RU2193065C2 - Dna structure (variants), dna-vector, immunogenic composition against influenza virus, method of immune response induction, vaccine and method of vaccination - Google Patents

Abstract

FIELD: genetic engineering, immunology, molecular biology, pharmacy. SUBSTANCE: DNA structures involve genes encoding human influenza virus proteins: nucleoprotein, hemaglutinin, matrix protein. Vector V1Jns is used as structure base involving cytomegalovirus promoter with intron A sequence, transcription termination region of bovine growth hormone with fused unique site Sfi I, region of replication onset and kanamycin resistance gene. In administration in subject tissues DNA structures as components of immunogenic composition or vaccine express gene products of influenza virus that can provide immune protection from infection with homologous or heterogeneous strains of influenza virus. Invention ensures to provide a long time acting cross-reactive immunity against influenza virus and can be used in preparing pharmaceutical preparations providing immune protection against influenza virus. EFFECT: improved method of induction and vaccination, valuable medicinal properties. 8 cl, 51 dwg, 7 tbl, 15 ex

Description

 The invention relates to the preparation and use of a new pharmaceutical product: nucleic acid, which, when directly introduced into the tissue of a living vertebrate, causes the formation of immune responses that specifically recognize the human influenza virus.

 Influenza is an acute febrile illness caused by an infection of the respiratory tract with influenza A or B viruses. Outbreaks of influenza occur around the world almost every year with periodic epidemics or pandemics. Influenza can cause significant general symptoms, serious illnesses (such as viral pneumonia) requiring hospitalization, and complications such as secondary bacterial pneumonia. Recent epidemics in the United States are believed to have led to more than 10,000 (up to 40,000) deaths per year and 5,000 to 10,000 deaths per year in non-epidemic years. The best strategy to prevent influenza-related morbidity and mortality is vaccination. Currently licensed vaccines are obtained from a virus grown in eggs and then inactivated. Vaccines include three viral strains (two A strains and one B strain). Three types of vaccines are suitable: those containing the whole virus, subvirion, and purified surface antigen. Only the last two are used for children because of the increased febrile responses when using the whole virus vaccine. Children under 9 years of age require two immunizations, while adults need only a single injection. However, it has been suggested [see Medical Letter 32: 89-90, Sept. 17, 1993] that “patients vaccinated in early autumn benefit from a second dose in winter or early spring,” based on observations from elderly patients. Antibody titers after vaccination can be reduced to levels below protective within four or less months. These vaccines are re-prepared each year based on a prediction of which of the new viral strains will be clinically distributed, and on the basis of an assessment of which of the new virulent strains is expected to prevail in the coming flu season. Recommended annual revaccination.

The disadvantages of a licensed vaccine are:
1) Antigenic variability, in particular in influenza A strains, leads to the appearance of viruses that are not neutralized by antibodies produced by the previous vaccine or with a previous infection. New strains result from point mutation (antigenic drift) and recombination (antigenic variation) of genes encoding surface glycoproteins (hemagglutinin [HA] and neuraminidase), while internal proteins are highly conserved in strains with antigenic drift and antigenic variability. Immunization induces a “homologous” strain-specific antibody-mediated immunity, but not “heterologous,” group-mediated immunity based on cell-mediated immunity.

 2) Even if the prevailing spreading strains of the influenza virus do not show significant antigenic drift or antigenic variation from one year to another, immunization should be carried out every year due to a decrease in antibody titers. Although some researchers have reported that hemagglutination inhibitory (HI) and neutralizing antibodies persist for months to years, followed by a gradual decrease, the Advisory Committee on Immunization considers a decrease in antibody titers over the next year after vaccination is sufficient reason for annual immunization, even if there was not a large antigenic drift or antigenic variation. (HI antibodies inhibit the ability of the influenza virus to agglutinate red blood cells. Like neutralizing antibodies, they are primarily directed against the HA antigen. Hemagglutination inhibition tests are easier and cheaper to perform than neutralization tests and, therefore, are more often used as a means to assess the ability of antibodies produced against one of the strains of the influenza virus, react with a different strain.) As mentioned above, the Medical Letter suggests that certain older individuals are at high risk of becoming ill Studies should be vaccinated twice a season due to short-lived protective titers of antibodies.

 3) The effectiveness of the vaccine is suboptimal. The development of the vaccine for the next season is based on predicting the expected propagating strains (through an on-site randomized trial in Asia), the forecasting may be inaccurate and may lead to poor match between the strains used for the vaccine and the strains really spreading in this space. In addition, as happened during the 1992-1993 flu season, the new H3N2 strain (A / Beijing / 92) became clinically detectable during the last phase of this flu season. This required a rapid change in the composition of the 1993-1994 vaccine due to weak cross-reactivity with A / Beijing / 92 antibodies induced by the previous H3N2 strain (A / Beijing / 89) due to antigenic drift. However, due to the long period of time required to prepare the currently licensed vaccine, a new strain of the vaccine could not be introduced during the 1992-1993 season, despite the evidence of poor protection when using the then existing vaccine and the increased virulence of the new spreading strain of H3N2 .

 Even when the vaccine and the spreading strains are well suited to each other, a licensed vaccine prevents the disease in only about 70% of children and youth and in 30-40% of weak old people. Therefore, other criteria are used to prove the effectiveness of the vaccine when the vaccine strains correspond to the circulating strains. These criteria include the prevention of serious illness and secondary complications, which is reflected in the prevention of hospitalization (70% for older people living at home, compared with 50-60% of older people living in nursing homes and disabled people), and the prevention of death (80% for residents of nursing homes). The immunity of the population to reduce the spread of infection in a nursing home is seen as another advantage of immunization.

Characteristics of an ideal universal influenza vaccine (objectives of the invention)
1) Generation of a common (heterologous) protection for all groups. A universal vaccine should be able to protect against different strains, for example, within the subtype of H3N2, and possibly even in the case of cross subtypes, for example from H1N1 to H3N2. Protection probably should be mediated by cytotoxic T-lymphocytes (CTLs) that recognize antigens from internal conserved viral proteins, although neutralizing antibodies directed against the conserved parts of membrane-bound proteins can also play a role.

 2) The increased breadth of the response in the form of antibodies. Since CTL is believed to play a role in recovery, a vaccine based on the CTL response alone should probably shorten the duration of the disease (potentially before the disease becomes preclinical (asymptomatic), but it could not completely prevent the disease. It was experimentally shown that the method for producing an influenza vaccine by passage in eggs is able to select subpopulations of the virus with altered HA antigenicity, and as a result, the effectiveness of the vaccine could be reduced, because the antibodies induced by this vaccine otherwise, they may not be completely effective against the prevailing circulating strain. , which was used by A / Beijing / 89, generated antibodies that were weakly reactive cross-linked (and less protective) against the new strain A / Beijing / 92, which was also more virulent. Both strains are H3N2, i.e. belong to the same subtype. In amino acid sequence, however, A / Beijing / 92-like strains differ from A / Beijing / 89-like strains in only 11 point mutations (positions 133, 135, 145, 156, 157, 186, 190, 191, 193, 226 and 262) in the area of NAI. It is not known whether the current vaccine manufacturing process has affected the lack of cross-reactivity, but it is obvious that an improvement in the breadth of antibody response is desired.

 3) The increased duration of the response in the form of antibody formation. Since one of the groups that pose the greatest risk to influenza morbidity and mortality (older people) is also the group in which protective titers of antibodies can decrease too quickly for annual immunization to be effective, an improved vaccine must generate protective titers of antibodies, lasting longer.

Polynucleotides as a vaccine
It was shown that intramuscular inoculation of polynucleotide constructs, i.e., DNA of plasmids encoding proteins, leads to the in situ formation of this protein in muscle cells. By using cDNA plasmids encoding viral proteins, they generated a response both in the form of antibodies and in the form of CTL, providing homologous and heterologous protection against subsequent infection with homologous or cross-protection with respect to the strains, respectively. Each of these types of immune responses represents a potential advantage over existing vaccination strategies. The use of polynucleotide vaccines (PNV) for the formation of antibodies can lead to an increase in the duration of antibody production, as well as to provide an antigen that can have both the exact sequence of a clinically circulating strain of the virus and the correct post-translational modifications and conformation of the native protein (compared to the recombinant protein) . Generating CTL responses in this way provides cross-protection advantages with respect to protection strains without the need for a live pathogenic vector or attenuated virus.

 Thus, the main incentive to develop vaccines against viruses such as the influenza virus, against which neutralizing antibodies are generated, is the diversity of the envelope proteins of the virus among different isolates or strains. Since cytotoxic T lymphocytes (CTLs) in mice and humans are able to recognize epitopes derived from conserved internal viral proteins [J. W. Yewdell et al., Proc. Natl. Acad Sci. (USA) 82, 1785 (1985); A.R.M. Townsend, et al., Cell 44, 959 (1986); A.J. McMichael et al., J. Gen. Virol. 67, 719 (1986); J. Bastin et al., J. Exp. Med. 165, 1508 (1987); A.R.M. Townsend and H. Bodmer, Annu. Rev. Immunol. 7, 601 (1989)], and are considered important in the immune response to viruses [Y.-L. Lin and B.A. Askonas, J. Exp. Med. 154,225 (1981); I. Gardner et al., Eur. J. Immunol. 4, 68 (1974); K.L. Yap and G.L. Ada, Nature 273, 238 (1978); A.J. McMichael et al. , New Engl. J. Med. 309, 13 (1983); P.M. Taylor and B.A. Askonas, 58, 417 (1986)], efforts have been directed towards the development of CTL vaccines capable of providing heterologous protection against various viral strains.

CD8 ⁺ CTL kills virus-infected cells when their T-cell receptors recognize viral peptides associated with class I MHC molecules (main tissue compatibility system) [RM Zinkernagel and PC Doherty, ibid. 141, 1427 (1975); RN Germain, Nature 353-605 (1991)]. These peptides are derived from endogenously synthesized viral proteins, regardless of the location or function of the protein within the virus. Therefore, by recognizing epitopes from conserved viral proteins, CTLs can provide cross-protection against strains. Peptides capable of association with MHC class I, recognizable by CTL, are derived from proteins present in or through the cytoplasm or endoplasmic reticulum [JW Yewdell and JR Bennink, Science 244, 1072 (1989); ARM Townsend et al., Nature 340, 443 (1989); JG Nuchtern et al., Ibid. 339, 223 (1989). Thus, exogenous proteins entering the nucleolar processing pathway (as in the case of antigens represented by MHC class II molecules) are not effective in generating CD8 ⁺ CTL responses.

 Most attempts to generate CTL responses have used replicating vectors to generate protein antigen within the cell [J.R. Bennink et al., Ibid. 311, 578 (1984); J.R. Bennink and J.W. Yewdell. Curr. Top Mecrobiol. Immunol. 163, 153 (1990); C.K. Stover et al., Nature 351, 456 (1991); A. Aldovini and R.A. Young, Nature 351, 479 (1991); R. Schafer et al., J. Immunol. , 149, 53 (1992); C.S. Hahn et al., Proc. Natl. Acad Sci. (USA) 89, 2679 (1992)] or they focused on introducing peptides into the cytosol [F.R. Carbone and M.J. Bevan, J. Exp. Med. 169, 603 (1989); K. Deres et al., Nature 342, 561 (1989); H. Takahashi et al., Ibid. 344, 873 (1990); D.S. Collins et al. , J. Immunol. 148, 3336 (1992); M.J. Newman et al., Ibid. 148, 2357 (1992)]. Both of these approaches have disadvantages that can reduce their use for vaccines. Retroviral vectors have limitations on the size and structure of polypeptides that can be expressed as fusion proteins while maintaining the ability of the recombinant virus to replicate [A. D. Miller, Curr. Top Microbiol. Immunol. 158, 1 (1992)], and the effectiveness of vectors, such as vaccinia virus, for subsequent immunizations can be weakened by immune responses against the vectors themselves [E. L. Cooney et al., Laucet 337, 567 (1991)]. In addition, viral vectors and modified pathogens are in themselves dangerous, which may interfere with their use in humans [R.R. Redfield et al., New Engl. J. Med. 316, 673 (1987); L. Mascola et al., Arch. Intern. Med. 149, 1569 (1989)]. In addition, the choice of peptide epitopes depends on the structure of MHC antigens of individuals and, therefore, peptide vaccines may have limited effectiveness due to the diversity of MHC haplotypes in outbreeding populations.

Benvenisty, N. and Reshef, L. [IPNAS 83, 9551-9555 (1986)] showed that precipitated CaCl ₂ DNA introduced into mice intraperitoneally, intravenously or intramuscularly could be expressed. It has been shown that intramuscular (im) injection of expressing DNA vectors in mice results in uptake of DNA by muscle cells and expression of the protein encoded by this DNA [JA Wolff et al., Science 247, 1465 (1990); G. Ascadi et al., Nature 352, 815 (1991)]. It was shown that these plasmids were stored in episomes and were not replicated. Persistent expression was then observed after im injection into the skeletal muscle of rats, fish and primates, and into the cardiac muscle of rats [H. Lin et al., Circulation 82, 2217 (1990); RN Kistis et al., Proc. Natl. Acad Sci. (USA) 88, 4138 (1991), E. Hansen et al., FEBS Lett. 290, 73 (1991); S. Jiao et al., Hum. Gene Therapy 3, 21 (1992); JA Wolff et al., Human Mol. Genet. 1, 363 (1992)]. The method of using nucleic acids as therapeutic agents was reported in WO 90/11092 (October 4, 1990), in which polynucleotides were used to vaccinate vertebrates.

 For the success of the method, it is not necessary that the immunization be intramuscular. So, Tang et al. [Nature, 356, 152-154 (1992)] found that the introduction of gold microprojectiles coated with bovine growth hormone coding DNA (BGH) into the skin of mice led to the formation of anti-BGH antibodies in mice. Turth et al. [Analytical Biochemistry, 205, 365-368 (1992)] showed that a jet injector could be used to transfect muscle, adipose, and mammary tissue of living animals. A review of the various methods of introducing nucleic acids was recently made by Friedman, T. [Science, 244, 1275-1281 (1989)]. See also Robinson et al., Abstracts of Papers Presented at the 1992 Meeting of Modern Approaches to New Vaccines, Including Prevention of AIDS, Cold Spring Harbor, p. 92, which states that intramuscular, intraperitoneal, and intravenous administration of avian influenza DNA DNA provided protection against lethal infection. However, there was no indication of which bird flu virus genes were used. In addition, only H7-specific responses were mentioned without mentioning the induction of cross-protection with respect to different strains of protection.

 Thus, this invention contemplates any of the known methods for introducing nucleic acids into living tissues to induce protein expression. The present invention provides a method for introducing viral proteins into an antigen processing pathway to generate virus-specific CTLs. This invention satisfies the need for specific therapeutic agents capable of eliciting the desired prophylactic immune responses against viral pathogens (for influenza virus). Of particular importance in this therapeutic approach is the ability to induce T-cell immune responses that can prevent infections even when the viral strains are heterologous with respect to the strain from which the antigen gene is derived. Thus, this invention provides DNA constructs encoding viral proteins of a human influenza virus; nucleoprotein (NP), hemagglutinin (HA), neuraminidase (NM), matrix protein (M), non-constructive protein (NS), polymerase (PB1 and PB2 - basic polymerases 1 and 2; RA - acid polymerase) or any other influenza virus genes encoding products that generate specific CTLs.

 The influenza virus has an RNA genome consisting of multiple segments of RNA (ribonucleic acid). Each RNA encodes at least one gene product. The NP gene product binds to RNA and transfers viral RNA to the nucleus of an infected cell. This sequence is conservative, only about 7% of the divergence of the amino acid sequence occurs over a period of 50 years. Gene P products (PB1, PB2, RA) are responsible for the synthesis of new viral RNAs. These genes are even more conserved than the NP gene. HA is the main gene product of the envelope of the virus. It is less highly conserved than NP. It binds the cell receptor and, therefore, is involved in the initiation of new influenza infections. The main neutralizing antibody reaction is directed against this gene product. The main response of cytotoxic T lymphocytes (CTLs) is also directed against this protein. Existing human influenza vaccines include three strains of the influenza virus or their HA proteins. However, due to the variability in the protein sequence of HA in different strains, this vaccine must be constantly adapted to the strains that are currently causing pathology. However, HA does have some conservative elements for generating CTL, if provided properly. The products of the NS1 and NS2 genes have not fully characterized biological functions, but they may be important in the formation of protective CTL responses. Finally, the gene products M1 and M2, which are somewhat more conservative than HA, induce a major CTL response. M1 protein is a very abundant mass product of the viral gene.

 The protective efficacy of DNA vaccination against subsequent viral infection is demonstrated by immunization of a non-replicating plasmid DNA encoding one or more of the aforementioned viral proteins. This is an advantage, since an infectious agent is not involved in vaccination, assembly of viral particles is not required, and selection of antigenic determinants is possible. In addition, since the sequence of the nucleoprotein and some other products of the viral genes is conserved and is present in numerous influenza strains, protection against subsequent infections with a virulent strain of the influenza virus homologous or heterologous to the strain from which the cloned gene is derived is possible.

DNA constructs capable of being expressed directly by injection, injection, or otherwise into animal tissues are new prophylactic pharmaceuticals. They induce cytotoxic T-lymphocytes (CTLs) specific for viral antigens and responding to different strains of the virus, in contrast to antibodies, which are usually strain-specific. The generation of such CTLs in vivo usually requires endogenous antigen expression, as in the case of a viral infection. In order to generate a viral antigen to provide it to the immune system, without the disadvantages of direct peptide delivery or the use of viral vectors, plasmid DNA encoding human influenza virus proteins was injected into the quadriceps muscle of BALB / c mice, this led to the generation of CTL-specific viruses and protection against subsequent infection with a heterologous strain of influenza virus, as measured, reduced viral titer in the lungs, inhibition of weight loss and increased survival. A high titer of neutralizing antibodies to hemagglutinin and antibodies to nucleoprotein was detected in rhesus monkeys and reduced titers of the virus in the nose were observed after homologous and heterologous infection in African ferrets. Key observations related to our invention include:
1) Demonstration of effectiveness. Heterologous protection is observed after immunization with nucleoprotein (NP) DNA, measured by increased survival, decreased viral titers in the lungs, and inhibition of weight loss in mice infected with an influenza virus strain different from the source of the strain for the NP gene. In this case, the surface proteins of the two strains were completely different (H1N1 vs. H3N2) and the strain for infection arose 34 years after the initial strain. Immunization of ferrets NP DNA and matrix DNA (M1) separately, together or in combination with DNA HA, provided protection (reduced nasal virus isolation) against infection with strain with antigenic drift (clinical isolate).

 Cocktail protection of DNA (NP and M1 DNA encoding Beijing / 89 proteins and HA DNA encoding either Beijing / 89 or Hawaii / 91) was significantly higher against the antigenic drift strain than that given by the licensed vaccine containing Beijing / 89 ferrets. The mixture (cocktail) containing HA DNA from Hawaii / 91 was apparently somewhat more effective than the mixture containing HA DNA from Beijing / 89. The protection found with a cocktail containing HA DNA for Hawaii / 91 resulted in a protection identical to that observed with homologous HA DNA (Georgia / 93), while the cocktail with HA DNA for Beijing / 89 was different from the homologous defense, although still was significantly better than a licensed product. Antibodies to H1 formed in all forms, including mice, ferrets, rhesus monkeys and African green monkeys.

 2) Constancy. In studies using DNA encoding a reporter gene, the presence of DNA and protein expression remained for at least 1.5 years (the longest time tested in mice; Wolff et al., Human Mol. Genet., 1992). Thus, if the gene products of the influenza virus were also constantly expressed, then the resulting reaction should also be preserved. It was shown that antibodies and CTL (Yankauckas et al., DNA and Cell Biol., 1993) and homologous protective immunity (MRL data) generated by injection of influenza virus DNA persisted for more than 1 year in mice. Antibodies have been shown to remain in Rhesus monkeys for at least 1 year. CTL responses and heterologous protection (increased survival) lasted up to 6 months (the farthest point tested so far). A slight decrease in the degree of heterologous protection was observed, but the protection can be enhanced (re-immunization).

 3) Dose range. Studies of the required doses carried out on rhesus monkeys showed that a dose of 100 μg HA DNA given twice gave good H1 titers of antibodies, which remained for up to one year. Protection formation (increased survival after heterologous infection) was observed with doses as low as 6 μg (given 3 times) and with a single injection of 200 μg, but usually an increased number of injections (up to three) improved the degree of protection. Studies on primates found that 2 injections of 10 or 100 μg of DNA encoding 3 HA and NP and M1 (the latter encodes Beijing / 89 H3N2 gene products) resulted in H1 titers of antibodies similar to those generated by the licensed vaccine. It is important to remember that all the animals studied were not exposed to the influenza virus, while the clinical population (older individuals) all suffered the flu. (Remember that children under 9 years of age were given 2 injections of a licensed vaccine).

Brief Description of the Drawings
FIG. 1. Detection of plasmid NP DNA in muscles by PCR. Mice were injected three times at three-week intervals with NP RSV DNA or an empty vector (100 μg per leg) in both quadriceps BALB / c muscles of the mice, followed by influenza infection. Muscles were removed 4 weeks after the final injection and were immediately frozen in liquid nitrogen. They were then pulverized in lysis buffer (25 mM Tris-H ₃ PO ₄ , pH 8, 2 mM trans-1: 2-diaminocyclohexane-tetraacetic acid (SDTA), 23 mM DTT, 10% glycerol, 1% Triton X-100 ) in MIKRODISMEMBRATOR ^™ (B. Braun Instruments) and high molecular weight DNA were extracted with phenol / chloroform and precipitated with ethanol. A 40-cycle PCR reaction was performed according to the instructions in a Perkin Elmer Cetus GENEAMP ^™ kit (kit) to detect the presence of the NP DNA plasmid in the muscle. PCR Product of 772 bp (see arrowhead), extending from the CMV promoter through most of the 5'-region of the integrated NP gene, was obtained from a semantic oligonucleotide of 18 bp primed in the promoter region (GTGTGCACCTCAAGCTGG, SEQ.ID:1) and an oligonucleotide antisense primer of 23 bp in the 5'-part of the built-in NP sequence (CCCTTTGAGAATGTTGCACATTC, SEQ.ID:2 :). Product 772 bp visible on ethidium bromide stained agarose gel in selected muscle samples injected with NP DNA, but not in control (empty vector) (600 L). The marks above each track indicate the mouse ID and right or left foot.

 Figure 2. Obtaining NP antibodies in mice injected with NP DNA. Mice were injected with 100 μg of V1-NP DNA in each leg at 0, 3, and 6 weeks and blood was extracted at 2, 5, and 8 weeks. The presence of anti-NP IgG in serum was determined by ELISA (J.J. Donnelly et al., J. Immunol., 145, 3071 (1990)) using NP purified from insect cells that were transfected with an expressing baculovirus vector. The results are plotted as the average log 10 titer ELISA ± SEM (n = 10) versus time after the first NP DNA injection. Mice immunized with a blank vector did not generate detectable NP antibodies.

FIG. 3. The percentage of specific lysis determined in the 4-hour ⁵¹ Cr release test for CTLs obtained from mice immunized with DNA. Mice were immunized with 400 μg V1 - NP DNA (solid circles) or an empty vector (solid squares) and were killed after 3-4 weeks. Negative CTL controls were obtained from an uninfected mouse (white triangles) and positive controls from a mouse that recovered from A / NK / 68 infection 4 weeks earlier (solid triangles). Graphs depict data from representative individual mice. At least 8 mice were examined for each series of conditions.

 Panel A: Spleen cells re-stimulated with NP147-155 pulse-labeled autologous spleen cells were tested against NP147-155 pulse-labeled P815 cells.

 Panel B: Spleen cells were re-stimulated with NP147-155 pulse-labeled autologous spleen cells and tested against P815 targets infected with A / Victoria / 73 virus (H3N2) for 6 hours before the addition of CTL.

 Panel C: Spleen cells were re-stimulated with Con A and IL-2 without additional antigen and tested against P815 cells pulse-labeled NP147-155.

 Panel D: Mice were injected with 200 μg per injection of V1-NP DNA or empty vector 3 times at 3-week intervals. Spleens were harvested 4 weeks after the last immunization, spleen cells were cultured with IL-2 and Con A for 7 days, and CTL was determined against P815 target cells infected with A / Victoria / 73.

FIG. 4. Weight loss (in grams) and recovery in the immunized DNA of mice after intranasal (without anesthesia) infection using 10 ⁴ TCID ₅₀ A / NK / 68. Mice were immunized three times with 3-week intervals of V1-NP DNA or a blank vector or were not injected and infected 3 weeks after the last immunization. Weights for groups of 10 mice were determined during infection and daily, starting from day 4, for NP DNA mice injected (solid circles), controls (empty vectors) (white triangles) and uninjected mice (controls) (white circles). Presents average masses ± SEM. Injected NP DNA from mice showed much lower weight loss by 8-13 days than those injected with empty mouse vectors (p≤0.005) and uninjected mice (p≤0.01), as shown by the t-test. There was no significant difference between the two controls (p = 0.8 according to the t-test).

FIG. 5. Survival of immunized DNA of mice after intranasal infection (under anesthesia) 10 ^2.5 TCID ₅₀ A / NK / 68. Mice immunized three times with 3-week V1-NP DNA intervals (solid circles) or empty vectors (white circles) and uninjected controls (white triangles) were infected three weeks after the last immunization. The survival rate is shown for groups of 9 or 10 mice. Survival of the injected NP DNA of mice was significantly higher than the controls (p = 0.0004 according to Chi-sguare analysis), while there was no significant difference (p = 0.1) according to Chi-sguare analysis between the injected empty vector and non-injected mice) .

 6. The sequence of the expression vector VIJ, SEQ.ID:10 :.

 7. The sequence of the expression vector VIJneo, SEQ.ID:18 :.

 FIG. 8. The sequence of the promoter-terminator sequence CMVintA-B H, SEQ.ID:11.

 Fig. 9 (A, B). Anti-NP Monkey Antibodies.

 Figure 10. Inhibition of haemagglutination in ferrets with a dashed line indicating the minimum protective titer of antibodies, and the average value indicated by a circle with a line passing through it.

 11. Anti-NP IgG antibodies in ferrets after DNA immunization.

 FIG. 12 (A, B). Isolation of influenza virus in ferrets with DNA immunization and without DNA immunization.

 FIG. 13. The diagram of the vectors p RSV-PR-NP and V1-NP, X denotes the built-in coding region.

 Fig. 14 (A, B). Schematic representation of proteins and strains of influenza.

 FIG. 15. Schematic illustration of the processing of injected DNA inside the cell.

 FIG. 16. Resistance of ferrets to strain A / PR / 8/34 of influenza, induced by immunization with HA genes and internal proteins.

 Fig.17. Schematic image of a VIJns vector.

 FIG. 18. African green monkeys were injected with a DNA mixture of HA DNA (A / Beijing / 89, B / Panama / 90, A / Texas / 91, NP DNA (A / PR / 34) and M1 DNA (A / PR / 34 Each component was either 10 μg (solid squares) or 100 μg (solid circles), administered twice at 6-week intervals (see arrows). For comparison, other animals were injected with licensed vaccines with subvirion (white squares) or whole virion (white circles) at the full dose used for humans (45 μg protein equivalent; 15 μg per HA). Serum samples were taken every two weeks for 18 weeks They were analyzed for H1 titer against A / Beijing / 89 HA. The data were expressed as geometric mean titer H1 ± SEM, where n = 3.

 FIG. 19. Female BALB / s mice (4-6 week old) were injected with DNA A / PR / 34 NP (200 μg) three times at 3-week intervals. Negative controls included mice injected with control DNA (200 μg), recombinant NP protein (10 μg), and non-injected mice (false control). For comparison, mice infected with the influenza A / NK / 68 virus (flu) were also tested. CTLs were obtained 6 months after the first dose and were restimulated in vitro with virus-infected spleen syngenic cells and tested against NP with a P815 pulse-labeled peptide at an effector: target ratio of 10: 1. Data indicate% specific lysis ± Sd, where n = 3.

FIG. 20. C3H / HeN mice were injected with normal C ₂ C ₁₂ myoblasts (1 x 10 ⁷ cells), recombinant NP protein (2 μg) or NP-transfected myoblasts (1 x 10 ⁷ cells). This amount of NP protein (2 μg) was sufficient to generate an antibody response and was equivalent to about 100 times the amount of NP present in transplanted NP-transfected myoblasts. CTLs were obtained from these mice 6 weeks after treatment and were restimulated in vitro with influenza virus infected syngeneic spleen cells. As a positive control, CTL was obtained from mice that were infected with the influenza A / HK / 68 virus. Untreated (solid bars) infected with A / Victoria / 73 influenza virus (striped bars) and NP-transfected (shaded bars) myoblasts were used as target cells with an effector: target ratio of 25: 1. Data are presented as% specific lysis ± Sd, where n = 3.

FIG. 21. 4-week-old female BALB / c mice were immunized intramuscularly with 200 μg NP DNA three times at 3-week intervals. Mice were infected 3 weeks after the third immunization with 300 TCID ₅₀ A / NK / 68 administered under general anesthesia (infection of all respiratory tracts). The percentage of surviving mice (10 mice per group) plotted against the time after infection.

FIG. 22. 4-week-old female BALB / c mice were immunized intramuscularly with 100 μg NP DNA three times at 3-week intervals. Mice were infected 3 weeks after the third immunization with 300 TCID ₅₀ A / NK / 68 administered under general anesthesia (general respiratory tract infection). Mice were weighed 1 time per day and a percentage of the initial weight was calculated for each surviving mouse. The average% of the initial weights was plotted on ± SEM versus time after infection.

FIG. 23. 4-week-old female BALB / c mice were immunized intramuscularly with 200 μg NP DNA three times at 3-week intervals. Mice were infected 3 weeks after the third immunization with 2000 TCID ₅₀ A / NK / 68 administered under general anesthesia (upper respiratory tract infection). Mice were killed 7 days after infection, the lungs were removed and homogenized, and virus titers were determined by serial titration on MDCK cells.

FIG. 24. 4-week-old female BALB / c mice were immunized intramuscularly with 6.25, 25, 100, or 200 μg NP DNA three times at 3-week intervals. Mice were infected 3 weeks after the third immunization with 300 TCID ₅₀ A / NK / 68 administered under general anesthesia (general respiratory tract infection). The percentage of surviving mice (10 mice per group) was plotted versus time after infection.

Fig.25. 4-week-old female BALB / c mice were immunized intramuscularly thrice at 3-week intervals with 200 μg A / PR / 34 NP DNA, control DNA or falsely injected. The mice were then infected with 300 TCID ₅₀ A / NK / 68 under anesthesia at 6, 12 and 25 weeks after the third DNA injection. Selected mice were immunized with 200 μg NP DNA at week 22 and then infected at week 25 (“re-immunization”). Average weights are presented as percentages of the initial total mass for each group. The control mass is the average of the masses of all control groups of 6, 12 and 25-week infections, only 6 groups receiving control DNA or a false injection. The groups initially contained 10 animals; mice were excluded from further mass analysis after death.

 FIG. 26. Adult male ferrets (22-28 weeks old) were immunized intramuscularly with 1 mg of DNA encoding NP from A / Beijing / 89, 1 mg of DNA encoding M1 from A / Beijing / 89 or 1 mg of these combined DNA on days 0 and 42nd. Control ferrets received non-coding DNA or the full dose used for humans (15 μg / strain), a licensed whole influenza virus vaccine (preparation 92-93 g) containing A / Beijing / 89, on days 0 and 42. Ferrets were infected with A / Georgia / 93 on the 5th day. Virus isolation in nasal washes was determined as described above. Virus isolation on days 3 to 5 was compared with that in ferrets given control DNA using two-way analysis of variance. Virus isolation in ferrets given NP NP, M1 DNA, or NP + M1 DNA was significantly lower (p <0.0001, 0.0016, and 0.0001, respectively) than virus isolation in control ferrets. The isolation in ferrets receiving NP (data not shown), M1 or NP + M1, was slightly different from the isolation in ferrets receiving a licensed vaccine (p = 0.104, 0.533 and 0.145, respectively). An immunization dose of 1 mg was chosen arbitrarily; dose range studies were performed on primates.

FIG. 27. Groups of 8 22-25-week-old male ferrets were immunized intramuscularly with control DNA, saline or DNA encoding influenza A / PR / 8/34 proteins on days 0, 21; 121st and intranasally infected with 200 TCID ₅₀ A / PR / 8/34 on day 148. Immunized animals received 1 mg of NP DNA or 2 mg of NP, NS1, PB1, PB2, and M1 DNA in combination (400 μg of each construct). Controls received 0.5 ml per leg of saline or 1 mg of control DNA. For analysis purposes, groups that received saline and control DNA were combined (control), as were groups that received only NP DNA or this DNA in combination with the genes of other internal proteins (internal proteins). The graph shows the infectious titers of nasal washes in TCID ₅₀ per 50 μl of a 3 milliliter volume of nasal washes. It is assumed that the undiluted wash liquid (the smallest dilution was tested) had a dilution of 1: 10 from the initial nasal exudate and a positive undiluted sample was taken as 1 log. Titers above 1 log were determined based on the interpolation of Reed Munch from three replicates, giving an endpoint of 50% infectivity. Samples that were negative when tested in undiluted form had a value of 0 log. The values for p shown in the graph are calculated for immunized ferrets versus controls on the indicated days using the T-test for two averages. Values for p for whole curves were calculated by two-way analysis of variance and they were less than 0.0001 for NP vs. control and less than 0.001 for pooled DNA against control.

Fig.28. Survival of mice immunized with DNA and then infected with influenza virus. Mice were injected intramuscularly with 200 μg of DNA encoding HA from A / PR / 34, or control (non-coding) DNA three times at 3-week intervals. 3 weeks after the last immunization, the mice were infected with a common respiratory tract infection (intranasal instillation under anesthesia) 1000 TCID ₅₀ A / PR / 34. Data were plotted as% survival versus time after infection (n = 9 or 10 mice per group).

FIG. 29. Weight loss in mice immunized with DNA and then infected with influenza virus. Mice were injected intramuscularly with 200 μg of DNA encoding HA from A / PR / 34 or control (non-coding) DNA three times at 3-week intervals. 3 weeks after the final immunization, a general infection of the respiratory tract (intranasal instillation with anesthesia) was performed with 1000 TCID ₅₀ A / PR / 34. Data were plotted as% of the initial mass for each individual animal, averaging for each group, depending on time (dead animals were excluded from the average values).

Fig.30. Survival of mice immunized with DNA and then infected with influenza virus. Mice were injected intramuscularly with 1, 10, or 100 μg of DNA encoding HA from A / PR / 34 or control (non-coding) DNA three times at 3-week intervals. 3 weeks after the final immunization, a general infection of the respiratory tract (intranasal instillation with anesthesia) was performed with 1000 TCID ₅₀ A / PR / 34. Data were plotted as% survival versus time after challenge (n = 9 or 10 mice per group).

FIG. 31. Groups of 8 22–25-week-old male ferrets were immunized intramuscularly with control DNA, saline, or DNA encoding the influenza A / PR / 8/34 virus proteins on days 0, 21, and 121 and were infected intranasally 200 TCID ₅₀ A / PR / 8/34 on the 148th day. Immunized animals received 1 mg of HA DNA or 2 mg of HA, NP, NS1, PB1, PB2, and M1 DNA in combination (330 μg of each construct). Controls received 0.5 ml per leg of saline or 1 mg of control DNA. For analysis, the groups that received saline and control DNA were combined (Control), as were the groups that received only HA DNA or this DNA in combination with other genes of internal proteins (HA, HA + DNA of internal proteins). The graph shows the infectious titers of nasal washes in TCID ₅₀ per 50 μl from a volume of 3 ml of nasal wash. It was assumed that the undiluted wash fluid (the lowest dilution tested) had a 1:10 dilution of the original nasal exudate and a positive undiluted sample was taken as a value of 1 log. Titers above 1 log were determined based on Reed-Münch interpolation from three replicates and gave an endpoint of 50% infectivity. Samples that were negative when tested in undiluted form had a value of 0 log. Values for p for whole curves were calculated by two-way analysis of variance and they were less than 0.0001 for anti-control HA and less than 0.0001 for combined anti-control DNA.

 Fig. 32. Adult (22-28-week-old) male ferrets were immunized intramuscularly with 1 mg of DNA encoding HA on A / Georgia / 93 on days 0 and 42. Control ferrets received non-coding DNA or the full dose used for humans (15 μg / strain) of a licensed flu vaccine containing the whole virus (preparation 92-93 g) containing A / Beijing / 89 in the 0 and 42nd days. Ferrets were infected with A / Georgia / 93 on day 56. Virus isolation in nasal washes was determined as described above. Virus isolation for 1-6 days was compared with the isolation in ferrets receiving control DNA using two-way analysis of variance. Virus isolation in ferrets treated with HA DNA was significantly lower (p <0.0001) than that in control ferrets.

 FIG. 33. Adult (22-28-week-old) male ferrets were immunized intramuscularly with 1 mg of DNA encoding HA from A / Hawaii / 91 or A / Beijing / 89 (data not shown) on days 0 and 42. Control ferrets received non-coding DNA or the full human dose (15 μg / strain) of the licensed one containing the whole influenza vaccine virus (preparation 92-93 g) containing A / Beijing / 89 on days 0 and 42. Ferrets were infected with A / Georgia / 93 on day 56. Virus isolation in nasal washes was determined as described above. Virus isolation for 1-6 days was compared with the isolation in ferrets receiving control DNA using two-way analysis of variance. Isolation in ferrets treated with HA A / Hawaii / 91 DNA was significantly lower (p <0.0001) than that in control ferrets. Isolation in ferrets receiving HA / A Hawaii / 91 DNA was significantly lower than isolation in ferrets receiving a licensed product (p = 0.021 for A / Hawaii / 91 HA DNA; two-factor ANOVA for 1-6 days); the isolation in ferrets receiving A / Beijing / 89 HA DNA (data not shown) did not differ from the isolation in ferrets receiving a licensed product (p = 0.058; two-factor ANOVA for 1-6 days).

 Fig. 34. Adult (22-28-week-old) male ferrets were immunized intramuscularly with 1 mg of DNA encoding HA from A / Hawaii / 91 (see FIG. 13), or 330 μg of each of the DNA encoding HA from A / Hawaii / 91 and NP and M1 from A / Beijing / 89, on the 0th and 42nd days. Control ferrets received non-coding DNA or the full human dose (15 μg / strain) of the licensed vaccine containing the whole flu virus (preparation 92-93 g) containing A / Beijing / 89 on days 0 and 42. Ferrets were infected with A / Georgia / 93 on day 56. Virus isolation in nasal washes was determined as described above. Virus isolation for 1-6 days was compared with the isolation in ferrets receiving control DNA using two-way analysis of variance. Isolation in ferrets receiving HA + NP + M1 DNA was significantly lower than excretion in ferrets receiving a licensed vaccine (p less than 0.0001) or only HA DNA (p = 0.0053).

 Fig. 35. Adult (22-28-week-old) male ferrets were immunized intramuscularly with 1 mg of DNA encoding HA from A / Georgia / 93, or 330 μg of each DNA encoding HA from A / Hawaii / 91, and NP and M1 from A / Beijing / 89 , on the 0th and 42nd days.

 Control ferrets received non-coding DNA or the full human dose (15 μg / strain) of the licensed vaccine containing the whole flu virus (preparation 92-93 g) containing A / Beijing / 89 on days 0 and 42. Ferrets were infected with A / Georgia / 93 on day 56. Virus isolation in nasal washes was determined as described above. Virus isolation for 1-6 days was compared with the isolation in ferrets receiving control DNA using two-way analysis of variance. Isolation in ferrets receiving HA + NP + M1 DNA did not differ significantly from virus isolation in ferrets receiving homologous HA DNA (p = 0.064).

 Fig. 36. VIR sequence.

DETAILED DESCRIPTION OF THE INVENTION
The present invention provides nucleic acid containing pharmaceutical preparations which, when directly introduced into an animal, including a vertebrate animal such as mammals and humans, induce the expression of encoded proteins within the animal. If such a protein is a protein that is not normally found in this animal, with the exception of pathological conditions, such as proteins associated with the influenza virus, for example (but not limited to), influenza virus nucleoprotein, neuraminidase, hemagglutinin, polymerase, matrix or non-structural proteins, then the animal’s immune system is activated to trigger a defensive reaction. Since these exogenous proteins are produced by the animal’s own tissues, the expressed proteins are processed and provided by the main histocompatibility complex, MHC. This recognition is similar to recognition that occurs with a true infection by the corresponding organism. The result, as shown in this application, is the induction of an immune response that protects against a virulent infection.

 The present invention provides nucleic acids which, when introduced into animal tissues in vivo, by injection, inhalation or perception by a similar mechanism (see background of the invention above), induce the expression of human influenza virus gene products. For example, injection of the DNA constructs of the present invention into the muscles of mice induces the expression of encoded gene products. The same thing happens in ferrets and rhesus monkeys. Subsequent infection with a virulent influenza virus using doses invariably killing control animals, animals injected with a polynucleotide vaccine show significantly reduced morbidity and mortality. Thus, this invention describes a vaccine applicable to humans for the prevention of influenza virus infections.

 We have shown that DNA constructs encoding influenza virus proteins induce protective immune responses in animals. As will be described in more detail below, the immune responses in animals included the generation of antibodies and CTL in mice, the generation of antibodies in ferrets and primates and the protection against viral infection in mice and ferrets with homologous antigenic drift and antigenic variability of the influenza strain. Perhaps the most striking result of immunization with DNA encoding viral proteins was the ability to defend against different subtypes of the virus. This suggests that the addition of a CTL-inducing component to the vaccine should help reduce the effects of new varieties that occur in the middle of the season or are unforeseen when choosing vaccine strains every year for the next year. Importantly, immunization with DNA vectors encoding the HA, NP and M1 genes was able to protect more effectively against a strain with antigenic drift in ferrets than a licensed vaccine. This justifies the use of constructs encoding internal genes in PNV.

 In one embodiment, the vaccine product will consist of individual DNA plasmids encoding, for example, HA from 3 widespread clinical strains representing viruses A / H1N1 (A / Texas / 91), N / H3N2 (A / Georgia / 93) and B ( B / Panama / 90), as well as DNA constructs encoding the internal conserved proteins NP and M1 (matrix protein) from A (Beijing / 89; H3N2) and B strains, to provide the group with common protection against antigens undergoing drift and variability. HA DNAs will function to provide HA and lead to the formation of neutralizing antibodies against HA. They will be specific for the type with a slightly increased breadth of protection against the antigenic drift strain compared to the existing licensed protein-based vaccine. DNA constructs for NP and M1 will result in CTLs that will provide strain-cross-protection with potentially lower viral loads and faster recovery. It is expected that the persistence of DNA constructs (in episomal, non-replicating, non-integrated form in muscle cells) will provide increased protection time compared to an existing vaccine.

 Expected benefits over existing licensed vaccines include: increased breadth of protection due to CTL responses ± breadth of antibodies and increased duration of protection. The PNV approach eliminates the need for preparation, selection and propagation of recombinants, as was done for the licensed vaccine, since the new DNA construct can be prepared directly from the clinical isolate.

 In one embodiment of the invention, the human influenza virus nucleoprotein gene sequence, NP, obtained from strain A-PR / 8, 34, is cloned into an expression vector. This vector contains a promoter for transcription by RNA polymerase and a transcription terminator at the end of the NP coding sequence. In one preferred embodiment, the promoter is a long terminal repeat (LTR) of the Ru sarcoma virus (RSV), which is a strong transcriptional promoter. More preferred is a cytomegalovirus promoter with an intron A sequence (CMVintA). A preferred terminator for transcription is bovine growth hormone terminator. A terminator combination (CMVintA-BGH) is particularly preferred. In addition, to facilitate the preparation of the pharmaceutical preparation, it is preferable to include an antibiotic resistance marker in the expression vector. Ampicillin resistance genes, neomycin resistance genes, or any other pharmaceutically acceptable antibiotic resistance marker may be used. In a preferred embodiment, the antibiotic resistance gene encodes a gene product for neomycin resistance. Further, in order to ensure a high level of pharmaceutical preparation by fermentation in prokaryotic organisms, it is advantageous for the vector to contain replication seed and have a high copy number. Any number of commercially available prokaryotic cloning vectors can provide these preferred properties. In a preferred embodiment of the invention, these properties are provided by commercially available vectors known as pUC. Removal of non-essential DNA sequences is desirable: for example, in one embodiment, lacZ and lacI pUC coding sequences are deleted.

 In one embodiment, an RSV pn expression vector is used in which a long terminal repeat (LTR) of Routh sarcoma virus (RSV) is used as a promoter. In another embodiment, V1, a mutated pBR322 vector, into which CMV promoters and BHH transcription terminator were cloned, is used. The V1-NP construct was used to immunize mice and induce CTLs that sutured against heterologous infection. In a particularly preferred embodiment of the invention, elements V1 are combined to produce an expression vector named VIJ. In VIJ, an influenza virus gene is cloned, such as the A / PP / 8/34 NP, PB1, NS1, HA, PB2 or M1 gene. In yet another embodiment, the ampicillin resistance gene is deleted from VIJ and replaced with the neomycin resistance gene to obtain VIJneo (SEQ.ID:18 :, FIG. 7) into which any of a large number of different influenza virus genes could be cloned for use in accordance with with this invention. In another embodiment, the vector VIJns, which is similar to VIJ, is used, except that the unique restriction site SfiI was inserted into the only KrnI site at position 2114 of the VIJ - neo. The incidence of SfiI sites in human genomic DNA is very low (approximately 1 site per 100,000 bases). Therefore, this vector makes it possible to carefully observe the integration of the expression vector into the host DNA simply by cleaving the SfiI of the extracted genomic DNA. A further improvement is the VIR vector. In this vector, as much as possible, non-essential DNA was "cleaned" from the vector, which gave a very compact vector. This vector is a derivative of VIJns and is shown in FIG. 36 (SEQ.ID:45). This vector allows the use of larger insertions, without worrying about the fact that undesired sequences are encoded, and optimizes cell uptake by introducing this construct encoding the specific genes of a group virus into surrounding tissues. In FIG. 36, the VIJneo parts (FIG. 7) that are deleted are shown as a gap and the inline sequence is shown in bold, but the VIJneo numbering is unchanged. The above vector modification and refinement procedures may be performed according to methods known to those skilled in the art. However, certain of the described products, although obtained by conventional methods, are particularly suitable for the specific purpose for which they are adapted.

Although one embodiment of the invention includes an NP virus gene group from strain A / PP / 8/34, more preferred options include an NP gene, HA gene, NA gene, PB gene, M gene, or NS gene of no more recent virus isolates flu. This is done by preparing DNA copies of viral genes followed by subcloning of individual genes. Sequences for many genes of many strains of influenza virus are currently openly available at GENBANK (approximately 509 such sequences for influenza A gene). Thus, any of these genes cloned from recent Texas-, Beijing- or Panama-virus isolates, which are recommended strains. The Centers for Disease Control as desired in influenza vaccines are preferred in this invention (see FLU-IMMUNE ^® influenza virus vaccine of Lederle, Physicians Desk Reference, 1993, p. 1232, a trivalent purified vaccine containing surface antigen of influenza virus containing hemagglutinin protein from A / Texas / 36/91, H1N1, A / Beijing, 353/89, H3N2 and B / Panama, 45/90). To maintain consistent terminology, the following custom is supported here for describing DNA constructs: "Vector name - influenza strain - gene." Thus, a construct in which the NP gene of strain A / PR / 8/34 is cloned into the VIJneo expression vector has the name: "VIJneo-PR-NP". Of course, since the etiological strain of this virus is changing, the exact gene that is optimal for incorporation into a pharmaceutical can change. However, as will be shown below, due to the fact that cytoxic lymphocyte responses are induced that can protect against heterologous strains, strain variability is less critical in new vaccines compared to whole virus or subunit polypeptide vaccines. Furthermore, since this pharmaceutical preparation is easy to manipulate to integrate a new gene, it can be easily accomplished by standard molecular biology methods.

Since the nucleoprotein sequence is conservative among a variety of influenza strains, protection against subsequent infection with a virulent influenza A strain that is heterologous to the strain from which the gene for nucleoprotein is cloned is achieved. Comparing NP from numerous strains of influenza A, did not show significant differences in the secondary structure [M. Gammelin et al. Virol. 170, 71, 1989] and very small changes in the amino acid sequence [OT Gorman et al., J. Virol. 65, 3704, 1991]. Over an approximately 50-year period, NP in human strains evolved at a rate of only 0.66 amino acid changes per year. Moreover, our results, which showed that specific for A / NK / 68 CTLs recognize target cells, pulse-labeled with synthetic NP peptide (147-155), obtained from the NP sequence A / PP / 8/34, show that this The H-2K ^d -bounded CTL epitope remained functionally intact for a period of 34 years (see FIG. 2). It should be noted that if the gene encodes a viral surface antigen, such as hemagglutinin or even neuraminidase, a significant response is generated in the form of the formation of neutralizing humoral antibodies in addition to the very important response in the form of cytotoxic T lymphocytes.

 Intramuscular injection of an expression vector DNA encoding a conserved internal protein of influenza A virus resulted in the formation of significant protective immunity against subsequent viral infection. In particular, NP-specific antibodies and primary CTLs are produced. Immunization of NP DNA resulted in lower viral titers in the lungs, inhibition of weight loss, and increased survival compared to controls. This protective immune response was not mediated by NP-specific antibodies, as shown by the lack of action of one of the NP-antibodies (see Example 4) in the fight against viral infection, and was therefore due to NP-specific cellular immunity. Moreover, significant levels of primary CTL directed against NP have formed. This protection was against virulent strain A, which is heterologous to the strain from which the DNA was cloned. In addition, the infecting strain arose more than three decades after strain A / PR / 8/34, which suggests that immune responses directed against conserved proteins may be effective despite antigenic variation and antigenic drift of variable proteins shell. Since each of the influenza virus gene products exhibits a certain degree of conservatism and since CTLs can be formed in response to intracellular expression and MHC processing, it is possible to predict that other influenza virus genes will increase responses similar to those achieved for NP. Methods for identifying immunogenic epitopes are now well known in the art [see, for example, Shirai et al., J. Immunol. 148: 1657-1667, 1992; Choppin et al., J. Immunol., 147: 575-583, 1991; Calin - Laurens et al. Vaccine 11: 974-978, 1993]. Thus, many of these genes were cloned, as shown by the cloned and sequenced portions of the compound in the expression vector (see below), so that these constructs are prophylactic in an accessible form.

Thus, this invention provides expression vectors encoding an influenza virus protein as an immunogen. The invention provides means for inducing cross-protective immunity against strains without the need for self-replicating agents or adjuvants. In addition, immunization with DNA provides many other benefits. First, this approach to vaccination should be applicable to tumors, as well as to infectious agents, since the response in the form of CD8 ⁺ CTL is important for both pathophysiological processes [K. Tanaka et al., Annu. Rev. Immunol. 6, 359 (1988)]. Therefore, inducing an immune response against a protein critical to the transformation process can be an effective defense against cancer or immunotherapy. Secondly, the formation of antibodies with a high titer against expressed proteins after infection of DNA of viral protein (NP and hemagglutinin) and DNA of human growth hormone [see, for example, D.-c. Tang et al. , Nature 356, 152, 1992] indicates that this is a quick and highly effective method for producing antibody-based vaccines, either alone or in combination with cytotoxic T-lymphocyte vaccines, directed against conserved antigens.

 The ease of preparation and purification of DNA constructs is higher than with conventional protein purification, which facilitates the preparation of combination vaccines. Thus, many constructs can be prepared, for example, a gene encoding NP, HA, M1, PB1, NS1 or any other influenza virus gene mixed and introduced together. Finally, since protein expression is maintained after DNA injection [H. Lin et al., Circulation 82, 4138 (1991); E. Hansen et al., FEBS Zett. 290, 73 (1991); S. Jiao et al., Hum. Gene Therapy 3, 21 (1992); J. A. Wolff et al. , Human Mol. Genet. 1, 363 (1992)], constancy of B- and T-cell memory can be enhanced [D. Gray and P. Matzinger, J. Exp. Med. 174, 969 (1991); S. Oehen et al., Ibid. 176, 1273 (1992)], which causes the formation of prolonged humoral and cell-mediated immunity.

 The current weaknesses of licensed influenza vaccines reinforce the need to develop effective agents to prevent infection and alleviate the disease. Older vaccines provide limited protection, are effective only against a small number of selected strains of the virus, and decrease their effectiveness after a short period of time. Thus, existing vaccines must be prepared anew for annual administration in order to be effective. The generation of an improved CTL response against internal proteins could apparently provide long-lasting cross-reactive immunity not provided by the current vaccine.

 We demonstrated the expression of protein from PNV constructs in mice, ferrets and primates, except humans, by detecting the host's immune response directed against influenza antigens. Injecting mice of DNA encoding influenza NP resulted in improved survival, reduced viral titers in the lungs and less weight loss compared to control animals after infection with influenza subtypes (strain with antigenic variability) different from the strains from which the DNA for the constructs was cloned.

 We also observed a reduced release of the virus into the medium after infection with altered strains in ferrets inoculated with NP DNA. These results show that protection against basic mixing (variability) in influenza strains is created by a DNA vaccine that includes genes encoding NP. Injection of HA DNA with subsequent infection of experimental animals with antigenic drift virus strains led to an even stronger decrease in virus excretion into the medium. The addition of DNA encoding an internal protein slightly increased the high degree of protection observed after injection of HA DNA alone.

 An immune response to the DNA of influenza virus was observed in mice for 6 months after injection, with persistence of antibodies, CTL activity and protection in vivo. Re-injection of DNA further increased survival after infection at 25 weeks with a different subtype influenza strain and showed the possibility of re-immunization to obtain protective cell-mediated immunity. Antibody retention was also documented for at least one year after two injections of HA DNA, with persistence for at least nine months after a single injection of HA DNA in African green monkeys.

 The results of these animal experiments show that direct DNA injection provides an improved way to protect people against influenza infection and morbidity. It should be noted that experimental protection by DNA injection was achieved by vaccination of previously uninfected mice and ferrets. Adults vaccinated with DNA may have previously been infected with the flu. These people will exhibit an even more substantial immune response, possibly a longer one, after immunization with DNA constructs.

 The dose range is compared by immunogenicity to optimize concentrations for use. In experiments on small mammals, only 1 μg of NP DNA elicited an immune response in the form of antibodies and CTL. Immunization of rhesus monkeys demonstrated an antibody response in 2 of 2 animals with doses of 100 and 1000 μg of HA DNA (A / PR / 08/34), while 1 of 2 animals responded to a single injection of 10 μg. In separate experiments, previously uninfected African green monkeys were injected with a mixture of 5 different DNA constructs encoding HA from three viral subtypes, as well as DNA encoding NP and M1 from influenza A virus. 3 out of 3 monkeys in each group responded to vaccines that contained 10 mcg or 100 mcg of each of the 5 constructs. Based on these findings, it can be predicted that doses of 10, 50, 100 and 200 μg of DNA are effective for humans.

 Prevention of infection with a licensed, inactivated vaccine correlates with the levels of antibodies in the serum and mucous membrane directed against HA, but does not correlate with the level of antibodies directed at the internal proteins of the virus. Thus, HA should be included in the development of a DNA-containing flu vaccine. However, the immune response to NP enhances the formation of antibodies to HA, and the internal proteins of the influenza virus provide a response in the form of CTL, cross-reactive with antigenically different strains of influenza. As mentioned above, animal experiments also show improved immunogenicity and protection when the injections contained DNA constructs encoding the internal proteins along with HA. The inclusion of DNA constructs encoding internal proteins in the vaccine is likely to enhance the effectiveness of human DNA-containing vaccines. Since dose levels seem to depend on the interaction of these components, a routine test will allow one skilled in the art to determine the amount of DNA in a vaccine to make a mixture of DNA constructs encoding HA, NP, and M1. The host response to each of these components can be measured separately, by comparing hemagglutinin (H1) inhibition titers and neutralization against HA components and CTL responses against M1 and NP epitopes. The results are compared with the formation of antibodies after injection of constructs expressing only HA. These studies allow us to evaluate a potentially increased response to a vaccine containing DNA encoding both HA and internal proteins.

 Human efficacy has been shown in volunteers who received an influenza DNA vaccine followed by intranasal infection in order to demonstrate the effectiveness of the vaccine against similar influenza virus strains of a different subtype. The composition, dosages, and regimens for this vaccine are based on previous studies. Clinical efficacy is indicated by the rate of infection, disease scores, and disease duration. These clinical results are compared with a laboratory assessment of the host's immune response and virus isolation in the medium to identify substitute markers that correlate with protection.

 Standard molecular biology methods for the preparation and purification of DNA constructs allow the preparation of the therapeutic DNA of the present invention. Thus, while standard molecular biology methods are sufficient to produce the products of this invention, the specific constructs described therein provide new therapeutic agents that unexpectedly induce cross-protection for different strains, a result not yet achievable with standard vaccines containing inactivated whole virus or protein of its subunit.

 The amount of expressed DNA to be introduced into the recipient vaccine will depend on the strength of the transcription and translation promoters used in this DNA construct and on the immunogenicity of the expressed gene product. In general terms, an immunologically or prophylactically effective dose of about 1 μg to 1 mg, and preferably about 10 μg to 300 μg, is administered directly to muscle tissue. Subcutaneous injection, intradermal injection, transdermal, intravenous or inhalation are also expected to be suitable. Booster vaccinations are also expected to be available.

 DNA can be naked, i.e., not associated with any proteins, adjuvants, or other agents acting on the recipient's immune system. In this case, it is desirable that the DNA be in a physiologically acceptable solution, such as (but not limited to) sterile saline or sterile buffered saline. Alternatively, DNA may be linked to liposomes, such as lecithin liposomes or other liposomes known in the art, as a DNA-liposome mixture (see, for example, WO 93/24640) or DNA may be coupled to an adjuvant known in the art. and enhancing the immune response, such as a protein or other carrier. It is also convenient to use agents that promote the uptake of DNA by the cell, such as (but not limited to) calcium ions, viral proteins, and other transfection facilitating agents. These agents are commonly referred to as transfection facilitating agents and pharmaceutically acceptable carriers. The term gene, as used herein, refers to a nucleic acid segment encoding a single polypeptide. The term pharmaceutical agent and vaccine are used interchangeably herein to mean compositions useful for inducing immune responses. The terms construct and plasmid are used interchangeably. The term vector is used to refer to DNA into which genes can be cloned for use in accordance with the method of the present invention.

Thus, one embodiment of this invention is a method of using influenza virus genes to induce immune responses in vivo in a vertebrate animal such as a mammal, including a human, comprising:
a) gene isolation,
b) combining a gene with regulatory sequences so that this gene is operatively linked to control sequences that, when introduced into living tissue, induce transcription initiation and subsequent translation of this gene,
c) introducing a gene into living tissue, and
d) optional boosting with an additional influenza virus gene.

 A preferred embodiment of this invention is a method of protection against heterologous strains of influenza virus. This is accomplished by introducing an immunologically effective amount of a nucleic acid encoding a conserved epitope of influenza virus. For example, the whole influenza nucleoprotein gene provides this function and it is expected that the coding sequences of other influenza genes and parts thereof encoding conserved epitopes within these genes also provide cross-protection for different strains.

 In another embodiment of this invention, the DNA vaccine encodes a nucleoprotein, hemagglutinin, matrix protein, non-structural protein, or a human influenza virus polymerase gene product. Typical examples of this option are given below, in which the human influenza virus gene encodes a nucleoprotein, basic polymerase 1, non-structural protein 1, hemagglutinin, matrix protein 1, basic polymerase 2 of human influenza virus isolate A / PR / 8/34, nucleoprotein of human influenza virus isolate A / Beijing / 353/89, hemagglutinin isolate of human influenza virus A / Texas / 36/91 or hemagglutinin isolate of human influenza virus B / Panama / 46/90.

In representative embodiments of this invention, the DNA construct comprises an influenza virus gene, the DNA construct being able to be expressed when introduced into animal tissues in vivo and generate an immune response against the expressed product of the coding gene of the influenza virus. In addition, the invention contemplates combinations containing such constructs with polynucleotides encoding other non-influenza antigens. Examples of preferred DNA constructs containing the influenza virus gene are:
a) pnRSV-PR-NP,
b) V1-PR-NP,
c) VIJ-PR-NP, the 5'-end of which is SEQ.ID: 12 :,
d) VIJ-PR-PB1, the 5'-end of which is SEQ.ID: 13 :,
e) VIJ-PR-NS, the 5'-end of which is SEQ.ID: 14 :,
f) VIJ-PR-HA, the 5'-end of which is SEQ.ID: 15 :,
g) VIJ-PR-PB2, the 5'-end of which is SEQ.ID: 16 :,
h) VIJ-PR-M1, the 5'-end of which is SEQ.ID: 17 :,
i) VIJneo-BJ-NP, the 5'-end of which is SEQ.ID: 20 :, and 3 '- the end of which is SEQ.ID: 21 :,
j) VIJneo-TX-NP, the 5'-end of which is SEQ.ID: 24: and 3 '- the end of which is SEQ.ID: 25,
k) VIJneo-PA-HA, the 5'-end of which is SEQ.ID: 26: and 3 '- the end of which is SEQ.ID: 27,
l) VIJns-GA-HA (A / Georgia / 03/93), construction size 6.56 kb, 5'-end is SEQ.ID: 46: and 3'-end is SEQ.ID: 47 :,
m) VIJns-TX-HA (A / Texas / 36/91), construction size 6.56 kb, 5'-end is SEQ.ID: 48: and 3'-end is SEQ.ID: 49 :,
n) VIJns-PA-HA (B / Panama / 45/90), construction size 6.61 kb, 5'-end is SEQ.ID: 50: and 3'-end is SEQ.ID: 51 :,
o) VIJns-BJ-NP (A / Beijing / 353/89), construction size 6.42 kb, 5'-end is SEQ.ID: 52: and 3'-end is SEQ.ID: 53 :,
p) VIJns-BJ-M1 (A / Beijing / 353/89), construction size 5.62 kb, 5'-end is SEQ.ID: 54: and 3'-end is SEQ.ID: 55 :,
q) VIJns-PA-NP (B / Panama / 45/90), construction size 6.54 kb, 5'-end is SEQ.ID: 56: and 3'-end is SEQ.ID: 57 :,
r) VIJns-PA-M1 (B / Panama / 45/90), construction size 5.61 kb, 5'-end is SEQ.ID: 58: and 3'-end is SEQ.ID: 59 :.

 The following examples are given to further disclose the invention, without limiting the invention, by the characteristic features of these examples.

Example 1
Obtaining DNA constructs encoding human influenza proteins
i) pnRSV-PRNP: NP A / PR / 8/34 gene was isolated from pAPR-501 [JF Young et al., The Origin of Pandemic Influenza Viruses, WG Laver, Ed. (Elsevier Science Publishing Co., Inc., 1983)] in the form of an EcoRI fragment of 1565 bp, was filled with the Klenov fragment and cloned into the Klenov fragment and treated with the XbaI phosphatase-treated pRSV-BL site. pRSV-BL was constructed by cleavage of the pBL-CAT3 vector [B. Luckow and G. Schutz, Nuc. Acids Res. 15, 5490 (1987)] XhoI and NcoI to remove the CAT coding sequence and were filled with a Klenov fragment and ligated. The RSV promoter fragment was isolated as a NdeI and ASp718 fragment from p Rshgrnx [V. Giguere et al., Nature 330, 624 (1987)], was filled with a Klenov fragment and cloned into the Hind III site of the vector obtained as described above (pBL-CAT without CAT sequence).

и антисмысловой праймер, SEQ.ID:8:

Фрагмент PCR разрезали SacI и BglII и встраивали в вектор, разрезанный теми же самыми ферментами. Ген NP из вируса гриппа А (А/PR/8/34) вырезали из pAPR501 [J.F. Young et al., в The Origin of Pandemic Influenza Viruses, W.G. Laver, Ed. (Elsevier Science Publishing Co., Inc., 1983)] ввиду EcoRI фрагмента 1565 п.н. и затупляли. Его встраивали в V1 при затупленном сайте BglII, получая V1-NP. Плазмиды размножали в E. coli и очищали способом щелочного лизиза [J. Sambrook, E.F. Fritisch and T. Maniatis, в Molecular Cloning, A Laboratory Manual, Second edition (Cold Spring Harbor Laboratory Press, 1989)] . Полученную при помощи градиента CsCl ДНК осаждали этанолом и ресуспендировали в 0,9% солевом растворе при концентрации 2 мг/мл для инъекции.ii) V1-NP: Expression vector V1 was constructed from pCMV1E-AK1-DHFR [J. Whang et al., J. Virol. 61, 1796 (1987)]. The AK1 and DHFR genes were removed by cutting the EcoRI vector and self-ligation. This vector does not contain intron A in the CMV promoter, so it was added as a PCR fragment that had a deleted SacI internal site [at 1855 in B.S. numbering Chapman et al., Nuc. Acids Res. 19, 3979 (1991)]. PCMVintA-Lux, obtained by doping a HindIII and NheI fragment from pCMV-6a120, was used as a matrix for the PCR reaction [see BS Chapman et al., Ibid.], Containing hCMV-IEI enhancer / promoter and intron A, at the HindIII and XbaI sites of pBL3, obtaining pCMVintBL. Fragment of the luciferase gene 1881 bp (HindIII - SmaI filled with a Klenov fragment) from RSV-Lux [JR de Wet et al., Mol. Cell Biol. 7, 725, 1987] was cloned into the SalI site of pCMVintB, which was filled with a Klenov fragment and treated with phosphatase. The primers that overlap intron A are:
5'-primer, SEQ.ID►:
5'-CTATATAAGCAGAGCTGTTTAG-3 '
3'-primer, SEQ.ID:6:
5'-GTAGCAAAGATCTAAGGACGGTGAGCTGCAG-3 '
The primers used to remove the SacI site are:
semantic primer SEQ.ID:7:

and antisense primer, SEQ.ID:8:

The PCR fragment was cut with SacI and BglII and inserted into a vector cut with the same enzymes. The NP gene from influenza A virus (A / PR / 8/34) was excised from pAPR501 [JF Young et al., In The Origin of Pandemic Influenza Viruses, WG Laver, Ed. (Elsevier Science Publishing Co., Inc., 1983)] in view of the EcoRI fragment of 1565 bp and blunted. It was inserted into V1 at the blunted BglII site to give V1-NP. Plasmids were propagated in E. coli and purified by alkaline lysis [J. Sambrook, EF Fritisch and T. Maniatis, in Molecular Cloning, A Laboratory Manual, Second edition (Cold Spring Harbor Laboratory Press, 1989)]. The DNA obtained using the CsCl gradient was precipitated with ethanol and resuspended in 0.9% saline at a concentration of 2 mg / ml for injection.

Example 2
Test for human influenza cytotoxic T lymphocytes
Cytotoxic T lymphocytes were obtained from mice immunized with DNA or recovered from A / NK / 68 infection. Control cultures were obtained from mice injected with control DNA and from uninjected mice. Cell suspensions were prepared, red blood cells were removed by lysis with ammonium chloride, and spleen cells were cultured in RPM 1640 with 10% fetal calf serum (FBS), 10 U / ml penicillin, 100 μg / ml streptomycin, 0.01 M HEPES (pH 7.5 ) and 2 mM l-glutamine. Equal number of autologous irradiated stimulatory cells pulse-labeled for 60 minutes with an N-2K ^d -reduced peptide epitope NP147-155 (Thr-Tyr Gln Arg Thr Arg Ala Leu Val, SEQ. ID: 9:) at 10 μM or virus infected influenza A / PR8 / 34 (H1N1), and 10 U / ml recombinant human IL-2 (Cellular Products, Buffalo, NY) were added and cultures were kept for 7 days at 37 ^° C with 5% CO ₂ and relative humidity 100% . In the selected experiments, rhIL-2 (20 U / ml) and ConA (2 μg / ml) were added instead of autologous stimulatory cells. Cytotoxic T-cell effector activity was determined with P815 cells labeled for 3 hours with 60 μCi ⁵¹ Cr per 10 ⁶ cells, and treated as described above with NR147-155 or infected with the influenza A / Victoria / 73 virus (H3N2). Control targets (labeled) of P815 cells without peptide (or virus) were not lysed. Targets were plated at a concentration of 1 • 10 ⁴ cells / well in round bottom 96-well plates and incubated with effectors for 4 hours in three rotations. Supernatant was removed from each well and counted in a Betaplate scintillation counter (LkB Wallac, Turku, Finland). The maximum score obtained by adding 6 M Hcl and the spontaneous count without CTL were determined for each target drug. The percentage of specific lysis was calculated as: [(experimental-spontaneous) / (maximum-spontaneous)] • 100.

Example 3
Obtaining NP-specific CTL and antibodies in vivo
BALB / c mice were injected into the quadriceps muscles of both legs with plasmid DNA encoding the nucleoprotein A / PR / 8/34 and regulated by the Routh sarcoma promoter or the cytomegalovirus promoter.

Expression vectors were:
i) pnRSV-PRNS, see example 1;
ii) V1-NP, see example 1.

 The animals used were female BALB / s mice obtained from Charles River, Raleigh, NC laboratories. Mice were received at the age of 4-5 weeks and initially injected with DNA at the age of 5-6 weeks. Unless otherwise indicated, DNA injections were injected into the quadriceps muscles of both legs, each leg receiving 50 μl of sterile saline containing 100 μg of DNA. Mice received 1, 2, or 3 series of inoculations at 3-week intervals. Negative control animals were uninjected or injected with the corresponding blank vector lacking the inserted NP gene.

 The presence or absence of NP plasmid DNA in the muscles of selected animals was analyzed by PCR (Fig. 1). Plasmid DNA (either NP or luciferase DNA) was detected in 44 of the 48 injected tested muscles. In muscles injected with luciferase DNA, protein expression was demonstrated by the luciferase activity found in muscle extracts according to methods known in the art [J. A. Wolff et al., Science 247, 1465 (1990); G. Ascadi et al., Nature 352, 815 (1991); H. Lin et al., Circulation 82, 2217 (1990); R.N. Kitsis et al., Proc. Natl. Acad Sci. (USA) 88, 4138 (1991); E. Hansen et al., FEBS Lett. 290, 73 (1991); S. Jiao et al., Hum. Gene Therapy 3, 21 (1992); J. A. Wolff et al., Human Mol. Genet. 1, 363 (1992)].

The expression of NP in muscles after injection of NP DNA was below the detection threshold for Western blotting (<1 ng), but was detected by the formation of NP-specific antibodies (see FIG. 2). To analyze the formation of NP-specific CTL, the spleen was removed 1-4 weeks after immunization and the spleen cells were restimulated with recombinant human IL-2 + autologous spleen cells that were either infected with influenza A / (A / PR / 8/34) or pulse H -2K ^d -reduced peptide epitope of the nucleoprotein (NP residues 147-155, see OK Rotzscke et al., Nature 348, 252 (1990)). Spleen cells restimulated with an infected virus or pulse-labeled epitope syngeneic cells were able to kill epitope-labeled target cells (Fig. 3A). This suggests that intramuscular injection of NP DNA generated the corresponding NP-derived peptide in association with MHC class I to induce a specific CTL response. These CTLs were able to recognize and lyse virus-infected target cells (Fig. 3B) or target cells pulse-labeled with an H-2K ^d -reduced peptide epitope of nucleoprotein and virus-infected target cells. This shows their specificity, as well as their ability to detect the epitope generated naturally in infected cells.

 A more rigorous measure of the immunogenicity of DNA-containing NP vaccines was the assessment of primary CTL response. Spleen cells taken from injected NP DNA of mice were activated by exposure to ConA and IL-2, but were not subjected to in vitro restimulation by antigen expressing cells before testing their ability to kill suitable targets. Splenocytes from mice immunized with NP DNA upon activation of ConA and IL-2 in vitro without antigen-specific restimulation were lysed both by pulse-labeled epitope and virus-infected target cells (Figs. 3C and D). This lytic activity of both restimulated and activated spleen cells compares favorably with the lytic activity of similarly treated splenocytes obtained from mice that were previously infected with influenza virus A / NK / 68, a virulent mouse adapted strain H3N2 34 years after A / PR / 8/34 (H1N1). Thus, NP DNA injection generated CTLs that were specific for the nucleoprotein epitope and which were able to identify a naturally-occurring antigen (i.e., could kill virus-infected cells). NP CTLs were also formed in C3P and B6 transgenic mice expressing human HLA-A2. NP CTLs were detected in BALB / c spleens from mice injected with only 1 dose of 1 μg NP DNA (lowest tested dose) (see Table 1).

 Table 1: Female BALB / c mice (4-6 week old) were injected with a single dose of NP DNA A / PR / 34 (VIJ-NP) or control DNA (VIJ) at the indicated doses. For comparison, mice were infected with influenza A / PR / 34 virus. CTL was obtained after 8 weeks, restimulated in vitro with syngeneic spleen cells pulse-labeled with NP peptide, and tested against pulse-labeled NP peptide P815 cells with an effector: target ratio of 50: 1. Data are presented as percent specific lysis for representative individual mice.

 Subsequent experiments showed that mice that received 1 dose of 1 μg NP DNA retained NP CTL for at least 4.5 months (the latest tested time). The range of CTL responses after DNA injection was comparable to the range in influenza-infected mice. However, it should be noted that CTL analysis after in vitro antigen restimulation is not strictly quantitative. Therefore, we have currently developed limiting dilution tests to more quantitatively evaluate NP-specific CTL levels in mice. In mice injected with 3 doses of 100 μg NP DNA, CTL responses were detected at least 6 months after immunization (FIG. 19). Thus, a flu polynucleotide vaccine (PNV) is capable of generating long-lived CTL responses directed to conserved influenza antigens.

 Injection of NP DNA mice resulted in the formation of a high titer A of anti-NP IgG antibodies (FIG. 2). It is believed that the formation of a high titer of IgG antibodies in mice requires the aid of CD4 + T cells (P. Vieira and K. Rajewsky, Int. Immunol, 2, 487 (1990); JJ Donnelly et al., J. Immunol. 145, 3071 ( 1990)). This suggests that NP expressed from plasmids in situ was processed to provide both MHC class I and MHC class II.

 Example 4

Protection of mice when infected with virulent human influenza virus
The role of NP antibodies in protective immunity to influenza is shown by two approaches. First, pulmonary virus titers were determined in a passive transfer experiment. Female BALB / c mice ≥ 10 weeks of age were injected intraperitoneally with 0.5 ml of fused serum (diluted in 2.0 ml of PBS) from mice injected 3 times with 200 μg NP DNA. Control mice were injected with an equal volume of fused (pooled) serum from mice infected with A / NK / 68 infection, also in 2.0 ml of PBS. The dose of A / NK / 68 immune serum was adjusted so that the ELISA titer of anti-NP antibodies was equal to the titer in the combined serum of mice injected with NP DNA. Mice were infected without anesthesia by a random sample method 10 ⁴ TCID ₅₀ A / NK / 68 2 hours after the injection of serum and the next injection with an equal amount of serum was given after 3 days. Mice were killed 6-7 days after infection and lung titer virus titers were determined at TCID ₅₀ per ml, as described by Moran [J. Immunol. 146, 321, 1991].

Mice that were not previously infected were injected with anti-NP antiserum obtained from mice injected with NP DNA and then infected with A / NK / 68. Virus infection was carried out with mouse strain A / NK / 68 adapted for mice and then maintained by in vivo passage in mice (Dr. I., Mbawuike, private communication). Stored viral inoculum was used as lung homogenate from infected mice. The homogenate had an infectious titer of 5 × 10 ⁸ TCID ₅₀ / ml on MDCK cells. For determining the titer of the virus in the lungs and studies, the mass loss of the virus infection was carried out by a non-selective method by intranasal instillation of 20 μl containing 10 ⁴ TCID ₅₀ per nostril of unanesthetized mice, which leads to a progressive infection of the lungs with the virus, but is not lethal for BALB / c mice [Getter , RA et al., Infect. Immunity 29, 654, 1980]. In survival experiments, mice were infected by instillation of 20 μl containing 10 ^2.5 TCID ₅₀ per nostril with complete anesthesia with ketamine and xylazine; infection of anesthetized mice with this dose causes rapid lung infection, which is lethal up to 90-100% for non-immunized mice [JL Schulman and ED Kilbaerne, J. Exp. Med., 118, 257, 1963; GH Scott and RJ Sydiskis, Infect. Immunity 14, 696, 1976; RA Getter et al., Infect. Immunity 29, 654, 1980]. Viral titers in the lungs were determined by serial titration on MDCK cells (obtained from ATCC, Rockville, MD) in 96-well plates as described by Moran et al. [ibid.].

 No decrease in viral titer in the lungs was observed in mice that received anti-NP antiserum (6.3 ± 0.2; mean ± SEM, n = 4) compared to control mice that received normal serum (6.1 ± 0.3; mean ± SEM, n = 4). As a positive control, serum was collected from A / NK / 68 infected mice and passively transferred to four uninfected mice. After infection with A / NK / 68, no viral infection was detected in the lungs, which indicates that the serum against the whole virus was completely protective against infection with a homologous virus. Secondly, uninfected mice were immunized with purified NP (5 μg / leg, 3 times over a period of 6 weeks) by intramuscular injection. These mice generated a high titer of NP-specific antibodies, but did not produce NP-specific CTLs and were not protected against a lethal dose of the virus. Thus, although circulating anti-NP IgG antibodies have a neutralizing effect on the whole virus, they do not induce protective immunity in mice.

The protective efficacy of in vivo NP DNA injections was evaluated to determine whether the cell-mediated immune response was functionally significant. One of the direct measures of the effectiveness of the immune response was the ability of mice, first immunized with NP DNA, to eliminate a progressive sublethal infection of the lung with a heterologous strain of influenza (A / HK / 68, H3N2). Virus infection was performed as described above. Mice immunized with NP DNA had viral titers in the lungs after infection, which were 3 orders of magnitude lower on day 7 (1.0 ± 1.0; mean ± SEM; n = 4) than titers of control mice that were not immunized (4.1 ± 0.3; mean ± SEM; n = 4) or which were immunized with a blank vector (4.5 ± 0.0; mean ± SEM; n = 4). In fact, three out of four immunized mice had undetectable virus levels
in their lungs, while none of the control mice eliminated the virus at this time point. The significant difference in viral titers in the lungs observed in this experiment and six others shows that the immune response accelerated the elimination of the virus. The absence of the protective effect of the blank vector control confirms that DNA per se is not responsible for the immune response. In addition, since the strain A / NK / 68 virus used for infection (the virulent mouse adapted strain H3N2) was heterologous to strain A / PR / 8/34 (H1N1) from which the NP gene was cloned, the immunity was clearly heterotypic.

 As a criterion for virus-induced morbidity, weight loss was observed in mice sublethally infected with A / NK / 68 virus after immunization with NP DNA (FIG. 4). Non-injectable mice or mice injected with an empty vector served as controls. Mice immunized with NP DNA showed less weight loss and faster return to the masses before infection after infection with influenza A virus compared with control mice.

 Intranasal infection of fully anesthetized mice with influenza A causes rapid, widespread virus propagation in the lungs and death within 6–8 days if the infection is not controlled (R.A. Yetter et al., Infect. Immunity 29, 654 (1980)). The survival of mice infected with this method reflects their ability to limit the severity of acute pulmonary infection. The ability of mice to survive infection with two different strains of influenza, A / NK / 68 (see FIG. 5) and A / PR / 8/34, was investigated. Mice pre-immunized with NP DNA showed a 90% survival rate compared to 0% in the empty vector injected and 20% in the uninjected control animals (Fig. 5). In 14 such studies, mice immunized with NP DNA showed at least a 50% increase in survival rate compared to controls. Thus, the ability of an NP DNA-induced immune response to effectively accelerate recovery and attenuate disease caused by a virus of a different strain that arose 34 years later confirms the rationality of using a conserved protein for the generated CTL response.

Example 5
Isolation of genes from influenza isolates
Many of the older viral strains are deposited with ATCC (Animal Virus and Antiserum Catalog, Chlamydiae and Rockettsiae 1990, 6th edition, lists of 20 influenza A strains and 14 influenza B strains).

A. Viral strains and purification:
The influenza strains contained in the 1992 influenza season vaccine were obtained from Dr. Nancy J. Cox (Virus and Rickettsia-caused Disease Center, Disease Control Center, Atlanta, GA). These strains are:
(1) A / Beijing / 353/89 (H3N2),
(2) A / Texas / 36/91 (H1N1),
(3) B / Panama / 45/90,
(4) A / Georgia / 03/93.

All of these viruses were grown by passage in 9-10-day-old embryo-containing eggs (except that A / Georgia was grown in MDCK cells) (100-200 per viral preparation) and purified by modification of the method described by Massicot et al. (Virology 101, 242-249 (1980)). Briefly, viral suspensions were clarified by centrifugation at 8,000 rpm (Sorvall RC5C centrifuge, GS-3 rotor) and then pelleted by centrifugation at 18,000 rpm for 2 hours in a Beckman Type 19. Rotor The precipitated virus was resuspended in STE (0.1 M NaCl, 20 Mm Tris, pH 7.4, 1 mM EDTA) and centrifuged at 4000 rpm for 10 minutes (Hermle Z 360 K centrifuge) to remove aggregates, 2 ml of the supernatant was applied to an intermittent sucrose gradient consisting of 2 ml of 60% sucrose, which is layered with 7 ml of 30% sucrose with STE buffer, and centrifuged at 36,000 rpm (rotor SW-40, Beckman) in those reading 90 minutes. The band forming virus at the interphase was collected, diluted 10 times with STE, and precipitated at 30,000 rpm for 2 hours (Beckman Ti 45 rotor). Then the precipitated virus was frozen at -70 ^o C.

B. Extraction of viral RNA and cDNA synthesis:
Viral RNA was purified from a frozen virus by extraction of guanidinium isothiocyanate using a commercially available whale (Stratagene, La Jolla, CA) and the method of Chomczynski u Sacchi (Anal. Biochem. 162, 156-159 (1987)). Double-stranded cDNA was prepared from viral RNA using a commercially available cDNA synthesis kit (Pharmacia) according to manufacturers instructions with some modifications. For the first cDNA strand, a synthetic oligonucleotide, 5'-AGCAAAAGCAGG-3 ', SEQ.ID: 30: was used as a primer, which is complementary to the conserved sequence located at the 3'-end of the viral RNA for all genes of strain A. This sequence is common for of all RNAs of type A influenza viruses and therefore provides a method for cloning any gene of viral strains A. After synthesis of the first and second cDNA chains, the reaction mixtures were extracted with phenol / chloroform and precipitated with ethanol, not following the kit instructions. These blunt-ended cDNAs were then directly ligated into the VIJneo or VIJns vector, which was digested with BglII restriction enzyme, blunted the T4 ends with DNA polymerase, and treated with calf intestinal alkaline phosphatase.

 For screening for specific full-sized viral genes, we used synthetic oligodeoxyribonucleotides, which were designed complementary to the 3'-end of the translational open reading frame of this viral gene. Samples, which apparently also provided full-size genes according to restriction mapping and sizing on agarose gels by electrophoresis, were tested by dideoxynucleotide sequencing at both sites of the viral gene connection with VIJneo. The connecting sequences for each gene cloned from these viruses are given in Example 8 below.

Similar strategies were used to clone cDNA from each of the above viruses, with the exception of cDNA for B / Panama / 45/90, which does not have common sequences at each end of the viral RNA; a mixture of oligodeoxyribonucleotides was used to primify the synthesis of the first strand of cDNA. These primers were:
(1) 5'-AGCAGAAGCGGAGC-3 ', SEQ.ID:31: for PB1 and PB2;
(2) 5'-AGCAGAAGCAGCGCA-3 ', SEQ.ID:19: for NS and HA;
(3) 5'-AGCAGAAGCACGCAC-3 ', SEQ.ID:22: for M1 and
(4) 5'-AGCAGAAGCACAGCA-3 ', SEQ.ID:23: for NP.

For genes that were cloned by PCR, a blunt-ended cDNA solution was used directly in PCR reactions as a DNA template. The primers used to clone 6 influenza virus genes obtained by PCR were the following primers:
1. The HA gene from A / Georgia / 03/93
semantic primer: SEQ.ID:33:
5'-GGT ACA ACC ATG AAG ACT ATC ATT GCT TTG AGC-3 '
antisense primer: SEQ.ID:34:
5'-CCA CAT AGA TCT TCA AAT GCA AAT GTT GCA CCT AAT-3 '.

2. The HA gene from A / Texas / 36/91
semantic primer: SEQ.ID:35:
5'-GGT ACA ACC ATG AAA GCA AAA CTA CTA GTC CTGTTA TG-3 '
antisense primer: SEQ.ID:36:
5'-CCA CAT TCA GAT GCA TAT TCT ACA CTG CAA AG-3 '.

3. HA gene from B / Panama / 45/90
semantic primer: SEQ.ID:37:
5'-GGT ACA ACC ATG AAG GCA ATA ATT GTA CTA CTC CTG-3 '
antisense primer: SEQ.ID:38:
5'-CCA CAT TTA TAG ACA GAT GGA GCA AGA AAC ATTGTC-3 '.

4. M1 gene from A / Beijing / 353/89
semantic primer: SEQ.ID:39:
5'-GGT ACA AGA TCT ACC ATG CTT CTA ACC GAG GTC-3 '
antisense primer: SEQ.ID:40:
5'-CCA CAT AGA TCT TCA CTT GAA CCG TTG CAT CTG CAC-3 '.

5. NP gene from B / Panama / 45/90
semantic primer: SEQ.ID:41:
5'-GGT ACA GGA TCC ACC ATG TCC AAC ATG GAT ATT GAC GGC-3 '
antisense primer: SEQ.ID:41:
5'-CCA CAT GGA TCC TTA ATA ATC GAG GTC ATC ATA ATC CTC-3 '.

6. Gene M1 of B / Panama / 45/90
semantic primer: SEQ.ID:43:
5'-GGT ACA GGA TCC ACC ATG TCG CTG TTT GGA GAC ACA ATTGCC-3 '
antisense primer: SEQ.ID:44:
5'-CCA CAT GGA TCC TTA TAG GTA TTT CTT CAC AAG AGC TG-3 '.

 All clones of influenza virus genes obtained using cDNA or PCR were verified by sequencing through ligation sites into the gene and expression of the gene in transfected RD cells. Expression was detected by immunoblotting.

 Constructs NP and M1 for strain A / H3N2 (vectors 4 and 5) were prepared from genes A / Beijing / 353/89. These genes were selected due to the expected high degree of conservatism of both the NP gene and the M1 gene and due to their availability.

Based on previous work, a particularly preferred group of 7 expression vectors that are combined to form a vaccine includes:
1. VIJns - HA (A / Georgia / 03/93) - 6.56 kb

 2. VIJns - HA (A / Texas / 36/91) - 6.56 kb

 3. VIJns - HA (B / Panama / 45/90) - 6.61 kb

 4. VIJns - NP (A / Beijing / 353/89) - 6.42 kb

 5. VIJns - M1 (A / Beijing / 353/89) - 5.62 kb

 6. VIJns - NP (B / Panama / 45/90) - 6.54 kb

 7. VIJns - M1 (B / Panama / 45/90) - 5.61 kb

 Below are the corresponding sequences for combining these genes into expression vectors. Only small parts of these constructs require sequencing to confirm that the correct gene has been cloned. By comparing close known genes, it is easy to confirm that this gene is an NP gene, an HA gene, an M1 gene, etc. For example, the HA A / Texas gene sequence is very similar to the HA A / Kiev / 59/79 gene sequence, which is available at GENBANK under M38353. Also, the HA B / Panama gene sequence is very similar to the HA B / England / 222/82 sequence, which is available at GENBANK under M18384.

Similarly, the identity of a given gene from any human influenza virus can be confirmed. In each case, both the 5'-sequence and the 3'-sequence were confirmed below to ensure that the whole gene is present. In each case, the ATG in bold indicates the start codon of the influenza virus gene, and the sequence in bold in the 3'-sequence indicates the stop codon:
1. VIJns-HA (A / Georgia / 03/93) 6.56 kb:
5'-sequence: (SEQ.ID:46 :)
. ..TCA CCG TCC TTA GAT C / GG TAC AAC CAT GAA GAC TAT CAT TGC TTT GAG CTA CAT TTT ATG TCT GGT TTT CGC ...

3'-sequence: (SEQ.ID:47 :)
. . . TCA TGC TTT TTG CTT TGT GTT GTT TTG CTG GGGTTC ATC ATG TGG GCC TGC CAA AAA GGC AAC ATT AGG TGC AAC ATT TGC ATT TGA A / GA TCT ATG TGG GAT CTG CTG TGC ...

2. VIJns-HA (A / Texas / 36/91) 6.56 bp:
5'-sequence: (SEQ.ID:48 :)
. . .TTA GAT C / GG AAC ATG AAA GCA AAACTA CTA GTC CTG TTA TGT GCA TTT ACA GCT ACA TAT GCA ...

3'-sequence: (SEQ.ID:49 :)
. . . CTG GTG CTT TTG GTC TCC CTG GGGGCA ATC AGC TTC TGG ATG TGT TCT AAT GGG TCT TTG CAG TGT AGA ATA GGC ATC TGA ATG TGG / GAT CTG CTG TGC CTT ...

3. VIJns-HA (B / Panama / 45/90) 6.61 kb:
5'-sequence: (SEQ.ID:50 :)
. . .CCT TAG ATC / GGT ACA ACC ATG AAG GCA ATA ATT GTA CTA CTA ATG GTA GTA ACA TCC AAC GCA GAT CGA ATC TGC ACT GGG ATA ACA TCT TCA AAC TCA CCT CAT GTG. ..

3'-sequence: (SEQ.ID:51 :)
. . .TTG GCT GTA ACA TTG ATG ATA GCT ATT TTT ATT GTT TAT ATG GTC TCC AGA GAC AAT GTT TCT TGC TCC ATC TGT CTA TAA ATG TGG / GAT CTG CTG TGC CTT ...

4. VIJns-NP (A / Beijing / 353/89) 6.42 kb:
5'-sequence: (SEQ.ID:52 :)
. ..GTC CTT AGA TC / C ACC ATG GCG TCC CAA GGC ACC AAA CGG TCT TAT GAA CAG ATG GAA ACA GAT GGGGAA CGC CAG AAT GCA ACT ...

3'-sequence: (SEQ.ID:53 :)
. . .GAA AAG GCA ACG AAC CCG ATC GTG CCC TCT TTT GAC ATG AGT AAT GAA GGA TCT TAT TTC TTC GGA GAC AAT GCA GAA GAG TAC GAC AAT TAA G / GA TCT GCT GTG CCT ...

5. VIJns-M1 (A / Beijing / 353/89) 5.62 kb:
5'-sequence: (SEQ.ID:54 :)
. ..CTT AGA TC / C AGA TCT ACC ATG AGT CTT CTA ACC GAG GTC GAA ACG TAT GTT CTC TCT ATC GTT CCA TCA GGC CCC CTC AAA GCC GAA ATC GCG CAG AGA CTT GAA GAT GTC TTT GCT GGG AAA AAC ACA GAT .. .

3'-sequence: (SEQ.ID:55 :)
. . .GGG ACT CAT CCT AGC TCC AGT ACT GGT CTA AAA GAT GAT CTT CTT GAA AAT TTG CAG ACC TAT CAG AAA CGA ATG GGG GTG CAG ATG CAA CGG TTC AAG TGA AGA TCT ATG TGG / GAT CTG CTG TGC CTT ...

6. VIJns-NP (B / Panama / 45/90) 6.54 kb:
5'-sequence: (SEQ.ID:56 :)
. ..CCT AGA TC / C ACC ATG TCC AAC ATG GAT ATT GAC GGT ATC AAC ACT GGG ACA ATT GAC AAA ACA CCG GAA GAA ATA ACT TCT ...

3'-sequence: (SEQ. ID: 57 :)
. . .GTT GAA ATT CCA ATT AAG CAG ACC ATC CCC AAT TTC TTC TTT GGG AGG GAC ACA GCA GAG GAT TAT GAT GAC CTC GAT TAT TAA G / GA TCT GCT GTG ...

7. VIJns-M1 (B / Panama / 45/90) 5.91 kb:
5'-sequence: (SEQ.ID:58 :)
. ..CCT AGA TC / C ACC ATG TCG CTG TTT GGA GAC ACA ATT GCC TAC CTG CTT TCA TTG ACA GAA GAT GGA GAA GGC AAA GCA GAA CTA GCA GAA AAA TTA ...

3'-sequence: (SEQ.ID:59 :)
. . . AGA TCT CTT GGGGCA AGT CAA GAG AAT GGG GAA GGA ATT GCA AAG GAT GTG ATG GAA GTG CTA AAG CAG AGC TCT ATG GGA AAT TCA GCT CTT GTG AAG AAA TAC CTA TAA G / GA TCT GCT GTG ...

Example 6
Expression vector VIJ, SEQ.ID:10:
Our goal in creating the VIJ was to remove the promoter and transcription termination elements from our vector, V1, in order to place them in a more specific context and obtain a more compact vector and improve plasmid purification yields.

 VIJ obtained from vectors V1 (see example 1) and pU C18, a commercially available plasmid. V1 was digested with SspI and EcoRI to form two DNA fragments. The smaller of these fragments, containing the CMVintA promoter and bovine growth hormone transcription termination elements (BGH) that control the expression of heterologous genes (SEQ.ID:11 :), was purified from an agarose electrophoresis gel. The ends of this DNA fragment were "blunted" with the T4 DNA polymerase enzyme to facilitate ligation of this fragment with another blunt-ended DNA fragment.

 To provide a “framework” for this expression vector, the pUC10 plasmid was selected. It is known that it gives high plasmid yields, is well characterized by its sequence and function, and has a minimum size. We removed the entire lac operon from this vector, which was optional for our purposes and could interfere with plasmid yields and expression of heterologous genes. Removal was carried out by partial digestion with the HaeII enzyme. The remaining plasmid was purified from an agarose gel, its ends were blunted with T4 DNA polymerase, then it was treated with calf intestinal alkaline phosphatase and ligated with the CMVintA / BGH element described above. Plasmids were obtained that exhibit either of two possible orientations of promoter elements in the pUC scaffold. One of these plasmids gave significantly greater DNA yields in E. coli and was named VIJ (SEQ.ID:10). This vector structure was checked by sequencing the connecting sections. It was then shown that this plasmid gives comparable or higher expression of heterologous genes compared to V1.

Example 7
Designs of the influenza virus gene in the expressing vector VIJ:
Many of the genes of the strain A / PR / 8/34 of the influenza virus were cloned into an expression vector VIJ, which, as noted in Example 4, increased expression to levels as high or higher than levels in vector V1. PR8 gene sequences are known and available in the GENBANK databases. For each of these genes cloned as described below, the size of the cloned fragment was checked using a size-determining gel and a GENBANK number was provided with which the partial sequence was compared. A method of obtaining these genes from viral strains, for example, from a virus derived from ATCC (A / PR / 8/34 is ATCC VR-95; many other strains are also deposited in ATCC) see Example 5.

A. Subcloning of PR8 genes in VIJ:
1. NP gene
The NP gene was subcloned from pAPPR501 (JF Young, U. Desselberber, P. Graves, P. Palese, A. Shatzman and M. Rosenberg (1983), in "The Origins of Pandemic Influenza Viruses", ed. WG Laver. (Elsevier, Amsterdam) pp. 129-138). It was excised by cutting with pAPPR501 using EcoRI, the fragment was gel purified and blunted with T4 DNA polymerase. The cloned fragment was 1.6 kb in length.

2. NS gene
The NS gene was subcloned from pAPPR801 (JF Young, U. Desselberber, P. Graves, P. Palese, A. Shatzman and M. Rosenberg (1983), in "The Origins of Pandemic Influenza Viruses", ed. WG Laver. (Elsevier, Amsterdam) pp. 129-138). It was excised by cutting with pAPPR801 using EcoRI, gel purified and blunted with T4 DNA polymerase. A blunted fragment was inserted into VIJ, cut with BglII and also blunted with T4 DNA polymerase. The cloned fragment was 0.9 kb in length. (full coding region of NS, including NS1 and NS2).

3. The HA gene
The HA gene was subcloned from pJZ102 (JF Young, U. Desselberber, P. Graves, P. Palese, A. Shatzman and M. Rosenberg (1983), in "The Origins of Pandemic Influenza Viruses", ed. WG Laver (Elsevier, Amsterdam ) pp. 129-138). It was excised by cutting pJZ102 with HindIII, the fragment was gel purified and blunted with T4 DNA polymerase. A blunted fragment was inserted into VIJ, cut with BglII and also blunted with T4 DNA polymerase. The cloned fragment was 1.75 kb in length.

4. Gene PB1
The PB1 gene was subcloned from pGemI-PB1 (the 5'- and 3'-compounds of these genes with the vector were sequenced to verify their identity. See JF Young, U. Desselberber, P. Graves, P. Palese, A. Shatzman and M. Rosenberg (1983), in The Origins of Pandemic Influenza Viruses, ed. WG Laver (Elsevier, Amsterdam) pp. 129-138). It was excised by cutting with pGem-PB1 HindIII, the fragment was gel purified and blunted with T4 DNA polymerase. A blunted fragment was inserted into VIJ, cut with BglII and also blunted with T4 DNA polymerase. The cloned fragment was 2.3 kb in length.

5. Gene PB2
The PB2 gene was subcloned from pGemI-PB2 (the 5'- and 3'-compounds of these genes with the vector were sequenced to verify their identity. See JF Young, U. Desselberber, P. Graves, P. Palese, A. Shatzman and M. Rosenberg (1983), in "The Origins of Pandemic Influenza Viruses", ed. WG Laver (Elsevier, Amsterdam) pp. 129-138). It was excised by cutting with pGem-PB2 BamHI and gel purified. A sticky-end fragment was inserted into a VIJ cut with BglII. The cloned fragment was 2.3 kb in length.

6. Gene M1
The M1 gene was obtained by PCR from plasmid p8901 M1TE. The M sequence in this plasmid was generated by PCR from pAPPR701 (JF Young, U. Desselberber, P. Graves, P. Palese, A. Shatzman and M. Rosenberg (1983), in "The Origins of Pandemic Influenza Viruses", ed. WG Laver (Elsevier, Amsterdam) pp. 129-138). using the oligomer 5'-GGT ACA AGA TCT ACC ATG CTT CTA ACC GAG GTC-3 ', SEQ. ID: 3 :, for sense primer and oligomer 5'-CCA CAT AGA TCT TCA CTT GAA CCG TTG CAT CTG CAC-3 ', SEQ.ID:4 :, for antisense primer. The PCR fragment was gel purified, cut with BglII and ligated into VIJ cut with BglII. The cloned fragment was 0.7 kb in length. The amino acid end of the encoded M1 is encoded in the sense primer shown above as the ATG codon, while the translation stop codon M1 (stop codon) is encoded by reversing the TCA codon, which in the sense is the TGA stop codon.

B. Expression constructs of the influenza virus VIJ gene:
In each case, the connecting sequence from the 5'-promoter region (CMVintA) to the cloned gene is shown. The sequences were generated by primer sequencing: CMVintA primer: 5'-CTA ACA GAC TGT TCC TTT CCA TG-3 ', SEQ.ID:28: which generates a coding sequence. The position in which the connection is located is marked with "/", which does not mean interruption of the sequence. The method of obtaining these structures is summarized after the sequences below. Each sequence presented represents a complete, suitable, expressed DNA construct for an influenza virus gene.

 Each construct was temporarily transfected into RD cells (ATCC CCL 136), a human rhabdomyosarcoma cell line in culture. 48 hours after transfection, cells were harvested, lysed, and Western blots were obtained (with the exception of the VIJ-PR-HA construct, which was tested in mice and anti-HA specific antibodies were given before western blotting, thereby avoiding the need for Western blotting, since expression could be observed in vivo). Antibodies specific for PB1, PB2 and NS proteins were obtained from Stephen Inglis at the University of Cambridge, which used purified proteins expressed as β-galactosidase fused proteins to produce polyclonal antisera. Anti-NP polyclonal antiserum was obtained by immunizing rabbits with the whole virus A / PR / 8/34. Anti-M1 antibodies are commercially available from Biodesign as a goat anti-influenza A serum, catalog number B65245G. In each case, a protein of predicted size was observed, which confirmed the expression of the in vitro encoded protein of the influenza virus.

 The nomenclature of these structures corresponds to the generally accepted: "The name of the vector is the influenza strain is the gene." In each case, the sequence was checked by comparison with known sequences from GENBANK for cloned and sequenced gene sequences A / PR / 8/34. The biological effectiveness of each of these constructs is demonstrated in examples 2, 3 and 4 (see the end of the description).

 The sequence through the 5'-compounds of CMVintA and influenza genes from A / PR / 8/34 are given at the end of the description.

How fragments are connected:
1. VIJ-PR-NP: Blunt BglII (vector) with blunt EcoRI (NP)
2. VIJ-PR-PB1: Blunt BglII (vector) with blunt HindIII (PB1)
3. VIJ-PR-NS: Blunt BglII (vector) with blunt EcoRI (NS1)
4. VIJ-PP-HA: Blunt BglII (vector) with blunt HindIII (HA)
5. VIJ-PP-PB2: Sticky BglII (vector) with Sticky BamHI (PB2)
6. VIJ-PR-M1: sticky BglII (vector) with sticky BglII (M1).

 M1 was obtained by PCR using P8901-M1TE as a template and primers that add a BglII site at both ends and begin 3 bases in front of ATG and end immediately after the termination codon for M1 (TGA).

Example 8
Expression Vector VIJneo SEQ.ID:18:
It was necessary to remove the amp ^r gene used for antibiotic selection of bacteria that capture VIJ, since ampicillin cannot be used in large-scale fermenters. Amp ^r gene from pUC VIJ structure was removed by restriction enzyme digestion with SspI and Eam 11051. The remaining plasmid was purified by agarose gel electrophoresis, the ends were blunted with T4 DNA polymerase and then treated with calf intestinal alkaline phosphatase. The commercially available kan ^r gene derived from transposon 903 and contained in the plasmid pUC4K was excised with PstI restriction enzyme, purified by agarose gel electrophoresis, and blunted with T4 DNA polymerase. This fragment was ligated with the frame VIJ give plasmid kan ^r gene in either orientation, which were designated as VIJneo 1 and 3. Each of these plasmids was tested by restriction analysis, DNA sequencing connecting portions. It was shown that they produced similar amounts compared to VIJ. Expression of heterologous gene products was comparable to VIJ expression for these VIJneo vectors. We arbitrarily chose VIJneo 3, hereinafter referred to as VIJneo (SEQ.ID:I8 :), which contains the kan ^r gene in the same orientation as the amp ^r gene in VIJ as an expression construct.

 Genes from each of the strains A / Beijing / 353/39, A / Texas / 36/91 and B / Panama / 46/90 were cloned into the VIJneo vector as cDNA. In each case, the connecting sequences from the 5'-promoter region (CMVintA) to the cloned gene was sequenced using a primer: CMVintA primer: 5'-CTA ACA GAC T GT TCC TTT CCA TG-3 ', SEQ.ID:28: which generates coding sequence. It is adjacent to a terminator, the connection of which is also shown. This sequence is generated using a primer: BGH primer: 5'-GGA GTG GCA CCT TCC AGG-3 ', SEQ.ID:29:, which generates a non-coding chain. In each case, the sequence was checked by comparing with known GENBANK sequences for cloning and sequencing genes from these or other influenza isolates. The position at which the connection occurs is delimited in the form of "/", which does not mean any interruption of the sequence. In the case of the VIJneo-TX-HA compound, the sequencing gel was compressed and the initial sequence was difficult to read. Therefore, the first 8 bases of this compound are shown as "N". These nucleotides have been confirmed and identified. The first ATG codon, found in each sequence, is the translation initiation codon for the corresponding cloned gene. Each of the provided sequences represents the complete available expressed DNA construct for the designated influenza virus gene. The nomenclature corresponds to the generally accepted: "Vector name - influenza strain - gene." The biological effectiveness of each of these sequences was demonstrated in the same manner as in examples 2, 3 and 4 above.

 The sequence through 5'-compounds of CMVintA and influenza genes and through 3'-compounds of influenza genes and the terminator of BHH expressing constructs for various strains of the influenza virus and proteins are given at the end of the description.

Example 9
Intradermal injection of influenza virus genes:
The protocol for intradermal gene administration was the same as it was for intramuscular injection: three 200 μg injections at 3-week intervals V1-PR-NP. The spleens were collected for in vitro analysis 55 days after the third injection, restimulated with the nonapeptide epitope of nucleoprotein 147-155, SEQ.ID:9 :. Target cells (P815 cells, murine mastocytoma syngene with H-2 ^d BALB / c mice) were infected with heterologous virus A / Victoria / 73 and specific lysis was performed using spleen cells as an effector with an effector: target ratio between 5: 1 and 40: 1. Negative controls were obtained by measuring the lysis of target cells not infected with influenza virus. Positive controls were obtained by measuring the lysis of influenza virus infected target cells obtained from a mouse that was injected three times with 130 μg V1-PP-NP and which survived infection with a live strain of influenza virus A / NK / 68.

 Results: Specific lysis was achieved using spleen cells from intradermally injected mice in all effector: target ratios. There was no specific lysis when spleen cells obtained from uninjected mice or mice injected with the V1 vector without the inserted PR-NP gene (empty vector) were used as effector cells. In addition, the specific lysis achieved by intradermal delivery was comparable in all respects to the effector: target with the results obtained using intramuscular delivery. Also measured viral titers in the lungs in mice injected intradermally or intramuscularly. The results using 5 mice per group, 3 • 200 mcg doses at intervals of 3 weeks and infection 3 weeks after the last dose are given in table. 2.

 Finally, the survival rate of mice by day 28 was tested. On day 28, 89% of intramuscular recipients and 50% of intradermal recipients survived from mice receiving V1-NP-PP. None of the mice receiving the V1 vector survived, and only 30% survived from untreated mice. This experiment demonstrates that DNA encoding a nucleoprotein from strain A / PP / 8/34 was able to induce CTLs recognizing a nucleoprotein from a heterologous strain A / Victoria and a protective immune response against a heterologous strain A / NK / 68.

Example 10
Vaccination with polynucleotides in primates
1. Antibodies to NP in rhesus monkeys: Rhesus monkeys (006 NP, 009 NP or control 101; 021) were injected with 1 mg / RSV-NP site intramuscularly in 3 places on the 1st day. Injections of 1 mg of RSV-Lux and CMV-int-Lux, constructs for expression of the firefly luciferase reporter gene, were given at the same time in other places. Animals were re-injected on day 15 with the same amounts of DNA as the first time, and also 1 mg of pD5-CAT, a construct for the expression of the chloramphenicol acetyltransferase reporter gene, at 1 site each. Muscle sites containing reporter genes were taken for biopsy and analyzed for reporter gene activity. Serum was collected at 2, 5, 9, 11, 13, and 15 weeks after the first injection. The first positive test for antibodies against NR was collected at week 11 and positive samples were also obtained at weeks 13 and 15. Antibodies against NR were determined using ELISA. The results are presented in Fig.9.

 2. Inhibiting hemagglutination (H1) antibodies in rhesus monkeys: Macaques were injected intramuscularly with VIJ-PR-HA on day 1. Two animals received (each) 1 mg, 100 μg or 10 μg of DNA in each quadriceps. Each injection was administered in a volume of 0.5 ml. Animals were bled prior to injection on day 1. All animals were re-injected with DNA on day 15 and blood was collected after that at 2-4 week intervals. Hemagglutination inhibition titers (H1) against A / PP / 8/34 were positive at 5, 9, and 12 weeks after the first injection of VIJ-PP-HA DNA. The results are shown in table. 3.

Example 11
Ferret polynucleotide vaccine studies
1. A study of the ferret polynucleotide vaccine was started to determine whether animals can be protected against infection by influenza virus by immunization with genes encoding either HA (a surface protein capable of inducing the formation of strain-specific neutralizing antibodies) or an internal protein NP, NS1, PB1, M (which could induce a cell-mediated immune response that would be strain independent). Animals were injected with DNA encoding the different genes of the influenza virus in our vector VIJ, as shown in table. 4.

 2. On the 22nd and 43rd days after immunization, serum was collected from immunized animals and analyzed for neutralizing (hemagglutination inhibiting - H1) antibodies and for antibodies to nucleoprotein (NP) using ELISA, animals injected with DNA formed antibodies to the corresponding genes. This is shown in FIGS. 10, 11 and 16.

3. On the 128th day of the selected immunized animals, 1200 TCID ₅₀ of influenza A / NK / 68 virus was infected. This strain is heterologous to strain A / PP / 8/34, which was the source of the coding sequences used for immunization, and therefore protection indicates immunity based on cell mediated immune mechanisms independent of the strain. As shown in FIG. 12, in animals immunized with DNA encoding the internal proteins, a statistically significant decrease in virus excretion into the medium was observed compared with the controls, which confirms that immunization with polynucleotides in ferrets is able to induce an immune response and this immune response is protective .

 4. Similarly, homologous infection was tested with A / PP / 8/34 and the protective efficacy of neutralizing antibodies induced by polynucleotide vaccination was also demonstrated.

Example 12
Getting VIJns
The SfiI site was added to VIJneo to facilitate integration studies. Commercially available 13 bp SfiI linker (New England BioLabs) was added at the KpnI site within the BGH sequence of this vector. VIJneo was linearized with KpnI, gel purified, blunted with T4 DNA polymerase and ligated with a blunted SfiI linker. Clone isolates were selected by restriction mapping and checked by sequencing through a linker. The new vector was designated VIJns (Fig.17). The expression of heterologous genes in VIJns (with SfiI) was comparable to the expression of the same genes in VIJns (with KpnI).

Example 13
Immunogenicity
1. Humoral immune responses
Injection of DNA encoding the HA, NR, and M1 proteins of influenza resulted in humoral immune responses in mice, ferrets, or primates other than humans (including African green monkeys and rhesus monkeys). To date, it has been shown that PNVs containing HA genes cloned from influenza virus strains A / PR / 34, B / Panama / 90, A / Beijing / 89, A / Texas / 91, A / Hawaii / 91 and A / Georgia / 93, cause the formation of antibodies.

a) Mice: Antibodies to NP and M1 were detected by ELISA in sera from mice after DNA injection. Significant antibody titers (10 ⁴ -10 ⁶ ) were formed in total
with only 1 μg of DNA (A / PR / 34) administered once (the lowest tested dose), they occurred already 2 weeks after the injection (the earliest tested time) and did not decrease for at least 6 months after the injection. These NP antibodies are not neutralizing and do not participate in protection. However, they do demonstrate NP protein expression in vivo after DNA injection. In contrast, anti-HA antibodies do provide protective immunity against a homologous strain of influenza virus. Injection of HA cloned from strain A / PR / 34 resulted in the formation of neutralizing antibodies, as measured in vitro in a hemagglutination inhibition test (H1). H1≥1280 titers were measured in many mice that received 3 doses of 100 μg of HA DNA, and detectable titers were observed in some animals that received only 2 doses of 0.1 μg. There was a dose-response relationship between the H1 titer and the dose of DNA, as well as between the H1 titer and the number of injections (Table 5).

 Table 5: Female BALB / s mice (4-6 week old) were injected with DNA A / PR / 34 (VIJ HA) at the indicated doses 1, 2 or 3 times at 3-week intervals. Negative controls were mice injected with control DNA consisting of a vector without gene insertion (VIJ) and previously uninfected mice that were not infected. Serum samples were taken at 7 weeks after injection and analyzed for the presence of inhibitory hemagglutination (H1) antibodies. Data are presented as geometric mean titers H1, where n = 10.

 In each of the tested mice, the presence of H1 antibodies correlated with protection in a homologous infection model. Hemagglutination inhibiting antibodies (H1 antibodies) in mice injected with HA DNA (A / PP / 34) remained virtually unchanged for at least six months. HA antibodies, as measured by ELISA, were also formed in mice using HA DNA from influenza virus strains A / Beijing / 89, B / Panama / 90 and A / Texas / 91.

 Based on a literature report showing that after DNA injection the expression of the reporter gene was lower in old mice, we examined the effect of age on humoral immune responses to HA. Due to the inaccessibility of the oldest unfertilized female mice, non-producing mice of approximately 10 months of age were used. These mice and 4-6 week old unfertilized mice were compared for their ability to form antibodies to HA. Older mice were able to form HA antibodies after injection of HA DNA at doses as low as 1 μg (the lowest dose tested), although with a lower titer than younger mice (see Table 6).

 Table 6: Female BALB / c mice (4-6 week old unfertilized and 10 month old non-producing) were injected with DNA A / PR / 34 (VIJ HA) at the indicated doses three times at 3-week intervals. Negative controls were mice injected with control DNA (VIJ) and previously uninfected mice that were not infected. For comparison, other mice were injected with a sublethal dose of A / PP / 34. Serum samples were taken at 9 weeks after injection 1 and analyzed for titer H1. Data are presented as geometric mean H1 titers, where n = 15.

 However, this was not the result of the PNV vaccine itself, but rather due to the reduced ability in old mice to generate generally humoral immune responses, as old mice found such lower H1 responses than young mice after infection with live A / PP / 34 virus. In fact, H1 antibodies appear to be less reduced in old mouse vaccinated DNAs than in old mouse infected with influenza virus. In addition, the non-producing old mice used in these studies were approximately 50% heavier than typical unfertilized mice of the same age, which, based on studies by other authors using calorie-restricted diets in mice, could have an adverse effect on immune the answers of these animals. For this and other reasons, the immune responses of these mice may not be representative. However, age (at least up to 10 months) does not seem to significantly reduce the ability of polynucleotide vaccination to induce humoral immune responses, even at doses as low as 1 μg.

 b) Ferrets: Humoral immune responses were obtained in ferrets injected with HA DNA from A / PR / 34, A / Beijing / 89, A / Hawaii / 91 and A / Georgia / 93 influenza strains. H1 antibodies against A / PR / 34 and ELILA antibodies against HA from other strains were induced by the corresponding PNV. Ferret sera injected with DNA A / Beijing / 89, A / Hawaii / 91 and A / Georgia / 93 DNA contained H1 antibodies and neutralizing antibodies, as these animals were protected against virus infection.

 c) Primates other than humans: (see also example 10 above). Rhesus macaques were immunized twice with DNA (A / PR / 34) at doses of 10, 100 and 1000 μg per foot. H1 titers of up to 320 were found in animals that received 100 or 1000 micrograms and one of the two doses receiving 10 micrograms of macaque had H1 80. So far, sera were analyzed up to 13 months; H1 titers did not decrease markedly when compared with 6–13 months (see Table 7).

 Table 7: Rhesus macaques (both males and females) ranging in size from 4.3 to 8.8 kg were injected with DNA A / PP / 34 (VIJ HA) at the indicated doses at 0 and 2 weeks. Serum samples were taken at the indicated time points after the first dose and analyzed for H1 titer. Data are H1 titers for individual animals.

 In African green monkeys injected with a PNV combination containing 100 μg HA DNA (A / Beijing / 89), a serum score 4–6 weeks after the 1st dose revealed a GMT (geometric mean titer) of 29 (8 out of 9). This is better than responses to a licensed vaccine containing subvirion (GMT = 16, 5/6), and to a licensed vaccine containing a whole virion (MT = 36, 6/6) at the same time point (Fig. 18). A noticeable booster effect of the second immunization was found in animals receiving a dose of 10 μg HA DNA (GMT 1.9 after 1 dose and 199 after 2 doses). The licensed whole virion vaccine showed a similar revaccination effect, while the H1 titers produced by the subvirion vaccine were only temporary. To date, similar levels of H1 antibodies have been measured up to 18 weeks in animals immunized with doses of 10 μg or doses of 100 μg of HA DNA when compared with the best licensed whole virion vaccine. These results indicate that PNV was at least as effective in generating neutralizing antibodies as the whole virion vaccine, and more effective than the subvirion vaccine. The purified subunit vaccine was not detectable immunogenic in mice; therefore, subunit vaccines have not been tested in primates other than humans. In this study, PNV contained a 5-valent mixture (cocktail) of DNA encoding HA from A / Beijing / 89, B / Panama / 90 and A / Texas / 91, and NP and M1 from A / PP / 34 to make it look like for a possible (candidate) vaccine. These animals were also tested for the generation of humoral immune responses against other components of this vaccine and antibodies against HA B / Panama / 90 and NP A / PP / 34 were detected. In a separate experiment, injection of two doses of HA DNA cloned with PCR induced both H1 antibodies and neutralizing antibodies against HA A / Texas / 91.

2. Cell-mediated immune responses
See example 3 above.

3. The formation of immune responses
a) Humoral immunity: Events leading to the formation of humoral and cell-mediated immune responses after DNA injection have not yet been clarified. It is likely that for the formation of neutralizing antibodies (for example, against influenza HA), cells must express this antigen on the plasma membrane or secrete it into the extracellular medium. In addition, transfected cells must express HA with a secondary, tertiary and quaternary structure similar to that in the virion. In the rosette test, HA cell expression was demonstrated in RD cells (rhabdomyosarcoma; myoblast origin) temporarily transfected with DNA. Erythrocytes agglutinated on the surface of transfected HA cells, but not falsely transfected cells, showing that HA not only is expressed on the cell surface, but also retains the correct conformation for binding to sialic acid-containing proteins.

 b) Cell-mediated immunity: The formation of cell-mediated immune responses (e.g., against the influenza NP virus) requires proteolytic processing and the provision of processing-derived peptides in association with the glorious class I tissue compatibility complex. The nature of antigen-producing cells leading to the formation of immune responses after DNA injection is still unknown. Muscle cells express low levels of MHC class I and are not believed to express co-stimulatory molecules on their surface. Therefore, muscle cells are not considered to provide antigen cells.

 However, some lines of evidence suggest that muscle cells are involved in the generation of immune responses after intramuscular DNA injection. First, a limited examination of tissues capable of internalizing naked plasmid DNA followed by in situ expression of the protein showed that many types of cells can express reporter genes by injecting such plasmids directly into this tissue, but these tissues were significantly less effective than muscle cells . A full analysis of DNA uptake by non-muscle cells after intramuscular injection has not yet been reported, but perhaps this uptake would be even less effective. Secondly, expression of reporter genes after intramuscular injection of DNA has been demonstrated in skeletal and cardiac muscle cells in many different forms. Third, although CTL responses could be obtained after DNA injection by other means (intravenously and intradermally), the best protective name responses in mice were induced after intramuscular injection of DNA. Fourth, myoblasts and myocytes could be recognized and lysed by CTL in vitro, and this lysis could be enhanced by pretreatment with γ-interferon, which stimulates the expression of MHC class I. Finally, transplantation of stably transfected NP-expressing myoblasts in previously uninfected syngeneic mice led to the formation of protective cell-mediated immune responses in vivo (Fig. 20). Thus, expression of antigens by muscle cells is sufficient to induce protective immune responses detected after DNA injection. In addition, uptake and expression of DNA by non-muscle cells may not be required to generate protective immunity. From the point of view of polynucleotides as vaccines, it would be potentially beneficial to limit the uptake of DNA only to muscle cells. Firstly, myocytes are completely differentiated and do not divide. This could be important to reduce the possibility of integration of plasmid DNA into chromosomal DNA and to maintain antigen expression, which could lead to long-term immune responses. Secondly, myocytes are large, multinucleated cells that can be regenerated by fusion of myoblasts. This may help explain why DNA injection results in protein expression that can potentially persist for extended periods of time without detecting cytolytic degradation under the influence of CTL.

Example 14
Defense Studies
Immunization of DNA encoding influenza virus antigens provided protection against death and morbidity and reduced viral loads in many combinations of influenza virus strains using two widely recognized models for human influenza infection (mice and ferrets).

 1. Heterologous (heterotypic, common for the group) protection (immunity) is not provided by an effectively licensed vaccine with killed virus, but is provided by DNA vaccination in animal models. This protection was demonstrated by injecting DNA encoding NP or M1 into laboratory animals. The cross-reactive cell-mediated immune response (CMI) induced by vaccination of these DNAs provided a protective response.

a). Mice: BALB / s and C3H mice were injected intramuscularly with DNA encoding NP from A / PR / 34; these mice were protected from death and from disease (estimated by weight loss) when all airways were infected with LD ₉₀ A / Hong kong / 68 (H3N2), a heterotypic strain (H3 versus H1 for A / PR / 34). Fig. 21 shows the survival of BALB / s mice immunized 3 times with NP DNA (200 μg per dose) at 3-week intervals and infected 3 weeks after the last immunization. Fig. 22 shows the suppression of weight loss after infection in immunized mice compared to severe weight loss experienced by control mice. 23 shows a decrease in viral load in the lungs 7 days after infection of the upper respiratory tract of mice immunized with NP DNA, compared with mice that received control DNA. Mice immunized with NP DNA were completely protected from death, experienced reduced weight loss, and found less viral load (viral titer) in the lungs when compared with control mice. It was found that the amount of NP DNA required to protect mice from death and weight loss is ≤ 6.35 μg per injection with 3 injections (Fig. 24). It was found that the protection created by immunization with NP DNA remains virtually unchanged for at least 3 months in immunized mice. The level of protection lasted up to 6 months, but slightly decreased between the 3rd and 6th months after the last immunization. However, re-vaccination with a single injection of NP DNA at 22 weeks, 3 weeks before infection at week 25, restored full protection (Fig. 25). Thus, immunization of mice with NP DNA produced a prolonged, heterologous defense enhanced by re-immunization. The ability to generate an anamnestic response when re-vaccinating these animals suggests that immunization with NP DNA induced immunological memory.

 b) Ferrets: Ferrets are usually used as a model for human influenza virus infection, as they are susceptible to infection with a wide variety of human influenza virus isolates. The replication of the virus in the ferret occurs mainly in the nostrils and trachea and to a much lesser extent in the lungs, as opposed to mice, in which the viral load (titer) is very large in the lungs. Infection in ferrets can be traced most easily by titration of the virus in the nasal wash fluid. Ferrets immunized with NP DNA or M1 DNA, separately or in combination, from a strain recently obtained from humans (A / Beijing / 89, H3N2) found significantly reduced virus isolation on days 1-6 after infection with A / Georgia / 93 culture (H3N2) (Fig. 26). This isolate showed antigenic drift from strain A / Beijing / 89, so that the licensed vaccine against A / Beijing / 89 provided little or no protection in humans against the disease caused by A / Georgia / 93. Ferrets immunized with DNA encoding the internal proteins A / PR / 34 found a significantly reduced virus in the nose 5–6 days after infection with the homologous strain A / PR / 34 (FIG. 27). A decrease in virus isolation was observed after infection with A / Georgia / 9Z at earlier and later time points, while only a later decrease in virus isolation was observed after infection with A / PP / 34; this may be due to the difference in virulence between the two strains for ferrets.

 2. Homologous (homotypic, type-specific) protection was easily demonstrated both in mice and in ferrets immunized with DNA.

a) Mice: BALB / c mice immunized with DNA (A / PR / 34) were fully protected against infection with LD ₉₀ A / PR / 34. Immunized mice did not die (Fig. 28) and did not experience a weight loss of more than 5% (Fig. 29) after infection, while 90-100% of the mice died and experienced severe weight loss. Titration of the dose of HA DNA required to achieve protection showed that 3 injections of 1 μg of HA DNA were sufficient to achieve complete protection (FIG. 30).

 b) Ferrets immunized with DNA encoding HA from A / PP / 34 had significantly lower virus isolation on days 1-6 after homologous infection than ferrets received control DNA (Fig. 31). Also, ferrets immunized with DNA A / Georgia / 93 had a reduced virus isolation on the 1st day and on the 3rd-7th days after the homologous infection (Fig. 32). H1 antibodies were present against the corresponding strains in sera from all immunized ferrets (vide supra). Thus, immunization with DNA produces a homologous defense.

 3. Vaccine combinations: Ferrets were tested for the ability of HA DNA to provide the best breadth (range) of protection when combined with NP and M1 DNA.

 a) Protection range against varieties with antigenic drift: The antigenic drift occurring between strains A / Beijing / 89 and A / Beijing / 92 was sufficient to prevent many people immunized with a licensed vaccine containing strain A / Beijing / 89 against the disease caused by variety A / Beijing / 92. In North America, a widespread disease was caused by field strains of the A / Beijing / 92-like virus, such as A / Georgia / 93. Field isolates of North America are antigenically similar to strain type A / Beijing / 92, but differ in the geographical location of their isolation and in their history of passage, since they were passaged in a culture of mammalian cells, and not in eggs. However, the amino acid sequence of HA A / Beijing / 92-like strains differed from A / Beijing / 89-like strains by only 11 point mutations (positions 133, 135, 145, 156, 157, 186, 190, 191, 193, 226 and 262 ) in the area of NAI. Therefore, we tried to determine whether combining homotypic immune responses induced by HA DNA with cross-reactive CMI responses induced by NP and M1 DNA would provide a greater degree of protection against this species with antigenic drift. Immunization of ferrets with a licensed vaccine containing strain A / Beijing / 89, or HA DNA from A / Beijing / 89 or A / Beijing / 89-like field isolate (A / Hawaii / 91) resulted in a decrease in virus excretion during infection of ferrets A / Georgia / 93 (Fig. 33). Ferrets immunized with a combination PNV containing DNK NP, M1 and HA had significantly less virus isolation than ferrets immunized with a licensed product or one HA DNA (Fig. 34). In the case of HA DNA A / Hawaii / 91 combined with NP DNA and M1 A / Beijing / 89, the protection obtained did not differ significantly from the maximum protection provided by the DNA of homologous A / Georgia / 93 (Fig. 35). Thus, the combination of HA, NP, and MI DNA provided improved protection (immunity) against the antigenic drift variety compared to the licensed vaccine.

 b) Effect of vaccine antigen passaging history: Ferrets immunized with a vaccine consisting of a HA DNA sequence obtained from a US field isolate passaged in MDSC cells in tissue culture (A / Hawaii / 91) found less (p = 0.021 according to two-factor ANOVA) virus isolation than ferrets who received a licensed vaccine with killed virus containing strain A / Beijing / 89, passaged in eggs, when infected with a strain with antigenic drift A / Georgia / 93 (Fig. 33). In contrast, ferrets receiving HA DNA from A / Beijing / 89 did not experience significantly different virus isolation (p = 0.058) after infection with A / Georgia / 93 compared with ferrets receiving a licensed vaccine containing the identical virus. The strains grown in eggs and mammalian cells are distinguished by two point mutations in the HAI HA region (positions 186 and 193), both of which are located in antigenic site B, close to the apex of HA monomer in the region, which is considered important for binding of H1 antibodies and neutralizing antibodies. In some cases, the ability of some influenza virus isolates to bind to chicken RBC is initially very low, but increases by subsequent egg passages, suggesting that the binding site of the HA receptor can be significantly selected by growing in bird cells. The effect of small sequence changes on the efficacy of HA-based influenza vaccines in laboratory animals indicates the potential importance of maintaining the wild-type virus sequence as possible in the manufacture of such vaccines.

 c) Primates other than humans: Primates other than humans are not commonly used for influenza infection models due to the lack of clinical response to infection. However, we investigated the immunogenicity of PNV vaccine combinations in non-human primates compared to licensed vaccines containing the killed virus. Antibody titers induced by combined PNV containing HA genes and internal proteins were at least equivalent to licensed product titers with the same duration of the response (vide supra). African green monkeys immunized with PNV responded to HA PNV for a species with antigenic drift, showing that type-specific responses to PNV can form in previously immunized individuals. Monkeys immunized with PNV also responded to subsequent immunization with a conventional killed virus vaccine.

 4. Conclusion: Polynucleotide influenza vaccines are effective in laboratory animal models of influenza infection. Homologous protection can be achieved using DNA vectors encoding HA, most likely through an immunological mechanism similar to that induced by the HA protein used in an existing licensed influenza vaccine. Heterologous protection can be achieved against strains with antigenic variation and antigenic drift by also including DNA encoding the internal proteins of the influenza virus in the vaccine. A combination of these approaches improved protection against antigenic drift species compared to the existing licensed vaccine in the ferret model.

Example 15
Getting VIR vectors
Trying to optimize further our main vector used for vaccination, we prepared a derivative of VIJns, which was designated as VIR. The aim of constructing this vector was to obtain a minimum size vector for the vaccine, i.e., without optional DNA sequences, which still retains all optimized heterologous gene characteristics and high plasmid yields that are characteristic for VIJ and VIJns. We determined from the literature and also through experiment that (1) the regions within the pUC structure containing the E. coli replication seed could be removed without affecting the plasmid exit from bacteria; (2) the 3'-region of the kan ^r gene, after the open reading frame of kanamycin, could be deleted if a bacterial terminator was inserted in its place; and (3) ~ 300 bp BGH could be removed from the 3'-half of the terminator without affecting its regulatory function (after the site of the original KpnI enzyme inside the BGH element).

VIR was constructed using PCR synthesizing 3 segments of DNA from VIJns, which are the CMVintA promoter / BHH terminator, seed replication, and kanamycin resistance elements, respectively. Restriction enzymes unique to each segment were added to the end of each segment using PCR oligomers: SspI and XhoI for CMVintA / BGH; EcoRV and BamHI for kan ^r gene; and BclI and SalI for ori ^r . These enzymes were chosen because they allow ligation of each of the DNA segments obtained by PCR with the subsequent loss of each site: EcoRV and SspI leave DNA with blunt ends, which are suitable for ligation, while BamHI and BclI leave complementary protrusions, as well as SalI and XhoI. After obtaining these segments by PCR, each segment was digested with the appropriate restriction enzymes mentioned above, and then ligated together in one reaction mixture containing all three segments of DNA. The 5'-end of ori ^r was designed to include the T2 rho independent terminator sequence that is normally found in the area so that it can provide termination information for the kanamycin resistance gene. The ligation product was checked by restriction enzyme digestion (more than 8 enzymes), as well as DNA sequencing of ligation compounds. The plasmid yields and heterologous expression using viral genes within the VIR appear to be similar to the VIJns. In general, a decrease in the size of the vector by 1346 bp was achieved. (VIJns - 4.86 kbp; VIR - 3.52 kbp) see Fig. 36, SEQ.ID:45 :.

PCR oligomeric sequences used to synthesize VIR (restriction enzyme sites are underlined and identified in square brackets after the sequence):
(1) 5'-GGT ACA AAT ATT GG CTA TTG GCC ATT GCA TAC-G-3 '[SspI], SEQ.ID: 60 :,
(2) 5'-CCA CAT CTC GAG GAA SSG GGT CAA TTC TTC AGC ACC-3 '[XhoI], SEQ. ID: 61:
(for the CMVintA / BGH segment),
(3) 5'-GGT ACA GAT ATC GGA AAA CCA CGT TGT GTC TCA AAA TC-3 [EcoRY], SEQ.ID:62 :,
(4) 5'-CCA CAT GGA TCC G TAA TGC TST GCC AGT GTT ACA ACC-3 '[BamHI], SEQ.ID:63:
(for kanamycin resistance gene segment),
(5) 5'-GGT ACA TGA TCA SGT AGA AAA GAT CAA AGG ATC TTC TTG-3 '[BclI], SEQ.ID:64 :,
(6) 5'-CCA CAT GTC GAC CC GTA AAA AGG CCG CGT TGC TGG-3 '[SalI], SEQ.ID: 32:
(for seed replication of E. coli).

Claims (8)

 1. A DNA construct encoding an influenza virus protein selected from plasmids V1Jns-BJ-NP or V1Jns-PA-NP (B / Panama / 45/90), containing a cytomegalovirus promoter with an intron A sequence (1.64 kb); the region of termination of transcription of growth hormone of the bull (0.55 kb), in the KrnI site of which a unique SfiI site is built in (13 bp); the nucleoprotein gene of the corresponding influenza virus; replication start area (0.64 kb); kanamycin resistance gene (1.30 kb).  2. The DNA construct encoding the protein of the influenza virus, selected from plasmid V1Jns-GA-HA (A / Georgia / 03/93) size of 6.56 so-so. wherein the 5'-end is SEQ. ID: 46, a 3'-end is SEQ. ID: 47; plasmids V1Jns-TX-HA (A / Texas / 36/91) of 6.56 bp wherein the 5'-end is SEQ. ID: 48, and 3'-end is SEQ. ID: 49; and plasmids V1Jns-PA-HA (B / Panama / 45/90) measuring 6.61 bp wherein the 5'-end is SEQ. ID: 50, and 3'-end is SEQ. ID: 51, including a cytomegalovirus promoter with an intron A sequence (1.64 kb); the region of termination of transcription of growth hormone of the bull (0.55 kb), in the KrnI site of which a unique SfiI site (13 bp) is embedded; hemagglutinin gene of the corresponding influenza virus; replication start area (0.64 kb); kanamycin resistance gene (1.30 kb).  3. The DNA construct encoding a protein of the influenza virus, selected from plasmid V1Jns-BJ-M1 (A / Beijing / 353/89) size of 5.62 TPN wherein the 5'-end is SEQ. ID: 54, and 3'-end is SEQ. ID: 55; and plasmids V1Jns-Pa-M1 (B / Panama / 45/90) measuring 5.61 bp wherein the 5'-end is SEQ. ID: 58 and 3'-end is SEQ. ID: 59, including a cytomegalovirus promoter with an intron A sequence (1.64 kb); the region of termination of transcription of growth hormone of the bull (0.55 kb), in the KpnI site of which a unique SfiI site is built in (13 bp); the matrix protein gene of the corresponding influenza virus; replication start area (0.64 kb); kanamycin resistance gene (1.30 kb).  4. A DNA vector for use as a basis for a vaccine, which is V1Jns, comprising a cytomegalovirus promoter with an intron A sequence (1.64 kb); the region of termination of transcription of growth hormone of the bull (0.55 kb), in the KrnI site of which a unique SfiI site is built in (13 bp); replication start area (0.64 kb); kanamycin resistance gene (1.30 kb), as shown in FIG. 17.  5. Immunogenic composition for the induction of specific for the influenza virus immunity, containing as an active agent an effective amount of nucleic acid, characterized in that for the induction of immunity using the DNA construct according to any one of paragraphs. 1-3.  6. A vaccine against influenza virus containing the DNA construct according to any one of paragraphs. 1-3.  7. A method of inducing an influenza virus-specific immune response in a subject, characterized in that it comprises administering to the subject a DNA construct according to claim 1.  8. The method of vaccination of a subject, characterized in that it includes the introduction of a subject DNA construct according to claim 1.

Images