RU2045575C1

RU2045575C1 - RECOMBINANT PLASMIDE DNA PPR-TGATG-HIL-Iβ-TSR WHICH PROVIDES SYNTHESIS OF RECOMBINANT INTERLEIKIN-1 AND STRAIN BSCHERICHIA COLI BEING PRODUCER OF RECOMBINANT HUMAN INTERLEIKIN-1 b

Info

Publication number: RU2045575C1
Application number: SU5024478/13A
Authority: RU
Inventors: С.В. Машко; М.И. Лебедева; Ю.П. Винецкий; С.В. Котенко; С.А. Кетлинский; А.С. Симбирцев; А.П. Козлов; Л.С. Изотова; Ю.И. Козлов; В.Г. Дебабов
Original assignee: Государственный научно-исследовательский институт генетики и селекции промышленных микроорганизмов
Priority date: 1992-01-29
Filing date: 1992-01-29
Publication date: 1995-10-10

Abstract

FIELD: microbiological and medicinal industries, molecular biology, biotechnology. SUBSTANCE: with the help of prepared plasmide pPR-TGATG-hIL-Iβ-tsr strain E. coli is obtained. Said strain produces human interleikin-1 b, its quantity being 5-10 mg per 1 g of humid cells or 10-12 of total cellular protein. Specific activity thus prepared interleikin is 2×10⁸ IU per 1 mg of purified preparation. EFFECT: improves quality of desired product. 3 cl, 3 dwg

Description

Изобретение относится к микробиологической и медицинской промышленности, молекулярной биологии и генно-инженерной биотехнологии и представляет собой сконструированную in vitro рекомбинантную плазмидную ДНК, обеспечивающую микробиологический синтез рекомбинантного интерлейкина-1 бета человека и штамм E.coli, содержащий эту рекомбинантную плазмиду, продуцент интерлейкина-1 бета. The invention relates to the microbiological and medical industries, molecular biology and genetic engineering biotechnology, and is a recombinant plasmid DNA constructed in vitro that provides microbiological synthesis of recombinant human interleukin-1 beta and E. coli strain containing this recombinant plasmid, interleukin-1 beta producer .

Цитокины (интерлейкины, см. ниже) это достаточно большая группа веществ, представленная в основном гликопептидами с Mw 15-20 КД, которые продуцируются различными клетками организмов высших млекопитающих, в том числе и человека, и действуют на реакции иммунной системы (Sporn and Roberts, 1991). Цитокины можно разделить на две большие группы лимфокины (синтезируются лимфоцитами) и монокины (синтезируются моноцитами). Кроме того, существует термин "интерлейкин", который присваивается только наиболее изученным с молекулярной и биологической точки зрения цитокинам. Cytokines (interleukins, see below) are a fairly large group of substances, represented mainly by glycopeptides with Mw 15-20 CDs, which are produced by various cells of organisms of higher mammals, including humans, and act on the reactions of the immune system (Sporn and Roberts, 1991). Cytokines can be divided into two large groups of lymphokines (synthesized by lymphocytes) and monokines (synthesized by monocytes). In addition, there is the term "interleukin", which is assigned only to the most studied from a molecular and biological point of view cytokines.

К настоящему времени выделены и всесторонне охарактеризованы 11 интерлейкинов. To date, 11 interleukins have been isolated and comprehensively characterized.

Предпринятые широкие исследования интерлейкинов позволили показать существование в организме новой системы регуляции иммунных и воспалительных реакций организма, в которой интерлейкины играют роль медиаторов. Выяснилось также, что синтез интерлейкинов происходит лишь в ответ на стимул и манифестирует начало ответной реакции иммунокомпетентных клеток. Интерлейкины обладают широким спектром активностей. Они являются стимуляторами лимфоцитов, тем самым обеспечивают необходимый уровень иммунитета, способствуют развитию температурной реакции организма, активируют синтез острофазовых белков (С-реактивный белок и др.), привлекают в область поражения клетки воспаления, стимулируют образование кроветворных элементов, принимают участие в обновлении костной и хрящевой тканей, обеспечивают защиту организма от опухолевых клеток, опосредуют реакции центральной и периферической нервной систем и многие другие функции. Extensive studies of interleukins made it possible to show the existence in the body of a new system of regulation of the immune and inflammatory reactions of the body, in which interleukins play the role of mediators. It was also found that the synthesis of interleukins occurs only in response to a stimulus and manifests the onset of a response of immunocompetent cells. Interleukins have a wide range of activities. They are stimulators of lymphocytes, thereby providing the necessary level of immunity, contribute to the development of the temperature reaction of the body, activate the synthesis of acute phase proteins (C-reactive protein, etc.), attract inflammatory cells to the affected area, stimulate the formation of hematopoietic elements, take part in bone and cartilage tissue, protect the body from tumor cells, mediate the reaction of the central and peripheral nervous systems and many other functions.

При старении организма, инфекционных и злокачественных заболеваниях и других патологических процессах происходит нарушение интерлейкиновой регуляции, что приводит к резкому снижению защитных реакций. Так например, при СПИДе полностью отсутствует интерлейкин-2, а при ожоговой болезни снижается синтез ряда интерлейкинов, такая же картина наблюдается при анемиях и лейкопениях. С другой стороны, многие аутоиммунные заболевания, аллергические состояния характеризуются повышенной продукцией интерлейкинов. К ним прежде всего относятся заболевания щитовидной железы, артриты, вирусные и бактериальные менингиты и другие. В ряде клинических и экспериментальных исследований было показано, что экзогенное введение интерлейкинов способствует защите организма от радиации, инфекции (в тех случаях когда антибиотики оказываются неэффективными), септического шока и других состояниях. With the aging of the body, infectious and malignant diseases and other pathological processes, interleukin regulation is disturbed, which leads to a sharp decrease in protective reactions. For example, with AIDS, interleukin-2 is completely absent, and with a burn disease, the synthesis of a number of interleukins decreases, the same picture is observed with anemia and leukopenia. On the other hand, many autoimmune diseases, allergic conditions are characterized by increased production of interleukins. These primarily include thyroid diseases, arthritis, viral and bacterial meningitis, and others. A number of clinical and experimental studies have shown that exogenous administration of interleukins helps protect the body from radiation, infection (in those cases when antibiotics are ineffective), septic shock, and other conditions.

По крайней мере некоторые из интерлейкинов (в частности, hIL-1beta и hIL-1alpha) оказывают на организмы млекопитающих ярко выраженное протекторное действие от радиоактивного излучения. В настоящее время этот эффект неоднократно продемонстpирован за рубежом и в нашей стране, разрабатываются медицинские аспекты его применения. At least some of the interleukins (in particular, hIL-1beta and hIL-1alpha) have a pronounced protective effect on mammalian organisms from radioactive radiation. Currently, this effect has been repeatedly demonstrated abroad and in our country, and medical aspects of its application are being developed.

Большое значение интерлейкины имеют при пересадке костного мозга. Interleukins are of great importance in bone marrow transplantation.

К настоящему времени показана возможность эффективного применения интерлейкинов для диагностики и лечения ряда заболеваний. Однако единственным источником получения этих веществ в препаративных количествах, необходимых для их применения в медицине, являются искусственно созданные бактериальные штаммы-продуценты рекомбинантных интерлейкинов. To date, the possibility of the effective use of interleukins for the diagnosis and treatment of a number of diseases has been shown. However, the only source for producing these substances in the preparative amounts necessary for their use in medicine is artificially created bacterial strains producing recombinant interleukins.

Получены генно-инженерные продуценты интерлейкинов-2 (см. в частности, Дебабов и др. 1987), -3, -4, фактора некроза опухолей. Готовятся к выпуску интерлейкин-2 и фактор некроза опухоли. Проходят испытания на безвредность колоние-стимулирующие факторы. Genetically engineered producers of interleukins-2 were obtained (see, in particular, Debabov et al. 1987), -3, -4, tumor necrosis factor. Interleukin-2 and tumor necrosis factor are being prepared for release. Colony-stimulating factors are being tested for harmlessness.

Как правило, образующийся в результате микробиологического синтеза рекомбинантный интерлейкин характеризуется наличием дополнительного остатка метионина. В случае отщепления N-концевого метионина рекомбинантного полипептида N-терминальной аминопептидазой бактериальной клетки интерлейкин, синтезируемый микробиологическим способом, может быть использован как для фундаментальных исследований молекулярных механизмов взаимодействия с клеточными рецепторами, так и в практической медицине. As a rule, the recombinant interleukin resulting from microbiological synthesis is characterized by the presence of an additional methionine residue. In the case of cleavage of the N-terminal methionine of the recombinant polypeptide by the N-terminal aminopeptidase of the bacterial cell, the interleukin synthesized by the microbiological method can be used both for basic studies of the molecular mechanisms of interaction with cell receptors and in practical medicine.

Аналогами предлагаемого изобретения можно считать штаммы E. coli [pLNIL1beta] (Kronheim et al. 1986); E.coli [pILPbeta] (March et.al. 1985); E. coli W3110 [P_L-Mu IL-1beta] (Wingfield et al. 1986) продуценты рекомбинантного интерлейкина-1 бета человека и содержащиеся в соответствующих бактериальных клетках рекомбинантные плазмиды, обозначения которых приведены в квадратных скобках в названии рекомбинантного штамма. В составе указанных плазмид структурная часть гена интерлейкина-1 бета человека находится под транскрипционным контролем раннего промотора бактериофага лямбда (p_L), а инициация трансляции соответствующего белкового продукта осуществляется в результате взаимодействия рибосом с гибридным участком, включающим каноническую химически синтезированную SD-последовательность (Kronheim et al. 1986), либо SD-последовательность гена бета-галактозидазы E.coli (March et al. 1985), либо SD-последовательность гена ner бактериофага Mu (Wingfield et al. 1986). Гибридный участок содержит также химически синтезированный ATG-кодон, расположенный в результате генно-инженерного конструирования непосредственно перед первым аминокислотным кодоном зрелого интерлейкина-1 бета человека Ala¹¹⁷, образующегося в условиях in vivo результате посттрансляционного процессинга пре-проинтерлейкина-1 бета человека.The analogues of the present invention can be considered strains of E. coli [pLNIL1beta] (Kronheim et al. 1986); E. coli [pILPbeta] (March et.al. 1985); E. coli W3110 [P _L- Mu IL-1beta] (Wingfield et al. 1986) are producers of recombinant human interleukin-1 beta and the recombinant plasmids contained in the corresponding bacterial cells are indicated in square brackets in the name of the recombinant strain. In the composition of these plasmids, the structural part of the human interleukin-1 beta gene is under transcriptional control of the early promoter of the bacteriophage lambda (p _L ), and translation of the corresponding protein product is initiated as a result of the interaction of the ribosomes with a hybrid region that includes the canonical chemically synthesized SD sequence (Kronheim et al. 1986), either the SD sequence of the E. gali beta-galactosidase gene (March et al. 1985) or the SD sequence of the bacteriophage ner ner gene Mu (Wingfield et al. 1986). The hybrid region also contains a chemically synthesized ATG codon located as a result of genetic engineering immediately before the first amino acid codon of the mature human interleukin-1 beta Ala ¹¹⁷ , which is formed in vivo by post-translational processing of human pre-interleukin-1 beta.

Максимальный выход целевого продукта был зарегистрирован Кронхеймом и соавт. (Kronheim et al. 1986) в том случае, когда в условиях термоиндукции при 42^оС рекомбинантные клетки E.coli продолжали биосинтез интерлейкина-1 бета в течение 15-20 ч. При этом доля образующегося целевого полипептида достигла 30% от суммарных клеточных белков, но весь интерлейкин-1 бета был локализован во фракции нерастворимых клеточных полипептидов, что значительно затрудняло последующее выделение целевого продукта способами, пригодными для приготовления препаратов для медицины (в частности, использовались ионные детегенты типа SDS и/или гуанидингидрохлорид) (Kane and Hartley, 1988).The maximum yield of the target product was recorded by Kronheim et al. (Kronheim et al. 1986) in the case where under termoinduktsii at 42 ^C. Recombinant E.coli cells continued biosynthesis of interleukin-1 beta for 15-20 hours. The proportion of the target polypeptide generated has reached 30% of total cell protein , but all interleukin-1 beta was localized in the fraction of insoluble cellular polypeptides, which greatly complicated the subsequent isolation of the target product by methods suitable for the preparation of medicines for medicine (in particular, ionic detergents such as SDS and / or guanidine hydrochloride were used chloride) (Kane and Hartley, 1988).

Из всех аналогов прототипом можно считать штамм, описанный Kikumoto et al. 1987. Он является наиболее близким по техническому решению к предлагаемому штамму синтезирует до 10-12% интерлейкина от суммарных белков бактериальной клетки, интерлейкин-1 бета входит в состав водорастворимой фракции клеточных белков. Однако детальный анализ выделенного рекомбинантного продукта показывает наличие в его составе 20% непроцессированных белковых молекул, содержащих N-концевой остаток Met, не присутствующий у природных молекул интерлейкина-1 бета, что может приводить к некоторым нежелательным последствиям медицинского применения целевого белка. Of all the analogues, the strain described by Kikumoto et al. 1987. It is the closest in technical solution to the proposed strain synthesizes up to 10-12% of interleukin from the total proteins of the bacterial cell, interleukin-1 beta is part of the water-soluble fraction of cellular proteins. However, a detailed analysis of the isolated recombinant product shows the presence of 20% of unprocessed protein molecules containing the N-terminal Met residue, which is not present in natural interleukin-1 beta molecules, which may lead to some undesirable consequences of the medical use of the target protein.

Целью представленной группы изобретений является получение штамма-продуцента интерлейкина-1 бета человека, позволяющего обеспечить высокий выход интерлейкина-1 бета, неотличимого по структуре от природного, и получить препарат, не содержащий примесей, пригодный для медицинских целей. The aim of the present group of inventions is to obtain a producer strain of human interleukin-1 beta, which allows to provide a high yield of interleukin-1 beta, indistinguishable in structure from natural, and to obtain a drug that does not contain impurities suitable for medical purposes.

Цель достигается конструированием новой рекомбинантной плазмиды pPR-TGATG-hIL-1beta-tsr с регулируемой копийностью (фиг.1), которая обеспечивает экспрессию гена hIL-1beta под контролем регуляторной области p_Ro_R бактериофага лямбда, имеет длину 7,3х10³ н.п. состоит из большого (6,6х10³ н.п.) EcoRI-SalGI фрагмента векторной плазмиды pPR53-tsr (Mashko et al. 1991) и малого (0,7х10³ н. п. ) EcoRI-SalGI фрагмента плазмиды pPR-TGATG-hIL-beta (Mashko et al. 1991) и характеризуется следующими признаками:
содержит участок, ответственный за инициацию репликации и ее регуляцию (ori pSC101), а также генетический локус, обеспечивающий стабильное наследование и правильное распределение малокопийной плазмиды между дочерними клетками при делении бактерии (par pSC101) из исходной векторной плазмиды pSC101 (Bernardi and Bernardi, 1984); участок, ответственный за репликацию плазмиды ColE1, в котором промотор праймерной РНК-РНК II (Davison, 1984) в результате олигонуклеотид-направленного сайт-специфического мутагенеза (Kunkel, 1985) заменен на промотор p_L бактериофага лямбда (Sanger et al. 1982), что делает репликацию и тем самым увеличение копий образованной рекомбинантной плазмиды, зависящей от условий депрессии указанного фагового промотора; ген термочувствительного репрессора (cIts857) фага лямбда; ген устойчивости к ампициллину (Ap^R) плазмиды pBR322 (Sutcliffe, 1979); тандем ро-независимых терминаторов транскрипции фага fd (ter_fd); промотор p_R фага лямбда, участки инициации трансляции и первые аминокислотные кодоны (22 и 72, соответственно) генов cro (cro') фага лямбда и cat (cat') транспозона Tn9 E.coli, а также фрагмент клонированный ранее кДНК (Котенко и др. 1989), кодирующий последовательность зрелого интерлейкина-1 бета человека (hIL-1beta) и модифицированный в результате сайт-специфического мутагенеза таким образом, что перед первым аминокислотным кодоном зрелого интерлейкина Ala¹¹⁷ во вновь образованном структурном гене был расположен дополнительный метиониновый, ATG, кодон, которому предшествовал фрагмент межцистронной области генов trpE-trpD E.coli (ON):

._->3', где жирным шрифтом выделен дополнительный инициирующий формилметиониновый кодон, ATG, а подчеркнут кодон Ala¹¹⁷ структурной части зрелого интерлейкина-1 бета человека;
соединение модифицированного таким образом гена hIL-1 beta с кодирующей частью генов cro'-cat' было осуществлено таким образом, что в результате в полученной плазмиде под контролем промотора p_R оказался гибридный оперон, в котором дистальным к промотору геном является структурная часть hIL-1beta, а проксимальным открытая трансляционная рамка считывания гибридного гена cro'-cat'-ON, перекрывающаяся своим терминирующим кодоном, TGA, с инициирующим, ATG, кодоном интерлейкина-1 бета, как это имеет место в природной межцистронной области генов trpE-trpD E.coli, а терминация транскрипции мРНК образованного гибридного оперона с частично перекрывающимися цистронами осуществляется на тандеме терминаторов транскрипции фага fd; при этом в результате конструирования перед структурным геном hIL-1beta, и тем самым в кодирующей части гибридного цистрона cro'-cat'-ON, образован участок связывания рибосом, имеющий следующую нуклеотидную последовательность:
5'-.AGGAGACTTTCTGATG.->3',
где AGGAG-SD последовательность гена trpD e.coli;
плазмида имеет уникальные участки узнавания рестриктаз EcoRI, координата которого выбрана за точку отсчета (1) на фиг.1, SalGI (969), KpnI (3862), PstI (5278), два сайта расщепления рестриктазой BamHI (534, 979).The goal is achieved by constructing a new recombinant plasmid pPR-TGATG-hIL-1beta-tsr with adjustable copy number (Fig. 1), which provides expression of the hIL-1beta gene under the control of the regulatory region p _R o _{R of the} lambda bacteriophage, has a length of 7.3x10 ³ N. P. consists of a large (6.6x10 ³ n.p.) EcoRI-SalGI fragment of the pPR53-tsr vector plasmid (Mashko et al. 1991) and a small (0.7 × 10 ³ n.p.) EcoRI-SalGI fragment of the pPR-TGATG- plasmid hIL-beta (Mashko et al. 1991) and is characterized by the following features:
contains the region responsible for the initiation of replication and its regulation (ori pSC101), as well as a genetic locus that ensures stable inheritance and proper distribution of the small copy plasmid between daughter cells during bacterial division (par pSC101) from the original vector plasmid pSC101 (Bernardi and Bernardi, 1984) ; the region responsible for the replication of the plasmid ColE1, in which the promoter of primer RNA-RNA II (Davison, 1984) was replaced by the p _L bacteriophage promoter lambda (Sanger et al. 1982) as a result of oligonucleotide-directed site-specific mutagenesis (Kangerel, 1985) which makes replication and thereby an increase in copies of the formed recombinant plasmid, depending on the conditions of depression of the specified phage promoter; lambda phage heat-sensitive repressor gene (cIts857); the ampicillin resistance gene (Ap ^R ) of the plasmid pBR322 (Sutcliffe, 1979); tandem of ro-independent phage fd transcription terminators (ter _fd ); lambda phage p _R promoter, translation initiation sites, and first amino acid codons (22 and 72, respectively) of the cro (cro ') phage lambda phage and cat (cat') genes of the E. coli Tn9 transposon, as well as a fragment of the previously cloned cDNA (Kotenko et al. . 1989), encoding the sequence of mature human interleukin-1 beta (hIL-1beta) and modified as a result of site-specific mutagenesis so that an additional methionine ATG codon is located in the newly formed structural gene before the first amino acid codon of mature interleukin Ala ¹¹⁷ which a fragment of the intercistronic region of the E. coli trpE-trpD genes (ON):

. _{-> 3 ',} where the additional initiating formylmethionine codon, ATG, is highlighted in bold and the Ala ¹¹⁷ codon of the structural part of mature human interleukin-1 beta is underlined;
the hIL-1 beta gene modified in this way was connected with the coding part of the cro'-cat 'genes in such a way that, as a result, a hybrid operon was found in the resulting plasmid under the control of the p _R promoter, in which the structural part of hIL-1beta is distal to the promoter and the proximal open reading frame of the cro'-cat'-ON hybrid gene, overlapping with its terminating codon, TGA, with the initiating, ATG, interleukin-1 beta codon, as is the case in the natural intercistronic region of E. coli trpE-trpD genes , and the term mRNA transcription of the formed hybrid operon with partially overlapping cistrons is performed on the tandem of phage fd transcription terminators; in this case, as a result of construction in front of the hIL-1beta structural gene, and thereby in the coding part of the cro'-cat'-ON hybrid cistron, a ribosome binding site is formed having the following nucleotide sequence:
5 '-. AGGAGACTTTCTGATG .->3',
where AGGAG-SD trpD e.coli gene sequence;
the plasmid has unique EcoRI restriction enzyme recognition sites, the coordinate of which is selected for the reference point (1) in Fig. 1, SalGI (969), KpnI (3862), PstI (5278), two BamHI restriction enzyme cleavage sites (534, 979).

Цель достигается также созданием штамма E.coli C600 [pPR-TGATG-hIL-1beta-tsr] (регистрационный номер во Всесоюзной коллекции культур промышленных микроорганизмов Всесоюзного научно-исследовательского института генетики и селекции промышленных микроорганизмов ВКПМ В-5830) продуцента рекомбинантного интерлейкина-1 бета человека, синтезирующего до 10-12% интерлейкина от суммарных белков бактериальной клетки через 2-3 ч после переноса бактерий, растущих на питательной среде при 28^оС, на температуру 42^оС. При этом весь синтезируемый новым штаммом интерлейкин локализован в водорастворимой фракции клеточных белков, что позволяет упростить процедуру выделения интерлейкина и получить препарат интерлейкина с удельной активностью 2х10⁸ МЕ/мг белка, пригодный для медицинских целей.The goal is also achieved by the creation of E. coli strain C600 [pPR-TGATG-hIL-1beta-tsr] (registration number in the All-Union Collection of Cultures of Industrial Microorganisms of the All-Union Scientific Research Institute of Genetics and Breeding of Industrial Microorganisms VKPM B-5830) of a producer of recombinant interleukin-1 beta human synthesizing interleukin 10-12% of the total protein of the bacterial cells 2-3 hours after transfer of bacteria growing in a nutrient medium at ²⁸ ° C, the temperature 42 ° ^C. The entire synthesized new strain interleukin localized in a water-soluble fraction of cellular proteins, which simplifies the procedure for the isolation of interleukin and obtain an interleukin preparation with a specific activity of 2x10 ⁸ IU / mg protein, suitable for medical purposes.

Полученный в результате выделения целевой полипептид имеет на N-конце следующую аминокислотную последовательность:
80% молекул Ala-Pro-Val-Arg-Ser-Leu-Asn-Cys-.The resulting polypeptide obtained by isolation has the following amino acid sequence at the N-terminus:
80% of Ala-Pro-Val-Arg-Ser-Leu-Asn-Cys- molecules.

и 20% молекул Pro-Val-Arg-Ser-Leu-Asn-Cys-. and 20% of Pro-Val-Arg-Ser-Leu-Asn-Cys- molecules.

Данная гетерогенность рекомбинантных полипептидов по N-концу соответствует природной гетерогенности молекул интерлейкина-1 бета, выделяемых из природных источников (Kikumoto et al. 1987; Tocci et al. 1987). В выделяемых из экстрактов растворимых белков штамма-продуцента препаратах рекомбинантного интерлейкина-1 бета высокочувствительными методами определения белковой первичной структуры не обнаружено молекул с дополнительным N-концевым метионином, синтезируемым в качестве предшественника зрелого интерлейкина-1 бета в бактериальной клетке и детерминированного созданной структурой экспрессирующегося модифицированного гена hIL-1beta. Таким образом, структура получаемого рекомбинантного полипептида была идентична его природному аналогу. This heterogeneity of the recombinant polypeptides at the N-terminus corresponds to the natural heterogeneity of interleukin-1 beta molecules isolated from natural sources (Kikumoto et al. 1987; Tocci et al. 1987). In the extracts of soluble proteins of the producer strain of the recombinant interleukin-1 beta preparations, highly sensitive methods for determining the primary protein structure did not reveal molecules with an additional N-terminal methionine synthesized as a precursor of mature interleukin-1 beta in the bacterial cell and determined by the created structure of the expressed modified gene hIL-1beta. Thus, the structure of the resulting recombinant polypeptide was identical to its natural counterpart.

Штамм получают трансформацией реципиентного штамма E.coli С600 (F^-, thi, thr, leuB6, supE44, lacY1, tonA21) рекомбинантной плазмидой pPR-TGATG-hIL-1beta-tsr с последующим отбором рекомбинантных клонов на среде с ампициллином при 28^оС и определением активности рекомбинантного интерлейкина-1 бета в экстрактах клеток трансформантов после депрессии p_R-промотора, достигаемой культивированием штамма в течение 2-3 ч при 42^оС. В качестве реципиента могут быть также использованы штаммы E.coli ВНИИгенетика VL902, E.coli ВНИИгенетика VL903 (Дебабов и др. 1987) и другие производные E.coli К12, а также E.coli BL21 (Maniatis et al. 1989) и другие производные E.coli В.Strain obtained by transformation of a recipient strain E.coli C600 ^{(F -, thi, thr,} leuB6, supE44, lacY1, tonA21) recombinant plasmid pPR-TGATG-hIL-1beta- tsr followed by selection of recombinant clones on medium with ampicillin at ²⁸ ° C and determining the activity of recombinant interleukin-1 beta in cell extracts of the transformants after depression of promoter p _R achieved by culturing the strain for 2-3 hours at 42 ° ^C. as the recipient E.coli strains VNIIgenetika VL902 may also be used, E.coli VNIIgenetika VL903 (Debabov et al. 1987) and other derivatives of E. coli K12, as well e E.coli BL21 (Maniatis et al. 1989) and other derivatives of E.coli B.

Штамм E.coli ВКПМ В-5830 характеризуется следующими признаками:
1. Морфологические признаки: клетки прямые, палочковидной формы (1,2-1,3)х(2,0-6,0) мкм, слабоподвижные, способные к образованию нитевидных форм, грамотрицательные, неспороносные.The strain of E. coli VKPM B-5830 is characterized by the following features:
1. Morphological signs: cells are straight, rod-shaped (1.2-1.3) x (2.0-6.0) microns, weakly mobile, capable of forming filiform forms, gram-negative, non-spore-bearing.

2. Культуральные признаки. Клетки хорошо растут на плотных и жидких простых синтетических, полусинтетических и комплексных средах. При росте на агаризованном бульоне Хоттингера или L-бульоне образуют ослизненные, круглые, слабоматовые колонии. При выращивании в жидких средах типа L-бульона или М9 с казаминовыми кислотами образуют равномерную взвесь. 2. Cultural traits. Cells grow well in dense and liquid simple synthetic, semi-synthetic and complex environments. When growing on an agarized Hottinger broth or L-broth, mucous, round, weakly matous colonies are formed. When grown in liquid media such as L-broth or M9 with casamino acids form a uniform suspension.

3. Физиолого-биохимические признаки. Клетки способны к росту в диапазоне температур от 5 до 35^оС (оптимум 32^оС) при рН 6,7-7,5. В качестве источника углерода используют аминокислоты и углеводы (например, глюкозу). Источником азота могут служить минеральные соли в аммонийной форме, а также органические соединения в виде пептона, триптона, дрожжевого экстракта и аминокислот.3. Physiological and biochemical characteristics. Cells able to grow at temperatures ranging from 5 to 35 ^{° C} (optimum 32 ° ^C) at pH 6.7-7.5. Amino acids and carbohydrates (e.g. glucose) are used as a carbon source. Mineral salts in the ammonium form, as well as organic compounds in the form of peptone, tryptone, yeast extract, and amino acids, can serve as a nitrogen source.

4. Устойчивость к антибиотикам. Штамм устойчив к ампициллину в концентрации до 100 мг/л при выращивании в жидких и на агаризованных питательных средах. 4. Resistance to antibiotics. The strain is resistant to ampicillin at a concentration of up to 100 mg / l when grown in liquid and agarized culture media.

5. Устойчивость к бактериофагам. Плазмидный штамм при культивировании в условиях пониженной температуры (28-32^оС) устойчив к заражению фагом лямбда с операторными участками o_L и o_R дикого типа вследствие наличия в составе плазмиды гена-репрессора cIts857.5. Resistance to bacteriophages. Plasmid strain when cultured under conditions of reduced temperature (28-32 ^o C) resistant to infection with phage lambda operator sites and o _L o _R wild type due to the presence in the composition of plasmid-repressor gene cIts857.

6. Штамм содержит рекомбинантную плазмиду pPR-TGATG-hIL-beta-tsr с регулируемой копийностью и продуцирует интерлейкин-1 бета человека. 6. The strain contains a recombinant plasmid pPR-TGATG-hIL-beta-tsr with adjustable copy number and produces human interleukin-1 beta.

7. Стабильность плазмиды. При хранении клеток на агаризованной среде (сроком до 1 месяца), при серии последовательных пересевов (в течениe не менее 6 месяцев) и в процессе глубинного культивирования в жидкой среде с антибиотиком, а также без него при температуре 28^оС не происходит потери и перестройки малокопийной (5-7 копий на геномный эквивалент) плазмиды, что обусловлено наличием и функционированием в составе плазмиды малокопийного репликона и генетического локуса par плазмиды pSC101. При росте клеток в условиях термоиндукции (при температуре 42^оС) и вследствие этого транскрипции праймерной РНК I мутантного репликона ColE1 осуществляется неконтролируемый рост копийности плазмиды до 120-150 копий на геномный эквивалент через 2-3 часа культивирования (Mashko et al. 1991) и вследствие этого лизис бактериальных клеток через 6-8 часов.7. Stability of the plasmid. When storing the cells on an agar medium (up to 1 month) with a series of successive passages (in Big within at least 6 months) and in submerged culture in a liquid medium with antibiotic and without it at 28 ^{° C} no loss and restructuring small copy (5-7 copies per genomic equivalent) plasmid, which is due to the presence and functioning of the small copy replicon and the genetic locus par of the plasmid pSC101 in the plasmid. With the growth of cells under conditions termoinduktsii (at 42 ^C) and thereby transcription of RNA primer I mutant ColE1 replicon carried uncontrolled copy number plasmids increase to 120-150 copies per genome equivalent to 2-3 hours of cultivation (Mashko et al. 1991) and as a result, lysis of bacterial cells after 6-8 hours.

Отличия предлагаемых технических решений заключаются в следующем. Структурная часть гена интерлейкина-1 бета человека входит в состав гибридного оперона, экспрессия генов которого контролируется регуляторной областью p_Ro_R бактериофага лямбда. Данный оперон располагается в составе рекомбинантной ДНК бирепликонной плазмиды, репликация которой при температуре 28^оС осуществляется под контролем репликона pSC101, а при повышении температуры под контролем мутантного репликона ColE1-типа, в котором синтез праймерной РНК происходит под контролем промоторнооператорной регуляторной области p_Lo_L бактериофага лямбда. Наличие в составе той же рекомбинантной плазмиды гена-регулятора cIts857 позволяет осуществлять экспрессию цистронов гибридного оперона и одновременно амплификацию плазмиды после накопления бактериальной биомассы повышением температуры культивирования клеток с 28-32 до 42-45^оС. Поскольку за время 2-3 ч термоиндукции происходит значительное увеличение копийности рекомбинантной плазмиды одновременно с эффективной транскрипцией и трансляцией целевого продукта, то следствием этого является быстрое накопление значительных количеств рекомбинантного интерлейкина-1 бета, в то же время недостаточных для его агрегации и локализации во фракции нерастворимых клеточных белков. Использование описанного штамма-продуцента позволяет получать препарат рекомбинантного интерлейкина-1 бета, не содержащего молекул с дополнительным остатком метионина на N-конце, не обладающих биологической активностью (Kikumoto et al. 1987) и способных вызывать нежелательные аутоиммунные реакции при медицинском использовании препарата. Это обстоятельство выгодно отличает описанный вариант бактериального продуцента от штамма-прототипа (Kikumoto et al. 1987).The differences of the proposed technical solutions are as follows. The structural part of the human interleukin-1 beta gene is part of a hybrid operon whose gene expression is controlled by the regulatory region p _R o _{R of the} lambda bacteriophage. This operon is composed of the recombinant DNA bireplikonnoy plasmid, the replication of which at a temperature of 28 ^{° C} is carried out under the control of replicon pSC101, and the temperature is raised under the control of the mutant replicon of ColE1-type in which synthesis of primer RNA occurs under the control promotornooperatornoy regulatory region p _{_L} o _L bacteriophage lambda. The presence of the regulator gene cIts857 in the same recombinant plasmid allows expression of the cystrons of the hybrid operon and simultaneous amplification of the plasmid after bacterial biomass accumulation by increasing the cell cultivation temperature from 28-32 to 42-45 ^о С. Since considerable induction occurs during 2-3 hours increasing the copy number of the recombinant plasmid simultaneously with efficient transcription and translation of the target product, the result is the rapid accumulation of significant amounts of recombin nantal interleukin-1 beta, at the same time insufficient for its aggregation and localization in the fraction of insoluble cellular proteins. Using the described producer strain allows one to obtain a recombinant interleukin-1 beta preparation that does not contain molecules with an additional methionine residue at the N-terminus that does not have biological activity (Kikumoto et al. 1987) and that can cause undesirable autoimmune reactions in medical use of the drug. This circumstance favorably distinguishes the described variant of the bacterial producer from the prototype strain (Kikumoto et al. 1987).

Указанное отличие от прототипа позволяет обеспечить стабильное накопление целевого продукта с биологической активностью 2х10⁸ МЕ/мг белка, не отличимого по своим биологическим и физико-химическим свойствам от своего природного аналога, в условиях крупномасштабного культивирования и позволяет получить препарат, пригодный для медицинских целей.The specified difference from the prototype allows for the stable accumulation of the target product with a biological activity of 2x10 ⁸ IU / mg of protein, which is not distinguished by its biological and physicochemical properties from its natural counterpart, under conditions of large-scale cultivation and allows you to get a drug suitable for medical purposes.

Процесс биосинтеза интерлейкина-1 бета человека включает стадии получения посевного материала, основную ферментацию и выделение биомассы используемой в качестве источника интерлейкина. Выращивание посевного материала и основную ферментацию E.coli ВКПМ В-5830 осуществляют в аэробных условиях на традиционно используемых для культивирования E.coli питательных средах, содержащих ассимилируемые источники углерода, азота, минеральные соли, стимуляторы роста, например, в виде триптона, дрожжевых автолизатов или экстрактов. В питательные среды вносят ампициллин в концентрации 100 мг/л. The biosynthesis of human interleukin-1 beta includes the stages of seed production, basic fermentation and the isolation of biomass used as a source of interleukin. The cultivation of seed and the main fermentation of E. coli VKPM B-5830 is carried out under aerobic conditions on nutrient media traditionally used for the cultivation of E. coli, containing assimilable sources of carbon, nitrogen, mineral salts, growth stimulants, for example, in the form of tryptone, yeast autolysates or extracts. Ampicillin at a concentration of 100 mg / L is added to the culture media.

Биомассу выращивают при рН 6,75-6,9 и температуре 28^оС до концентрации, определяемой составом питательной среды и массообменными характеристиками ферментера. Затем температуру в ферментере повышают до 42^оС и продолжают процесс на протяжении 2-3 ч. За это время синтезируется до 10-12% интерлейкина-1 бета от суммарных клеточных белков.The biomass was grown at pH 6.75-6.9, and a temperature of 28 ^{° C} to a concentration determined by the composition of the nutrient medium and the mass transfer characteristics of the fermenter. Then, the temperature in the fermentor was increased to 42 ^{° C} and the process is continued for 2-3 h. During this time, synthesized to 10-12% interleukin-1 beta of the total cellular proteins.

После завершения процесса ферментации бактериальные клетки отделяют от культуральной среды центрифугированием и ресуспендируют в соответствующем буферном растворе, после чего разрушают с помощью ультразвуковой обработки или другими известным способом. Разрушенные клетки подвергают центрифугированию и используют водорастворимую фракцию для последующего выделения целевого продукта. Для этого проводят подкисление водорастворимой клеточной фракции до рН 4,0 и две стадии гидрофобной хроматографии на фенильных сорбентах, фенил-Сефарозе CL4В и фенил-Суперозе-12. Уже на первой стадии при подкислении водорастворимой фракции разрушенных клеток до рН 4,0 95% IL-1beta оставалось в супернатанте, тогда как большинство бактериальных белков и нуклеиновых кислот удалялось при центрифугировании. Данная процедура при высоком выходе целевого белка позволяла обеспечить его 80%-ную чистоту. Две последующие хроматографии на гидрофобных сорбентах сначала при нейтральных, а затем кислых значениях рН позволили получить электрофоретически чистый препарат с удельной активностью около 2х10⁸МЕ/мг, что хорошо коррелировало с известными данными, полученными для выделенного из природных источников hIL-1beta (Tocci et al. 1987). Чистота препаратов hIL-1beta в процессе выделения анализировалась с помощью SDS-PAGE (фиг.2). Выделенный белок элюировался в виде гомогенного пика при HPLC-хроматографии на колонке Pro RPC ("Pharmacia") при рН 2,0 в градиенте ацетонитрила. Использованный метод выделения обеспечивал 60%-ный выход целевого белка, что составляло 5-10 мг интерлейкина-1 бета из 1 г влажной биомассы. Определение N-концевой последовательности полученного белка проводили методом Эдмана на автоматическом сиквенаторе "Beckman-890".After completion of the fermentation process, the bacterial cells are separated from the culture medium by centrifugation and resuspended in the appropriate buffer solution, after which they are destroyed by ultrasonic treatment or other known method. The destroyed cells are centrifuged and a water-soluble fraction is used for subsequent isolation of the target product. To do this, acidify the water-soluble cell fraction to pH 4.0 and two stages of hydrophobic chromatography on phenyl sorbents, phenyl-Sepharose CL4B and phenyl-Superose-12. Already at the first stage, upon acidification of the water-soluble fraction of the destroyed cells to pH 4.0, 95% of IL-1 beta remained in the supernatant, while most bacterial proteins and nucleic acids were removed by centrifugation. This procedure with a high yield of the target protein made it possible to ensure its 80% purity. Two subsequent chromatography on hydrophobic sorbents, first at neutral and then acidic pH values, made it possible to obtain an electrophoretically pure preparation with a specific activity of about 2x10 ⁸ IU / mg, which correlated well with the known data obtained for hIL-1beta isolated from natural sources (Tocci et al . 1987). The purity of hIL-1beta preparations during isolation was analyzed by SDS-PAGE (FIG. 2). The isolated protein was eluted as a homogeneous peak by HPLC chromatography on a Pro RPC column (Pharmacia) at pH 2.0 in an acetonitrile gradient. The isolation method used provided a 60% yield of the target protein, which was 5-10 mg of interleukin-1 beta from 1 g of wet biomass. The N-terminal sequence of the obtained protein was determined by the Edman method on a Beckman-890 automated sequencer.

Определение биологической активности рекомбинантного интерлейкина-1 бета проводилось по его комитогенному действию на пролиферацию мышиных тимоцитов в стандартном тесте (Mizel and Mizel, 1981; Rosenwasser et al. 1986) с некоторыми модификациями, как описано ранее (Котенко и др. 1989). За одну единицу биологической активности интерлейкина-1 бета принималась доза препарата, обеспечивающая 50% от максимальной пролиферации мышиных тимоцитов в стандартных тест-системах, как подробно описано в лабораторных протоколах (Mizel, 1979). The biological activity of recombinant interleukin-1 beta was determined by its comitogenic effect on the proliferation of murine thymocytes in a standard test (Mizel and Mizel, 1981; Rosenwasser et al. 1986) with some modifications, as described previously (Kotenko et al. 1989). For one unit of biological activity of interleukin-1 beta, the dose of the drug was taken, which provided 50% of the maximum proliferation of mouse thymocytes in standard test systems, as described in detail in laboratory protocols (Mizel, 1979).

Изобретение иллюстрируется фиг.1-3. The invention is illustrated in figures 1-3.

На фиг. 1 показана физико-генетическая карта рекомбинантной плазмиды pPR-TGATG-hIL-1beta-tsr. Рекомбинантная плазмида сконструирована с использованием следующих фрагментов ДНК: (1) TaqI-BglII-фрагмент, несущий ген cIts857 фага лямбда, p_R и p_RM промоторы и 20 N-кoнцевых кодонов гена cro, cro', (от 37165 до 38100 н.п. ДНК фага лямбда; Sanger et al. 1982); (2) кодирующий участок гена cat из pBR325 (775 н.п. фрагмент TaqI; Bolivar, 1978), фланкированный двумя сайтами BamHI, аналогично соответствующему гену в плазмиде рСМ4 (Close и Rodriguez; 1982); (3) фрагмент BamHI-SalI плазмиды pPR-TGATG-1 (прибл. 420 н.п.) (Mashko et al. 1990); SalI-KpnI фрагмент ДНК, несущий HindII фрагмент плазмиды pSC101 (4521-7449 н.п. на кольцевой карте pSC101; Bernardi и Bernardi, 1984), содержащий ori- и par участки (данный фрагмент ДНК был предварительно интегрирован в SmaI-сайт, расположенный в составе полилинкера плазмиды pUC18 (Yanish-Perron et al. 1985); (4) ClaI-SalI фpагмент (прибл. 2100 н.п.) плазмиды pPR-TGATG-1 (Mashko et al. 1990), несущий ген устойчивости к ампициллину и генетический локус ColE1-подобной плазмиды, обеспечивающий репликацию ДНК, в котором промотор праймерной РНК (PHKII, Davison, 1984) (3087-3205 н.п. на кольцевой карте плазмиды pBR322, Sutcliffe, 1979) заменен на фрагмент ДНК, содержащий p_L-промотор фага лямбда и локус nutL (положение 35,653-32,513 в ДНК фага лямбда, (Sanger et al. 1982), а также фланкирующий этот фрагмент ДНК SalI сайт заменен на сайт KpnI с помощью соответствующего линкера.In FIG. 1 shows a physico-genetic map of the recombinant plasmid pPR-TGATG-hIL-1beta-tsr. The recombinant plasmid was constructed using the following DNA fragments: (1) TaqI-BglII fragment carrying the cIts857 gene lambda phage, p _R and p _RM promoters and 20 N-terminal codons of the cro, cro 'gene, (from 37165 to 38100 bp Lambda phage DNA; Sanger et al. 1982); (2) the coding region of the cat gene from pBR325 (775 bp TaqI fragment; Bolivar, 1978), flanked by two BamHI sites, similar to the corresponding gene in plasmid pCM4 (Close and Rodriguez; 1982); (3) a fragment of the BamHI-SalI plasmid pPR-TGATG-1 (approx. 420 n.p.) (Mashko et al. 1990); SalI-KpnI DNA fragment carrying the HindII fragment of plasmid pSC101 (4521-7449 bp on the pSC101 ring map; Bernardi and Bernardi, 1984) containing ori- and par sites (this DNA fragment was previously integrated into the SmaI site located as part of the polylinker of plasmid pUC18 (Yanish-Perron et al. 1985); (4) ClaI-SalI fragment (approx. 2100 bp) of the plasmid pPR-TGATG-1 (Mashko et al. 1990) carrying the ampicillin resistance gene and the genetic locus of the ColE1-like plasmid, which provides DNA replication, in which the primer RNA promoter (PHKII, Davison, 1984) (3087-3205 bp on the ring map of plasmid pBR322, Sutcliffe, 1979) is replaced by the DNA fragment containing the p _L promoter of the lambda phage and the nutL locus (position 35.653-32.513 in the DNA of the lambda phage, (Sanger et al. 1982), as well as the flanking this SalI DNA fragment, was replaced with the KpnI site using the corresponding linker.

На фиг. 2 показаны электрофореграммы клеточных белков в 0,1% SDS 12,5% ПААГ, получаемых в ходе очистки hIL-1beta из клеток E.coli С600 [pPR-TGATG-hIL-1beta-tsr] Образцы кипятили 15 мин в буфере для нанесения образцов (60 мМ Трис-HCl рН 6,8) (2,3% SDS) 10% глицерин (5% 2-меркаптоэтанол) и полученные надосадочные жидкости анализировали согласно Laemmli (1970). Полосы белка проявляли путем прокрашивания в Кумасси синем. 1. Белковые маркеры (набор маркеров для белкового электрофореза, Pharmacia) с мол.весами 94, 67, 43, 30, 20,1 и 14,4 кДа; 2. Суммарные белки клеток продуцента после термоиндукции в течение 2 ч; 3. Надосадочная жидкость, содержащая водорастворимые клеточные белки, подкисленная до рН 4,0; рекомбинантный hlL-1beta, полученный после двух стадий хроматографической очистки на фенильных сорбентах. In FIG. 2 shows the electrophoregrams of cell proteins in 0.1% SDS 12.5% PAG obtained by purification of hIL-1beta from E. coli C600 cells [pPR-TGATG-hIL-1beta-tsr] Samples were boiled for 15 min in sample buffer (60 mM Tris-HCl pH 6.8) (2.3% SDS) 10% glycerol (5% 2-mercaptoethanol) and the resulting supernatants were analyzed according to Laemmli (1970). Protein bands were developed by staining in Coomassie blue. 1. Protein markers (a set of markers for protein electrophoresis, Pharmacia) with molecular weights of 94, 67, 43, 30, 20.1 and 14.4 kDa; 2. The total proteins of the producer cells after thermal induction for 2 hours; 3. The supernatant containing water-soluble cellular proteins, acidified to pH 4.0; recombinant hlL-1beta obtained after two stages of chromatographic purification on phenyl sorbents.

На фиг. 3 показана схема конструирования плазмиды pPR-TGATG-hIL-1beta, кДНК гена hIL-1beta, которая была клонирована в составе вектора лямбда gt10 с использованием EcoRI линкеров и в последующем переклонирована на фаг M13tg130 (Kieny и др. 1983) с образованием фагов M13tg130-IL-1beta-3' и М13tg130-IL-1beta-5' (Котенко и др. 1989). В ДНК первого из полученных фагов клонированный ген был расположен между сайтами EcoRI и AccI, после чего участок расщепления AccI был затем заменен на сайт BamHI c использованием соответствующих линкеров. ДНК фага М13tg130-IL-1beta-5' содержала EcoRI-HindIII фрагмент кДНК, соответствующий 5'-концевому участку hIL-1beta. Полученная таким образом ДНК была в дальнейшем подвергнута сайтспецифическому мутагенезу: PstI сайт был встроен непосредственно перед GCA кодоном аминокислоты Ala¹¹⁷ и из полученной рекомбинантной фаговой ДНК SacI-HindIII фрагмент кДНК был переклонирован в полученную ранее ДНК фага M13tg131-ON (Mashko et al. 1990). GCA кодон аминокислоты Ala¹¹⁷ был состыкован с ATG кодоном межцистронного участка trpE-trpD E.coli, находящемся на фаге M13tg131-ON, с помощью гидролиза ДНК рестриктазами SacI и PstI, удалением образующихся одноцепочечных 3'-концевых олигонуклеотидов с помощью Кленовского фрагмента А ДНК полимеразы I E.coli и рециклизации рекомбинантной молекулы ДНК ДНК-лигазой фага Т4. Полученная рекомбинантная молекула ДНК была обозначена как M13tg131-ON-IL-1beta-5'. EcoRI-HindIII-фрагмент фага M13tg131-ON-IL-1beta-5' и HindIII-BamHI-фрагмент фага M13tg130-IL-1beta-3' использовались как 5'- и 3'-концевые фрагменты гена hIL-1beta, включенного в экспрессионный вектор pPR-TGATG-1 (Mashko et al. 1990) с целью получения плазмиды pPR-TGATG-hIL-1beta. Эндонуклеазы рестрикции. ДНК-лигаза фага Т4 и Кленовский фрагмент ДНК полимеразы I E. coli являлись коммерческими препаратами Научно-производственной ассоциации "Fermentas", Вильнюс, Литва. Методы энзиматической обработки ДНК, выделения плазмид, электрофореза ДНК в агарозном и полиакриламидном гелях проводились как описано Maniatis et al, 1982. Обозначения AI, BI, EI, HIII, PI, ScI, SlI оносятся к сайтам рестрикции AccI, BamHI, EcoRI, HindIII, PstI, SacI и SalI, соответственно; cI ген, кодирующий репрессор cIts857 фага лямбда; ON синтетический олигонуклеотид (Mashko et al. 1990), включающий межцистронный участок trpE-trpD E.coli; p_lac промотор лактозного оперона E.coli на векторе фагов серии М13, p_RM промотор фага лямбда, обеспечивающий экспрессию гена cI; t_fd терминатор транскрипции фага fd.In FIG. Figure 3 shows the construction scheme of the plasmid pPR-TGATG-hIL-1beta, the cDNA of the hIL-1beta gene, which was cloned into the gt10 lambda vector using EcoRI linkers and subsequently cloned into the M13tg130 phage (Kieny et al. 1983) to form M13tg130- phages IL-1beta-3 'and M13tg130-IL-1beta-5' (Kotenko et al. 1989). In the DNA of the first of the obtained phages, the cloned gene was located between the EcoRI and AccI sites, after which the AccI cleavage site was then replaced with the BamHI site using the corresponding linkers. Phage M13tg130-IL-1beta-5 'phage DNA contained an EcoRI-HindIII cDNA fragment corresponding to the 5'-terminal portion of hIL-1beta. The DNA thus obtained was subsequently subjected to site-specific mutagenesis: the PstI site was inserted immediately before the GCA codon of amino acid Ala ^117, and from the obtained recombinant phage DNA SacI-HindIII, the cDNA fragment was cloned into the previously obtained DNA of phage M13tg131-ON (Mashko et al. 1990) . The GCA codon of Ala ¹¹⁷ amino acid was docked with the ATG codon of the intercistronic region of E. coli trpE-trpD located on the M13tg131-ON phage by hydrolysis of DNA with restriction enzymes SacI and PstI, removing the single-stranded 3'-terminal oligonucleotides using the A Klenov DNA I E. coli and recycling of a recombinant DNA molecule with T4 phage DNA ligase. The resulting recombinant DNA molecule was designated as M13tg131-ON-IL-1beta-5 '. The EcoRI-HindIII fragment of the phage M13tg131-ON-IL-1beta-5 'and the HindIII-BamHI fragment of the phage M13tg130-IL-1beta-3' were used as the 5'- and 3'-terminal fragments of the hIL-1beta gene included in the expression vector pPR-TGATG-1 (Mashko et al. 1990) to obtain plasmid pPR-TGATG-hIL-1beta. Restriction endonucleases. Phage T4 DNA ligase and the Klenov fragment of E. coli polymerase I DNA were commercial preparations of the Fermentas Research and Production Association, Vilnius, Lithuania. The methods of enzymatic DNA processing, plasmid isolation, DNA electrophoresis in agarose and polyacrylamide gels were carried out as described by Maniatis et al, 1982. The designations AI, BI, EI, HIII, PI, ScI, SlI refer to the restriction sites AccI, BamHI, EcoRI, HindIII, PstI, SacI, and SalI, respectively; cI gene encoding the repressor cIts857 phage lambda; ON synthetic oligonucleotide (Mashko et al. 1990), including the intercistronic region of E. coli trpE-trpD; p _lac promoter of the lactose operon of E. coli on the phage vector of the M13 series, p _RM lambda phage promoter, providing expression of the cI gene; t _fd phage transcriptional terminator fd.

П р и м е р 1. Конструирование рекомбинантной плазмиды pPR-TGATG-hIL-1beta-tsr. PRI me R 1. Construction of a recombinant plasmid pPR-TGATG-hIL-1beta-tsr.

Для решения поставленной задачи в качестве исходных использовались препараты ДНК:
1) рекомбинантного бактериофага M13tg130-IL-1beta, полученного ранее (Котенко и др. 1989) на основе вектора M13tg130 (Kieny et al. 1983) путем клонирования кДНК гена hIL-1beta между участками расщепления EcoRI и AccI;
2) фага M13tg130-IL-1beta-5', в котором 5'-концевой фрагмент гена hIL-1beta интегрирован в состав вектора M13tg130 после гидролиза ДНК рестриктазами EcoRI и HindIII;
3) фага M13tg131-ON (Mashko et al. 1990), в котором химически синтезированный олигонуклеотид с межцистронной областью генов trpE-trpD E.coli расположен в полилинкерном участке фага M13tg131 (Kieny et al. 1983) между участками EcoRI и SacI. При этом в области перекрывания кодонов TGATG 3'-концевой остаток "G" является первым из последовательности, узнаваемой SacI (GAGCT'C);
4) экспрессионного вектора плазмиды pPR-TGATG-1 (Mashko et al. 1990);
5) бирепликонного вектора с терморегулируемой копийностью плазмиды pPR53-tsr (Mashko et al. 1991).To solve this problem, DNA preparations were used as initial ones:
1) a recombinant bacteriophage M13tg130-IL-1beta, previously obtained (Kotenko et al. 1989) based on the vector M13tg130 (Kieny et al. 1983) by cloning cDNA of the hIL-1beta gene between EcoRI and AccI cleavage sites;
2) phage M13tg130-IL-1beta-5 ', in which the 5'-terminal fragment of the hIL-1beta gene is integrated into the vector M13tg130 after DNA hydrolysis with restriction enzymes EcoRI and HindIII;
3) phage M13tg131-ON (Mashko et al. 1990), in which a chemically synthesized oligonucleotide with an intercistronic region of E. coli trpE-trpD genes is located in the polylinker region of phage M13tg131 (Kieny et al. 1983) between the EcoRI and SacI sites. Moreover, in the region of overlapping TGATG codons, the 3'-terminal residue "G" is the first of the sequence recognized by SacI (GAGCT'C);
4) the expression vector of the plasmid pPR-TGATG-1 (Mashko et al. 1990);
5) a bireplicon vector with temperature-controlled copy number of plasmid pPR53-tsr (Mashko et al. 1991).

Конструирование целевой плазмиды pPR-TGATG-hIL-1beta-tsr осуществляют в два этапа: первый состоит в конструировании промежуточной плазмиды pPR-TGATG-hIL-1beta, а второй состоит из введения EcoRI-SalGI фрагмента полученной плазмиды, содержащей структурный ген зрелого интерлейкина-1 бета, модифицированный для экспрессии методом конструирования гибридных оперонов с частично перекрывающимися генами (Mashko et al. 1990), в состав вектора pPR53-tsr взамен С-концевой области гена cat. The construction of the target plasmid pPR-TGATG-hIL-1beta-tsr is carried out in two stages: the first consists of the construction of the intermediate plasmid pPR-TGATG-hIL-1beta, and the second consists of introducing an EcoRI-SalGI fragment of the obtained plasmid containing the mature interleukin-1 structural gene beta modified for expression by constructing hybrid operons with partially overlapping genes (Mashko et al. 1990), into the pPR53-tsr vector instead of the C-terminal region of the cat gene.

Схема конструирования рекомбинантной плазмиды pPR-TGATG-IL-1beta включает в себя следующие этапы (фиг.3). The design scheme of the recombinant plasmid pPR-TGATG-IL-1beta includes the following steps (figure 3).

Модификацию фага M13tg130-IL-1beta заменой участка расщепления PstI из полилинкера исходного векторного фага на сайт узнавания BamHI. Для этого рекомбинантную ДНК расщепляют PstI, образующиеся 3'-однонитевые концы удаляют с использованием ДНК-полимеразы I E. coli, присоединяют BamHI-линкеры ("Pharmacia") и после гидролиза ДНК BamHI и циклизации молекул ДНК-лигазой Т4, отбирают рекомбинанты, имеющие соответствующий участок узнавания рестриктазой. Таким образом в составе ДНК фага M13tg130-IL-1beta-3' уникальный участок гидролиза BamHI оказывается в 3'-нетранслируемой области гена hIL-1beta. Modification of phage M13tg130-IL-1beta by replacing the PstI cleavage site from the polylinker of the original vector phage with the BamHI recognition site. For this, recombinant DNA is cleaved with PstI, the resulting 3'-single-stranded ends are removed using E. coli DNA polymerase I, BamHI linkers (Pharmacia) are attached, and after hydrolysis of BamHI DNA and cyclization of molecules with T4 DNA ligase, recombinants having restriction enzyme recognition site. Thus, in the phage M13tg130-IL-1beta-3 'phage DNA, a unique BamHI hydrolysis site appears in the 3'-untranslated region of the hIL-1beta gene.

Далее проводят сайт-специфический мутагенез фага M13tg130-IL-1beta-5', в результате которого перед первым кодоном биологически активного белкового продукта гена hIL-1beta, Ala¹¹⁷, образуется участок узнавания PstI. Мутагенез проводят по стандартной методике (Maniatis et al. 1989), при этом используют синтезированный твердофазным фосфитамидным методом олигонуклеотид:
5'-d(ATCGTACAGGTGCTGCAGCACATAAGCCTC).Next, site-specific mutagenesis of the phage M13tg130-IL-1beta-5 'is carried out, as a result of which a PstI recognition site is formed before the first codon of the biologically active protein product of the hIL-1beta gene, Ala ¹¹⁷ . Mutagenesis is carried out according to the standard method (Maniatis et al. 1989), using the oligonucleotide synthesized by the solid-phase phosphitamide method:
5'-d (ATCGTACAGGTGCTGCAGCACATAAGCCTC).

Структуру рекомбинантных бактериофагов, отобранных гибридизацией in situ с меченным по [³²P] олигонуклеотидом, определяют по методу Сенгера (Sanger et al. 1977). ДНК нескольких таких фагов, в точном соответствии с планом эксперимента, содержат уникальный участок расщепления PstI перед первым аминокислотным кодоном биологически активного интерлейкина. При этом последний "G" из последовательности, узнаваемой PstI (CTGCA'G), является одновременно первым нуклеотидом N-концевого Ala¹¹⁷-кодона (GCA) целевого белка. Один из таких рекомбинантов, обозначенный M13tg130-IL-1beta-5'M, используют в дальнейших экспериментах.The structure of recombinant bacteriophages selected by in situ hybridization with a [ ³² P] labeled oligonucleotide was determined by the Senger method (Sanger et al. 1977). The DNA of several such phages, in strict accordance with the experimental design, contains a unique PstI cleavage site in front of the first amino acid codon of biologically active interleukin. Moreover, the last “G” from the sequence recognized by PstI (CTGCA'G) is simultaneously the first nucleotide of the N-terminal Ala ¹¹⁷ codon (GCA) of the target protein. One of these recombinants, designated M13tg130-IL-1beta-5'M, is used in further experiments.

SacI-HindIII фрагмент ДНК бактериофага N13tg130-IL-1beta-5'M, содержащий 5'-концевую область гена hIL-1beta с введенным с помощью мутагенеза сайтом расщепления PstI, был интегрирован в состав ДНК фага M13tg131-ON, из ДНК которого с помощью обработки ДНК-полимеразой I E.coli был предварительно удален участок расщепления PstI, расположенный в полилинкере исходного фагового генома. Интеграцию осуществляют при расщеплении измененной ДНК M13tg131-ON, рестриктазами SacI+ + HindIII, как схематически показано на фиг.3. Необходимое соединение ATG-кодона гена trpD, расположенного в составе химически синтезированного ранее (Mashko et al. 1990) олигонуклеотида, и первого кодона интерлейкина-1 проводят после обработки полученной рекомбинантной ДНК рестриктазами SacI и PstI, удаления одноцепочечных концов ДНК-полимеразой I и циклизации молекул ДНК-лигазой. Полученные таким образом бактериофаги подвергают непосредственному определению первичной структуры и ДНК одного из целевых вариантов (M13tg131-IL-1beta-5') используют на следующей стадии в качестве донора 5'-концевого фрагмента гена hiL-1beta. The SacI-HindIII DNA fragment of the bacteriophage N13tg130-IL-1beta-5'M containing the 5'-terminal region of the hIL-1beta gene with the PstI cleavage site introduced by mutagenesis was integrated into the DNA of the phage M13tg131-ON, from the DNA of which DNA polymerase I treatment E. coli previously removed the PstI cleavage site located in the polylinker of the original phage genome. Integration is carried out by cleaving the altered M13tg131-ON DNA with restriction enzymes SacI + + HindIII, as shown schematically in FIG. 3. The necessary compound of the ATG codon of the trpD gene located in the oligonucleotide chemically synthesized earlier (Mashko et al. 1990) and the first codon of interleukin-1 is carried out after processing the obtained recombinant DNA with restriction enzymes SacI and PstI, removing single-stranded ends with DNA polymerase I and cyclization of molecules DNA ligase. The bacteriophages thus obtained are subjected to direct determination of the primary structure and the DNA of one of the target variants (M13tg131-IL-1beta-5 ') is used in the next step as a donor of the 5'-terminal fragment of the hiL-1beta gene.

На последнем этапе конструирования pPR-TGATG-hIL-1beta в состав плазмиды pPR-TGATG-1 интегрируют кодирующую часть зрелого интерлейкина-1 бета с расположенной на ее 5'-конце синтетической последовательностью межцистронной области trpE-trpD E.coli. В качестве донора гена hIL-1beta при этом используют EcoRI-HindIII фрагмент фага M13tg131-IL-1beta-5' (5'-концевой фрагмент цистрона) и HindIII-BamHi-фрагмент ДНК M13tg130-IL-1beta-3' (3'-концевая область гена). Интеграцию полноразмерного гена осуществляют после расщепления ДНК вектора рестриктазами EcoRI + BamHI. At the last stage of constructing pPR-TGATG-hIL-1beta, the coding part of mature interleukin-1 beta with the synthetic sequence of the E. coli trpE-trpD intercistronic region located at its 5'-end is integrated into the pPR-TGATG-1 plasmid. In this case, an EcoRI-HindIII fragment of the phage M13tg131-IL-1beta-5 '(5'-terminal fragment of cistron) and a HindIII-BamHi DNA fragment of M13tg130-IL-1beta-3' (3'- end region of the gene). The integration of the full-sized gene is carried out after digestion of the vector DNA with restriction enzymes EcoRI + BamHI.

На заключительном этапе сборки целевой рекомбинантной плазмиды pPR-TGATG-hIL-1beta-tsr описанную выше плазмиду pPR-TGATG-hIL-1beta используют в качестве донора гена hIL-1beta для клонирования в вектор pPR53-tsr (Mashko et al. 1991), как описано выше. At the final stage of the assembly of the target recombinant plasmid pPR-TGATG-hIL-1beta-tsr, the above described plasmid pPR-TGATG-hIL-1beta is used as a donor of the hIL-1beta gene for cloning into the pPR53-tsr vector (Mashko et al. 1991), as described above.

П р и м е р 2. Получение штамма E.coli ВКПМ В-5830 продуцента рекомбинантного интерлейкина-1 бета человека. PRI me R 2. Obtaining a strain of E. coli VKPM B-5830 producer of recombinant human interleukin-1 beta.

Плазмиду pPR-TGATG-hIL-1beta-tsr, обеспечивающую синтез рекомбинантного интерлейкина-1 бета человека, трансформацией (см. Maniatis et al. 1989) вводят в клетки штамма E.coli С600. Эффективность трансформации клеток E.coli С600 составляет около 10⁶ клонов на 1 мкг нативной ДНК плазмиды. Трансформанты отбирают на среде, содержащей ампициллин (100 мкг/мл) после культивирования клеток в течение суток при 28^оС. Из отобранных клонов выделяют плазмидную ДНК и подтверждают ее идентичность препарату ДНК pPR-TGATG-hIL-1beta-tsr с помощью рестрикционного анализа. Полученный штамм E.coli ВКПМ В-5830 депонирован во Всесоюзной коллекции промышленных микроорганизмов Всесоюзного научно-исследовательского института генетики и селекции промышленных микроорганизмов.Plasmid pPR-TGATG-hIL-1beta-tsr, which provides the synthesis of recombinant human interleukin-1 beta, is introduced into cells of E. coli strain C600 by transformation (see Maniatis et al. 1989). The transformation efficiency of E. coli C600 cells is about 10 ⁶ clones per 1 μg of native plasmid DNA. Transformants were selected on medium containing ampicillin (100 ug / ml) after culturing the cells overnight at 28 ° ^C. From the selected clones, plasmid DNA was isolated and its identity confirmed by DNA preparation pPR-TGATG-hIL-1beta- tsr by restriction analysis. The obtained E. coli strain VKPM B-5830 was deposited in the All-Union Collection of Industrial Microorganisms of the All-Union Scientific Research Institute of Genetics and Selection of Industrial Microorganisms.

П р и м е р 3. Определение продуктивности штамма E.coli ВКПМ В-5830 продуцента рекомбинантного интерлейкина-1 бета человека. PRI me R 3. Determination of the productivity of the strain of E. coli VKPM B-5830 producer of recombinant human interleukin-1 beta.

Для определения продуктивности штамма E.coli ВКПМ В-5830 плазмидосодержащие клетки выращивают при 28^оС на скошенной агаризованной стандартной среде Хоттингера или на L-бульоне, содержащей 50 мкг/мл ампициллина, в течение 14 ч. Выросшую на косяках биомассу используют для получения посевного материала. Для этого клетки переносят в колбы Эрленмейера объемом 750 мл с 75 мл среды Хоттингера, содержащей 5 г/л глюкозы и 100 мг/л ампициллина. Культуру выращивают на качалке при интенсивном перемешивании при температуре 28^оС в течение 6-8 ч до плотности посевной культуры 2-3 оптические единицы при А₅₄₀.To determine productivity of E.coli strain VKPM B-5830 plazmidosoderzhaschie cells were grown at ²⁸ ° C on agar standard sloped Hottinger medium or on L-broth containing 50 ug / ml ampicillin, for 14 hours. The biomass grown on jambs used to produce seed material. For this, the cells are transferred into 750 ml Erlenmeyer flasks with 75 ml of Hottinger medium containing 5 g / l glucose and 100 mg / l ampicillin. The culture is grown on a rocking chair with vigorous stirring at a temperature of 28 ^about C for 6-8 hours to a density of inoculum 2-3 optical units at A ₅₄₀ .

Ферментацию проводят в ферментере объемом 2 л, оснащенном системами измерения и регулирования температуры, рН, парциального давления кислорода, скорости вращения мешалки и подачи воздуха для аэрации. В ферментер со стерильной питательной средой вносят посевной материал в количестве 5-7,5% и проводят ферментацию при интенсивном перемешивании и аэрации, начальной температуре 28^оС, рН 6,7-6,9, который стабилизируют с помощью 8% раствора аммиака. Парциальное давление растворенного кислорода поддерживают на уpовне 25-30% путем регулирования скорости вращения мешалки и расхода воздуха в диапазоне 0,5-1,5 объема на объем культуральной жидкости в минуту.Fermentation is carried out in a 2 L fermenter equipped with systems for measuring and regulating temperature, pH, oxygen partial pressure, stirrer rotation speed and air supply for aeration. The fermenter with a sterile culture medium was inoculated in an amount of 5-7.5% and the fermentation is carried out under vigorous agitation and aeration, initial temperature of 28 ^{° C,} pH 6.7-6.9, which is stabilized with 8% ammonia solution. The partial pressure of dissolved oxygen is maintained at a level of 25-30% by adjusting the speed of rotation of the mixer and air flow in the range of 0.5-1.5 volume per volume of culture fluid per minute.

Для выращивания культуры используют питательную среду следующего состава (г/л): глюкоза 20,0, MgSO₄ x 7H₂O, CaCl₂ 0,01, NaCl 1,0, бульон Хоттингера до 1 л. Исходный рН среды 6,75-7,0.For growing the culture, a nutrient medium of the following composition (g / l) is used: glucose 20.0, MgSO ₄ x 7H ₂ O, CaCl ₂ 0.01, NaCl 1.0, Hottinger broth up to 1 l. The initial pH of the medium is 6.75-7.0.

После внесения посевного материала процесс ферментации ведут при 28^оС и, когда оптическая плотность клеточной суспензии при А₅₄₀достигает 10 оптических единиц, температуру повышают до 42^оС и продолжают пpоцесс еще в течение 2-3 ч.After making the seed fermentation process is carried out at ²⁸ ° C, and when the optical density of the cell suspension with A ₅₄₀ absorbance units 10 reaches the temperature was raised to 42 ^{° C} and continue ppotsess for another 2-3 hours.

После завершения ферментации биомассу выделяют центрифугированием из предварительно охлажденной до 12^оС культуральной жидкости и используют для получения интерлейкина-1 бета. Собранные центрифугированием клетки разрушают кипячением 2-3 мин в 0,05 М фосфатном буфере, рН 7,2, содержащим 1% додецилсульфата натрия из расчета 1 г биомассы на 10 мл буфера. Осадок отделяют центрифугированием, супернатант разводят не менее чем в 1000 раз 0,05 М фосфатным буфером, рН 7,2, содеpжащим 2%-ный бычий сывороточный альбумин, и подвергают количественному анализу на биологическую активность, а также анализируют методом электрофореза в SDS-PAAG. Продуктивность штамма составляет не менее 10-12% рекомбинантного интерлейкина-1 бета от суммарных бактериальных белков, а в пересчете биологической активности на мг препарата выделенного интерлейкина удельная активность составляет 2х10⁸ МЕ. При выделении целевого продукта выход его составляет 60% при этом указанная удельная активность обеспечивает выход 5-10 мг чистого интерлейкина на 1 г влажного веса клеток.After fermentation is completed, the biomass is isolated by centrifugation from the culture fluid previously cooled to 12 ^° C and used to produce interleukin-1 beta. The cells collected by centrifugation are destroyed by boiling for 2-3 min in 0.05 M phosphate buffer, pH 7.2, containing 1% sodium dodecyl sulfate at the rate of 1 g of biomass per 10 ml of buffer. The precipitate was separated by centrifugation, the supernatant was diluted at least 1000 times with 0.05 M phosphate buffer, pH 7.2, containing 2% bovine serum albumin, and subjected to quantitative analysis for biological activity, as well as analyzed by SDS-PAAG electrophoresis . The strain productivity is at least 10-12% of recombinant interleukin-1 beta of the total bacterial proteins, and in terms of the biological activity per mg of the preparation of isolated interleukin, the specific activity is 2x10 ⁸ IU. When isolating the target product, its yield is 60%, while the specified specific activity provides a yield of 5-10 mg of pure interleukin per 1 g of wet cell weight.

П р и м е р 4. Определение биологической активности рекомбинантного интерлейкина-1 бета человека. PRI me R 4. Determination of the biological activity of recombinant human interleukin-1 beta.

Определение биологической активности рекомбинантного интерлейкина-1 бета проводят по его комитогенному действию на пролиферацию мышиных тимоцитов в стандартном тесте (Mizel S. 1981; Rosenwasser L. 1981) с некоторыми модификациями. Для каждого эксперимента готовят три параллельные культуры мышиных тимоцитов С57BLxCBACF1 в концентрации 5х10⁶ клеток и инкубируют в присутствие образцов интерлейкина в различных концентрациях в течение 72 часов в атмосфере 5% СО₂ в планшетах для иммунологических исследований. Объем инкубационной смеси составляет 2 мл. Смесь содержит среду Игла с добавлением 1% термоинактивиpованного альбумина человека, 2 мМ L-глутамина, гентамицина в концентpации 80 мкг/м. Полимиксина В в концентpации 5 мкг/мл и конканавалина А в концентpации 0,5 мкг/мл.The biological activity of recombinant interleukin-1 beta is determined by its comitogenic effect on the proliferation of murine thymocytes in a standard test (Mizel S. 1981; Rosenwasser L. 1981) with some modifications. For each experiment, three parallel cultures of mouse thymocytes C57BLxCBACF1 at a concentration of 5x10 ⁶ cells were prepared and incubated in the presence of interleukin samples at various concentrations for 72 hours in an atmosphere of 5% CO ₂ in immunological research plates. The volume of the incubation mixture is 2 ml. The mixture contains Needle medium with the addition of 1% thermally inactivated human albumin, 2 mM L-glutamine, gentamicin in a concentration of 80 μg / m. Polymyxin B at a concentration of 5 μg / ml and concanavalin A at a concentration of 0.5 μg / ml.

В течение последних 16 ч культивирования клетки инкубируют с ³Н-тимидином в концентрации 5 мкKи/мл.During the last 16 hours of cultivation, cells are incubated with ³ H-thymidine at a concentration of 5 μCi / ml.

Клетки переносят на фильтp из стекловолокна с помощью клеточного харвестера Titertek. Каждый фильтр помещают в пробирку, содержащую 5 мл сцинтилляционной жидкости и включение ³Н-тимидиновой метки определяют в жидкостном сцинтилляционном счетчике Rack Beta 1719 (LKB).Cells are transferred to a fiberglass filter using a Titertek cell harvester. Each filter was placed in a test tube containing 5 ml of scintillation fluid and the incorporation of a ³ H-thymidine tag was determined in a Rack Beta 1719 liquid scintillation counter (LKB).

За одну единицу биологической активности интерлейкина-1 бета принимают ту концентрацию интерлейкина-1 бета, которая обеспечивает 50% увеличение (от максимально возможного) пролиферации мышиных тимоцитов для данной тест-системы. В пересчете на мг препарата выделенного интерлейкина активность составляет 2х10⁸ МЕ.For one unit of biological activity of interleukin-1 beta, the concentration of interleukin-1 beta is taken that provides a 50% increase (from the maximum possible) in the proliferation of mouse thymocytes for this test system. In terms of mg of the drug, isolated interleukin activity is 2x10 ⁸ IU.

Claims

1. Recombinant plasmid DNA pPr-TGATG-hIL-1beta-tsr, providing the synthesis of recombinant interleukin-1 with a length of 7.3 x 10 ³ n.p. and containing a large EcoRI SalGI fragment of the vector plasmid pPR 53-tsr measuring 6.6 x 10 ³ n.p. small E corI SalGI fragment of the plasmid pPR-TGATG-hIL-1beta 0.7 x 10 ³ n.p. oripSC101 is the region responsible for initiating replication p SC101 and the locus par associated with it; a mutant region responsible for the replication of the plasmid Col E1, in which the primer RNA promoter is the regulatory region P _L O _{L of the} bacteriophage lambda; cIts857 - gene of the thermosensitive repressor of the phage lambda; terfd tandem of fo independent phage fd transcription terminators; promoter-operator region tP _R O _{R of the} lambda phage, translation initiation sites and first amino acid codons 22 and 72, respectively, of the cro (cro ′) phage lambda and cat (cat ′) genes of the E. coli Tn9 transposon; a hybrid operon consisting of a cro′-cat ′ cistron partially overlapping with a gene encoding a mature human interleukin-1 beta having an additional N-terminal Met codon in front of the first codon corresponding to Ala preprointerleukin; artificially created structure of the intercistronic region with overlapping terminating and initiating codons of the proximal and distal to the promoter of the genes, providing translational conjugation of the genes of the hybrid operon; 5′-AATTCGAACAGGAGACTTTCTGATG ...- 3 ′; unique registration sites: E coR, whose coordinate was chosen for reference point 1, Sal GI 969, KpnI - 3863, Pst I 5278, two restriction cleavage sites Bam HI 534, 979.

2. The bacterial strain Escherichia coli VKPM B-5830 producer of recombinant human interleukin-1 beta.