RU2104305C1 - Human insulin analogs, method of their synthesis, injection solution - Google Patents

Abstract

FIELD: biotechnology, genetic engineering, medicine. SUBSTANCE: analogs of human insulin with substitution of one or more amino acid residues in A- and B-chain with more hydrophilic amino acid residues were synthesized by transformation of the yeast strain with plasmid carrying DNA-sequence that encodes insulin analog precursor. The obtained precursor is converted to analog by reaction with L-threonine ester in organic solvent in the presence of trypsin. Preferable amino acid subtituents are the following amino acids: Asp, Glu, Ser, Thr, His and Ile. EFFECT: improved method of synthesis. 3 cl, 11 dwg, 1 tbl

Description

 The invention relates to new analogues of human insulin, characterized by the rapid onset of the desired effect after subcutaneous injection, and insulin solutions for injection containing similar insulin analogs and to methods for producing new insulin analogues.

 For the treatment of diabetes mellitus, many varieties of insulin preparations have been proposed in the art. Some of these drugs are quick-acting, while others provide a more or less long-lasting effect.

 Fast-acting insulin preparations can be used in acute situations, such as hyperglycemic coma, during surgery, pregnancy, and in cases of severe infections. In addition, repeated, daily injections of fast-acting insulin preparations can improve the control of the course of the disease in diabetics who have difficulty controlling the use of long-acting insulin.

 In recent years, there has been growing interest in insulin treatment, which is approaching the release of insulin by the beta cells of a healthy body, that is, the production of insulin in combination with food intake and maintaining a basal level of insulin. Clinical studies have shown that diabetics can receive normal concentrations of insulin and glucose with a single daily injection of long-acting insulin to cover the basal need, supplemented by injecting smaller amounts (bolus) of fast-acting insulin before taking significant amounts of food.

 Fast-acting insulins are also used in mixtures with intermediate and long-acting insulins for the treatment of diabetics who require a stronger initial effect in addition to the slowed-down action of intermediate and long-acting insulins.

 Finally, fast-acting insulin is used in continuous insulin delivery systems.

 With subcutaneous injection of fast-acting insulin solutions, an initial delay in absorption was observed (Binder, Diabetes Care, 7, N 2 (1984), 1988-199). However, a delay in absorption due to the delayed onset of the effect is undesirable if the task is to ensure strictly metabolic control. Mixing solutions of fast-acting insulin with long-acting insulin preparations can, in addition, lead to a decrease in the absorption rate of fast-acting insulin.

 Accordingly, there is a need for solutions of fast-acting insulin, providing an accelerated onset of effect after subcutaneous injection and improved miscibility with long-acting insulin preparations.

 Another disadvantage of the known solutions of fast-acting insulin is the tendency of insulin to fibrillate and drop out of the insulin solutions used for continuous delivery of insulin, which leads to clogging of mechanical components and delivery catheters.

 Finally, there is a need for alternative insulin preparations for treating patients who are difficult to treat with normal insulin.

The aim of the present invention is the creation of new solutions of fast-acting insulin with one or more of the following improved characteristics:
1) rapid onset of effect with subcutaneous injection or when administered by other methods,
2) improved miscibility with long-acting insulin preparations,
3) reduced tendency to fibrillation when used in implanted delivery systems, and
4) suitability for the treatment of resistant patients (low affinity for pre-existing antibodies).

 These objectives of the present invention are achieved using aqueous solutions for injection of new analogues of human insulin, described below.

 A large number of insulin analogues are known. So, Marki et al. (Hoppe-Seyler's Z. Physiol. Chem. 360 (1979), 1619-1632) describe the synthesis of human insulin analogs that differ from human insulin by amino acid substitution at positions 2, 5, 6, 7, 8 and 11 of the A chain and 5 , 7, 13 and 16 of the B-chain, which gives new ideas about the interesting dependence of the structure - activity in the case of insulin. In further studies, the main region of insulin receptor binding was modified (B (22) - B (26)) to study the effect of such a mutation on receptor binding activity. However, known analogues of human insulin do not exhibit the characteristics sought by the authors of the present invention.

 Sulfated insulins are known to have a significantly lower susceptibility to fibrillation (Albisser et al., Desired Characteristics of insulin to be used in infusion pumps, in Jueriguian JL et al. (Ed.) US Pharmacopeial Concention, Rockville, Maryland p. 84 -95) and exhibit weak antigenicity. However, sulfated insulins are a heterogeneous mixture of at least nine different derivatives of insulin containing an average of 4.5 ether sulfate groups per molecule. Further, sulfated insulins exhibit reduced insulin activity, comprising about 20% of the activity of native insulin. A further disadvantage of sulfated insulins compared to native insulin is that they unnecessarily contain amino acid residues that are chemically modified, that is, amino acids that are not found in nature.

 Therefore, an additional objective of the present invention is the creation of insulin analogues that are homogeneous, have a higher biological activity than sulfated insulins, and, in addition, preferably contain only naturally occurring amino acids.

 The term "insulin analogs" in the application materials refers to a compound having a molecular structure similar to that of human insulin, including disulfide bridges between A (7) Cys and B (7) Cys, between A20) Cys and B (19) Cys and an internal disulfide bridge between A (6) Cys and A (11) Cys, and exhibiting insulin activity.

 The present invention is based on the fact that some insulin analogs in which at least one of the amino acid residues of human insulin is replaced by naturally occurring amino acid residues exhibit the required fast-acting activity.

 In its expanded interpretation, the present invention provides new, fast-acting analogs of human insulin, formed by replacing one or more amino acid residues of human insulin, found in nature, with amino acid residues leading to less self-association in dimers, tetramers, hexamers or polymers, and having the same charge or greater negative charge at neutral pH than human insulin.

 To achieve a lower tendency to self-associate into dimers, tetramers, hexamers, or polymers, some human insulin residues are preferably substituted with other amino acid residues that are more hydrophilic than the natural amino acid residue at the corresponding position in the molecule. In addition, in some positions of the insulin molecule, substitution with a more voluminous amino acid residue leads to a decrease in the tendency of insulin molecules to associate into dimers, tetramers, hexamers or polymers.

 Figure 1 presents the proposed new derivatives of insulin of the General formula I, where X - are the amino acid residues of human insulin or other amino acid residues, the total function of which is to give the molecule the same or greater negative charge at a neutral pH compared to human insulin, provided that at least one X differs from the amino acid residues of human insulin in the corresponding position and the insulin molecule, and when X in position A (8) is His or Phe, X in When A (21) is reached, Asp, X at position B (5) is Ala, X at position B (9) is Leu, X at position B (10) is Asn or Leu, X at position B (12) is Asn or X in position B (26) is Ala, then at least one of the remaining X is different from the amino acid residues of human insulin in the corresponding position of the insulin molecule, and under the further condition that one or more amino acid residues can be removed from N and / or C the ends of the A chain and / or B chain.

 Preferably, at least most substitutions of amino acid residues are more hydrophilic than the amino acid residue at the corresponding site of the human insulin molecule, and more preferably, all substitutions of amino acid residues are more hydrophilic than the corresponding amino acid residues of human insulin.

 With regard to hydrophilicity, reference is made to the work of C. Trommel, J. Theor. Biol. 111 (1984), 247-260 (Table 1).

 With reference to the above formula I, we note that preferably no more than 7 substituents X differ from the amino acid residue in the corresponding position of the human insulin molecule. 2-4 substitutions are preferred.

 Preferred Embodiments of the Invention

 Substitution of amino acid residues is preferably selected from the group consisting of Asp, Glu, Ser, Thr, His and Ile, and more preferably negatively charged amino acid residues, i.e. Asp and / or Glu.

 A new human insulin analogue may preferably contain Asp and / or Glu instead of one or more hydroxy amino acids of human insulin, or instead of one or more Glu and Asn of human insulin.

 New human insulin analogs may also preferably contain Ser and / or Thr or Asp and / or Glu instead of one or more amino acid residues of human insulin with an aliphatic and / or aromatic side chain.

 New human insulin analogs may also preferably contain His instead of one or more amino acid residues of human insulin with an aliphatic and / or aromatic side chain, or instead of one or more hydroxy amino acids of human insulin.

 Preferred substitution sites are B9, B10, B12, B26, B27 and B28, preferably B9, B12, B27 and B28, and in these positions, one substitution may be sufficient to achieve a reduced tendency to self-association and greater speed when consumed.

 Substitution of the amino acid residue at position B9 may be selected from the group consisting of Asp, Pro, Glu, Ile, Leu, Val, His, Thr, Gln, Asn, Met, Tyr, Trp and Phe, and more preferably from the group including Asp, Glu, Gln, Asn, and His.

 Substitution of the amino acid residue at position B12 may be selected from the group consisting of Ile and Tyr. Substitution of the amino acid residue at position B10 may be selected from the group consisting of Asp, Arg, Glu, Asn and Gln, and at positions B26, B27 and B28, the substitution of amino acid residues is preferably Asp or Glu.

 And in the remaining positions of the insulin molecule in at least two substitutions (preferably in combination with the above positions) it is necessary to achieve improved performance. At these positions, the substitutions shown in FIG. 2 can be made.

Further preferred compounds of the present invention are insulin analogs in which substitutions are in the following positions:
B27, B12, B9, (B27 + B9), (B27 + A21), (B27 + B12), (B12 + A21), (B27 + B17), (B27 + A13), (B27 + B16), (B27 + A10), (B27 + B28), (B27 + B26), (B27 + B10), (B27 + B1), (B27 + B2), (B27 + B5), (B27 + B14), (B27 + B18 ), (B27 + B20), (B12 + B17), (B12 + A10), (B12 + A13), (B12 + B16), (B12 + B1), (B12 + B2), (B12 + B5), (B12 + B10), (B12 + B26), (B12 + B28), (B9 + B17), (B9 + A13), (B9 + B16), (B9 + A8), (B9 + A9), (B9 + A10), (B9 + B1), (B9 + B2), (B9 + B5), (B9 + B10), (B9 + B12), (B9 + B14), (B9 + B28), (B9 + B18 ), (B9 + B20), (B9 + B26), (B27 + B9 + A21), (B9 + B27 + A8), (B27 + B12 + A21), (B27 + B12 + B9), (B9 + B12 + B27 + B17), (B9 + B12 + B27 + A13), (B9 + B12 + B27 + B16) and (B12 + B16 + B17 + B27 + A10 + A13).

 Preferred embodiments of the above formula I are the compounds shown in figure 3, where X is defined above.

 Other preferred insulin analogs of formula I according to the present invention are such that at position B27 X is Glu, at position B12 X is Ile or Tyr, X at position A21 is Asp and at position B27 is Glu, X at position B9 is Asp, X in position A21 and in position B9 - Asp, and in position B27 - Glu, X in position A8 - His, in position B9 - Asp and in position B27 - Glu, X in position B10 - Asp, X in position B28 means Asp or X at position B9 - Asp and at position B27 - Glu.

 In accordance with a second aspect of the present invention, there are provided injectable solutions having insulin activity. The insulin injectable solutions of the present invention contain the human insulin analogs described above or a pharmaceutically acceptable salt thereof in an aqueous solution, preferably at a neutral pH. An aqueous medium can be prepared by isotonic addition of, for example, sodium chloride and glycerol. In addition, buffers such as acetate or citrate and preservatives such as m-cresol, phenol or 4-hydroxybenzoic acid methyl ester can be added. Further, insulin solutions may contain zinc ions.

 Analogues of human insulin according to the invention can replace human or porcine insulin in fast-acting insulin solutions known so far.

 Obtaining insulin analogues.

 With the advent of recombinant DNA techniques, the possibilities for constructing proteins have become enormous. Using the methods of so-called site-specific mutagenesis, it became possible to change the gene coding of naturally occurring proteins by replacing any one or more codons of the native gene with codon (s) for other naturally occurring amino acids. Alternatively, the modified gene can be created by chemical synthesis of the complete DNA sequence by well-known methods. The purpose of this manipulation of the natural protein gene in a typical case is to change the properties of the natural protein in one direction or another.

 New insulin analogs can be obtained by altering the proinsulin gene by replacing the codon (s) in a suitable site of the native human proinsulin gene with codon (s) encoding the desired amino acid residue (s) substitution (s) or by synthesizing the complete DNA sequence encoding the required analogue of human insulin. A new modified or synthetic gene encoding the desired insulin analog is then inserted into a suitable expression vector which, when transferred to a suitable host organism, for example E. coli, Bacillus or yeast, produces the desired product. The expression product is then isolated from cells or culture broth depending on whether the expression product is a cell secret or not.

 Closest to the technical nature of the proposed is a method for producing new insulin analogues described by Marki et al. (Hoppe-Seyler's Z. Physiol. Chem. 360 (1979), 1619-1632). They can also be obtained from separately prepared in vitro A and B chains containing suitable substitutions of amino acid residues, after which the modified A and B chains are linked together by establishing disulfide bridges according to known methods (e.g., Chauce et al., B Rick DH, Gross E. (ed.) Peptides: Synthesis-Structure-Function Proc. Of Am 7th American Peptide Symp., Pp. 721-728).

New insulin analogs are preferably prepared by reacting a biosynthetic precursor having the general formula II shown in FIG. 4, where Q _n is a peptide chain with n naturally occurring amino acid residues; R is Lys or Arg; n is an integer from 0 to 33; m is 0 or 1, and X is defined above under the condition that the peptide chain, Q _n -R, does not contain two adjacent basic amino acid residues with L-threonine ether in the presence of trypsin or a trypsin derivative and subsequent conversion of the obtained threonine ester of human insulin analogue into an analog of human insulin by known methods. The so-called "transpeptization" reaction is described in US Pat. No. 4,343,898 (materials of which are incorporated by reference).

Using the transpeptization reaction, the bridge - (Q _n -R) _m between amino acid 29 in the B chain and amino acid 1 and in the A chain is cut out and the threonine ester group binds to the C-terminus of B29 Lys.

 The precursors of the above formula II can be obtained by a method similar to that described in European patent description N 0163529A, the materials of which are included here for reference purposes. Using this method, the DNA sequence encoding the precursor under consideration binds to a suitable expression vector, which then, when transferred to a yeast cell, is able to ensure expression and secretion of the desired compound with correctly located disulfide bridges. Then the expression product is isolated from the culture broth.

 The proposed insulin analogs can also be prepared by reacting a biosynthetic precursor of the general formula III shown in FIG. 5, where V and T are each Lys or Arg), and X is as defined above, in an aqueous solution with trypsin and carboxypepsidase-B, and isolation of a human insulin analog from the reaction solution.

 The precursors of the above formula III can be obtained by a method similar to that described in European patent description N 86302133.3, the materials of which are included here for reference purposes. According to this technique, the DNA sequence encoding the precursor is inserted into a suitable expression vector, which, when transferred to yeast, is capable of expressing and secreting the product with correctly located disulfide bridges into the culture medium.

 According to a third aspect of the present invention, there is provided a method for producing new insulin analogs in which a yeast strain containing a replicable expression vector comprising a DNA sequence encoding an insulin analog precursor is cultured in a suitable nutrient medium and the precursor is isolated from the culture medium and converted to a new insulin analog with using enzyme-chemical conversion in vitro.

 The present invention also relates to new precursors of new insulin analogues, DNA sequences encoding such new precursors, expression vectors containing such DNA sequences, and yeast strains transformed with such expression vectors.

 Modified insulin analogues.

 The present invention also encompasses certain derivatives and further substitutions of insulin analogs, provided that such derivatives or further substitutions do not significantly affect the achievement of the above object of the invention. Accordingly, it seems possible to introduce derivatives of one or more functional groups in amino acid residues. An example of such derivatization is the conversion of acid groups in an insulin molecule to ester or amide groups, the conversion of alcohol groups to alkoxy groups, or vice versa, and selective deamidation, which is known per se. For example, A21 Asn can be deamidated in A21 Asp by hydrolysis in an acidic medium, or B3 Asn can be deamidated in B3 Asp in a neutral medium.

 It is possible, further, to modify the considered insulin analogs either by attaching or removing amino acid residues at the N- or C-ends. The insulin analogs of the present invention may not have up to four amino acid residues at the N-terminus of the B chain and up to five amino acid residues at the C-terminus of the B chain, which does not significantly affect the general properties of the insulin analogue. Examples of such modified insulin analogs are insulin analogues in which there is no amino acid residue B1 Phe or B30 Thr.

 In addition, naturally occurring amino acid residues can be attached to one or more ends of the polypeptide chains, provided that this does not significantly affect the achievement of the above goal.

 Such exceptions or additions at the ends of the polypeptide chain of the proposed insulin analogs can be carried out in vitro with the amino acid substitution insulin analogs of the present invention. Alternatively, the gene for new insulin analogs according to the invention can be modified either by attaching or removing codons corresponding to excess amino acid residues or missing amino acid residues at the ends of the polypeptide chain, respectively.

 The abbreviations used for amino acids are those given in J. Biol. Chem, 243 (1968), 3558. Amino acids are in the configuration L.

 As used in the following text, B (1-29) means the shortened B-chain of human insulin from B1 Phe to B29 Lys, and A (1-21) means the A-chain of human insulin.

 Substitutions made in the molecule of human insulin in the implementation of the present invention are indicated by a prefix with reference to human insulin. For example, B27 Ghi-human insulin means a human insulin analogue in which Glu is inserted in place of Thr at position 27 in the B chain. B27 Glu, B9 Asp-human insulin means a human insulin analogue in which Glu is inserted instead of Thr at position 27 of the B chain, and A Asp is inserted instead of Ser at position 9 of the B chain. B27 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin means the precursor of the insulin analogue (see formula II), in which instead of Thr is inserted in position 27 of the shortened B-chain (see . above), and the B (1-29) chain and the A chain (A (1-21)) are connected by the Ala-Ala-Lys peptide sequence. Unless otherwise indicated, it should be understood that the B (1-29) chain and the A (1-21) chain are connected by disulfide bridges between A (7) Cys and B (7) Cys, between A (20) Cys and B (19) Cys, respectively, as in human insulin, and that the A chain contains an internal disulfide bridge between A (6) Cys and A (11) Cys.

As already noted, the purpose of the present invention is to provide solutions of fast-acting insulin for injection. In order to achieve this goal, the inventors first found that there are significant differences between insulin in the depot or bolus and insulin in the bloodstream, including the completely inevitable difference in insulin concentration. More specifically, the insulin in the blood stream is highly diluted at a content of 10 ^-11 to 10 ^-8 M and is in monomeric form, with some insulin possibly in dimeric form. At a much higher concentration, it accumulates in the B-cell granules of the pancreas and in the usually taken solution is mainly, if not mainly, inactive hexamer form, for example in the form of the well-known 2-zinc hexamer.

 It is known that human insulin in solution exists in many molecular forms, namely, in the form of a monomer, dimer, tetramer and hexamer (Blundell et al., Advances in Protein Chemistry, Academic Press, NY-London, 26, pp. 279-330, 1972), with high concentrations of insulin contributing to oligomeric forms, and the monomer is the most active form of insulin. The tetramer and hexamer are not active forms, and even a dimer may be inactive. The principle underlying the present invention is the assumption by the author that the previously well-known phenomena of delayed absorption (Binder, Diabetes Care 7, N 1 (1984), 188-199) identified to a large extent can be attributed to the time required for the dissociation of insulin from hexameric, tetrameric and dimeric forms in the (active) monomeric form.

 Analogues of human insulin according to the invention ensure their speed due to the molecular structure, which is not so susceptible to the formation of a dimer, tetramer, hexamer or polymer, i.e. characterized by a reduced tendency to self-associate into dimers, tetramers, hexamers or polymers in the presence or absence of zinc ions.

 It has long been recognized that significant species differences in the amino acid sequence found in insulin indicate that not all amino acid residues present in the insulin molecule are important for insulin activity and that some amino acids that are not essential for insulin activity are important for ensuring the physical properties of the insulin molecule. Indeed, it is known that guinea pig insulin is not capable of dimerizing. Sulfated insulin and tetranitrotyrosine-insulin do not dimerize. Thus, many of the amino acid residues of the human insulin molecule can be altered without a significant decrease in insulin activity. The amino acid substitutions proposed herein in the human insulin molecule are aimed at preventing the formation of dimers, tetramers, hexamers, or polymers without disturbing insulin activity.

 Amino acid residues at the A-chain and B-chain positions of formula I, where substitutions can be made, are not critical for insulin activity, but they are important for ensuring the ability of human insulin to aggregate into dimers, tetramers, hexamers or polymers, or for the solubility of human insulin. The introduced substitutions of amino acid residues interfere with the contact of atoms of neighboring insulin molecules, which promotes aggregation into dimers, tetramers, hexamers or polymers.

 As might be expected, from the point of view of substitution, changes in some positions of the human insulin molecule are more effective than others. In most cases, a single substitution in the B chain may be sufficient to reduce the tendency to self-associate, while other residues may require at least two changes. Substitutions in the A chain serve primarily to improve the solubility of the dissociated molecule. Preferred provisions for the implementation of substitutions of amino acid residues are B9, B12, B10, B26, B27 and B28 individually, in combination with each other or together with substitutions in other places of the insulin molecule, as represented in formula I.

 Substitution of one or more negatively charged amino acid residues instead of an uncharged or positively charged amino acid residue is performed to create a more negative charge of the human insulin analogue at a neutral pH and lower the isoelectric point compared to human insulin. It is characteristic that analogues of human insulin according to the invention have the same or more negative charge (at neutral pH) and a lower isoelectric point than human insulin.

 In most cases, 1-3 substitutions provide the achievement of the immediate objectives of the present invention, namely, the production of faster insulin, which is the preferred embodiment of the invention. By using 2-3 substitutions, improved miscibility with protected insulin preparations can be achieved. However, it is considered advantageous that the immediate objectives of the present invention can be achieved through more than three substitutions, as this allows you to realize the desired secondary goals.

 In particular, an additional level of substitution, for example the presence of 4 or 5 amino acid substituent residues, can produce an analog of human insulin, which is also less prone to fibrillation or polymerization at the phase boundary, which is a particularly desirable property when the insulin solution is designed for continuous infusion. In most cases, to obtain an analog of human insulin according to the invention, no more than 7 substitutions are realized in the insulin molecule. Preferably 2-4 substitutions.

 Genes encoding the precursors of the proposed insulin analogs can be obtained by modifying the genes encoding the above-described insulin precursors of formula II or III, in which all X are amino acid residues of human insulin, by site-specific mutagenesis to insert or replace codons or codons encoding the desired mutation , The DNA sequence encoding the precursor of the insulin analogue can be obtained by enzymatic synthesis from oligonucleotides corresponding to all or part of the gene dshestvennika insulin analog.

DNA sequences containing the gene with the desired mutation of the insulin gene are then combined with fragments encoding the TPI promoter (TPIp) (T. Alber and G. Kawasaki, "Nucleotid Sequence of the triose phosphate isomerase gene of Saccharomycea cerevistac. J. Mol. Applied. Jenet. I (1982) 419-434), MF α I-leader sequence (J. Kurjan and I. Herskowitz "Structure of an yeast pheromone gene (MF alpha I): A putative α-factor precursor contains four tandem coptes of mature α-factor. Cell 30 (1982) 933-943) and the sequence of transcription termination from TPI of S. cerevisiae yeast (TPI _T ). These fragments give sequences that provide a high transcription rate of the coding gene for the precursor, and also provide a subsequence that can localize the precursor in the secretory circuit and its further excretion in the growth medium. Expression units are also provided with a 2-micron yeast origin of replication and a selectable LEU2 marker.

 During in vivo alpha-factor maturation in yeast, the latter (C-terminus of six amino acids of the MF α I leader peptide (Lys-Arg-Glu-Ala-Glu-Ala) are sequentially removed from the alpha factor precursor using endopeptidase that recognizes the Lys sequence is Arg, and the aminodipeptidase that removes Glu-Ala residues (Julius D. et al., Cell 32 (1983) 839-852) To eliminate the need for yeast aminodipeptidase, the C-terminal Glu-Ala-Glu- coding sequence Ala MF α I leader, removed from the MF α I leader sequence by in vitro mutagenesis. In the following text, “MF α I leader” is denoted chaet whole leader sequence whereas "MF α I-leader (minus Glu-Ala-Glu-Ala)" means a leader sequence wherein the C-terminal deleted sequence Glu-Ala-Glu-Ala.

 Example 1. The construction of a synthetic gene encoding B (1-29) Ala-Ala-Lys, -A- (1-21) -human insulin.

 Yeast codon - an optimized structural gene for B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin is constructed as follows.

 The following 10 oligonucleotides shown in FIG. 6, synthesized on an automatic DNA synthesizer using phosphoramidite chemicals on a glass carrier with a controlled pore size (S.Z. Beancage & M.H. Caruthers (1981) Jetrehedren Letters 22, 1859-1869).

 Of these (Fig. 6) 10 ligonucleotides form 5 duplexes A-E, as shown in Fig.7.

20 pmoles of each of the AE duplexes are formed from the corresponding pairs of 5'-phosphorylated oligonucleotides IX by heating for 5 minutes at 90 ^° C, followed by cooling to room temperature for 75 minutes. 33-mer (X) in diplex E is not subjected to 5'-phosphorylation to avoid dimerization of complementary Xba I-single-stranded ends during ligation. Five duplexes are mixed and treated with T4 ligase. The synthetic gene is isolated as a band of 182/183 bp after electrophoresis of the ligation mixture on a 2% agarose gel.

 The resulting synthetic gene is presented in Fig.7.

The synthetic gene is ligated with 4 kbp KpnI-EcoRI fragment and 8 kbp XbaI-KpnI fragment from pMT644 and 0.3 kbp EcoRI-Hgal fragment from pKFN 9 to obtain the following structure: TPIp-MF α I-leader-B (1-29) -Ala-Ala-Lys-A (1-21) -TPL _T.

Plasmid pMT644 contains the DNA sequence TPIp-MF α I-leader-B (1-29) -A (1-21) -TPI _T and its construction is described in Danish patent N 1293/85. The construction of the plasmid pKFN9 is described below.

The ligation mixture was used to transform the competent strain of E. coli (r ^- , m ⁺ ) (MT172). 30 ampicillin-resistant colonies were transferred onto plates containing minimal M9 medium (T. Maniatis et al., Molecular Cloning, Cold Sprig Harbor Lab. 1982, p. 68), resulting in 8 Leu ⁺ colonies. Sequence determination by Maxam-Gilbert for ³² P-XbaI-EcoRI fragment showed that three plasmids contain the gene with the desired sequence. For further use, one plasmid pKFN27 was used.

 The construction of plasmid pKFN27 is shown in Fig. 8.

Construction of the plasmid pKFN9. The aim of constructing the plasmid pKFN9 is to obtain a plasmid containing the Hga I site immediately after the MF α I leader. Plasmid pMT544 (the construction of which is described in Danish Patent No. 278/85) was cut with Xba I and about 250 bases were removed from the 3 ′ end by ExoIII nuclease treatment. A synthetic 32-dimensional insert seed GGATAAAAGAGAGGCGCGTCTGAAGCTCACTC containing the Hga I sequence is hybridized to partially single-stranded DNA. Double-stranded ring DNA was prepared using Klenov polymerase and ligated using T4 ligase. After transformation of E. coli (r ^- , m ⁺ ) (MT172), colonies containing the mutated plasmid are identified by hybridization of the colonies with 5'- ³² P-labeled 32-dimensional insert seed. The appearance of a new Hga I site is confirmed by restriction enzyme digestion (EcoRI + HgaI, Hind 3 + HgaI). After repeated transformation, the “pure” mutant pKFN9 is selected for further use. The construction of pKFN9 is shown in FIG. 9.

 Example 2. Obtaining B27 Glu-human insulin.

B27 Glu-human insulin is obtained by transpeptidization of B27 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin with Thr-OBu ⁺ and the acidification of the obtained threonine ester with trifluoroacetic acid. The process of obtaining consists of the following stages:
I. Construction of the gene encoding B27 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) -insulin.

Plasmid pKFN27 is located on a single XbaI site located immediately after the synthetic insulin precursor gene. In order not to destroy the XbaI site upon binding in the step described below, each end of the linear plasmid is ligated with a 19-dimensional Hind 3-XbaI double-stranded linker
XbaI - Hind3
CTAGAAGAGCCCAAGACTA
TTCTCGGGTTCTGATTCGA
The linker is 5'-phosphorylated at the XbaI single-stranded end, but left unphosphorylated at the Hind 3-terminus, thereby eliminating the polymerization of the linker during the ligation step and obtaining ring DNA (see Fig. 10).

5'-mononucleotides are removed from the 3'-ends of the obtained linear double-stranded DNA by treatment with ExoIII nuclease. Treatment with ExoIII nuclease is carried out at 23 ^° C. under conditions under which about 250 nucleotides are removed from each 3 ′ end of the DNA (L. Guo and R. Wu (1983), Methods in Enzymdogy, lOO, 60-96).

 The 5'-phosphorylated 25-dimensional mutagenic primer d (GTTTCTTCTACGAACCTAAGGCTGC) is hybridized with a mutation site. After binding using Klenov polymerase in the presence of a T4 ligase, double-stranded DNA is digested with XbaI. Then heteroduplex ring DNA with a mutation in one strand using T4 ligase.

The ligation mixture was transformed into E. coli (r ^- , m ⁺ ) (MT172), selected for ampicillin resistance.

 Mutants are identified by hybridization of colonies with 5'-32P-labeled 25-dimensional mutagenic seed. After repeated transformation, it was shown that the plasmid pKFN37 at one of the resulting colonies contains the desired mutation according to 0.5 kb DNA determination data. XbaI-EcoRI fragments (A. Maxam and W. Gilbert (1980) Methods in Enzymology, 65, 499-560).

 II. Transformation.

 S. cerevisiae strain MT663 (E2-7B X EII-ZC a / alpha, Δtpi / Δtpi, pep 4-3 / pep 4-3) is grown on YPGAL (1% bacto-yeast extract, 2% bacto-peptone, 2% galactose, 2% lactate) to obtain an optical density of OD equal to 0.6 at a wavelength of 600 nm.

100 ml of culture are centrifuged, washed with 10 ml of water, re-centrifuged and resuspended in 10 ml of 1.2 M sorbitol, 25 mm Na ₂ EDTA pH 8.0, 6.7 mg / ml dithiotreitol. The suspension is incubated for 15 minutes at 30 ^° C, centrifuged and the cells are resuspended in 10 ml of 1.2 M sorbitol, 10 mM Na ₂ EDTA, 0.1 M sodium citrate pH 5.8, 2 mg Novozima 234. The suspension is incubated for 30 min at 30 ^o C, the cells are collected by centrifugation, washed in 10 ml of 1.2 M sorbitol and in 10 ml of CAS (1.2 M sorbitol, 10 mm CACl ₂ , 10 mm Tris (Tris = Tris (hydroxymethyl) - aminomethane) pH 7.5) and resuspended in 2 ml of CAS. To transform 0.1 ml of CAS-resuspended cells are mixed with approximately 1 μg of plasmid pKFN37 and left for 15 min at room temperature. 1 ml of 20% polyethylene glycol 4000, 10 mM CACl ₂ , 10 mM Tris pH 7.5 was added and the mixture was left at room temperature for another 30 minutes. The mixture was centrifuged and the pellets resuspended in 0.1 ml SOS (1.2 M sorbitol, 33 vol.% YPGal, 6.7 mm CACl ₂ , 14 μg / ml leucine) and incubated for 2 hours at 30 ^° C. Then, the suspension was centrifuged and the granules are resuspended in 0.5 ml of 1.2 M sorbitol. Add 6 ml of top agar (SC medium according to Sherman et al. (Methods in Yeast Genesis. Cold Spring Harbor Labs, 1981) in the absence of leucine and containing 1.2 M sorbitol + 2.5% agar) at 52 ^° C and the suspension is poured onto the top of the plates containing the same agar but solidified in the form of a sorbitol-containing medium. Transformation colonies were selected after 3 days at 30 ^° C., re-isolated and used for cultivation in liquid media. One such KFN40 transformant (= MT663 / pKFN37) was selected to obtain further characteristics.

 III. Expression of the precursor B27 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) insulin.

The KFN40 yeast strain is grown on YPD medium (1% yeast extract, 2% peptone (both manufactured by Diflo laborotriz) and 2% glucose). A 10 ml culture of the strain was shaken at 30 ^° C. to OD ₆₀₀ 26. After centrifugation, the supernatant was analyzed by antiphase HPLC and 13.5 mg / L of the precursor was detected.

 The analog in the supernatant is concentrated on a cation exchange column at low pH, followed by desorption with a suitable buffer solution. Crystallization is carried out using an alcohol citrate buffer.

 IV. Transpeptidation.

0.2 mol (47.1 g) Thr - OBu ^t , SPLA are dissolved in DMF to give 100 ml of solution, 50 ml of 76.5 vol.% DMF in water and 10 g of crude B27 Glu, B (1-29) are added. -Ala-Ala-Lys-A (1-21) -human insulin is dissolved in a mixture that is thermostated at 12 ^o C. Then add 1 g of trypsin in 25 ml of 0.05 M calcium acetate and after 24 hours at 12 ^o C the mixture add to 2 l of acetone and the precipitated peptides are isolated by centrifugation and dried in vacuum. B27 Glu, B30 Thr-Bu ^t- human insulin was purified on a preparative HPLC column with silica-C18 as the material of the column.

 V. Conversion to B27 Glu-human insulin.

B27 Glu, B30 Thr-OBu ^t- human insulin is dissolved in 100 ml of trifluoroacetic acid. After 2 hours at room temperature, the solution is lyophilized. The lyophilized powder was dissolved in 400 ml of 47.5 mm sodium citrate at pH 7. The peptides precipitated at pH 5.5 after adding 2.4 ml of 1 M ZnCl ₂ , isolated by centrifugation and dried in vacuum. The product is purified by anion exchange chromatography and the salt is removed by gel filtration. Yield: 1.7 g of B27 Glu-human insulin.

 Example 3. Obtaining B9 Asp-human insulin.

B9 Asp-human insulin is obtained by transpeptidization of B9 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin with Thr-OBu ^t and the acidification of the obtained threonine ester with trifluoroacetic acid.

 I. Construction of the gene encoding B29 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin.

 This gene is constructed using the same procedure as described for the gene encoding B27 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin, site-specific mutagenesis of pKFN27, directed 23-dimensional mutagenic seed d (CTTGTGCGGTGACCACTTGGTTG). The plasmid pKFN38 was shown to contain the desired mutation.

 II. Transformation.

 Plasmid pKFN38 was transformed into S. cerevisiae strain MT663 according to the procedure of Example 2, II, and the KFN41 transformant was isolated.

 III. Expression of B9 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin.

 The yeast strain KFN41 is grown on YPD medium as described in Example 2, III. 2.5 mg / L of the insulin analog precursor was detected in the supernatant.

 IV. Transpeptidation.

7.4 g of crude B9 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin are transpeptidized according to the procedure of example 2, IV to obtain B9 Asp, B30 Thr-OBu ⁺ -human insulin .

 V. Conversion.

B9 Asp, BZ0 Thr-OBu ⁺ -human insulin is converted to B9 Asp-human insulin according to the procedure of Example 2, V. Yield: 0.83 g of B9 Asp-human insulin.

 Example 4. Obtaining B9 Asp, B27 Glu-human insulin.

B9 Asp, B27 Glu-human insulin is obtained by transpeptidization of B9 Asp, B27 Glu, B (1-21) -Ala-Ala-Lys-A (1-21) -human insulin with Thr-OBu ⁺ , and by acidolysis of the obtained threonine ester trifluoroacetic acid.

 I. Construction of the gene encoding B9 Asp, B27 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin.

 367 bp EcoRI-Hind 3-fragment from pKFN8 (see example 3) and 140 bp The Hind 3-XbaI fragment from pKFN37 (see Example 2) is ligated with a large XbaI-EcoRI fragment of plasmid pUC13 (this plasmid is constructed according to the procedure described for pUC8 and pUC9 Vieira et al. (1982), Gene. 19, 259- 268). The ligation mixture was transformed into E. coli (MT172) selected for ampicillin resistance. Plasmids are obtained from a number of transformants and digested by PstI and Hind3. Fragment XbaI-EcoRI 0.5 kbp from one plasmid, which gave the correct restriction enzyme structures, are ligated with 7.8 kb XbaI-KpnI fragment and 4.3 kbp KpnI-EcoRI fragment, both of which are from pMT644 (described in Danish patent N 1293/84). The ligation mixture was transformed into E. coli (MT172) selected for ampicillin resistance. It was shown that plasmid pKFN43 from one of the resulting colonies contains the gene of the desired precursor of the insulin derivative according to the determination of the DNA sequence of 0.5 kbp XbaI-EcoRI fragment. The construction of pKFN43 is shown in FIG. 11.

 II. Transformation.

 Plasmid pKFN38 was transformed into S. cerevisiae strain MT663 according to the procedure of Example 2, II, and the KFN44 transformant was isolated.

 III. Expression of B9 Asp, B27 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin.

 The yeast strain KFN44 is grown on YPD medium as described in Example 2, III. 7.3 mg / L of the insulin analog precursor is obtained from the supernatant.

 IV. Transpeptidation.

12.7 crude B9 Asp, B27 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin are transpeptidized according to the procedure of example 2, IV to obtain B9 Asp, B27 Glu, B30 Thr- OBu ⁺ -human insulin.

 V. Conversion.

B29 Asp, B27 Glu, B30 Thr-OBu ^t- human insulin is converted to B9 Asp, B27 Glu, B30 Thr-human insulin and purified according to the procedure of Example 2, V. Yield: 1.0 B9 Asp, B27 Glu-human insulin.

 Example 5. Obtaining A8 His, B9 Asp, B27 Glu-human insulin.

A8 His, B9 Asp, B27 Glu-human insulin is obtained by transpeptidization of A8 His, B9 Asp, B27 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin using Thr-OBu ^t and acidolysis of the obtained threonine ester with trifluoroacetic acid according to the procedure of Example 2.

 I. Construction of the gene encoding A8 His, B9 Asp, B27 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin.

This gene is constructed using oligonucleotide directed mutagenesis using a double-strand break technique (J. Moinega, T. Frances chimi, S. Inonyl, M. Inonyl (1984) Biotechnology 2, 636-639). A pUC13-derived plasmid encoding the MFα I leader sequence and B9 Asp B27 precursor of Glu-human insulin (FIG. 11) was digested with HpaI and XbaI. The large fragment is mixed with a plasmid linearized with Ndl I. After denaturing by temperature and cooling, the mixture contains double-stranded duplexes with a single-stranded “window” in the region corresponding to the insulin precursor gene (HpaI-XbaI). The 37-dimensional mutagenic mismatch seed d (GAACAATGCTGTCACTCCATCTGCTCCTTGTACCAAT) is hybridized with pinched duplex followed by Klenov polymerase and ligation. The mixture is used to transform E. coli (MT172) selected for ampicillin resistance. Mutants are identified by hybridization of a colony with an 18-dimensional 5'- ³² P-labeled probe d (AATGCTGTCACTCCATCT). After repeated transformation, it was determined that the plasmid from one of the resulting colonies contains the desired mutation according to the determination of the DNA sequence of the XbaI-EcoRI fragment of 0.5 kbp This plasmid was used to construct the yeast plasmid pKFN102, as described in example 4 for the case of constructing pKFN43.

 II. Transformation.

 Plasmid pKFN102 was transformed into S. cereovisiae strain MT663 according to the procedure of Example 2, II, and the transformant KFN109 was isolated.

 III. Expression of A8 His, B9 Asp, B27 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin.

 The yeast strain KFN109 is grown on YPD medium as described in Example 2, III. 21.5 mg / L of the precursor of the insulin analogue was detected in the supernatant.

 IV-V. Transpeptidation and conversion.

 22.0 g of crude A8 His, B9 Asp, B27 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin are transpeptidized, converted and purified according to the procedure of Example 2, IV-V. Yield: 4.0 g A8 His, B9 Asp, B27 Glu-human insulin.

 Example 6. Obtaining B12 Ile-human insulin.

B12 Ile-human insulin is obtained by transpeptidation of B12 Ile, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin with Thr-OBu ⁺ and acidification of the obtained threonine ester with trifluoroacetic acid, as described in Example 2, I. Construction of the gene encoding B12 Ile, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin.

 0.5 kb EcoRI-XbaI fragment of pMT598 (construction of plasmid pMT598 is described in European Patent Application No. 0163529A) encoding MF α 1-leader (minus Glu-Ala-Glu-Ala) -B (1-29) -Ala-Ala-Lys- B (1-21) is inserted into the M13 mp 10 RF phage digested with XbaI-EcoRI, and the corresponding single-stranded DNA is purified from the M13 mp 10 recombinant phage. Single stranded template DNA was hybridized with a mutagenic 27-dimensional seed NOR-092 d (GTAGAGAGCTTCGATCAGGTGTGAGCC). Seeds are expanded with dNTPS and Klenov polymerase and ligated with T4 DNA ligase. The KFN92 mutagenic seed was chosen to destroy the Bst NI site (the only one in the XbaI-EcoRI fragment). Therefore, to select a relatively un-mutated EcoRI-XbaI fragment, the mixture was digested with Bst NI and then EcoRI and XbaI and ligated with the pUC13 vector by EcoRI and XbaI cleavage. A plasmid, pMT76O, which does not have a Bst NI site in the insulin coding sequence, is selected from one of the obtained transformants. The desired mutated sequence is checked by determining the DNA sequence according to Maxam Gilbert. Plasmid pMT760 contains 0.5 kbp EcoRI-XbaI sequence corresponding to the same fragment from pMT598 (see above), except for mutations in B12 (Val-Ile). This mutated sequence is then linked to a yeast expression plasmid by ligation with 0.5 kbp EcoRI-XbaI fragment from pMT76O with 7.8 bp XbaI-KpnI and 4.3 kbp KpnI-EcoRI fragment from pMT644 to obtain pMTA.

 II-V. Transformation, expression, transpeptidation, conversion.

 Plasmid pMTA is transformed into the yeast strain MT663, as described in example 2, II, and the transformed strain MTA is cultured according to the method of example 2, III. 10.4 mg / L of the insulin analog precursor is obtained from the supernatant. 10 g of the crude analog precursor are transpeptidized, converted and purified according to the procedure of Example 2, IV-V. Yield: 1.3 g of B12 Ile-human insulin.

 Example 7. Obtaining B12 Tyr-human insulin.

B12 Tyr-human insulin can be obtained by transpeptidation of B12 Tyr, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin with Thr-OBu ^t and acidification of the obtained threonine ester with trifluoroacetic acid according to the procedure of Example 2.

 I. Construction of the gene encoding B12 Tyr, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin.

 The gene is constructed by a method similar to the method of obtaining the gene encoding B12 Ile, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin with the exception that KFN93 d seed (GTAGAGAGCTTCGTACAGGTGTGAGCC) was used instead of KFN92 .

 II-IV. Transformation, expression, transpeptidation, conversion.

 Steps II-III are carried out according to the procedure of Example 2. 1.7 mg / L of the insulin analog precursor is obtained from the supernatant. The crude analog precursor can be transpeptidized, converted and purified according to the procedure of Example 2, IV-V to give B12 Tyr-human insulin.

 Example 8. Obtaining B10 Asp-human insulin.

B10 Asp-human insulin is obtained by transpeptidation of B10 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin with Thr-OBu ^t and the acidification of the obtained threonine ester with trifluoroacetic acid according to the procedure of Example 2.

 I. Construction of the gene encoding B10 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin.

 The gene is constructed according to a method similar to the generation of the gene encoding B12 Ile, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin, with the difference that KFN94 d seed (AGCTTCCACCAGATCTGAGCCGCACAG) was used instead of KFN92.

 II-V. Transformation, expression, transpeptidation, expression.

 Stage II-III is carried out according to the method of example 2. 36 mg / l of the precursor of the insulin analogue is detected in the supernatant. The crude analog precursor is transpeptidized, converted and purified according to the procedure of Example 2, IV-V. Yield: 7.6 g B10 Asp-human insulin.

 Example 9. Obtaining B28 Asp-human insulin.

 B28 Asp-human insulin is obtained by transposition of B28 Asp, B (1-29) -Als-Ala-Lys-A (1-21) -human insulin with Thr-OMe and hydrolysis of the obtained threonine ester at pH 8-12.

 I. Construction of the gene encoding B28 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin.

 0.5 kb The EcoRI-XbaI fragment of pMT462 (the construction of plasmid pMT462 is described in Danish patent application N 1257/86) encoding the MF α I leader (minus Glu-Ala-Glu-Ala) -B-C-A, i.e. the human proinsulin gene with the previous modified MFα I leader is inserted into the M13 mp 10RF phage, digested with XbaI-EcoRI and the corresponding single-stranded DNA is purified from the M13 mp 10 recombinant phage. Single stranded template DNA was hybridized with the NOR205 d mutagenic 41 seed seed (TTCCACAATGCCCTTAGCGGCCTTGTCTGTGTAGAAGAAGC) and the M13 d universal sequencing seed (TCCCAGTCACGACGT). Seeds are increased using dNTP and Klenov polymerase and ligated using T4 DNA ligase.

 After extraction with phenol, ethanol precipitation and re-suspension, the DNAs are digested with restriction enzymes Apa I, XbaI and KcoRI. After another phenol extraction, ethanol precipitation and re-suspension of the DNA, they are ligated with EcoRI-XbaI digested with pUC13. The ligation mixture is obtained from a number of transformants. Plasmid preparations are digested with EcoRI and XbaI and preparations giving bands of 0.5 and 0.6. KPO, re-transformed into E. coli. After repeated transformation, a transformant containing only pU13 with an insert of 0.5 kb is selected.

 Plasmid pMT881 with the desired mutation at B28 (Pro-Asp) is selected from one of the obtained transformants. The mutated sequence is checked by determining the DNA sequence according to the Maxam-Gilbert method. Then the mutated sequence is transferred to a yeast expression plasmid by ligation of 0.5 kbp EcoRI-XbaI fragment of pMT881 with 7.8 kbp XbaI-KpnI & 4.3 c.p. KpnI EcorI fragment from pMT644 to obtain pMTA1.

 II. Transformation.

 Plasmid pMTA1 was transformed into S. cerevisiae strain MT663 according to the procedure of Example 2, II, and the transformant MTA1 was isolated.

 III. Expression of B28 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) -human insulin.

 The yeast strain MTA1 is grown on YPD medium as described in Example 2, III. From the supernatant obtained: 7.2 mg / l of the precursor of the insulin analogue.

 IV. Transpeptidization.

The crude B28 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) is transpeptized according to the procedure of Example 2, IV by replacing Thr-OBu ^t with Thr-OMe to give B28 Asp, B30 Thr-OMe- human insulin.

 V. Conversion.

B28 Asp, B30 Thr-OMe-human insulin is dispersed in water up to 1% (w / v) and dissolved by adding 1N. sodium hydroxide to a pH of 10.0. The pH was kept constant at 10.0 for 24 hours at 25 ^° C. The Asp-human insulin formed by B28 was precipitated by the addition of sodium chloride up to 8% (w / v), sodium acetate trihydrate up to 1.4% (w. / vol.) and zinc acetate dihydrate to 0.01% (wt./about.) with the subsequent addition of 1N. hydrochloric acid to a pH of 5.5. The precipitate was isolated by centrifugation and purified by anion exchange chromatography and the salts were removed by gel filtration. Yield: 0.2 g B28 Asp-human insulin.

 Example 10. Obtaining A21 Asp, B9 Asp, B27 Glu-human insulin.

A21 Asp, B9 Asp, B27 Glu-human insulin is obtained from B9 Asp, B27 Glu-human insulin by selective deamidation (hydrolysis of a 5% solution for 14 days at 37 ^° C, pH 2.5). The deamidated product is isolated by anion exchange chromatography.

 Example 11. Obtaining B27 Asp, A21 Asp-human insulin.

B21 Glu, A21 Asp-human insulin is obtained by transpeptidization of B27 Glu, B21 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) with Thr-OBu ⁺ and acidification of the obtained threonine ester with trifluoroacetic acid according to the procedure example 2.

 B27 Glu, A21 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) are obtained from B27 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) ( see example 2) deamidation, as described in example 10.

 Example 12. B26 Glu-human insulin was obtained by transpeptidation of B26 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) Thr-OMe and hydrolysis of the obtained threonine ester at a pH of from about 8 to 12, as described in example 9. The yield was 6 mg.

 Example 13. B9 Asp, B27 Arg-human insulin was obtained by transpeptidation of B9 Asp, B27 Arg, B (1-29) -Ala-Ala-Lys-A (1-21) Thr-OMe and hydrolysis of the obtained threonine ester at pH from about 8 to 12, as described in example 9. The yield was 0.5 g.

 Example 14. B16 Glu, B27 Glu human insulin was obtained by transpeptidation of B16 Glu, B27 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) Thr-OMe and hydrolysis of the obtained threonine ester at pH from about 8 to 12, as described in example 9. The yield was 8 g.

 Example 15. B20 Gln-human insulin was obtained by transpeptidation of B20 Gln, B (1-29) -Ala-Ala-Lys-A (1-21) Thr-OMe and hydrolysis of the obtained threonine ester at a pH of from about 8 to 12, as described in example 9. The yield was 22 mg.

 Example 16. A13 Ser, B27 Glu-human insulin was obtained by transpeptidation of A13 Ser, B27 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) Thr-OMe and hydrolysis of the obtained threonine ester at pH from about 8 to 12, as described in example 9. The yield was 7.4 g.

 Example 17. B10 Asp, B28 Asp-human insulin was obtained by transpeptidation of B10 Asp, B28 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) Thr-OMe and hydrolysis of the obtained threonine ester at pH from about 8 to 12, as described in example 9. The yield was 3 g.

 Example 18. B17 Gln human insulin was obtained by transpeptidation of B17 Gln, B (1-29) -Ala-Ala-Lys-A (1-21) Thr-OMe and hydrolysis of the obtained threonine ester at a pH of from about 8 to 12, as described in example 9. The yield was 4.2 g.

 Example 19. B19 Glu, B27 Glu-human insulin was obtained by transpeptidation of B1 Glu, B27Glu, B (1-29) -Ala-Ala-Lys-A (1-21) Thr-OMe and hydrolysis of the obtained threonine ester at pH from about 8 to 12, as described in example 8. The yield was 24.4 g.

 Example 20. B2 Asp, B5 Ser, B27 Glu-human insulin was obtained by transpeptidization of B2 Asp, B5 Ser, B27 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) Thr-OMe and hydrolysis of the obtained threonine ester at a pH of from about 8 to 12, as described in example 9. The yield was 4.8 g.

 Example 21. B10 Thr-human insulin was obtained by transpeptidation of B10 Thr, B (1-29) -Ala-Ala-Lys-A (1-21) Thr-OMe and hydrolysis of the obtained threonine ester at a pH of from about 8 to 12, as described in example 9. The yield was 6.4 g.

 Example 22. A13 Glu, B10 Glu-human insulin was obtained by transpeptidation of A13 Glu, B10 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) Thr-OMe and hydrolysis of the obtained threonine ester at pH from about 8 to 12, as described in example 9. The yield was 25.2 g.

 Example 23. B2 Ser, B10 Asp-human insulin was obtained by transpeptidization of B2 Ser, B10 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) Thr-OMe and hydrolysis of the obtained threonine ester at pH from about 8 to 12, as described in example 9. The yield was 7.3 g.

 Example 24. B16 His human insulin was obtained by transpeptidation of B16 His, B (1-29) -Ala-Ala-Lys-A (1-21) Thr-OMe and hydrolysis of the obtained threonine ester at a pH of from about 8 to 12, as described in example 9. Yield 78 g.

 Example 25. A21 Glu, B10 Asp-human insulin was obtained by transpeptidation of A2l Glu, B10 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) Thr-OMe and hydrolysis of the obtained threonine ester at pH from about 8 to 12, as described in example 9. The yield was 9.3 g.

 Example 26. A2l Glu, B28 Asp-human insulin was obtained by transpeptidation of A21 Glu, B28 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) Thr-OMe and hydrolysis of the obtained threonine ester at pH from about 8 to 12, as described in example 9. The yield was 3.4 g.

 Example 27. A21 Glu, B9 Asp-human insulin was obtained by transpeptidation of A21 Glu, B9 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) Thr-OMe and hydrolysis of the obtained threonine ester at pH from about 8 to 12, as described in example 9. Yield 1.3 g.

Example 28. B9 Asn-human insulin was obtained by transpeptidation of B9 Asn, B (1-29) -Ala-Ala-Lys-A (1-21) human insulin Thr-Ome at 20 ^° C. and hydrolysis of the obtained threonine ester at a pH of about 8-12 and at a temperature of 26 ^o C, as described in example 9. The yield was 3 g.

Example 29. B10 Asp-human insulin was obtained by transpeptidation of B10 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) human insulin Thr-OMe at 18 ^o C and hydrolysis of the obtained threonine ester at the pH is about 8-12 and at a temperature of 10 ^o C, as described in example 9. The yield was 43 g.

Example 30. B16 Gln-human insulin was obtained by transpeptidation of B16 Gln, B (1-29) -Ala-Ala-Lys-A (1-21) human insulin Thr-OMe at 40 ^o C and hydrolysis of the obtained threonine ester at a pH of about 8-12 and at a temperature of 5 ^o C, as described in example 9. The yield was 1 g.

Example 31. B17 Ala-human insulin was obtained by transpeptidation of B17 Ala, B (1-29) -Ala-Ala-Lys-A (1-21) human insulin Thr-OMe at 5 ^o C and hydrolysis of the obtained threonine ester at a pH of about 8-12, as described in example 9. The yield was 4 g.

Example 32. B28 Asp-human insulin was obtained by transpeptidation of B28 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) human insulin Thr-OMe at 15 ^o C and hydrolysis of the obtained threonine ester at a pH of about 8-12, as described in example 9. The yield was 17 g.

Example 33. B9 Glu, A21 Gly-human insulin was obtained using the transpeptidation B9 Glu, A21 Gly, B (1-29) -Ala-Ala-Lys-A (1-21) human insulin Thr-OMe at 12 ^o C and hydrolysis of the obtained threonine ester at a pH of about 8-12, as described in Example 9. The yield was 4.6 g.

Example 34. B16 Asp, A21 Gly-human insulin was obtained using the transpeptidation B16 Asp, A21 Gly, B (1-29) -Ala-Ala-Lys-A (1-21) human insulin Thr-OMe at 12 ^o C and hydrolysis of the obtained threonine ester at a pH of about 8-12, as described in Example 9. The yield was 0.2 g.

Example 35. B9 Asp, B27 Glu, A21 Gly-human insulin was obtained using the transpeptidation B9 Asp, B27 Glu, A21 Gly, B (1-29) -Ala-Ala-Lys-A (1-21) human insulin Thr -OMe at 12 ^o C and hydrolysis of the obtained threonine ester at a pH of about 8-12 and at a temperature of 0 ^o C in other respects, as described in example 9. The yield was 1.3 g.

Example 36. B9 Glu, B27 Glu, A21 Gly-human insulin was obtained using the transpeptidation B9 Glu, B27 Glu, A21 Gly, B (1-29) -Ala-Ala-Lys-A (1-21) human insulin Thr -OMe at 10 ^o C and hydrolysis of the obtained threonine ester at a pH of about 8-12, as described in example 9. The yield was 2 g.

Example 37. B9 Glu, B10 Glu, A21 Gly-human insulin was obtained using the transpeptidation B9 Glu, B10 Glu, A21 Gly, B (1-29) -Ala-Ala-Lys-A (1-21) human insulin Thr -OMe at 0 ^o C and hydrolysis of the obtained threonine ester at a pH of about 8-12, as described in example 9. The yield was 2 g.

 Example 38. B2 Ser, B10 Glu, B27 Glu, A8 His, A21 Gly-human insulin was obtained using the transpeptidation B2 Ser, B10 Glu, B27 Glu, A8 His, A21 Gly, B (1-29) -Ala-Ala -Lys-A (1-21) of human insulin Thr-OMe and hydrolysis of the obtained threonine ester at a pH of about 8-12, as described in Example 9. The yield was 1.1 g.

Example 39. B9 Gln-human insulin was obtained by transpeptidation of B9 Gln, B (1-29) -Ala-Ala-Lys-A (1-21) human insulin Thr-OMe at 40 ^o C and hydrolysis of the obtained threonine ester at a pH of about 8-12, as described in example 9. The yield was 0.4 g.

 Example 40. B5 Tyr-human insulin was obtained by transpeptidation of B5 Tyr, B (1-29) -Ala-Ala-Lys-A (1-21) human insulin at a pH of about 8-12, as described in example 9. The yield was 0.5 g.

Example 41. B14 Ser, B17 Asp-human insulin was obtained by transpeptidation of B14 Ser, B17 Asp, B (1-29) -Ala-Ala-Lys-A (1-21) human insulin Thr-OMe at 17 ^o C and hydrolysis of the obtained threonine ester at a pH of about 8-12, as described in Example 9. The yield was 0.3 g.

 Example 42. B16 Glu, B27 Glu-human insulin was obtained using the transpeptidation of B16 Glu, B27 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) human insulin Thr-OMe and hydrolysis of the obtained complex threonine ester at a pH of about 8-12, as described in Example 9. The yield was 8 g.

 Example 43. B9 Glu, B10 Glu-human insulin was obtained by transpeptidation of B9 Glu, B10 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) human insulin Thr-OMe and hydrolysis of the obtained complex threonine ester at a pH of about 8-12, as described in Example 9. The yield was 20 g.

 Example 44. B10 Glu, des B30-human insulin was obtained by converting B10 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) human insulin to B10 Glu, des B30-human insulin using trypsin in an aqueous solution. The yield was 5 g.

 Example 45. B1 Glu, B28 Glu-human insulin was obtained by transpeptidation of B1 Glu, B28 Glu, B (1-29) -Ala-Ala-Lys-A (1-21) human insulin Thr-OMe and hydrolysis of the obtained complex threonine ester at a pH of about 8-12, as described in Example 9. The yield was 6.5 g.

 Characterization of an analogue of human insulin according to the present invention.

 Determination of molecular weight (Gutfreund H, Biochemical Journal, 42 (544) 1948).

 Methodology: membrane osmometer "Knauer", type: 1.00; Schleicher & Scholl membrane, type: R52.

Solvent: 0.05 M NaCl pH 7.5, temperature 21 ^o C.

 Results: all types of insulin were measured at a concentration of 4 mg / ml.

Type of insulin - Molecular mass, kDa
Human 2Zn-insulin - 36 ± 2
Human zinc-free insulin - 29 ± 1
Zinc-free B27 Glu-human insulin - 22 ± 1
Zinc-free B12 Ile-human insulin - 17 ± 1
Zinc-free B27 Glu, B21 Asp-human insulin - 8 ± 1
Zinc-free B9 Asp, B27 Glu-human insulin - 6 ± 1
Zinc-free B9 Asp-human insulin - 6 ± 1
Zinc-free B9 Asp, B27 Glu, A21 Asp-human insulin - 6 ± 1
Zinc-free B9 Asp, B27 Glu, A8 His-human insulin - 9 ± 1
Zinc-free B10 Asp-human insulin - 12 ± 1
Zinc-free B28 Asp-human insulin - 9 ± 2
As can be seen from the above data, analogues of human insulin have a significantly lower molecular weight than human insulin, which leads to a decrease in self-association in dimers, tetramers and hexamers, or in some cases to its absence.

 As follows from the table below, the time for a 50% disappearance of insulin analogs from the injection site is significantly reduced compared to human insulin.

 The biological potency of insulin analogues is comparable to that of human insulin or not much less.

Claims (3)

 1. Analogues of human insulin having the General formula I, shown on p. where X is the amino acid residue of human insulin or a substitution, which at position A ₈ may be His, Glu or Asp, at position A _{1 3} Ser, Glu or Asp, at position A _{2 1} Asp, Glu, Ser, Thr or Gly, at position B ₁ Glu or Asp, at position B ₂ Glu, Asp or Ser, at position B ₅ Glu, Asp, Ser or Tyr, at position B ₉ Asp, Glu, Gln or Asn, at position B _{1 0} Glu, Asp or Thr in position B _{1 2} Ile or Tyr, in position B _{1 4} - Glu, Asp or Ser, in position B _{1 6} Asp, Gln, Glu or His, in position B _{1 7} Gln, Glu, Asp or Ala, in position B _{2 0} Gln, Asp or Glu, at position B _{2 6} Glu or Asp, at position B _{2 7} Glu, Asp or Arg and at position B _{2 8} Asp or Glu; A ₁ -O or Gly, and / or A _{2 1} -O or X, and / or B ₁ -O or X, and / or B ₁ -O or X, and / or B _{3 0} -O or Thr, with the condition of substitution of at least one amino acid residue in the B chain and not more than 7 of the total number of substitutions in the B and A chains,
having mol.m. approximately 6000 kDa and activity essentially similar to the activity of human insulin.  2. The method for producing human insulin analogues of the formula according to claim 1, wherein the Saccharomyces cerevisiae yeast strain is transformed with a replicable plasmid containing the DNA sequence encoding the precursor of the insulin analogue of formula II shown in p. where X has the indicated meaning;
Q _{n is a} peptide chain with n natural amino acid residues;
R Lys or Arg;
n 0 33, an integer;
m 0 or 1,
the cells are cultured in a suitable nutrient medium, the precursor is isolated from the supernatant of the culture medium and converted to human insulin analogues by reaction with L-threonine ester or its salt in an organic solution at 12 ^{° C.} in the presence of trypsin or its derivatives, the obtained insulin threonine ester a person is hydrolyzed under acidic or basic conditions at room temperature and the desired product is isolated.  3. An injection solution having insulin activity, comprising the human insulin analogue according to claim 1, or a pharmaceutically acceptable salt thereof and water, preferably neutral pH.

Images