RU2158603C2 - Methods and preparations for stimulating growth and differentiation of megacariocytes - Google Patents

Abstract

FIELD: biotechnology. SUBSTANCE: invention provides novel proteins belonging to megacariocyte growth and development factors (MGDF, commonly defined as Mp1 ligands), whose activity leads finally to formation of platelets. Invention also provides methods for preparing MGDF derivatives and these derivatives themselves, in which MGDF molecules are linked to water-soluble polymers such as polyethylene glycol. MGDFs can also be obtained in the form of homogeneous preparations from natural sources. Invention offers procedures for preparing MGDFs from mammalians (including humans) involving recombinant genetic-engineering technology. EFFECT: increased stability of preparations enabling therapeutic application thereof. 29 cl, 25 dwg, 2 tbl, 16 ex

Description

 The invention relates to new proteins, designated as Mpl ligands or MGDF, which stimulate the growth of megakaryocytes and enhance the differentiation or maturation of megakaryocytes, which inevitably leads to an increase in the number of platelets. In addition, the invention relates to methods for producing these proteins in homogeneous form from natural sources and methods of genetic engineering.

 On the other hand, the present invention is closely related to a new class of MGDF derivatives in which the MGDF molecule is coupled to a water-soluble polymer. Methods for preparing such derivatives are also described. In addition, the present invention describes MGDF derivatives in which a MGDF molecule is attached to one or more polyethylene glycol ("PEG") groups, as well as methods for their preparation.

 The invention covers at least two broad areas of research. The first one is the development of megakaryocytes with the subsequent formation of platelets, and the second is the properties of the polypeptide that is part of the family of growth factor receptors, designated as the Mpl receptor, and its ligands. Each of these research areas will be discussed in more detail below.

A. Formation of platelets from megakaryocytes
Blood platelets are circulating cells that play an important role in preventing blood loss and blood clotting. Megakaryocytes are a cellular source of platelets and come from a common bone marrow precursor cell, which gives rise to all sprouts of hematopoiesis. This common progenitor cell is known as a pluripotent stem cell or PPSC.

 The hierarchy of megakaryocytic progenitor cells was determined based on the time of appearance and size of megakaryocytic (MK) colonies formed in in vitro cultivation systems in response to exposure to the corresponding growth factors. The burst-forming megakaryocytic cell (BFU-MK) is the most primitive megakaryocytic precursor cell. It is believed that BFU-MK gives rise to numerous colony-forming megakaryocytes (CPU-MK), which are more differentiated MK progenitor cells.

 As MK cells undergo sequential differentiation, they lose their ability to mitosis, but acquire the ability to endoreduplicate. Endoreduplication (or endomitosis) is a nuclear fission phenomenon in the absence of cell division. Endoreduplication inevitably leads to the formation of polyploid MK cells. Further maturation of MK leads to the acquisition of cytoplasmic organelles and membrane components characteristic of platelets.

 Platelets are formed from mature MK through a poorly understood process, which is believed to be a consequence of the physical fragmentation of MK. Other mechanisms are possible. The detection of extended membrane structures in megakaryocytes led to the formation of a platelet formation model, according to which a separating membrane system separates the resulting platelets inside the cell. Another model of platelet formation is based on the fact that megakaryocytes form long cytoplasmic processes, approximately corresponding in diameter to the size of the platelet. Presumably, platelets detach from these processes under the influence of blood flow in the bone marrow and / or in the lungs. These cytoplasmic processes were called prothrombocytes by Becker and DeBryun to emphasize their presumed role of predecessors in the process of platelet formation. CM Becker and DeBruyn, Amer. J. Ann. 145: 183 (1976).

 In FIG. 1 shows various progenitor cells involved in the development of megakaryocytes and platelets. The leftmost cell in FIG. 1 - PPSC, to the right of it is BFU-MK, followed by CFU-MK. A cell undergoing endoreduplication and located immediately to the right of PPSC is a mature megakaryocytic cell. As a result of endomitosis, this cell becomes polyploid. Further on the right is a structure with long cytoplasmic processes formed from the polyploid nucleus of a mature megakaryocytic cell. In the far right of FIG. 1 depicts numerous platelets formed by fragmentation of cytoplasmic processes.

The following are some important publications related to the above description of the maturation of megakaryocytes and the formation of platelets:
1. Williams, N and Levine, RF, British Journal of Haematology 52: 173-180 (1982).

 2. Levin, J., Molecular Biology and Differentiation of Megakaryocytes, pub. Wiley-Liss, Inc .: 1-10 (1990).

 3. Gewirtz, A. M. The Biology of Hematopoiesis, pub. Wiley-Liss, Inc .: 123-132 (1990).

 4. Han, Z. C., et al., Int. J. Hematol. 54: 3-14 (1991).

 5. Nieuwenhuis, H, K. and Sixma, J., New Eng. J. of Med. 327: 1812-1813 (1992).

 6. Long.M., Stem Cells 11: 33-40 (1993).

B. Regulation of platelet formation
A large amount of data obtained in various laboratories indicates that platelet formation is regulated by humoral factors. The complexity of this biological process was initially underestimated, but it has now become apparent that a number of human growth factors have this ability.

 Regulation of megakaryocyte growth occurs at several cellular levels. Some cytokines enhance platelet formation by increasing the pool of progenitor cells. Another group of humoral growth factors serves as maturation factors, acting on more differentiated cells and accelerating endoreduplication. In addition, in the regulation of these processes, there are two independent feedback loops.

 Several groups of nonspecific hematopoietic growth factors have an important effect on the maturation of MK.

 Granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-3 (IL-3), IL-6, IL-11, leukemia suppression factor (LIF) and erythropoietin (EPO) independently and individually accelerate in vitro MK maturation, about which judged by the size of MK, their number and ploidy. The effect of LIF, IL-6, and IL-11 on the maturation of MK partially (LIF and IL-6) or completely (IL-11) supplements that of IL-3. The data in the following publications suggests that in order to enhance the maturation of MK in vivo, a combination of cytokines may be necessary.

 The following are some of the main publications devoted to the regulation of the formation of megakaryocytes and platelets.

 7. Hoffman, R. et al. Blood Cells 13: 75-86 (1987).

 8. Murphy, M. J., Hematology / Oncology Clinics of North America 3 (3): 465-478 (1988).

 9. Hoffman, R., Blood 74 (4): 1196-1212 (1989).

 10. Mazur, E. M. and Cohen, J. L., Clin. Pharmacol. Ter., 46 (3): 250-256 (1989).

 11. Gewirtz, A. M. and Calabretta. B., Int. J. Cell Cloning 8: 267-276 (1990).

 12. Williams, N., Progress in Growth Factor Research 2: 81-95 (1990).

 13. Gordon, M.S. and Hoffman, R., Blood 80 (2): 302-307 (1992).

 14. Hunt, P. et al., Exp. Hematol. 21: 372-381 (1993).

 15. Hunt, P. et al., Exp. Hematol. 21: 1295-1304 (1993).

 It has also been reported (see reference 16) that human aplastic serum contains megakaryocyte colony stimulating activity other than IL-3, granulocyte colony stimulating factor and factors present in the conditioned lymphocyte environment. However, the molecules responsible for this activity have not been isolated and have not been characterized to date.

 16. Mazur.E.M., Etal. Blood 76: 290-297 (1990).

C. Receptor Mpl
Myeloproliferative leukemia virus (MPLV) is a replication-defective mouse retrovirus that causes acute leukemia in infected mammals. The MPLV gene expressed has been shown to consist of a gene fragment encoding a retroviral surface protein linked to a sequence related to cytokine receptors, including GM-CSF, G-CSF and EPO receptors.

 Expression of the indicated MPLV gene in murine progenitor cells of various types leads to the rapid acquisition of independence from growth factors, which are normally necessary for proliferation and final maturation. In addition, the fact that megakaryocytes are detected in some bone marrow transformed MPLV cultures indicates a link between the MPLV gene and the growth and differentiation of megakaryocytes.

 It has now been shown that the MPLV viral gene (designated as v-Mpl) has a mammalian cell homologue, which is called the cell gene Mpl (or c-Mpl). Using v-Mpl-based samples, it was possible to clone the cDNA corresponding to the human c-Mpl gene. See published PCT application 92/07074 (publ. April 30, 1992). Sequence analysis showed that the protein encoded by the c-Mpl gene belongs to the highly conserved superfamily of cytokine receptors, as well as the homologous product of the v-Mpl gene.

 The conclusion about the functional role of the c-Mpl cell gene in hematopoiesis is based on evidence that its expression is found in the bone marrow, spleen, and embryonic liver of normal mice, but not in other tissues. In particular, c-Mpl is expressed in megakaryocytes. It has also been shown that human c-Mpl is expressed in CD34-positive cells, including purified megakaryocytes and platelets. CD34 is an antigen characteristic of early hematopoietic progenitor cells. In addition, treatment of CD34-positive cells with synthetic oligonucleotides antisense with c-Mpl mRNA significantly inhibits the colony forming ability of CFU-MK megakaryocytic precursors, but does not have an effect on erythroid and granulocyte-macrophage precursors.

 The above results indicate that c-Mpl encodes a cell surface molecule designated as the Mpl receptor. Ligand binding activates the receptor and is likely to lead to the formation and / or development of megakaryocytes.

 PCT published application 92/07074 relates to a sequence of a protein encoded by the cMpl gene of both human and mouse. The product of this gene, which, as mentioned, is a receptor, consists of at least three regions or domains: an extracellular domain, a transmembrane domain, and an intracellular (or cytoplasmic) domain. Connected together, these domains make up the intact Mpl receptor. The PCT publication also refers to a soluble form of the receptor, which largely corresponds to the extracellular domain of the mature c-Mpl protein. The intracellular domain contains a hydrophobic region, and when it is connected through the transmembrane domain to the extracellular domain, the entire protein becomes insoluble. On the other hand, when the extracellular domain of the c-Mpl gene product is separated from the transmembrane and intracellular domains, the protein becomes soluble, therefore the extracellular form of the protein is designated as the “soluble” form of the receptor.

 The following are major publications on the v-Mpl and c-Mpl receptors and their genes.

 17. Wendling. F., et al., Leukemia 3 (7): 475-480 (1989).

 18. Wendling. F., et al., Blood 73 (5): 1161-1167 (1989).

 19. Souyri. M., et al., Cell 63: 1137-1147 (1990).

 20. Vigon. l., Proc.Natl.Acad.Sci USA 89: 5640-5644 (1992).

 21. Skoda. R.C., et al. The EMBO Journal 12 (7): 2645-2653 (1993).

 22. Ogawa. M., Blood 81 (11): 2844-2853 (1993).

 23. Methia. N., et al. Blood 82 (5): 1395-1401 (1993).

 24. Wendling. F., et al. Blood 80: 246a (1993).

D. Need for an agent capable of stimulating platelet formation
There are reports that platelet transfusions are being performed in an increasing number of cases at medical centers in North America, Western Europe and Japan. see Gordon, MS and Hoffman, R., Blood 80 (2): 302-307 (1992). This is largely due to the improvement of medical methods and the spread of new technologies in cardiac surgery, as well as bone marrow, heart and liver transplants. Increased doses of chemotherapy drugs for cancer patients and the spread of HIV-1 infection have also contributed to the increasing need for platelets.

 Platelet transfusion carries with it the possibility of the spread of many diseases transmitted by blood, as well as the possibility of alloimmunization. In addition, obtaining purified platelets is an expensive procedure and its increasingly frequent use leads to an increase in overall medical costs. Therefore, there is an urgent need for new and improved methods for obtaining platelets for transfusion to people.

 The following are some examples of experimental approaches to increasing platelet formation.

 US Pat. No. 5,032,396 describes the ability of interleukin-7 (IL-7) to stimulate platelet formation. Interleukin-7, also known as lymphopoietin-1, is a lymphopoietic growth factor that stimulates the growth of T and B cell precursors in the bone marrow. The published PCT application 88/03747 (filed October 19, 1988) and European patent application 88309977.2 (filed October 24, 1988) describe DNA, vectors and the necessary methods for the production of mammalian IL-7 by genetic engineering. The data presented in the US patent indicate that IL-7 can increase the number of circulating platelets in normal and sublethally irradiated mice.

 US Pat. No. 5,087,448 shows that mammalian megakaryocytes and platelets can be stimulated to proliferate using interleukin-6 (IL-6). Recombinant human IL-6 is a glycoprotein with mol. weighing 26,000, with several biological activities. The data presented in this patent indicate that IL-6 increases the formation of megakaryocyte colonies in in vitro tests.

 None of the cited patents mention the Mpl ligands described in the present invention.

 Despite these achievements, the need for new stimulators of megakaryocytes and / or platelets in mammals remains very acute.

E. Background to the Chemically Modified MGDF
Proteins for therapeutic use are currently available in significant quantities and acceptable forms, mainly due to advances in recombinant DNA technology. Chemical modifications of such proteins can effectively prevent physical contact of proteolytic enzymes with the actual protein framework, thereby preventing degradation. Under certain conditions, benefits may also appear, such as an increase in the stability and circulation time of the therapeutic protein and a decrease in its immunogenicity. However, it must be emphasized that the effect of modification in relation to each specific protein is difficult to predict. Francis published a review article on protein modification, including fusion proteins: Focus on Growth Factors 3: 4-10 (May, 1992) (published by Mediscript, Mountview Court, Friern Barnet Lane, London N20, OLD UK).

 Polyethylene glycol ("PEG", "peg" or PEG) is one of the chemicals used to prepare the pharmacological forms of therapeutic proteins. For example, Adagen-R, a pegylated adenosine deaminase drug, is recommended for the treatment of acute combined immunodeficiency; pegylated superoxide dismutase is undergoing clinical trials to treat head injuries; pegylated interferon alpha has passed phase 1 clinical trials for the treatment of hepatitis; pegylated glucocerebrosidase and pegylated hemoglobin are in preclinical trials. For some proteins, polyethylene glycol attachment has been shown to protect against proteolysis (Sada et at., J. Fermentation Bioengineering 71: 137: 139 (1991)), and polyethylene glycol addition methods are known. See US Patent No. 4,179,337, Davis et al., "Non-Immunogenic Polypeptides", issued December 18, 1979, and US Patent No. 4,002,531, Royer "Modification of Polyethylene Glycol Enzymes and Products of this Process", issued January 11, 1977. For a review see Abuchowski et al., in Enzymes as Drugs (JS Holcerberg and J. Roberts, eds.pp. 367-383 (1981)).

 Other water-soluble polymers are used to modify proteins, such as copolymer polyethylene glycol / propylene glycol, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1,3-dioxolane, poly-1,3,6-trioxane, copolymer of ethylene / maleic anhydride and polyamino (both homopolymers and random copolymers).

 A number of approaches have been used to attach polyethylene glycol molecules to a protein. Typically, polyethylene glycol molecules are attached to a protein through one of the active groups of the protein. Suitable for this attachment are amino groups, for example, amino groups of lysine residues or amino groups of the N-terminus. For example, Royer (US Pat. No. 4,002,531) used reductive alkylation to attach polyethylene glycol molecules to an enzyme. In European Patent Publication No. 0539167 for "PEG Imidates and Their Protein Derivatives", published April 28, 1993, Wright describes peptides and organic compounds with free amino group (s) modified with PEG imidate derivatives or other water-soluble organic polymers. In U.S. Patent No. 4,904,584, issued February 27, 1990, Shaw describes the modification of lysine residues in proteins to attach polyethylene glycol molecules through reactive amino groups.

 One of the therapeutic proteins that has been chemically modified is the granulocyte colony stimulating factor, “G-CSF”. See EP N 0401384, EP N 0473268 and EP N 0335423.

 Another example is pegylated IL-6 (see European patent N 0442724, entitled "Modified hlL-6", as well as related application US 07 / 632,070, which describes polyethylene glycol molecules attached to IL-6. In European patent, N 0154316 published September 11, 1985 describes the interaction of lymphokine with polyethylene glycol aldehyde.

 The possibility of modifying MGDF is unknown, because it is determined by the specific structural parameters of each specific protein. In addition, the effects of such a modification on the biological properties of an individual protein are unpredictable. Due to the numerous clinical applications of MGDF described in this application, it would be desirable to obtain a derivative of this protein with modified properties. Such molecules could have an increased half-life and / or enhanced in vivo activity, along with other properties.

 Pegylation of a protein typically results in a mixture of chemically modified protein molecules. For example, protein molecules with five lysine residues and a free amino group at the N-terminus when pegylation by the described method can form a heterogeneous mixture in which some protein molecules will have six attached PEG molecules, some five, some four or three, or two, or one, or none at all. In this case, polyethylene glycol groups can be attached to various protein molecules in different areas.

 It is often desirable to obtain a homogeneous product containing essentially only one or a small number (2-3) forms of the modified protein, differing in the number and / or localization of polyethylene glycol groups. However, for some therapeutic indications, mixtures of mono-, di- and / or tri-pegyated forms may be desirable or suitable.

 Variability of the mixture from batch to batch is a drawback in the development of therapeutic pegylated protein. In this case, the predictability of biological activity is important. For example, it has been shown that when non-selective conjugation of superoxide dismutase with polyethylene glycol, individual fractions of the modified enzyme are completely inactive (P. McGoff et al., Chem. Pharm. Bull. 36: 3079-3091 (1988)). See also Rose et al. Bioconjugate Chemistry 2: 154-159 (1991), which shows the selective attachment of the carboxyhydrazide linker group to the C-terminus of the carboxyl group of the protein substrate (insulin). If the therapeutic protein is variable in composition from batch to batch, the predictability of its properties is unattainable. Individual polyethylene glycol molecules in certain areas can be attached weaker than in others, which can lead to the dissociation of PEG and protein. Obviously, if PEG molecules are randomly attached to a protein and also dissociate randomly, the pharmacokinetics of the therapeutic protein cannot be accurately predicted.

 It would also be highly desirable to obtain a derivative of MGDF in which there is no connecting link between the polymer and the protein. One of the problems associated with the application of the methods described above is that it usually requires some kind of connecting link between the protein and the polyethylene glycol molecule. This link may be an antigen, which is also a drawback in the development of a therapeutic protein preparation.

 Methods without the participation of connecting groups are described by Fransis et al., In the book. "Stability of protein pharmaceuticals: in vivo degradation pathways and protein stabilization strategies" (Ed.Ahern., T. and Manning, M.C.) Plenum, New York, 1991). See also Delgado et al., "Combining PEG with Protein by Activation with Tresyl Chloride, Use in Immunoaffinity Cellular Preparations and Fisher et al., Ed. Separation Using Water-Phased Systems. Use in Cell Biology and Biotechnology. Plenum Press , NY, 1989, pp. 211-213, which describes the use of tresyl chloride, which leads to the absence of connecting groups between polyethylene glycol and protein.This method is difficult to apply for the preparation of therapeutic drugs, since the use of tresyl chloride leads to the formation of toxic products.

 Chamow et al.,. Bioconjugate Chem. 5: 133-140 (1994) described the modification of a CD immunoadhesin with a monomethoxy polyethylene glycol aldehyde ("MePEG") by reductive alkylation. The authors report that 50% of CD4-lg was modified by MePEG in a selective reaction at the alpha-amino group of the N-terminus (see cited source, p. 137). The authors also report that the ability of the modified CD4-lg to bind in vivo to the gp 120 protein decreased depending on the degree of binding to MePEG.

 Thus, there is a need for derivatives of MGDF, in particular pegyated MGDF. There is also a need to develop methods for producing such derivatives.

 The present invention claims new polypeptides that specifically enhance the growth and / or development of megakaryocytes ("Mpl ligands" or "MGDFs"), which are essentially free (ie, purified) from other proteins (i.e. mammalian proteins in the case of Mpl ligands obtained from appropriate sources). These proteins can be isolated from cells that produce factors naturally or by induction by other factors. They can also be obtained by genetic engineering. In addition, Mpl ligands can be synthesized by chemical methods or obtained by combining the described approaches.

 The Mpl ligands of the present invention can be obtained natively from mammalian cells and tissues. In the Examples section of the present application, two Mpl ligands isolated from dog aplastic plasma are described. However, as described in other Examples of the present application, closely related Mpl ligands are present in human and pig aplastic plasma. It is noteworthy that the activity of the human, porcine and canine Mpl ligand is specifically inhibited by the soluble form of the mouse Mpl receptor, which indicates a strong similarity of these Mpl ligands both in terms of structure and function.

 Mpl ligands of humans, pigs and other mammals can be isolated from natural sources by the methods described in this application (see Example 10). Thus, the present invention includes mammalian Mpl ligands, i.e., dogs, pigs, humans, mice, horses, sheep and rabbits. Especially preferred are the Mpl ligands of dogs, pigs and humans.

 In addition, genes encoding human Mpl ligands were cloned from the embryonic kidney and liver libraries. These genes are sequenced as described in the Examples section of this application. It was shown that two human polypeptide sequences have activity in cell tests (see Example 4). They differ in length, but are identical in a significant part of their amino acid sequences. Identical regions have homology with erythropoietin. Mpl ligands are also designated as growth and development factors of megakaryocytes (MGDFs); all references to Mpl ligands have the same relation to MGDFs, and vice versa. "MGDF polypeptide" means a polypeptide having the ability to specifically stimulate or inhibit the growth and / or development of megakaryocytes. Examples of such polypeptides are provided herein.

 The Mpl ligands described in the present invention exhibit specific activity with respect to the megakaryocytic hematopoietic germ, enhancing the maturation and / or proliferation of megakaryocytes, as shown in Examples 2 and 4 below. The term "specifically" means that the biological activity of polypeptides is manifested to a large extent with respect to megakaryocytes, rather than with respect to other types of cells. Those factors that have a stimulating effect on megakaryocytes have in vivo activity that stimulates the formation of platelets. This happens by stimulating the maturation and differentiation of megakaryocytes.

 Two preferred canine-derived Mpl ligands have molecular weights of about 25 kD and 31 kD, as determined by non-reducing sodium dodecyl sulfate polyacrylamide gel electrophoresis. Both proteins were purified according to the same procedure described in the Examples section.

 The two preferred ligands of human origin, MGDF-1 and MGDF-2, consist of 332 and 173 amino acids, respectively, and do not include 21 amino acids of the intended signal peptide.

 Another aspect of the present invention are processes for the isolation and purification of said Mpl ligands or fragments thereof from natural sources, preferably whole blood, serum or mammalian plasma. Aplastic blood, serum or plasma are most preferred as starting material. They can be obtained using a mammalian irradiation procedure, for example, with a dose of about 400-800 rad using cobalt-60, which makes these animals aplastic. A similar procedure is well known, as can be seen from the publications cited in Example 1. In the case of a person, aplastic blood, serum or plasma can be obtained from patients undergoing radiotherapy, for example, with cancer.

 Aplastic blood, serum or plasma is then subjected to a purification process. The purification process of the present invention consists of several key steps: affinity chromatography with pectin and affinity chromatography with an Mpl receptor. Each of these steps gives approximately 300-500-fold purification of 25 kDa and 31 kDa proteins from dog aplastic plasma. Other standard protein purification methods can be used in conjunction with those indicated for further purification of Mpl ligands, as described below.

 Another aspect of the present invention are polynucleotides encoding a mammalian Mpl ligand protein. Such DNA sequences may include isolated DNA sequences that direct the expression of mammalian Mpl ligand proteins, as described below. These DNA sequences may also include 5 'and 3' non-coding mammalian sequences, lanking the coding sequences of Mpl ligands. In addition, DNA sequences can encode an amino terminal signal peptide. Similar sequences can be obtained by any of the known methods, including full or partial chemical synthesis. Codons can be optimized for expression in a particular host (e.g., E. coli or CHO cells).

 The present invention also claims recombinant DNA molecules, each of which is a vector DNA linked to DNA sequences encoding a mammalian Mpl ligand. In these recombinant DNA molecules, the Mpl ligand is operably linked to a regulatory sequence that allows the replication and expression of the Mpl ligand in specific host cells. Host cells (e.g., bacteria, insects, mammals, yeast or plants) transformed with such DNA molecules to express the recombinant Mpl ligand protein are also the subject of this invention.

 The DNA molecules and transformed cells of the present invention can be used to produce recombinant mammalian Mpl ligand protein or fragments thereof. A cell line transformed with DNA sequences encoding an Mpl ligand or fragment thereof (or the recombinant DNA molecules mentioned above) in functional association with suitable regulatory sequences is cultured under appropriate conditions for expression of the recombinant DNA. In this process, many cell lines can be used as host cells for protein expression. Preferred for the preparation of the Mpl ligand are mammalian cell lines (e.g., CHO cells) and bacterial cells (e.g., E. coli).

 To obtain the Mpl ligand in E. coli cells, it is preferable that Met and Lys residues are present at the N-terminus of the expressed protein, since in this case the yield of the expression product is usually higher. Human MGDF contains 165 amino acids (ie Met-2 Lys-1 [1-163] MGDF (when counting from the first amino acid of a mature protein). After purification of the product expressed in bacterial cells such as E. coli, terminal Met- Lys residues can be removed by treatment with any dipeptidase (eg, cathepsin C).

 The expressed Mpl ligand protein is then isolated from the host cells, cell lysate or culture medium by one of the usual methods. The conditioned medium can be subjected to the same purification steps (or their modifications) of the Mpl ligand as aplastic plasma.

 Another subject of the present invention are recombinant Mpl ligands. These proteins are essentially free of other biological structures of animal origin, especially proteins. The Mpl ligands of the present invention are characterized by one or more physical, biochemical, pharmacological or biological activities. Activity data are described in the application.

 The present invention also claims a chemically modified MGDF, consisting of the MGDF protein itself, coupled with at least one water-soluble polymer, as well as methods for preparing and using such compositions. In particular, a chemically modified MGDF is claimed in which PEG is attached to the MGDF by reaction with polyethylene glycol. A similar compound can be achieved by the pegylation reactions described below, such as acylation or alkylation. Acylation or alkylation with PEG can be carried out under conditions under which the final product will be monopaginated or polypaginated. In polypegging, PEG usually attaches to the epsilon amino groups of lysine residues, and pegging of the N-terminus of the protein is also possible. When monopagination preferably occurs the addition of PEG to the alpha-amino group of the N-terminus of the protein. The yield and homogeneity of the product of the monopegging reaction can be increased by such a reducing alkylation in which the alpha-amino group of the N-terminus of the MGDF is selectively modified, thereby allowing the water-soluble polymer to be selectively attached to the N-terminus of the protein. This approach allows one to obtain predominantly homogeneous preparations of the polymer / MGDF protein conjugate, as well as (in the case of PEG) preparations of the pegydated MGDF protein in which polyethylene glycol is directly connected to the protein.

 The present invention also provides pharmaceutical formulations (compositions) comprising a therapeutically effective amount of a purified natural or recombinant Mpl ligand that can be modified with a water-soluble polymer such as polyethylene glycol, together with a pharmaceutically acceptable carrier, diluent or buffer. These pharmaceutical preparations can be used to treat such disease states or disorders that are characterized by a deficiency of megakaryocytes and / or platelets, as well as a deficiency of the Mpl ligand in vivo. They can also be used prophylactically to compensate for the expected loss of megakaryocytes or platelets (for example, during surgical operations).

 Thus, the Mpl ligands of the present invention can be used to treat aplastic anemia, for example, to enhance platelet formation in patients (say, AIDS patients or patients undergoing tumor chemotherapy). Mpl-ligand can be used to treat hematopoiesis such as thrombocytopenia. Mpl-ligand may become part of the combination therapy of patients undergoing bone marrow transplantation. They can be humans or other mammals. Mpl ligand obtained from one biological species can be used for patients of another biological species.

 Another subject of the present invention is a method for treating other pathological conditions characterized by platelet deficiency by administering to a patient a therapeutically effective amount of the pharmaceutical preparation described above. Such therapeutic methods may include administering simultaneously with the Mpl ligand or sequentially an effective amount of at least one megakaryocyte colony stimulating factor, cytokine (e.g., EPO), soluble Mpl receptor, hematopoietin, interleukin, growth factor, or antibodies.

 Antibodies (polyclonal, monoclonal, humanized or recombinant) as well as antibody fragments obtained (ie, reacting) against a mammalian Mpl ligand or fragment thereof are also claimed in the present invention. Accordingly, cells capable of secreting such antibodies (i.e., hybridomas in the case of monoclonal antibodies), methods for producing such antibodies and their use for diagnostic and therapeutic purposes are included in the present invention.

 Another object of the present invention is a method for determining Mpl ligand in body fluids. In this case, antibodies that specifically recognize the Mpl ligand can be used, both in the “sandwich” variant and by themselves. A similar approach can be used to determine the need for the introduction of the patient Mpl-ligand and / or detection of platelet deficiency in this patient. Reagents for staging such tests can be assembled into a kit that includes positive and negative controls, antibodies, and other standard components of such kits.

 Other aspects and advantages of the claimed invention will become apparent from the following detailed description of its embodiments.

Numerous advantages of the present invention will be more apparent upon consideration of the following drawings:
Figure 1 reflects the development and maturation of megakaryocytes and platelets.

 Figure 2 shows that the soluble murine Mpl receptor almost completely suppresses the ability of plasma of irradiated dogs ("aplastic canine" or "ARK9") to induce the development of megakaryocytes. A test for the development of megakaryocytes is described in example 2.

 FIG. 3 shows that the activity of ARK9, enriched in affinity chromatography with lectin and affinity chromatography with an Mpl receptor (“Mpl ligand”), stimulates the growth of 1A6.1 cells, and that soluble murine Mpl receptor blocks this growth.

 FIG. 4 provides an overview of the purification steps of 25 kD and 31 kD forms of a dog Mpl receptor from dog aplastic plasma.

 Figure 5 shows the purification of the Mpl ligand by reverse phase chromatography high resolution (RP-HPLC). Fraction 21 contains a highly purified 31 kD Mpl ligand; fraction 22 contains a mixture of 31 cd and 25 kD Mpl ligand; fraction 23 contains a highly purified 25 kD Mpl ligand.

 FIG. 6 shows a comparison of the activities of Mpl ligand in the fractions obtained by RP-HPLC (column C4) and containing 25 kD and / or 31 kD Mpl ligand proteins.

 FIG. 7 shows the number of megakaryocytes formed in cultures of CD34-positive peripheral blood cells stimulated by APK9, Mpl ligand and various other factors.

 FIG. 8 reflects the total number of lymphocytes formed in cultures of CD34-positive peripheral blood cells stimulated by APK9, Mpl-ligand and various other factors.

 FIG. 9 shows the percentage of megakaryocytes formed in cultures of CD34-positive peripheral blood cells stimulated by APK9, Mpl-ligand and various other factors.

 FIG. 10 shows that human IL-3 is not involved in Mpl-ligand-induced megakaryocyte development.

 FIG. 11 represents cDNA sequences and predicted amino acid sequences of human MGDF-1 and MGDF-2.

 FIG. 12 represents the cDNA sequence and the predicted amino acid sequence of human MGDF-3.

 FIG. 13 shows a comparison of MGDF-1 and MGDFs (Mpl ligands) of canine (A) and mouse (B) origin.

 FIG. 14 shows an example of MGDF acylation using N-hydroxysuccinimidyl (NHS) monomethoxy-polyethylene glycol active esters to produce a poly-pegylated product.

 FIG. 15 shows an example of non-specific reductive alkylation of MGDF using monomethoxy-polyethylene glycol aldehydes to produce a poly-pegylated product.

 FIG. 16 shows an example of site-specific reductive alkylation of MGDF at the alpha amino group of the N-terminal residue using monomethoxypolyethylene glycol aldehydes to produce a substantially mono-pegylated product.

FIG. 17 shows HPLC analysis based on size exclusion (SEC HPLC) of MePEG-MGDF conjugates prepared using activated MePEG derivatives mol. weighing 20 kD:
A. poly-MePEG-MGDF conjugate obtained by acylation of MGDF with MePEG NHS-ester (PEG11);
B. poly-MePEG-MGDF conjugate obtained by alkylation of MGDF MePEG with aldehyde (PEG 20);
B. poly-MePEG-MGDF conjugate obtained by alkylation of MGDF with MePEG aldehyde (PEG 16).

 FIG. 18 shows the platelet count in mice treated with recombinant human MGDF: open stars — MGDF 22-353 obtained in CHO cells; open circles — non-pegyed MGDF 22-184 obtained in E. coli (i.e., MGDF 1-163); filled circles — pegyated MGDF 22-184 obtained in E. coli.

 19 shows a r-HuMGDF purification scheme.

 Figure 20 in a mouse model shows the effect of r-HuMGDF (E. coli 1-163) on platelet count. On day 0, Batb / c mice were intraperitoneally injected once with carboplatin (1.25 mg / mouse). The control group of mice was injected with a solvent instead of carboplatin. After 24 hours, the carboplatin treated animals were injected subcutaneously with a solvent or 100 μg / kg r-HuMGDF. Injections were performed daily until the end of the experiment (n = 10 for each group; at each time point, blood was taken from five animals).

 21 shows the effect of r-HuMGDF (E. coli 1-163) on platelet count in irradiated mice. On day 0, Balb / c mice received a single dose of 500 rad gamma radiation (cesium source). The control group of mice was not exposed to radiation. After 24 hours, the exposed animals were subcutaneously injected with a solvent or 100 μg / kg r-HuMGDF. Injections were performed daily until the end of the experiment (n = 8 for each group; at each time point, blood was taken from five animals).

 FIG. 22 shows the effect of r-HuMGDF (E. coli 1-163) on platelet count in mice subjected to the combined effects of irradiation and carboplatin. On day 0, Balb / c mice received a single dose of 500 rad gamma irradiation (cesium source) and a single dose of carboplatin (1.25 mg / mouse). After 24 hours, the treated animals were injected subcutaneously with a solvent or 100 μg / kg r-HuMGDF. Injections were performed daily until the end of the experiment (n = 8 for each group). Most animals not treated with r-HuMGDF did not survive. In the control group, 1 animal out of eight survived. In the experimental group, 8 out of 8 animals survived.

 FIG. 23 shows the effects of r-HuMGDF (E. coli 1-163) on irradiation-induced thrombocytopenia in rhesus monkeys. The monkeys received a radiation dose of 700 cGy, Co-80. Within 18 days, 24 hours after irradiation, the animals were injected subcutaneously with r-HuMGDF (n = 3) or human serum albumin (n = 9) (each at a dose of 25 μg / kg / day). Blood cells were analyzed using an electronic analyzer. Each icon represents an average value (+/- average deviation).

 FIG. 24 shows the effect of pegylated and glycosylated r-HuMGDF on platelet counts in mice treated with carboplatin and irradiation. Mice were subjected to the combined effects of carboplatin and irradiation, as described in the experiment shown in Fig.22. Subcutaneous injections of the indicated r-HuMGDF preparation (50 μg / kg / day) were performed daily throughout the experiment, starting from 24 hours after the initial treatment. Blood cells were counted on the indicated days using an electronic cell counter (Sysmex, Baxter).

 FIG. 25 shows the sequence of a synthetic recombinant human MGDF (amino acids 1-163) having codons optimizing expression in E. coli.

 Additional aspects and advantages of the invention will become more apparent to those skilled in the art from the following description, which discloses the practical possibilities of using the invention.

 New factors enhancing the growth of mammalian megakaryocytes and / or platelet producing factors, designated as Mpl ligands and obtained according to the present invention, are homogeneous proteins that are practically free of other protein-like compounds. Preferably, the target proteins are 90% free of other proteins, more preferably 95% and it is highly preferred that the target proteins are 98% or more free of other proteins. These proteins can be obtained in large quantities using recombinant technology in such a way that the final product is a high purity active Mpl ligands, which can be successfully used in therapy. Alternatively, such proteins can be obtained in homogeneous form from aplastic mammalian blood, plasma or serum, as well as from mammalian cell lines secreting or expressing Mpl ligand.

 Moreover, the Mpl ligand or its active fragments can be chemically synthesized. In general, the term "Mpl ligands" as used in the present invention refers to both the Mpl ligands themselves and their active fragments and variants, which are described in more detail below.

Two preferred dog Mpl ligands have a molecular weight of about 25 kD and 31 kD, determined by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate (SDS-PAGE) under non-reducing conditions. Both proteins are purified according to one technique, which is described in more detail in the following examples. For example, both Mpl ligands bind wheat germ lectin and immobilize the Mpl receptor. A 25 kD protein has the following amino acid sequence:
Ala-Pro-Pro-Ala-Xaa-Sap-Pro-Arg-Leu-Leu-Asn-Lys-Met-Leu-Arg-Asp-Ser-His-Val-Leu-His-Xaa-Arg-Leu-Xaa- Gln-Xaa-Pro-Asp-Ile-Tyr (SEQ ID N0: 1).

 A 31 kD protein has the following amino acid sequence: Ala-Pro-Pro-Ala-Xaa-Asp-Pro-Arg-Leu-Leu-Asn-Lys-Met-Leu-Arg-Asp-Ser-His-Val-Leu-His (SEQ ID N0: 2).

 Amino acids "Xaa" in the sequences of SEQ ID N0: 1 and 2 are not precisely defined, but are presumably cysteine, serine, threonine or (less likely) tryptophan. From the above sequences it can be seen that a 31 kD ligand contains at least a portion of a 25 kD ligand. In particular, the first 21 amino acids of the 31 kD protein match exactly the first 21 amino acids of the 25 kD protein. This circumstance, and in particular the fact that both proteins are active in studies of the properties of the Mpl ligands described in the present invention, allow us to conclude that both proteins are very closely related both in structure and function. It is likely that the 31 kD protein form differs from the 25 kD protein in the structure of the C-terminal sequence, as well as the different glycosylation pattern and / or other pattern of splicing of the gene encoding the proteins. In addition to the sequences described above, another sequence was determined during the sequencing of the 25-kD band to the final purification step (using reverse phase HPLC). It was shown that this sequence is associated with a 25 kD band under non-reducing conditions, but not under reducing conditions, suggesting that it is the result of splitting into two fragments (for example, using a protease) of a 25-kD protein, and these fragments are held together by a disulfide communication. Said sequence has the following structure: Thr-Gln-Lys-Glu-Gln-Thr-Lys-Ala-Gln-Asp-Val-Leu-Gly-Ala-Val-Ala-Leu (SEQ ID N0: 3).

 Despite the fact that the localization of the sequence SEQ ID N0: 3 within the 25-kDa protein sequence is unknown, an analogy with other cytokines, such as erythropoietin, suggests that this sequence is located near the 114th amino acid of the 25-kDa protein. It should be noted that the localization of the sequence SEQ ID N0: 3 is likely (but not proven) and within the protein size 31 kD, despite the fact that it again begins near amino acid 114. Information on this sequence is discussed in more detail in Example 7.

 Thanks to the initial dog ligand purification experiments described above, a ligand encoding gene was cloned. As a result, the complete amino acid sequence of the indicated dog ligand was determined, which is shown in Fig. 13A. Based on molecular weight data, it is predicted that dog ligands of 25 kD and 31 kD are C-terminal processed forms of the full length ligand, whose sequence is shown in FIG. 13A. In addition, a mouse Mpl ligand having the sequence shown in FIG. 13B was obtained. Such purified ligands can also be characterized according to the specific activity shown in the study of human megakaryocytes (Example 2), which is at least 5.7 billion megakaryocytic units / ml. A megakaryocytic unit is defined as the amount of material from which as many megakaryocytes can be obtained as from 1 μl of the control ARK9 standard, as shown in the description of the study in Example 2.

 In addition, such purified ligands can be characterized according to the specific activity shown in the study of Mpl-dependent cell growth (Example 4), which is at least 6.9 billion units of cell growth / mg The cell growth unit is defined as the amount of ligand required for the growth of 200 1A6.1 cells in the study described in Example 4. Table 1 (see the end of the description) lists additional specific activity indicators of purified dog Mpl ligands obtained according to this invention.

Summarizing the above information, some Mpl ligands can be characterized as examples based on one or more biochemical and biological properties:
(a) such Mpl ligands are isolated from aplastic plasma;
(b) such Mpl ligands have a molecular weight of about 25 kD or 31 kD, as determined by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate (SDS-PAGE) under non-reducing conditions;
(c) Mpl ligands contain the following amino acid sequences: SEQ ID N0: 1 in the case of protein mol. mass 25 kD; or SEQ ID N0: 2 in the case of protein mol. mass 31 kD;
(d) Mpl ligands additionally contain the amino acid sequence of SEQ ID N0: 3 (especially important in the case of a protein with a molecular weight of 25 kDa);
(e) Mpl ligands bind wheat germ lectin;
(e) Mpl ligands bind the immobilized soluble mouse Mpl receptor;
(g) the activity of Mpl ligands can be inhibited in vitro by a soluble Mpl receptor and
(h) Mpl ligands bind to the anion exchange column at a pH of about 8-9.

 The biological activity of the preferred Mpl ligands obtained according to the present invention is confirmed by their ability to specifically stimulate the growth and development of megakaryocytes in the study of cell growth enhancement described in Example 2. In this experiment, Mpl ligands stimulate differentiation of human peripheral blood CD34 + cells (i.e., CD34 -cells secreted by immunoadsorption) during 8 days of cultivation. Megakaryocytes are identified by staining with specific antibodies to the platelet antigen and counted under a microscope. In addition, the Mpl ligand stimulates the growth of factor-dependent cell line 1A6.1. In the absence of the Mpl ligand, the cells die. The number of cells in the culture containing the Mpl ligand is determined after 2 days. Mpl ligands described above have the specific activity shown in Table 1 (see earlier).

The sources of Mpl ligands are mammalian aplastic blood, blood plasma or serum. However, the sources of such ligands are not limited to these and may include other mammalian body fluids, cells derived from such fluids, etc. Purification of native Mpl ligands upon isolation from the above sources is based on two main procedures:
(a) affinity chromatography using lectin, mainly agglutinin, wheat germ; and
(b) affinity chromatography with immobilized Mpl receptor.

 Additional procedures may include further protein purification. These include, for example, ion exchange chromatography, gel filtration chromatography and reverse phase chromatography.

The purification technique actually used to isolate the Mpl ligand from the dog’s aplastic blood plasma includes the following steps (see Example 7):
(a) lectin affinity chromatography (chromatography using wheat germ agglutinin is particularly preferred);
(b) affinity chromatography using a soluble Mpl receptor (Mpl-X) (particularly preferred is the use of immobilized mouse Mpl-X);
(c) ion exchange chromatography (cation or anion exchange chromatography, especially when using a Mono Q column);
(d) gel filtration chromatography under conditions causing dissociation (preferably using Superdex 200 and SDS); and
(e) reverse phase chromatography (preferably using a C4 column).

 A homogeneous mammalian Mpl ligand, including a human ligand, can be obtained from aplastic blood, serum, plasma, or other sources of human Mpl ligand, for example cells or tissues, using the purification procedure described above. The necessary cleaning steps do not necessarily follow in this order, however, the sequence of steps involved is preferred. Techniques for culturing cells or tissues that may be the source of the Mpl ligand are well known to those skilled in the art and can be used, for example, to increase the amount of starting material.

 Mpl ligand or one or more of its peptide fragments can be obtained using recombinant DNA technology. To obtain the DNA sequence of a specific Mpl ligand, the ligand-containing material is concentrated and usually treated with a protease, such as trypsin. Fragments resulting from enzymatic cleavage are isolated and sequenced using a suitable method. Alternatively, as shown in the examples below, the intact purified protein can be sequenced directly to the extent that is achievable with a given amount of protein, and then the sequenced region can be similarly used to obtain tryptic fragments according to the following procedure. Oligonucleotide samples are synthesized using a genetic code to predict all possible sequences of genes encoding the amino acid sequences of sequenced fragments (or fragment). Preferably, some degenerate sequences are used as samples. The Mpl ligand gene is identified using these samples for screening a mammalian genomic library or other sources. In contrast, mRNA from cells that are the source of the Mpl ligand can be used to obtain a cDNA library that is screened using samples to identify cDNA encoding the Mpl ligand polypeptide. Moreover, to increase the cDNA sequence can be used polymerase chain reaction (PCR), in which the corresponding primers are involved.

 Using the appropriate samples for screening the genomic library, a DNA clone is obtained. To obtain a clone containing a full-sized copy of the Mpl ligand gene, samples based on the obtained DNA sequence can be used for re-screening the library and hybridization with a full-sized sequence of the Mpl ligand.

 Human Mpl ligand cDNA can also be obtained by subcloning a full-size human genomic clone in an expression vector, then transferring it to COS cells, obtaining a cDNA library from these transfected COS cells, and screening the Mpl ligand cDNA by hybridization. After identifying the complete cDNA sequence, it or any part of it encoding the active fragment of the Mpl ligand can be inserted into any of a large number of known expression vectors to obtain an expression system for the Mpl ligand or one or more fragments.

 Using this recombinant technology, DNA sequences that determine the synthesis of Mpl ligand polypeptides are preferably obtained. The present invention also relates to said sequences that are free of DNA sequences encoding other proteins (i.e., isolated sequences) and that allow expression of Mpl ligand polypeptides with Mpl ligand activity (i.e., polypeptides that cause growth and / or the development of megakaryocytes). These DNA sequences include those sequences that encode the whole or any fragment of the Mpl ligand, and those sequences that hybridize, preferably under stringent hybridization conditions, to cDNA sequences [see Maniatis et al., Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory (1982), PP.387-389].

Typically, hybridization under stringent conditions is carried out in 4 x SSC at 62-67 ^° C followed by washing in 0.1 x SSC at 62-67 ^° C. Alternatively, hybridization under stringent conditions is carried out in 45 - 55% formamide, 4 x SSC at 40-45 ^° C. DNA sequences that hybridize to Mpl ligand sequences under mild conditions and encode Mpl ligand peptides having biological properties of the Mpl ligand also encode the new Mpl ligand polypeptides of the present invention. Usually, hybridization is carried out under mild conditions in 4 x SSC at 40-45 ^o C or 30-40% formamide at 40 to 45 ^o C. For example, a DNA sequence that has substantial homology plots (for example, glycosylation or disulfide area binding) to the sequences of the Mpl ligand and encodes a protein having one or more types of biological activity of the Mpl ligand, explicitly encodes the Mpl ligand polypeptide, even if such a DNA sequence does not hybridize with the sequence (sequences) of the Mpl ligand in hard condition Barrier-.

 Allelic variants (naturally occurring base changes in the genetic structures of the organisms that make up this population, which do not necessarily lead to amino acid changes) of DNA sequences encoding the peptide sequences of the Mpl ligand are also included in the scope of the present invention, as well as analogues and derivatives of these sequences. Similarly, DNA sequences that encode Mpl ligand polypeptides, but differ in some codons due to the degeneracy of the genetic code, as well as various variants of the Mpl ligand DNA sequence that are due to point mutations or induced modifications to enhance activity, increase half-life or increase yield polypeptides encoded by such modified sequences are also included in the scope of the present invention.

As a result of the cloning procedure described in Example 11 below, the cDNA sequence and amino acid sequence of the human proteins MGDF-1, MGDF-2 and MGDF-3, which are described herein in the application materials, are determined. MGDF-1 is represented by amino acids 22-353 (FIG. 11) and contains 332 amino acids. MGDF-2 is a cleaved portion of MGDF-1 and contains amino acids 22-195, as shown in FIG. 11. MGDF-2, respectively, consists of 174 amino acids. MGDF-3 is represented by amino acids 22-289 (Fig. 12) and contains 268 amino acids. When describing each of the MGDFs, it is understood that the signal peptide sequence (amino acids 1-21 in FIGS. 11 and 12) is also part of the polypeptides claimed in the present invention, however, for the manifestation of activity that determines the growth and development of megakaryocytes, it is preferable to remove the signal peptide. In general, data on MGDFs can be summarized as follows:
MGDF-1 amino acids 22-353 of FIG. 11
MGDF-2 amino acids 22-195 of FIG. 11
MGDF-3 amino acids 22-289 of Fig.12
In the described experiments, MGDF-1 and MGDF-2 are active, while MGDF-3 is inactive.

Based on the activity information presented here, it can be assumed that human MGDF is expressed in vivo as a substantially inactive or less active precursor polypeptide containing various C-terminal amino acids. When C-terminal amino acids are cleaved (as well as the signal peptide), the processed form (s) of the polypeptide becomes active or becomes more active. Considering the above assumption, it is believed that processing is necessary for the manifestation of MGDF-1 activity (e.g., cleavage
protease). The fact that MGDF-1, from which a specific site is cleaved (i.e., MGDF-2), is active, confirms this assumption.

 The conditioned medium of 293 human kidney cells (Invitrogen) transfected with the MGDF-1 gene exhibits corresponding activity in the experiments on the cells described below in Example 4. On the other hand, in other cell lines, for example, 32D cells, MGDF-1 activity is not detected . Presumably, this can be explained by the ability of 293 cells to process the MGDF-1 polypeptide, possibly by cleaving a specific site, so that the molecule that actually shows activity is such a processed form, while 32D cells are not capable of processing MGDF-1.

 From the point of view of the above hypothesis, various active molecules can be formed as a result of cleavage of certain regions from the sequence shown here as the MGDF-1 sequence (Fig. 11). The conservative features characteristic of cytokines, such as erythropoietin (EPO), include four alpha-helices and four cysteines. When studying the arrangement of cysteine molecules (evolutionarily conservative and functionally necessary elements), it turned out that Cys 172 in the MGDF-1 sequence is the most terminal compared to cysteine molecules in other sequences. Accordingly, preferred variants of MGDF-1 are those that are formed by cleaving C-terminal regions from MGDF-1, starting from the amino acid at position 173 and the amino acid at position 353 (in combination with cleavage of the signal peptide). In the MGDF-1 sequence, it is preferred that cleavage occurs in the region of the 50th to 185th amino acids, particularly preferably in the region of the 90th to 172th amino acids, starting at the C-terminus of the sequence. As noted, the signal peptide is 21 amino acids in length, however, the signal peptide may contain 23 amino acids, based on the sequence of MGDF-1. Accordingly, polypeptides related to the claimed but starting at the 24th amino acid (see FIG. 11 or 12) are also to be considered.

The following are some particularly preferred MGDF-1 variants that may be active (i.e., the ability to enhance the growth of megakaryocytes and / or platelets or inhibit / stimulate the activity of a natural receptor):
MGDF-4 amino acids 22-172 of FIG. 11
MGDF-5 amino acids 22-177 of FIG. 11
MGDF-6 amino acids 22-191 of FIG. 11
MGDF-7 amino acids 22-198 of FIG. 11
MGDF-8 amino acids 22-265 of FIG. 11
MGDF-11 amino acids 22-184 of FIG. 11
In some clones, amino acids 133-136 in the MGDF-1 sequence were absent, therefore, sequences corresponding to the above but in which the indicated amino acids are lost (and the number of the C-terminal amino acid is reduced by 4) can also be active.

 In one clone having a termination codon at position 192, instead of the Thr residue at position 191, an Ala residue was found, as reflected in FIG. 11. Thus, variants of MGDF molecules are included in the scope of the invention, in which Ala is in position 191 instead of Thr.

 MGDF-3 is formed by removing a sequence called here IVS-5 (Intermediate sequence-5), since this sequence is spliced within the fifth exon. Since the 5'-end of IVS-5 is part of the codon, the removal of this sequence leads to a shift of the reading frame in the remaining MGDF sequence, which occurs at position 160 towards the end of the MGDF-3 molecule.

For MGDF-3 itself, no biological activity was detected upon transfection of 293 cells and testing the corresponding conditioned medium in cell experiments, as described in Example 4. Obviously, unlike MGDF-1, 293 cells are not able to process MGDF-3 to form active form. However, based on the cleavage theory described above with respect to MGDF-1, cleavage of C-terminal amino acids (e.g., at position 40-102) from MGDF-3 can provide its activity. Cleavage of 50 to 90 amino acids is preferred. Two particularly preferred MGDF-2 variants are as follows:
MGDF-9 22-179 Fig. 12
MGDF-10 22-190 Fig. 12
In all the described Mpl ligands, including the MGDFs mentioned above, a methionine residue may be present on the N-terminal region, especially when such polypeptides are expressed in bacterial host cells. Mpl ligand polypeptides can also be prepared using known chemical synthesis techniques. Such techniques are well known to those skilled in the art. Synthetic Mpl ligand polypeptides, having a primary, secondary, tertiary structure and conformational properties of Mpl ligand polypeptides obtained by other methods, may have similar biological properties. So, they can replace biologically active and immunologically active natural, purified Mpl ligand polypeptides for therapeutic and immunological applications.

 Modifications of peptides or DNA sequences encoding the Mpl ligand can be obtained by any person skilled in the art using known techniques. Modifications of the Mpl ligand sequence of this kind may include permutations, insertions, or deletions of selected amino acid residues in the coding sequences. Methods for carrying out mutagenesis in order to obtain such rearrangements, insertions or deletions are well known to specialists in this field of research [see, for example, US Patent No. 4,518,584]. Preferred peptides can be obtained using proteolytic enzymes or by targeted chemical synthesis. Such variants of the Mpl ligand and polynucleotides are included in the scope of the present invention.

 Specific mutations in the sequences of the Mpl ligand polypeptide may include modifications at the glycosylation site (eg, serine, threonine or aspartic). The absence of glycosylation or only partial glycosylation is the result of substitution or deletion of the amino acid at the asparagine-linked glycosylation site or some other site modified by the addition of O-linked carbohydrate. An asparagine-linked glycosylation site contains a tripeptide sequence that is specifically recognized by the corresponding cellular glycosylation enzyme. Such a tripeptide sequence may be an Asn-Xaa-Thr or Asn-Xaa-Ser sequence, where Xaa may be any amino acid except Pro. Various substitutions or deletions of amino acids in one or both of the first or third positions of the amino acids in the recognized glycosylation site (and / or amino acid deletion in the second position) lead to the absence of glycosylation at the modified tripeptide sequence. Expression of such altered nucleotide sequences leads to the formation of products that are not glycosylated at this site.

Additional Analogs / Derivatives MGDF
Other analogs or derivatives of MGDF sequences (Mpl ligands) that can retain MGDF (Mpl ligand) activity (partially or fully) can be obtained by a person skilled in the art using the methods indicated here. Such modified products are also included in the scope of this invention. More specifically, the present invention also encompasses compositions based on chemically modified MGDF, as well as methods for preparing and using such compositions. The present description shows that it is possible to modify MGDF with increasing its activity. One aspect of the invention is to provide an MGDF product containing an MGDF protein coupled to at least one water soluble polymer. On the other hand, the invention relates to a MGDF product, wherein said MGDF protein is bound to at least one polyethylene glycol molecule. The invention further relates to an MGDF protein bound to at least one polyethylene glycol molecule via an acyl or alkyl bond.

 Pegylation of MGDF can be carried out using any reaction known in the art, see, for example, Focus on Growth Factors 3 (2): 4-10 (1992); EP 0154316; EP 0401384 and other publications cited herein related to pegylation. Preferably, the pegylation is carried out by an acylation reaction or an alkylation reaction with a reactive polyethylene glycol molecule (or a molecule of a similar water-soluble polymer). Preferred options for producing pegyated products are described in detail below.

Acylation
Compounding with polyethylene glycol by acylation mainly involves the reaction between the active polyethylene glycol ether (PEG) and the MGDF protein. Any known or subsequently prepared reactive PEG molecule can be used to pegy MGDF. A preferred activated PEG ester is PEG esterified to form N-hydroxysuccinimide ("NHS"). Thus, in the context of the present invention, the term “acylation” is considered to include, without limitation, the following types of bonds of MGDF with a water-soluble polymer (PEG): amide, carbamate, urethane, and the like. See Bioconjugate Chem. 5: 133-140 (1994). The conditions for the PEG addition reaction can be selected from any known or discovered later, however, in any case, the use of temperatures, solvents or pH values that are capable of inactivating the MGDF products to be modified should be avoided. The reaction conditions commonly used to attach PEG to MGDF are described below. For example, a reaction with a monomethoxy-PEG NHS ester is shown in FIG.

 The addition of PEG by acylation typically results in the formation of an MGDF product bound to several PEG molecules, wherein the amino groups of epsilon-lysine are linked to the PEG via an acyl linking group. Preferably, the connecting bond is amide. It is also preferred that the resulting product is substantially only (> 95%) bound to one, two or three PEG molecules. However, some products with a higher degree of pegylation (the maximum number of epsilon-lysine amino groups and one alpha-amino group in the amino terminal portion of MGDF reacted) can normally form, and their number depends on the specific reaction conditions. If necessary, purified pegylated products as well as unreacted compounds can be isolated from the reaction mixture using standard purification methods, including dialysis, salting out, ultrafiltration, ion exchange chromatography, gel filtration chromatography, and electrophoresis.

Alkylation
Compounding with PEG by alkylation typically involves the reaction between a terminal aldehyde derivative of PEG and a protein, such as MGDF, in the presence of a reducing agent. As with acylation, detailed conditions for the alkylation reaction are described below.

 Compound with PEG by alkylation can also lead to the formation of an MGDF product bound to several PEG molecules. For example, the MGDF alkylation reaction under reducing conditions, which leads to the formation of the MGDF product bound to several PEG molecules, is shown in FIG. 15. In addition, the reaction conditions can be changed so that PEG addition will occur only at the alpha-amino group of the N-terminal portion of the MGDF molecules (that is, MGDF products associated with one PEG molecule will form). For example, the MGDF alkylation reaction under reducing conditions, which leads to the formation of the MGDF product bound to one PEG molecule, is shown in FIG. 16. In the case of "monopagging", as well as in "polypegging", the PEG groups are preferably coupled to the protein via an -CH2-NH group. Due to the presence of the group —CH 2 -, this type of bond is called an “alkyl” bond.

 The preparation of MGDF derivatives linked to a single PEG molecule by reductive alkylation is based on the unequal reactivity of various types of primary amino groups (lysine as opposed to N-terminal amino groups) suitable for the preparation of said MGDF derivatives. The reaction is carried out at a pH value (see below), which allows the use of pKa differences between residues of epsilon-amino groups of lysine and alpha-amino groups of the N-terminal portion of the protein. Thanks to this approach, the addition of a water-soluble polymer containing a reactive group such as an aldehyde to the protein is controlled. Conjugation with the polymer occurs predominantly at the N-terminal portions of the protein, and significant modifications of other reactive groups, such as the side groups of the amino groups of lysine, do not occur. One important aspect of the present invention is to provide a substantially homogeneous preparation of a monopolymer conjugated with a MGDF protein (i.e., an MGDF protein to which the polymer molecule is attached at only one (> 95%) specific site). More specifically, if polyethylene glycol is used, the present invention also relates to a pegyed MGDF protein that has lost possible antigenic groups and contains a polyethylene glycol molecule directly linked to the MGDF protein.

 Thus, a preferred aspect of the invention is the preparation of pegyated MGDF, wherein the PEG groups (a) are attached (a) to the protein molecule via an acyl or alkyl group. As indicated above, such products can be monopaginated (for example, containing 2-6, preferably 2-5 PEG groups). PEG groups are attached to the protein mainly through alpha or epsilon amino acid groups, however, it is possible that PEG groups can be attached to any amino group of the protein that has sufficient reactivity to bind to PEG under suitable reaction conditions .

 The polymer molecules used in the acylation and alkylation reactions may be selected from water-soluble polymers or mixtures thereof. In the case of a water-soluble polymer, the protein to which it is attached will not precipitate in an aqueous medium, such as physiological fluid. The selected polymer should be modified so that it contains one reactive group, such as an active ester in the case of acylation or an aldehyde in the case of alkylation. Preferably, the degree of polymerization can be controlled as described in the present invention. A preferred reactive PEG aldehyde is polyethylene glycol propionaldehyde, which is stable in water, or mono C1-C1 alkoxy or aryloxy derivatives thereof (see US Pat. No. 5,252,714). The polymer may be linear or branched. When used for therapeutic purposes, the final product, it is preferable that the polymer is pharmaceutically acceptable. The water-soluble polymer may be selected from the group consisting of, for example, polyethylene glycol, monomethoxypolyethylene glycol, dextran, poly (N-vinylpyrrolidone) polyethylene glycol, propylene glycol homopolymers, polypropylene oxide / ethylene dioxide copolymer, polyoxyethylene polyols (e.g. polyvinyl glycerol). For the acylation reaction, the polymer (s) is chosen so that he (they) has (and) one reactive ether group. For alkylation reactions under reducing conditions, the polymer (s) are selected so that he (they) has (and) one reactive aldehyde group. In general, a water-soluble polymer should not be selected from natural glycosyl residues, since these residues are usually more convenient to attach to the protein by expression in mammalian cells. The polymer may be of any molecular weight.

 Particularly preferred is the use of a polyethylene glycol (PEG, PEG) as a water-soluble polymer. As noted herein, any form of PEG, for example, mono- (C1-C10) alkoxy or aryloxy-polyethylene glycol, can be used to produce derivatives of various proteins.

As noted earlier, MGDF also means any of its forms described herein. For example, these may be glycosylated or non-glycosylated forms of MGDF, as well as proteins having a full length or formed as a result of cleavage of the starting material. The following are preferred MGDF proteins, based on which various derivatives can be obtained (in each case, the amino acid numbers correspond to those in Fig. 11):
MGDF-1 amino acids 22-353 of FIG. 11
MGDF-2 amino acids 22-195 of FIG. 11
MGDF-4 amino acids 22-172 of FIG. 11
MGDF-11 amino acids 22-184 of FIG. 11
MGDF-12 amino acids 27-353 of FIG. 11
MGDF-13 amino acids 27-195 of FIG. 11
MGDF-14 amino acids 27-172 of FIG. 11
MGDF-15 amino acids 27-184 of FIG. 11
Said MGDF proteins can be non-glycosylated, deglycosylated, preferably non-glycosylated. They can be obtained in recombinant bacterial (e.g., E. coli) systems or in mammalian cells (e.g., CHO).

The following are the most preferred chemically derived MGDF derivatives (in each case they are mono or polypaginated, i.e., for example, contain 2-4 PEG molecules attached via an acyl or alkyl group):
peeled MGDF-11
pegyled MGDF-4
pegyled MGDF-2
In general, the chemical derivatization of MGDF can occur under any suitable conditions for the reaction of the biologically active compound with the activated polymer molecule. Methods for preparing pegyed MGDF typically include the following steps: (a) reacting the MGDF polypeptide and polyethylene glycol (e.g., a reactive ester or PEG aldehyde derivative) under conditions where the MGDF combines with one or more PEG groups, and (b) isolating reaction product (s). In general, the optimal reaction conditions for acylation are determined from case to case based on known parameters and the desired result. For example, the greater the ratio of PEG: protein, the greater the yield (in percent) of the poly-pegylated product.

 Reductive alkylation to produce a substantially homogeneous monopolymer / MGDF protein conjugate typically involves the following steps: (a) reacting a MGDF protein with reactive PEG under reductive alkylation conditions at pH to selectively modify the alpha-amino group to amino terminal portion of MGDF protein; and (b) isolating the reaction product (s).

 In order to obtain a substantially homogeneous monopolymer / MGDF protein conjugate, the conditions of the reductive alkylation reaction should allow selective binding of the water-soluble polymer to the N-terminal portion of the MGDF. Such conditions are usually based on the differences in pKa between the amino groups of lysine and the alpha-amino group in the N-terminal region (pKa is the pH at which 50% of the amino groups are protonated and 50% are not). pH also affects the ratio of polymer to protein used. In general, at a lower pH, an excess of polymer relative to the protein is required (i.e., the smaller the reactive N-terminal alpha-amino groups, the greater the amount of polymer needed to achieve an optimal result). If the pH is higher, a large polymer: protein ratio is not required (more reactive groups are available, so fewer polymer molecules are required). For the purposes of the present invention, the pH is usually 3-9, preferably 3-6.

 Another important aspect is the molecular weight of the polymer. In general, the more pier. the mass of the polymer, the smaller the number of its molecules capable of connecting with the protein. To optimize these parameters, the degree of branching of the polymer should be taken into account. As a rule, with a larger pier. weight (greater degree of branching) higher polymer: protein ratio. For the reactions of the PEG compound with a protein of mol. PEG mass averages about 2 kD - 100 kD (the term "about" corresponds to +/- 1 kD). Preferably, the average mol. the PEG mass was about 5 kD-50 kD, particularly preferably about 12 kD-25 kD. The ratio of water-soluble polymer: MGDF protein is generally 1: 1-100: 1, preferably (for polypegging) 1: 1-20: 1 and (for monopaging) 1: 1-5: 1.

 Using the above conditions, reductive alkylation will allow the polymer to selectively attach to any MGDF protein having an alpha-amino group at the amino-terminal site and facilitate the preparation of a substantially homogeneous monopolymer preparation conjugated to the MGDF protein. The term "MGDF protein conjugated monopolymer" refers to a compound containing PEG protein molecules bound to a single polymer molecule. Such a conjugate will preferably contain a polymer molecule located on the N-terminal site, but not on the side amino groups of lysine. The resulting preparation, preferably, more than 90% consists of a monopolymer conjugated to MGDF protein, and more preferably more than 95%, while there remain molecules that have not reacted (protein molecules with which there was not enough polymer) . The following examples show the preparation of at least 90% of the monopolymer conjugate and protein and 10% of the unreacted protein. Such a conjugate is biologically active.

 To carry out reductive alkylation, the reducing agent must be stable in aqueous solution and preferably have the ability to reduce only Schiff bases formed in the initial stages of reductive alkylation. Preferred reducing agents may be selected from the group consisting of sodium borohydride, sodium cyanoborohydride, dimethylamine borane, trimethylamine borane and pyridinborane. A particularly preferred reducing agent is cyanoborohydride.

 Other parameters of the reaction, such as solvent, reaction time, temperature, etc., as well as the degree of purification of products can be determined from case to case based on published information regarding the preparation of protein derivatives using water-soluble polymers (see. Description links). These reactions are described in more detail in the examples below.

 To obtain a polymer conjugated protein mixture, an acylation and / or alkylation method can be selected, the advantage of the approach described here is that you can prepare a mixture with a given relative monopolymer / protein content. Thus, if necessary, get a mixture of different proteins associated with a different number of polymer molecules (di-, tri-, tetra-, etc.), in combination with a monopolymer / protein conjugate obtained using the methods described here, and this mixture characterized by a given monopolymer / protein conjugate content.

 The following examples disclose a process for the preparation of chemically modified MGDF and MGDF coupled to PEG via acylation or alkylation. Accordingly, other aspects of the invention relate to these compounds.

 In general, many disease states can be corrected by using the claimed MGDF conjugates with a polymer. However, such conjugates may have modified activity, both increased and decreased, as well as other properties compared to unchanged molecules.

 Another aspect of the present invention relates to pharmaceutical compositions based on chemically modified MGDF proteins. Such pharmaceutical compositions may also contain any of the unmodified MGDF proteins.

 As additional studies are conducted, information will appear on suitable doses of these drugs for the treatment of various diseases in different patients, and the average specialist in this field of research, taking into account medical indications, age and general condition of the patient, will be able to choose the appropriate dose. In general, the dose can range from 0.01 μg / kg body weight (based on the weight of the protein without chemical modifications) to 300 μg / kg body weight (calculated in a similar way). The preferred dose, in General, can be from 5 μg / kg of body weight to 100 μg / kg of body weight, a particularly preferred dose of from 10 μg / kg of body weight to 75 μg / kg

 The present invention also relates to a method for producing MGDF polypeptides (MGDF ligand polypeptides) or active fragments thereof. One of the claimed methods involves embedding a cDNA encoding an Mpl ligand polypeptide in an expression vector to obtain an Mpl ligand expression system. Selected host cells are transfected with this vector and cultured. The method of the present invention thus involves culturing suitable cells or a cell line transfected with a DNA sequence encoding or expressing an Mpl ligand polypeptide under the control of known regulatory sequences. Regulatory sequences include fragments of a promoter, terminator, and other suitable sequences that direct / control protein expression in their respective host cells. Then the expression product is isolated and purified from the culture medium (or cells in the case of intracellular expression) by any suitable method known to the person skilled in the art. In addition, the methods described in US Pat. No. 5,272,071 can be used to obtain the claimed polypeptides / polynucleotides.

 Suitable cells or cell lines may be mammalian cells, for example, Chinese hamster ovary (CHO) or 3T3 cells. Methods for selecting suitable host cells, transforming and culturing them, amplifying, screening, isolating and purifying the desired product are known in the art, see, for example, Gething and Sambrook, Nature 293: 620-625 (1981) or Kaufman et al., Mol. Cell. Biol. 5 (7): 1750-1759 (1985) or Howley et al., US Pat. No. 4,419,446. Other suitable mammalian cell lines include monkey cell lines COS-1, COS-7 and CV-1. The following examples use mammalian cells, including primate and rodent cell lines, in particular, transformed cell lines. Normal diploid cells, cell strains obtained in vitro by culturing primary tissues, as well as primary explants can also be used. Cells may be genetically defective by a selective marker or contain a dominantly functioning selective gene. Other suitable mammalian cell lines include (but are not limited to) HeLa, mouse L-929 cells, 3T3 lines obtained from Swiss, Balb / c or NIH mice, as well as BHK or HaK hamster cells.

 Bacterial cells are also suitable host cells for the purposes of the present invention. For example, various strains of E. coli (e.g., HB101, DH5-alfa, DH10 and MC1061) that can be used as host cells are well known to those skilled in biotechnology. In addition, in the implementation of the claimed method, various strains of B. subtilis, Pseudomonas spp., Bacillus spp., Streptomyces spp. and the like.

 For expression of the claimed polypeptides as host cells, various yeast strains known to those skilled in the art can be used. If necessary, for the implementation of the claimed method as host cells, the use of insect cells is possible, see, for example, Miller et al., Genetic Engineering 8: 277-298 (1986) and the references cited in the present description.

 The present invention also relates to recombinant molecules or vectors for use in the method for expressing new Mpl ligand polypeptides. These vectors contain Mpl ligand DNA sequences that alone or in combination with other sequences encode Mpl ligand polypeptides (with or without a signal peptide) as claimed in the present invention, or their active fragments. Alternatively, vectors containing modified sequences as described above are also included in the scope of the invention and are used to prepare Mpl ligand polypeptides. The vector used to carry out the method contains selected regulatory sequences operably linked to the DNA coding sequences obtained according to the present invention, and is capable of directing the expression of such sequences in host cells.

 For expression of proteins in COS cells, the pXM vector is particularly preferred [Y. C. Yang et al., 47: 3-10 (1986)]. Another vector convenient for expression of proteins in mammalian cells, for example, CHO cells, is the vector pEMC2B1. The vectors described herein for expression of proteins in mammalian cells can be obtained by known methods. Vector constituents, for example, replicons, selective marker genes, enhancers, promoters, etc. can be obtained from natural sources or synthesized using known approaches, see, for example, Kaufman et al., J. Mol. Biol. 159: 511-521 (1982); and Kaufman, Proc. Natl. Acad Sci. USA 82: 689-693 (1985). Alternatively, the DNA vector may contain the whole genome or part of the genome of bovine papilloma virus [Lusky et al., 36: 391-401 (1984)] and replicate in cell lines, for example, mouse C127 cells, as a stable episomal element. Transfer of such vectors to the corresponding host cells leads to the expression of Mpl ligand polypeptides in these cells.

 Other suitable vectors for expressing proteins in mammalian, insect, yeast, fungal, and bacterial cells can be used for the purposes of the present invention.

 Painful conditions that need to be corrected using the claimed compositions and methods of their use, in general, are conditions with megakaryocyte / platelet deficiency, or the occurrence of such a deficiency is expected in the future (for example, with planned surgical operations). These conditions usually develop as a result of insufficiency (chronic or transient) of the active Mpl ligand in vivo. The usual name for platelet deficiency is thrombocytopenia, therefore, the claimed compositions and methods of their use relate to the treatment of thrombocytopenia.

 Thrombocytopenia (platelet failure) can be caused by various causes, including chemotherapy, drug therapy, radiation therapy, surgical interventions, accidental blood loss and other diseases. Examples of disease states in which thrombocytopenia is observed and which can be corrected in accordance with the present invention are aplastic anemia, idiopathic thrombocytopenia, metastatic tumors leading to thrombocytopenia, systemic lupus erythematosus, splenomegaly, Fanconi syndrome, vitamin B12 deficiency, acid deficiency, vitamin B12 deficiency May-Hegglin anomaly, Wiskott-Aldrich syndrome and paroxysmal nocturnal hemoglobinuria. In addition, the treatment of AIDS with certain drugs (e.g., AZT) leads to thrombocytopenia. Certain abnormalities in wound healing may also be due to an increase in platelet count.

 With the expected platelet insufficiency, for example as a result of future surgery, the Mpl ligand of the present invention can be used for a period of time from several days to several hours before the need for platelets. In the case of acute conditions, for example, in sudden and large blood loss, the Mpl ligand can be administered together with replacement blood or purified platelets.

 The claimed Mpl ligands can also be used to stimulate certain types of cells other than megakaryocytes, if it is shown that such cells express an Mpl receptor. The conditions associated with cells expressing the Mpl receptor responsible for the stimulation effect by the Mpl ligand are also contemplated within the scope of the present invention.

 MGDF molecules, which by themselves do not exhibit activity in the experiments described herein, may be useful as modulators (for example, stimulants or inhibitors) of in vitro Mpl receptors.

 For the treatment of the above diseases, the claimed polypeptides can be used alone or in combination with other cytokines, a soluble Mpl receptor, hematopoietic factors, interleukins, growth factors or antibodies.

 In accordance with this, another aspect of the present invention is to provide therapeutic compositions for the treatment of these diseases. Such compositions comprise a therapeutically effective amount of an Mpl ligand polypeptide or active fragment thereof in combination with a pharmaceutically acceptable carrier. The carrier may be water for injection, preferably supplemented with other components to prepare solutions that can be administered to mammals. For therapeutic use, the Mpl ligand can be used in the form of a composition containing purified protein conjugated to one or more physiologically acceptable carriers, solvents or diluents. Neutral buffer solution or solution mixed with serum albumin are examples of suitable carriers. Preferably, the product is prepared in lyophilized form using appropriate solvents (e.g. sucrose). Other conventional carriers, diluents or solvents, for example Tris buffer (pH 8.0) and acetate buffer (pH 5.0), which sometimes contain sorbitol, can be used. The claimed compositions can be administered parenterally. Alternatively, the compositions may be administered intravenously or subcutaneously. For systemic use for the purposes of the present invention, therapeutic compositions can be prepared in a pyrogen-free form in the form of an aqueous solution suitable for parenteral administration. Methods for preparing such pharmaceutically acceptable protein solutions in accordance with the required pH, isotonic properties, stability are well known to specialists in this field of research.

 The dosage and mode of administration of the drugs when implementing the method of treating the diseases described above are selected by the practitioner taking into account various factors that change the effect of drugs, such as age, condition of the patient, the nature of his diet, body weight, gender, severity of any infection, time of use, and others clinical factors. In general, about 0.1-1000 μg of Mpl-ligand protein or its fragment per 1 kg of body weight should be used daily.

 The compositions and polypeptides of the present invention can be used alone or in combination with other cytokines, a soluble Mpl receptor, hematopoietic factors, interleukins, growth factors or antibodies for correcting diseases characterized by symptoms, when implementing methods of treatment. different from platelet deficiency. The Mpl ligand is expected to be truly useful in treating certain forms of thrombocytopenia in combination with potent hematopoiesis stimulants such as IL-3 or GM-CSF. In addition, other megakaryocyte stimulation factors, for example, meg-CSF (meg-CSF), stem cell factor (SCF), leukemia inhibiting factor (LIF), oncostatin M (OSM), or others, can be used along with the Mpl ligand. compounds with megakaryocyte-stimulating activity. Additional examples of cytokines or hematopoietic factors for this combination therapy are alpha-IL-1, beta-IL-1, IL-2, IL-3, IL-4, II-5, IL-6, II-11, colony-stimulating factor 1 (CSF-1), GM-CSF, granulocyte colony stimulating factor (G-CSF), EPO, alpha interferon (alpha IFN, IFN), beta IFN or gamma IFN. It may be appropriate to administer simultaneously or sequentially, together with the compounds, a soluble mammalian Mpl receptor, which appears to contribute to the destruction of megakaryocytes with the formation of platelets as soon as megakaryocytes mature. Thus, the introduction of the Mpl ligand (to increase the number of mature megakaryocytes), followed by the use of a soluble Mpl receptor (to inactivate the ligand and destroy the mature megakaryocytes to form platelets), is likely to be really effective for stimulating platelet formation. The doses indicated above can be adjusted depending on what additional components are included in the pharmaceutical composition. The effectiveness of treatment is controlled by appropriate methods. In addition, the claimed new polypeptides are used to produce antibodies. Thus, antibodies that interact with the Mpl ligand obtained according to the present invention and active fragments of these antibodies are included in the scope of the invention. Antibodies can be polyclonal, monoclonal, recombinant, chimeric, single chain and / or bispecific, etc. A fragment of an antibody can be any fragment that interacts with an Mpl ligand, such as Fab, Fab ', etc. Hybridomas obtained by using the Mpl ligand or fragment thereof as an antigen to immunize animals, followed by fusion of animal cells (e.g., spleen cells) with a specific tumor cell line, are also included in the scope of the present invention. As a result of the fusion carried out by known methods, immortal cell lines producing antibodies are obtained. Methods for producing hybridomas and antibodies directed to the whole Mpl ligand polypeptide or its individual regions are also included in the scope of the present invention.

 Antibodies can be used in therapy, for example, to inhibit the binding of an Mpl ligand to a receptor. Antibodies associated with the corresponding label can be used in both in vivo and in vitro diagnostics to detect Mpl ligand in body fluids.

 The following Examples most fully disclose the invention. In addition, they reflect preferred embodiments of the invention without limiting its scope. Standard procedures for performing the experiments described in the Examples below, as well as suitable alternative procedures, are set forth in well-known molecular biology manuals such as Sambrook et al., Molecular Cloning, Second Edition, Cold Spring Harbor Laboratory Press (1987) and Ausubel et al., (Eds), Current Protocols in Molecular Biology, Greene associates / Wiley Interscience, New York (1990).

Example 1. Aplastic plasma of a dog
Heparinized dog aplastic plasma ("ARK9") or normal dog plasma ("NK9") was obtained as described in the following publications, with the difference that the dose to recipients was 450 rad:
1. Mazur.E. and South, C. Exp. Hematol. 13: 1164-1172 (1985).

 2. Arriada, M., South, C., Cohen, J. L., and Mazur, E. M. Blood 69: 486-492 (1987).

 3. Mazur. E., Basilico, D., Newton, J. L., Cohen, J. L., Garland, C., Sohl, P. A., and Narendran, A. Blood 76: 1771-1782 (1990).

Example 2. Determination of human megakaryocytes
APC9 and fractionated APC9 were tested for their ability to stimulate the development of human megakaryocytes from CD34 + progenitor cells. CD34 + cells were obtained from peripheral blood cells as described (Hokom, M.N., Choi.E., Nichol, JL, Hornkohl, A., Arakawa.T., And Hunt, P. Molecular Biology of Haematopoiesis 3: 15- 31.1994), and incubated in a culture medium of the following composition: Dalbecco's medium in the modification of Claims (IMDM; GIBCO, Grand Island, NY) with a 1% glutamine-pennicillin-streptomycin mixture (Irvine Scientific, Santa Ana, CA), 10% heparinized platelet-free human plasma AB. 2-mercaptoethanol (10-4 M), pyruvate (110 μg / ml), cholesterol (7.8 μg / ml), adenosine, guanine, cytidine, uridine, thymidine, 2-deoxycytosine, 2-deoxyadenosine, 2- deoxyguanosine (each 10 μg / ml, Sigma); human recombinant insulin (10 μg / ml); human transferrin (300 μg / ml), soy lipids (1%, Boehringer Mannheim, Indianapolis, IN); human recombinant major fibroblast growth factor (2 ng / ml, Genzyme, Cambridge, MA); human recombinant epidermal growth factor (15 ng / ml), growth factor derived from platelets (10 ng / ml, Amgen, Inc., Thousand Oaks, CA).

CD34 + cells were seeded at a concentration of 200,000 / ml culture medium, in a final volume of 15 μl, in Terazaki plate cells (Vanguard, Inc., Neptune, NJ). Cells were incubated for 8 days in a humid atmosphere with 5% CO ₂ at 37 ^° C, then fixed directly in the plates with 1% glutaraldehyde and incubated with a mixture of monoclonal antibodies (anti-GPIb, anti GPIIb, (Bio design) and anti GPIb ( Dako, Carpinteria, CA) An immune response was detected using a streptavidin-beta-galactosidase system (HistoMark, Kirkegaard and Perry). Megakaryocytes detected as blue colonies were counted on an inverted phase microscope with a magnification of 1000x. per well +/- standard error of determination (SEM) In some cases, the data were presented in “megakaryocytic units / ml”, while the degree to which this test sample induced the development of megakaryocytes was normalized with respect to the positive control used in the experiment — APK9.One unit was determined as the amount of material which led to the formation of the same number of megakaryocytes as 1 μl of the standard APK9. Activity was attributed to the Mpl ligand if it could be blocked with 5-10 μl / ml MPL-X (soluble Mpl receptor).

 APK9 has been shown to contain factor (s) that stimulate the development of human megakaryocytes in this system. CD34 + cells incubated with 10% NK9 for 8 days showed a negligible amount of blue stained megakaryocytes, while the same cells incubated 8 days with 10% APK9 yielded a very large number of stained megakaryocytes.

 Figure 2 shows that increasing concentrations of Mpl-X added to the culture system of human megakaryocytes, to an increasing extent, block the development of megakaryocytes. At concentrations of Mpl-X greater than 5 μg / ml, complete suppression occurs. In this experiment, CD34 + cells were stimulated with 5% APK9. This indicates that the activity interacting with Mpl-X (presumably the Mpl ligand) is necessary for the development of human megakaryocytes and the actual Mpl ligand is present in APK9.

 Other evidence has been obtained that the activity of Mpl ligand necessary for the development of human megakaryocytes is present in APK9. APK9 (135 ml) was diluted 6 times with Isc media and applied to an Mpl-X affinity column. Unbound material was collected and concentrated to its original volume before staging the test. The bound material was eluted with 10 ml of 1 M NaCl, 20% of the collected pool was diafiltered and then concentrated 4 times. CB34 + cells that were incubated in medium without APK9 additives did not give rise to megakaryocytes. Cells incubated with 5% APK9 (the same sample as applied to the column) gave 48 +/- 8 megakaryocytes per cell. Cells incubated with unbound material (at a concentration of 10%) did not form megakaryocytes. Cells incubated with 10% eluate gave a score of 120 +/- 44 megakaryocytes per cell. The activity in the sample applied to the column and the activity in the eluate were almost completely suppressed by 5 μg / ml Mpl-X.

Example 3. Transfection of the mouse or human Mpl receptor into a murine cell line
A. Mpl receptor mouse
The full-length mouse Mpl receptor cDNA was subcloned into an expression vector containing a transcription promoter derived from Moloni mouse sarcoma virus LTR. 5 μg of this construct and 1 μg of the pWLNeo plasmid carrying the selectable marker (Stratagene) were co-electroporated into cells of the IL-3-dependent mouse line (32D, clone 23; Greenberger et al., PNAS 80: 2931-2936 (1983) ) Cells were cultured for five days to recover from electroporation, then transferred to selective medium containing 800 μg / ml Genetecin (G418, Sigma) and 1 ng / ml IL-3. The surviving cells were then divided into two pools of 200,000 cells each and grown for analysis. Six cell populations were tested for surface expression of the Mpl receptor by flow cytofluorimetry (FACS) using polyclonal rabbit antipeptide serum. One of the populations was selected for sorting in the duct using the same serum. Unicellular clones of the original cell line were obtained by growing cells on a medium with 10% APK9 and Genetecin. After selection in the presence of APK9 for 35 days, the cells were maintained by culturing in the presence of 1 ng / ml mouse IL-3. One of the subclones, 1A6.1, was used to carry out the main work.

B. Human Mpl Receptor
Full-length human Mpl receptor sequences (Vigon.l., Et al., PNAS 89: 5640-5644 (1992)) were subcloned into an expression vector containing the transcription promoter of Molony mouse sarcoma virus (the same vector as in the case of the mouse receptor ) Six μg of this construct and 6 μg of amphotropic retroviral packaging construct (Landau, NR, Littman, DR, J. Virology 66: 5110-5113 (1992)) were transfected into three million 293 cells using a CaPO ₄ mammalian cell transfection kit (Stratagene). The same cells were retransfected after 2 days of cultivation and again retransfected after 4 days. One day after the last transfection, 293 cells were cocultured with cells of the IL-3-dependent mouse line (32D, clone 23; Greenberger et al., PNAS 80: 2831-2936 (1983)). After 24 hours of cocultivation, 32D cells were separated and fractionated in a BSA gradient (Path-o-cyte; Miles Inc.). Cells were then grown in the presence of 1 ng / ml mouse IL-3 and selected for their ability to grow in the presence of 20% ARP9. Cells were sorted by flow cytometry (FACS) for surface expression of the receptor using polyclonal rabbit antipeptide serum. These cells were further used in experiments.

Example 4. The definition of Mpl ligand using cells 1A6.1
Cells 1A6.1 were washed from the IL-3 medium present and seeded (1000 cells / 15 μl final volume / well) in Terazaki plates in alpha-MEM medium (Gibco) with 10% fetal calf serum (FCS), Genetecin (800 μg / ml), 1% penicillin-streptomycin (Gibco) in 1: 1 serial dilutions of test samples. After 48 hours of cultivation, the number of viable cells per cell was microscopically determined. Such activity was taken as a unit of activity, which led to the detection of 200 viable cells per cell. Activity was attributed to the Mpl ligand if it was completely suppressed by the inclusion of 5-10 μg / ml Mpl-X in the definition. The activity of the Mpl ligand in averaged units of APK9 was 4400 +/- 539 units / ml of aplastic plasma. Unless specifically indicated, units of Mpl ligand activity were determined in experiments using 1A6.1 cells.

 Determinations with cells transfected with the human Mpl receptor gene (Example 3B) were carried out in exactly the same way as with cells 1A6.1.

Example 5. Mpl-ligand is present in aplastic plasma or serum of mouse, dog, pig and human
Mpl-ligand is present in aplastic plasma or serum of mouse, dog, pig and human (table 2). Plasma was collected from BDF1 mice before irradiation and 12 days after irradiation with a dose of 500 rad. Plasma was checked in the test on cells 1A6.1, and activity of 2000 units / ml was detected, which was almost completely inhibited by Mpl-X (10 μg / ml). The plasma of the irradiated mice was also positive in the test for human megakaryocytes, and its activity was 1833 units / ml. In dogs, plasma was collected before irradiation and 10 days after irradiation at a dose of 450 rad. Plasma was tested in the test on cells 1A6.1 and in the test on human megarikaryocytes. In both determinations, activity was found that was completely inhibited by Mpl-X (10 μg / ml). In pigs, plasma was collected before irradiation and 10 days after irradiation (650 rad). Plasma was tested in a test on cells 1A6.1 and a test on human megakaryocytes. In both determinations, ligand activity (suppressed by Mpl-X at a concentration of 10 μg / ml) was found, comparable to that found in dog aplastic plasma. Serums were also obtained from aplastic patients. This material was obtained from patients undergoing bone marrow transplantation. The sera of six patients were tested in the test on cells 1A6.1 and activity of 903 U / ml was detected, 88% of which was due to the Mpl ligand (10 μg / ml Mpl-X was suppressed). Sera from 14 plastic patients were also tested in the human megakaryocyte assay. Altogether, they showed significant activity, 941 U / ml, which was completely suppressed by 10 μg / ml Mpl-X. Data obtained using murine IL-3 are included to show the specificity of the test on cells 1A6.1. Although this recombinant cytokine induces the growth of this cell line, its activity is not blocked by 10 μg / ml Mpl-X.

Example 6. Mpl-ligand stimulates the growth of cells 1A6.1 and the development of human megakaryocytes
The Mpl ligand (enriched at least 100,000 times after pectin and affinity chromatography; see Example 7) stimulates the growth of 1A6.1 cells and the development of human megakaryocytes from 34+ peripheral blood cells depending on the dose. The activity is due precisely to the Mpl ligand, since, as shown in FIGS. 2 and 3, this activity in both definitions can be completely blocked by Mpl-X.

 Applicants have also shown that peripheral blood cells fractionated by flow cytometry (FACS) 34+ when incubated with an Mpl ligand (in this case, 100 units / ml for 9 days) develop into phenotypically normal, mature megakaryocytes. Thus, it was shown that the purified Mpl ligand has the same effect on megakaryocytes as the crude APK9. In addition, purified CD34 + cells (100% CD34 +) were used in this experiment, but not enriched ones, in which the proportion of CD34 + cells is usually 30-50%.

Example 7. Purification of Mpl-ligand dogs
1. Summary
Proteins (25 kD and 31 kD) were purified that showed activity attributed to the Mpl receptor ligand. Proteins were isolated from the plasma of irradiated dogs according to the scheme, including affinity chromatography on wheat germ agglutinin (WGA), affinity chromatography on Mpl receptor, anion exchange chromatography, gel filtration chromatography, and reverse phase CLC HP4, see Fig. 46, which presents this cleaning scheme.

 Mpl ligands with a molecular weight of 25 kDa and 31 kDa were purified essentially homogeneity and it was shown that they consist of the amino acid sequences described in the present invention.

II. Methods
A. Plasma clarification
Frozen plasma (about 20 liters in total) obtained from irradiated dogs (see Example 1) was thawed overnight at 4 ^° C; plasma thawing in large bottles was carried out at room temperature for several hours, and then in a cold room. Insoluble material was removed by centrifugation for 6 hours at 11,000 g. Plasma was diluted with phosphate buffered saline, pH 7.3, containing 0.01% sodium azide (PBS / azide), and filtered through a 1.2 μm filter. The clarification procedure usually led to a double dilution of the starting material.

B. Wheat Germ Agglutinin Affinity Chromatography
All operations were carried out at 4 ^° C. The clarified plasma (two batches) was applied to a column with immobilized agglutinin of wheat germ (1 liter, 10 x 12 cm, EY Laboratories), equilibrated with PBS / azide. After applying the sample, unbound material was washed from the PBS / azide column and the column was washed with 0.5 M NaCl in 20 mM TrisHCl, pH 8. The activity of the Mpl ligand bound to the WGA column was eluted with 0.35 M N-acetylglucosamine (GleNAc), 0.5 M NaCl, 20 mM Tris-HCl, pH 8. No Mpl ligand activity was detected in flow or wash fractions.

B. Affinity Chromatography on the Mpl-X Receptor
The soluble murine Mpl receptor (Mpl-X) used corresponded to the whole extracellular domain of the Mpl receptor minus Trp at position 483 (see Vigon, et al., 8: 2607-2615 (1993)). To optimize the binding of the Mpl ligand to the Mpl-X receptor on an affinity column, the material eluted from the WGA column was concentrated using an ultrafilter membrane (cut-off threshold for molecular weight 10,000, YM-10, Amicon) and the NaCl concentration was adjusted to 0.2 M followed by breeding. The concentrated material from the WGA column was applied to a 20 ml column with m-Mpl-X (soluble murine Mpl-X receptor) / cyanogen bromide-activated Sepharose (2.6 x 4.2 cm, 1.5 mg m-Npl-X per ml of resin) at a flow rate of 0.9 ml / min. The column was washed with PBS / azide at a flow rate of 1.5 ml / min and then with high salt buffer (405 ml) consisting of 10 mM Tris-HCl, 1 M NaCl, 1 mM CHAPS, pH 8.0. The bound Mpl ligand was eluted from the column with a buffer of the following composition: 20 mM CAPS, 1 M NaCl, 5 mM CHAPS, pH 10.5. The appropriate fractions were collected. To neutralize the pH, Tris was added to each fraction.

 SDS-PAGE and absorbance at 280 nm showed the presence of an early protein peak in fractions 1-4 in the elution profile of the affinity column with the Mpl-X receptor in fractions 1-4, while the main activity of the Mpl ligand eluted after fraction 5.

G. Mono-Q Anion Exchange Chromatography
The most purified fractions from several affinity columns with the Mpl-X receptor were combined, concentrated and dialyzed against 20 mM Tris-HCl, 5 mM CHAPS, pH 8.7, to a final volume of 58.5 ml. The protein concentration in the mixture was evaluated by absorbance at 280 nm, and it was 0.12 mg / ml (approximately 7 mg of total protein). The mixture was applied at a flow rate of 0.5 ml / min to a Mono-Q HR 5/5 column (Pharmacia), equilibrated with 20 mM Tris-HCl, 5 mM CHAPS, pH 8.7. Elution was carried out by a linear gradient to 0.36 M NaCl in the same buffer for 27 minutes. The column was then washed with a gradient of up to 0.54 m NaCl for 6 minutes, and a final wash was performed with 0.9 M NaCl. 1 ml fractions were collected.

 The elution profile from the Mono-Q column showed that the flow and wash fractions did not contain the Mpl ligand and generally no significant amount of protein. Significant activity of the Mpl ligand was eluted in fractions 5-7 at the initial stages of the NaCl gradient. The "shoulder" of activity was observed in fractions 8-10, followed by the main peak, represented by fractions 11-15. In the active fractions, there was a clear band of 25 kD (SDS-PAGE under non-reducing conditions). The band intensity directly corresponded to the activity of the Mpl ligand in fractions. This band was absent in fractions 3 and 4 (no activity). It was expressed in fractions 5 and 6 (peak activity in tests on cells 1A6.1) and similarly, an intensively stained band was present in fractions 11-14 (peak activity in tests on cells 1A6.1). The band was weak in the combined fractions 15 and 16, which corresponded to a significantly lower activity of fraction 16.

D. Gel Elution Experiments
Gel elution experiments were carried out with aliquots of Mono Q fractions 5 and 6 or 13 and 14. In these experiments, mixtures of fractions 5 and 6 (6 μl each) or 13 and 14 (7.5 μl each) were prepared, mixed with buffer for applying samples to SDS-PAGE and applied to 12% SDS-gels. Upon completion of electrophoresis, bands of interest (1 mm) were cut and cut into small pieces with a razor blade. Pieces of gel were transferred to 1.5 ml centrifuge tubes containing 0.5 ml PBS / 5 mM CHAPS and gently mixed at 4 ^° C. overnight. The next day, the samples were centrifuged, aliquots were taken, and the samples were diafiltered against Iskov medium supplemented with BSA as a carrier protein. Diafiltered samples were used for further determinations.

 The results show the presence of two peaks in the activity of the Mpl ligand. One peak corresponds to a gel region of 25 kD, and another peak of Mpl ligand activity corresponds to a region of 31 kD.

E. Gel Filtration on Superdex 200
Fractions 13-16 from the Mono Q anion exchange column and two equivalent fractions of the second fractionation on Mono Q were combined and concentrated using a membrane ultrafilter (Centricon-10, Amicon). Sodium dodecyl sulfate (SDS) was added to a final concentration of 0.1% and the sample was applied to a Superdex 200 HR 10/30 column (Pharmacia). The column was equilibrated with 50 MMTris, 0.1% SDS, pH 7.5 at a flow rate of 0.3 ml / min and room temperature. Fractions were collected every minute. Most of the protein contained in the sample eluted in fractions 32–40, while Mpl ligand activity was detected in fractions 42–46. Fraction analysis by SDS-PAGE showed the presence of a clear 25 kD band in the active fractions.

G. C4 reverse phase high-resolution chromatography
Fractions 43-46 from a Superdex 200 column were combined with fraction 42 and concentrated using a membrane ultrafilter (Microcon, Amicon). The concentrated mixture was applied to a 1 x 100 mm C4 reverse phase column (SynChropack RP-4). The column was equilibrated with a solution of 0.04% TFA in water (buffer A); buffer B had the following composition: 0.035% TFA in 80% acetonitrile. After application of the sample, a linear gradient of buffer B to 45% was carried out for 4 minutes. A linear gradient followed to 75% of buffer B over 40 minutes. The flow rate was set to 75 μl / min. The results of the purification of fraction 42 are shown in FIG. 5. Explicit peaks of Mpl ligand activity were observed in fractions 21-23. These fractions were analyzed by electrophoresis in a 14% polyacrylamide gel under reducing and non-reducing conditions. Fraction 21 consisted of a single band of 31 kD; fraction 23 consisted of a single wide band of 25 kD; and fraction 22 contained both bands — 25 kD and 31 kD. No other significant bands were visible. It is noteworthy that preliminary experiments on elution from the gel gave reason to associate the activity of the Mpl ligand with precisely these two molecular weight regions. The only high molecular weight minor band was observed in all fractions in non-reducing gels, but could not be found in reducing gels.

H. Analysis of N-terminal sequences of 25 kDa and 31 kDa Mpl ligands
N-terminal sequence analysis was performed on activity-containing fractions of C4 RP-HPLC. The established sequences of these proteins are given above. In addition to the main sequence corresponding to the 25 kD band (at least 90% of the sample used), sequencing detected two minor sequences that were associated with the minor additional band described previously in section “Z”. Comparison with known sequences showed that the minor sequences are the dog’s immunoglobulin heavy chain and kappa chain. If necessary, these minor contaminants can be removed by an additional purification step, preferably by additional gel filtration.

I. Comparison of the activity of Mpl ligand from purified fractions of C4
The data presented in FIG. 6 shows that the activities present in fractions 22 and 23 of C4 RP-HPLC chromatography are substantially equivalent. Fraction 22 contains a mixture of 25 kD and 31 kD bands, while fraction 23 contains only a 25 kD band. Aliquots of each fraction were diluted 1: 45000. The diluted fractions almost equally stimulated the growth of 1A6.1 cells (fraction 22 - 5400 cells per cell, fraction 23 - 6000 cells per cell). The diluted fractions were incubated with increasing concentrations of Mpl-X. Fractions were equally sensitive to inhibition of Mpl-X, the activity of both fractions was completely blocked by Mpl-X at a concentration of 7-1.4 μg / ml. This serves as an indication that the active protein (s) of each fraction are varieties of the Mpl ligand with the same biological activity.

Example 8. Comparison of the action of Mpl-ligand on the development of megakaryocytes with the action of other factors
A number of recombinant factors and organic compounds, such as phorbol-myristyl acetate (PMA), have been shown to influence the growth and development of megakaryocytes. The effects of these factors on CD34-positive peripheral blood cells were studied. Recombinant human interleukin 3 (IL-3, 1 ng / ml), stem cell growth factor (SCF, 50 ng / ml), Interleukin 6 (IL-6, 25 ng / ml), erythropoietin (EPO, 1 unit / ml) leukemia inhibition factor (LIF, 10 ng / ml) and granulocyte-phacrophage colony stimulating factor (GM-CSF, 25 ng / ml, Amgen, Inc.); interleukin 11 (IL-11, 25 ng / ml, R + D Systems, minneapolis, MN); phorbol myristyl acetate (PMA, 10 ^-10 M, Sigma) were added to
crops as indicated. Mpl ligand was used at a concentration of 275 units per ml, APK9 was used at a concentration of 5% (equivalent to 220 units / ml). When using factors in combination, their concentration was equal to that of individual use. After 8 days of cultivation, the cells were fixed in the cells and stained for megakaryocytes (n = 6 cells for each variant) or the total number of cells (n = 3 cells for each variant) was counted. Data are represented by an average of +/- standard error.

 7 shows that APK9 and Mpl ligand led to the formation of the largest number of megakaryocytes per cell. IL-3 also led to the development of megakaryocytes, especially in combination with SCF, IL-6, IL-11 or EPO had a negligible effect on the number of megakaryocytes formed upon individual exposure or in combination with IL-3. PMA, LIF, and GM-CSF had little effect. In FIG. Figure 8 shows the data from the same experiment, showing the total number of cells in the cells ("cellularity"). APR9 and Mpl ligand slightly changed this indicator, and II-3 and SCF showed moderate effects. The combination of SCF and IL-3 had the strongest effect. The data shown in Fig.7 and Fig.8 were used to calculate the percentage of megakaryocytes per cell, as shown in Fig.9. Obviously, the factor leading to the formation of the highest percentage of megakaryocytes per cell is the Mpl ligand, the active component of APK9. This indicates the specificity of the Mpl ligand with respect to megakaryocytes.

Example 9. Megakaryocyte-stimulating activity of Mpl-ligand is not dependent on human IL-3
Mpl-ligand stimulates the development of human megakaryocytes when it is added to the culture medium, as described in Example 2. Although IL-3 is not a component of the culture medium, it can be present in undetectably small amounts in normal human plasma, which is part of the medium. However, if IL-3 is present, it is not involved in megakaryopoiesis due to the Mpl ligand. This can be seen from figure 10. IL-3 at a concentration of 2 ng / ml has an activity in the test for human megakaryocytes equal to 14,900 megakaryocytic units / ml. This activity is 97% inhibited by anti-IL-3 (3.3 μg / ml; Genzyme, Cambridge, MA). Mpl ligand at a concentration of 8203 megakaryocytic units / ml was not suppressed by anti-IL-3.

Example 10. Analysis of Mpl-pig ligand
1. Summary
Proteins from irradiated pig plasma with Mpl ligand activity were characterized by WGA affinity chromatography, Mpl receptor affinity chromatography, ion exchange chromatography, and reverse phase C4 chromatography (HPLC). Activity was also characterized by elution from sections of SDS-polyacrylamide gel (see Table A).

Example 11. Cloning of human Mpl ligand (human MGDF)
The following are two approaches used:
1. The first example of cloning
A. Obtaining a sample of human MGDF
A number of degenerative PCR primers were designed based on the amino terminus of a dog protein. For amplification of the MGDF gene from human genomic DNA, different pairs of primers were used. After 40 amplification cycles using 5 ′ GCN CCN CCN CCN HCN TGY GA 3 ′ sense primers (SEQ ID N0: 4) encoding the first five amino acids of the dog protein (SEQ ID N0: 1) and antisense primer: 5 ′ GCA RTG YAA CAC RTG NGA RTC 3 '(SEQ ID N0: 5), encoding amino acids 16 through 21 of the sequence SEQ ID N0: 1, the PCR product was gel dispersed in 2.0% agarose in TBE buffer. The band corresponding to the fragment of 63 base pairs was cut from the gel and reamplified with the same set of primers. The PCR product was cloned into PCR II vector (Invitrogen, San Diego). A number of colonies were screened by DNA sequencing. Plasmid DNA encoding a peptide similar to a dog MGDF protein was used to obtain a radioactive sample in a subsequent screening of cDNA libraries. The amino acid sequence encoded by the gene fragment was as follows: Ala-Pro-Pro-Ala-Cys-Asp-Leu-Arg-Val-Leu-Ser-Lys-Leu-Leu-Arg-Asp-Ser-His-Val-Leu- His (SEQ ID N0: 6).

A fragment of an agarose gel containing human MGDF was used to obtain the sample by hot PCR. A typical 100 μl PCR reaction mixture contained the following components:
Matrix DNA - 2-3 μl
5 'Primer (SEQ ID N0: 4) - 1 μl, 20 pM
3'Primer (SEQ ID N0: 5) - 1 μl, 20 pM
10 x buffer - 10 μl
dATP (0.1 mM) - 2 μl
dTTP (10 mM) - 2 μl
dGTP (10 mM) - 2 μl
dCTP (0.1 mM) - 2 μl
dCTP, P32 (10 μCi / μl) - 5 μl
dATP, P32 (10 μCi / μl) - 5 μl
Taq DNA polymerase - 0.5 μl, 2.5 units
Water - 77 μl
Total volume - 100 μl
The amplification conditions were as follows: initial heating 94 ^o C, 2 min; annealing - 53 ^o C, 30 sec; building up - 72 ^o C, 30 sec; denaturation - 94 ^o C, 30 sec.

 40 amplification cycles were performed on a Perkin Elmer GeneAmp System 9600 instrument.

 The product was purified on a column (push column) (Stratagene, San Diego). A 1 μl sample was counted in a scintillation counter. Those samples containing 1-3 million pulses per ml were added to the hybridization mixture.

B. Construction of an embryonic liver library
PolyA + PHK of human embryonic liver was purchased from Clontech laboratories. About 4 μg of PHK was used for cDNA synthesis in which a random hexamer, 5 'GTA CGC GTT STA GAN NNN NNT 3' (SEQ ID N0: 7), connected to an oligonucleotide containing the Xba 1 restriction site, was used for priming.

 Gibco-BRL protocol was used to prepare double stranded cDNA. The Eco RI-Bstxl adapter (Invitrogen, San Diego) was ligated with double stranded cDNA and then was digested with Xba 1.

 Size cDNA was selected on an S500 Sephacryl column (Life Technologies, Inc.). CDNA molecules having a size of more than 400 base pairs were ligated with the expression vector for mammalian cells v19.8 (Martin, F., Cell 63: 203-211 (1990)), previously restricted with EcoRI and Xba 1. The competent cells 1E were transformed. .coli ODH10 and the resulting library were divided into 7 pools of 100,000 cDNA clones each.

B. Screening of the library in the lambda phage
A human embryonic liver library in the gt11 lambda phage with a titer of 650 million plaque forming units / ml was purchased from Clontech. About 2 million plaques were screened with a sample obtained by PCR (see above). Hybridization was carried out for 15 hours at 56 ^o C in 6 x SSC, 5x Denhardt's solution, 0.1% SDS, 100 μg / ml single-stranded salmon sperm DNA.

 Conducted numerous rounds of screening. DNA from single plaques was amplified and, to identify truly positive plaques, this DNA was hybridized with an internal primer 5 ′ AGT TTA CTG AGG ACT CGG AGG 3 ′ (SEQ ID N0: 8) encoding amino acids 7 through 13 of SEQ ID N0 : 6.

D. 3'-Primed Fast Amplification of cDNA Ends (RACE)
Polyadenylated RNA from the human embryonic kidney and human embryonic liver was purchased from Clonetech. One microgram of PHK was reverse transcribed using a 5 ′ TTC GGC CGG ATA GGC CTT TTT TTT TTT TTT 3 ′ oligonucleotide as a primer (SEQ ID N0: 9).

Gibco-BRL cDNA synthesis kit (Life Technologies, Inc. Cat. # 18267-013) was used to prepare the first cDNA strand. The total volume was 30 μl. The reaction was stopped by adding 500 mm EDTA to a final concentration of 10 mm and the mixture was frozen at -20 ^o C.

To start, PCR was used as a matrix of 0.5 μl of cDNA. Primer SEQ ID N0: 9 and competitive oligonucleotide 5 'TTC GGC CGG ATA GGC CTT TTT TTT TTT TT-P 3' (SEQ ID N0: 10) was used as antisense primers, whereas oligonucleotide 5 'TGC GAC CTC CGA GTC CTC AD 3 '(SEQ ID N0: 11) encoding amino acids 5 through 11 of SEQ ID N0: 6 was used as a sense primer. Forty cycles of amplification were carried out according to the following protocol: 94 ^o C, 30 sec; 65 ^o C, 30 sec; 72 ^o C, 30 sec; after an initial 2-minute incubation at 94 ^° C. A Perkin Elmer GeneAmp System 9600 instrument was used for amplification.

Fixation ("nesting") was carried out using the 5 ′ GAG TCC TCA GTA AAC TGC TTC GT 3 ′ sense primer (SEQ ID N0: 12) encoding amino acids 8 through 14 of SEQ ID N0: 6, while that the sequences SEQ ID N0: 9 and SEQ ID N0: 10 served as antisense primers. Forty cycles of amplification were carried out with annealing at 65 ^o C. The PCR products were fractionated by electrophoresis in 0.8% agarose gel and photographed in ultraviolet. Stripes were visible in the region of 0.8 - 1.2 kilobases.

 Then, PCR products were cloned into PCR II vector (Invitrogen). Individual colonies were selected and plasmids were isolated using Qiagen kits (Cat. # 12143 and 12145). Two-stranded sequencing was performed using vector primers. The sequences were analyzed using various types of GCG software.

D. Extension of the DNA chain using 3 'and 5'-primers
To obtain the sequence of the full-sized MGDF gene, the DNA strand was extended using 3'- and 5'-primers using different libraries of embryonic liver libraries as matrices. For amplification of the 5'-primer, cDNA was used as a template about 20 ng of cDNA from each pool. Used MGDF-specific antisense primer 5 'GGA GTC ACG AAG CAG TT AC 3' (SEQ ID N0: 13), encoding amino acids 12 through 17 of SEQ ID N0: 6, and 5 'vector v19.8 sense primer 5 'CCT TTA CTT STA GGC CTG 3''(SEQ ID N0: 14). Amplification was carried out for 30 cycles with annealing at 53 ^o C. Fixation was carried out for 30 cycles with the antisense primer 5 'GAG GTC ACA AGC AGG AGG A 3' (SEQ ID N0: 15) (encodes amino acids 1 through 6 sequence SEQ ID N0: 6) and vector primer SEQ ID N0: 14.

To grow the chain from the 3 'ends of the MGDF cDNA, the 5' GGC ATA GTC CGG GAC GTC G 3 'antisense vector primer (SEQ ID N0: 16) and the MGDF-specific primer 5' TTC TCC TGC TTG TGA CCT C 3 '(SEQ ID N0: 17) encoding amino acids 1 through 6 of SEQ ID N0: 6. Amplification was carried out for 30 cycles with annealing at 58 ^o C.

 Amplification of fusion ("nesting amplification") was carried out for 30 cycles using MGDF primer SEQ ID N0: 12 and vector primer SEQ ID N0: 16. Specific bands were found in pools 1, 7 and 8, which were then cloned into the PCR vector II. Plasmid DNA from individual colonies was purified and sequenced.

E. Isolation of full-sized human MGDF clones
Many of the original clones lost part of the amino end of MGDF, as part of the MGDF sequence was used for priming and binding. Primer 5 'CCA GGA AGG ATT CAG GGG A 3' (SEQ ID N0: 18), the sequence of which was obtained in experiments on the extension of the 5'-primer, as described above, was used as a sense primer. Vector primer SEQ ID N0: 16 served as an antisense primer. 35 cycles of amplification were performed with annealing at 58 ^° C. MGDF-specific primer 5 'CAA CAA TGC GAC CGC CAG CCA GAC ACC CCG 3' (SEQ ID N0: 19) containing the Sal 1 restriction site and vector primer (SEQ ID N0 : 15) used for fixing ("nesting") for 35 cycles. The PCR product was cloned into PCR II vector and sequenced.

II. The second example of cloning
A. Cloning of the N-terminal dog MGDF cDNA
Degenerated oligonucleotide primers were designed based on the N-terminal amino acid sequence of the dog MGDF described in the previous sections. These primers were used in the polymerase chain reaction (PCR) to amplify cDNA sequences encoding MGDF.

Total PHK was isolated from dog kidney samples by the guanidine-isothiocyanate method according to Chomzynski and Sacchi (Biochem. 162: 156-159 (1987)). The first cDNA strand was prepared with a 5 ′ GGC CGG ATA GGC CAC TCN NNN NNT 3 ′ random primer adapter (SEQ ID N0: 20) using Mo-MuLV reverse transcriptase and was used as a template in subsequent polymerase chain reactions. PCR was performed in a volume of 0.5 μl with ~ 50 ng of cDNA using primer A 5 ′ GCN CCN CCN GCN TGY GA 3 ′ (SEQ ID N0: 4), sense strand primer encoding amino acids 1-6 of the sequence SEQ ID N0: 1, as well as primer B 5 'GCA RTG NAG NAC RTG NGA RTC 3' (SEQ ID N0: 5) or primer C 5 'GCA RTG YAA NAC RTG NGA RTC 3' (SEQ ID N0: 21), which are primers antisense chains encoding amino acids 16-21 of the sequence SEQ ID N0: 1, with three additional nucleotides at the 5'-end to increase stability during hybridization. PCR with Taq polymerase was performed for 35-45 cycles until the product bands became clearly distinguishable by agarose gel electrophoresis. For the first two cycles of PCR, annealing was performed at 37 ^° C for two minutes; for subsequent cycles of PCR, annealing was performed at 50 ^° C for one minute. In each reaction, multiple product bands were observed. Gel fragments containing bands of the expected size (66 base pairs) were removed using a Pasteur pipette and reamplified with the same pair of primers. DNA products were cloned into PCR II vector (Invitrogen) according to the manufacturer's recommendations. Three clones were sequenced and it was shown that they encode the expected MGDF sequences of the dog, residues 1-21, in a single reading frame. Thus, a unique dog MGDF cDNA was obtained, representing the region from the third nucleotide of codon 6 to the third nucleotide of codon 15. One of these clones served as a template for obtaining labeled dog MGDF cDNA samples.

B. Construction of cDNA library from human embryonic liver
PHK was isolated from the human embryonic liver (International Institute for the Advancement of Medicine, Exton, PA) by tissue lysis in 5.5 M guanidine isothiocyanate and purification by centrifugation in CsTFA (Pharmacia). Polyadenylated PHK was prepared using oligo (dT) 25 dynabids (Dynal, as directed by the manufacturer). A double-stranded cDNA was obtained from the indicated PHK using a Superscript plasmid system for cDNA synthesis (Life Technologies, Inc.) with the only exception consisting in the use of an excellent adapter: 5 'TTG GTG TGC ACT TGT G 3' (SEQ ID N0: 22) and 5 'CAC AAG TGC ACA ACC CC 3' (SEQ ID N0: 23). After selection by size, this cDNA was directionally inserted at the Bst XI NotI sites into a vector for expression in mammalian cells pBCB (pBCB was obtained on the basis of the plasmid Rc / CMV, Invitrogen, consisting of the pUC19 skeleton, CMV promoter, and BGH polyadenylation site). The ligated DNA was introduced by electroporation into cells of the electrocompetent bacterial strain 10B (Life Technologies, Inc.).

B. Screening for MGDF cDNA library of human embryonic liver
A library of human embryonic liver, fixed as filter replicas, was hybridized with the radioactive PCR product of MGDF N-terminus cDNA (5x SSPE, 2x Denhardt solution, 0.05% sodium pyrophosphate, 0.5% SDS, 100 μg / ml yeast lysate tRNA and 100 μg / ml denatured salmon sperm DNA) at 64 ^° C for 18 hours. Filters were washed at 64 ^° C. in 5x SSPE, 0.5% SDS and exposed with x-ray film overnight. Two different clones hybridizing with this sample were isolated and analyzed.

D. Expression of human MGDF cDNA clones
The purified DNA of cDNA clones of MGDF was transfected with EBNA line 293 (Invitrogen). 1.5 μg of DNA was mixed with 7.5 μl of Lipofectamine (Life Technologies, Inc.) in 100 μl of serum-free DMEM. After 20 minutes of incubation at room temperature, the DNA-Lipofectamine mixture was added to 5 x 10 ⁵ cells / well (24-well Greiner plates) in 400 μl of DMEM, 1% serum (Fetal Clone II) and incubated at 37 ^° C. for 6 hours. Then, 500 μl of DMEM with 20% serum (Fetal Clone II) was added to the cells. After 72 hours, the conditioned medium was collected and centrifuged through a 0.22 micron centrifuge filter. The conditioned medium was tested for the biological activity of MGDF.

III. Description and activity of human MGDF clones
Using the cloning strategy described above, human cDNA clones were obtained as shown in FIG. 11 (MGDF-1 and MGDF-2; SEQ ID NOS: 24, 25 and 26, 27) and FIG. 12 (MGDF-3: SEQ ID NOS : 28, 29). Each of the sequences shown in the drawings contains a signal sequence of amino acids 1-21, so that in each case, the mature protein begins with amino acid 22.

 The results of determining the activity using the cell tests described in Example 4A are shown in Tables 3 and 4 below. In Table 3, the conditioned medium of 293 cells transfected with each construct was collected after two days of cultivation and tested in the test on cells 1A6.1 (32D / mur -MPL +) +/- 10 μg / ml mur-MPL-X. In Table 4, the conditioned medium of 293 cells transfected with each of the constructs was collected after four days of cultivation and tested in the test on 32D / mur-MPL + cells (Example 3A) and 32D / hu-MPL + cells (Example 3B). As can be seen from these data, human MGDF-1 and MGDF-2, but not MGDF-3, are active against cell lines expressing human and mouse Mpl. A cell line expressing a human Mpl receptor is more sensitive to human MGDF-1 and MGDF-2 than a cell line expressing a mouse Mpl receptor.

 From the results presented in Table 5, it can be seen that the activity of human MGDF-1 and MGDF-2 in relation to 32D / hu-MPL + cells (Example 3B) is almost completely suppressed by the soluble human mpl receptor (hu-MPL-X). Hu-MPL-X is present in the conditioned medium of CHO cells producing this protein. This conditioned medium was concentrated 120 times and then added to the cultures to a concentration of 6.6%. The conditioned medium of the CHO control cells showed no effect in this definition. The determination was carried out as described in Example 4B with the exception that viable cells were determined after three days of cultivation.

Determination of human megakaryocytes
MGDF-1 and MGDF-2, but not MGDF-3, induced the formation of megakaryocytes from CD34-positive peripheral blood cells. The experiment shown in Table 6 was carried out as described in Example 2 with the exception that CD34-positive peripheral blood cells were selected without elution and the culture was used after seven days of growth. The conditioned medium from each 293 EBNA MGDF construct was used at a final concentration of 20% +/- 30 μg / ml mur-MPL-X. Control plasma APK9 was used at a final concentration of 6%.

 Example 12

 This example describes the synthesis of 12 different pegyated MGDF molecules, namely, PEG9 - PEG12 and PEG14 - PEG21. In each case, the MGDF molecule that was coupled to the PEG was MGDF-11 obtained by E. coli (amino acids 22-184, numbered from the start of the signal peptide, or amino acids 1-63, numbered from the start of the mature peptide). Details of all pegylated compounds are given below in tables 7-10.

12.1. Obtaining poly-MePEG-MGDF by acylation of MGDF with activated MePEG derivatives
Obtaining poly-MePEG (20 kD) - MGDF conjugate (PEG11)
A cooled (4 ^° C) solution of MGDF (2.5 mg / ml) in 0.1 M BICINE buffer, pH 8, was added to a 10-fold molar excess of solid MePEG succinimidyl propionate (molar mass 20 kD) (Shearwater Polymers, Inc .). The polymer is dissolved with gentle stirring, and then the reaction is carried out at room temperature.

 The degree of protein modification during the reaction is controlled by HPLC, taking into account the size of the molecules (size exclusion SEC), using a Superdex 200 HR 10/30 column (Pharmacia Biotech). Elution is carried out with 0.1 M sodium phosphate buffer at pH 6.9 and a flow rate of 0.7 ml / min.

 Examination of the reaction mixture by SEC HPLC after 30 minutes shows that no free protein remains in it. At this time point, the protein concentration in the reaction mixture is reduced to 1 mg / ml by adding sterile water, and the pH of the mixture is adjusted to 4 with a few drops of 0.5 M acetic acid.

 The MePEG-MGDF conjugate is separated from the excess MGDF and other reaction byproducts by ion exchange chromatography using SP Sepharose HP (Pharmacia Biotech) as the ion exchange resin.

 The reaction mixture was applied to a column (2.5 mg / ml ion exchange resin) and the unreacted MePEG was eluted with start buffer A (3 column volumes, 20 mM sodium phosphate, pH 7.2, 15% glycerol). The MePEG-MGDF conjugate was then eluted using a linear gradient (0% to 30%) of final buffer B (10 column volumes) (1 M NaCl in buffer A). The eluate was examined at 280 nm. Fractions containing polyMePEG-MGDF conjugate were combined, concentrated and filtered sterilized.

 Purified poly-MePEG-MGDF conjugate was analyzed by HPLC SEC using TSK-GEL 64000SWXL and 62000SWXL gel filtration columns combined in series. Proteins are detected by ultraviolet absorption at 280 nm. BIO-RAD gel filtration standards are used as markers of the molecular weight of globular proteins.

 As can be seen in figa, using SEC HPLC in the preparation revealed two main components (in an approximate ratio of 2 to 1), and their points of elution correspond to globular proteins mol. masses of 370.9 kD and 155.0 kD, respectively (see also Table 8 below).

 Conjugates of PEG9, PEG10 and PEG12 Obtained by Acylation of MGDF with Succinimidated Esters of MePEGs mol. masses of 6-50 kD, are investigated in a similar way. The main parameters of the reactions used to obtain the corresponding drugs are shown in Table 7.

 The results of studies of the obtained conjugates using SEC HPLC are shown in Table 8.

12.2 Preparation of poly-MePEG-MGDF conjugates by alkylation of MGDF with MePEG aldehydes under reducing conditions
Obtaining poly-MePEG (20 kD) -MGDF conjugate (PEG20)
To a cooled (4 ^° C), mixed solution of MGDF (2 ml, 2.5 mg / ml) in 100 mM sodium phosphate, pH 5, containing 20 mM NaCNBH ₃ , a 10-fold molar excess of monomethoxy-polyethylene glycol aldehyde (MePEG) was added. (average mol. mass of 20 kD), and stirring of the reaction mixture was continued at the same temperature.

 The degree of protein modification during the reaction is monitored by SEC HPLC using a Superdex HR 10/30 column (Pharmacia Biotech). Elution is carried out with 0.1 M sodium phosphate buffer at pH 6.9 and a flow rate of 0.7 ml / min.

 After 16 hours, SEC HPLC analysis of the reaction mixture showed that more than 90% of the initial amount of protein was modified. At this time, the protein concentration in the reaction mixture was set to 1 mg / ml, diluting it with sterile water, and the pH was adjusted to 4 by adding 0.5 M acetic acid.

 MePEG-MGDF conjugate is separated from excess MePEG and other reaction by-products by ion exchange chromatography using SP Sepharose HP (Pharmacia Biotech) as the ion exchange resin.

 The reaction mixture was applied to a column (2.5 mg / ml resin), and the unreacted MePEG was eluted with start buffer A (3 column volumes, 20 mM sodium phosphate, pH 7.2, 15% glycerol). Then, the MePEG-MGDF conjugate was eluted using a linear gradient (0% to 30%) of final buffer B (10 column volumes) (1 M NaCl in buffer A). The eluate was examined at 280 nm. Fractions containing poly-MePEG-MGDF conjugate were combined, concentrated and filtered sterilized.

 Purified poly-MePEG-MGDF conjugate was analyzed by HPLC SEC using TSK-GEL 64000SWXL and 62000 SWXL gel filtration columns combined in series. Proteins are detected by ultraviolet absorption at 280 nm. BIO-RAD gel filtration standards are used as markers of the molecular weight of globular proteins.

 As can be seen in figv, using SEC HPLC in the preparation revealed two main components (52% and 47% of the total protein), and their points of elution correlate with globular proteins mol. masses of 359.4 kD and 159.3 kD, respectively (see also Table 8 below).

 Conjugates PEG18, PEG19 and PEG21 obtained by reductive alkylation of MGDF with aldehydes MePEG mol. masses of 6-25 kDa, investigated in a similar way. The main parameters of the reactions used to obtain the corresponding drugs are shown in Table 7.

 The results of studies of the obtained conjugates using SEC HPLC are shown in Table 8.

12.3. Obtaining conjugates of MGDF with monomethoxypolyethylene glycol by combining it with an alpha-amino residue in the N-terminal portion of MGDF
Obtaining MOHO-PEG (20 kD) -MGDF conjugate (PEG16)
To a chilled (4 ^° C), mixed solution of MGDF (2 ml, 2.5 mg / ml) in 100 mM sodium phosphate, pH 5, containing 20 mM NaCNBH ₃ , a 5-fold molar excess of monomethoxy-polyethylene glycol aldehyde (MePEG) was added (average mol. mass of 20 kD), and stirring of the reaction mixture was continued at the same temperature.

 The degree of protein modification during the reaction is monitored by SEC HPLC using a Superdex 200 HR 10/30 column (Pharmacia Biotech). Elution is carried out with 0.1 M sodium phosphate buffer at pH 6.9 and a flow rate of 0.7 ml / min.

 After 16 hours, SEC HPLC analysis of the reaction mixture showed that more than 90% of the initial amount of protein was modified. At this time, the protein concentration in the reaction mixture was reduced by 1 mg / ml, diluting it with sterile water, and the pH was adjusted to 4 by adding 0.5 M acetic acid.

 The mono-MePEG (20 kD) -MGDF conjugate was separated from the excess MePEG and other reaction by-products by ion exchange chromatography using SP Sepharose HP (Pharmacia Biotech) as the ion exchange resin.

 The reaction mixture was applied to a column (2.5 mg / ml resin) and the unreacted MePEG was eluted with start buffer A (3 column volumes, 20 mM sodium phosphate, pH 7.2, 15% glycerol).

 Then, the MePEG-MGDF conjugate was eluted using a linear gradient (0% to 25%) of final buffer B (20 column volumes) (1 M NaCl in buffer A). The eluate was examined at 280 nm. Fractions containing poly-MePEG-MGDF conjugate were combined, concentrated and filtered sterilized.

 The homogeneity of the mono-MePEG-MGDF conjugate was confirmed by polyacrylamide gel electrophoresis in the presence of SDS using a 4-20% NOVEX gradient gel. Identify one main band corresponding to the protein with a pier. weighing 46.9 kD.

 Purified poly-MePEG-MGDF conjugate was analyzed by HPLC SEC using TSK-GEL 64000SWXL and 62000 SWXL gel filtration columns combined in series. Proteins are detected by ultraviolet absorption at 280 nm. BIO-RAD gel filtration standards are used as markers of the molecular weight of globular proteins.

 As can be seen in figs, using SEC HPLC in the preparation revealed one main component, and its point of elution corresponds to the globular protein mol. mass 181.1 kD (see also Table 9).

 Mono-MePEG-MGDF conjugates PEG14, PEG15 and PEG17 obtained by reductive alkylation of MGDF with MePEG aldehydes mol. masses of 6-25 kDa, investigated in a similar way. The main parameters of the reactions used to obtain the corresponding drugs are shown in Table 7.

 The results of studies of the obtained conjugates using SEC HPLC are shown in Table 9.

12.4. Obtaining DiMePEG (12 KD) -MGDF conjugates by alkylation of MGDF with methoxy polyethylene glycol aldehyde (PEG20) under reducing conditions
The procedure described below yields a purified compound, referred to herein as PEG22.

5-fold excess of methoxypolyethylene glycol aldehyde (MePEG, for example, OHC- (CH ₂ ) ₂ -O- (CH ₂ -CH ₂ O) _n -CH ₃ ; where n is repeated so many times that the molar mass is about 12 kD) ( Shearwater Polymers) is added to a 2.5 mg / ml solution of MGDF (prepared in E. coli, 1-163) in 100 mM sodium acetate, pH 5, cooled to 5 ^° C. After 10 minutes stirring, an appropriate amount of sodium cyanoborohydride ( Aldrich) so that its concentration in the reaction mixture is 20 mM.

The resulting mixture was stirred for 16 hours at a temperature of 5 ^° C. At the end of the indicated time period, the concentration of MGDF was adjusted to 1 mg / ml by adding sufficiently purified water. Then the mixture is filtered through a vacuum filter with a pore size of 0.2 μm. By this method, 90 mg of the reaction product are obtained. Small amounts of solutions of 1.0 M monobasic phosphate and 1 N sodium hydroxide are added to the mixture containing the reaction product to obtain a solution containing 10 mM phosphate at pH 6.8.

 The conjugate is purified on a cation exchange column. Prepare a 40 ml column filled with SP-Sepharose for high-resolution chromatography, 7.5 cm long. The column is equilibrated with the appropriate buffer (10 mM phosphate, pH 6.8, 15% glycerol). The column is loaded with 2.2 mg / ml resin at a flow rate of 0.15 column volumes (CV) per minute. Then the column is washed with equilibration buffer until it reaches the zero reference point. The column is eluted with a linear gradient from buffer A (10 column volumes, 20 mM phosphate, pH 7.2, 15% glycerol) to buffer B (buffer A and 0.3 M NaCl). The flow rate is maintained at 0.15 CV. The eluate was examined at 280 nm.

 SDS-containing polyacrylamide gels are fractionated, and those containing DiPEG conjugate are combined and filtered through a 0.2 μm cell.

Example 13. The biological activity of pegyated MGDF molecules
A. PEG-9 - PEG-12 and PEG-14 - PEG-21
The platelet count in mice treated with recombinant human MGDF is shown in FIG. Obtained in CHO cells MGDF (22-353) (open stars), non-pegyed MGDF obtained in E. coli (22-184) (open circles), and pegyed MGDF obtained in E. coli (22-184) ( filled circles) at the concentrations indicated in the description of the drawings above were administered subcutaneously to normal Balb / c mice once daily for 5 days. 24 hours after the last injection, control blood samples were taken from a small lateral section of the tail vein. Blood cell analyzes were performed using a Sysmex electronic blood cell analyzer (Baxter Dignostics. Inc. Irvine, CA). The average data for four animals is given +/- standard deviation. This treatment did not affect other parameters of blood cells, such as the total number of red and white blood cells.

 Other forms of recombinant human MGDF were tested as described above. Platelet counts in mice treated with 50 μg / kg / day or 10 μg / kg / day of the indicated r-HuMGDF form are shown in Table 10. The values presented are averages of four animals, and standard errors are shown in italics.

B.PEG-22
The results obtained with PEG-22 are presented in Fig.24. It is noteworthy that platelet count normalization with PEG-22 occurred several days earlier than with the full-sized PEG-16 or PEG-17 obtained in CHO MGDF.

Example 14. Expression of recombinant human MGDF (1-163) in E. coli
For expression of r-HuMGDF in E. coli using optimal E. coli codons, a sequence encoding the first 163 amino acids of the mature protein was chemically synthesized. In addition, DNA sequences encoding the amino acids Methionine and Lysine were added to the 5'-end of the gene. Thus, the r-HuMGDF protein, consisting of 165 amino acids, started with Met-Lys. The sequence of this gene is shown in Fig.25.

 The synthesis of the r-HuMGDF gene (1-163) was carried out in several stages. First, complementary oligonucleotides (60-70 base pairs long) representing fragments adjacent to the gene were chemically synthesized using the optimal E. coli codons. During this synthesis, the codons for the amino acids Methionine and Lysine were placed at the 5'-end of the mature gene and the stop codon was placed at the 3'-end of the gene. In addition, Xbal and Hindlll restriction enzyme recognition sites were placed in the vicinity of the 5 'and 3' ends of the gene, respectively, and the synthetic ribosome binding site was placed at an appropriate distance above the starting Methionine. Secondly, oligonucleotides complementary to each gene fragment were hybridized. Third, these individual synthetic gene fragments were amplified in a polymerase chain reaction. Fourth, amplified fragments were subcloned into the corresponding vector. Fifth, the sequence of subcloned fragments was verified. Sixth, individual fragments were ligated together and subcloned into the corresponding vector, restoring the full-length r-HuMGDF gene (1-163). Finally, the sequence of the restored gene was verified.

 The synthetic fragment of the r-HuMGDF gene flanked by the Xbal and HindIII restriction sites at the 5 'and 3' ends, respectively, contained a ribosome binding site initiating the ATG codon, a sequence encoding the mature Met-Lys r-HuMGDF protein, and a stop codon.

 The indicated fragment was cloned at the Xbal and Hind III sites into the lactose-induced expression vector pAMG11. The pAMG11 vector is a low copy plasmid with the start of replication derived from pR100. The expression plasmid pAMG11 can be obtained from plasmid pCFM1656 (deposited on February 24, 1994 at the American Collection of Cell Cultures, ATCC # 69576) by a series of targeted base changes when the oligonucleotides overlap in the polymerase chain reaction. Starting from the Bglll site (base pair # 180 in the plasmid) directly in the 5'-direction to the replication promoter of the PcopB plasmid and further towards the replicative plasmid genes, base pair replacements were as follows (see Table B).

The expression of r-HuMGDF cloned into pAMG11 is directed by a synthetic lactose-induced promoter like Ps4, which has the following sequence:
5'GACGTCTCATAATTTTTAAAAAATTCATTTGACAAATGCTAA- - ATTCTTGATTAATATTCTCAATTGTGAGCTCACAATTTATCGAT3 '(SEQ ID N0: 34).

 The Ps4 promoter is inhibited by the lactose repressor (LacI), a product of the E. coli lac gene.

 Then the plasmid pAMG11-r-HiMGDF transformed E. coli cells of strain K-12 with a laclq allele. The laclq allele is a mutation of the lacI promoter that enhances the expression of LacI, which leads to more stringent control of protein expression from the Ps4 promoter. Thus, in the cells of this strain in the absence of lactose, the expression of r-HuMGDF is suppressed by LacI. With the addition of lactose, the binding of the LacI protein to the surgical site on the Ps4 promoter decreases and the transcription of r-HuMGDF with Ps4 begins. The E. coli host cells used in this example were deposited under ANNC # 69717 on November 30, 1994.

E. coli ATCC # 69717 cells were transformed with pAMG11-r-HuMGDF plasmid and grown according to the following protocol. The E. coli strain was inoculated into Luria broth and incubated at 30 ^° C. for approximately 12 hours. Then the cells were aseptically transferred to a fermenter, which contained a medium of the following composition: 20 g / l of yeast extract; 3.4 g / l citric acid; 15 g / l K ₂ HPO ₄ ; 15 ml Dow P2000; 5 g / l glucose; 1 g / l MgSO ₄ • 7H ₂ O. The first phase of the cultivation process (batch-phase) continued until the culture reached an optical density of 5.0 +/- 1.0 at 600 nm. Then the fed-batch phase began with the first feed medium (700 g / l glucose; 6.75 g / l MgSO ₄ • 7H ₂ O). The feed rate was adjusted every two hours according to the established schedule. The second feed medium (129 g / l trypticase peptin; 258 g / l yeast extract) was started when the culture reached an optical density of 20-25 at 600 nm. The feed of the second feed medium was kept constant, while the feed of the first feed medium continued to change. The temperature during the whole fermentation process was maintained at about 30 ^° C. The pH value in the culture was maintained at about 7 by the addition of acid or alkali. The desired level of dissolved oxygen was maintained by changing the mixing speed and the rate of air and oxygen supply to the fermenter. When the optical density of the culture reached 57-63 at 600 nm, the feed of the third feed medium was started. A third feed medium (300 g / l lactose) was introduced into the fermenter at a constant current rate; the addition of the first feed medium was stopped at that moment, and the feed rate of the second feed medium was set to another constant level. Fermentation continued for approximately ten hours from the start of the addition of a third feed medium. After fermentation, the culture was cooled to 15 +/- 5 ^o C. Cells were collected by centrifugation. The resulting paste was Packed and stored at a temperature below -60 ^o C.

 Purification of the recombinant MGDF obtained in E. coli as described above was carried out as follows. 1800 g of cell paste was suspended in approximately 18 liters of a 10 mM EDTA solution and passed through a high pressure homogenizer at 15,000 psi. The cell suspension was centrifuged and the pellet resuspended in 10 liters of 10 mM EDTA. The suspension was centrifuged and the precipitate obtained at 200 g was solubilized in 2 liters of a buffer of the following composition: 10 mM Tris, 8M guanidine hydrochloride; 10 mM dithiothreitol, pH 8.7. The volume of this solution was slowly adjusted to 200 liters by the addition of the following solution: 10 mM CAPS; 3M urea; 30% glycerin; 3 mM cystamine; 1 mM cysteine, pH 10.5. The diluted solution was slowly stirred at room temperature for 16 hours and the pH was adjusted to 6.8. Then, the pH adjusted solution was clarified and applied onto a 2 liter Sepharose CM column, balanced with 10 mM sodium phosphate, 1.5 M urea, 15% glycerol, pH 6.8. After loading, the column was washed with 10 mM sodium phosphate, 15% glycerol, pH 7.2. MGDF was suirable gradient of sodium chloride from 0 to 0.5 M, 10 mm sodium phosphate, pH 7.2.

 The eluate was concentrated and the buffer replaced with 10 mM sodium phosphate, pH 6.5 using a membrane with a cut-off threshold for molecular weight 10,000. A concentrated solution (about 2 mg / ml) was treated with cathepsin C (molar ratio 500 to 1) for 90 minutes at a suitable temperature. The solution was then applied to a 1.2 L SP High Performance Sepharose column, balanced with 10 mM sodium phosphate, 15% glycerol, pH 7.2. MGDF was suirable gradient of sodium chloride from 0.1 to 0.25 M, 10 mm sodium phosphate, pH 7.2.

 Ammonium sulfate was added to the eluate from the SP High Performance Sepharose column to a concentration of 0.6 M. Then, the eluate was applied to a 1.6 liter Phenyl Toyopearl column, balanced with 10 mM sodium phosphate, 0.6 M ammonium sulfate, pH 7.2. The MGDF peak was eluted with a gradient of ammonium sulfate from 0.6 to 0 M, 10 mM sodium phosphate, pH 7.2.

 The Phenyl Toyopearl eluate was concentrated and the buffer replaced with 10 mM Tris, 5% sorbitol, pH 7.5 using a membrane with a cut-off threshold of 10,000 molecular weight.

Example 15. Biological properties of r-HuMGDF (E. coli 1-163) in vivo
The biological efficacy of r-HuMGDF (E. coli 1-163) obtained as described above in Example 14 was evaluated in rodents. Normal female Balb / c mice were injected subcutaneously with increasing doses of r-HuMGDF for five consecutive days. Doses ranged from 15 mcg / kg / day to 1,500 mcg / kg / day. 24 hours after the last administration, blood cells were counted using an electronic cell counter (Sysmex, Baxter). A linear increase in platelet count was observed, parallel to a logarithmic increase in cytokine concentration. In this system, at a dose of 1500 μg / kg / day, the platelet count increased to 300% with respect to the original. Other indicators of blood cells, such as the number of red and white cells or hematocrit, did not change during this treatment.

 Rats were injected subcutaneously with r-HuMGDF (E. coli 1-163) at doses of 300 μg / kg / day for 6 days, then platelets were taken and their ability to aggregate in response to ADP was determined. It was shown that the platelets of the treated animals are practically indistinguishable from the platelets of the control animals in sensitivity to platelet agonist, ADP.

 The ability of r-HuMGDF to correct thrombocytopenia due to chemotherapy and / or radiation was also evaluated. In these experiments, carboplatin, a chemotherapeutic agent capable of causing deep thrombocytopenia in humans, was used. At the beginning of the experiment, 1.25 mg carboplatin was administered subcutaneously to Balb / c mice. After 24 hours, daily injections of 100 μg / kg / day of r-HuMGDF (E. coli 1-163) or, in control, a solvent were started. By the ninth day, the platelet count dropped to 15% of normal in mice treated with one solvent, but remained within normal limits in mice treated with r-HuMGDF (see FIG. 20). In irradiation experiments, mice received a single dose of 500 rad gamma radiation (cesium source). This sublethal dose reduced platelet count by 90% by day 11. The platelet count did not return to normal until the 21st day. When 100-mg / kg / day r-HuMGDF (E. coli 1-163) was administered daily to irradiated mice from day 1 to day 20, the decrease in platelet count was less dramatic and the return to their normal number was faster than in mice receiving one solvent (Fig. 21). To test r-HuMGDF in a model of acute and prolonged thrombocytopenia, a combination of carboplatin and radiation was used (Fig. 22). In this case, the platelet count decreased to extremely low levels (3-5% of the norm) and most animals (7/8) did not survive this treatment. However, when the animals were injected subcutaneously daily with 100 μg / kg / day r-HuMGDF throughout the experiment, thrombocytopenia was significantly corrected, the return to the initial platelet count was faster and all animals receiving r-HuMGDF (8/8) survived.

 r-HuMGDF was also tested on rhesus monkeys. Normal rhesus monkeys were injected subcutaneously with r-HuMGDF at doses of 2.5 or 25 mcg / kg / day for ten days (days 0-9). In the group receiving the low dose, the platelet count increased to 400% of the norm by the 12th day, and in the group receiving the high dose, the increase was 700% also by the 12th day. At the end of the injection, the platelet count returned to normal by the 25-30th day. This treatment did not affect the number of white and red blood cells.

 r-HuMGDF was also tested on a primate model with acute thrombocytopenia (FIG. 23). Irradiation of animals (700 rad, a cesium source) led to a decrease in the number of platelets to 1-2% of the norm by the 15th day. On the 35-40th day, the platelet count returned to normal. In irradiated animals that were injected with r-HuMGDF (25 μg / kg / day), the platelet count decreased only to 10% of the norm and did not fall below 20,000 / ml on average, the value at which platelet transfusion begins for people suffering from thrombocytopenia. A return to the normal platelet count also occurred more rapidly in animals treated with r-HuMGDF, and occurred on day 20.

 The data from in vivo experiments on rodents and primates fully support the concept that r-HuMGDF (E. coli 1-163) is a powerful therapeutic agent that can significantly affect the clinical thrombocytopenia.

Example 16. The method of obtaining r-HuMGDF (1-332) in a culture of CHO cells
Glycosylated r-HuMGDF 1-332 is produced by transfected CHO cells expressing MGDF 1-332 cDNA under the regulation of a suitable promoter and linked to a gene encoding an amplifiable selectable marker, DHFR. A suitable promoter for the expression of MGDF in CHO cells is the SR-alfa promoter, see Mol.Cell.Biol. 8: 466-472 (1988) and WO 91/13160 (1991). A suitable vector for the expression of MGDF in cells is pDSR-alfa2, see WO 90/14363 (1990). CHO cell lines can produce secreted MGDF in an amount of 10-20 mg / L in standard culture medium, but production levels can be increased from 25 to 100 mg / L. When MGDF is produced in a typical cell line, the culture can be “dispersed” by passages in suspension or on culture bottles (in the case of substrate-dependent growth) using a culture medium consisting of equal amounts of Dalbecco's Modified Eagle's Medium (DMEM) and Ham's F12 medium ( DMEM / F12, Gibco) supplemented with 5 to 10% fetal calf serum (FBS) or dialyzed fetal calf serum and methotrexate (MTX) (if necessary; typical MTX concentration is 200-600 nM) to maintain selective pressure. Non-essential amino acids (NEAA's) and glutamine must be added to the medium. Suspension cultures can be expanded within concentrations of 1-4 • 10 ⁵ cells / ml (inoculum concentration) to about 1 million cells / ml. When the maximum concentration of cells is reached, the passage of the culture is carried out by dilution to large volumes and achieving inoculum concentration.

When receiving MGDF in roller bottles, the appropriate cell volume and density in suspension culture should be selected using spinner bottles with magnetic stirrers placed in thermostated conditions (37 +/- 1 ^o C), or using an automatic controlled system with a bioreactor. Roller bottles (for example, Falcon bottles with an area of 850 cm ² ) should be seeded with cells with inoculative doses from 1.5 to 3 • 10 ⁷ cells per bottle in this amount of growth medium (DMEM / F12 with 5-10% FBC, 1xNEAA and 1x glutamine), which would ensure the formation of a fused monolayer on the 3-4th day of cultivation (150-300 ml). The growth medium should be buffered with sodium bicarbonate to a pH of 6.9-7.2 and balanced with carbon dioxide to a partial pressure of 60-90 mmHg. The vials should be filled with a mixture of 10% CO ₂ in air, and cultures are incubated at 37 +/- 1 ^o C on a roller apparatus at a rotation speed of about one revolution per minute for 3-4 days. When a monolayer is reached, coller cultures must be transferred to a serum-free production medium. In this case, the old growth medium is drained or aspirated, the cultures are washed with isotonic buffer, for example, Dalbecco phosphate buffer solution (D-PBS), 50-100 ml per vial, then the corresponding volume of serum-free bicarbonate-buffered medium DMEM / F12 (1: 1) is added (200 -300 ml per vial) with the addition of NEAA, glutamine and copper sulfate (1-20 μM) to minimize covalent aggregation. The vials are filled with a gas mixture (10% CO ₂ in air) and incubated for 6 +/- 1 days at 37 ^o C on roller devices (~ 1 rpm) or until the moment when, as a result of cell metabolism, the glucose level in the medium drops below 0.5 g / l and / or the pH will drop below 6.6. The conditioned medium is drained or aspirated from the vials and replaced with a fresh serum-free production medium of the above composition for additional charges. This can continue until the cells can no longer tolerate serum-free conditions and begin to slide from the roller bottles.

The collected conditioned medium is purified by microfiltration through filters with a pore size of 0.45 or 0.2 μm (Sartorius Sartobran pH or Pall). The filtered conditioned medium is cooled to 4 ^° C. and stored for a short time at this temperature or immediately concentrated and dialyzed against a buffer with low ionic strength using a tangential ultrafiltration system (e.g. Filtron YM-50). Ultrafiltration and diafiltration must be carried out at 4 ^o C to minimize protein degradation. Prior to chromatographic purification, the conditioned medium should be dialyzed against a buffer solution (for example, 10 mM potassium phosphate, pH 6.8).

 The quality of the product contained in an air-conditioned environment is best controlled using SDS-PAGE under non-reducing conditions followed by Western blotting, which can detect the amounts of aggregated, monomeric and proteolytically degraded MGDF in the samples.

 Another method for producing MGDF in CHO cells is to adapt the cell line expressing MGDF to a serum-free medium such as Gibco S-SFM II. Cells can be adapted by serial passages on medium containing a minimum of serum or not containing it at all. If the cell line grows stably on such a medium and produces adequate amounts of secreted MGDF, cultivation can continue by serial passages, in increasing volumes, then the cells are transferred to a suitable production vessel (automatic controlled bioreactor) and the culture is allowed to proliferate to the maximum density at which cells are still viable under optimal growth conditions (pH, nutrients, temperature, oxygen, cell destruction). At the point of optimal production (which is determined experimentally by measuring the quantity and quality of the product), the culture is collected from the bioreactor, the cells are removed from the conditioned medium by micron depth filtration or submicron tangential microfiltration. In the case of deep micron filtration, the medium should subsequently be clarified by submicron final filtration for concentration and dialysis, as described above.

 Despite the fact that the claimed invention is described above both in general and in relation to specific embodiments, it should be understood that modifications of the invention based on the above description can be reproduced by any specialist in this field of research. Thus, the claimed claims in fact cover all variants of the invention included in its scope.

 In addition, publications and other information sources cited for assessing the state of the art and for a better understanding of the description of the invention, in particular for more detailed coverage of practical issues, are incorporated into the application materials by reference.

Claims (39)

 1. The polypeptide of growth factor and differentiation of megakaryocytes (FRDM) having an amino acid sequence selected from the group comprising the FRDM-7 sequence from 22 to 198 amino acids shown in the graphic part, as well as the FRDM-2 sequence including amino acids 22 to 195 of the above the FRDM-7 sequence, the FRDM-4 sequence comprising amino acids 22 through 172 of the reduced FRDM-7 sequence, the FRDM-5 sequence comprising amino acids 22 through 177 of the reduced FRDM-7 sequence, the sequence the number of FRDM-6, including amino acids 22 through 191 of the reduced sequence FRDM-7 and the sequence FRDM-8, comprising amino acids 22 through 184 of the reduced sequence FRDM-7.  2. The selected polynucleotide encoding the FRDM according to claim 1.  3. The selected polynucleotide according to claim 2, which is a DNA sequence.  4. The DNA sequence according to claim 3, which is a cDNA sequence.  5. The cDNA sequence according to claim 4, which is a nucleotide sequence 1, or a nucleotide sequence 2 shown in the graphic part.  6. The strain of cell culture 293 EBNA, stably transformed or transfected with the DNA sequence according to claim 4 and expressing the specified polypeptide according to claim 1.  7. A method of producing a FRDM polypeptide, which consists in growing a host cell with a transformed or transfected DNA sequence according to claim 4 in a suitable nutrient medium and isolating said polypeptide.  8. Derived FRDM, which is a FRDM polypeptide coupled to at least one water-soluble polymer having a mol.m. 2 - 100 kD, with a molecular ratio of polymer: polypeptide 1: 1 - 20: 1 by the formation of an acyl or amide bond.  9. The FRDM derivative of claim 8, wherein said polypeptide is selected from the group comprising the FRDM-1 sequence from 22 to 353 amino acids shown in the graphic part, as well as the FRDM-11 sequence comprising amino acids 22 to 184 of the above sequence FRDM-1, the FRDM-12 sequence comprising amino acids 27 through 353 of the reduced FRDM-1 sequence, the FRDM-13 sequence comprising amino acids 27 through 195 of the reduced FRDM-1 sequence, the FRDM-14 sequence comprising amino acids from 27 p about 172 of the reduced FRDM-1 sequence, and the FRDM-15 sequence comprising amino acids 27 through 184 of the reduced FRDM-1 sequence.  10. The FRDM derivative of claim 8, wherein said FRDM polypeptide is produced in a bacterial cell as a recombinant polypeptide.  11. Derived FRDM according to claim 8, characterized in that said water-soluble polymer is pharmaceutically acceptable.  12. The FRDM derivative of claim 8, wherein said water-soluble polymer is selected from the group consisting of dextran, poly (N-vinyl-pyrrolidine), polyethylene glycols, polypropylene glycol homopolymers, propylene oxide / ethylene oxide copolymers, polyoxyethylene polyols, polyvinyl alcohols, and mixtures thereof.  13. Derived FRDM according to claim 8, characterized in that the water-soluble polymer is a polyethylene glycol.  14. The FRDM derivative of claim 13, wherein said polyethylene glycol is monomethoxypolyethylene glycol.  15. The FRDM derivative of claim 13, wherein the polyethylene glycol group is connected to the N-terminal portion of the polypeptide.  16. The FRDM derivative according to claim 13, characterized in that the polyethylene glycol group has an average mol.m. 10-50 kD.  17. The FRDM derivative of claim 18, which is a FRDM polypeptide covalently linked to two water-soluble polymer molecules.  18. Derived FRDM according to claim 17, characterized in that said water-soluble polymer molecules are polyethylene glycol molecules.  19. The method of producing derivatives of FRDM according to claim 8 by combining with a water-soluble polymer having one reactive aldehyde group, comprising contacting said FRDM polypeptide with a water-soluble polymer under conditions of reductive alkylation at a sufficiently acidic pH so that the alpha-amino group on the aminothermal a portion of the indicated FRDM polypeptide has reacted, and the indicated FRDM polypeptide coupled to at least one water-soluble polymer is isolated.  20. The method of producing derivatives of FRDM according to claim 8 by combining with a water-soluble polymer having one reactive ether group, comprising contacting said FRDM polypeptide with a water-soluble polymer under conditions in which said FRDM polypeptide is coupled to the water-soluble polymer via an acyl bond, and isolate the indicated FRDM polypeptide coupled to at least one water-soluble polymer.  21. The method according to claim 19 or 20, characterized in that said polymer is pharmaceutically acceptable.  22. The method according to claim 19 or 20, characterized in that the water-soluble polymer is selected from the group consisting of dextran, poly (N-vinyl-pyrrolidone), polyethylene glycols, polypropylene glycol homopolymers, propylene oxide / ethylene oxide copolymers, polyoxyethylene polyols and polyvinyl alcohols.  23. The method according to claim 19 or 20, characterized in that the water-soluble polymer is a polyethylene glycol.  24. The method according to item 23, wherein the polyethylene glycol has a mol.m. 2-100 kD.  25. The method according to claim 19, characterized in that the FRDM polypeptide is obtained by cleaving Met-2-Lys-1 from a polypeptide obtained by expression in a E. coli cell of a DNA sequence encoding a polypeptide containing amino acids 22-184 from the above FRDM sequence 1 and the sequence Met-Lys in the N-terminal portion of it.  26. The method according to claim 19, characterized in that the FRDM polypeptide is obtained by expression in a E. coli cell of a DNA sequence encoding a polypeptide containing amino acids 22-184 from the above FRDM-1 sequence and the Met-Lys sequence in the N-terminal region, isolating the expressed polypeptide; and cleaving the Met-2-Lys-1 sequence from the isolated polypeptide.  27. A derivative of the FRDM polypeptide, which is a FRDM polypeptide linked by an acyl bond to one polyethylene glycol molecule having a mol.m. 2-100 kD.  28. The derivative of the FRDM polypeptide according to Claim 27, wherein said FRDM polypeptide is selected from the group consisting of FRDM-1, FRDM-2, FRDM-4, FRDM-5, FRDM-6, FRDM-7, FRDM-8, FRDM-11, FRDM-12, FRDM-13, FRDM-14, FRDM-15, as well as FRDM-3, having the amino acid sequence from 22 to 286 of the reduced FRDM-1 sequence.  29. The derivative of the FRDM polypeptide according to Claim 27, wherein said FRDM polypeptide is coupled to one polyethylene glycol molecule via an alpha amino group in the N-terminal region.  30. Derived FRDM according to clause 29, wherein the polyethylene glycol has an average mol.m. 5-50 kD.  31. The derivative of the FRDM polypeptide according to Claim 27, wherein the polyethylene glycol group is connected to an N-terminal portion of the polypeptide.  32. The derivative of the FRDM polypeptide according to Claim 27, wherein the FRDM polypeptide is produced by E. coli.  33. A pharmaceutical composition that enhances the growth and / or development of metakaryocytes, containing a derivative of the FRDM polypeptide of claim 8 and a pharmaceutically acceptable diluent, adjuvant or carrier.  34. A pharmaceutical composition that enhances the growth and / or development of metacaryocytes, containing the derivative of the FRDM polypeptide of claim 27 and a pharmaceutically acceptable diluent, adjuvant or carrier.  35. A method of treating a patient with a deficiency of the FRDM polypeptide, which comprises administering an effective amount of the FRDM polypeptide according to claim 1 or the FRDM derivative of claim 8.  36. A method of treating a patient with thrombocytopenia, which includes the introduction of an effective amount of the FRDM polypeptide according to claim 1 or the FRDM derivative of claim 8.  37. The method according to clause 36, wherein said disease is included in the group comprising aplastic anemia, idiopathic thrombocytopenia and thrombocytopenia, which has developed as a result of medication or radiation exposure.  38. A method of increasing the number of mature megakaryocytes in a patient in need thereof, comprising administering an effective amount of the FRDM polypeptide of claim 1 or the FRDM derivative of claim 8.  39. A method of increasing platelet count in a patient in need thereof, comprising administering an effective amount of the FRDM polypeptide of claim 1 or the FRDM derivative of claim 8. Priority on points:
05/31/94 according to claims 1-3, 35-39;
12.10.94 according to claims 4-34.

Images