RU1789562C - Recombinant plasmid dna pgp 120-428 encoding hybridous protein showing antigenic properties of protein gp 120 hiv-1 - Google Patents

Description

on env: Bgl II (7071) - Bgl 11 (7651) (276-466) and Bgl II (7651) - Bam Ht a. k (467-750).

The recombinant protein encoded by a plasmid containing the Bgl 1.T - Bam Hi fragment possessed high antigenic activity under immunoblotting conditions. However, the recombinant protein containing the polypeptide encoded by the Bglll-Bglll fragment, which includes the region from 428 to 443 amino acids of protein 120, did not possess antigenic properties.

In another work, the same Bg ill (7071) - Bg ill (7651) fragment was cloned as part of an expression vector pJM containing the promoter operator trp E gene of the tryptophan operon E coll.

The main disadvantage of the described analogue is the lack of antigenic activity in a recombinant protein that carries the polypeptide encoded by Bgl II - Bgl II fragment of the HIV-1 env gene.

Known pazmide pENV 83, containing the natural DNA fragment of the HIV-1 env gene BICH-1 fused to the beginning of the gene / 3-galactosidase, is 1240 N in size. p., comprising a fragment encoding a region (428-443 aa), the resulting fusion protein recognizes antibodies to HIV-1 in the sera of patients with STI-Dom in the EL1SA test and is proposed by the authors for diagnostic test systems.

The disadvantage of the recombinant plasmid pENV 83 is the use of potentially hazardous foreign genetic material for its construction, as well as the presence of several antigenically significant regions of proteins other 120 and 41.

Thus, close analogs describing the construction of a recombinant plasmid containing a systematic fragment corresponding to the strictly defined Zitope of the antigenically significant region (428-443 a.a.) other 120 VCh-1, and expressing this fragment in the form of a peptide fused with the ctvl end / b-galactosidase is not available in the literature. .

The aim of the invention is the creation of recombinant plasmid DNA that provides a high level of synthesis of a chimeric polypeptide having a region of homology with a region of (428-443) protein dr 120 HIV-1, which is antigenically significant and provides a high level of synthesis of a chimeric polypeptide having antigenic protein properties dr 120

hiv-1. :

The goal is achieved using the recombinant plasmid pGP 120-428, providing synthesis in cells

E. coli polypeptide having antigenic properties of a protein of other 120 HIV-1. Plasmid pGp 120-428, containing a chemically synthesized DNA fragment encoding a fragment of a protein of other HIV 120 with coordinates 428-443, consists of the following elements: ......

a large fragment of EcoRI-HamHI plasmid pLZ4 size (6790 N. p.);

chemically synthesized ZaISA-ZaISA DNA fragment encoding the amino acid sequence 428-443 of the HIV-1 env protein, HTLV III;

fragment of EcoRI-Sau3A, size $ 8 N.

n. plasmid REMB 303 containing the a-amylase promoter, SD sequence and the initiating codon separated by a distance of 6 nucleotide pairs

ATG.

Plasmid pGp 12Q-428 contains:

ampicillin resistance gene as a genetic marker;

has a molecular weight of 4.6 MDA (size 69.55 bp);

provides synthesis of a hybrid polypeptide in E. col cells with a region of homology with a region of (428-443) protein dr 120 HIV-1 and having antigenic properties of protein dr 120 HIV-1. Hybrid

the polypeptide is synthesized in the form of a chimeric @ -galactosidase having an antigen-significant fragment at the N-terminus corresponding to region 428 through 443 of the amino acid of protein 120.

The essence of the invention lies in the fact that a chemically synthesized DNA fragment encoding the antigen-important region of the other 120 env (428-443) HIV-1 protein is coupled to the β-galactosidase gene in the expression vector.

The resulting recombinant plasmid provides the synthesis of a hybrid protein consisting of a polypeptide carrying the antigenic determinant of the protein dr 120 env

(428-443) HIV-1 fused to the M-terminus of {$ -galactosidase. .

The resulting fusion protein has the ability to bind antibodies to HIV-1 serum of AIDS patients in ELISA tests.

The method of constructing pGp 120-428 consists of several sequential steps: at the first step, a synthesized Synthesized Sau ZA - Sau is introduced into the original pLZ 4 plasmid at the unique BamHI site

BEYOND a DNA fragment containing sites for two restriction endonucleases Bgt If and Ham HI. The resulting plasmid is named pZ 41. EcoRI-SauSA is inserted at two sites EcoRI and Bglll of the azmid pZ 41

DNA fragment from plasmid pEMB 303 containing the promoter of the a-amylase gene, SD sequence and following it at a distance of 6 N. n. initiating ATG code. The resulting plasmid is named. PAZR. It provides the synthesis of galactosidase from the constitutive promoter of the ra gene of amylase and can be used to obtain N-terminal hybrid c / 3-galactosidase proteins, since at the beginning of the galactosidase gene behind the ATS initiating codon there is a unique BamHI site.

In the next step, the pAZR plasmid is hydrolyzed with a BamHI restriction endonuclease and ligated with a chemically synthesized Bglll - Bam HI DNA fragment encoding a polypeptide corresponding to region 428-443 of other 120 HIV-1.

The resulting plasmid, called pGp 120-428, provides in E. coli cells the synthesis of a hybrid protein having a homology region with a protein region of dr 120 (428- 443) and having antigenic properties of protein dr 120.

Thus, plasmid DNA was obtained for the first time, which ensures the synthesis of a hybrid protein with antigenic properties of dr 120 HIV-1 in E. coli cells by expressing an artificial gene encoding the antigenically significant region of dr 120 (428-443) fused to / -galactosidase.

The drawing shows the construction of plasmid pGp 120-428.

Designations: Na-gene / -lactase; lacZ gene / 8-galactosidase: P «50 regulatory region consisting of a promoter homologous to the promoter of the a-amylase gene from B. subtHis and an SD ribosomal binding site.

The essence of the invention is disclosed in the following examples.

Example 1. A method for constructing a recombinant plasmid pGp 120-428.

1 µg of plasmid pLZ4 DNA was digested with Bam HI endonuclease restriction (10 units) in R-buffer containing 10 mM Tris-HCI, pH 7.5, 50 mM NaCI, 10 mM MgCla, 1 mM dithiothreitol (DTT). The reaction is carried out for 1 h at 37 ° C. The completeness of hydrolysis is analyzed by electrophoresis. The drug is deproteinized using phenolic extraction, DNA is precipitated with ethanol and resuspended in TE buffer containing 10 mM HCI. pH 8 and 1 mm EDTA.

An individual adapter fragment preparation is obtained by annealing 60 picomoles of each of two oligonucleotides,

18 nucleotides long. The resulting adapter fragment contains the restriction endonuclease sites Bgl II and Bam HI, contains protruding sticky ends for the restriction endonuclease Sau ZA and has the following structure: Bgl II Bam HI Sau ZA GATCAGATCTGGATCCGA TCTAGACCTAGGCTCTAG

0Sau FOR

Ligation of hydrolyzed p124 vector DNA (0.02 μg); adapter fragment (0.40 μg) was performed using T4 phage ligase DNA (4 units) in a volume of 10 μl

5 (incubation was carried out for 10 hours at 12 ° C), The resulting plasmid mixture was used to transform E. coli cells. JC 5183.

Transformants were plated on an agarized medium with ampicillin, transferred to a nitrocellulose filter and clones hybridized with an oligonucleotide probe were selected (labeled P oligonucleotide, which is part of the adapter fragment, was used as a probe).

5 Plasmid DNA was isolated from the selected clones and analyzed for restriction endonuclease sites: Bgl II. and wat hi. The structure was confirmed by sequencing: the obtained plasmid DNA containing the adapter fragment was designated pZ 41. 1 μg of DNAR241 was digested with EcoRI restriction endonuclease for one hour in R-buffer. After that, the restriction enzyme Vd II was added and also incubated for

5 hours at 37 ° C. The drug is deproteinized using phenolic extraction, the DNA is precipitated with ethanol and resuspended in TE buffer.

A fragment of 98 n. A p. containing the α-amylase promoter, an SD sequence and a codon initiating from it at a distance of 6 nucleotide pairs are obtained on an EcoRI - Sau mixture for the DNA fragments of plasmid pEMB 303.

5 Isolation of an individual fragment is carried out by electrophoretic separation in a 6% polyacrylamide gel, followed by electroelution. Ligation of a mixture of hydrolyzed plasmid pZ41

0 (0.5 μg) and the fragment encoding the regulatory region from pEMB 303 (5 μg) are carried out using T4 phage DNA ligase (4 units) in a volume of 10 μl (incubation is carried out for 10 hours at 12 ° WITH).

5 The resulting plasmid mixture is used to transform E. coli JM 103 cells. Transformants are seeded on agar medium with ampicillin (50 μg / ml) and J-Gal (0.1 μg / ml), clones with a blue color are selected, plasmid DNA is isolated and

Analyzed for the content of the cloned fragment.

Plasmid DNA containing the desired fragment is designated pAZR. It provides the synthesis of β-galactosidase from the constitutive promoter Ra of the α-amylase gene. At the beginning of the β-galactosidase gene, at a distance of 15 nucleodes from the initiating ATG codon, a unique Wat II site is found.

1 µg of pAZR was digested with Bam HI restriction endonuclease (10 units) in R-buffer. The reaction is carried out for 1 h at 37 ° C. The hydrolysis is complete by electrophoresis. The preparation is deproteinized by phenolic extraction, the DNA is precipitated with ethanol and resuspended in TE buffer.

The preparation of an individual fragment encoding a polypeptide corresponding to region 428-443 of the protein dr 120 of HIV-1 is obtained by annealing 50 picomoles of two complementary oligonucleotides. 54 nucleotide long.

The resulting fragment is bounded by protruding sticky ends: on the left for Bg l II restriction endnuclease, on the right for Bam Hi and has the following structure:

Bam hi

QATCTGAAGCAGATCATCAACATGTGC CAGCAAGtTCG CAAAGCTATGTACGCG

ACTTCGTCTAGTAGTTGTACACCGTCC TTCAACCGTTTCGATACATGCGCCTAG

Bgl And ...

The ligation of the mixture of hydrolyzed flHKpAZR (0.05 μg) and the obtained fragment (1 μg) was carried out using T4 phage ligase DNA (4 units) in a volume of 10 μl, incubation was carried out for 10 hours. The resulting plasmid mixture was transformed with E, coli JM 103. Transformants are seeded on an agar medium with ampicillin (50 μg / ml), clones that have not lost their blue color are transferred to a nitrocellulose filter (because when a fragment is inserted in the reverse direction, two stop codons are located in the reading frame , which leads to stop reading of the D-galactosidase gene and eokrashennyh clones) are selected and the clones hybridizing with the oligonucleotide probe. As a probe, one of the labeled 3 P-oligonucleotides included in the ligated fragment is used.

Plasmid DNA was isolated from the selected clones and analyzed by Bsp RI restriction endonuclease digestion. The structure is confirmed by sequencing.

The resulting plasmid DNA containing a DNA fragment encoding a polypeptide corresponding to a protein region of dr 120 with coordinates 428-443 is designated pGp 120-428.

Example 2. Purification of recombinant

Antigua.

E. coli JM 103 cells containing durCp 120-428 plasmas were grown on LB medium in the presence of ampicillin (50 μg / ml) at 37 ° C for 18 hours. Cells were collected by centrifugation at 5000 rpm for 20 min at 2 ° C. washed with 0.1 M NaCl and again precipitated by centrifugation. After determining the mass of the sediment, the biomass is suspended in O. GM Tris-HCI, pH 7.5, 10

mM MgCla, 1 mM DTT, 0.1 mM PMSF, 5% glycerol, with the ratio: biomass: buffer: 1: (10-30). Cells are destroyed by ultrasound in a series of 30 s with 30-second interruptions upon cooling in an ice bath. The total processing time of 5 minutes The suspension is centrifuged at 10 thousand rpm./min, 2 ° C for 15 minutes. To the clarified lysate obtained, 30% treptomycin sulfate was added to the final

concentration of 3%. After 30 minutes at 0 ° C, the precipitate formed is centrifuged and discarded. Recombinant antigen-containing supernatant / detectable by

the activity of β-galactosidase is applied to a DE 52 DEAE cellulose column equilibrated with 0.2 M MTM (buffer containing 0.2 M NaCI, 10 mM Tris-HCi, pH 7.5, 1 mM MDS) 2I 1 mM DTT).

After application, the column is washed with 0.2 M MTM and the sorbed proteins are eluted with a linear NaCI gradient (0.2-0.8 M).

The yield of the hybrid protein is determined by the presence of activity / 3-galactosidase,

Fractions containing recombinant eigen are combined, the hybrid protein is precipitated with ammonium sulfate, adding it to a final concentration of 231 mg / ml. The precipitate collected by centrifugation was dissolved in 20 mM Tris-HCI pH 7.5, 20 mM EDTA and the protein was chromatographed on a Toureag TSK Gei HW 557 gel. Protein was detected as described in HPLC chromatography using HPAE cellulose. The concentration of recombinant antigen is determined taking into account that the specific activity of / 3-galactosidase is 300 thousand units. act./mg. Antigenic activity of a hybrid protein obtained after ion-exchange chromatography and gel filtration is evaluated by the results of an enzyme-linked immunosorbent assay with human serum unified by HIV. Yield of a hybrid protein having antigenic properties of a protein

gp 120 is 1-2 mg / r of cell biomass. : - - -;

Example 3. Enzyme-linked immunosorbent assay.

Selective binding of antibodies to the HTLVIII retrovirus with an immobilized recombinant polypeptide comprising an HIV-1 gp 120 protein fragment. The recombinant polypeptide including the region (428-443) of the HIV-1 gp 120 protein was sorbed on polystyrene plates manufactured by Nunk (Dani) or Flow (Great Britain) at a concentration of 2-10 μg / ml in 0.06 M pH bicarbonate buffer 9.6 for 16 hours at 2-8 ° C. Next, a standard enzyme-linked immunosorbent assay is performed with human donor blood serum (negative -J) and serum containing antibodies to HTLV III structural proteins previously verified in the immunoblot test (positive +).

An enzyme-linked immunosorbent assay is carried out according to the instructions for use of the recombinant HIV test system for the detection of antibodies to HIV-1.

1. The test sera are kept in a 1: 100 dilution in physiological saline, phosphate buffered, pH 7.4, with the addition of TWIN-80 detergent to a final concentration of 0.5% (FSB-T) in the wells of a plate with an sorbed polypeptide comprising a protein fragment gp 120 HIV-1.

Incubation was carried out at 37 ° C for 60 minutes.

Without dependent components of the serum, wash Zraza FSB-T.

2. Soak washed tablets with conjugate (protein A of Staphylococcus aureus - horseradish peroxidase) in a working dilution. Incubation was carried out at 37 ° C for 60 minutes, washed 3 times.

3. Incubation with an enzymatic substrate, which is 5 M solution of phenophenylenediamine in citrate phosphate buffer, pH 6 with the addition of 0.025% hydrogen peroxide. Incubation with the substrate was carried out for 30 minutes at room temperature in the dark. To stop the reaction, 50 µl of 2 M H2S04, stabilizing the chromogenic reaction product, was added to the sample (100 µl).

4. To quantify the results, the plates with the substrate after stopping the reaction are placed in a multiscan automatic photometer to measure absorbance at a wavelength of 492 nm. The following indicators were evaluated to determine the specific binding of antibodies to the HTLV III retrrvirus with a recombinant peptide:

the binding rate of immunoglobulins from positive serum to a recombinant polypeptide comprising the gp 120 region (A + 492);

the binding rate of immunoglobulins from a commercial diagnostic kit in a recombinant peptide

(A 492).

In 20 experiments, four samples of the recombinant polypeptide were used as a substrate. The average value of the binding of immunoglobulins from positive serum to the recombinant polypeptide (A + 492) was 0.499, the average value of

binding of immunoglobulins from negative serum () 0.266 mathematical treatment by the calculation method of the Stiodent test showed that the differences in the values of A + 492 are significant (P 0.999).

The present invention allows to obtain from 1 l of a cell suspension of 10 mg of a hybrid protein having a homology region with the gp 120 (428-443) HIV-1 protein and having antigenic properties of the protein

gp 120 HIV-1. Moreover, the synthesized fusion protein is a polypeptide consisting of 16 amino acids corresponding; the gp 120 protein region (428-443), flanked on the left by 8 amino acids encoded by the regulatory fragment and the adapter sequence, and by 4 amino acids encoded by the linker region and 1033 amino acids of the β-galactosidase protein on the right.

Thus, the invention for the first time produced a hybrid polypeptide having the antigenic properties of the gp 120 HIV-1 protein by expressing a chemically synthesized DNA fragment homologous to the antigenically significant region of the gp 120 protein with coordinates 428-443 fused to the / 3-galactosidase gene,

Claims (1)

Claims Recombinant plasmid DNA pGp 120-428 encoding a fusion protein c antigenic properties of HIV-1 gp 120 protein, measuring 6955 n. item and consisting of: EcoRI - Bam HI DNA fragment of the vector pLZ4, size 6790 N. n., Sau FOR - Sau FOR synthetic DNA fragment. 54 np in size. coding for the region of the protein dr 120 env (428-443) HIV-1; Zai ZA - EcoRI DNA fragment from plasmids PEMB 303, size 98 N. p. encoding a promoter homologous to the promoter of a-amylase from tcoti Bamhi Bacillus subtilis, SD sequence. ATЈ-initiating codon, genetic markers Arg gene for ampicillin resistance; unique EcoRI restriction sites. SalG1, located to the right of EcoRI at a distance of 3248 N. p., Pstl, located to the left of EcoRI at a distance of 752 N. P.