RU2162711C2 - Recombinant antibody il4 used for treatment of disorders associated with function of il4 - Google Patents

Abstract

FIELD: biotechnology, medicine, immunology. SUBSTANCE: invention relates to recombinant antibodies IL4 used for treatment of patients with disorders associated with functions of IL4. Invention involves chimeric and human antibodies IL4 Mab that are derivatives of highly effective antibodies Mab and containing their pharmaceutical compositions and methods of diagnosis and treatment. Advantage of invention consists of the development of antagonist of IL4 with high affinity that is able to decrease the level of eosinophilic inflammation. EFFECT: enhanced effectiveness of antagonist, valuable immunological properties. 25 cl, 3 tbl, 10 dwg, 8 ex

Description

 This application is a partially continued application for a US application with serial number 08 / 136,783 dated October 14, 1993, which is a continuation of the US application with serial number 08 / 117.366 dated September 7, 1993, both of which are referenced in the present invention.

 The present invention mainly relates to the field of fusion proteins, as well as to proteins used for the treatment and diagnosis of disease conditions associated with the action of IL 4 and excess production of IgE, more specifically, the present invention relates to chimeric and humanized IL 4 antibodies.

 The field of atopic allergic diseases covers both relatively minor diseases, for example, such as seasonal rhinitis and conjunctivitis, as well as more serious diseases, such as atopic dermatitis and atopic asthma, as well as life-threatening diseases such as anaphylactic shock. A common factor in such painful conditions is the body's immune response to allergens, and such a reaction consists in the production of immunoglobulin E (IgE) antibodies in genetically predisposed patients (atopy). Inhibition of IgE production for a long time has been the goal of specific immunotherapy of allergic diseases using desensitizing vaccines. However, in recent years, the safety and effectiveness of vaccine therapy has become doubtful, however, the need to lower IgE levels has not disappeared.

 Interleukin 4 (IL 4) is a protein mediator in the lymphoid system. A study of lymphocytes taken from atopic patients revealed an increased number of T-lymphocytes with the ability to secrete IL 4 in response to stimulation and increased amounts of IL 4 secreted after stimulation.

It was found that the anti-IL 4 antibody inhibits IgE, but does not inhibit IgG ₁ or IgG _2a / Finkelman et al., Ann. Rev. Immunol. 8: 303 (1990) /, as well as the production of IL 5 secreting T cells / Maggi et al., J. Immunol. 148: 2142 (1992). In addition, recent data have confirmed that IL 4 can affect the accumulation of eosinophil in tissues. See, for example, Tepper et al. Cell, 62: 457 (1990); Tepper et al. Cell, 57; 503 (1989).

 In the art, there remains a need for a high affinity IL 4 antagonist capable of reducing the level of zosinophilic inflammation by reducing the proliferation of IL 5 secreting cells and inhibiting the adhesion mechanism, as a result of which zosinophils can accumulate in tissues and be used for treatment, prevention and diagnosis of allergic reactions.

In accordance with the first aspect, the present invention provides a fusion protein having an affinity for binding to human interleukin-4, which contains regions determining the complementarity (CDR) of a non-human neutralizing monoclonal antibody (Mab), characterized by a dissociation constant equal to or less than 2 · 10 ^-10 M for human IL 4, and a first fusion partner in which at least one and preferably all of the complementarity determining regions (CDRs) are substituted by the CDRs of a non-human monoclonal antibody walking (Mab). Such a neutralizing monoclonal antibody of non-human origin can be selected from the group consisting of 3B9 and 6A1, in accordance with what is more fully described in the detailed description of the invention. Preferably, the fusion protein is operably linked to a second fusion protein comprising all or part of the immunoglobulin constant chain.

In a related aspect, the present invention provides a CDR of a neutralizing non-human monoclonal antibody (Mab) having a dissociation constant of equal to or less than 2 × 10 ^-10 M for human IL 4 and a nucleic acid molecule encoding such CDRs.

According to another aspect, the present invention provides humanized antibodies containing at least one and preferably six complementarity determining regions (CDRs) derived from neutralizing monoclonal antibodies of a nonhuman origin (Mab) having a dissociation constant of equal to or less than 2 ^10-10 M for human IL 4.

According to yet another aspect, a chimeric antibody is provided comprising human constant regions of the heavy and light chains and variable regions of the heavy and light chains derived from non-human neutralizing monoclonal antibodies (Mabs) having a dissociation constant of equal to or less than 2 × 10 ⁻¹⁰ M for human IL 4.

 Another aspect of the present invention relates to a pharmaceutical composition, which contains one (or more) of the above fused proteins or Mab (for example, humanized, chimeric, etc.) and a pharmaceutically acceptable carrier.

 A further aspect of the present invention provides a method for treating and / or preventing allergic conditions in humans by applying an effective amount of a pharmaceutical composition of the invention.

Another aspect of the present invention provides methods and components used for the recombinant production of fusion proteins, Mabs (e.g., humanized, chimeric, etc.), their CDR, Fab or F (ab ') ₂ or their analogues derived from non-human neutralizing monoclonal antibodies (Mabs) characterized by a dissociation constant equal to or less than 2 · 10 ^-10 M for IL 4. Such components include isolated coding nucleic acid sequences, recombinant plasmids containing nucleic acid sequences abilities controlled by selected regulatory sequences capable of directing their expression in host cells, as well as host cells (preferably mammals) transfected with recombinant plasmids. The production method includes culturing a transfected host cell line of the present invention under such conditions that an antibody, preferably a humanized antibody, is expressed in said cells, and isolating the expression product.

 Another aspect of the present invention encompasses a method for diagnosing allergies and other painful conditions associated with excess formation of immunoglobulin E in the human body, comprising contacting a sample of a biological fluid with fusion proteins, Mab's (e.g., humanized, chimeric, etc.) and Fab's of the present invention and analysis of the implementation of the binding between the specified fused protein, Mab or Fab and human interleukin 4.

Another aspect provides a method for screening monoclonal antibodies having a high titer with respect to human interleukin 4, which includes:
a) obtaining a hybridoma cell line characterized by the secretion of a monoclonal antibody with respect to human interleukin 4; and (b) screening said hybridoma cell line with aldehyde-conjugated interleukin-4 or biotinylated human interleukin-4. Preferably, a hybridoma cell line with biotinylated human interleukin-4 is screened.

The present invention also provides neutralizing Mabs having a high affinity for IL 4, Fab fragments thereof, or F (ab) ₂ fragments obtained by screening a hybridoma product library in the presence of aldehyde-conjugated human interleukin-4 or biotinylated human IL 4.

According to another aspect, the present invention provides rodent neutralizing monoclonal antibodies specific for human interleukin-4 and having an affinity for binding characterized by a dissociation constant equal to or less than 2 × 10 ^-10 M. Examples of such monoclonal antibodies are mouse Mab, 3B9, rat Mab , 6A1 and other Mabs with identical characteristics (i.e., the ability to bind to 3B9 or 6A1 epitopes with specificity for human IL 4 and a dissociation constant equal to or less than 2 · 10 ^-10 M). Another aspect of the present invention is a hybridoma 3426A11C1B9.

 Other aspects of the present invention are presented below in the detailed description of its preferred embodiments.

 In FIG. 1 (SEQ ID N: 1,2) illustrates a light chain variable region (amino acids 21-132) of mouse 114 antibody 3B9, human / mouse 3B9 chimeric antibody, and a native signal sequence (amino acids 1-20). The underlined sections indicate CDR (Sequences of SEQ ID N: 15, 16; SEQ ID N: 17 and 18; and SEQ ID N: 19 and 20).

 In FIG. 2 (SEQ ID N: 3 and 4) illustrates the variable region of the heavy chain (amino acids 20-140) of mouse 3B9, as well as the native signal sequence (amino acids 1-19). The underlined sections indicate CDR (SEQ ID N: 21, 22; SEQ ID N: 23 and 24; and SEQ ID N: 25.26).

 In FIG. 3 (SEQ ID N: 9, 10) illustrates the variable region of the heavy chain (amino acids 21-141) of the human / mouse 3B9 chimeric antibody and its signal sequence (amino acids 1-19; SEQ ID N: 5 and 6). The underlined sections indicate CDRs derived from 3B9 (SEQ ID N: 21, 22; SEQ ID N: 23, 24 and SEQ ID N: 25, 26).

 In FIG. 4 illustrates (SEQ ID N: 11, 12) the heavy chain variable region (amino acids 20-141) of a humanized 3B9 antibody with a signal sequence (amino acids 1-19; SEQ ID N: 5, 6). The underlined sections indicate CDRs derived from 3B9 (SEQ ID N: 54, 22; SEQ ID N: 55, 24; and SEQ ID N: 56 and 26).

 In FIG. 5 (SEQ ID N: 13, 14) illustrates the variable region of the light chain (amino acids 21-131) of a humanized 3B9 antibody and a signal sequence (amino acids 1-20; SEQ ID N: 7, 8). The underlined sections indicate CDRs derived from 3B9 (SEQ ID N: 53, 16; SEQ ID N: 17, 18 and SEQ ID N: 27, 28).

 In FIG. 6A (SEQ ID N: 5, 6) shows the heavy chain signal sequence used in Example 4 below.

 In FIG. 6B (SEQ ID N: 7, 8) shows the light chain signal sequence used in Example 4 below.

 In FIG. 7 is a schematic representation of the plasmid plL4chhc3-pcd used to express the chimeric heavy chain IL 4 in mammalian cells. Such a plasmid contains a beta-lactamase gene (BETA LAC), an SV40 origin of replication (SV40), a cytomegalovirus promoter sequence (CMV), a signal sequence, a chimeric variable heavy chain from SEQ ID N 9, 10, a constant region of the human heavy chain, poly A bovine growth hormone signal (BGH), betaglobin promoter (beto glopro), dihydrofolate reductase gene (DHFR), and another BGH poly A signal sequence in pVC19 medium.

 In FIG. 8 is a schematic diagram of the plasmid pIL 4 chlc-pcdn used to express the chimeric IL 4 light chain variable region of SEQ ID N 1 and 2 in mammalian cells. This plasmid is different from that shown in FIG. 7 in that it contains a chimeric easy-chain variable region other than the chimeric heavy chain, a constant region of the human light chain, and a neomycin gene (Neo) in addition to DHFP.

 In FIG. 9 is a schematic of the plasmid pIL 4 hzhc-1-pcd used to express synthetic IL 4 heavy chain variable region of SEQ ID N 11 and 12 in mammalian cells. Such a plasmid is different from that shown in FIG. 7 in that it comprises a variable region of the humanized heavy chain other than that present in the chimeric heavy chain.

 In FIG. 10 is a schematic diagram of the plasmid pIL 4hzlc-O-Pcn used to express the variable region of the humanized IL 4 light chain of SEQ ID N 13 and 14 in mammalian cells. Such a plasmid is different from that shown in FIG. 8 in that it contains a variable region of a humanized light chain that is different from that present in the chimeric light chain and does not encode the DHFP gene.

 The present invention provides a number of antibodies, fragments thereof and fusion proteins, mainly humanized antibodies, which are characterized by binding specificity for human IL 4, neutralizing activity and high affinity for human IL 4, as shown in the examples relating to murine Mab or rat Mab 6A1. Such products are used in therapeutic and pharmaceutical compositions for treating reactions caused by the action of IL 4 and IgE. Such products are also used to diagnose a disease state caused by IL 4 as a result of measurements (for example, by enzyme-linked immunosorbent assay (EL1SA) of the circulating endogenous level of IL 4 in humans.

 1. Accepted definitions.

The term "fusion protein" refers to a protein encoded by a fusion molecule, which can be obtained by expression in a selected host cell. Such fusion proteins are genetically engineered antibodies, for example chimeric or humanized antibodies, or antibody fragments in which the constant region of an immunoglobulin, for example Fy, Fab or F (ab) _2, is missing or missing.

 The term “fusion molecules” refers to a nucleic acid sequence encoding the complementarity determining regions (CDRs) of non-human immunoglobulin that are inserted into a first fusion partner comprising human variable frame sequences. Sometimes the first merger partner is operatively linked to the second merger partner.

 The term "first fusion partner" refers to a nucleic acid sequence encoding a human framework or a variable region of a human immunoglobulin, where native (or naturally occurring) CDRSs are replaced by a CDR of a donor antibody. The human variable region may be an immunoglobulin heavy chain, a light chain (or both such chains), as well as an analog of their functional fragments. Such CDR or CDR regions located within the variable regions of antibodies (immunoglobulins) can be determined (determined) by known methods. So, for example, Kabat et al. / Sequences of Protein of Immunological Interest, 4th ed. US Department of Health, National Institutes of Health (1987) / describes CDR layout rules. In addition, computer programs for identifying CDR regions or structures are known.

The term "high titer" refers to an antibody with high binding affinity, characterized by Kd equal to or less than 2 · 10 ^-10 M for human IL 4.

 By the term “binding specificity for human IL 4” is meant a high titer (or affinity) for human, but not for bovine or murine IL 4.

The term "second fusion partner" refers to other nucleotide sequences encoding a protein or peptide to which the first fusion partner is conjugated in a frame or using an optional traditional linker sequence (for example, by operative linking). Preferably this substance is an immunoglobulin. The second fusion partner may include a nucleic acid sequence encoding a complete constant region of the same (e.g., a homology variant when the first and second fusion proteins are of the same origin) or an additional (e.g., heterologous) desired antibody. This substance may be an immunoglobulin heavy or light chain (or both such chains as part of a single polypeptide). The second fusion partner is not limited to a particular immunoglobulin class or isotype. In addition, the second fusion partner may include a portion of an immunoglobulin constant region, such as Fab or F (ab) ₂ (for example, a discrete portion of a corresponding human constant region or framework region). Such a second fusion partner may also include a sequence encoding an integral membrane protein exposed on the outer surface of the host cell, for example, as part of a phage library, or a sequence encoding a protein for diagnostic purposes, for example, horseradish peroxidase, β-galactosidase, etc. .

The terms Fy, Fc, Fab, or F (ab) ₂ are used in standard terms (see, for example, Harlow et al., Antibodies Alaboratore Manual, Cold Spring Harbor Lab (1988).

 As used herein, the term “engineered antibody” refers to a type of fusion protein, i.e. a synthetic antibody (for example, a chimeric or humanized antibody) in which part of the variable domains of the light and / or heavy chains of the selected acceptor antibody are replaced by similar parts of one or more donor antibodies that are specific for the selected epitope. For example, these molecules may include antibodies characterized by the presence of a humanized heavy chain associated with an unmodified light chain (or a chimeric light chain), or vice versa. Engineering antibodies may also be characterized by a change in nucleic acid sequences encoding the variable domain frame regions of the light and / or heavy chains of the acceptor antibody in order to maintain specificity for the binding of the donor antibody. Such antibodies may include replacing one or more CDRs (preferably all) from an acceptor antibody with a CDR from a donor antibody described herein.

 The term “chimeric antibody” as used herein refers to a type of engineered antibody that contains a naturally occurring variable region (light chain and heavy chain) derived from a donor antibody associated with constant regions of the light and heavy chains derived from an acceptor antibody.

 The term “humanized antibody” refers to an engineering type antibody with its CDR from a non-human donor immunoglobulin, the other remaining immunoglobulin moieties being derived from one (or more) human immunoglobulins. It should be noted that the skeleton support residues can be modified in order to maintain binding affinity (see, for example, Queen et al., Proc. Natl. Acad. Sci. UCA 86, 10029-10032 (1989), Hodgson et al. Bio / Technology, 9: 421 (1991).

As used herein, the term “donor antibody” refers to an antibody (polyclonal, monoclonal, or recombinant) that facilitates the transfer of the nucleic acid sequences of its variable regions, CDRs or other functional fragments or analogues thereof to the first fusion partner, resulting in a fusion molecule and expressed fusion protein with antigenic specificity and neutralizing ability, characteristic of a donor antibody. An example of a donor antibody suitable for use in the present invention is a non-human neutralizing monoclonal antibody (e.g., murine), designated 3B9. Antibody 3B9 is defined as having a high titer, human-IL 4 specific (i.e., not recognizing bovine or murine IL 4), neutralizing an IgG ₁ isotype antibody with variable light chain DNA and amino acid sequences of SEQ ID N 1 and 2, and also the variable heavy chain DNA and amino acid sequences of SEQ ID N 3 and 4 in the constant region of a suitable mouse IgG.

 The term “acceptor antibody” refers to an antibody (polyclonal, monoclonal, or recombinant), a heterologous donor antibody that promotes the transfer of all (or any part, but preferably all) of nucleic acid sequences encoding the framework regions of its heavy and / or light chain and / or constant regions of its heavy and / or light chain to the second fusion partner. Preferably, the human antibody is an acceptor antibody.

 The term "CDRS" refers to the complementarity determining region of an amino acid sequence of an antibody, which is a hypervariable region of immunoglobulin light and heavy chains. See, for example, Kabat et al. Immunological Protein Sequences, 4th ed., US Department of Health, National Institutes of Health (1987). There are three CDRs (or CDRs) in the heavy and light chains in the variable part of the immunoglobulin. In this regard, the term "CDR" as used in the text refers to all three CDRs of the heavy chain or all three CDRs of the light chain (or to all CDRs of both light and heavy chains).

 CDRs provide many constant residues for binding of an antibody to an antigen or epitope. The CDRs of the present invention are derived from the heavy and light chain variable sequences of a donor antibody and contain analogs of naturally occurring CDRs, such analogs possessing or retaining the same antigen binding specificity and / or neutralizing ability as the donor antibody from which they originated.

 By the term “distribution of antigen binding specificity or neutralizing ability” it is assumed, for example, that although Mab 3B9 may have some level of antigenic affinity, and CDR encoded by the 3B9 nucleic acid sequence in a suitable structural environment may have a lower or higher affinity, it is assumed that CDR 3B9 under such conditions will still recognize the same egritope as 3B9. Examples of heavy chain CDR 3B9 are sequences ID N 22; the sequence ID N 24; sequence ID N 26; and examples of light chain CDR 3B9 include the sequence ID N 16; sequence ID N 18 and sequence ID N 20.

 The term "functional fragment" refers to an incomplete variable sequence of the heavy or light chain (for example, small deletions at the amino or carboxy termini of an immunoglobulin variable region) that retains the same antigen binding specificity and / or neutralizing ability as the antibody from which the fragment was obtained .

 The term "analogue" refers to an amino acid sequence modified by at least one amino acid, and this modification can be carried out chemically, represent the substitution or rearrangement of several amino acids (usually not more than 10) and this modification allows the amino acid sequence to maintain biological characteristics, for example, antigen specificity, high titer, or affinity inherent in an unmodified sequence. For example, silent mutations can be realized by substitutions in order to create restriction endonuclease sites within or within the surrounding CDR region.

 Analogs may also arise during allelic variations. The term "allelic variation or modification" means a change in the nucleic acid sequence encoding the amino acid or peptide sequences of the invention. Such variations or modifications may be related to the degeneration of the genetic code or achieved as a result of deliberate design in order to give the desired characteristics. Such variations or modifications may or may not result in a change in any coding amino acid sequence. For example, the amino acid sequences of a light chain CDR, sequence ID 16 is identical to the native mouse sequence and the humanized 3B9 antibody. However, such a CDR sequence is encoded as SEQ ID N: 15 and SEQ ID N: 53. Similarly, CDR of SEQ ID N: 22 is encoded as SEQ ID N: 21 and SEQ ID N: 54, CDR SEQ ID N: 24 encoded as SEQ ID N: 23 and SEQ ID N: 55; and CDR SEQ ID N: 26 encoded as SEQ ID N: 25 and SEQ ID N: 56.

 The term "effector agents" refers to non-protein carrier molecules to which fusion proteins and / or the natural or synthetic, light or heavy chain of a donor antibody or other fragments of a donor antibody can be coupled by conventional methods. Such non-protein carriers can include conventional carriers used in the diagnostic field, for example polystyrene or other plastic balls, polysaccharides, for example those used in the BlAcope / Pharmacia / system, or other non-protein substances used in medicine and safe for use in humans and animals. Other effector agents may include a macrocycle for chelating a heavy metal atom or radioisotopes. Such effectors can also be used to increase the half-life of fusion proteins; such agents include polyethylene glycol.

 II. High affinity IL 4 monoclonal antibodies.

 Non-human species (e.g., materials derived from cows, sheep, primates, rodents (e.g., mice and rats), etc.) can be used to implement the construction of antibodies, fragments, and fusion proteins of the invention, and they are used to generate the desired immunoglobulin by presenting using native human IL 4 or its peptide epitope. Conventional hybridoma techniques are used to provide a hybridoma cell line secreting the non-human Mab to IL 4. These hybridomas are then screened using IL 4 covalently linked to 96-well plates, or using biotinylated IL 4 for use in screening according to the methodology described in detail in the following Example 2. Thus, one of the distinguishing features of the present invention is a method for detecting Mab on human IL 4, in which using Analytical tools can be used to avoid the denaturation of IL 4. According to this method, it was found that Mabs with a high titer (or high affinity) for human IL 4 can be detected.

As one example, the production of a high titer neutralizing Mab from a mouse donor will be described first. Mab 3B9, which is the desired murine (donor) antibody for use in the production of a chimeric or humanized antibody, is described in detail in the following Example 1. 3B9 Mab is characterized by antigen binding specificity to human IL 4 with K _d <2 · 10 ^-1 M (about 1 , 8 · 10 ^-10 M) in relation to IL 4. K _d for 114 Fab fragments of such 3B9 is less than 3 · 10 ^-10 M. The epitope of such an antibody cannot be mapped using IL 4 linear peptides and, therefore, such an epitope is considered as binding to a non-contacting epitope. The binding pattern suggests the presence of a binding site in the BC loop region (residues 60-69) ---> C-helix (residues 70-93). With respect to the mapped designation of such sites, reference may be made to the work of Cook et al. J. Mol. Biol. 218: 675-678 (1991), Walter et al., J. Biol. Chem. 267: 20371-20376 (1992), Wlodaver et al., FEBS Lett. 309: 59-64 (1992), Redfield et al. Biochem 30: 11029-11035 (1991), Smith et al., J. Mol. Biol. 224: 899-904 (1992), Garrett et al., (1992) and Rowers et al. Biochem. 31: 4334-4346 (1992) and Science 256: 1673-1677 (1992).

Another desired donor antibody is rat Mab, 6A1. The preparation of such a Mab is described below in Example 7. Such a Mab is characterized in that it is an IgG _2a isotype and has a dissociation constant for IL 4 of less than 2 × 10 ⁻¹⁰ M (about 1.6 × 10 ⁻¹⁰ M). As in the case of 3B9, the epitope of the target of such 6A1 is not mapped with IL 4 linear peptides and therefore this epitope is considered as non-contacting and three-dimensional. The pattern of binding to IL 4 muteins and its biological activity indicate binding in the D-helix region of human IL 4 (amino acid residues 109-127), apparently in the tyrosine region at amino acid residue # 124.

The present invention is not limited to the use of 3B9 Mab, 6A1 Mab or their hypervariable (i.e., CDR) sequences. Any other suitable high titer IL 4 antibodies characterized by a dissociation constant of equal to or less than 2 · 10 ^-10 M in relation to human IL 4 and corresponding anti-IL 4 CDRs can serve as a substitute for these materials. In the following description, a donor antibody is identified as 3B9 or 6A1, and this designation is given only to illustrate and simplify the description.

Ill. Antibody fragments
The present invention also encompasses the use of Fab fragments or F (ab) ₂ fragments derived from Mabs directed against human IL 4. Such fragments are used as agents protecting in vivo from IL 4 IgE mediator states or in vitro as part of IL 4 diagnostic tools. The Fab fragment contains the complete light chain and the amino terminal portion of the heavy chain; and the F (ab ') ₂ fragment is a fragment formed by two Fab fragments linked through a disulfide bond. Mab 3B9, 6A1 and other similar high-affinity, IL 4 binding antibodies are sources of Fab and F (ab ') fragments that can be obtained by conventional methods, for example, by cleaving Mab using appropriate proteolytic enzymes, papain and / or pepsin, or recombinant methods . Such Fab and F (ab ') ₂ fragments are themselves used as therapeutic, prophylactic or diagnostic agents, as well as donor sequences including variable regions and CDR sequences used to form recombinant or humanized antibodies, as described herein document.

 IV. Anti-114 amino acid and nucleotide sequences.

 Mab 3B9 or other antibodies described above can provide sequences, for example, variable peptide sequences of the heavy and light chains, frame sequences, CDR sequences, their functional fragments and analogues, as well as nucleic acid sequences iodinating them, used to construct and obtain various fusion proteins ( including genetically engineered antibodies), which are characterized by the antigen binding specificity of the donor antibody.

 Thus, as one example, the present invention provides for the variable light chain and variable heavy chain sequences of IL 4 mouse 3B9 antibodies and sequences derived from them. The 3B9 heavy chain variable region is characterized by amino acid residues 20-140 of SEQ ID N: 4. CDR regions are indicated by underlining in FIG. 2 and are presented in SEQ ID N: 22; SEQ ID N: 24 and SEQ ID N: 26. The variable region of the light chain clone is characterized by amino acid residues 21-132 in FIG. 1 / SEQ ID N: 2 /. CDR regions are given by amino acid residues 44-58 / SEQ ID N: 16 /; 74-80 / SEQ ID N: 18 / and 113-121 / SEQ ID N: 20 /.

 The variable region of the chimeric heavy chain and the signal nucleotide and amino acid sequences are also provided. These sequences are identical to the 3B9 heavy chain except for the signal sequence. The signal sequence of the chimeric heavy chain is shown in SEQ ID N: 5 and 6. The CDR regions are underlined in FIG. 3 and they are identical in amino acid sequence to native murine CDR / SEQ ID N: 21-26 /. The nucleotide and amino acid sequences of the variable region of the chimeric light chain are identical to unmodified 3B9 sequences (amino acid residues 21-132 of SEQ ID N: 2), which makes it possible to use natural mouse signal sequences (amino acid residues 1-20 of SEQ ID N: 2).

 The humanized heavy chain variable region and signal sequences are illustrated in FIG. 4 / SEQ ID N: 11 and 12 /. The signal sequence is also shown in SEQ ID N: 5 and 6. Other suitable signal sequences known to those skilled in the art can serve as a substitute for the signal sequences shown in the examples. The CDR amino acid sequences of this construct are identical to the CDRs of the native mouse and chimeric heavy chain and are shown in SEQ ID N: 22 (encoded SEQ ID N: 54), SEQ ID N: 24 (encoded SEQ ID N: 55) and SEQ ID N: 56 (encoded SEQ ID N: 26).

 An exemplary (synthetic) variable sequence of a humanized light chain is illustrated in FIG. 5 / SEQ ID N: 13 and 14 /. Such a signal sequence includes amino acid residues 1-19 of the sequence ID N: 8. The CDR sequences in this figure are underlined and they differ from the native mouse CDR CDRs in the signal amino acid sequence of SEQ ID N: 20. Thus, humanized light chain CDRs are represented by SEQ ID N: 53 and 16, SEQ ID N: 17 and 18 and SEQ ID N 27 and 28. The difference is described in detail in Example 3.

 The nucleic acid sequences of the present invention or fragments thereof encoding the peptide sequences of the variable light chain and heavy chain are used in unmodified form or can be synthesized to introduce the desired modifications, for example restriction sites. Isolated natural or synthetic nucleic acid sequences derived from Mab 3B9 or other desired high titer IL 4 antibodies may optionally contain restriction sites to facilitate insertion or ligation into a suitable nucleic acid sequence, for example, that encodes a framework region of a desired antibody ligation with mutant CDRs or fusion to a nucleic acid sequence encoding a selected second fusion partner.

 Given the degeneracy of the genetic code, various coding sequences can be constructed that are capable of encoding the variable amino acid sequences of the heavy and light chains, as well as the CDR sequences of the invention and their functional fragments and analogs that share the antigenic specificity of the donor antibody. The isolated nucleic acid sequences of the invention or fragments thereof encoding the variable chain peptide sequences or CDRs can be used to prepare the fusion proteins, chimeric or humanized antibodies or other engineering antibodies of the present invention when operatively coupled to a second fusion partner.

 These sequences are also used for mutagenically introducing specific changes into nucleic acid sequences encoding CDRs or framework regions, as well as for introducing the resulting modified or fused nucleic acid sequence into an expression plasmid. For example, silent substitutions in the nucleotide sequence of the frame and CDR coding regions were used to create restriction sites that facilitate the insertion of mutagenized CDR (and / or frame) regions. Such CDR regions were used to construct the humanized antibody of the invention.

It should be noted that in addition to the isolated nucleic acid sequences encoding portions of the fusion protein and antibodies described herein, other nucleic acid sequences can be used, for example, complementary to native sequences. DNA sequences used include those that hybridize under stringent conditions / cm. T. Maniatis et al. Molecular Cloning (Laboratory Manual), Cold Spring Harbor Laboratory (1982), pp. 387-389 / with DNA sequences. One example of such hybridization under stringent conditions is hybridization at 4XSSC at 65 ^° C followed by washing with 0.1 XSSC at 65 ^° C for one hour. Another example of hybridization under stringent conditions is treatment in 50% formamide, 4 XSSC at 42 ^° C. It is preferred that such hybrid DNA sequences contain at least 18 nucleotides, i.e. had a size close to the size of the CDR.

V. Fusion Molecules and Fusion Proteins
Fusion molecules are capable of encoding fusion proteins that include engineered antibodies such as chimeric antibodies and humanized antibodies. The desired fusion molecule contains CDRs, sequences encoding peptides having the antigenic specificity of an IL 4 antibody, preferably a high affinity antibody of the invention, inserted into the first fusion partner (human framework region or human immunoglobulin variable region).

 Preferably, the first merger partner is operatively associated with the second merger partner. A second fusion partner is defined above and may include a sequence encoding a region of a second antibody, for example, an Fc region. The second fusion partners may also include sequences encoding other immunoglobulins with which, with the preservation of the reading frame, the constant region of the light or heavy chain is fused, or such fusion is carried out using a linker sequence. Engineering antibodies directed against functional fragments or analogues of IL 4 can be designed to provide enhanced binding to the same antibody.

 The second fusion partner may also be associated with the affector agent described above, including non-protein carrier molecules with which the second fusion partner can be operatively linked by conventional means.

 The fusion or linkage between second fusion partners, e.g., antibody sequences, and an affector agent, can be accomplished by any suitable methods, for example, by creating traditional covalent or ionic bonds, fusing proteins, or using hetero-bifunctional crosslinkers such as carbodiimide, glutaraldehyde, etc. P. Such techniques are known in the art and are readily available from traditional chemical and biochemical literature. In addition, traditional linker sequences that simply provide the desired space between the second fusion partner and the affector agent can also be constructed in a fusion molecule. The design of such linkers is well known to those skilled in the art.

It should be noted that the signal sequences of the molecules of the invention can be modified to enhance expression. As one example, a fusion protein having the amino acid sequence of a murine heavy chain sequence that is identical to the chimeric variable heavy chain (Y _n ) of FIG. 2 / SEQ ID N: 4 /, contains the original signal peptide, replaced by a different signal sequence (amino acid residues 1-20) / SEQ ID N: 6 /.

An example of a fusion protein contains a peptide or protein sequence of a variable heavy and / or light chain having antigenic specificity of Mab 3B9, for example, Y _n / amino acid residues 21-141 of the sequence SEQ ID N: 9 and 10 / and Y _L chains / amino acid residues 21-132 sequences SEQ ID N: 1 and 2 /. Another desirable fusion protein of the invention is characterized by an amino acid sequence containing at least one, and preferably all, CDRs of the variable region of the heavy and / or light chains of murine 3B9 antibodies, the remaining sequences being of human origin, or their analogues or functional fragments. See, for example, the humanized Y _H and Y _L regions of SEQ ID N: 11 and 12 and SEQ ID N: 13 and 14 (FIGS. 4 and 5).

 According to another embodiment of the invention, an engineered antibody may comprise an additional agent attached thereto. For example, the recombinant DNA technology method can be used to produce an engineering antibody of the invention in which the Fc fragment of the CH3 domain of the whole antibody molecule is replaced by an enzyme or other detectable molecule (for example, a polypeptide effector or reporter molecule).

 The second fusion partner may also be operatively linked to a non-immunoglobulin peptide, protein or fragment thereof, a heterologous CDR-containing sequence having antigenic specificity in mouse 3B9. The resulting protein may exhibit both anti-IL 4 antigenic specificity and non-immunoglobulin characteristics during expression. The characteristics of such a fusion partner may include functional characteristics such as another binding or receptor domain, or therapeutic characteristics, if the fusion partner itself is a therapeutic protein, or additional antigenic characteristics.

Another desirable protein of the present invention may comprise a full antibody molecule having full length light and heavy chains, or any discrete fragment thereof, for example Fab or F (ab ') ₂ , a heavy chain dimer, or any minimal recombinant fragments thereof, for example F _y or single chain antibody (SCA), or any other molecule with the same specificity as the selected donor Mab, for example, Mab 3B9 or 6A1. Such a protein may be used as a fusion protein or may be used in a non-fused form.

 In each case, when the second fusion partner originates from another antibody, for example, any isotype or class of immunoglobulin skeleton or constant region, a genetically engineered antibody appears. Engineering antibodies may contain immunoglobulin (Ig) constant regions and variable framework regions from a single source, for example an acceptor antibody, and one or more (preferably all) CDRs of a donor antibody, for example, an anti-IL 4 antibody described herein. In addition, changes can be made, for example, deletion, substitution or insertion of the variable domain of the framework region of the heavy and / or light and / or heavy chain variable domain backbone region of the acceptor Mab acceptor chain at the nucleic acid or amino acid levels or sites of the donor CDR so that to maintain the antigenic binding specificity of the donor antibody.

 Such engineered antibodies are designed to use one (or both) the variable heavy and / or light chains of IL 4 Mab (optionally modified as described) or one or more of the below identified heavy or light chain CDRs (see Example 3). The engineered antibodies of the present invention are neutralizing antibodies, i.e. they can block binding to the IL 4 protein receptor. So, for example, an antibody derived from Mab 3B9 is directed against a specific tertiary protein epitope of human IL 4, which is believed to be in the B-C region loop ----> C-helix, as noted above.

Such engineered antibodies may include a humanized antibody containing framework regions of a selected human immunoglobulin or subtype, or a chimeric antibody containing human heavy or light chain constant regions fused to functional fragments of an IL 4 antibody. A suitable human (or other animal) atseptornoe antibody may be selected from a conventional database, such as database Kawata ^®, Los Alamos database, and Swiss protein database, by homology to the nucleotide and amino acid sequences of the donor antibody. A human antibody characterized by homology to the framework regions of the donor antibody (on an amino acid basis) may be suitable for providing a constant region of the heavy chain and / or variable framework region of the heavy chain for insertion of donor CDRs. A suitable acceptor antibody capable of donating constant or variable light chain framework regions can be selected in a similar manner. It should be noted that the heavy and light chains of an acceptor antibody need not be derived from the same acceptor antibody.

 Heterologous framework and constant regions are preferably selected from human immunoglobulin classes and isotypes such as IgG (subtypes 1-4), IgM, IgA, and IgE. However, the acceptor antibody does not need to contain only human immunoglobulin protein sequences. So, for example, a gene can be constructed in which the DNA sequence encoding part of the chain of a human immunoglobulin is fused to a DNA sequence encoding a non-immunoglobulin amino acid sequence, for example, a polypeptide effector or reporter molecule.

 One example of a particularly desirable humanized antibody comprises CDRs, 3B9 inserted in the framework region of a sequence of a selected human antibody. In the case of neutralizing humanized antibodies, one, two, or preferably three CDRs of the variable regions of the heavy and / or light chain of IL 4 antibodies are inserted into the frame regions of the sequence of the selected human antibody, replacing the native CDRs of the latter antibody.

 Preferably, in the humanized antibody, the variable domains of both human heavy and light chains are genetically engineered by replacing one or more CDRs. All six CDRs or various combinations of less than six CDRs may be used. Preferably, all six CDRs are replaced. CDRs can only be replaced in the human heavy chain using the unmodified light chain of a human acceptor antibody as the light chain. On the other hand, a compatible light chain can be selected from another human antibody using the traditional antibody database. The remainder of the engineered antibody may be derived from any suitable acceptor human immunoglobulin.

 Thus, a genetically engineered humanized antibody preferably has the structure of a natural human antibody or fragment thereof and has a combination of properties required for effective therapeutic use, for example, in the treatment of human inflammatory diseases associated with IL 4 or for diagnostic use.

 Another example is an engineering antibody that contains three CDRs of the variable region of the light chain 3B9 / SEQ ID 1: 16, 18, 20 and 28 / and three CDRs, the variable region of the heavy chain 3B9 / SEQ ID N 22, 24 and 26 / .

 The resulting humanized antibody is characterized by antigen binding specificity and high affinity for Mab 3B9.

 Specialists in this field should be clear that the engineering antibody may undergo additional modifications as a result of changes in amino acids of the variable domains, and this does not have to affect the specificity and high affinity of the donor antibody (i.e., analog). For example, humanized monoclonal antibodies were constructed in which the amino acid residue at position 120 of the light chain was arginine / SEQ ID N: 13 and 14 / or threonine / SEQ ID N: 57 and 58 /. It should be noted that the amino acids of the heavy and light chains can be replaced by other amino acids either in the variable domain of the scaffolds, or in the CDR, or in both of these regions.

 In addition, the constant region may undergo a change aimed at enhancing or decreasing the selective properties of the molecules of the present invention. Examples of such changes include dimerization, binding to Fc receptors, or changes in the ability to bind and activate complement (see, for example, Angal et al. Mol. Immunol. 30: 105-108 (1993), Xu et al., J Biol. Chem. 299: 3469-3474 (1994), Winter et al., EP 307,434-B).

 A fusion protein, which is a chimeric antibody, differs from the humanized antibodies described above in that it has the variable regions of the heavy and light chains of a completely non-human donor antibody, includes the framework regions associated with the human immunoglobulin constant regions of both chains. It should be noted that chimeric antibodies that retain additional non-human sequences relative to the humanized antibodies of the invention can cause a significant immune response in humans.

 As discussed below, such antibodies are useful in the prevention and treatment of allergic disorders associated with IL 4.

 VI. Obtaining fusion proteins and engineering antibodies.

 Preferably, the light and / or heavy chain variable sequences and CDRs of Mab 3B9 / SEQ ID N: 16, 18, 20, 22, 24, and 26 / or other suitable donor Mabs (e.g. 6A1) and their coding nucleic acid sequences are used to construct fusion proteins and engineered antibodies, preferably humanized antibodies of the invention, using the following method. The same or similar methods can be used to implement other technical solutions of the present invention.

 A hybridoma producing the selected donor Mab, for example, mouse antibody 3B9, is subjected to conventional cloning and the DNA of its variable regions of the heavy and light chains is obtained by methods known to those skilled in the art, for example, methods described by Sambrook et al. Molecular Cloning (Laboratory Manual), 2nd ed., Cold Spring Laboratory. Harbor (1989). The variable regions of the 3B9 heavy and light chains containing at least CDR and those parts of the variable domain of the framework region of the light and / or heavy chains of the acceptor Mab that are required to maintain binding specificity for the donor Mab, as well as the remaining immunoglobulin parts of the antibody chain, originating from human immunoglobulin, obtained using polynucleotide primers and reverse transcriptase. CDRs are identified using a known database and by comparison with other antibodies.

Then a mouse / human chimeric antibody can be prepared and tested for binding ability. Such a chimeric antibody contains the Y _H and Y ₁ regions of a completely inhuman donor antibody associated with constant regions of human Ig for both chains.

Homologous framework regions of the variable region of the heavy chain of human antibody were identified using computerized databases, e.g. Kawata ^®, and a human antibody having homology to 3B9 was selected as the acceptor antibody. The sequences of the synthetic variable regions of the heavy chain containing 3B9 CDRs inside the frameworks of the human antibody were designed with optional nucleotide substitutions in the framework regions to introduce restriction sites. This engineered sequence was then synthesized using overlapping oligonucleotides, amplified by polymerase chain reaction (PCR) and error corrected.

 Similarly, a suitable light chain variable framework region was constructed.

 A humanized antibody can be derived from a chimeric antibody, or it can preferably be synthesized by inserting the CDR of the donor Mab from the heavy and light chains into a selected heavy and light chain framework. On the other hand, a humanized antibody of the invention can be obtained using standard methods of mutagenesis. Thus, the resulting humanized antibody contains human framework regions and CDRs of the donor Mab. Subsequent manipulations with the carcass residues may be carried out. The resulting humanized antibody can be expressed in recombinant host cells, for example, COS or CHO cells. Other details of such a method are presented in Example 4. Other humanized antibodies can be obtained using this method on other suitable IL 4-specific, neutralizing, non-human antibodies with a high titer.

 A traditional expression vector or recombinant plasmid is obtained by operatively associating such coding sequences for a fusion protein with traditional regulatory control sequences capable of controlling replication and expression in and / or secretion from the host cell. Regulatory sequences include promoter sequences, for example, the CMV promoter and signal sequences that originate from other known antibodies. Similarly, a second expression vector is obtained containing a DNA sequence encoding the light or heavy chain of a complementary antibody. Preferably, such a second expression vector is identical to the first, except when the coding sequences and selectable markers are intended for the maximum possible functional expression of each polypeptide chain.

 The selected host cell is co-transfected with conventional methods with both the first and second vectors or simply transfected with a single vector in order to obtain a transfected host cell of the present invention containing both recombinant and synthetic light and heavy chains. The transfected cell is then cultured by conventional methods to produce an engineering antibody of the invention. A humanized antibody comprising the association of a recombinant heavy chain and / or light chain is tested from culture using appropriate assays, such as ELISA or RIA. Similar traditional techniques can be used to construct other fusion proteins and molecules of the present invention.

 Suitable vectors for cloning and subcloning, as well as the design of the compositions of the present invention, may be selected by those skilled in the art. For example, the generally accepted pYC series of cloning vectors can be used. One of the vectors used is pYC19 and is available from vendors such as Amersham (Buckinghamshire, UK) or Pharmacia (Uppsala, Sweden). In addition, any vector that is able to easily replicate contains many cloning sites and marker genes, and any manipulation can be easily performed for cloning purposes. Thus, the choice of a cloning vector is not a limiting factor of the present invention.

 Similarly, vectors used to express engineering antibodies of the invention can be selected by one of ordinary skill in the art from any conventional vector. Such vectors also contain selected regulatory sequences that are operatively associated with the DNA coding sequences of immunoglobulin regions and are capable of directing the replication and expression of heterologous DNA sequences in selected host cells, for example, CMV promoters. Such vectors contain the DNA sequences described above that encode an engineered antibody for a fusion molecule. On the other hand, such vectors may contain selected immunoglobulin sequences modified by the insertion of the desired restriction sites in order to facilitate manipulation.

Expression vectors can also be characterized by marker genes suitable for enhancing the expression of heterologous DNA sequences, for example, mammalian dihydrofolate reductase gene (DHFP) or neomycin resistance gene (neo ^® ). Other preferred vector sequences include a poly-A signal sequence, for example, bovine growth hormone (BGH), and beta-globin promoter sequence (betaglopro). Used expression vectors can be synthesized by methods well known to specialists in this field.

 The components of such vectors, for example, replicons, selection genes, enhancers, promoters, signal sequences, etc., can be obtained from natural sources or synthesized by known methods with the aim of using them to direct expression and / or secretion of the recombinant DNA product in the selected host. Other suitable expression vectors, numerous types of which are known in the art for expression in mammals, bacteria, insects, yeast and fungi, can also be selected for use for the above purposes.

 The present invention also encompasses a cell line transfected with a recombinant plasmid containing the coding sequences of engineered antibodies or their fusion molecules. Host cells used for cloning and other manipulations of such cloning vectors are also traditional. However, it is most desirable to use cells of different strains of E. coli for replication of cloning vectors and other steps for constructing the fusion proteins of the present invention.

 Suitable host cells or cell lines for expressing engineered antibodies or fusion proteins of the invention are preferably eukaryotic cells such as CHO, COS, a fibroblast cell (e.g. 3T3) and myeloid cells, with a mammalian cell such as a CHO cell or myeloid cell. Human cells can be used, allowing modification of the molecule according to human glycosylation profiles. Other eukaryotic cell lines may be used. The selection of suitable mammalian host cells, methods for their transformation, cultivation, amplification, screening, as well as preparation and purification of the product are known from the literature. See, for example, Sambrook et al. Cited above.

 Bacterial cells may be useful as host cells suitable for expression of the recombinant Mabs of the present invention. However, due to the tendency of proteins to be expressed in bacterial cells in an unsettled or improperly folded form or in a non-glycosylated form, any recombinant Mabs obtained in a bacterial cell must be screened to maintain antigen binding ability. If the molecule expressed by the bacterial cell is obtained in a properly laid form, then such a bacterial cell can be considered a desired host. For example, the various E. coli strains used for expression are well known to be used as host cells in the field of biotechnology. Various strains of B. subtilis, Streptomyces, other bacteria and the like can also be used in this method.

 As is known to those skilled in the art, yeast cell strains can also be used as host cells, like insect cells such as Drasophila and Lepidoptera, as well as viral expression systems. See, for example, Miller et al. Genetic Engineering, 8: 277-298, Plenum Press (1986) and the literature cited in this work.

 The basic methods for constructing the vectors of the present invention, the transfection methods required to obtain host cells of the invention, and the cultivation methods necessary to obtain the fusion protein or engineered antibody of the present invention from such a host cell are well known techniques. Similarly, upon receipt, the fusion proteins or engineering antibodies of the invention can be purified from the components of the cell culture using standard methods, including precipitation with ammonium sulfate, purification on affinity columns, chromatographic columns, gel electrophoresis, etc. These methods are known to those skilled in the art and do not limit the scope of the invention.

 Another method for expressing humanized antibodies may be expression in a transgenic animal as described in US Pat. No. 4,873,316. This method relates to an expression system using an animal casein promoter that, when transgenically introduced into a mammal, allows the female to produce the desired recombinant protein in her milk.

 After expression by the desired method, an engineering antibody is tested for in vitro activity using an appropriate assay. Currently, generally accepted ELISA assay schemes are used to evaluate the qualitative and quantitative binding of an engineered antibody to an IL 4 epitope. In addition, other in vitro assays, such as Blacore / Pharmacia /, can also be used to test neutralizing efficacy before a subsequent human clinical trial to evaluate the engineered antibody persystems in humans, regardless of the usual purification mechanisms.

 Following the methods described for preparing humanized antibodies from 3B9, one of skill in the art can also construct humanized antibodies from other donor IL 4 antibodies, variable region sequences, and CDR peptides described herein. Engineering antibodies can be made with such variable framework regions that are potentially recognized as “their” engineering antibody recipients. In the variable framework region, small modifications can be made to achieve a strong increase in antigenic binding without a noticeable increase in immunogenicity to the recipient. Such engineered antibodies can be effectively used to treat people with painful conditions associated with IL 4. These antibodies can also be used to diagnose these conditions.

 VII. Therapeutic and preventive use.

 The present invention also relates to a method of treating people experiencing allergic disorders, which consists in the use of an effective dose of antibodies comprising one or more of the engineered antibodies or fusion proteins described in this application, or fragments thereof.

 The therapeutic response caused by the use of the molecules of the present invention results from binding to human IL 4 and subsequent blocking of IgE release. Thus, the molecules of the present invention in the form of preparations and formulations for therapeutic use are highly desirable for use in patients with allergic disorders such as allergic rhinitis, conjunctivitis, atopic dermatitis, atopic asthma and anaphylactic shock.

 Fusion proteins, antibodies, engineering antibodies, or fragments of the present invention can also be used in conjunction with other antibodies, especially human Mabs, reactive with other markers (epitopes) responsible for the disease state against which the engineering antibodies of the invention are directed. Similarly, Mabs reactive with epitopes responsible for the disease state of the selected animal against which the antibody of the invention is directed can also be used in veterinary compositions.

 The therapeutic agents of the present invention are believed to be useful in treating allergic conditions for a period of time from 2 days to 3 weeks, or as needed. So, for example, longer treatment times may be desirable in the treatment of seasonal rhinitis, etc. This method represents a significant improvement over the current infusion method in accordance with the known methods of treating disorders caused by the action of IL 4. Dosage and the duration of treatment depend on the relative duration of the molecules of the invention in the human body and they can be regulated by a specialist depending on the type of disease and general health the customer.

 The type of use of the therapeutic agent of the invention may be any that delivers such an agent to the host. Fusion proteins, antibodies, engineered antibodies and fragments thereof, as well as pharmaceutical compositions of the invention are particularly useful for parenteral administration, i.e. subcutaneously, intramuscularly, intravenously or intranasally.

 The therapeutic agents of the present invention can be prepared in the form of pharmaceutical compositions containing an effective amount of the engineered (eg, humanized) antibody of the present invention as an active ingredient in a pharmaceutically acceptable carrier. For prophylactic use of the agent of the invention, it is preferable to use an aqueous suspension or solution containing an engineered antibody, preferably in a buffer medium at physiological pH, in a form ready for injection. Compositions for parenteral administration usually contain a solution of an engineering antibody of the invention or a mixture thereof dissolved in a pharmaceutically acceptable carrier, preferably in an aqueous carrier. A large number of aqueous carriers can be used, for example, 0.4% saline, 0.31% glycine solution, and the like. Such solutions must be sterile and, as a rule, they do not contain small particles of the substance. These solutions can be sterilized by well-known methods (e.g., filtration). Such compositions may contain pharmaceutically acceptable adjuvants required to approximate physiological conditions, and may be pH regulators, buffering agents, and the like. The concentration of the antibodies of the invention in such a pharmaceutical formulation can vary within wide limits, for example from a value of less than 0.5%, usually at least 1% to 15-20% by weight, and the desired concentration is selected based on the desired volume of liquid, viscosity, etc., in accordance with the specific type of application.

 For example, the pharmaceutical composition of the present invention for intramuscular infusion is prepared so that it contains 1 ml of sterile buffered water and 1 ng - 100 mg, typically 50 ng - 30 mg, or more preferably 5-25 mg of an engineering antibody of the invention. Similarly, the pharmaceutical composition of the invention for intravenous infusion should contain 250 ml of sterile Ringer's solution and 1-30 mg, preferably 5-25 mg of the engineering antibody of the present invention. Methods for the preparation of parenteral compositions are well known in the art and are described in more detail, for example, in Remington's Pharmaceutical Science, 15th ed. Mack Publishing Company, Easton, PA.

 Preferably, the therapeutic agent of the invention is present in the pharmaceutical preparation in unit dosage form. An appropriate therapeutically effective dose may be readily determined by one of skill in the art. For the effective treatment of inflammatory disorder in humans and animals, a unit dose comprising about 0.1-20 mg per 70 kg body weight of a protein or antibody of the present invention should be administered parenterally, preferably intramuscularly. Such a dose, if necessary, can be repeated after an appropriate period of time during the inflammatory reaction in accordance with the instructions of the therapist.

 The present invention also encompasses the administration of IL 4 fusion proteins of the present invention simultaneously or sequentially with other antibodies or fusion proteins characterized by anti-IL 4 activity, for example, an antitumor necrosis activity factor or other pharmaceutical activities compatible with IL 4 receptor binding ability of the fusion proteins of the invention. Such other antibodies are commercially available or can be engineered in accordance with a method similar to that described herein.

 The fusion proteins and engineered antibodies of the present invention can also be used for diagnostic purposes, for example, to identify disorders associated with the action of IL 4, or to monitor the progress of treatment of such disorders. As diagnostic reagents, such fusion proteins can be traditionally labeled for use in ELISA and other conventional assays designed to measure levels of IL 4 in serum, plasma, or other appropriate tissues. Such assays using fusion proteins are generally accepted and do not limit the scope of the invention.

 Antibodies, engineered antibodies, or fragments thereof, described herein can be lyophilized for storage and reconstituted in a suitable vehicle before use. It was shown that this technique is effective for conventional immunoglobulins and known methods of lyophilization and reconstitution can be used.

 The following examples illustrate various aspects of the present invention, including the construction of representatives of engineering antibodies and their expression in suitable vectors and host cells, and such examples do not limit the scope of the invention. All amino acids are indicated by traditional three-letter or single-letter codes. All necessary restriction enzymes, plasmids, and other reagents and materials were obtained from commercial sources, unless otherwise specified. All general methods of cloning ligation and other methods of recombinant DNA technology were performed as described in T. Maniatis et al., Cited above, or second edition of this book (1989), ed. Sombrook et al., Same publishers (Sambrook et al.).

Example 1.-Getting Mab 3B9
A. Methods of immunization.

 Four mice (F1 BaIb / c and C57B1 / 6 hybrids) were subcutaneously immunized with 50 μg of recombinant E. coli human IL 4 in Freund's complete adjuvant and 4 weeks later, intraperitoneal immunization was repeated with 50 μg of IL 4 in Freund's incomplete adjuvant. Based on a good titer of serum antibody against IL 4, one of the mice was additionally immunized after 8 weeks with 200 μg of IL 4 (intraperitoneal, saline), after two days - 100 μg of IL 4 (intraperitoneally, in saline) and two days 50 μg IL 4 (intraperitoneally, in saline). Two days after the final immunization, splenectomy was performed.

 B. Merger procedure and screening system.

 Mouse spleen cells were used to obtain hybridomas (according to a standard technique, for example, described by Kohler et al., Nature 256; 495 (1975), of which> 250 cell clones were screened for secretion of anti-IL 4 antibodies using a commercially available B1Acore system and ELISA assay, as described below, in order to bind IL 4. A positive response was obtained in five wells: Only 1 clone of mice, 3B9, was strongly positive. All secondary clones derived from 3B9 were positive.

 Example 2. ELISA assays and affinity constants.

A.ELISA
The screening assay performed as described below was designed to measure the affinity for native human IL 4. In experiment 1, 96-well aldehyde-activated plates were coated with IL 4 in an amount of 1 μg / ml, 100 μl / well in 0.1 M borate buffer, pH 8.5 and incubated overnight at room temperature. HIL 4 was covalently attached to the plate. IL 4 solution was removed and non-specifically bound (NSB) sites were blocked with 1% bovine serum albumin (BSA) in TBS buffer (50 mM Tris, 150 mM NaCl, 1 mM MgCl ₂ , 0.02% NaN ₃ , pH 7.4) for 60 minutes at 37 ^° C. After this and each of the subsequent steps, the plate was washed 4 times with wash buffer (10 mM Tris, 150 mM NaCl, 0.05% Tween 20, 0.02% NaN ₃ , pH 7.4). Thereafter, 50 μl of hybridoma medium (purified 3B9 or Fab fragments) and 50 μl of assay buffer (0.5% bovine gamma globulin in TBS buffer) were added and plates were incubated for 60 minutes at 37 ^° C. 100 μl of biotinylated anti-mouse antibody was added into each well in the medium of the analytical buffer and incubation was performed as described above. 100 μl alkaline phosphatase conjugated streptavidin was added to the well and incubated (30 min at 37 ^° C). 100 μl / well PNP was added and incubated for 30 min at 37 ^° C. The readings were taken at optical density at a wavelength of 405 nm. In experiment 2, streptavidin-coated plates (100 μl / well, 1 μg / ml in phosphate buffered saline (PBS)) were incubated overnight at 4 ^° C. and analyzed as described below. The streptavidin solution was removed, NSB sites were blocked with 1% BSA in NBS buffer (60 min at 37 ^° C). After this stage and each of the subsequent stages, the plates were washed four times with wash buffer with 50 μl of biotinylated IL 4, added together with 50 μl of assay buffer, and the system was incubated for 30 minutes at 37 ^° C. Then, 50 μl of purified 3B9 IgG or Fab fragment was added. (or hybridoma medium) plus 50 μl of assay buffer and incubated for 60 minutes at 37 ^° C. 100 μl of anti-mouse IgG-alkaline phosphatase conjugate was added and incubated for 60 minutes at 37 ^° C. 100 μl of PNP substrate was added and carried out incubation for 30 minutes at 37 ^o C. Readout was performed as described above.

 B. Calculation of 3B9 affinity for IL 4.

Using the results of the experiments described above and summarizing them as described below, K _{d was} calculated for 3B9 in accordance with the Beadty method with sotr. J. Immunol. Methods, 100: 173-179 (1987): K _aff = 1/2 (2 [Ab ^x ] - [Ab],
Ab ^x = concentration of bound Ab at 150 ng / ml biotinylated hIL 4;
Ab = concentration of bound Ab at 300 ng / ml biotinylated hIL 4.

Dissociation constants were calculated from the following ratio: K _d = 1 / K _aff .

Experiment 1: ELISA assay on a 96-well plate coated with streptavidin (100 ng / well). K _d = 2.2 · 10 ^-10 M (3B9 Fab).

Experiment 2: ELISA assay on a 96-well plate coated with streptavidin (100 ng / well). K _d = 1.4 · 10 ^-10 M (3B9 IgG).

 C. Specificity.

Mab 3B9 recognizes human IL 4, but does not recognize bovine or murine IL 4. One way to determine this phenomenon is as follows. ELISA analysis can be performed using a 96-well plate coated with anti-mouse IgG and then blocked with bovine serum albumin, in which 50 μl of 3B9 (100 ng / ml), 25 μl of non-human IL 4 and 25 μl of Biotin-IL 4 were incubated for 60 min at 37 ^o C, after which they were washed with streptavidin conjugated with alkaline phosphatase and PNP.

 Similarly, it was found that Mab 6A1 does not recognize bovine or murine IL 4.

Example 3. Humanitariannet antibody
One humanized antibody was designed to contain murine CDRs within the framework of a human antibody. Such a humanized version of IL 4 specific mouse antibodies 3B9 was prepared by the following manipulations.

 A. cDNA cloning.

 CDNA clones were obtained from 3B9 heavy and light chain mRNA extracted from a 3B9 hybridoma cell line (Example 1) using the Boehringer Mannheim kit. Primers specific for both the mouse hinge region and the kappa constant region were used to synthesize the first strand.

The kappa chain primer is / SEQ ID 1: 29 /:
5 '- CTAACACTCATTCCTCTTCAACCTCTTCACAATCCC-3'
The heavy gamma chain primer is / SEQ ID N: 30 /:
5 '- CTACATATCCAACCCTTACAACCACAATC3'.

The double-stranded cDNA was cloned directly in the plasmid pGEM7 _f + / Promega /, which was then transformed with E. coli DN-5a / Bethesda Research Labs /.

 B. DNA sequencing.

 The cDNA of eight murine heavy and one murine light chain clones from Part A was sequenced. Sequencing results of the variable regions of such clones are shown in SEQ ID N: 1, 2, 3, and 4. Each clone contained amino acids known as conserved among the variable regions of murine heavy chains or light chains, and mouse signal sequences. Amino acid CDR sequences are listed below.

 The heavy chain CDR regions are SEQ ID N: 22, 24 and 26 (amino acids 50-56, 71-86 and 119-129 of the sequence SEQ ID N: 4). See FIG. 2. Such sequences are encoded by the sequences SEQ ID N: 21, SEQ ID N: 23 and SEQ ID N: 25, respectively. Light chain CDRs are SEQ ID N: 16, 18, and 20 (amino acids 45-58, 74-80, and 113-121 of SEQ ID N: 2. See Fig. 1. Such sequences are encoded by SEQ ID N: 15 , 17 and 19, respectively.

 C. Selection of human frameworks.

After cloning 3B9, the amino acid sequences of the variable region (amino acids 21-132 SEQ ID N: 2 and amino acids 20-140 SEQ ID N: 4) were compared with a database of human immunoglobulin sequences using the CAVAT ^® and SWiSS databases to identify the human framework as both heavy and light chains, which are most closely compatible with the mouse source by sequence homology. In addition to these homology studies, light and heavy chain sequences were also evaluated relative to a positional database developed from Fab domain structural models to identify potential conflicts associated with amino acid substitutions that could affect CDR presentation. In the present case, no apparent conflicts were detected by structural studies; therefore, DNA coding, derived from studies of amino acid sequence homology, was used.

 The framework regions of the heavy chain of an antibody derived from human myeloma immunoglobulin (COR) /E.M.Press, N.M. Hogg Biochem were used. J. 117: 641-660 (1970)). This sequence was approximately 77% homologous (69.4% identity) to the 3B9 variable region of the chain at the amino acid level.

 For a suitable variable light chain framework region, the human antibody variable light chain framework sequence identified by H. G. Klobeck et al., Nucl. Acid Res. 13: 6515-6529 (1985). The human antibody sequence was found to be approximately 80.2% homologous (72.0% identity) to the murine variable region of the light chain at the amino acid level.

 Using murine 3B9 CDR / SEQ ID N: 15-26 / and a human antibody sequence, a synthetic heavy chain was obtained and PCR was performed to amplify the DNA. Such sequences were synthesized using the following overlapping oligonucleotides and amplified using PCR. SEQ ID N: 31-37 provides five overlapping oligo and 2 PCR primers. Oligo 1 / SEQ ID N: 31 / has been found to contain bases 5-121. Oligo 2 / SEQ ID N: 32 / contains a base in the range 122-241, and oligo 3 / SEQ ID N: 33 / contains a base 242-361. The two lower filament primers of SEQ ID N: 34 and SEQ ID N: 35 contain bases 134-110, and bases 134-110, and bases 253-230. All errors in the mapped sequence that were introduced by the PCR were corrected. PCR was carried out again using nucleotides 1-25 of SEQ ID N: 36 as a 5 ′ primer, and nucleotides 361-341 of SEQ ID N: 37 as a 3 ′ primer.

The synthetic variable region was ligated into the pCD expression vector together with the synthetic signal sequence of SEQ ID N; 5 and 6 from the chimeric construction of the heavy chain together with IgG ₁ human constant region. The synthetic Y _H and nucleotide and amino acid sequences of the signal sequence are shown in FIG. 4 / SEQ ID N: 11 and 12 /. The amino acid sequences of CDR / SEQ ID N: 22, 24, and 26 / are identical to murine 3B9 BDR. However, the coding sequences for CDR / SEQ ID N: 54, 55 and 56 / differ from the murine 3B9 coding sequences / SEQ ID N: 21, 23 and 25 /. The resulting expression vector, 114hzhc 1-1-Pcd, is shown in FIG. 9.

 CDR gene regions of a pre-existing light chain framework were removed by restriction digestion and replaced with the following synthetic IL 4 CDR genes, which were synthetically prepared.

For CDR, 1:
SEO IDNO: 38: 5'CTAGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGCAAGG 3 '
SEQ IDNO: 39: CCTTGCAGTTGATGGTGGCCCTCTGGCCCAGAGACACAG
SEQ IDNO: 40: TCGAGAGGCCTCCCAAAGTGTTGATTATGATGGTGATAG
TTATATGAACTGGTATCAGCAGAAACCC
SEQ IDNO: 41: GGGTTTCTGCTGATACCAGTTCATATAACTATCACCATCATA
ATCAACACTTTGGGAGGCCTC
for CDR2:
SEQ IDNO: 44:
GGGCAGCCTCCTAAGTTGCTCATTTACGCTCGATGCAATCTA
GAATCTGGGGTAC
SEQ 1DNO: 45;
CCCAGATTCTAGATTGGATGCAGCGTAAATGAGCAACTTAGG
AGGCTGCCC
For CDR3:
SEQ 1DNO: 42:
ATACTACTGTCAGCAAAGTAATGAGGATGGTCCGAGGTTCGG
CGGAGGGAC
SEQ 1DNO: 43:
CTTGGTCCCTCCGCCGAACCTCGGAGGATCCTCATTACTTTG
CTGACAGTAGT
The synthetic Y _L and nucleotide and amino acid sequences of the signal sequence are shown in FIG. 5 / SEQ ID N: 13 and 14 /. The amino acid sequences of the first two CDRs / SEQ ID N: 16 and 18 / are identical to the corresponding murine 3B9 CDRs. However, the coding sequence for the first CDR / SEQ ID N: 53 / differs from the mouse 3B9 coding sequence / SEQ ID N: 15 /. In addition, two humanized 3B9 amino acid sequence constructs were created in the last CDR. One of them / SEQ ID N: 28 / differs in signal amino acid / SEQ ID N: 20 / from the native mouse 3B9 sequence. SEQ ID N: 28 is encoded by the sequence of SEQ ID N: 27. Synthetic variable light regions were ligated into the expression vector together with the signal sequence / SEQ ID N: 7 and 8 /. One of the resulting expression vectors, 114hzic1-O-Pcn, is shown in FIG. 10.

 Such synthetic variable sequences of the light and / or heavy chain are used in the construction of a humanized antibody.

 Example 4. Expression of humanized Mab in COS and CHO cells.

The pUC18 subclones for Y _H were prepared in such a way as to add the signal sequence originally obtained from the human antibody of SEQ ID N: 5. For Y _L , pUC18 subclones were prepared to add the signal sequence of SEQ ID N: 7.

The humanized heavy chain, which is a derivative of the IgG ₁ isotype, exhibits 89: 3% homology (84.3% identity) at the amino acid level to the mouse heavy chain from 3B9. Synthetic Y _{H is} provided with amino acids 20-141 of the sequence SEQ ID N: 11 and 12. The humanized light chain, human kappa chain, shows 92.0% homology (86.6% identity) with 3B9 at the amino acid level. Synthetic Y _L / amino acids 21-131 of the sequence SEQ ID N: 13 and 14 /, containing 3B9 CDR, was designed and synthesized as described for synthetic heavy chains.

 DNA fragments, the corresponding signals of which are associated with variable regions of both the humanized heavy and light chains, were inserted pUC19 - based expressing plasmids of mammalian cells containing CMY promoters and constant regions of the human heavy or light chain of the chimera obtained in example 5, using traditional methods / Maniatis, cited above / with obtaining plasmids 114 hzhc1 - 1Pcd (heavy chain) / Fig. 9 / and 114 hz1c1 - oPcn) (light chain) / Fig. 10/. HZHC and HZLC plasmids were co-transfected into COS cells and supernatants were analyzed by ELISA for the presence of a humanized antibody after 3 and 5 days. Another humanized antibody was constructed using the IgG4 isotype.

 The presented example describes the preparation of an engineered antibody. Other methods can be used to create other engineering antibodies using other anti-IL 4 antibodies (for example, 6A1 - example 7) obtained by traditional methods.

Example 5. Construction of a chimeric antibody
A. The chimeric heavy chain was constructed by isolating the murine variable region of the heavy chain from the original murine Mab 3B9 as an EcoR1-BstE11 restriction fragment. A small DNA oligomer was designed and synthesized to connect the mouse variable region with the human IgG1 constant region (Bst EII - Apa1):
5 'primer: SEQ ID N: 50: GTCACCGTCTCCTCAGCTAGCACCAAGGGGG
3 'primer: SEQ ID N: 51: CTTGGTGCTAGCTGAGGAGACG.

 Two such fragments were ligated into the pCD plasmid (see FIG. 7) (digested with EcoR1 and Apa1), which already encodes the human IgG1 constant region. Such a clone was not expressed, therefore, wild-type 5 ′ UTP and the signal sequence were deleted and replaced with SEQ ID N: 5 and 6.

Since the traditional restriction endonuclease site is not available at the 3 'end of the signal sequence, the Bst EII site (i.e., silent mutation) was introduced using PCR. The following PCR primers were used;
SEQ IDNO: 48: 5 'primer: 5'CACCTTACCCTCAAACACTC 3'
SEQ IDNO: 49: 3 'primer: 5'GAAGTAGTCCTTGACCAG 3'
Then, a Bst EII-PstI restriction fragment was isolated from such a plasmid. Then, a new signal sequence and 5'ITP containing EcoRI and Bst EII1 ends were constructed and synthesized.

SEQ IDNO: 46: 5 primer: AATTCGAGGACGCCAGCAACATGGTGTTGCA GACCCAGGTCTTCATTTCTCTGTTGCTCTGGAATCTCTGGTGCCTACGGGC
AG
SEQ IDNO: 47: 3 'primer: GTAACCTGCCCGTAGGCACGAGAGATCCAGA
GCAACAGAGAAATGAAGACCTGGGTCTGCAACACCATGTTGCTCGCGTC
CTCG
The chimeric light chain was constructed using PCR to the original mouse 3B9 light chain, which was cloned into pGEM72f (+) / Progema /. The primers used were a commercially available p UC18 universal reverse primer at the 5 'end (EcoR1) and a 3' primer introducing the Nar1 site:
[5'CATCTAGATGGCGCCGCCACAGTACGTTTGATCTCCAGCTTGGTCCC3 '
used to fuse a mouse variable region with a human constant region. Then, such a variable region was ligated into the PcDN expression vector (EcoR1 Nar1) (Fig. 8), which already contained the human kappa region.

 After 3 and 5 days, supernatants were collected and ELISA was performed as described below: ELISA plates covered 0.1 μg of goat antibody specific for the Fc region of human antibodies. Medium supernatants were added over an hour. Horseradish peroxidase was added conjugated to a goat antibody specific for full human IgG antibody. After this, ABTS peroxidase substrate was added over an hour (Kierkegaard and Perry Laboratories Inc., Gaithersburg, MD). The expression of a chimeric antibody was detected. In a second COS ELISA, cell supernants containing a chimeric antibody specifically bind to recombinant human IL 4 protein. This result confirms the fact that genes encoding an antibody specific for IL 4 were cloned.

B. A humanized heavy chain may also be derived from such a chimeric heavy chain. The humanized heavy chain was constructed by inserting murine CDRs into a human framework. Used the same human framework described above, the most homologous protein sequence in the Swiss mouse 3B9 Y _H protein database (amino acids 20-140 of SEQ ID N: 4). Such a humanized heavy chain sequence (EcoRI ApaI) was synthetically prepared and PCR was performed to amplify the DNA as described above. The synthetic variable region was ligated into the pCD expression vector (EcoR1 Apa1) together with the synthetic signal sequence of SEQ ID N: 5 and 6 from the chimeric heavy chain construct and human constant region IgG.

Similarly, a humanized light chain can be obtained from a chimeric light chain as described above for the heavy chain. This gene (EcoRY Nar1) was also obtained synthetically. The humanized Y _{L was} ligated into the pCN expression vector digested in the presence of EcoR1 Nar1, together with the signal sequence (EcoR1 EcoRY). The expression vector contained human kappa constant region.

 Example 6. Cleaning and thermodynamics of a humanized Mab.

 Purification of CHO expressed chimeric and humanized 3B9 can be achieved by traditional methods of protein A (or G) affinity chromatography followed by ion exchange chromatography and gel filtration. Similar methods have been successfully used to clean up to purity> 95% of other Mabs (for example, respiratory syncytial virus and malaria circumsporozoite antigens).

The affinity and detailed thermodynamics of IL 4 binding to humanized Mab 3B9 and murine 3B9 (Example 1) were determined by microcalorimetric titration. In this method, binding reactions are measured by their internal reaction heats (see, for example, Wiseman et al. Anal. Biochem. 179: 131-137 (1989). The affinity of both Mabs was so strong that it was not possible to measure at ambient temperature Then the thermodynamic approach was applied: I) affinity was measured at 60 ^o C, when it is rather weak and amenable to direct measurement; and II) removed the temperature dependence of the enthalpy of binding at 30-60 ^o C. Together, the results obtained allowed us to calculate affinity in a wide temperature range using the Gibbs-Helmholtz equation.

The results of the thermodynamics of IL 4 binding for humanized and mouse 3B9 antibodies are presented in table 1. On
Based on the differences in free energy, enthalpy, entropy, and heat capacity of two such Mabs, it can be concluded that their thermodynamic behavior is indistinguishable.

 Example 7. Obtaining characteristics of rat Mab.

 Mab 6A1 selected for high affinity binding was obtained from an immunized rat using the immunization protocol described for the mice in Example 1. 6A1 was selected from hybridomas (specifically, hybridoma 3426A11C1B9) obtained from rats immunized with human IL 4.

K _d for 6A1 was calculated as described by Beaty et al. J. Immmunol. Methods 100: 173-179 (1987) and the obtained value was 2 · 10 ^-10 M.

 Hybridoma 3426A11C1B9 was deposited on October 6, 1993 at the European Collection of Animal Cell Culture (ECACC), Health Laboratory Service Center for Applied Microbiology and Research, Norton Down, Salisbury, Wiltshire, SP4 O1G, UK, catalog number 93100620 and accepted as a patent deposit in accordance with the 1977 Budapest Treaty governing the deposit of microorganisms for patent purposes.

 Example 8. The biological activity of Mabs: 3B9 (humanized) 3B9 (mouse) and 6A1.

 The following assays were performed using the procedures described below.

 A. Binding to glycosylated rhIL 4.

 The above antibodies induced to non-glycosylated recombinant human IL 4 (rh IL 4), which was produced in E. coli. Since native human IL 4 is glycosylated, it is important to confirm by binding to material secreted by the mammalian cell line. 3B9 equally well attaches to both glycosylated and non-glycosylated human recombinant IL 4 and therefore is directed towards an epitope that can be masked by natural human IL 4.

 B. Inhibition of IL 4 receptor binding.

The ability of 3B9 to inhibit the binding of IL 4 to its receptor was studied using ¹²⁵ I -rhIL 4 binding to the gibon cell line, M1a / ATCC T1B201 /, which carries approximately 6,000 receptors per cell. M1A cells were incubated with ¹²⁵ I-IL 4 for 30 minutes at 37 ^° C. The absorption of radioactivity was determined in a gamma counter after separation of the cell-bound ¹²⁵ I-IL 4 by centrifugation through an oil gradient. Nonspecific binding was determined by incubation in the presence of a 100-fold molar excess of unlabeled IL 4 / Park et al., J. Exp. Med. 166: 476-488 (1987). The IC ₅₀ value for unlabeled IL 4 in this analysis was 22 pM with an added amount of IL 4 of 83 pM. For intact mouse (IgG) 3B9, the IC ₅₀ value was 63 pM and 93 pM for the Fab fragment. At a different concentration of IL 4 (218 pM), the amount obtained in the analysis for mouse (IgG) 3B9 was 109 pM.

 C. Inhibition of lymphocyte proliferation.

Using the method described by Spits et al., J. Immunol. 139: 1142-1147 (1987), human peripheral blood lymphocytes were incubated for three days in the presence of phytohemagglutinin, a T-cell mitogen, to activate IL 4 receptor. The resulting blastoid cells were then stimulated for three days with IL 4. Proliferation was measured by incorporation of ³ H thymidine. B cell proliferation was measured by analysis according to Collard et al., Lymphokinesis and interferons. The practical approach, ch. 19, p. 345, with the following modifications. Purified human tonsil B cells were stimulated for 3 days with IL 4 and immobilized anti-IgM. Proliferation was measured by incorporation of ³ H thymidine.

Mouse 3B9 inhibited ³ H-thymidine uptake in human peripheral blood T lymphocytes stimulated with 133 pM IL 4 and in human tonsils B lymphocytes stimulated with 167 pM IL 4. IL 2-stimulated T lymphocytes were not exposed. The IC ₅₀ value for inhibition of T cell proliferation was 30 pM, and for proliferation of B cells, 103 pM. The corresponding values for the Fab fragment of mouse 3B9 were 108 and 393 PM.

 D. Inhibition of CD23 induction.

CD23 is a low affinity IgE receptor (FcER11) and is induced on the membrane of B lymphocytes by low concentrations of IL 4, which is a prerequisite for IgE production. Purified human tonsil B cells were stimulated for 2 days with IL 4. The percentage of cells expressing the CD23 receptor was determined by flow cytometry / Defrance et al., J. Exp. Med. 165: 1459-1467 (1987). Mouse 3B9 inhibited CD23 expression on human tonsils B lymphocytes stimulated with 8.3 pM IL 4 at an IC ₅₀ value of 136 pM.

 E. Inhibition of IgE secretion.

Unlike other assays in which IL 4 was added at EC ₅₀ concentrations / Pere et al., Proc. Natl. Acad, Sci. 85: 6880-6884 (1988), IgE secretion was investigated in the presence of IL 4 concentrations that maximize secretion in order to reduce the variability inherent in such a system. T cell proliferation was measured as follows. Human peripheral blood lymphocytes were incubated with IL 4 for 10-18, preferably 12 days. The concentration of IgE in the culture supernatant was determined by ELISA.

IgE secretion was inhibited by mouse 3B9 and Fab fragment 3B9 in the presence of 1.7 nM IL 4, giving an IC ₅₀ value of 1.9 and 5.0 nM, respectively. The experiment was repeated using a lower concentration of IL 4, 667 PM, which lowered the value of the IC ₅₀ to 0.65 nm in the case of mouse 3B9. In the studied concentration limits, the molar ratio of antibody (IgC) to IL 4 remained unchanged (1: 1).

 F. Summary and interpretation of data.

 The molar ratios of IL 4 to various Mabs required for 50% inhibition of function in bioassays are presented in Table 2.

In all assays, with the exception of IgE secretion, IL 4 was added at about a ED ₅₀ concentration. The molar ratios between antibody and IL 4 required for 50% inhibition are similar for humanized 3B9, mouse 3B9 and 6A1 in two lymphocyte proliferation assays, but higher for humanized 3B9 in CD23 induction assay. The latter analysis is especially sensitive, requiring very low (~ 5%) degrees of receptor occupancy (Kruse et al., EMBO J, 12: 5121, 1993) and, as can be seen from the results obtained using mouse 3B9 and is therefore susceptible to analytical variations.

 A comparison of the activity of rat 6A1 and mouse 3B9 shows a similar picture of functional effects, as well as the unexpected inability of 6A1 to completely inhibit the binding of radioiodinated IL 4 to its receptor. It is believed that the radioiodinated IL 4 used in the receptor binding assay is iodinated with available tyrosine, residue 124. When comparing the ability of 6A1 to inhibit CD23 expression induced by unlabeled or iodinated IL 4, it was found that inhibition is less effective in the case of iodinated ligand. These results indicate that 6A1 binds to IL 4 in the tyrosine 124 region, but without specificity for this residue.

 Thus, the data obtained show that 6A1 is a high affinity neutralizing antibody capable of binding to a completely different region of IL 4 than 3B9.

Example 9. Pharmacokinetics
The pharmacokinetic properties of humanized 3B9 were studied in male Sprague Dawley rats, humanized 3B9 was used in four animals in the form of iv spherical mass with a dosage of 1 mg / kg, and blood sampling was continued for 5 weeks after use. The concentration of humanized 3B9 in plasma was determined using IL 4 / anti-human IgG sandwich EILSA, designed to confirm not only the presence of circulating human IgG, but also its ability to bind to recombinant human IL 4.

 The results obtained are summarized in table 3.

 The data obtained show that the variability between animals is relatively small and the disappearance of humanized 3B9 from plasma, apparently, is two-phase. The apparent plasma clearance was low (0.5 ml / h / kg). The half-life was 11 days. Thus, the pharmacokinetic characteristics of humanized 3B9, which is a derivative of CHO cells, are consistent with other humanized monoclonal antibodies in rats. The long circulation half-life of humanized 3B9 in rats also suggests that, when used in humans, humanized 3B9 is likely to be effective over a long period of time.

 Numerous modifications and variations of the present invention are encompassed by the above description and should be apparent to those skilled in the art. Thus, for example, human framework regions or modifications thereof other than the above antibody examples can be used to construct humanized antibodies. Such modifications and variations of the compositions and methods of the present invention are covered by the scope of the attached claims.

Claims (25)

1. A fusion protein having binding specificity for human interleukin-4 (IL4) containing complementarity determining regions (CDRs), where the amino acid sequences of the heavy chain complementarity determining regions are
(a) ThrSerGlyMetGlyValSer: SEQ ID NO: 22;
(b) HisIle TyrTrpAspAspLysArgTyrAsnProSerLeuLysSer: SEQ ID NO: 24 or
(c) ArgGluThrVal PheTyrTrpPheAspVal: SEQ ID NO: 26,
where the amino acid sequences of the regions determining the complementarity of the light chain are
(a) LeuAlaSerGlnSerValAspTyrAspGlyAspSerTyrMetAsn: SEQ ID NO: 16;
(b) AlaAlaSerAsnLeuGluSer: SEQ ID NO: 18 or
(c) GlnGlnSerAsnGluAspProProArg: SEQ ID NO: 28,
where the amino acid sequences of the regions determining the complementarity of the light chain are
(a) LysAlaSerGlnSerValAspTyrAspGlyAspSerTyrMetAsn: SEQ ID NO: 16;
(b) AlaAlaSerAsnLeuGluSer: SEQ ID NO: 18 or
(c) GlnGlnSerAsnGluAspProProThr: SEQ ID NO: 20,
originating from a non-human monoclonal antibody selected from the group consisting of 3B9 and 6A1, characterized by a dissociation constant equal to or less than 2 x 10 ^-10 M relative to human IL4, as well as the first fusion partner, where the sequence of the first fusion partner contains a heavy chain sequence: amino acids 21-50, 56-71, 88-119 and 131-141 of the sequence SEQ ID NO: 12, where the sequence of the first fusion partner contains the sequence of the light chain: amino acids 20-42, 58-72, 80-111 and 121-131 and the sequence SEQ ID NO: 14. 2. The region determining the complementarity (CDR) of the heavy chain of immunoglobulin, the amino acid sequence of which is selected from the group consisting of
(a) ThrSerGlyMetGlyValSer: SEQ ID NO: 22;
(b) HisIle TyrTrpAspAspAspLysArgTyrAsnProSerLeuLysSer: SEQ ID NO: 24, and
(c) ArgGluThrValPheTyrTrpPheAspVal SEQ ID NO: 26. 3. The region determining the complementarity (CDR) of the immunoglobulin light chain, the amino acid sequence of which is selected from the group consisting of
(a) LeuAlaSerGlnSerValAspTyrAspGlyAspSerTyrMetAsn: SEQ ID NO: 16;
(b) AlaAlaSerAsnLeuGluSer: SEQ ID NO: 18;
(c) GlnGlnSerAsnGluAspProProArg: SEQ ID NO: 28; and
(c) GlnGlnSerAsnGluAspProProThr: SEQ ID NO: 20. 4. A nucleic acid molecule encoding a complementarity determining region (CDR) of an immunoglobulin heavy chain, the sequence of which is selected from the group consisting of:
(a) ACT TCT GGT ATG GGT GTG AGC: SEQ ID NO: 21;
(b) CAC ATT TAC TGG GAT GAT GAC AAG CGC TAT; AACCCATCCCTGAAGAGC: SEQ ID NO: 23;
(c) AGA GAG ACT GTG TTC TAC TGG TAC TTC GAT GTC: SEQ ID NO: 25;
(d) ACC TCC GGT ATG GGT GTT TCC: SEQ ID NO: 54;
(e) CAC ATC TAC TGG GAC GAC GAC AAA CGT TAC AAC CCG AGC CTG AAA TCC: SEQ ID NO: 55 and
(f) CGC GAA ACC GTT TTC TAC TGG TAC TTC GAC GTT: SEQ ID NO: 56. 5. A nucleic acid molecule encoding a complementarity determining region (CDR) of an immunoglobulin light chain, the sequence of which is selected from the group consisting of
(a) AAG GCC AGC CAA AGT GTT GAT TAT GAT GCT GAT AGT TAT ATG AAC: SEQ ID NO: 15;
(b) AAG GCC TCC CAA AGT GTT GAT TAT GAT GGT GAT AGT TAT ATG AAC: SEQ ID NO: 53;
(c) GCT GCA TCC AAT CTA GAA TCT: SEQ ID NO: 17;
(d) CAG CAA AGT AAT GAG GAT CCT CCG ACG: SEQ ID NO: 19 and
(e) CAG CAA AGT AAT GAG GAT CCT CCG AGG: SEQ ID NO: 27. 6. A humanized antibody containing a heavy and light chain, characterized by a dissociation constant of equal to or less than 2 x 10 ^-10 M against IL4, in which the frame regions of these heavy and light chains come from at least one selected human antibody, and amino acid sequences areas that determine the complementarity of each of these chains come from a non-human neutralizing monoclonal antibody specific for human IL4, characterized by a dissociation constant equal to or less than about 2 x 10 ^-10 M relative to IL4, and having the identification characteristics of a monoclonal antibody 3B9.  7. The antibody according to claim 6, characterized in that it is optionally associated with an effector agent selected from the group consisting of a protein carrier molecule, polystyrene and plastic granules. 8. Chimeric antibody containing heavy and light chains, characterized by a dissociation constant equal to or less than about 2 x 10 ^-10 M relative to human IL4, in which the amino acid sequences of the regions determining the complementarity of these heavy and light chains are derived from non-human neutralizing monoclonal antibodies, specific for human IL4, characterized by a dissociation constant equal to or less than about 2 x 10 ^-10 M in relation to human IL4, and having identificational E characteristics of monoclonal antibody 3B9.  9. A pharmaceutical composition comprising an effective amount of a fusion protein according to claim 1 and a pharmaceutically acceptable carrier.  10. A method of treating allergies and other painful conditions associated with excess IgE production in the human body, comprising the step of administering to the patient in need of treatment an effective amount of a fusion protein according to claim 1.  11. The selected nucleic acid sequence, which is selected from the group consisting of a) a nucleotide sequence encoding a fusion protein according to claim 1, having the sequence shown in figure 5 SEQ ID NO: 13 and figure 4 SEQ ID NO: 11, c) a nucleotide sequence complementary to (a); c) a nucleic acid sequence of 18 or more nucleotides capable of hybridizing with (a) or (b) under stringent conditions; d) a fragment or analogue (a), (b) or (c) that encodes a protein characterized by specificity for human interleukin-4; moreover, the specified sequence optionally contains a restriction site. 12. The selected nucleic acid sequence, which is selected from the group consisting of:
a) SEQ ID NO: 21; SEQ ID NO: 23;
SEQ ID NO: 25; SEQ ID NO: 54;
SEQ ID NO: 55; SEQ ID NO: 56;
SEQ ID NO: 15; SEQ ID NO: 53;
SEQ ID NO: 17; SEQ ID NO: 19 and
SEQ ID NO: 27;
(b) a nucleic acid sequence complementary to a), c) a nucleic acid sequence of 18 or more nucleotides capable of hybridizing under stringent conditions with (a) or (b), and
(d) a fragment or analogue of (a), (b) or (c) encoding a protein characterized by specificity for human interleukin-4.  13. Recombinant plasmid pIl4chhc3-Pcd, comprising the nucleic acid sequence according to item 12.  14. The recombinant plasmid pIl4chlc-Cdn, comprising the nucleic acid sequence according to item 12.  15. Recombinant plasmid pIl4hzcll-Pcd, comprising the nucleic acid sequence according to item 12.  16. The recombinant plasmid pIl4hzlc1-0-Pcn, comprising the nucleic acid sequence according to item 12.  17. A method for producing a humanized antibody specific for human interleukin-4, comprising culturing COS and CHO cell lines with a transfected recombinant plasmid according to claims 13-16, under the control of selected regulatory sequences capable of directing its expression in these cells. 18. A method for diagnosing allergies and other painful conditions associated with excessive formation of immunoglobulin E in humans, comprising contacting a sample of body fluid with a high titer of monoclonal antibodies to human IL-4, having a binding agent, characterized by a dissociation constant equal to or less than 2 x 10 ^-10 M, and a binding assay between said monoclonal antibody and human interleukin-4. 19. A method for screening monoclonal antibodies to human IL-4, having an affinity for binding, characterized by a dissociation constant equal to or less than 2 x 10 ^-10 M, comprising a) obtaining a hybridoma cell line characterized by secretion of a monoclonal antibody to human interleukin 4 and b) screening said hybridoma cell line with aldehyde-linked human interleukin-4 or biotinylated human interleukin-4. 20. A neutralizing monoclonal antibody to human IL-4, having a binding agent, characterized by a dissociation constant equal to or less than 2 x 10 ^-10 M, its Fab fragment or (Fab ') ₂ fragment obtained by screening a library of hybridoma products with using aldehyde-linked human interleukin-4 or biotinylated human interleukin-4. 21. A neutralizing mouse monoclonal antibody specific for human IL-4 and having an affinity for binding, characterized by a dissociation constant equal to or less than 2 x 10 ^-10 M.  22. The antibody according to item 21, characterized in that it contains the amino acid sequence of the light chain of SEQ ID NO: 2. 23. A neutralizing rat monoclonal antibody specific for human IL-4 and having an affinity for binding, characterized by a dissociation constant equal to or less than 2 x 10 ^-10 M.  24. The antibody according to item 23, wherein it has the identifying characteristics of 6A1.  25. A hybridoma cell line having identifying characteristics 3426A11C1B9, with access number 93100620, deposited on October 6, 1993 in the European Collection of Animal Cell Cultures.

Images