as natural protein due to substitution or incorporation of at least one amino acid in native protein determining protease activity. Amino acid can be taken among amino acids 195-201, His-91 or Asp- 121 of native protein Hin47. Chimeric molecule comprises analogue of protein Hin47 of Haemophilus influenzae bound with polysaccharide. Recombinant plasmid DS-1011-1-1 (pT7/Hin47*) carries nucleic acid molecule expressing analogue of protein Hin47 with substitution of Ser-197 for alanine. At least a single amino acid residue of protein Hin47 determining protease activity is identified. For removal or substitution of nucleotide sequence encoding this amino acid site-directed mutagenesis of gene hin47 is carried out. Mutant gene is incorporated into cell to obtain transformed cell and the latter is cultured to yield analogue of Hin47. Immunogenic composition comprises effective amount of analogue Hin47. Interaction of sample with analogue Hin47 is carried out to obtain complexes comprising analogue Hin47 and recognizing its antibodies specifically if they present in sample. In subject immunization antibodies exhibiting specificity to protein Hin47 are obtained. Interaction of sample with antibodies is carried out. Diagnostic set for assay of antibodies presence that are able to recognize protein Hin47 specifically comprises in sample analogue of protein Hin47 and agents providing interaction of analogue with sample. Invention ensures to obtain vaccine preparations against sicknesses caused by pathogenic microorganism Haemophilus influenzae. EFFECT: improved method of preparing, valuable biological and medicinal properties. 18 cl, 25 dwg, 3 tbl, 14 ex

Description

Field of Invention
The invention relates to the field of immunology, in particular to immunogens and antigens from Haemophilus species. Link to a related application.

 This application is an integral part of US patent application serial 08/296149 of August 26, 1994, which in itself is an integral part of serial application 08/278091 of July 21, 1994

BACKGROUND OF THE INVENTION
Haemophilus influenzae is an organism that is responsible for many serious human diseases, such as meningitis, epiglotitis, pneumonia and otitis media. Haemophilus influenzae type b (Hib) is the leading cause of bacterial meningitis in children under five years of age. Protective antibodies to this disease are induced by the capsular polysaccharide of this organism, and a vaccine has been developed that uses purified polyribosylribitolphosphate (PRF) as an antigen. This vaccine provided 90% protection in adults and children over 24 months of age, but was ineffective in children under 24 months of age (Zangwill et al, 1993). (Links are given in the list of references at the end of the present description, each of the links in this list is included here as a reference without further reference) Like other polysaccharide antigens, PRF does not induce proliferation of T helper cells, and reimmunization is not able to cause an enhanced response or increase memory cells. Conjugation of a PRF polysaccharide with a carrier protein gives the characteristics of the vaccine dependent on T cells and significantly enhances the immune response to the PRF antigen. Currently, there are four vaccines available for PRF-bearing conjugate. These are vaccines based on the conjugate of the capsular polysaccharide of H. influenzae type b with diphtheria toxoid, tetanus toxoid, or Neisseria meningitidis outer membrane protein (reviewed by Zangwill et al, 1993). These H. influenzae b conjugate vaccines significantly reduced the incidence of bacterial meningitis (Schoendorf et al, 1994).

 There are six serotypes of H. influenzae, designated a - f, which are determined by their capsular polysaccharides. Currently available Haemophilus conjugate vaccines do not protect against other invasive typable strains (types a and c) and, importantly, do not protect against non-typable (NTHi) strains, which are a common cause of postpartum sepsis and neonatal sepsis, pneumonia and otitis media. Otitis media is the most common disease in early childhood, with approximately 70% of all children under the age of seven years having suffered at least one otitis media. Chronic otitis media can lead to impaired hearing, speech and recognition in children. This is caused by a bacterial infection of Streptococcus pneumoniae (approximately 50%), non-typable H. influenzae (approximately 30%) and Moraxella (Branhamella) catarrhalis (approximately 20%). In the United States alone, antibiotics and surgical procedures, such as tonsillectomy, adenoidectomy, and tympanostomy tubes, are spent between $ 1 and $ 2 billion a year. In order to achieve universal protection against H. influenzae-mediated diseases, especially in the age group of two to six months and in groups of a certain high risk, it is desirable to have a stock of canned cross-reactive non-capsular N. influenzae immunogens. Untyped H. influenzae strains are also important pathogens responsible for pneumonia in the elderly and other individuals who are particularly prone to respiratory infections. Thus, the presence of H. influenzae antigens, which are used as components in immunogenic preparations that provide protection against many serotypes of H. influenzae, is necessary. PCT application WO 92/10936, published July 9, 1992 and incorporated herein by reference, describes an outer membrane protein derived from H. influenzae with a molecular weight of 47,000, which is reported to be adhesin and is designated as Hin47, which is immunologically conserved between untypical type b and for atypical clinical isolates of H. influenzae. The amino acid sequence of Hin47 and the nucleotide sequence of the gene encoding Hin47 are presented at a conference of the American Society of Microbiology (ASM) held in New Orleans on May 26-30, 1992. These sequences were also published in PCT application WO 94/00149, published January 6, 1994 and incorporated herein by reference.

 Because Hin47 is conserved between strains of Haemophilus influenzae and is reported to be adhesin, a protein used to diagnose and vaccinate against diseases caused by H. influenzae or other bacterial pathogens that produce Hin47, or a protein that can increase the specific reactivity of antibodies to Hin47 .

 The disadvantage of Hin47 when used as an antigen for diagnosis, to produce anti-Hin47 antibodies used for diagnosis and as an immunogen for vaccination is the unexpected discovery for applicants of the present invention that Hin47 has protease activity that leads to Hin47 auto-digestion and proteolytic degradation of others mixed antigens with it.

 It would be an advantage to create Hin47 protein analogues (sometimes referred to as mutants or derivatives), which exhibit significantly reduced proteolytic activity, for use as antigens, immunogenic drugs, including vaccines, carriers for other immunogens and for the production of diagnostic reagents.

Description of the invention
The present invention relates to the development of Haemophilus Hin47 protein analogues having reduced protease activity.

 In accordance with a first aspect of the invention, there is provided an isolated and purified Haemophilus Hin47 protein analogue having a reduced protease activity, which is less than 10% of the activity of the natural Hin47 protein. Such an Hin47 analogue preferably has substantially the same immunogenic properties of the natural Hin47 protein. An analogue of the present invention can be obtained by chemical, biochemical or genetic modification of natural Hin47.

 In one embodiment of the present invention, when an analogue is obtained by genetic modification, at least one amino acid of natural Hin47 contributing to protease activity can be removed or replaced with another amino acid to obtain reduced protease activity. Alternatively, reduced protease activity can be achieved by introducing at least one amino acid into the natural Hin47 protein. At least one deleted or substituted amino acid may be selected among the 195-201 amino acid residue of Hin47, in particular it may be serin-197, which may be removed or replaced with alanine, cysteine or threonine. In addition, at least one deleted or substituted amino acid may be His-91, which can be removed or replaced with alanine, lysine or arginine. Further, at least one removable or substituted amino acid may be Asp-121, which may be removed or replaced with alanine.

 In addition, many amino acids in the Hin47 molecule can be removed or replaced. Such amino acids may include His-91 and Serin-197, and they can be removed or replaced with Ala-91 and Ala-197 to give the Hin47 analog H19A / S197A. In addition, many amino acids may include His-91, Asp-121 and Ser-197 and they can be removed or replaced with Ala-91, Ala-121 and Ala-197, respectively, to obtain the Hin47 analog H91A / D121A / S197A. A description of some of the properties of some of the Hin47 analogues proposed here is presented in Table 3. It was found that only one Hin47 D121E mutant retains significant protease activity.

 On the other hand, the present invention relates to an isolated and purified nucleic acid molecule containing a mutant gene of Haemophilus influenzae hin47, encoding an analogue of the protein Haemophilus influenzae Hin47, having reduced protease activity, which is less than 10% of the activity of the natural protein Hin47. The mutant hin47 gene can encode any of the Hin47 analogues discussed above. The mutant gene is mainly formed by site-directed mutagenesis of the wild-type hin47 gene. The nucleic acid molecule can be included in a recombinant plasmid adapted for host transformation and can be a DS-1011-1-1 plasmid (deposited July 27, 1994 in the American type Culture Collection, Rockwill, Maryland, USA, under Incoming N 75845). The invention also includes a transformed cell containing such a recombinant plasmid.

 The present invention, on the other hand, includes a method for producing a Haemophilus influenzae Hin47 protein analogue having a reduced protease activity that is less than 10% of the activity of the natural Hin47 protein, which comprises identifying at least one amino acid residue of the Hin47 protein, which contributes to its protease activity, in the implementation of site-directed mutagenesis of the hin47 gene to remove or replace the nucleotide sequence encoding at least one amino acid, and to obtain a mutated hin47 gene, introducing the mutated hin47 gene into the cell to obtain a transformed cell and growing the transformed cell to obtain a Hin47 analog. At least one amino acid that is selected may be any of the specifically identified amino acids indicated above in relation to the Hin47 analogue.

 Introduction of the mutated hin47 gene preferably produces a transformed cell in which the mutated hin47 gene is under the control of the T7 promoter, and the cultivation of the transformed cell and expression of the Hin47 analog under the influence of the T7 promoter is further preferably carried out by cultivation in the presence of an inducing concentration of lactose. The introduction of mutated hin47 is preferably carried out by transforming the cell with the recombinant plasmid DS-1011-1-1, sometimes in a different way, relative to the plasmid pT / Hin47 *.

 According to a further aspect of the invention, there is provided a method for producing an isolated and purified Hin47 analogue, which consists in using the method described above to obtain a Hin47 analogue, producing transformed cells including inclusion bodies containing an Hin47 analog, destroying grown transformed cells to obtain a supernatant and inclusion bodies, solubilization of inclusion bodies to obtain the Hin47 analog, chromatographic purification of the Hin47 analog from a solution containing no cell residues, and isolation purified of Hin47 analog.

 The Hin47 analogs proposed here, with their reduced proteolytic activity, are useful as antigens in the immunological composition, as carriers for other immunogens, diagnostic agents, and in the production of diagnostic agents. Nucleic acid molecules are also used as samples for diagnostic use, as well as immunogenic compositions.

 A further aspect of the invention relates to an immunogenic composition comprising an immunoeffective amount of an Hin47 analog or nucleic acid molecule comprising a gene encoding an Hin47 analog. An immunogenic composition can be prepared as a vaccine for in vivo administration to a host, including humans, to confer protection against diseases caused by a bacterial pathogen that produces Hin47 or a protein capable of inducing antibodies specifically reactive to Hin47 on the host. The bacterial pathogen may be a species of Haemophilus, such as Haemophilus influenzae. The immunogenic compositions of the invention may also contain at least one other immunogenic or immunostimulating material, such as an adjuvant. In a further embodiment, a nucleic acid molecule comprising a gene encoding an Hin47 analogue may comprise a living vector such as smallpox virus. Salmonella, poliovirus, adenovirus, vaccinia virus or BCG.

 The invention also encompasses a method for generating an immune response in a host, including a human, comprising administering to him an immunoeffective amount of the immunogenic compositions provided herein.

As noted above, the Hin47 analogue provided herein is useful for diagnostic use. Accordingly, in an additional aspect of the invention, a method for determining the presence of antibodies specifically reactive to Hin47 in a sample is described, comprising the following steps:
(a) contacting the sample with an Hin47 analog having substantially the same immunogenic properties as the natural Hin47 protein claimed herein to form complexes containing the Hin47 analog and any similar antibodies present in the sample that specifically react with it, and
(b) determination of the formation of complexes.

The present invention also describes a method for determining the presence of Hin47 in a sample, comprising the following steps:
(a) immunizing a subject with an immunogenic composition as described herein to produce antibodies specific for the Hin47 protein;
(b) contacting the sample with antibodies to form complexes comprising any specific antibodies present in the Hin47 and Hin47 sample, and
(c) determination of the formation of complexes.

The invention also encompasses a diagnostic kit for determining the presence of antibodies in a sample specifically reactive to Hin47, including:
(a) an Hin47 analogue having substantially the same immunogenic properties as the native Hin47 protein, as described herein;
(b) a device for contacting an analog with a sample to obtain a complex comprising an analog and any similar antibody present in the sample, and
(c) a device for determining complex formation.

Brief Description of the Drawings
In FIG. 1 shows a restriction map of plasmids JB-1031-1-14 and JB-1068-2-2 and the construction of a plasmid for sequence analysis;
In FIG. 2 AH represents the complete nucleotide (SEQ ID NO: I) and deduced amino acid sequence (SEQ ID NO: 2) of Hin47 from H. influenzae strain SB33, as well as the partial nucleotide sequence (SEQ ID NO: 33) and the partial deduced amino acid sequence copied here, the applicant from the materials presented at the AOM conference, as described above.

 In FIG. 3A-B presents a comparison of the amino acid sequences of H. influenzae Hin47 (SEQ ID NO: 2), E. coli htrA (SEQ ID NO: 5) and Salmonella typhimirium htrA (SEQ ID NO: 6).

 In FIG. 4 A-E shows the sequence of Hin47 amino acid residues from 57 to 256 in comparison with some known proteases (SEQ ID NO: 7-16).

 The designations are as follows: TON, rat tonin; PKAAV, kallikrein; PTN, trypsin; CHAA, chymotrypsin; Est, elastase; RP2A, rat mast cell protease; SGBE, proteinase A of S. griseus; SGA, Proteinase B S. griseus; ALP, alpha-lytic protease of L. enzymogenes; hin47, remnants 57 - 256 Hin47. An asterisk (*) indicates structurally conservative regions. The triads of catalytic residues are indicated by (#). 'con' corresponds to regions of structural coordination among mammalian proteases.

 In FIG. 5 AB shows restriction maps of plasmids DS-1011-1-1 and DS-1048-2, which express the E. coli Hin47 analog and the construction scheme for plasmid DS-1011-1-1 (plasmid pT7 / Hin47 *).

 In FIG. Figure 6 shows the purification process of an E. coli Hin47 analogue in accordance with one of the descriptions of the present invention and gel analysis of the purified product.

 In FIG. 7 shows the protease activities of natural Hin47 and an analog of Hin47 with respect to betta casein.

 In FIG. Figure 8 shows the stability of natural Hin47 and an analog of Hin47 at various temperatures.

 In FIG. Figure 9 shows the enzymatic degradation of a recombinant H. influenzae protein by natural Hin47 and an analog of Hin47.

 In FIG. 10 shows the comparative immunogenicity of natural Hin47 and mouse Hin47 analog.

 In FIG. 11 AB shows a comparison of the amino acids of the Hin47 protein isolated from H. influenzae strains SB33 and SB12.

 In FIG. 12 shows the purification of Hin47 H19A analogue from E. coli.

General Description of the Invention
Any Haemophilus strains that have Hin47 genes can be used in a conventional manner to purify and isolate nucleic acid molecules (which may be in the form of DNA molecules) containing at least a portion encoding Hin47, as typified by embodiments of the present invention. Such strains are usually available from clinical sources and from collections of bacterial cultures, such as the American Type Culture Collection. Such strains include strains of H. influenzae and other bacteria that produce a protein capable of forming antibodies that specifically recognize fragments of Hin47 or its analogs. Suitable strains of Haemophilus may include:
H. influenzae type b strain MinnA;
H. influenzae type b strain Eagan;
H. influenzae non-typeable strain SB33;
H. influenzae non-typable strain SB12 or
H. influenzae non-typable strain of PAK 12085.

 With reference to FIG. 1, it shows restriction maps of plasmids JB-1031-1-14 and JB-1068-2-2, which contain a portion encoding the Hin47 protein from the non-typable H. influenzae SB33 strain. The nucleotide sequence of the Hin47 gene was determined, which is shown in FIG. 2 together with the deduced amino acid sequence of the Hin47 protein. With reference to FIG. 3, it shows the amino acid sequence of Hin47 H. influenzae and htrA serine proteinase from Escherichia coli and htrA from Salmonella tyrimimium. This linear sequence primarily exhibits an unexpected finding by the applicants of the present invention that Hin47 is a bacterial serine protease and that Hin47 has protease activity. As previously reported, Hin47 is an adhesin. Its detected protease activity significantly limits the applicability of natural Hin47 as an immunogen for vaccination and as an antigen for diagnostic purposes. The linear sequence shown in FIG. 3 shows that the htrA and Hin47 proteins contain the GNSGGAL (SEQ ID NO: 17) sequence between residues 195 and 201 of the mature protein. The consistent sequence of the active center of serine proteases is GDSGGPK (SEQ ID NO: 18) (Brenner, 1988) and the active residue is serine. Thus, Serin-197 in Hin47 mutated to produce a Hin47 analog with reduced protease activity in accordance with an embodiment of the invention. In a particular embodiment, Serin-197 has been replaced by alanine. Amino acid residues from 57 to 256 Hin47 were further compared with known proteases and residues of the active center were identified from local homologies surrounding the residues of the catalytic triad (Fig. 4). There is a standard numbering system for serine proteases in which the residues of the catalytic triad are numbered as His-57, Asp-102 and Ser-195. This corresponds to residues His-91, Asp-121 and Ser-197 in a sequential numbering system. Thus, with respect to FIG. 4, there is presented the linear structural basis of ten structurally defined serine proteases (SEQ ID NOS: 7-16), in which homologous residues are primarily linear at the basis of a similar arrangement in three-dimensional space. The position of many residues in the hydrophobic core of Hin47, as well as the residues around the active site, can be arranged quite well to identify the functional amino acids of the Hin47 protease. Therefore, other amino acid residues in Hin47 that contribute to the protease activity of the protein include His-91 and Asp-121. In private practice, His-91 can be replaced with alanine, lysine or arginine. In a further embodiment, Asp-121 may be replaced with alanine or glutamic acid. In a further embodiment, Serin-197 may be replaced by alanine, series, or threonine. Although the preparation of the Hin47 analog having reduced protease activity by partial amino acid substitution in the Hin47 protein was given in the examples here, the detection of protease activity and Hin47 expression methods, purification and analysis, proposed here, allow to obtain other analogues with at least one other amino acid, deleted or replaced, or having at least one additional amino acid introduced into the Hin47 protein. In specific applications and implementations, it may be desirable to simultaneously change several amino acids in the Hin47 protein to partially reduce the Hin47 protease activity. The multiple amino acids can be His-91 and Ser-197 and can be removed or replaced with alanine. In an alternative embodiment, several amino acids may be His-91, Asp-121, and Ser-197 and they may be removed or replaced with alanine. Accordingly, the present invention relates to analogues of the Hin47 protein having reduced protease activity as a result of single or multiple removal, substitution or addition of the Hin47 protein.

As discussed above, Hin47 exhibits homology with E. coli htrA or S. typhimirium htrA, both of which are stress-dependent proteins with serine protease activity. E. coli is included with growth at a temperature of 43.5 ^o With (link 13). Applicants have shown that E. coli htrA protein is also an inducible 6% ethanol. Hin47 is also induced by 6% ethanol and, to a lesser extent, when the temperature is brought up to 43.5 ^{° C.} , as described in detail below. This analysis of Hin47 expression provides further evidence of the relationship between this protein and LtrA.

 The hin47 gene has also been cloned from an unbreakable H. influenzae SB12 strain by PCR amplification. With reference to FIG. 11, there is a comparison of amino acids between Hin47 proteins of H. influenzae strains SB12 and SB33. The almost complete amino acid sequence identity is shown.

 With reference to FIG. 5, plasmids DS-1011-1-1 and DS-1048-2, which express the Hin47 Serin-197 -> alanine analogue in E. coli, are illustrated there. FIG. 6 shows a sequence diagram of a method for purifying an Hin47 analog from E. coli inclusion bodies.

 FIG. 7 shows the reduced protease activity of the Hin47 Serin-197 -> alanine analog with respect to the betta-casein substrate and shows that the analog has less than 10% of the protease activity of the natural Hin47 protein. Thus, in one embodiment of the invention, there is provided an analog of Hin47 having a protease activity of less than 10% of the protease activity of natural Hin47, and this analogue specifically has the amino acid Serin-197 replaced with alanine.

 With reference to FIG. 8, therein is presented an analysis of the increased stability of the Hin47 analog proposed here. Thus, one embodiment of the present invention relates to an Hin47 protein analogue having enhanced temperature stability, and such an analogue may specifically have the Serin-197 amino acid substituted for alanine.

 With reference to FIG. 9, there is shown the proteolytic degradation of a non-Hin47 Haemophilus antigen by the action of the Hin47 and Hin47 analogue proposed here. Thus, in accordance with a further embodiment of the present invention, there is provided an Hin47 analog compatible with a second non-Hin47 protein, and such an analog may specifically have the Serin-197 amino acid replaced with alanine.

 With reference to FIG. 10 and Table 1, comparative immunogenicity is shown therein in mice of unmodified Hin47 and an analog of Hin47 having reduced protease activity. The Hin47 protein and the Hin47 analog S197A and H91A have comparable immunogenicity. Thus, in private implementation, an analog of Hin47 is proposed, which has reduced protease activity and has substantially the same immunogenic properties of the natural Hin47 protein. A similar analogue may specifically have the amino acid Serin-197 substituted for alanine.

 As for tables 2 and 3, there are presented the immunogenic properties of Hin47 analogues having reduced protease activity against Hib in the bacteremia model in rat pups and in the otitis model during active immunization of chinchillas in accordance with a particular embodiment of the invention, a similar analogue may specifically have an amino acid His-91, deleted or replaced with alanine, lysine or arginine; Asp-121, deleted or replaced with alanine or glutamic acid; Serin-197, replaced with alanine, cysteine or threonine, or a combination thereof.

 In accordance with another aspect of the present invention, there is provided a vaccine against Haemophilus or other bacterial pathogens that produce Hin47 or a protein capable of inducing antibodies that specifically recognize Hin47 containing an immunogenically effective amount of the immunoprotective Hin47 analogue provided herein, or a nucleic acid molecule having the sequence encoding Hin47, proposed here, and their physiologically acceptable carrier. The proposed analogs can also be used as carrier proteins for hapten, polysaccharides or peptides to create a conjugate vaccine against antigenic determinants not related to Hin47.

 As will be clear from the following description, the present invention further relates to plasmids and new bacterial strains for the production of Hin47 analogues proposed herein.

 Purified and isolated DNA molecules containing at least a portion encoding a Haemophilus influenzae Hin47 protein analog that has reduced protease activity compared to native Hin47 typed by the implementation described herein are improved as nucleic acid probes for the specific detection of Haemophilus in vivo and in vitro. The Hin47 analogs encoded by the DNA molecules provided herein are used as diagnostic reagents, such as antigens or for the production of anti-Hin47 antibodies, antigens for vaccination against diseases caused by Haemophilus species and other bacterial pathogens that produce a protein capable of producing antibodies that Hin47 is also specifically recognized for infection with Haemophilus and other similar bacteria.

 In a further embodiment of the present invention, the Hin47 analog having the reduced protease activity provided herein can be used as a molecule carrier for the preparation of chimera molecules and vaccine conjugates (including glycoconjugates) against pathogenic bacteria, including encapsulated bacteria. Thus, for example, the glycoconjugates of the present invention can be used for vaccination to provide protection against a disease and infection caused by any other bacterium having a polysaccharide antigen, including lipopolysaccharides (LPS) and PRF. Bacterial pathogens may include, for example, Haemophilus influenzae, Strptococcus pneumonae, Niesseria meningitides. Salmonella typhi, Streptococcus mutans, Cryptococcus neophormans, Klebsiella, Staphylococcus aureus and Pseudomonas aeruginosa. Specific antigens that can be conjugated to Hin47 analogues and methods for preparing such conjugates are described in the appendices of PCT published application WO 94/12641, which is further incorporated herein by reference.

 In a further embodiment, the Hin47 analog carrier function can be used, for example, to induce immunity against abnormal polysaccharides of tumor cells or to produce anti-tumor antibodies that can be conjugated to chemotherapeutic or bioactive agents.

 Accordingly, the present invention relates to the primary sequence and production of Hin47 analogues of H. influenzae, which can be used for the prevention and diagnosis of diseases caused by H. influenzae. In particular, applicants have found that Hin47 analogues can elicit protective immune responses against bacterial challenge by living H. influenzae dash b. Thus, the present invention is useful for vaccines. The invention also describes the nucleotide sequences of genes encoding Hin47 analogues. These segments of DNA can be used to create an immunogen that is virtually free of other H. influenzae antigens, such as PRP and lipopolysaccharides (LPS), by applying technology with recombinant DNA technology. The Hin47 protein analogue can be obtained in suitable expression systems such as E. coli, Haemophilus, Bacillus, Bordetella, fungi, yeast, baculovirus, poxivirus, vaccinia virus, or mammalian expression systems. The present description further includes new methods that can be used to produce substantially pure Hin47 analogues.

 One skilled in the art will recognize that various implementations of the present invention have many uses in the fields of vaccination, diagnosis, and treatment, for example, Haemophilus infections and infections of other bacterial pathogens that produce proteins capable of producing antibodies that specifically recognize Hin47, and in the production of immunological reagents. A further non-limiting discussion of such applications is presented below.

1. Vaccine preparation and use
Immunogenic compositions suitable for use as a vaccine can be prepared from Hin47 analogues, as described herein. The vaccine enhances the immune response in a subject that produces antibodies, including anti-Hin47 antibodies and antibodies that are opsonizing or bactericidal. The vaccinee must be responsive to Haemophilus or other bacteria that produce proteins capable of producing antibodies that specifically recognize Hin47, the antibodies bind and inactivate the bacterium. Moreover, opsonizing or bactericidal anti-Hin47 may also provide protection by alternative mechanisms.

 An immunogenic composition comprising vaccines can be obtained in the form suitable for injection, in the form of liquid solutions or emulsions. Hin47 analogs may be mixed with pharmaceutically acceptable excipients that are compatible with the Hin47 analog. Such excipients may include water, saline, dextrose, glycerin, ethanol, and a combination thereof. The immunogenic composition and vaccines may also contain adjuvants, such as wetting or emulsifying agents, pH buffering agents or adjuvants, to improve their effectiveness. Methods for achieving adjuvant action include the use of agents such as aluminum hydroxide or phosphate, commonly used as a 0.05-0.1 percent solution in phosphate buffer in saline. Immunogenic compositions and vaccines can be administered orally by injection subcutaneously or intramuscularly. Alternatively, immunogenic compositions formed in accordance with the present invention can be formulated and delivered to elicit an immune response to mucous membranes. Thus, the immunogenic composition can be delivered to the mucous membranes, for example, through the nasal or oral (intragastric) routes. Alternatively, other administration methods including suppositories and oral formulations may be desirable. For suppositories, binding vehicles may include, for example, polyalkene glycols or triglycerides. Oral formulations may include commonly used additives, such as, for example, pharmaceutically pure saccharin, cellulose and magnesium carbonate. These compositions may take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders and contain from 1 to 95% Hin47 analogues. Immunogenic drugs and vaccines are administered in a manner compatible with the dosage of the drug, and in amounts that are therapeutically effective, prophylactic, and immunogenic. The amount administered depends on the subject being treated, including, for example, the ability of the individual immune system to synthesize antibodies, and, if necessary, to produce cells that mediate the immune response. The exact amount of active ingredient required for administration depends on the judgment of the attending physician. However, suitable dosage ranges are readily determinable by one skilled in the art and may be of the order of micrograms for the Hin47 analog. Suitable regimens for initial administration and loading doses are also variable, but may include initial and subsequent administration. Dosages may also depend on the route of administration and will vary according to the size of the host.

 The concentration of antigen in the immunogenic composition in accordance with the invention is usually from 1 to 95%. A vaccine that contains only one pathogen antigenic material is a monovalent vaccine. Vaccines that contain antigenic material from several pathogens are combination vaccines and also relate to the present invention. Such combination vaccines contain, for example, material from different pathogens or from different strains of the same pathogen, or from combinations of different pathogens.

 Nucleic acid molecules encoding the Hin47 analog of the present invention can also be used directly for immunization by direct DNA injection, for example, by injection for genetic immunization or by creating a live vector such as Salmonella, BCG, adenovirus, poxivirus, vaccinia virus or poliovirus. A discussion of some live vectors that were used to transfer heterologous antigens to the immune system is discussed, for example, O'Hagan (1992). Methods for direct injection of DNA into test subjects for genetic immunization are described, for example, by Ulmer et al, 1993.

2. Immunoassays
The Hin47 analogs of the present invention are used as immunogens to generate anti-Hin47 antibodies, as antigens for immunoassays, including enzyme-linked enzyme assays (ELISA), radioimmunoassays (RIAs) and other non-enzyme-linked antibody binding assays or methods known in the art. this area for the detection of antibacterial, Haemophilus and anti-Hin47 antibodies. In ELISA assays, Hin47 analogues are immobilized on a selected surface, for example, a surface capable of binding proteins, such as polystyrene microtiter plates. After washing to remove incompletely absorbed Hin47 analogues, a non-specific protein, such as bovine serum albumin (BSA) in solution, which is known to be antigenically neutral with respect to the test sample, can be bound to the selected surface. This allows you to block the site of non-specific adsorption on the immobilization surface and, thus, suppress the background due to non-specific binding of antiserum to the surface.

The immobilization surface is then contacted with a sample, such as clinical or biological materials, examined by a method that promotes the formation of an immune complex (antigen / antibody). This may include diluting the sample with diluents such as BSA solutions, bovine gamma globulin (BGG) and / or phosphate buffered saline (PBS) / Tween. The sample is then incubated for 2 to 4 hours at a temperature, as expected, from 25 to 37 ^o C. After incubation, the surface in contact with the sample was washed to remove non-immunocomplex material. The washing procedure may include washing with a solution such as PBS / Tween or borate buffer. The subsequent formation of specific immunocomplexes between the test sample and the attached Hin47 analogues, sequential washing, detection of an equal amount of formation of immunocomplexes can be determined by placing the immunocomplex to a second antibody having specificity for the first antibody. If the test sample is of human nature, the second antibody is an antibody that is specific for human immunoglobulins and usually IgG. To ensure detection, the second antibody may have associated activity, such as enzymatic activity, which will produce, for example, the development of color when incubated with a suitable chromogenic substrate. Quantification can then be achieved by measuring the degree of color development using, for example, a spectrophotometer in the visible spectrum.

3. Using sequences as hybridization probes
The nucleic acid molecules of the present invention having the hin47 gene analogue sequence allow the identification and cloning of Hin47 genes from any species of Haemophilus and other bacteria that produce proteins capable of generating antibodies that specifically recognize Hin47.

Nucleic acid molecules having a sequence encoding the Hin47 analog of the present invention are used in connection with their ability to selectively form duplex molecules that complementaryly extend other hin47 genes. Depending on the application, a variety of hybridization conditions can be used to achieve varying degrees of selectivity of probes with respect to other hin47 genes. For a high degree of selectivity, relatively stringent conditions for the formation of duplexes are used, such as a low salt concentration and / or high temperature conditions, such as the creation of a 0.02 M-0.15 M NaCl concentration at a temperature between 50 and 70 ^o C. For some applications, less stringent hybridization conditions, such as 0.15 M-0.9 M salt at a temperature of about 20-55 ^° C. Hybridization conditions can also be more strictly maintained by adding increasing amounts of formamide to destabilize the hybrid duplex. Thus, specific hybridization conditions can be easily manipulated and will usually be the method of choice, depending on the desired result.

 In clinical diagnostic implementation, nucleic acid molecules encoding the hin47 genes of the present invention can be used to determine hybridization in combination with suitable devices, such as a label. A wide variety of suitable indicators are known in the art, including radioactive, enzymatic or other ligands, such as avidin / biotin, which are capable of signal detection. In some diagnostic embodiments, an enzyme label, such as urease, alkaline phosphatase or peroxidase, may be used in place of the radioactive label. In the case of enzyme labels, colorimetric indicator substrates are known that can be used to create a device visible to the human eye or spectrophotometrically to identify specific hybridization with samples containing the hin47 gene sequence.

 Nucleic acid molecules containing the hin47 genes of the present invention are used as hybridization probes in hybridization solutions and in embodiments using solid phase methods. In embodiments involving solid-state methods, test DNA (or RNA) from samples, such as clinical samples, including exudates, body fluids (e.g., serum, amniotic fluid, middle ear discharge, sulfur, bronchoalveolar liquid sputum), or even tissue, is adsorbed or otherwise attached to a selected matrix or surface. The fixed single-stranded nucleic acid then undergoes specific hybridization with selected samples containing the nucleic acid sequence of the hin47 genes of the present invention under the desired conditions. The conditions selected will depend on the specific circumstances based on the particular required criterion, depending, for example, on the content of G + C, the type of target nucleic acid, the nucleic acid source, the size of the hybridization probe, etc. After washing the hybridization surface so as to remove non-specifically bound probe molecules, specific hybridization is detected or even counted by label.

4. Expression of genes encoding Hin47 analogues with reduced protease activity
Vectors, possibly containing a replicon and control sequences that are derived from species compatible with the host cells, can be used to express the Hin47 analog genes, as is explained here in expression systems. A vector typically carries a replication site, as well as labeled sequences, which are methods for providing phenotypic selection in transformed cells. For example, E. coli can be transformed using pBR322, which contains resistance genes for ampicillin and tetracycline, and thus easily provides methods for identifying transformed cells. The pRB322 plasmid or other microbial plasmid or phage must also contain or be modified to contain promoters that can be used by host cells to express its own proteins.

In addition, phage vectors containing a replicon and control sequences that are compatible with the host can be used as transforming vectors when interacting with these hosts. For example, the phage in lambda GEM ^™ -11 can be used to create recombinant phage vectors that can be used to transform host cells, such as E. coli LE932.

 Promoters commonly used in recombinant DNA constructs include beta-lactamase (penicillinase) and lactose promoter systems (Chaang et al, 1979; Goeddel et al, 1980) and other microbial promoter systems (US Pat. No. 4,952,496). Details regarding the nucleotide sequences of promoters are known, and enable a person skilled in the art to sew them functionally to plasmid vectors. The particular promoter used will usually be the subject of choice, depending on the desired results. Hosts suitable for the expression of Hin47 analogues may be used, including E. coli, Bacillus, Haemophilus, Bordetella, fungi, yeast, mammalian cells, or baculovirus expression systems.

 Thus, in accordance with the invention, it may be preferable to create an analogue of the Hin47 protein by recombinant methods. Particularly desirable hosts for expression in accordance with this include gram-positive bacteria that do not have LPS and, therefore, are free from endotoxin. Such hosts include Bacillus species and can be, in particular, used to produce the non-pyrogenic analogue of Hin47.

Biological deposits
Plasmid DS-1011-1-1 (pT7 / Hin47 *), which contains the part encoding the Hin47 analogue, which is described and is hereby incorporated by reference, was deposited at the American Type Culture Collection (ATCC), located in Rockville, Maryland. , USA (Rockwill), according to the Budapest Treaty and prior to the filing of this application, which is a continuation of the part of the application dated July 27, 1994 under incoming N 75845. Samples of the deposited plasmids became available to the public due to the grant of a patent based on this US patent application. The invention described and claimed herein is not limited to the deposited plasmid, since the deposited embodiment is intended only to illustrate the invention. Any equivalent or similar plasmids that encode similar or equivalent antigens, as described in this application, are included in the scope of this invention.

Examples
The above description generally describes the present invention. A more complete understanding can be obtained by referring to the following specific examples. These examples are described for illustrative purposes only and are not intended to limit the scope of the invention. Depending on the proposed circumstances or expediency, changes in form and replacement with equivalents may be considered. Although specific terms are used herein, such terms are used in a descriptive sense and not for purposes of limitation.

 Used methods of molecular genetics, protein biochemistry and immunology in this description are described without explanation, and these examples are quite widely described in the scientific literature and are easily accessible to the specialist.

 Example 1

 This example illustrates the cloning of the hin47 gene from the non-typable H. influenzae SB33 strain.

Chromosomal DNA was obtained from H. influenzae strain SB33 and an EMBL3 library was obtained and sieved with a labeled oligonucleotide probe specific for the 5'-end of hin47. The non-typable H. influenzae SB33 strain was grown on Muellar-Hinton agar or on cardiac infusion broth as described by Harkness et al, 1992. Chromosomal DNA was obtained as follows: cells from 50 ml of culture were pelleted by centrifugation at 5000 rpm for 15-20 minutes at 4 ^o C in a Sorwall RC-3B centrifuge. The cell pellet was resuspended in 10 ml TE (10 ml Tris / HCl, 1 mm EDTA, pH 7.5), then pronase was added to 500 μg / ml and SDS to 1%. A sample was incubated at 37 ^{° C.} until a clear lysate was obtained. The lysate was gently extracted once with Tris-saturated phenol (pH 7.4) and once with Tris-saturated phenol / chloroform (1: 1) and once with chloroform. The final aqueous phase was dialyzed at 4 ^{° C.} for 24 hours against 1M NaCl and then for 24 hours against TE.

The EMBL3 library was obtained by partial digestion of SB33 chromosomal DNA with Sau3A I and subsequent fractionation by size either in the sucrose gradient of 10-30% on TNE (20 mM Tris / HCl, 5 mM NaCl, 1 mM EDTA, pH 8.0) or preparative gel electrophoresis. Fractions containing DNA fragments of more than 5 kb in length were collected, precipitated, and attached to the BAMH I arms of EMBL3 (Promega). The ligation mix was packaged using a Gigapack II packaging kit and introduced into E. coli cells. The library was expanded and stored at 4 ^{° C.} in the presence of 0.3% chloroform.

Plaques were placed on nitrocellulose filters for hybridization with ³² P-labeled nucleotide probes (3026.SL). The nucleotide sequence was ATGAAAAAAACACGTTTTGTATTAAATAGTATTGCACTTGG (SEQ ID NO: 3) corresponding to the N-terminus of the amino acid sequence MKKTRFVLNSIALG (SEQ ID NO: 19). Phage DNA was prepared from natural plaques and the introduced DNA was excised by digestion with Sal I and cloned into pUCS-BgXb digested with Sal I. Plasmids JB-1031-1-14 and JB-1068-2-2 (Fig. 1) were selected for further analysis.

 Example 2

 This example illustrates the characterization and sequence analysis of the hin47 gene and the deduced amino acid sequence of the Hin47 protein from NTHi strain SB33.

Restriction mapping and Sauthern blot analysis of clones JB-1031-1-14 and JB-1068-2-2 localized the hin47 gene on 4.7 kb BamH I / BamH I or 2.7 kb BamH I / Pst I DNA fragment. The 4.7 kb BamH I / BamH I fragment from JB-1068-2-2 was subcloned into the pUC8 / BgXb generating plasmid DS-755-1. A fragment of 3.1 kb BamH I to Xba I DS-755-1 was subcloned into pUC18 generating plasmid JB-1165-1, which has restriction sites suitable for the Erase-a-base (Promega) procedure (Fig. 1). This technique produces successful clones with increased truncation of the introduced DNA, with observable
deletions at the same end. The final complete set of clones can be quickly sequenced using a universal primer.

 The plasmid JB-1165-1 DNA was digested with BamH I and Sac I and subjected to exoIII digestion using the Erase-a-base kit. The final set of truncated plasmids was analyzed by agarose gel electrophoresis and representative plasmids were selected for sequence analysis.

Sequencing plasmid DNA was prepared according to the procedure of Holmes and Quigley, 1981, with modifications. Briefly, a cell pellet from 50 ml of culture was resuspended in 10 ml of STET (8% sucrose, 5% Triton X-100, 50 mM EDTA and 50 mM Tris / HCl, pH 8.0), then lysozyme was added to the mixture (2, 5 mg) and the mixture was boiled for 2 minutes. The sample was unscrewed at 14,000 rpm in a Sorvall RC 5B centrifuge for 20 minutes and the precipitate was precipitated with an equal amount of isopropanol, washed with 70% ethanol and then absolute ethanol, then dried to dryness with air. The pellet was resuspended in 0.9 ml TE, then 20 μl RNase I was added at a concentration of 5 mg / ml and then the mixture was incubated at 37 ^{° C.} for 15 minutes. After adding 500 μl of 1.5 M NaCl / 30% PEG, the mixture was incubated on ice for 30 minutes and DNA was precipitated by centrifugation in an Eppendorf microfuge for 10 minutes. The pellet was resuspended in 400 μl TE and extracted twice with Tris saturated phenol (pH 7.4), twice Tris saturated phenol / chloroform (1: 1) and twice with chloroform. DNA was precipitated by adding 40 μl of 3 M ammonium acetate and 1 ml of ethanol, washed with 70% ethanol and resuspended in distilled water.

 DNA samples were sequenced using an ABI DNA sequencer 370A model and terminal dye chemistry methods. A universal reverse primer was used together with a nested set of clones to determine the hin47 sequence encoding the strands. An oligonucleotide primer of approximately 25 bases long was used to confirm the sequence of the non-coding strand. The nucleotide sequence of the hin47 SB33 gene and the deduced amino acid sequence of the Hin47 protein are shown in FIG. 2. The nucleotide and amino acid sequence of the N-terminus of Hin47 presented at the ASM meeting, New Orleans, May 26, 1992, is characterized by low randomness, see FIG. 2. The amino terminal sequence of SB33 Hin47 and this presented sequence are identical, which establishes the identity of the cloned gene as hin47.

 Example 3

 This example describes the detection of the serine protease activity of the Hin47 protein.

 The deduced amino acid sequence of the Hin47 protein as defined above in Example 2 was compared with other known Genebank database proteins. As described above, the Hin47 protein described in PCT published applications WO 94/001149, WO 92/11367 and WO 92/110936 represents a Haemophilus adhesin molecule. Therefore, it was an amazing and unexpected discovery of the present invention that Hin47 has significant homology (55%) with the serine proteases of E. coli htrA and S. typhimurium htrA and other proteases. These amino acid sequence homologies are shown in FIG. 3 and 4. Moreover, it was found that the Hin47 protein is self-digesting, despite being stored in the presence of a serine protease inhibitor such as Pefablock.

 Example 4

 This example illustrates the formation of the mutant hin47 gene through site-directed mutagenesis.

 As explained above, H. influenzae Hin47, E. coli htrA, and S. typhimurium htrA are all serine proteases. The general sequence of all active centers of serine proteases GDSGGPK (SEQ ID NO: 18) [Brenner, 1988] with serine being the active residue. Both htrA proteins have the GNSGGAL sequence (SEQ ID NO: 17) and the H. influenzae Hin47 sequence is identical to the sequence between residues 195 and 201 of the mature protein. Thus, the serine residue at position 197 was selected for site-directed mutagenesis to obtain the Hin47 analog with reduced protease activity.

 The oligonucleotide CGCTCCACCAGCATTACCGCGG (SEQ ID NO: 22) was synthesized, which was supposed to replace the 197 serine residue with Alanine. The hin47 gene was cloned into clone M13mp18 of the generating clone DS-981-8 and mugagenesis was performed using the Amersham kit "In Vitro Site Directed Mutagenesis Kit". Clone DS-991-8 was confirmed by analysis of the mutation content of the replacement of Serin-197 with alanine. The mutant hin47 gene was designated hin47 *. Using suitable oligonucleotides, the serine residue 197 was replaced by cysteine (mutant S197C) and threonine (mutant S197T).

 In addition, comparison of the amino acid sequence of Hin47 with other proteases (as shown in Fig. 4) showed that the amino acids His-91 and Asp-121 are sites suitable for mutagenesis to obtain the Hin47 analog, with reduced protease activity. Using mutagenesis methods similar to those described above, His-91 and / or Asp-121 were removed or replaced with various amino acids. Such amino acid substitutions included His-91 with Alanine (mutant H91A) and Arginine (mutant H91R) and Asp-121 with Alanine (mutant D121A) and Glutamic acid (mutant D121E). Oligonucleotides for obtaining such mutagenesis included: His-91 -> Ala-91 5 'ATCAATAACAGCATATGGT 3' (SEQ ID NO: 21) Asp-121 -> Ala121 5 'TAATGCAATTGCTGATAGTTC 3' (SEQ ID NO: 22).

 Appropriate nucleotides were used for other mutations. Multiple mutations were also obtained in which His-91 and Ser-197 were both replaced with Alanine (mutant H91A / S197A) and His-91, Asp-121 and Ser-197 were all replaced with Alanine (mutant H91A / D121A / S197A )

 These additional mutants were obtained, isolated, purified and tested for protease activity, as described for Hin47 * material in the following examples.

 Many serine proteases are secreted in an inactive ('zymogen') form and a notch is required to manifest their active sites. Analysis of the N terminal sequence of the mature natural protein Hin47 confirms that cleavage of the preprotein is observed at the KFFFG DRFAAEQ position (SEQ ID NO: 23). Modifications of amino acids that prevent the cleavage of a molecule to produce an active protease molecule can produce an analog of Hin47, which has reduced protease activity.

 Example 5

 This example illustrates the construction of plasmids expressing the analog Ser-197 -> alanine Hin47 E. coli.

 The mutated hin47 * gene from plasmid DS-91-8 was cloned into the pT7-7 expression vector to obtain plasmid DS-1011-1-1 (Fig. 5). The E. coli strain BL21 / DE3 was transformed to obtain E. coli strain DS-1018-3-1, which expresses the analog Ser-197 -> Hin47 alanine after induction.

 In order to use tetracycline selection, the hin47 * gene was cloned into pBR328. A fragment of the Bgl II / CIa I T7 / hin47 * gene from DS-1011-1-1 was cloned into pEVvrfl (Young and Davis, 1985) in order to produce a Bgl II / BamH I fragment that should be cloned into pUC-4K (Pharmacia) digested with BamH I. The final clone DS-1034-3 was digested with TcoR I and the T7 / hib47 * gene fragment was cloned into pBR328 (Boehringer Mannheim Corporation) to obtain plasmids DS-1048-2 and DS-1067-2 . Electroporation of the DNA plasmid into E. coli strain BL21 / DE3 yields strains DS-1071-1-1 and DS-1071-3-1, which express the Ser-197 -> alanine analog of Hin47.

 Example 6

 This example illustrates the expression of the Ser-197 -> alanine Hin47 analog from E. coli.

Overnight cultures of strains DS-1018-3-1, DS-1071-1-1 or DS-1071-3-1 were grown overnight in NZCYM medium + 3% dextrose + antibiotics (ampicillin at a concentration of 25 μg / ml or tetracycline concentration of 10 μg / ml) at 37 ^o With shaking. A diluted 1: 40 overnight culture was inoculated into the same medium and grown at 37 ^{° C.} with shaking until an absorption of A _{578 of} approximately 0.3. Then, 1/10 volume of 10% lactose was added to induce expression from the T7 promoter. Cell samples were collected 4 hours after induction by centrifuging the culture samples at 5000 rpm for 10 min at 4 ^{° C.} in a Sorvall RC-3B centrifuge.

 Example 7

 This example illustrates the extraction and purification of Hin47.

 Hin47 was expressed as a soluble protein in E. coli. The cell pellet from a 250 ml culture prepared as described in Example 6 was suspended in 40 ml of 50 mM Tris / HCl, pH 8.0 and destroyed by sonication (3 x 10 min, 70% load cycle). The extract was centrifuged at 20,000 x g and the final supernatant was retained, which contained> 95% soluble Hin47 protein. This fraction was named "Hin47 Extract."

This Hin47 extract was further purified on a DEAE Sephacel column. 40 ml of Hin47 extract was applied to a 20 ml column with DEAE Sephacel equilibrated with 50 mM Tris / HCl, pH 8.0. Hin47 binds to the column under these conditions. The column was washed with 100 ml of 50 mM Tris / HCl, pH 8.0, containing 20 mM NaCl. Then, Hin47 was eluted with 50 mM Tris / HCl, pH 8.0, containing 40 mM NaCl. The amount of Hin47 in the fractions was determined by measuring the BSA protein. Hin47 purity was evaluated by SDS-PAGE analysis. Fractions containing Hin47 were combined and stored at -20 ^o C.

 Only the H91A mutant was also soluble, as was the wild-type Hin47 protein; most of the other mutants were obtained as inclusion bodies.

 Example 8

 This example illustrates the extraction and purification of the Hin47 Ser-197 -> alanine analog.

An analog of Hin47 Ser-197 -> alanine was expressed in inclusion bodies in E. coli. Cell pellet obtained from 250 ml of culture, prepared as described in Example 6, was resuspended in 40 ml of 50 mM Tris / HCl, pH 8.0, and disrupted by scoring (3 x 10 min, 70% load cycle). The extract was centrifuged at 20,000 x g and the final pellet was retained. The precipitate was re-extracted with 40 ml of 50 mM Tris / HCl, 0.5% Triton X-100, 10 ml EDTA, pH 8.0. The suspension was voiced for 10 min, 70% load cycle. The extract was centrifuged at 300 x g for 5 minutes. The resulting supernatant was centrifuged again at 20,000 x g for 30 minutes and the final pellet was retained. The precipitate was resuspended in 50 mM Tris / HCl, 0.5% Triton X-100, 10 mM EDTA, pH 8.0. Then the suspension was mixed in 50 mm Tris / HCl, pH 8.0, containing 8 M urea. The final concentration of urea in the mixture was adjusted to 2 M 50 mM Tris / HCl, pH 8.0. The Hin47 Ser-197 -> alanine analog was completely dissolved under these conditions. The final solution volume was 20 ml. This fraction is called "Hin47 analog extract.""Hin47 analog extract" was further purified on a column with DEAE Sephacel. 20 ml of “Hin47 analog extract” were applied to a 10 ml column with DEAE Sephacel, equilibrated with 50 mM Tris / HCl, pH 8.0. The Hin47 Ser-197 -> alanine analog binds to the column under these conditions. The column was washed with 50 mM Tris / HCl, pH 8.0, and the analogue was eluted with 50 mM Tris / HCl, pH 8.0, containing 30 mM NaCl. The amount of Hin47 analog in fractions was determined by measuring the BSA protein. The purity of the Hin47 analog was evaluated by SDS-PAGE analysis (Fig. 6). Fractions containing an analog of Hin47 were combined and stored at -20 ^o C.

 Example 9

 This example illustrates the protease activity of Hin47 and Ser-197 -> alanine of the Hin47 analog.

The enzymatic activity of Hin47 and Ser-197 -> alanine of the Hin47 analog was analyzed using beta-casein as a substrate (Fig. 7). The reaction mixture contained 5 μg betta-casein and Hin47 or an analog of Hin47. The reaction was carried out at 37 ^{° C.} for two hours and then stopped by adding SDS buffer and immediately boiling the sample at 100 ^{° C.} for 5 minutes. Aliquots were analyzed by SDS-PAGE. As shown in FIG. 7, hydrolysis of beta-casein under the action of Hin47 was more pronounced after two hours (panel A, line 1) compared to fractions containing the Hin47 analog (panel A, line 2) or without the addition of exogenous proteins (panel A, line 3). The presence of Hin47 and an Hin47 analog in the mixture was confirmed by immunoblotting using a monoclonal antibody to Hin47 (Fig. 7, panel C, lines 1 and 2).

The protease activities of Hin47 and the Hin47 analog Ser-197 -> alanine were compared by analyzing the autohydrolysis of Hin47 and the Hin47 analog at 4 ^° C and at -20 ^° C. The purified Hin47 or Hin47 analog was stored either at 4 ^° C or at -20 ^° C up to 20 days. On day zero, 10 and 20, aliquots were selected and the stability of Hin47 or the Hin47 analog was analyzed by immunoblotting using monoclonal antibodies to Hin47 (Fig. 8). The analog was significantly more stable than Hin47, up to 20 days when stored both at 4 ^o C and at -20 ^o C.

To further study the protease activity of the Hin47 analog Ser-197 -> alanine, the ability of Hin47 or analog to cleave the 80-kDa recombinant H. influenzae antigen was investigated. Similarly, a mixed antigen was studied to determine the proteolytic effect of Hin47 or an Hin47 analog on other antigens. For this study, a recombinant protein (TBP1) of 80 kDa H. influenzae was selected in order to distinguish it from Hin47 or an analogue protein (47 kDa). The following five mixtures were made: protein 80 kDa without additives; protein 80 kDa + Hin47; protein 80 kDa + analogue; Hin47 no additives; analogue without additives. The amount of each protein in the mixture was 5 μg. The mixture was stored at 4 ^{° C.} for four weeks. Aliquots were selected on days 0, 7, 14 and 28 for analysis by SDS-PAGE (Fig. 9). Both 80 kDa and Hin47 proteins were noticeably cleaved after one week (lines 2 and 4). In contrast, the 80 kDa protein in combination with the Hin47 analogue remained intact after one week, and only four weeks later showed slight degradation (direct 3).

 The residual protease activity of other Hin47 analogues was determined by cleavage of betta-casein as described by Lipinska et al (ref. 13), the results of which are shown in Table 3. It was found that only one mutant (D121E) retained serine protease activity.

 Example 10

 This example illustrates the comparative immunogenicity of Hin47 and the Hin47 analog in mice.

In FIG. 10 presents the results of a study to determine the comparative immunogenicity of Hin47 and an analog of Hin47 Ser-197 -> alanine. For example, groups of five Balb / c mice were injected three times (as indicated by arrows) subcutaneously on days 1, 29, and 43 at a dose of 1 μg of either Hin47 or the Hin47 analog in the presence of AlPO ₄ (1.5 mg per dose ) Blood samples were taken on days 14, 28, 42 and 56 (as indicated by 1, 2, 3 and 4 blood samples, respectively) to analyze the titer of anti-Hin47 antibodies by ElAs. Determination of anti-Hin47 antibodies in mouse serum was performed as described by Panezutti et al. (1993). Microtiter cells coated with 1 μg of either Hin47 or Hin47 analog for 16 hours at room temperature. The plates were then formed with 0.1% (w / v) bovine serum albumin in PBS. Serum of mice was serially diluted, added to the cells, then incubated for one hour at room temperature. Affinity purified F (ab ') ₂ anti-mouse IgG (Fc specific) antibody fragments conjugated to horseradish peroxidase were added as a second antibody. The reaction was carried out using tetramethylbenzidine (TMB / H ₂ O ₂ ) and absorbance was measured at 450 nm (using 540 nm as the comparison wavelength) on a Flow Multiskan MCC microplate reader. The antiserum reactivity titer was determined as reverse dilution, sequentially showing a twofold increase in absorption over that obtained with pre-taken blood samples. As can be seen from FIG. 10, both Hin47 and the Hin47 analogue revealed comparable titers in mice, whether either Hin47 or a mutant was used as an antigen in ElAs.

 Immunogenicity studies were also conducted using the H91A analog of Hin47. It was found that this analogue gives an immune response equivalent to the response of the Hin47 analog S197A.

To further study the immune response to Hin47 or Ser-197 -> alanine, an analog of Hin47, subclasses of anti-Hin47 IgG in mouse serum were determined. Microtiter cells were coated with 1 μg of purified Hin47 or analog. The final selection of mouse serum samples from a comparative immunogenicity study (as described above) was collected and tested by ElAs. Rat anti-mouse IgG ₁ , IgG _2a and IgG _2b conjugated to horseradish peroxidase and rabbit anti-mouse IgG ₃ conjugated to horseradish peroxidase were used as reagents in ElAs. Working dilutions of each conjugate were determined using purified subclass antibodies to avoid cross-reactivity. Reactivity titers were determined as described above. As shown in Table 1 below, the IgG subclass profile generated in both Hin47 and Hin47 analog mice were identical, regardless of whether they were used as solid antigen in Hin47 EIAs or Hin47 analog. The predominant IgG response in both groups of mouse serum was the IgG ₁ isotype. Therefore, the Hin47 analog exhibits essentially the same immunogenic properties as the natural protein.

 Example 11

 This example illustrates the immunoprotective properties of Hin47 and Ser-197 -> alanine analogue Hin47.

 The immunoprotective properties of Hin47 and Ser-197 -> alanine of the Hin47 analog were analyzed by the ability of specific Hin47 serum to protect rat young rats from H. influenzae type b strain MinnA in a bacterial model. The results of this study are presented in Table 2 below. Groups of 6-day-old Wistar rat pups were injected subcutaneously (SC) in the back next to the neck with 0.1 ml of either rabbit antiserum to the anti-Hin47 analogue or the corresponding pre-taken serum. Twenty-four hours later, animals were injected intraperitoneally (b.p.) with 700 CFU of freshly grown Hib strain MinnA. Blood samples were collected 24 hours after administration and placed in chocolate agar plates. Bacterial colonies were counted after 24 hours. As shown in table 2, three out of nine animals in the group that was injected with the antiserum to the anti-Hin47 analog did not show any bacteremia in the blood. Only one mouse in the group that was injected with the antiserum to the anti-Hin47 analogue (11%) had a high bacterial yield from blood samples compared to mice that were injected with pre-taken serum. In contrast, bacteria emerged in all nine mice that were injected with pre-taken serum. Four out of nine animals (44%) in the group that was injected with pre-taken serum, showed a high level (from 500 to 1000) of the output of bacteria in blood samples.

 The rat pup bacteremia model was used to evaluate the protection given by anti-Hin47 antiserum or mutant anti-Hin47 antiserum against bacteremia caused by H. influenzae type b infection. 6 out of 10 rat pups were protected with antiserum obtained against each of the wild-type Hin47, H91A Hin47 and S197A Hin47 analogues.

 Example 12

 This example illustrates the induction of Hin47 under stressful conditions.

The strain Eagan H. influenzae was grown at 37 ^° C to A ₅₉₀ = 0.3 on a brain heart infusion broth (BHI) containing hemin (2 μg / ml) and NAD (2 μg / ml). Samples were aliquoted and grown at 37 ^° C, 42 ^° C and 43.5 ^° C or in the presence of 6% ethanol, 0.2 M NaCl or 0.3 M NaCl. The strain E. coli JM109 was grown at 37 ^{° C.} to A ₅₉₀ ≈ 0.3 in YT medium and aliquoted as described. Samples were collected at 0 min, 20 min, 40 min, 60 min and 90 min and analyzed by OD and SDS-PGE / Western blot. Guinea pig antiserum was used for Western blot analysis, which recognizes both H. influenzae and E. coli htrA. The E. coli htrA protein was produced in large quantities when the body was grown at 43.5 ^° C, while the H. influenzae Hin47 protein was observed in small quantities. Both E. coli htrA and H. influenzae Hin47 proteins were induced when grown in medium containing 6% ethanol. High salt concentrations were insufficient for the induction of other proteins. These results indicate that the Hin47 protein is a stress-dependent protein in H. influenzae, which is inducible under similar conditions as the E. coli htrA protein.

 Example 13

 This example illustrates the purification of H91A Hin47 protein.

The soluble mutant H91A was purified predominantly as described for wild-type Hin47 in Example 7 with the addition of a hydroxylappatite (HAP) column. The HAP column was balanced with 10 mM sodium phosphate buffer (pH 8.0) and coated with material driven through a DEAE column. H91A Hin47 bound to the column, and impurity proteins were removed by washing the column with 175 mM sodium phosphate buffer. Protein H91A Hin47 was suirable 300 mm sodium phosphate buffer (pH 8.0) and stored at -20 ^o C.

 Example 14

 This example illustrates the study of the protective effects of Hin47 and the mutant Hin47 in a model of otitis in chinchillas.

Chinchillas (500 g weight) were immunized with m. three times at 30 μg / dose of Hin47 or with a Hin47 mutant (H91A or S197A) with an adjuvant with AlP0 ₄ and on days 1, 28 and 42. Animals were selected on day 56 for bloating in organisms with 50-1000 CFU of virulent NTHi strain SB12. Animals were monitored by tympanometric and otoscopic examination, and on day 4 after selection, aspirated fluid from the middle ear and placed on chocolate agar. Bacterial colonies were counted after 24 hours. The wild-type proteins Hin47 and H91A Hin47 provided protection in 50% of the animals, however, S197A Hin47 was ineffective in this model (table 3).

Conclusion
To conclude the present description, the present invention relates to new analogues of the Hin47 protein of Haemophilus influenzae, which have a reduced protease activity of less than 10% of the activity of the natural Hin47 protein, as well as to isolated and purified DNA molecules encoding them. Modifications are possible within the scope of the present invention.

List of references
1. Zangwill et al, 1993. MMWR 42: 1-15.

 2. Schoendorf et al, 1994. Pediatrics 93: 663-8.

 3. Brenner et al, 1988. Nature 334: 528-530.

 4. O'Hagan, 1992. Clin. Pharmokinet. 22: 1-10.

 5. Ulmer et al, 1993. Curr. Opinion Invest. Drugs 2: 983-989.

 6. Chang et al, 1978. Nature 275: 617.

 7. Goeddel et al, 1980. Nucl. Acid Res. 8: 4057.

 8. Harkness et al, 1992. J. Bacteriol. 174: 2425-2430.

 9. Loeb et al, 1987. Infec. Immun. 55: 2612-2618.

 10. Holmes and Quigley, 1981. Analyt. Biochem. 114: 193-197.

 11. Young and Davis, 1985. Gene 38: 31-38.

 12. Panezutti et al, 1993. Infec. Immun. 61: 1867-72.

 13. Lipinska et al, 1985. Bacteriol. 171: 1574-1584.

 14. Barenkamp et al, 1986. Infect. Immun. 52: 572-578.9

Claims (18)

 1. An isolated and purified analogue of the Hin47 protein of Haemophilus influenzae, which has a reduced protease activity of less than 10% of the activity of the native Hin47 protein, and in which at least one amino acid of the native Hin47 protein responsible for the protease activity is deleted or replaced by another amino acid or at least one amino acid is introduced into the native Hin47 protein to provide this reduced protease activity.  2. The analogue according to claim 1, characterized in that it has essentially the same immunogenic properties as the native Hin47 protein.  3. An analogue according to claim 1, characterized in that one said deleted or substituted amino acid is selected from amino acids 195-201, His-91 or Asp-121 of the native Hin47 protein.  4. An analogue according to claim 3, characterized in that one of the specified amino acid is Ser-197.  5. An analogue according to claim 4, characterized in that Ser-197 is replaced by alanine, cysteine or threonine.  6. An analogue according to claim 3, characterized in that at least one of said amino acids is His-91, which is replaced by alanine, lysine or arginine.  7. An analogue according to claim 3, characterized in that at least one of said amino acids is Asp-121, which is replaced by alanine.  8. An analogue according to claim 1, characterized in that the amino acids are selected from His-91 and Ser-197 or His-91, Asp-121 and Ser-197, which can be removed or replaced with alanine.  9. Chimeric molecule containing an analogue according to any one of paragraphs. 1-8 associated with the polysaccharide.  10. Recombinant plasmid DS-1011-1-1 (pT7 / Hin47 *) ATCC N 75845, carrying a nucleic acid molecule expressing the Hin47 protein analogue in which Ser-197 is replaced with alanine.  11. A method of obtaining an analog of the Hin47 protein of Haemophilus influenzae, which has a reduced protease activity of less than 10% of the activity of the native Hin47 protein, and in which at least one amino acid of the native protein Hin47, responsible for the protease activity, is removed or replaced with another an amino acid or at least one amino acid is introduced into the native Hin47 protein to provide said reduced protease activity, including the identification of at least one amino acid residue of the Hin47 protein responsible for its protease activity; the implementation of site-directed mutagenesis of the hin47 gene to remove or replace a nucleotide sequence encoding at least one of the specified amino acids to obtain a mutant hin47 gene; introducing a mutant hin47 gene into a cell to obtain a transformed cell; and culturing the transformed cell to obtain an analog of Hin47.  12. The method according to p. 11, characterized in that the introduction of a mutated hin47 gene allows you to obtain a transformed cell in which the mutant hin47 gene is under the control of the T7 promoter, and the cultivation of the transformed cell and expression of the Hin47 analog under the control of the specified promoter is carried out by culturing in the presence of inducing lactose concentration.  13. The method according to p. 12, characterized in that the introduction of the mutant hin47 gene is carried out by transforming the indicated cell with the recombinant plasmid DS-1011-1-1 (pT7 / Hin47 *) ATCC N 75845.  14. The method according to any one of paragraphs. 11-13, characterized in that the specified stage of cultivation allows to obtain transformed cells, including inclusion bodies, containing an analog of Hin47, and further includes the destruction of these cultured transformed cells to obtain a supernatant and these inclusion bodies, solubilization of these inclusion bodies to obtain a solution containing an analog Hin47, chromatographic purification of the indicated Hin47 analog from the indicated solution containing no cell residues, and isolation of the indicated Hin47 analog.  15. A vaccine against diseases caused by pathogenic bacteria of the species Haemophilus influenzae, containing an immunologically effective amount of the Hin47 analogue described in paragraphs. 1-8.  16. A method for determining the presence of antibodies that specifically recognize the Hin47 protein in a sample, comprising the steps of: (a) interacting the sample with a Hin47 analog described in any one of claims. 1-8 to obtain complexes containing an analog of Hin47 and these specific antibodies specifically recognizing it, if any, are present in the sample; (b) determining the formation of complexes.  17. A method for determining the presence of a Hin47 protein in a sample, comprising the steps of: (a) immunizing a non-human subject with the vaccine described in claim 15 to produce antibodies specific for the Hin47 protein; (b) interaction of the sample with antibodies to obtain complexes containing the Hin47 protein, if present in the sample, and said specific antibodies to the Hin47 protein; (c) determining the formation of complexes.  18. A diagnostic kit for determining the presence of antibodies in a sample that specifically recognizes a Hin47 protein, comprising: (a) an analogue of the Hin47 protein, characterized in any one of paragraphs. 1-8; (b) means for reacting the analog with the sample to produce complexes containing the analog and said antibody, if any, in the sample; and (c) means for determining the formation of complexes.

Images