RO134998A2 - Set of two primers and one probe for detection and dosing of mutant npm1 gene - Google Patents

Abstract

The invention relates to a method of detection and dosing of cancer cells carrying NPM1 mutations, applicable in molecular diagnosis of acute myeloid leukemia. According to the invention, the method consists in that the biological sample is subjected to a single modified PCR procedure, depending on the endonuclease H2, using a single pair of primers: (P1 and Pmut) and one probe (S) together with an enzyme, such as endonuclease H2, heat-resistant, natural or modified, with the effect of ribose elimination from primers, so that the expression of NPM1 with mutations is detected from blood sample or hematogenic marrow sample at a detection limit of at least 10 mutant NPM1 copies.

Description

SET OF TWO FIRSTS AND A PROBE FOR DETECTING AND DOSING THE MUTANT NPM1 GENE EXPRESSION

b) Technical field and definition of technical terms

The invention is in the field of molecular biology and genetic analysis of leukemia! acute myeloids or other pathologies associated with mutations in exon 12 of the NPM1 gene. Acute myeloid leukemia, like any other type of cancer, is the consequence of the accumulation of genetic mutations in cells. Genetic mutations can occur at any time during the life of a cell. Some are corrected by repair mechanisms, and others persist in the cell and can be passed on to cellular offspring (if that cell is a hematopoietic progenitor that multiplies). Most genetic mutations cause some of the cellular mechanisms to unfold abnormally. The accumulation of a set of such mutations in the genome of the same cell increases the number of affected cellular mechanisms and ultimately causes the cell to become a tumor. A very wide range of genetic mutations, although different in nature and location in the genome, can eventually lead to cancer. The consequence of this phenomenon is that acute myeloid leukemia differs in pathogenic manifestation, treatment, severity, prognosis and life expectancy of the patient depending on the nature of the mutations. Therefore, the identification of mutations provides essential information to the doctor to establish an accurate diagnosis, the most appropriate treatment and a realistic prognosis.

As a result of the development of sequencing technology, many mutations associated with acute myeloid leukemia have been discovered. For some of them, they have been shown to occur very frequently in acute myeloid leukemia and, at the same time, have a prognostic value (the probable evolution of the patient after treatment). In this category are also the mutations that occur in the NPM1 gene. The gene encodes a protein, which has a role in multiple cellular mechanisms, the most relevant for the pathogenesis of acute myeloid leukemia being cell proliferation (multiplication) and differentiation.

NPM1 mutations encountered in acute myeloid leukemia are variable in sequence, but all represent the successive insertion of four or more nucleotides into a region located in exon 12. Regardless of the size and sequence of the $ DNA fragment

inserted, the pathological consequence is the same: the mutation causes the modification of the NPM1 protein at the terminal end so that the protein is no longer located in the nucleus and is abundant in the cytoplasm of cells (compared to normal cells).

One of the objectives of clinical trials in the field of oncology is to establish prognostic methods for the further evolution of patients. This goal is especially important in acute myeloid leukemia because the recurrence rate is high. In order to assess the risk of recurrence, it is necessary to monitor and quantify the presence of leukemia cells in the biological preparations taken from the respective patients. In practice, the detection of leukemic cells is performed at the level of DNA or RNA, by testing the presence of mutations specific to that patient. The most widely used molecular analysis methods are based on the ROP procedure, as these methods are the most specific and can detect very small amounts of the target.

Definitions f

DNA = deoxyribonucleic acid = polymer formed by covalent bonding of two or more deoxyribonucleotides; there are four types of deoxyribonucleotides: adenine (A or a), cytosine (C or c), guanine (G or g), thymine (T or t);

DNA sequence = the order in which the four types of deoxyribonucleotides succeed each other in a DNA molecule; by convention any written sequence has end 5 on the left and end 3 on the right;

Double-stranded DNA = consisting of two complementary strands to each other, which stand together at temperatures below 45 degrees Celsius, through hydrogen bridge interactions; each strand is a DNA fragment;

Target DNA = double-stranded DNA molecules that will be detected and multiplied by a PCR reaction;

DNA polymerase = protein with enzymatic activity, which binds to double-stranded DNA structures formed by a strand of target DNA (strand as a template) and the complementary primer; after attachment to the end 3 of the primer, the enzyme has the ability to lengthen the primer by successively adding deoxyribonucleotides (polymerization), which it covalently binds, one by one, to the end 3 of the growing sequence; the type of deoxyribonucleotide (A, C, G or T) selected by the enzyme as well as their order of attachment to the growing DNA fragment are chosen so that the sequence of the new DNA is perfectly complementary to the template strand, attached to the primer;

Primers = short single-stranded DNA fragments (generally consisting of less than 35 deoxyribonucleotides) whose sequences are complementary to the target DNA and which have the role of initiating the enzymatic activity of DNA polymerase; at least two primers are always used, each complementary to one of the two chains.

Probes = short single-stranded DNA fragments (usually consisting of less than 35 deoxyribonucleotides) whose sequences are complementary to the target DNA. The probe has at the end 5 a substance with fluorescent properties, and at the end 3 a substance with the role of blocking the fluorescence of the substance at the opposite end (end 5). The substance with fluorescent properties cannot emit any fluorescent signal as long as it is bound to the probe, because it is close to the compound with the role of blocking fluorescence. Each probe works only together with a primer, both being complementary to the same strand of the target DNA, ie the template strand. in relation to the die chain, the probe is designed to be complementary to a region of the die located upstream of the sequence complementary to the primer. Thus, during the polymerization step (see PCR definition), as it adds deoxynucleotides to the parent strand, the DNA polymerase moves along the template strand until it meets the probe bound to that template. At that time, the enzyme carries out the degradation activity of the probe end 5 and the release into solution of the compound with fluorescent properties.

The released substance may emit the characteristic fluorescent signal and the signal strength is proportional to the number of degraded probes. Because the stoichiometric ratio between the number of degraded probes and the number of target DNA molecules is 1: 1, the intensity of the fluorescent signal is a way to dose the target DNA. Fluorescent property = the ability of a chemical compound to emit a signal with a certain wavelength only when stimulated by another signal with another wavelength;

FAM, HEX = chemical compounds that have fluorescent properties; each emits a signal with a distinct wavelength;

lABkFQ = chemical compound intended to block the fluorescence emission of compounds attached to probes>

TaqMan PCR (original name is 'TaqMan polymerase chain reaction') = cyclic enzymatic method by which target DNA is detected with high specificity and multiplied. The reaction mixture for PCR contains at least the following types of ingredients: DNA polymerase enzyme (heat-resistant enzyme); primers; fluorescent probes; target DNA molecules; deoxyribonucleotides from the 4 categories mentioned above; inorganic substances with the role of ensuring the ionic strength and pH of the reaction solution, optimal for the functioning of the enzyme. Each PCR cycle consists of 3 steps: the strand of the DNA strands; the stage of binding the primers and probes; polymerization step. In the first stage, which corresponds to temperatures above 95 degrees Celsius, the non-covalent interactions between the chains disappear and the target DNA becomes single-stranded. in the second stage, when the temperature drops to 60 degrees Celsius, the primers and probes bind to the complementary areas existing on the target DNA coffees, in the third stage the polymerization of the primers attached to the template strand takes place and the generation of a new DNA strand (details at definition of DNA polymerase). In general, the temperature of step three is 72 degrees Celsius; frequently, steps two and three coincide and take place at the temperature at which the primers and probes bind to the die chain (most often, 60 degrees Celsius). At the end of stage three of a cycle, as a result of the polymerization, a new strand appears for each template strand, so that after each cycle, the total number of target DNA molecules doubles. In parallel with the multiplication of the target DNA, in the third stage there is also the degradation of fluorescent probes and the release of compounds with fluorescent properties (details on the definition of probes). The measured fluorescent signal of the compounds released from the probes is proportional to the number of target DNA molecules (details of the probe definition). As the cycles are repeated, the amount of target DNA increases during PCR, and from this point of view, the number of degraded probe molecules, as well as the intensity of fluorescence, increase exponentially.

PCR device = device dedicated to PCR reactions, which determines and controls with high precision the temperature of the reaction mixture;

Genome = the totality of double-stranded DNA inside an organized nucleus in the form of chromosomes;

Coding gene = part of the genome that encodes a protein, ie through the transcription of the gene a messenger RNA is generated, which, in turn, is converted into protein by translation.

Exon = region of DNA in a gene, which contains some of the information needed to synthesize the protein encoded by that gene; a gene can have one or more exons, and all the exons in a gene are converted to messenger RNA and encode the entire protein;

RO 134998 Α2

Genetic mutation = any change in the genome, in the sense that the sequence of deoxyribonucleotides in any region of DNA is different from the normal sequence;

Acute myeloid leukemia = pathology of the human hematopoietic system, characterized by the existence in the patient's body of tumor cells from myeloid precursor cells and which, due to genetic mutations, have acquired the ability to multiply uncontrollably; myeloid precursor cells are immature cells in the bone marrow that normally turn into monocytes, neutrophils or white blood cells in the category of myeloid cells;

Molecular diagnosis = any molecular technical procedure by which the presence of a genetic mutation is detected, in order to genetically characterize the investigated pathology and to help the doctor to establish a prognosis regarding the subsequent evolution of the patient;

NPM1 mutations = mutations in the NPM1 gene, represented by the random insertion in certain places of exon 12 of DNA fragments with variable sequences and sizes;

c) The state of technology

The invention relates to a procedure for detecting and dosing insertion-type mutations that may occur in the NPM1 gene. Clinical studies published in the last 10 years have shown that this type of mutation is frequently associated with acute myeloid leukemia: the frequency of NPM1 mutations is at least 20% of all cases of acute myeloid leukemia. In addition, monitoring of NPM1 mutations in peripheral blood cells harvested from patients, during and after treatment, provides essential information on the efficacy of treatment, as well as prognostic information on the likely follow-up of the patient.

A number of laboratories have developed PCR techniques to analyze mutations in the mutant NPM1 gene, but in most cases the techniques are applied only locally, with established "in-house" procedures. Thus, most studies published by these laboratories are based on the TaqMan method, in which detection and dosing are performed with sets of primers coupled with a probe. Because NPM1 mutations are variable in sequence, the analysis is performed with several sets of primers, one for each mutation. More recently, an attempt has been made to simplify the procedure by using degenerate primers, ie primers that are only partially complementary to those mutations. In this way several types of mutant sequences with a lower number of primers can be detected. Another group tested a multiplex PCR, i.e. a

EN 134998 Α2 amplification reaction in which several primers are mixed, each with a complementary sequence for one of the known NPM1 mutations. Attempts to quantify the mutant NPM1 were also performed in the case of digital PCR, a method in which the result of the reaction is analyzed at the end. Two variants of the method were published: the distinction between the normal form and the mutant form was made at the level of primers (as in the above qPCR cases); the identification of mutant or normal forms was performed at the probe, depending on the sequences. In the most recently published tests, digital PCR has been used in conjunction with multiplex PCR. All these methods have proved effective in the analysis of NPM1, but each has presented certain technological limitations in situations when the amount of mutant NPM1 is low.

The alternative to PCR-based methods is sequencing and identifying the specific mutation of each patient. Although this alternative is used in medical research, it is not clinically implemented due to some disadvantages: the work schedule is complex and very expensive; the procedures can be applied only by specialists with very good expertise in molecular biology and bioinformatics; the method must be applied differently for each patient.

The invention relates to a procedure for detecting and dosing NPM1 gene mutations by applying a modified PCR procedure, generically called H2 endonuclease-dependent PCR. The principle of operation of the PCR method has remained unchanged since the invention of the method (1983, Dr. Kary Mullis - use of primers; 1986, Dr. Randall Saiki - use of heat-resistant polymers). However, PCR-based technology has evolved significantly over the last 20 years, with the addition of new functional elements. One such change is the use of H2 endonuclease, an enzyme capable of cleaving a nucleic acid sequence that has a single flanked ribose of at least 4 deoxyribonucleotides on both sides. The enzyme breaks down the covalent bonds between ribose and deoxyribose if the fragment is double-stranded. The h2 endonuclease-dependent PCR procedure is schematically described in Figure 1. In this method, the primers are modified as follows: (i) they contain a ribose (figure 1 black triangle with the tip up), positioned 5 bases before the 3 'end; (ii) at the 3 'end they have a modification (figure 1 - black star) that prevents DNA polymerase from polymerizing and expanding the DNA fragment - thus the PCR reaction is blocked. In this context, the PCR amplification reaction will occur only after the primers are activated: heat-resistant H2 endonuclease (Figure 1 - dotted semicircle) recognizes only Pmut primers that are perfectly linked to the target gene (Figure 1 - Pmut disposed

R0 134998 Α2 ΛΖ parallel to the target), loosens the covalent bonds between the ribose and the neighboring dexiriboses (flanks) and thus eliminates the change at the 3 * end. Removal of the inhibitor from the 3 'end causes activation of the primer (figure 1 - activated Pmut), which in this form can be extended by coordinated polymerization by DNA polymerase (figure 1 - horizontal dashes with dashed line). The polymerization causes the probe to degrade (figure 1 - S) and thus the fluorescent particle (figure 1 - empty circle) separates from the fluorescence inhibitor (figure 1 - black circle). The fluorescent signal recorded over time (figure 1 - graph on the right, bottom) is proportional to the number of target molecules (figure 1 - mutant NPM1).

d) The problems of current technology

Molecular diagnosis for the detection and characterization of genetic mutations is based in the vast majority of cases on PCR technology. Because primers and probes are designed based on the nucleotide sequence of the DNA region comprising the analyzed mutation, PCR technology can only be applied if the analyzed mutation is well known. Thus, in cases where the mutant region of a gene may have variable sequences, different between patients, it is necessary to establish a set of primers for each variant variant. The NPM1 gene mutation is also included in this category. More than 24 variants of the NPM1 mutant gene are known, of which 6 are more common. Molecular diagnosis using standard PCR would involve performing 24 separate PCR reactions for each biological sample.

The variant of using degenerate primers (a primer can be attached to several sequence variants) or the variant in which several primers are mixed in a single PCR reaction (multiplex PCR) was also tested. The main problem in such cases is the decrease in the accuracy of the method and the increased risk of obtaining false results. Most methods are effective for diagnostic tests, when the amounts of mutant NPM1 are increased. In the case of monitoring the evolution of leukemia in patients under treatment or after treatment, when the amount of mutant NPM1 is substantially reduced in the samples collected, all these methods have limits.

The technological alternative is represented by the DNA sequencing of the patients to identify the mutant sequence, followed by PCR monitoring with specific primers for the respective sequence. This procedure is expensive and currently only applies in medical research.

e) Disclosure of the invention

The invention presents a technological solution for the detection and dosing of the most frequent NPM1 mutations, variable in sequence, by a single PCR reaction. Unlike the methods published in the literature, in this case, the accuracy of the method is much increased by the use of primers that can be activated by heat-resistant H2 endonuclease.

The invention represents a set of two primers (figure 1 - primer P1 and primer Pmut) and a probe (figure 1 - probe S). Primer P1 is complementary to an area of exon 11, which is not affected by mutations. Primer P1 is required for amplification of NPM1 and exponentially increasing the amount of product.

The Pmut primer is complementary to the region of exon 12 susceptible to pathogenic mutations (figure 1 - the area susceptible to mutations is marked with a vertical line in exon 12 of NPM1, and the area that actually includes a mutation is shaded with vertical lines in exon 12 of Mutant NPM1). This primer is the one that ensures the specificity of the reaction, in the sense that it either allows PCR amplification if there are mutant targets in the analyzed sample, or blocks the PCR reaction if all NPM1 molecules are normal. in the case of the interaction between the normal NPM1 molecule and the * »blocked Pmut primer, the vertically hatched area of the primer (figure 1) has no target sequence correspondent (because the mutation is missing), so that the area and the 3 'portion (with ribose) do not binds to the target. Because the ribose area does not interact with normal NPM1 and does not make double-stranded structures, endonuclease H2 (figure 1 - dotted arc) is not able to remove the PCR inhibitor from the end (figure 1 - star marked in black) and thus the primer does not can be extended by PCR (figure 1 - X marking). in this way the accuracy of the method is ensured: if none of the NPM1 molecules in the analyzed sample is mutant then the reaction does not take place. J

When the Pmut primer (Figure 1 - Pmut-blocked primer) interacts with the mutant NPM1, it aligns along its entire length with the target molecule to form a double-stranded structure, including the ribose region. In this situation, the heat-resistant H2 endonuclease recognizes the double-stranded structure between Pmut and the mutant NPM1, digests the bonds between the ribose and the neighboring deoxyriboses and removes the 3 'end of the primer. In this way, the primer Pmut is converted from the blocked form to the active form. The activated Pmut primer induces DNA polymerase activity according to the arrow (figure 1 - horizontal arrow with dashed line), and when the enzyme

R0 134998 Α2 meets probe S causes its degradation. Upon degradation of the probe, performed by DNA polymerase, the fluorescent compound is released and will emit the characteristic fluorescent signal. The intensity of the fluorescent signal is a measure of the number of mutant NPM1 molecules.

The probe is complementary to the sequence formed by attaching exon 11 to exon 12, and the two primers are complementary with different exons (figure 1 - primer P1 is complementary to the sequence from exon 11, and primer Pmut is complementary to the existing sequence at exon 12) . In this way the expression of the mutant NPM1 is evaluated by dosing the messenger RNA transcribed from the NPM1 gene. Due to the sequence specificity of the primers and probe, the test does not quantify NPM1 at the genome level so the results accurately reflect the level of gene expression.

The sequences of primers and probes are:

(first P1) 5'-CAATTATGTGAAGAATTGCTTCCGGATGAC -3 '(first Pmut blocked) 5'TACCACATTACACCACACACGAGAGACTTCCTCCACTGCCAGGCAGAGaTCTTC (C3) -3' (first Pmut activated S) + C + AGT / 3IABkFQ /, where: "a" is ribose, 6-FAM "is the fluorescent compound (fluorescein)," lABkFQ "is the fluorescence inhibitor, (C3) is the PCR inhibitor," + ... "is modified LNA nucleotides, and the rest are deoxyribonucleotides.

f) The practical realization of the invention

The invention was practically tested for NPM1 A (TCTG sequence), B (CATG sequence) and D (CCTG sequence) mutations using the clinically recommended plasmid set ("NPM1 mut A cDNA MutaQuant Stds", catalog no. 677591, " NPM1 mut B&D cDNA MutaQuant Stds ”, catalog no. 677791, manufacturer Ipsogen / Qiagen, Hilden, Germany). These plasmids are used in medical practice to allow the dosing of the number of mutant NPM1 copies, through a procedure recommended by European hematology societies. The three mutations tested represent approximately 70-89% of NPM1 mutations. The testing was performed in triplicate by two operators. The testing was performed with the set of reagents provided by Thermo Fischer Scientific (TaqMan ™ Universal Master Mix II, no UNG ”, catalog no.

RO 134998 Α2

4440047, United States of America), in accordance with the manufacturer's instructions. The primer concentration is 0.3 micromolar, and the probe is 0.5 micromolar, in a final volume of 20 microliters. For each mutation, a variable number of copies of plasmids were tested, as delivered by the manufacturer (Figure 2 - values on the horizontal axis, which are as follows, in order from left to right, 10 copies, 100 copies, 1,000 copies , 100,000 children, 1,000,000 children). For each reaction, 2.3 million enzyme units of heat-resistant H2 endonuclease ("Rnase H2"), donated from the extremely thermophilic organism Pyrococcus abyssi, manufacturer Integrated DNA Technologies, Inc., catalog no. 11-03-02-02, United States, were added. of America). Figure 2 shows the results of calibration with serial dilutions for each type of mutation analyzed. In all cases, even if the sequence of the mutation is different, the accuracy of the PCR reaction is high (mutation A - R = 0.998; mutation B - R = 0.999, mutation D - R = 0.998). Figure 3 shows the profile of the fluorescent signal recorded during the PCR reactions underlying the NPM1 mutA calibration curve - the 5 recordings without arrows. The results prove that a single set of primers plus probe is enough to detect mutant NPM1 with variable seven.

The primer plus probe set was also tested for biological samples (total RNA extracted from peripheral blood and converted to complementary DNA). Figure 3 shows a typical result for a leukemic sample mutated to NPM1 and for a sample with normal NPM1 - only the fluorescent curves marked with arrows: the horizontal arrow indicates the mutant sample, and the vertical arrow indicates the normal sample. The result demonstrates that the method is applicable in the medical field.

g) Advantages of the invention

The main advantage of the invention is that by a single PCR reaction different dose NPM1 mutations can be detected, variable in sequence. It is no longer necessary to design, synthesize and optimize primers and probes for each mutation. Virtually all patients can be tested by a single PCR reaction. The result obtained has clinical relevance, because the prognostic value of the mutant NPM1 gene is the same regardless of the mutation sequence. »I 1

The second advantage is that, by including the step of activating the primers, by digestion coordinated by the H2 endonuclease, the accuracy of the method is much increased. The activation of the primers is strictly dependent on the presence of the mutant sequence and thus eliminates the risk that the test erroneously indicates that the analyzed sample contains mutant NPM1 molecules.

me

The method would reduce the cost of diagnosing NPM1 as it reduces the number of PCR reactions and the consumption of materials and reagents. secondly, the costs of diagnosing NPM1 by sequencing would be reduced: a pre-selection of samples could be made by testing NPM1 with the PCR method set out here and only positive samples would be evaluated later, if clinically relevant, by sequencing. »

h) The description of the figures in figure 1 is presented schematically the operating principle of the PCR reaction dependent on H2 endonuclease. Thus, primers dependent on H2 endonuclease activity (inactive Pmut) have two specific features: at the 3 'end they have a structural change (marked with a black star) that inhibits DNA polymerase binding; also in the 3 'region, but with 5 bases closer to the center of the sequence, the primers have a ribose (marked with a black triangle), the rest of the nucleotides being deoxyribose. When the inactive primer recognizes and binds to the perfectly complementary sequence on the target molecule (mutant NPM1), a double-stranded DNA structure is generated, which has a single ribose in its composition. This structure and only it is digested by the heat-resistant H2 endonuclease (marked with a dotted semicircle), a process after which the ribose and the 3 'end are removed from the primer, which thus becomes activated (Pmut active) and which is extended by the polymerase to at the other end of the target. During polymerization, the S-probe fragmentation phenomenon occurs, which triggers the emission of a fluorescent signal that is recorded in real time by the instrument. Probe S is an oligo DNA that has a fluorescent dye (white circle) at the 5 'end, and has a fluorescence inhibitor (black circle) at the 3' end. As long as the probe is complete, the fluorescent signal is canceled by the neighboring inhibitor. Following degradation of the probe, performed by DNA polymerase, the fluorescent compound is released and will emit the characteristic fluorescent signal (ray circle). The intensity of the fluorescent signal is a measure of the number of target molecules at the time of recording.

If the primer interacts with a molecule that does not have the characteristic sequence (in this case, normal NPM1), then its binding to the target is only partial (in the figure, the primer is not parallel to the target along its entire length) and no double-stranded structure is formed. to include ribose. In this embodiment, the heat-resistant H2 endonuclease cannot digest the primer and cannot remove the 3 'end, and the primer remains inactive. Idle primer (Pmut blocked) no

R0 134998 Α2 Iq can be extended by polymerization (X-marked phenomenon in the figure) and, consequently, no probe degradation occurs and the fluorescent signal is absent.

The term complementary DNA in Figure 1 refers to the fact that NPM1 molecules are obtained from RNA by converting it to DNA.

Figure 2 shows the calibration curves for detecting mutations A (left graph), B (left graph) and D (left graph) of NPM1. For each graph, the amount of NPM1 (number of copies) is indicated on the horizontal axis, and the Ct values produced by the PCR reactions are indicated on the vertical axis. Each point is a PCR reaction corresponding to a certain amount of target and a Ct value. The lines represent the calibration equation established by a specialized software.

Figure 3 shows the fluorescent profiles of some PCR reactions.

Profiles marked with arrows were made with biological samples (vertical arrow indicates a sample without mutations in NPM1, and the horizontal arrow indicates a sample with mutation NPM1 mut A); the other PCR reactions were performed with the mutation-carrying plasmids NPM1 mut A existing in the calibration kit. The Ct values are determined automatically by the instrument and represent the number of reaction cycles (on the horizontal axis) corresponding to the point of interaction between the fluorescence curve and the horizontal line marked, in this case, with the value 0.315.

i) Applicability of the invention

The invention is applicable in the molecular diagnosis of acute myeloid leukemia, for the detection and dosing of cancer cells, carriers of NPM1 mutations. The test can be applied for RNA analysis obtained from blood or hematogenous marrow samples.

The PCR assay is combined with other standard procedures by which RNA is converted to complementary DNA, a step that precedes the PCR reaction. Alternatively, the test can be applied directly to RNA preparations, in which both processes (RNA conversion and PCR reaction) are carried out in a single step.

Because the procedure has a detection limit of at least 10 mutant NPM1 copies, the invention is applicable to any medical procedure that monitors the presence of residual leukemia cells in patients undergoing or post-treatment.

The test can be applied in a pre-selection stage of the samples to be evaluated later by sequencing, with the advantage of reducing the number of sequencers for the NPM1 gene.

Claims (4)

demand 1. Set of two primers and a probe to detect and dose the NPM1 mutations encountered in acute myeloid leukemia, which have the following structure: (primer P1) 5'-CAATTATGTGAAGAATTGCTTCCGGATGAC -3 '(primer Pmut blocked) 5'TACCACATTACACCACACCT3 3 '(Pmut primer activated) 5'TACCACATTACACCACACACGAGAGACTTCCTCCACTGCCAGGCAGAG -3' (probe S) / 56-FAM / TAG + C + CTCTTGGT + C + AGT / 3IABkFQ /, where: "a" is ribose, "6-FAM" is compound fluorescent (fluorescein), "lABkFQ" is the fluorescence inhibitor, (C3) is the PCR inhibitor, is the modified LNA nucleotide, and the rest are deoxyribonucleotides. The procedure for detecting and measuring NPM1 mutations encountered in acute myeloid leukemia 1 I », without fully knowing the mutant sequence and involving the primers and probe specified in claim 1, together with the use of natural or modified H2 endonuclease or the use of any enzyme with enzymatic activity similar to H2 endonuclease, respectively, ribose elimination activity from the specified primers. 3. Claims 1 and 2 are performed with RNA samples after their conversion into complementary DNA, regardless of the conversion method and regardless of whether the RNA source is blood or hematogenous marrow, collected for the purpose of diagnosis or monitoring of the evolution of leukemic cell populations in patients, before, during or after treatment. 4. Claims 1 and 2 are made with any commercial kit intended for reactions i i TaqMan type PCR, as well as the use of any type of thermophilic DNA polymerase capable of degrading the probe during polymerization.