PT1844164E - Method of detecting pathogens using molecular beacons - Google Patents

Description

1

DESCRIPTION

" METHOD FOR DETECTING PATHOGENIC AGENTS USING BEACONS MOLECULAR PROBES "

This invention relates to specific diagnostic means for organisms associated with sexually transmitted diseases, and more particularly to the detection of human papillomavirus (HPV) genotypes, primarily genital human genital papillomavirus genotypes.

Human papillomavirus and its importance

According to the World Health Organization (WHO), cervical cancer is the second most common cause of cancer death in women. The presence of HPV infection has been implicated in more than 99% of cervical cancers worldwide. As estimated, more than 500,000 women globally develop cervical cancer every year and more than 273,000 of these cases are fatal. Even with screening programs through the Pap smear, the number of deaths of women with cervical cancer is significant every year. HPV infection is the most common sexually transmitted disease (STD) worldwide, and more than 60% of sexually active women are infected with HPV in the genital tract once in a lifetime. Regardless of the state of the HPV infection, less than 1 in 10,000 women will develop invasive cervical cancer. The fact that most HPV-infected women do not develop cytologic abnormalities or cancer underscores the importance of the modulating factors of cervical cancer disease development in HPV-infected women. These factors may include the HPV genotype and molecular variant, HPV viral load, persistence of HPV infection, co-infection or other STD agents, host immune status, and environmental factors such as smoking.

Papillomaviruses are small DNA viruses that infect the epithelial cells of a mammal, causing proliferative epithelial lesions, which may be benign, for example, fibropapillomas (warts) or malignant ones. All papillomaviruses are similar considering that the size of the genome, organization, open reading frame and functions of the proteins are shared. Many, but not all, regions of the genome are conserved among the various papillomaviruses.

Due to the close association between the life cycle of the papillomavirus and the state of differentiation of the host cell, details of the life cycle of the papillomavirus are not yet completely elucidated. Papillomaviruses are known to infect basal epithelial host cells where viral genomes are established and maintained as low copy number epitomes that replicate in coordination with host cell replication. As the infected cells differentiate into keratinocytes, the viral DNA is amplified, the late expression genes are induced following the vegetative replication of the papillomavirus.

Papillomaviruses infect a wide variety of animals, including humans. Human papillomaviruses (HPV) (including the family Papilomaviridae, Alpha-, Beta-, Gamma-, Delta-, Mupapilomavirus and genera 3

Unclassified papillomaviridae) are common causes of sexually transmitted diseases. Various types of HPV have been identified by means of DNA sequencing data and 96 HPV genotypes have been fully sequenced to date. HPV genotyping is based on DNA sequences from the Ll, E6 and E7 genes. A 10% difference in sequence, relative to previously established chains, is sufficient to define a new virus type. The heterogeneity of the human papillomavirus group is generally described in de Villiers, 1989, J. Virology 63: 4898-4903. The genomes of the numerous HPV types were sequenced and / or characterized.

HPVs are currently oncogenic DNA viruses, whose genome is organized into three regions: the early expression gene (EI to E7) regions, the late expression gene region (Ll and L2), and the upper regulatory region Region - URR) or long control region (LCR). URR has binding sites for many repressors and transcriptional activators, suggesting that it may play a role in determining the host variety for specific types of HPV. EI and E2, however, encode proteins that are vital for the replication of extra-chromosomal DNA and for the completion of the viral life cycle. Ο E2 encodes two proteins: one, which inhibits transcription of the early expression region and the other, which enhances the transcription of the early expression region. A hallmark of cervical carcinoma associated with HPV is loss of expression of E2 viral proteins. Recently, a new E2 protein has been described, consisting of the product of the small open reading frame E8 with the E2 protein part. This protein has the ability to suppress both viral replication and viral transcription and therefore it is believed to play an important role in viral latency. The E4 protein is expressed in the late stages of infection when the virions are constructed, and the transformation characteristics are unknown; however, this protein is considered to play an important role in virus maturation and replication. The E4 protein also induces the collapse of the cytoplasmic cytokeratin network in human keratinocytes, a situation that may aid the release of virions from the infected cell. The open reading frame (ORF) E5, however, is often deleted in cervical carcinoma cells, indicating that it may not be essential in maintaining malignant transformation of the host cell. When present, E5 interacts with various transmembrane proteins such as epidermal growth factor receptors, platelet-derived growth factor β and colony stimulating factor. In one study, in which 16 HPV infected cells were used, the E5 protein was found to have weak transformation activity.

In carcinogenesis, ORF E6 and E7 are considered to have the most important roles. These two units encode oncoproteins that allow replication of the virus and the immortalization and transformation of the host cell from the HPV DNA.

The early region, LI and L2 units encode viral capsid proteins during the late phases of virion construction. The protein encoded by L1 is highly conserved among the different papillomavirus species. The minor capsid protein encoded by L2 has more sequence variants than Li protein. HPV can infect the basal epithelial cells of the skin or inner tissue alignments and are therefore categorized as either cutaneous or mucosal (anogenital) type. HPV DNA is usually extrachromosomal or episomal in benign cervical precursor lesions. However, in many cervical cancer cells, as well as in cervical cancer cell lines and human keratinocytes transformed by HPV in vitro, the HPV DNA is integrated into the host genome.

Carcinogenic tissues may contain both integrated and episomal DNAs, although integration appears to occur more frequently in cervical cancer associated with HPV 18 than in cervical cancer associated with HPV 16. The integrated HPV 16 is present in some pre-malignant lesions, but is not always present in carcinomas. During the integration of HPV DNA, the viral genome breaks normally in the E1 / E2 region. This break usually causes loss of the El and E2 regions. The loss of E2, which encodes proteins including the protein that inhibits the transcription of the E6 and E7 regions, is known to result in the uncontrolled and increased expression of the oncogenic proteins E6 and E7. It has been observed, however, that increased expression of E6 and E7 leads to malignant transformation of host cells and to tumor formation. Viral integration of HPV into host genomic DNA is associated with the development of polyclonal status into monoclonal 6 status in cervical intraepithelial neoplasia (NIC), and these events play a key role in the development of low grade cervical neoplasia for cervical neoplasia. high grade.

DNA copy number imbalance (NIC) models are characteristic of a degree of cervical squamous intraepithelial lesion (SIL), human papillomavirus (HPV) status, and postoperative recurrence. While several NICs were observed at similar frequencies in HG-SIL (high-grade SIL) as well as in LG-SIL (low-grade SIL), others, including gain in lq, 3q and 16q, were frequently found in HG-SIL more not in LG-SIL. Significantly more CNCs per case were found in HG-SILs, with loss of the HPV 16 E2 gene and in HG SILs, which subsequently recurred. The data are consistent with the sequential acquisition of CNIs in the development of cervical SIL. The higher frequency of CIN associated with loss of the E2 gene in vitro supports the signals that the integration of high-risk HPV is associated with genomic instability.

Based on existing epidemiological, clinical, and molecular data, a subgroup of HPVs are unequivocally the etiologic agents for cervical cancers and their precursors. HPVs have been detected in approximately 90% of cervical adenocarcinomas and squamous cell carcinomas. Most HPV infections are eliminated spontaneously, but persistent infections with HPV DNA have been discovered in metastases from cervical tumors. However, known types of high-risk (or oncogenic) HPV are a significant risk factor for cervical cancer and 7 are increasingly recognized for their role in other types of cancer. Virtually all cervical cancers (99%) contain high-risk HPV genes, most commonly types 16, 18, 31 and 45. Other high-risk types include types 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68 and 73. HPVs 31, 33, 35, 51 and 52 are often referred to as " intermediate risks " considering that they are more common in moderate or severe dysplastic lesions than in carcinomas. Among the high-risk chains, HPV 16 and HPV 18 are most closely associated with cervical carcinoma. HPV 16 DNA was discovered in more than 50% squamous cell carcinomas, while HPV 18 DNA was discovered in more than 50% adenocarcinomas. However, the vast majority of anogenital HPVs have oncogenic potential. The interaction of HPVs with host cells has two major biological consequences: a) All anogenital HPVs induce low grade squamous lesions, which are the morphological correlation of a productive infection and the immortalization phenotypes exerted by normal expression and E6 and E7 . Immortalization is an inherent pailomavirus strategy to mobilize resources for DNA replication and to produce new offspring. b) Rarely, HPVs induce a proliferative epithelial phenotype recognized as a high-grade lesion and this is the next cytohistological precursor of invasive cervical carcinoma, which may involve an uncontrolled expression of E6 and E7.

To date, clinical diseases associated with HPV infections and the potential field of applications for 8 HPV detection and typing methods include condyloma acuminata, lichen sclerosus, squamous cell hyperplasia, intraepithelial vulvar neoplasm, cell carcinoma cervical intraepithelial neoplasia, cervical carcinoma, cervical adenocarcinoma, anal intraepithelial neoplasia, penile intraepithelial neoplasia, laryngeal adenocarcinoma, recurrent respiratory papillomatosis, and verrucciform epidermodysplasias. Recent evidence suggests that HPV may also play a role in the development of prostate cancer in men.

Precursor lesions of cervical cancer (intraepithelial lesions) or cytological abnormalities are tested using the Papanicola stain, known as the Papanicolae smear, a name derived from the name of its discoverer George Papanicolau. The technique involves placing the material collected from the scraping of the cervix on a glass slide and coloring the cells obtained from the anogenital tract with hematoxylin, a nuclear dye. The Pap smear, however, has a lack of repeatability and is not predictable enough to prevent imminent HPV-induced neoplasms. It has been shown that 25% of patients with advanced in situ carcinoma may have a normal Pap smear a few years before diagnosis or the last negative cytology and that on a reevaluation has been uniformly positive in cases of cervical cancer. An increasingly prevalent problem is the occurrence of invasive cancer in the 3 years following a negative Pap smear. The current acceptable range of false negatives (ie women who have dysplasia according to a particular panel of pathologists who analyze tissue biopsies in 9-fold samples of vaginal secretions but who are not diagnosed with such disease during a routine examination ) is approximately 5-10%, but recent studies suggest that the current variation may be much higher. In addition, in approximately 7-8% of cases, the Pap smear reveals atypical squamous cells of undetermined importance (ASCUS). In another 20-30% of cases, the Pap smear may be insufficient in terms of interpretation due to the presence of inflammatory cells. In the case of the cervix, flat warts (visualized by colposcopy) are suspected of pre-malignant lesions. The histopathological progression of flat warts to carcinoma in situ and cervical cancer has been well described.

Intraepithelial lesions are common early events among women with HPV-incident infection and the interval between the HPV-16 or HPV-18 infection and the biopsy-confirmed grade of CIN-2 appears to be relatively short. However, studies have shown that infection with high-risk types of HPV is usually transient. Persistence of HPV infection substantially increases the risk of progression to high-grade intraepithelial lesions and invasive disease. The progression of the disease is variable and is associated with loss or persistence of HPV. Significant numbers of dysplastic lesions regress spontaneously, others fail to progress while few develop rapidly.

As a consequence of the preferential role of high risk genotypes in cervical cancer and because of the different, consequential and characteristic types of models for other pathological conditions, both HPV identification and typing 10 are considered to be of paramount importance. In addition, different types of high-risk HPV present different risks for affected individuals. For example, HPV 16 and HPV 18 have been more consistently identified at higher levels of cervical dysplasia and carcinoma compared to other types of HPV. HPV 16 is also more prevalent in cases of squamous cell carcinoma and HPV 18 is more prevalent in cases of adenocarcinomas.

HPV Diagnostics

Since 1980, some viral genomes have been cloned and used as specific probes in the diagnosis of HPV. Hybridization techniques have been used by filtration to detect HPV DNA in cervical scrapes collected in parallel with routine cytology samples. HPV DNA probes have been used in different assays based on different hybridizations such as the Southern and Dot / Southern Hybrid assays to detect HPV DNA in clinically derived tissue samples. In addition, purified biopsy DNA and in situ hybridizations in preserved tissue samples, i.e. direct location in the intact cell of the complementary sequences of the nucleic acid probes, have also been demonstrated.

A method has been described for detecting types of HPV DNA using a reverse blotting procedure. The procedure involved the formation of a membrane to which genomic DNA was ligated from four different types of HPV and subsequently the hybridization of labeled DNA from a biological sample for binding of the DNA to the membrane.

Numerous methods have been developed to detect types of human papillomavirus using type-specific reactions, detecting one type of HPV at a time. The Polymerase Chain Reaction (PCR) was used to amplify and detect the presence of HPV 16 and HPV 18 DNA, in particular, to detect HPV 16 in oral and cervical biopsies. A primer mix was described for PCR-specific amplification of HPV sequences at types 1, 5, 6a, 8, 11, 16, 18, and 33. Patents Nos. US 4 683 195 and US 4 683 202, present the PCR and the use of PCR to detect the presence or absence of nucleic acid sequence in a sample. U.S. Pat. US 5,447,839 discloses a method for detecting and typing HPV. In this method, the HPV DNA sequences in a sample are amplified by PCR using consensus primers, which amplify the oncogenic HPV type with the non-oncogenic HPV type. Thus, the presence of HPV in the sample is indicated by the formation of amplification products. HPV is further typed using specific type DNA probes, which hybridize to the amplified DNA region. The type-specific hybridization probes disclosed in the present patent are capable of identifying and distinguishing between five known oncogenic HPV types, namely HPV 6, HPV 11, HPV 16, HPV 18 and HPV 33.

A number of methods have been devised to detect high-risk types of HPV. Many of these methods depend on the detection of single sequences in the HPV genome. For example, in the art, DNA probes or 12 RNAs, complementary to a fraction of the genes of a particular high-risk HPV strain, have been reported and are useful in screening for the presence of a particular high-risk HPV strain in samples of U.S. Patent No. 5,705,627 discloses the use of PCR to amplify and detect HPV DNA using degenerate or mixed consensus primers, followed by typing using a mixture of DNA probes Further examples of use of consensus primers can be found in U.S. Patent No. 5,364,758, and Kleter, B. et al., Am. J. Pathology, Vol. 153, No. 6, 1731- 39 (1998)

There is a commercial method available, which is based on hybridization and signal amplification. (Hybrid Capture II, Digene Corp.) However, this method has specificity problems due to the high sequence homology of some part of the HPV genomes.

Amplification-based methods consist of a part responsible for the sensitivity (amplification), which is separated from those parts responsible for the specificity (detection by hybridization). These techniques differ in the amplified genome section, the number of primers and the detection techniques. The most frequently used methods of amplification are GP5 + - GP6 + (general initiator - GP), MY9-MY11, PGMY, SPF, L1C and specific type PCR reactions. The most frequently used detection techniques are sequence specific hybridization, restriction fragment length polymorphism (RFPL) and probe line test (LiPA). Sometimes, though rarely, the sequencing method or other methods are applied. The analytical characteristics of the amplifications 13 vary in a wide variety and are characterized by the number of genotypes which can be amplified by the analytical sensitivity, amplification / detection specificity of the genotypes and also by the differences in sensitivity between the genotypes. HPV by real-time PCR method Human papillomavirus 16 (HPV-16) viral load could be a predictable biomarker of the presence of high-grade cervical lesions. Some real-time PCR assays have been developed to accurately assess the viral load of HPV-16 (HPV-16L, HPV-16 E6, and HPV-16 E6 PG). The methods teach us to develop HPV detection in real time, but only to detect one genotype at a time. Identification of HPV DNA in patients with recurrent juvenile respiratory papillomatosis was performed using SYBR ® Green PCR in real time. The method is used to detect multiple human papillomavirus genotypes in a real-time PCR reaction. However, the amplification method is different from that described in the present invention. The amplicon produced is higher (approximately 450 bp) than is accepted for a probe based on an amplification method in the art. The preferred length is 150 bp or less. The detection method is specific and incapable of reliably differentiating genotypes, which require subsequent viral typing using real-time PCR with primers of the type specific for HPV types 6, 11, 16, 18, 31, and 33. This method also detects the types of human papillomavirus in isolates, but only one genotype at a time. 14

Likewise, others have used a method in which a single tube reaction was used to detect genotypes of human papillomavirus in general. However, group-specific detection has not been described.

Another method was used to detect human papillomavirus DNA in sexual partners using a two-step approach to evaluate both genotypes and viral load data. The method uses the GP5 + / 6 + polymerase chain reaction (PCR), followed by the reverse-blot analysis. This method was used for the detection of 45 types of HPV in cervical and penile scraping samples. Viral loads were subsequently determined on HPV types 16, 18, 31 and 33 positive scraping samples by means of LightCycler tests based on real-time PCR. GP5 + / GP6 + PCR generates an amplicon of 150 bp in length, allowing the application of probe-based methods in real time. However, the method may not detect multiple genotypes or groups in one reaction.

A method for homogeneous detection and real-time quantification of nucleic acid amplification using restriction enzyme digestion was envisioned. In this homogeneous system, the detection is mediated by a substrate containing a reporter and a quencher fraction at its 5 'terminus separated by a small section of DNA encoding a restriction enzyme recognition sequence. In single-stranded form, the signal from the fluorescence reporter is extinguished due to the transfer of fluorescence resonance energy transfer (FRET). However, as the primer is incorporated into the double-stranded amplicon, a restriction enzyme present in the reaction cleaves the DNA that binds the reporter and extinguisher, allowing unrestricted fluorescence of the reporter. This system was tested using a specific primer for the human papillomavirus (HPV) E6 gene 16 combined with the cleavable energy transfer marker and used to amplify the HPV 16 positive DNA. The method can not be used for the detection of multiple genotypes or groups.

A real-time PCR-based system for simultaneous quantification of human papillomavirus types associated with high-risk cervical cancer has also been described. A real-time PCR test was developed for the detection and quantification of HPV 16, -18, -31, -33, -35, -39, -45, -52, -58 and -67. The test is based on three parallel real-time PCRs from each patient sample: (i) Reaction 1 detects and quantifies HPV 16, -31, -18, and -45 (HPV18 and -45 were detected and quantified together using a probe) with three different fluorophores; (ii) reaction 2 detects and quantifies HPV33, -35, -39, -52, -58, and -67 (HPV33, -52, -58, and -67 was detected and quantified together), again in three fluorophores and only three different probes were used; and (iii) reaction 3 detects and quantitates the amount of a single copy human gene (HMBS, Homo sapiens hydroxymethylbilan synthase; GenBank accession no. M95623.1). Reaction 1 includes a total of seven PCR primers and three probes, Reaction 2 includes a total of seven PCR primers and three probes and Reaction 3 includes two PCR primers and a single probe. The method applies hydrolyzable TaqMan probes to real-time PCR. The use of only three probes in one reaction was described, detecting a maximum of six genotypes in the same reaction. The method can not be used as a general teaching to devise reactions that detect multiple HPV genotypes, since sequence identities between genotypes are limited. The extent of the reaction is restricted by the use of sequence identities between genotypes.

A method for the detection and quantification of oncogenic human papillomavirus (HPV) was previously developed using the fluorescent 5 'exonuclease test. The method is based on the amplification of a 180 bp fragment from part 3 'of the open reading frame EI in a single PCR with probes of the type specific for HPV types 16, 18, 31, 33 and 35. The probes may be used separately or in combinations of up to three probes per assay. The method was limited to three probes per assay.

A strategy for detection and genotyping of papillomavirus with SybrGreen and molecular beacon polymerase chain reaction has also been described. The test performs general HPV detection by means of SybrGreen reporting HPV DNA amplicons and by genotyping the seven prevalent types of HPV (HPV-6, -11, -16, -18, -31, -33, -45) by means of real-time molecular beacon PCR. The two-phase method uses three different beacon molecular probes labeled in a PCR reaction.

Another method was also described: A degenerate HPV self-probing fluorescence primer, known as Scorpion and a mixture of Scorpions, was used in conjunction with a general-tail initiator.

By using a tail primer, it was possible to introduce a consensus site that allows a single

Scorpion recognizes very different HPV amplicons. This is a two-stage procedure that can theoretically

detect more than 40 different types of HPV. In this study, 10 Scorpion typing primers (HPV 6, 11, 16, 18, 31, 33, 39, 45, 51, 56) were used. The primer sequence of each Scorpion-specific primer is located in the same sequence position as that of the Jacobs primer GP6 + and such. The method explains a general detection method for detecting the presence of HPV and a specific type detection method used to type positive samples. But this does not solve the probing problem with multiple probes, which leads to the use of cross-reactive probe. In fact, the method avoids using multiple probes in one reaction.

Real-time PCR based HPV detection methods using real-time LightCycler ™ and TaqMan ™ assays have been compared to GP5 + / 6 + PCR / enzyme (EIA) immunoassays to evaluate the human papillomavirus load in samples of cervical scraping. Both real-time PCR tests also determined the HPV 16 load in scraping samples, but there was little agreement between these tests and GP5 + / 6 + PCR / EIA, suggesting that the latter method is not is suitable for quantifying HPV DNA. The DNA loads of HPV6 / 11 and HPV16 / 18 were also determined by real-time quantitative fluorgenic PCR detecting both types of HPV gene at a time. Consensus primer design methods

Primers and probes that are used to detect only one nucleic acid molecule of the human papillomavirus, for example, a nucleic acid molecule encoding a portion of the IL, may be designed using, for example, a computer program such as OLIGO ( Molecular Biology Insights Inc., Cascade, Colo.) Or Primer3. Appropriate characteristics of these oligonucleotides are well known to those skilled in the art. There is a vast literature on the general principles of PCR primer design, which has given rise to a number of software applications, notably Primer3 and other extensions. A rapid dynamic programming formulation was also developed to test primers for peer compatibility. The application of multiplex PCR has been increasing in the last decade, requiring more sophisticated initiator selection protocols. Different algorithms may favor objectives or may be designed for certain technology platforms. In general, the problem of identifying pairs of primers to maximize the multiplex level of a single test has been proved to be complete in terms of NP. An approach algorithm has been presented that eliminates a complementarity of the 3 'base while dealing with product size limitations. The method of the present invention relates to the problem of designing multiplex PCR assays, especially the design of consensus primers. The general approach to this issue is to design consensus primers to amplify numerous targets with fewer primer pairs than the number of targets. Moreover, the design would further consider the design rules for multiplex PCR assays, exemplified by a consensus herpesvirus. 19

A particular approach has been developed to identify distantly related gene sequences based on consensus degenerate hybrid oligonucleotide primers (CODEHOPs). Small regions of proteins, with high levels of conservation, can be represented as aligned multiplication protein sequence blocks. CODEHOPs derive from these conserved sequence blocks and are used in PCR to amplify the region between them. A CODEHOP PCR primer consists of a group of primers, each containing a different sequence in the 3 'degenerate major region, wherein each primer provides one of the possible codon combinations encoding a target of 3-4 target conserved amino acids from within the block of sequence. In addition, each primer in the group has a consensus clamp region 5 'derived from the most probable nucleotide at each position encoding the amino acids flanking the target motif. Amplification is initiated by annealing and primer extension in the group with the highest similarity in the degenerate 3 'nucleus relative to the target model. The pairing is stabilized by the consensus clamp 5 ', which partially corresponds to the target model. Once the primer is incorporated, it becomes the template for subsequent amplification cycles. Since all primers are identical in the consensus clamp region 5 ', they will all match with high stringency during subsequent cycles of amplification. This method has also been used in the field of virology. The approach is different from the approach of the method of the present invention where the specific sequence blocks are used to obtain effective amplification of the respective sequences. The CODEHOP program considers the primers for amplification purposes unknown targets and works with protein sequence alignments instead of DNA sequences.

There are a number of methods that deal with consensus / degenerate primer planning, but typically use different algorithms to basically solve the same problem: to identify the group of primers that best fits in terms of effective amplification of the target sequences in question. Collaboration between initiators is not taken into account:

Another approach is the PriFi program (http://cgi-www.daimi.au.dk/csi-chili/PriFi/main) This program designs pairs of primers useful for PCR amplification of genomic DNA in species, in which the sequence information is not available. The program works by aligning DNA sequences from phylogenetically related species and issues a list of degenerate primer pairs that meet a number of criteria, so that the primers have a high probability of amplifying orthologous sequences in other phylogenetically related species. However, the program does not use the concept of collaboration between initiators. The Amplicon program for designing PCR primers in aligned groups of DNA sequences is a similar method. The most important application for Amplicon is the design of " group-specific " PCR primer sets " which amplify a region of DNA from a taxonomic group, but do not amplify orthologous regions of other 21 taxonomic groups. Again, collaboration between initiators is not taken into account. The design of the amplification reaction primers for label detection of numerous related amplification targets has no direct rules in the literature. However, it is generally accepted that unpredictable interactions between primers and competition for amplification resources decrease the sensitivity of the reaction and more primers mean a greater probability of initiation errors, producing specific products that still compete for the resources. The potential role of the HPV test in cervical carcinoma screening is highly dependent on the existing infrastructure. In clinical settings where a well-organized and effective cytology program is applied, the question is to what extent the HPV test adds to the existing program, and issues cost-effectiveness, quality control, and added value to current visible practice. By contrast, for situations where screening is non-existent or ineffective due to poor cytology quality or inherent limitations due to a high rate of inflammatory smears, the most basic issues of sensitivity, specificity, and simplicity of testing procedures become paramount. Real-time PCR technology offers features that meet and exceed the requirements in both scenarios described above. A recent study determined the amount of HPV DNA for some of the more frequent types of high-risk HPV as determinants of cervical neoplasm progression (CIS). The number of copies per cell variable does not differ between 22 HPV types, but the CIS probability rate in the highest viral load percentile is substantially higher for HPV 16 (OR = 36.9, 95% CI = 8, 9-153.2) than for HPV 31 (OU = 3.2, 95% CI = 1.1-9.1) or HPV 18/45 (OR = 2.6, 95% CI = 1.0 -6.4). Therefore, viral load of HPV can be predicted in terms of the future risk of cervical CIS at a time when the smear is negative for squamous abnormalities. Real-time technologies provide conditions to determine viral load more accurately compared to existing HPV detection methods. Real-time technology offers numerous advantages over existing methods. However, no amplification and detection methods have been developed that can detect more than three types of human papillomaviruses in one reaction. Also, no method has been developed to clinically detect important groups of viruses, for example low-risk or high-risk human papillomaviruses in groups in a reaction.

A precise HPV self-sampling test could have major implications. A test of these opens the possibility of evaluating women, who, in one way or another, do not want or are unable to undergo a pelvic examination. In underdeveloped areas, this test could offer an advantage over current practice. In areas where organized screening is performed, self-sampling provides an additional approach to reach women who refuse conventional screening, and may also play a role in surveillance or monitoring after treatment of women with HPV positive and negative cytologies, which need to undergo follow-up tests at short intervals. The self-sampling approach with quasi-patient testing capabilities could improve the quality and accessibility of screening programs.

An HPV test, targeting both a conventional and a primary screening market, should meet all these needs. Real-time PCR technology is especially suited to technologically addressing these requirements. The inherent simplicity of technology helps to reduce infrastructure barriers and is also more accessible relative to other technologies. On the other hand, real-time PCR technologies could enhance the analytical sensitivity and, better still, the specificity of HPV detection, providing a more solid basis for improving the clinical counterparts of these parameters. Internal control adds quality control capabilities to the system.

In the near-sick application of HPV detection, real-time technologies are the most viable options. The near-sickness test would be the next frontier in primary screening, and real-time technologies are already gaining significant attention in this area in the case of other pathogens and may be an added value in practice. The increased sensitivity of real-time PCR compared to other methods, as well as improvements in the characteristics provided by real-time PCR, including sampling containment and real-time detection of the amplified product, indicate the feasibility of implementing this technology for routine diagnosis 24 of human papillomavirus infections in the clinical laboratory.

Tsourkas et al. (Briefings in functional genomics and proteomics, Vol. I, No. 4, 372-384 2003) describe the use of beacon molecular probes in the detection and identification of pathogens. Molecular beacon probes described typically include quads of six to six base pairs.

In the first aspect, the present invention provides a method for detecting the presence of at least one pathogen comprising contacting a nucleic acid obtained from a sample with an array that includes at least four probes, wherein each one of said probes includes a sequence complementary sequence of a pathogen flanked by four or five complementary base pairs, said bases forming an arm or rod structure in the absence of hybridization to a nucleic acid of a pathogen in that said probe is labeled with a first interactive marker and a second interactive marker, such that hybridization of said probe to a nucleic acid of a pathogen causes a change in the detected signal.

As used herein, " nucleic acid " designates DNA and RNA in their various forms such as mRNA and hnRNA. The nucleic acid may be single-stranded or double-stranded.

As used herein, " a pathogen " means a biological agent which disrupts the normal physiology of an animal and causes or is associated with a disease. The pathogen may be a causative agent, i.e. infection of a patient with the pathogen produces the disease alone or in the presence of one or more cofactors.

Preferably, the pathogen is an organism associated with a sexually transmitted disease. As used herein, the term " organism associated with a sexually transmitted disease " refers to an organism that is present in patients suffering from sexually transmitted disease. Examples of organisms associated with sexually transmitted disease include Chlamydia trachomatis, which is associated with chlamydia, Neisseria gonorrhea, which is associated with gonorrhea, herpes simplex virus (HSV) that is associated with genital herpes, human papillomavirus that is associated with genital warts and Pale treponema that is associated with syphilis. The organism is preferably a virus, more preferably a human papillomavirus (HPV). The method is preferably used to detect the presence of one or more HPV genotypes.

Although the method of the present invention relates to the detection of a pathogen, this method can be used to detect the presence or absence of any organism, especially organisms that contain more than one sub-species or related organisms. As used herein, " related organisms " refers to organisms belonging to the same class, genus or species and having a high level of similarity, preferably at least 80% identity, more preferably 90%. The related organisms are preferably viruses, more preferably human papillomaviruses. 26

Each of the probes preferably has the general structure 3 '-F-complement arm of HPV-F'-arm-5' F and F 'are optional ligand sequences that bind the complementary sequences to the flanking base pairs, arm and arm ', " arm & arm " are the sequences formed by the complementary base pairs forming a double helix rod structure in the solution. These sequences are preferably palindromic. There are preferably 4 bases at each end of the probe. The bases constituting the arm or rod preferably include C-G pairs and still preferably 1, 2, 3, 4 or 5 C-G pairs. The arm preferably has the CGCG sequence.

It has been determined from our experiments that beacon molecular probes with four base pair arms do not interact with each other causing a false amplification signal unpredictable over time in the absence of detectable target DNA, which appears to depend on the variation on-off arm structure. Occasionally, five base pair beacon molecular beacon probes must be used for the purpose of optimizing the reaction. Beacon molecular probes with longer arms in singleplex and multiplex detection exerted false and uncontrollable amplification signals. Smaller beacon molecular probes usually have melting temperatures too low to be useful for the real-time amplification reaction. The term " interactive marker " as used herein refers to a label of one pair of labels, which cooperates with the other of the label pair. This collaboration occurs when the markers are in close proximity, such as when the probes have a semi-circular structure with loop and stem. When the hybrid probe for a complementary nucleic acid, the collaboration between the markers is decreased or completely removed as the distance between them increases. Labels are attached to the probes at each end of the probe, preferably at the probe end or adjacent to the complementary bases forming the semicircular structure. The location at which the markers bind is irrelevant, whereas a change in signal may be detected when the probe changes from one conformation to another, i.e. semicircular to open. The change in the signal may be an increase in the signal when the probe is in the open position, i.e. when hybridized to a nucleic acid sequence, for example, when an interactive marker absorbs the signal from the second interactive marker. Alternatively, the change in signal may be a reduction in the signal when the probe is in the open position, when hybridized to a complementary nucleic acid sequence, for example, when the first interactive marker causes a signal to be emitted from of the second interactive marker.

In a preferred embodiment, the interactive labels are a FRET donor and a corresponding FRET acceptor.

FRET technology (see, for example, U.S. Patent Nos. 4,996, 143,5,565, 322, 5, 849, 489 and 6, 162, 603) is based on the fact that when a donor and a donor the corresponding acceptor fluorescent moiety are positioned within a certain distance from each other, there is a transfer of energy between the two fluorescent moieties which can be viewed or otherwise detected and / or quantified. As used herein, the FRET technology format utilizes technology from the molecular beacons probes to detect the presence or absence of a human papillomavirus. The technology of the molecular beacons probes uses a hybridization probe labeled with a fluorescent donor moiety and a fluorescent acceptor moiety. Fluorescent labels are usually labeled at each end of the probe. The technology of the molecular beacons probes uses an oligonucleotide probe with sequences that allow the formation of a secondary (eg, on a hook) structure. As a result of secondary structure formation within the probe, both fluorescent moieties are in spatial proximity when the probe is in the solution. After hybridization to the target nucleic acids (i.e. the nucleic acid for the HPV genotype), the secondary structure of the probe is disrupted and the fluorescent fractions are separated from each other such that upon excitation with light of a wavelength the first fluorescence fraction is different from that detected in the absence of a nucleic acid of an HPV genotype.

As used herein, with respect to the donor and corresponding fluorescent acceptor moieties, " corresponding " refers to a fluorescent acceptor fraction with an emission spectrum that overlaps the excitation spectrum of a fluorescent donor moiety. The maximum wavelength of the emission of the spectrum of the fluorescence acceptor fraction should preferably be at least 100 nm greater than the maximum wavelength of the excitation spectrum of the fluorescent donor moiety. Moreover, the transfer of effective non-radioactive energy can be produced between them.

Fluorescent donor and acceptor moieties are usually chosen by (a) high efficiency energy transfer from Forster; (b) a large Stokes final deviation (> 100 nm); (c) emission deviation as much as possible in the red zone of the visible spectrum (> 600 nm); and (d) emission drift to a wavelength greater than the emission of Raman fluorescence water produced by excitation at the wavelength of the excitation donor. For example, a fluorescent donor moiety may be chosen considering that it has its maximum excitation near a laser line (e.g., Helium-Cadmium 442 nm or Argon 448 nm), a high quench coefficient, high quantum yield and good overlapping of its fluorescence emission with the excitation spectrum of the corresponding fluorescence acceptor fraction. A corresponding fluorescence acceptor moiety can be chosen considering that it has a high quenching coefficient, a high quantum level, a good overlap of its excitation with the emission of the fluorescent donor moiety, and emission in the red part of the visible spectrum (> 600 nm)

Representative fluorescent donor moieties that can be used with various fluorescent acceptor moieties in the FRET technology include fluorescein,

Yellow Lucifer, B-phycoerythrin, 9-acridine isothiocyanate, Lucifer Yellow VS, 4-acetamido-4'-isothiocyanatoestilbene-2,2'-disulfonic acid, 7-diethylamino-3- (4'-isothiocyanatophenyl) -4-methylcoumarin , succinimidyl 1-pyrene butyrate, derivatives of 4-acetamido-4'-isothiocyanatoethylstilbene-2,2'-disulfonic acid, optionally substituted pyrenes, anthracenes, naphthalenes, acridines, stilbenes, indoles, benzindols, oxazoles, benzoxazoles, thiazoles, benzothiazoles, 4-amino-7-nitrobenz-2-oxa-1,3-diazoles, cyanines, carbocyanines, carbostyriles, porphyrins, salicylates, anthranilates, azulenes, perylenes, pyridines, quinolines, coumarins, polyazaindacenes, xanthenes, oxazines, benzoxazines, phenalenones, benzphenalenones, carbazines, oxazines, 4-bora-3a, 4a-diaza-s-indacenes, fluoroforesceins, rhodamines, rhodols, 5-carboxyfluoroforesceins (FAM), 5- (2'-aminoethyl) aminonaphthalene-1-sulfonic acids ( EDNS), anthranilamides, terbium chelates, red 4 Reagent, red Texas, ATTO dyes, EVO dyes, DYO dyes, Alexa dyes and BODIPY dyes.

Representative fluorescent acceptor moieties that depend on the fluorescent donor moiety used, include LC. TM. -RED 640 (Light Cycler TM-Red 640-N-hydroxysuccinimide ester), LC. TM. -RED 705 (Ligh, tCycler ™ TM-Red 705 Phosphoramidite), cyanine dyes such as CY5 and CY5, Lysamine rhodamine B sulfonyl chloride, tetramethyl rhodamine isothiocyanate, rhodamine xisothiocyanate, erythrosine isothiocyanate, fluorescein, diethylene triamine pentacetate or other lanthanide ion chelates (e.g. Europium, or Terbium). Fluorescent donor or acceptor moieties 31 may be obtained, for example, from Molecular Probes (Junction City, Oregon) or Sigma Chemical Co. (St. Louis, Mo.).

Preferably, the fluorescent receptor moiety is a quencher. As presently used, a quencher is a fraction, which decreases the fluorescence emitted by a fluorescent label. This includes total and partial inhibition of fluorescence emission. The degree of inhibition is not important since the change in fluorescence can be detected as soon as the quencher is removed. The absorbent fraction is preferably selected from the group consisting of phenyl, naphthyl, anthracenyl, benzothiazoles, benzoxazoles, orbenzimidazoles, pyrenes, anthracenes, naphthalenes, acridines, stilbenes, indoles, benzindols, oxazoles, benzoxazoles, thiazoles, benzothiazoles, 4-amino-7 2-oxo-1,3-diazoles, cyanines, carbocyanines, carbonyl esters, porphyrins, salicylates, anthranilates, azulenes, perylenes, pyridines, quinolines, coumarins, polyazaindacenes, xanthenes, oxazines, benzoxazines, carbazines, phenalenones, benzphenalenones, carbazines , oxapers, 4-bora-3a, 4a-diaza-s-indacenes, fluoroforesceins, rhodamines, rodols, 5-carboxyfluorophoresesins (FAM), 5- (2'-aminoethyl) aminonaphthalene-1-sulfonic acids (EDANS), anthranilamides, terbium chelates, red reagents, dabicyles, nitrotyrosines, malachite green, Texas reds, dinitrobenzenes, ATTO dyes, EVO dyes, DYO dyes, Alexa dyes, and optionally substituted BODIPY dyes. Selection of suitable pairs of donors and acceptors or FRET quenchers is within the knowledge of the person skilled in the art.

Typically, when the FRET is detected in a quantity statistically different from the amount of FRET in a sample in which the human papillomavirus nucleic acid molecule is missing, the presence of a papillomavirus infection in the subject is indicated. Hybridization of the probe into the nucleic acid increases the distance between the donor and recipient moiety, and, thus, the FRET interaction is reduced. The change in wave length emission may be an increase in emission or emission at a different wavelength such as when using a quencher. Alternatively, a reduction in emission or emission at a different wavelength may occur when using a nonabsorbent donor acceptor. Fluorescent analysis may be conducted using, for example, a photon counting epifluorescent microscope system (containing the dichroic mirror and filters suitable for fluorescence emission monitoring in the particular range), a photon counting system photon counting or a fluorometer . The excitation to initiate energy transfer may be conducted with an argon ion laser, a high intensity mercury arc (Hg) lamp, a fiber optic light source or other type of high intensity light source duly filtered for excitation in the desired range.

The fluorescent donor and acceptor moieties are preferably attached to the probe in the linker sequences. The fluorescent donor and recipient moieties 33 may be attached to the appropriate oligonucleotide probe through a linker arm. The length of each attachment arm is equally important, since the attachment arms will affect the distance between the fluorescent donor moiety and the fluorescent acceptor moiety. For the purposes of the present invention, the length of a binding arm is the Angstroms (ANG) distance from the nucleotide base to the fluorescent moiety. Generally, a linker arm is from about 10 to about 25 ANG. The connecting arm may be of the type described in WO 84/03285. WO 84/03285 also discloses methods for attaching binding arms to particular nucleotide bases as well as for binding fluorescent moieties to a linker arm. The probe must have a sufficient level of identity to the nucleic acid of the pathogen or organism associated with a sexually transmitted disease so that it can hybridize to nucleic acid of one or more pathogens or organisms associated with a sexually transmitted disease under certain conditions. One single-stranded nucleic acid is said to hybridize to another if double forms occur between them. This situation occurs when a nucleic acid contains a sequence that is the reverse or complement of the other (this situation gives rise to the natural interaction between the sense and anti-sense strands of DNA in the genome and stresses the configuration of the double helix). Complete complementarity between hybridization regions is not required so that a duplex is formed; it is only necessary that the even base number is sufficient to maintain the duplex under the hybridization conditions used. It is often desirable to have one or more mismatches between the probe sequence and the genome of the pathogen. This is necessary to avoid the formation of undesired secondary structures within the probe. Thus, in a preferred embodiment, the unique sequence for the pathogen within the probe contains at least one mismatch with the genomic sequence of the pathogen. Suitable hybridization conditions are well known to those skilled in the art. For example, 0.2 x SSC / 0.1% SDS at 42 ° C. (for moderate stringency conditions) and 0.1 x SSC at 68 ° C (for high stringency conditions). Washing may be performed using only one of the conditions indicated, or each condition may be used (for example, washing for 10-15 minutes each in the order indicated above).

Any or all washes may be repeated. The ideal conditions will vary and can be determined empirically by the person skilled in the art. The degree of identity between the probe and the nucleic acid of the pathogen will vary depending on the function of the probe. For example, the probe may be used to identify the presence of all subspecies of the pathogen, for example, all types of HPV genotypes, wherein in each case the probe will have a sequence that will hybridize to a sequence of a region of a nucleic acid which is highly conserved among all subspecies, such as HPV genotypes.

A probe may be used to detect the presence of pathogens, for example HPV genotypes, of a particular risk group, for example, high-risk or low-risk genotypes or others. The sequence of probe 35 will be properly delineated. For example, a probe may be designed to detect high-risk genotypes, which may bind to types 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, and 73, but not nucleic acids of other genotypes. These are called " risk group probes ".

Alternatively, each probe may have a sequence with a high level of similarity to a variable region of a specific genotype such that it hybridizes only to one nucleic acid of that genotype. These probes are named " genotype specific ". Specific human papillomavirus-like probe members can hybridize within specific regions of the genotype, preferably those including SEQ ID Nos: 53 to 103 in the amplified DNA. HPV genotype specific probes preferably include a sequence selected from SEQ ID Nos: 33 to 52 or SEQ ID. We. 105 to 117. These sequences form all or part of the unique sequence of the pathogen. The group of probes includes at least four probes, preferably 5, 10, 15 or 20 different probes. The probes are carefully designed so that the sequence contained in " loop " of the semi-circular structure, not only hybrid with the desired sequence in the nucleic acid to be detected, but also does not form secondary structures with sequences in the loops of other probes. Thus, the sequences for the semicircular part of the probes are usually not only a sequence that is 100% complementary to the sequence in the genome to be detected. Preferably, specific probes of the human papillomavirus type may hybridize within defined genotype-specific regions, preferably those that include SEQ ID NOs: 53 to 103 or SEQ ID NO: We. 105 to 117. In a preferred embodiment, each probe includes a sequence selected from SEQ ID. Nos. 33 to 52 or SEQ ID. We. 105 to 117. In a particularly preferred embodiment, the group of probes includes: 5'TET-CGGCGGGTCATCCTTA IIIII CCATAAGCCG-Dabcyl-3 '5TET-CGGCGGACACCCATATTACTCTATCAAAGCCG-Dabcyl-3' 5'TET-CGCGGGTCACCCTTATTACTCTATTACAAAACGCG-Dabcyl-3 ' TET-CCGGCACCCATATTTCCCCCTTAAACCGG-Dabcyl-3 '5'TET-CCGGACGACCAGCAAACAAGACACCCGG-Dabcyl-3' 5'FAM-CGGCCAATAACAAAATATTAGTTCCTAAAGCCG-Dabcyl-3 '5'FAM-CCGGTATCCTGCTTATTGCCACCCCGG-Dabcyl-3' 5'FAM-CGGCCATACCTAAATCTGACAATCCGCCG-Dabcyl-3 '5' FAM-Dabcyl-CGCG TTTTTTAGCGTTAGTAGGATTTTTCGGC-3 '5'FAM-CGGCAAAACAAGATTCTAATAAAATAGCAGCCG-Dabcyl-3' 5'FAM-CGGCTTAAAGTGGGTATGAATGGTTGGCCG-Dabcyl-3 '5'FAM-CCGGGCTGTTCCTAAGGTATCCGCCGG-Dabcyl-3' 5'FAM-CGGCAGCACGCGTTGAGGTTTTAGCCG-Dabcyl-3 '5 'CCGGAGTTTTAGTTCCCAAGGTGTCCCGG-FAM-Dabcyl-3' 5'FAM-CCCGCTGTGACTAAGGACAATACCAAACGGG-Dabcyl-3 '5'FAM-CGGCTTCCATCAAAAGTCCCAATAACGCCG-Dabcyl-3' 5'FAM-CGGCAAAGGTGGTAATGGTAGACAGGGCCG-Dabcyl-3 '5'FAM-CGGCAATCTGGTACCAAAACAAACATCGCCG-Dabcyl-3' 5 'FAM-CGGCTTAAGGTTCCTATGTCTGGGGGCCG-Dabcyl-3' a The presence of pathogens of a particular risk group can be detected in two ways: First, " risk group " probes " " " can be used. Preferably, the group of probes contains more than one type of probe of risk group, wherein each type is differently labeled. For example, a high-risk probe can be distinguished from a low-risk probe. Therefore, the presence of a pathogen, such as HPV, can be detected in any of these risk groups. Alternatively, the group of probes may include genotype-specific probes in which all probes for genotypes of a particular risk group, for example, high-risk genotypes are all labeled by the same interactive marker. Thus, the identity of the specific genotypes present may not be determined, but the presence of a genotype of a particular group may be confirmed.

In a preferred embodiment, the method further comprises determining the melt temperature of the double-stranded nucleic acid molecule formed by one of said probes and complementary nucleic acid obtained from said sample. Since each probe has a particular nucleic acid sequence, the melting temperature of the double stranded nucleic acid molecule formed by the probes and the complementary nucleic acid obtained from said probe is unique for each probe. Thus, the specific pathogen or genotype present can be detected. For example, a group of probes specific to a particular risk group may be used to ensure that any of the genotypes of that group are present. The melting temperature can then be determined to identify the specific genotypes present. The method for individually detecting HPV types can be performed after the method has been performed to detect the human family, genus, groups or competitors of human papillomavirus with the method for detecting human papillomavirus.

If more than one probe is used, they may preferably be distinguished from each other, i.e. each probe emits a detectably different signal when excited at a given wavelength. Thus, two probes are used. One will emit at a wavelength when it is hybridized to a nucleic acid of the pathogen that can be distinguished from both probes in the solution (i.e., unhybridized in the nucleic acid of the pathogen such as the HPV genotype) and the other probe when hybridized to the nucleic acid of the pathogen. This allows the presence of both probes hybridized to the nucleic acid to be visualized at the same time. Alternatively, the two probes are labeled with different interactive labels, for example, FRET donors, which are excited at different wavelengths. This can be achieved by using different combinations of interactive labels, such as FRET donors and acceptors. Selection of suitable combinations of interactive labels is routine for those skilled in the art. The method preferably detects the presence of four or more pathogens or genotypes using four or more probes. Preferably, the probes are attached to a solid phase so that each type of probe is a spatially defined location which is distinguishable from the locations of the other probes. Such a situation allows probes marked with the same or similar interactive marker which produces a signal at the same or similar wavelength to be used, while still providing means for distinguishing the signal produced by each probe. Alternatively, the probes may be labeled so that different signals are produced by each type of probe. One skilled in the art will appreciate that a variety of possible solid supports will be commonly used in the production of probe networks of the present invention.

In a preferred embodiment, there is provided a method for constructing a reaction to achieve detection of a number of related detection targets using at least four beacon molecular probes in a real-time reaction. The method includes selecting probe binding sites, determining the sequence of probes, which satisfy the criteria normally applied to the probes (for example, checking probes in a computer program for total complementarity, such as Primer3) and adding bases , preferably four or five bases, to the probe sequence at both ends, making them complementary and capable of forming double-stranded trunks enclosing exactly the two ends of the same oligonucleotides. These structures are usually called four-armed molecular beacons. In addition, the melting point of the probe sequence should be greater than the melting point of the arm structure, as measured by balanced heating and cooling variations. Molecular beacons with fourth base trunks are usually advantageous over other trunk lengths that have smaller on-off variations than longer trunks and which have a higher melting temperature than smaller molecular trunks beacons. 40

Typically, the members of the probe mixtures hybridize to amplify the product within a given specific region of the type. Probes are usually labeled with a fluorescent donor moiety at one end and at the other end are normally labeled with a corresponding receptor or quencher moiety. In some embodiments, the fluorescent donor moiety may contain a specific fluorescent dye complex, including so-called harvester dyes, to change the probe emission wavelength to provide a single fluorescent signal for detection. The method further comprises detecting the presence, absence, or change in fluorescence energy transfer (FRET) between the fluorescent donor moiety and the fluorescent acceptor or quencher moiety. The presence of or change in FRET is indicative of the presence of human papillomavirus in the biological sample, whereas the absence of FRET is indicative of absence of human papillomavirus in the biological sample.

Normally, the nucleic acid is hybridized to the probe and excited at a wavelength absorbed by the fluorescent donor moiety. The presence or absence of the binding probe is detected by visualizing and / or measuring the wavelength emitted by the acceptor fraction or fluorescent quencher. Alternatively, it can also be detected by quantifying FRET.

In a preferred embodiment, the nucleic acid obtained from a sample is amplified before being brought into contact with said group of probes. Preferably, amplification is performed using a polymerase chain reaction (PCR). The amplification reaction may be PCR (see, for example, U.S. Patents 4, 683, 195 and 4, 683, 202, and Innis et al., Editors, PCR Protocols, (Academic Press, New York, 1989; Sambrook et al., Molecular Cloning, Second Edition, (Cold Spring Harbor

Laboratory, New York 1989)). PCR can also be used when the RNA is isolated and converted, preferably by reverse transcription, to cDNA. Preferably, PCR is performed using Taq DNA polymerase, for example, Amplitaq ™ (Perkin-Elmer, Norwalk, Conn.). Taq polymerase can also be obtained from MBI Fermentas Perkin Elmer, Boehringer Mannheim and Beckman Instruments. An equivalent, preferably thermostable, DNA polymerase can also be used in the method of the present invention, such as Tfl (Thermus flavus) polymerase (Gut et al., Virol Methods 77 (1): 37-46 (1999)).

Alternatively, the amplification reaction may be RT-PCR (Yajima et al, Clin. Chem, 44 (12): 2441-2445 (1998); Martell et al., J. Clin Microbiol., 37 (2): 327 (1998), Gut et al., Virol Methods 77 (1): 37-46 (1999), Predhomme et al., Leukemia, 13 (6): 957-964 (1999)), in which RNA is transcribed inversely in cDNA, which is then subjected to PCR amplification.

As is well known, PCR involves the extraction and denaturation (preferably by heat) of a DNA (or RNA) sample. A molar excess of oligonucleotide primers is added, together with polymerase, which can be thermally stable and dNTPs to form the amplified sequence. Oligonucleotide primers are designed to hybridize opposite ends of the desired sequence for amplification. In the first round of amplification, the polymerase replicates the DNA to produce two " long products " which start with the respective primers. Total DNA, which includes the two long products and two original chains, is then denatured and a further polymerization round is carried out. The result of the second cycle is: two original chains, the two long products of the first cycle, two long new products (produced from the original chains) and two " short products " produced from long products. These short products have the sequence of the target sequence (sense or anti sense) with a primer at each end. For each additional amplification loop, the number of short products grows exponentially, with each cycle producing two additional long products and a number of short products equal to the sum of the long and short products remaining at the end of the previous cycle.

Oligonucleotide primers can be synthesized by a number of approaches, for example, Ozaki and such, Nuc. Acids Res. 20: 5205-5214 (1992); Agrawal et al., Nuc. Acids Res. 18: 5419-5423 (1990) or the like. Conveniently, oligonucleotide probes are synthesized on an automated DNA synthesizer, for example an Applied Biosystems, Inc., Foster City, California synthesizer model 392 or 394 DNA / RNA using standardized chemical reactions such as phosphoramidite chemistry (Beaucage and Iyer, Tetrahedron 48 2223-2311 (1992), U.S. Patent Nos. 4,980,460, 4,725,677, 4,415,732, 4,480,806 and 4,937,679). Alternative chemistries, including groups of non-natural structures such as phosphorothioate and phosphoramidate, may also be employed, since the hybridization efficiency of the resulting oligonucleotides 43 is not adversely affected. The exact length and sequence of the DNA primers will depend on the target polynucleotide to be amplified. Preferably, the length of the DNA primers is from 10 to 60 nucleotides and more preferably from 15 to 30 or 25 nucleotides.

Preferably, the production of the amplified nucleic acid is monitored continuously. As used presently, " continuously monitored " means that the amount of the amplified product is evaluated on a regular basis. For example, one can read after the first amplification cycle and thereafter after each one, two or five cycles. Alternatively, evaluations of the amount of amplified product present may be effected after a certain period of time, for example, one, two, five or ten seconds. This allows the process to be monitored in " real-time ". The person skilled in the art will appreciate that the level of the signal produced by the attached probes will fluctuate as the cycle passes through the various phases of annealing, amplification and denaturation.

Conventional PCR methods in conjunction with FRET technology can be used to practice the methods of the invention. In one embodiment, a rapid thermocycler such as the LIGHTCYCLER ™ instrument is used. A detailed description of the LIGHTCYCLER ™ System and Online PCR monitoring can be found on the Roche website. The following patent applications describe real-time PCR as used in LIGHTCYCLER ™ technology. WO 97/46707, WO 97/46714 and WO 97/46712. The LIGHTCYCLER ™ instrument is a fast thermal cycler combined with a microvolume fluorimeter that uses high quality optics. This thermocycling technique uses thin glass cuvettes as reactors. Heating and cooling of the reaction chamber are controlled by alternating heated air and at room temperature. Due to the low air mass and the high surface area ratio for cuvette volume, very rapid rates of thermal variation can be achieved within the thermal chamber. The instrument allows the PCR to be monitored in real time and online. Moreover, the cuvettes serve as optical signal collection elements (similar to glass fiber optical devices), concentrating the signal at the tip of the cuvette. The effect consists of efficient illumination and fluorescent monitoring of microvolume samples. The carousel with the cuvettes can be removed from the instrument. Therefore, the samples can be loaded off the instrument (for example, in a Clean PCR Room). In addition, this feature allows for easy cleaning of the sample carousel. The light meter, as part of the apparatus, accommodates the light source. The emitted light is filtered and focused by epi-lighting lenses on the top of the cuvette. The fluorescent light emitted from the sample is then focused by the same lens, passed through a dichroic mirror, properly filtered and focused on the photo-hybrids of data collection. The optical unit in the instrument preferably includes three band pass filters (530 nm, 640 nm and 710 nm), providing six color detection and various fluorescence acquisition options. The present invention, however, is not limited by the configuration of a commercially available instrument. The data collection options include one-time monitoring every single cycle, single continuous sample collection for melt curve analysis, continuous sampling (where sampling frequency depends on sample number) and / or stepwise measurement of all samples at a defined temperature range. The thermal cycler works preferably with a PC workstation and can use the Windows NT operating system. Sample signals are obtained as the machine positions the capillaries sequentially on the optical drive. The software can display real-time fluorescence signals immediately after each measurement. The fluorescence acquisition time is 10 to 100 msec. After each cycle, a quantitative visualization of the fluorescence vs number of cycles for all samples can be continuously updated. The generated data can be saved for later analysis.

In a preferred embodiment, the nucleic acid is amplified using at least one primer selected from Seq. Id. Nos. 1 to 32, most preferably using a primer mixture comprising Seq. Id. Nos. 1 to 32.

In a preferred embodiment, the method uses a natural or artificial internal control DNA, preferably detecting the FRET signal or emission at a distinguishable wavelength, different or independent of the emission wavelengths used by detecting the emission changes in a spatially distinguishable localization of probes bound to solid phases.

The methods described above may further include the preventive amplification of contaminating nucleic acids 46 from prior amplification reactions. Prevention of this undesired amplification may include performing the amplification step in the presence of uracil and treating the biological sample with uracil-DNA glycolase prior to a first amplification step. In addition, the loop may be run in a separate control sample to confirm appropriate amplification conditions. A control sample may include a portion of the human papillomavirus nucleic acid molecule. Alternatively, a control sample thereof may be amplified using a pair of control primers and hybridized using a pair of control probes. A control amplification product is produced if the control template is present in the sample and the control probes hybridize to the control amplification product.

The methods of the present invention are performed on nucleic acids obtained from a biological sample. Representative biological samples include cervical scrapings, smears or paraffin-shaped sections of tissue, other scraping of anatomical sites where human papillomavirus and urine infections occur. Preferably, the sample is selected from bronchial aspirates, urine, liquid obtained by prostatic massage, ejaculate, cytological specimens, scraping or biopsies of blood and cervix, vowel, anus, genitals, skin or larynx.

In the second aspect, the present invention features a set of probes comprising at least four probes, each of the probes comprising a sequence complementary sequence of a pathogen flanked by four complementary base pairs, wherein said bases form an arm structure in the absence of hybridization to a nucleic acid of a pathogen, wherein said probe is labeled with a first interactive marker and a second interactive marker, such that hybridization of said probe to a nucleic acid of a pathogen causes a change in the detected signal.

Preferred embodiments of the first aspect with respect to the probes apply to the second aspect.

As previously described, the sequences forming the " semicircular " of the probe are selected so that they not only hybridize to the desired sequence in the target organism but also do not form secondary structures with the semicircular regions of other probes. Thus, in the third aspect the present invention features a nucleic acid sequence which comprises any one of SEQ ID NOs. 33 to 52 or SEQ ID Nos. 105-117. Nucleic acid sequences may be used in other methods to detect the presence of one or more HPV genotypes. Accordingly, the present invention also provides the use of a nucleic acid of the invention for detecting the presence or absence of at least one HPV genotype. Preferably, the nucleic acid is used in a method that continuously monitors the amplification of the nucleic acids obtained from a sample.

These methods include TAQMAN ™ technology, the use of sequences as part of a molecular scorpion and other methods based on PCR. TAQMAN ™ technology detects the presence or absence of a product of the amplification and therefore the presence or absence of the human papillomavirus. TAQMAN ™ technology uses a single stranded hybridization probe labeled 48 with two fluorescent moieties. When a first fluorescent moiety is excited with light at a suitable wavelength, the absorbed energy is transferred to a second fluorescent moiety, in accordance with the FRET principles. The second fluorescent moiety is generally a quencher molecule. During the annealing phase of the PCR reaction, the labeled hybridization probe binds to the target DNA and is degraded by the 5 'to 3' exonulease activity of the Taq polymerase during the next elongation step. As a result, the excited fluorescent moiety and the second fluorescent moiety become spatially separated from each other. Accordingly, upon excitation of the first fluorescent moiety in the absence of the second fluorescent moiety, the fluorescence emission of the first fluorescent moiety is detectably altered. For example, if the second fluorescent moiety is a quencher, the fluorescence emission of the first fluorescent moiety increases and can thus be detected. By way of example, an ABI PRISM ™ 7700 Sequence Detection System (Applied Biosystems, Foster City, Calif.) Uses TAQMAN ™ technology and is suitable for performing human papillomavirus detection methods. Information on PCR amplification and detection using the ABI PRISM ™ 7700 system can be found on the Applied Biosystems website.

In a sixth aspect, the present invention provides a method of identifying a minimal set of primers that amplify nucleic acid sequences of two or more related organisms, comprising: (a) Identification of primer binding sites having at least 30% identity between those bodies; (b) Designing a set of primers capable of initiating amplification at the starter sites identified in (a), wherein each of said primers does not have more than 3 mismatches with the primer binding site in at least one of said organisms and wherein each of said primers differs from each of the primers referred to at 4 or less nucleotides; (c) Determination of the lowest number of primers required to detect as many of the above organisms as possible; (d) Determining the relative amount of each required primer in said primer set to ensure equal amplification of the nucleic acid sequences of all of the above organisms.

As used herein, " related organisms " means organisms belonging to the same class, genus or species and having a high level of similarity, preferably at least 80% identity, more preferably at least 90% identity. The related organisms are preferably viruses, more preferably human papillomaviruses. The primers preferably amplify the L1 region of human papillomaviruses. The percent identity of two nucleic acid sequences is determined by aligning the sequences for an optimal comparison (for example, ranges in the first sequence can be introduced for better alignment with the sequence), and comparison of the nucleotides at corresponding positions. 0 " better alignment " is an alignment of two sequences that results in the highest percentage of identity. The identity percentage is determined by the number of identical nucleotides in the sequences compared (i.e.% identity = number of identical positions / total number of positions × 100). Determination of the percentage of identity between two sequences can be achieved using a mathematical algorithm known to those skilled in the art. An example of a mathematical algorithm for comparing two sequences consists of the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Know. USA 87: 2264-2268, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Know. USA 90: 5873-5877. The NBLSAT and XBLAST programs of Altschul, et al. (1990) J. Mol. Biol. 215: 403-410 incorporated this algorithm. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, word length = 12 to obtain nucleotide sequences homologous with nucleic acid molecules of the invention. To obtain interval alignments for comparison, Gapped-BLAST can be used as described in Altschul et al. (1997) Nucleic Acids Res. 25: 3389-3402. Alternatively, PSI-Blast can be used to perform a repeated search that detects distant relationships between molecules (Id.). When using the BLAST, Gapped BLAST and PSI-BLAST programs, you can apply the predefined parameters of the respective programs (for example, XBLAST and NBLAST). Another example of a mathematical algorithm used for the comparison of sequences is the algorithm of 51

Myers and Miller, CABIOS (1989). The ALIGN program (version 2.0) that is part of the CGC sequence alignment software package has incorporated such an algorithm. Other sequence analysis algorithms known in the art include ADVANCE and ADAM, as described in Torellis and Robotti (1994) Comput. Appl. Biosci., 10: 3-5; and FASTA described in Pearson and Lipman (1988) Proc. Natl. Acad. Know. 85: 2444-8. In FASTA, kyup is a control option that sets the sensitivity and speed of the search. A minimal set of primers is a set of primers containing the minimum number of primers necessary to amplify the nucleic acid sequences of as many related organisms as necessary. The primer set may optionally contain a correction primer that is used to control initiation differences between the primers at a particular primer binding site. The correction primers should have no more than three mismatches relative to the primer binding site where they are expected to act. The addition of correction primers helps to produce a level of sensitivity in the detection that is at least two orders of magnitude or more for all organisms to be detected, for example all human papillomaviruses.

As presently used " unpaid " refers to when a base on a primer does not form a base pair according to the Watson-Crick annealing rules, with a corresponding base on the primer binding site. A mismatch is formed where the two corresponding bases do not conform to the Watson-Crick criteria, for example C-T, G-A. The mismatches are preferably within the primer half closest to the 5 'end, more preferably forming nucleotides prior to the 5' end of the primer. Each primer of the primer set differs only from each of the other primers in the set at four or fewer nucleotides. Thus, if the primers are all 15 nucleotides in length, then 11 nucleotides in one primer are identical to 11 nucleotides in each of the other primers. Preferably, the identical nucleotides are not identical.

In a preferred embodiment, there is shown a method of constructing an extremely complex multiplex reaction of papillomavirus amplification. The method includes selection of conserved primer binding sites (variability less than 70%) in an appropriate proximity. The primer binding sites should be located at a distance from each other to ensure the production of an amplicon of the appropriate size. Preferably, an amplicon of 30-160 nucleotides in length, more preferably 40-120, 50-100, 60-90 or 70-80 nucleotides in length is produced. Amplicons between 130 and 160 nucleotides in length are particularly preferred. The primers are part of the generated amplicon. Preferably, the primers are 10-30 nucleotides in length, more preferably 12-25, 15-22 or 18, 19, 20 or 21 nucleotides in length. The sequence of a complete set of primers where the primers meet the criteria normally applied to primers (for example, primer check compared to a fully complementary computer program such as Primer3) is then determined and the smallest possible number of primers with only three mismatches, preferably at one end of the primer, more preferably the 5 'end, relative to all organisms, such as the types of human papillomavirus, which is to be amplified. In addition, the primers should bind to a nearly equal number of types having no more than three mismatches. Other amplification differences are controlled by altering the relative concentration of the primers. The resulting detection sensitivity is preferably within at least two magnitudes for all related organisms, such as the types of human papillomaviruses, which are intended to be detected.

This constitutes significant progress over recent techniques, in which sequential addition of primers and trial and error methods are followed. The projected method keeps the competition at a minimum. Corrected initiation efficiencies are compared to all targets, resulting in equally equal amplification sensitivities. In addition, the probability of initiation errors is reduced by keeping the primers preferably variable at the respective 5 'end. The primer mixture is capable of amplifying at least one human papillomavirus type LI region, preferably comprising Seq Ids 53 to 103. Preferably it comprises at least one direct primer of the Seq group Id 1 to 16 and at least one a reverse primer from the Seq Id group at 17 to 32.

In a seventh aspect, the present aspect presents a set of primers which can be obtained by the method of the sixth aspect comprising at least one primer 54 selected from Seq Ids 1 to 32. Preferably includes at least one direct primer of the Seq Id 1 to 16 and at least one reverse primer of the Seq group Id 17 to 32. More preferably includes Seq Id. 1 to 32.

In another aspect, the present invention provides a detection kit for one or more pathogens comprising a set of probes, as defined in the second aspect. The kit further preferably includes a set of primers identified according to the method of the sixth aspect.

In addition, the invention features a kit for detecting one or more pathogens, comprising a set of primers identified according to the method of the sixth aspect.

Preferably, kits may be used to detect one or more organisms associated with a sexually transmitted disease, preferably HPV genotypes. Preferably, the probes include a sequence selected from SEQ ID Nos: 17 to 33. The primer set preferably comprises at least one sequence selected from the Seq. 1 to 32, more preferably at least one selected from Seq Id at 32 to 1 and at least one selected from Seq Id 17-32. Most preferably, the primer mix comprises the primers of Seq Id at 1-32.

Preferably, the assemblies further comprise an internal control. The kit may further include a leaflet or sheet with instructions for use of the primer blend (s) and probe pair (s) for detecting the presence or absence of the human papillomavirus in a biological sample. 55

The kits may further comprise other components, such as the reagents required for PCR. These reagents include buffers, a suitable DNA polymerase and dNTPs such as dATP, dCTP, dGTP and dTTP. Kit components may be presented in multiple vials or other containers. The reagents can be lyophilized for further reconstitution, for use. Alternatively, the components may be presented in suitably buffered, ready-to-use solutions. These solutions may contain suitable preservatives.

Except where otherwise defined, all technical and scientific terms used have a meaning equal to the assumption by one of ordinary skill in the art of the present invention. The present invention is illustrated in the following non-limiting examples. Other features, objects and advantages of the present invention will become apparent from the figures and the detailed description and from the claims.

Example 1

Real-time PCR detection for high-risk, low-risk HPV DNA. The total reaction volume was 20 μΐ, including the following components: 2μl (~ 0.2pg) cloned HPV DNA, 18μl polymerase buffer (final concentration: 90mM TRIS-HC1 (pH = 8.0), 1mM DTT, 50 mM KCl, 7 mM MgCl2-2f1 of Tween-20 (SIGMA), 1% Ficoll, 1% PVP, 250 μg of each dNTP (ATP, CTP, GTP, TTP) (Promega) f 0.28 μΜ of each primer: SEQ ID NO: 1-32, 0.18 μΜ of each molecular beacon SEQ ID NO: 33-52 and 7.5 U AmpliTaq Gold DNA polymerase ( ROCHE)). The reaction was run on a LightCycler 2.0 PCR thermocycler with the following parameters:

Step 1: 10 minutes at 95 ° C;

Step 2: 5 minutes at 55 ° C;

Stage 3: Cycles 1-37: 30 seconds at 95 ° C, 60 seconds at 42 ° C - single detection mode and 30 seconds at 72 ° C; High-risk HPV genotypes were detected by molecular beacon probes Seq Id. No 38-51. The fluorescence data were collected at 530 nm.

Low-risk HPV genotypes were detected by molecular beacon probes Seq Id No: 33-37. The fluorescent data were collected at 560 nm. Internal control of the reaction was detected by molecular beacon probes Seq Id No: 52. Fluorescence data were collected at 610 nm.

The following genotypes were successfully detected: low risk (6, 11, 42, 43, 44/55), high risk (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 , 66, 68) and internal control.

Example 2

Real-time PCR detection for HPV16 HPV16, HPV18 and HPV6, HPV11 DNA. The total reaction volume was 20 μΐ, including the following components: 2μl (~ 0.2pg) cloned HPV DNA, 18μl polymerase buffer (final concentration: 90mM TRIS-HCl (pH = 8.0), 10mM of DTT, 50 mM KCl, 7 mM MgCl 2, 1% Tween-20 (SIGMA), 1% Ficoll, 1% PVP, 250 μg of each dNTP (ATP, CTP, GTP, TTP) (Promega) 0.28 μl of each primer: Seq. ID No: 1-32, 0.18 μl of each molecular beacon Seq. Id. No: 33, 34, 38, 39, 52 and 7.5 U Amplitaq

Gold DNA Polymerase (ROCHE)). The reaction was performed on a LightCycler 2.0 PCR thermocycler with the following parameters:

Step 1: 10 minutes at 95 ° C;

Step 2: 5 minutes at 55 ° C;

Stage 3: Cycles 1-37: 30 seconds at 95 ° C, 60 seconds at 42 ° C - single detection mode and 30 seconds at 72 ° C; The HPV16 and HPV18 genotypes were detected by beacon molecular probes Seg Id. No 38-39. The fluorescent data were collected at 530 nm.

Genotypes of HPV6 and HPV11 were detected by beacon molecular probes Seq Id No: 33-34. The fluorescent data were collected at 560 nm. Internal control of the reaction was detected by molecular beacon probes Seq Id No: 52. Fluorescent data were collected at 610 nm.

The following genotypes were successfully detected: low risk (6, 11), high risk (16, 18) and internal control.

Annex 1

Direct initiators

SEQ. ID. NO: 1 KP-F / 1 CGCACCAACATATTTTATT SEQ. ID. NO: 2 KP-F / 2 CGCACAAGCATCTATTATTA SEQ. ID. NO: 3 KP-F / 3 CGCACAAGCATATTTTATC SEQ. ID. NO: 4 KP-F / 4 CGCACCAGTATATTTTATCA SEQ. ID. NO: 5 KP-F / 5 CGCACAAGCATTTACTATCA SEQ. ID. NO: 6 KP-F / 6 CGCACCAACTACTTTTACC SEQ. ID. NO: 7 KP-F / 7 CGTACCAGTATTTTCTACCAC SEQ. ID. NO: 8 KP-F / 8 CGCACAGGCATATATTACT SEQ. ID. NO: 9 KP-F / 9 CGCACCAACATATATATCA SEQ. ID. N0: 1C KP-F / 10 CGTACCAACCTGTACTATTATG 58

SEQ. ID. NO: 11 KP-F / 11 GCACCAACTTATTTTACCAT SEQ. ID. NO: 12 KP-F / 12 ACCAACCTCTTTTATTATGG SEQ. ID. NO: 13 KP-F / 13 AGCACAAATATATATTATTATGG SEQ. ID. NO: 14 KP-F / 14 CGCACCGGATATATTACT SEQ. ID. NO: 15 KP-F / 15 CGCACAAATATTTATTATTATGC SEQ. ID. NO: 16 KP-F / 16 CGGACGAATGTTTATTACC Inverse Reverse Initiator: SEQ. ID. NO: 17 L1C2 TACCCTAAATACTCTGTATTG SEQ. ID. NO: 18 L1R2TACCCTAAATACCCTATATTG SEQ. ID. NO: 19 RI AATTCTAAAAACTCTGTACTG SEQ. ID. NO: 20 R45 TACTCTAAATACTCTGTATTG SEQ. ID. NO: 21 RI1 TACCTTAAACACTCTATATTG SEQ. ID. NO: 22 RI 6 TATTCTAAATACCCTGTATTG SEQ. ID. NO: 23 R42 AACTCTAAATACTCTGTACTG SEQ. ID. NO: 24 R44 CATCTTAAAAACCCTATATTG SEQ. ID. NO: 25 RO3 AACCCTAAACACCCTGTATTG SEQ. ID. NO: 26 RO4 AACGCGAAAAACCCTATATTG SEQ. ID. NO: 27 RO5 TACCCTAAAGACCCTATACTG SEQ. ID. NO: 28 RO 6 AACTCTAAATACCCTATACTG SEQ. ID. NO: 29 RO7 AACGTGAAATACACGATATTG SEQ. ID. NO: 30 RO 8 CACACGGAACACCCTGTACTG SEQ. ID. NO: 31 R54 CACCCTAAACACCCTATATTG SEQ. ID. NO: 32 R85 AACCCGAAACACTCGATACTG

Probe

Sequences

SEQ ID NO: 33 HPV6B3: GGGTCATCCTTATTTTTCCATAA SEQ ID NO: 34 HPV11B2: GGGACATCCATATTACTCTATCAAA SEQ ID NO: 35 HPV42B2: GGTCACCCTTATTACTCTATTACAAA 59

SEQ ID NO: 36 HPV43B2: CACCCATATTTCCCCCTTAAA SEQ ID NO: 37 HPV44 / 55B2: ACGACCAGCAAACAAGACAC SEQ. ID. NO: 38 HPV16B5: CAATAACAAAATATTAGTTCCTAAA SEQ. ID. NO: 39 HPV18B8: TATCCTGCTTATTGCCACC SEQ. ID. NO: 40 HPV31B5: CATACCTAAATCTGACAATCC SEQ. ID. NO: 41 HPV33B7: TTTTTTAGCGTTAGTAGGATTTTT SEQ. ID. NO: 42 HPV35B2: AAAACAAGAT T C T AAT AAAATAGCA SEQ. ID. NO: 43 HPV39B3: TTAAAGTGGGTATGAATGGTTG SEQ. ID. NO: 44 HPV45B3: GCTGTTCCTAAGGTATCCG SEQ. ID. NO: 45 HPV51B2: AGCACGCGTTGAGGTTTTA SEQ. ID. NO: 46 HPV52B2: AGTTTTAGTTCCCAAGGTGTC SEQ. ID. NO: 47 HPV56B2: CTGTGACTAAGGACAATACCAAA SEQ. ID. NO: 48 HPV58B2: TTCCATCAAAAGTCCCAATAAC SEQ. ID. NO: 49 HPV59B2: AAAGGTGGTAATGGTAGACAGG SEQ. ID. NO: 50 HPV66B2: AAT C T GGTAC CAAAACAAACAT C SEQ. ID. NO: 51 HPV68B2: TTAAGGTTCCTATGTCTGGGG SEQ. ID. NO: 52 HPV-ICB2: T GACATAGATCCCCATAGACAGT T SEQ. ID. NO: 53> Hpv2a cgga ctaatgtgta ttaccatggt ggcagtteta ggcttctcac tgtgggtcat ccatattact ctataaagaa gagtaaíaat aaggtggctg tgcccaaggt atctgggtac caatatcgtg tatttcacgt g SEQ. ID. NO: 54> HPV3 cgc accaacattt attattatgc aggcagttct cgcttgctga ccgtgggtca tccttatttt gctatcccca aatcttctaa ttccaagatg gatattccta aggtgtccgc ctttcaatat agagtgttta gggtg SEQ. ID. NO: 55 > HPV6 cgcacca acatatttta tcatgccagc agttctagac ttcttgcagt gggtcatcct tatttttcca taaaacgggc taacaaaact gttgtgccaa aggtgtcagg atatcaatac aggglattta aggtg SEQ. ID. NO: 56 > HPV11 cgcacc aacatatttt atcatgccag cagttctaga ctccttgctg tgggacatcc atattactct atcaaaaaag ttaacaaaac agttgtacca aaggtgtctg gatatcaata tagagtgttt aaggta SEQ. ID. NO: 57 > HPV13 60 cgtac caacatattt tatcatgcta gcagttctag actacttgca gtgggaaatc cttattttcc tattaagaaa caaaacaaaa ctgttgtccc taaggtatct ggttatcagt ttagggtatt taaagtt SEQ. ID. NO: 58 > HPV16 cgcacaa acatatatta tcatgcagga acatccagac tacttgcagt tggacatccc tattttccta ttaaaaaacc taacaataac aaaatattag ttcctaaagt atcaggatta caatacaggg tatttagaat a SEQ. ID. NO: 59 > HPV18 & ccacaagcat attttatcat gctggcagct ctagattatt aactgttggt aatccatatt ttagggttcc tgcaggtggt ggcaataagc aggatattcc taaggtttct gcataccaat atagagtatt tagggtg SEQ. ID. NO: 60 > HPV26 cgcacc ggcatatatt attatgcggg cagctctcgt ttattaacat taggacatcc atatttttcc atacctaaaa ctggccaaaa ggccgaaatt cctaaggtat ctgcctatca gtacagggta tttagagtg SEQ. ID. NO: 61 > HPV27 cggacgaatg tctattacca tggtggcagt tctaggctcc tcactgtcgg ccacccatat tattctataa agaagggtag caataatagg ttggcagtgc ctaaggtgtc cggctaccaa taccgtgtat ttcacgtt SEQ. ID. NO: 62> HPV28 cgca ccaatattta ttattatgca ggcacttctc ggttgctgac cgtgggtcat ccttatttt ccattcctaa atcatccact aacaaagcag atgtgcccaa agtgtccgcc tttcagtata gggtattccg ggtg SEQ. ID. NO: 63 > HPV29 & gcacaaatat ttattattat gcaggcagtt ctcgcctgct cactgtgggt catccacatt attcaattcc caaatcctct ggtaataagg tagatgtgcc taaggtgtct gcatttcagt acagggtttt ccgtgtg SEQ. ID. NO: 64> HPV30 cg caccaatata ttttatcatg caggcagctc acgtttgctt gctgttggac atccatatta ttctatttct aaggctggta attccaaaac agatgttccc aaggtgtctg catttcagta tagggtcttt agggtc SEQ. ID. NO: 65> HPV31 cg aaccaacata tattatcacg caggcagtgc taggctgctt acagtaggcc atccatatta ttccatacct aaatctgaca atcctaaaaa aatagttgta ccaaaggtgt caggattaca atatagggta tttagggtt SEQ. ID. NO: 66 > HPV33 cgcacaagca tttattatta tgctggtagt tccagacttc ttgctgttgg ccatccatat ttttctatta aaatcctac taacgctaaa aaattattgg tacccaaagt atcaggcttg caatataggg tttttagggt c SEQ. ID. NO: 67> HPV34 61 cg cacaaatata tattattatg caggtagtac acgcttgctg gcagtaggac atccctatta tcctataaag gatactaatg ggaaacgtaa gattgctgta cctaaagttt caggtttgca atacagggta tttagaata SEQ. ID. NO: 68> HPV35 cgcacaaaca tctactatca tgcaggcagt tctaggctat tagctgtggg tcacccatac tatgctatta aaaaacaaga ttctaataaa atagcagtac ccaaggtalc tggtttgcaa tacagagtat ttagagt SEQ. ID. NO: 69 > HPV39 & gcacaggcat atattattat gctggcagct ctagattatt aacagtagga catccatatt ttaaagtggg tatgaatggt ggtcgcaagc aggacattcc aaaggtgtct gcatatcaat atagggtatt tcgcgtg SEQ. ID. NO: 70 > HPV40 cgcaccag tttatattat catgctggta gtgccaggtt actgactata ggacatccat actttgagtt aaaaaaaccc aatggtgaca tttcagtgcc taaggtttct ggacatcaat acagggtatt tagggta SEQ. ID. NO: 71 > HPV42 cgcacca actactttta ccatgccagc agttctaggc tattggttgt tggtcaccct tattactcta ttacaaaaag gccaaataag acatctatcc ccaaagtgtc tggtttacag tacagagtat ttagagtt SEQ. ID. NO: 72 > HPV43 cgcaccaact tattttatta tgctggcagt tcacgtttgc ttgcagtggg tcacccatat ttccccctta aaaattcctc tggtaaaata actgtaccta aggtttctgg ttatcaatac agagtattta gagtt SEQ. ID. NO: 73 > HPV44 cgc accaacatat attaccatgc tagcagttct agacttcttg ctgtgggcaa cccttatttt gccatacgac cagcaaacaa gacacttgtg cctaaggttt cgggatttca atatagggtt tttaagatg SEQ. ID. NO: 74 > HPV45 cgcaca agcatatttt atcatgcagg cagttcccga ttattaactg taggcaatcc atattttagg gttgtaccta atggtgcagg taataaacag gctgttccta aggtatccgc atatcagtat agggtgttta gagta SEQ. ID. NO: 75 > HPV51 cgc accggcatat attactatgc aggcagttcc agactaataa cattaggaca tccctatttt ccaataccta aaacctcaac gcgtgctgct attcctaaag tatctgcatt tcaatacagg gtatttaggg ta SEQ. ID. NO: 76> HPV52 c gcacaagcat ctattattat gcaggcagtt ctcgattact aacagtagga catccctatttttctattaa aaacaccagt agtggtaatg gtaaaaaagt tttagttccc aaggtgtctg gcctgcaata cagggtattt agaatt SEQ. ID. NO: 77 > HPV53 62 cgcaccact atattttatc atgctggaag ctctcgcttg cttaccgtgg gacatcctta ttaccccatt tctaaatctg gtaaagcaga catccctaag gtgtctgcat ttcagtatag ggtgtttaga gta SEQ. ID. NO: 78> HPV54 cgcaca agcatatact atcatgcaag cagctctaga ttattggctg ttggacatcc atattttaaa gtacaaaaaa ccaataataa gcaaagtatt cctaaagtat caggaíatca atatagggtg tttagggtg SEQ. ID. NO: 79 > HPV55 cgc accaacatag tttaccatgc tagcagttct agacttcttg ctgtaggcaa cccttatttt gccatacgac cagcaaacaa gacacttgtg cctaaagttt caggatttca atatagggtt tttaaggtg SEQ. ID. NO: 80 > HPV56 cgcacta gtatatttta tcatgcaggc agttcacgat tgcUgccgt aggacatccc tattactctg tgactaagga caataccaaa acaaacattc ccaaagttag tgcatatcaa tatagggtat ttagggta SEQ. ID. NO: 81 > HPV57 cgg acgaatgttt attatcatgg tgggagctct cggctcctca cagtaggcca tccatattat tctataaaaaagtggcaa taataaggtg tctgtgccca aggtatcggg ctaccagtac cgtgtgttcc atgtg SEQ. ID. NO: 82> HPV58 c gcacaagcat ttattattat gctggcagtt ccagactttt ggctgttggc aatccatatt tttccatcaa aagtcccaat aacaataaaa aagtattagt tcccaaggta tcaggcttac agtatagggt ctttagggtg SEQ. ID. NO: 83 > HPV59 cgtaccag tattttctac cacgcaggca gttccagact tcttacagtt ggacatccat annaaagt acctaaaggt ggtaatggta gacaggatgt tcctaaggtg tctgcatatc aatacagagt atttagggtt SEQ. ID. NO: 84 > HPV61 cgcaccaact tattttatta tggtggcagt tcccgtctgc ttactgtagg acatccctat tgtagtttgc agcttgatgg gctgcagggc aagaaaaaca ctatccccaa ggtgtctggc tatcaatata gggtgtttag ggte SEQ. ID. NO: 85 > HPV62 cgcacca acctttttta ttatgggggc agctcccgcc ttcttactgt gggacatcca tattgtactt tacaggttgg ccagggtaaa cgggccacca ttcctaaggt gtctgggtat cagtacaggg tgtttcgtgt SEQ. ID. NO: 86 > HPV66 cgtacca gtatatttta tcatgcaggt agctctaggt tgcttgctgt tggccatect tattactctg tttccaaatc tggtaccaaa acaaacatcc ctaaagttag tgcatatcag tatagagtgt ttagggta SEQ. ID. NO: 87 > HPV67 cgcacaag catttactat tacgctggta gctccagact tttagctgta ggccatcctt acttttccat tcctaatccc tccaacacta aaaaggtgtt agtgcccaag gtgtcaggtt tgcagtatag ggtatttagg gtt 63 SEQ. ID. NO: 88 > HPV68 cgcactggca tgtattacta tgctggtaca tcíaggttat taactgtagg ccatccatat tttaaggttc ctatgtctgg gggccgcaag cagggcattc ctaaggtgtc tgcatatcaatacagagtgt ttagggtt SEQ. ID. NO: 89 > HPV69 cgcac cggatatatt actatgcagg cagctctcga ttattaactt tgggtcatcc ctattttcca attcctaaat ctggttcaac agcagaaatt ectaaagtgt ctgcttacca atatagggtt tttcgtgtt SEQ. ID. NO: 90> HPV70 cgta caggcatata ttattatgct ggaagctctc gcttattaac agtagggcat ccttatttta aggtacctgt aaatggtggc cgcaagcagg aaatacctaa ggtgtctgca tatcagtata gggtatttag ggta SEQ. ID. NO: 91 > HPV72 cgcacca acctctatta ttatggtggc agttctcgtc tactaactgt aggacatcct tactgtgcca tacctctcaa cggacagggc aaaaaaaaca ccattcctaa ggtttcgggg tatcaataca gggtgtttag agta SEQ. ID. NO: 92 > HPV73 agaaca aatatatatt attatgcagg tagcacacgt ttgttggctg tgggacaccc aliattttcct atcaaggatt ctcaaaaacg taaaaccata gttcctaaag tttcaggttt gcaatacagg gtgtttaggc tt SEQ. ID. NO: 93 > HPV74 cgcacc aacatctttt atcatgctag cagttctaga ctacttgctg taggaaatcc ctatttccct ataaaacagg ttaacaaaac agttgttcct aaagtgtctg gatatcaatt tagggtgttt aaggtg SEQ. ID. NO: 94> HPV81 cgcacc aacctttttt attatggggg cagttcccgc cttcttactg tagggcatcc atattgtacattaactattg gtacccaagg aaagcgttcc actattccca aggtgtotgg giatcagtac cgggtgtttc gtgtg SEQ. ID. NO: 95 > HPV82 cgc accggcatat attattatgc aggcagttcc agacttatta ccttaggaca tccatatttt tcaataccca aaaccaatac acgtgctgaa atacctaagg tatctgcctt tcagtatagg gtgtttaggg ta SEQ. ID. NO: 96 > HPV83 cg caccaacctc ttttattacg gtggcagctc cagacttctt accgtaggac atccatatta tcctgtacag gttaatggtc aaggaaaaaa agccactatc cccaaggttt ctggctacca atatagggtg tttcgcatt SEQ. ID. NO: 97 > HPV84 cgcaccaac ttattttatt atggtggtag ttctcgcctg cttactgtgg gacatccata ttattctgtt cctgtgtcta cccctgggca aaacaacaaa aaggccacta tccccaaggt ttctgggtat caatacaggg tgtttagggtc SEQ. ID. NO: 98> HPV85 64 cgta ccagtacatt ttatcatgct ggcagctcta ggcttctaac cgttggacat ccatactata aagttacctc aaatggaggc cgcaagcaag acattcctaa agtgtctgcc tatcagtatc gagtgtttcg ggtt SEQ. ID. NO: 99> HPV86 cgtaccaac ctattttatt atggtggtag ttcccgcttg cttactgtgg gccatccata ttatcctgtt actgtttcct ccagccctgg acaaaacaac aaaaaggcca ataítcccaa ggtttcgggg tatcaataca gggtttttag ggtg SEQ. ID. NO: 10 > HPV87 cgcaccaac ttattttatt atggtggcag ttctcgcctg cttactgtgg gtcaccctta ctatccagtt actgttacca cccctggtca gaacaagaaa tccaatattc caaaggtgtc tggctatcag tacagggtgt ttcgggtg SEQ. ID. NO: 101 > HPV89 cgtaccaac ctgtactatt atggaggcag ctcccgcctt attacagttg gccaccctta ttatactgta caggtcaatg gtgctaacaa aaaggccaac atacctaagg tatcagggta tcaatacagg gtatttaggg ta SEQ. ID. NO: 102> HPV90 agaacaaacata tattattatg caggcagttc ccgactgtta actgttggcc atccttattt tgctatcaaa aagcaatcag gaaaaaaccc tatagtggtt cccaaggtgt ctggatatca atatagggtg tttagggta SEQ. ID. NO: 103 > HPV91 cgcacc aacttatttt accatgctgg cagttcccgt ttactggctg tgggccaccc tttttttcct ataaaaaata attctggtaa agtaattgtt cctaaagttt caggtcacca atatagggtg tttagagtt

SEQ. ID. NO: 104 HPV-IC

CGGACGAATGTTTATTACCAGATAGATAGAGATAGATACCCATATA

CAGATAATGACATAGATCCCCATAGACAGTTTATACAGATCAGTAG

CAGTTTTATATATGAGATGATGATAGCAATACAGAGTATTTAGGGT

THE

SEQ. ID. NO: 105 HPV11B3 / 2: AAAACAGTTGTACCAAAGGTGTCTG SEQ. ID. NO: 106 HPV42B1: CAAAAAGGCCAAATAAGACA SEQ. ID. NO: 107 HPV43B6: CCCCCTTAAAAATTCCTCT SEQ. ID. NO: 108 HPV44 / 55B1 AT AC GAC CAGCAAACAAGAC SEQ. ID. NO: 109 HPV39B4: TATGAATGGTGGTCGCAAG SEQ. ID. NO: 110 HPV52B7: AAAACACCAGTAGTGCTAATG 65 SEQ. ID. NO: 111 HPV56B3: CCAAAACAAACATTCCCAA SEQ. ID. NO: 112 HPV59B3: ATCCATATTTTAAAGTACCTAAAG SEQ. ID. NO: 113 HPV66B1: CAAAT C T GG T AC CAAAACAAA SEQ. ID. NO: 114 HPV-ICB4: CCCATAGACAGTTTATACAGATCA SEQ. ID. NO: 115 HPV6B6: ATAAAACGGGCTAACAAAA SEQ. ID. NO: 116 HPV26B1: TACCTAAAACTGGCCAAAAG SEQ. ID. NO: 117 HPV35B4: ATTCTAATAAAATAGCAGTACCCAAG SEQUENCE LISTING < 110 > Genoid Kft Jeney, Csaba Hart, Deborah M Takacs, Tibor < 120 > Method < 130 > P38434WO < 150 > US 60/737006 < 151 > 2005-11-15 < 150 > GB 0523250. 9 < 151 > 2005-11-15 < 160 > 117 < 170 > Patenteln version 3. 3 < 210 > 1 < 211 > 19 < 212 > DNA < 213 > Artificial < 22 0 > < 223 > Primer < 4 0 0 > 1 cgcaccaaca tattttatt 19 < 210 > 2 < 211 > 20

< 212 > DNA 66 < 213 > < 22 > Artificial < 223 > Initiator < 4 Ο 0 > 2 cgcacaagca tctattatta 20 < 210 > 3 < 211 > 19 < 212 > DNA < 213 > < 22 > Artificial < 223 > Primer < 4 0 0 > 3 cgcacaagca tattttatc 19

LIST OF SEQUENCES < 212 > DNA < 213 > < 22 > Artificial < 223 > Primer < 400 > 4 cgcaccagta tattttatca < 210 > 5 < 211 > 20 < 212 > DNA < 213 > < 22 > Artificial < 22 3 > Primer < 400 > 5 cgcacaagca tttactatca 20

&lt; 210 &gt; 6 &lt; 211 &gt; 19 &lt; 212 &gt; DNA 67 &lt; 213 &gt; Artificially &lt; 22 0 &gt; &lt; 223 &gt; Initiated r &lt; 400 &gt; 6 cgcaccaacl: acttttacc 19 &lt; 210 &gt; 7 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificially &lt; 22 0 &gt; &lt; 223 &gt; Initiated r &lt; 400 &gt; 7 cgtaccagta i ttttctacca c 21 &lt; 210 &gt; 8 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificially &lt; 22 0 &gt; &lt; 223 &gt; Initiated r <4 0 0> 8 cgcacaggca tatattact 19 &lt; 210 &gt; 9 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificially &lt; 22 0 &gt; &lt; 22 3 &gt; Initiated r &lt; 4 0 0 &gt; 9 1 cgcaccaaca tatattatca 20 &lt; 210 &gt; 10 &lt; 211 &gt; 22 68 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Primer &lt; 4 0 0 &gt; 10 cgtaccaacc tgtactatta tg 22 &lt; 210 &gt; 11 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 22 3 &gt; Primer &lt; 400 &gt; 11 geaccaactt attttaccat 20 &lt; 210 &gt; 12 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Primer &lt; 4 0 0 &gt; 12 accaacctct tttattatgg 20 &lt; 210 &gt; 13 &lt; 211 &gt; 23 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Primer &lt; 400 &gt; 13 agcacaaata tatattatta tgg &lt; 210 &gt; 14 23 69 &lt; 211 &gt; 18 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 4 0 0 &gt; 14 cgcaccggat atattact 18 &lt; 210 &gt; 15 &lt; 211 &gt; 23 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Primer &lt; 400 &gt; 15 cgcacaaata tttattatta tgc 23 &lt; 210 &gt; 16 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Primer &lt; 4 0 0 &gt; 16 cgg acg aatg tttattacc 19 &lt; 210 &gt; 17 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 22 3 &gt; Primer &lt; 400 &gt; 17 taccctaaat actctgtatt g 21 &lt; 210 &gt; 18 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Primer &lt; 4 0 0 &gt; 18 taccctaaat accctatatt g 21 &lt; 210 &gt; 19 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Primer &lt; 4 0 0 &gt; 19 aattctaaaa actctgtact g 21 &lt; 210 &gt; 20 <211> 21 <212> DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 22 3 &gt; Primer &lt; 400 &gt; 20 tactctaaat actctgtatt g 21 &lt; 210 &gt; 21 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Primer &lt; 400 &gt; 21 taccttaaac actctatatt g 21 &lt; 210 &gt; 22 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Primer &lt; 4 0 0 &gt; 22 tattctaaat accctgtatt g 21 &lt; 210 &gt; 23 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 22 3 &gt; Primer &lt; 400 &gt; 23 aactctaaat actctgtact g 21 &lt; 210 &gt; 24 <211> 21 <212> DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Primer &lt; 4 0 0 &gt; 24 catcttaaaa accctatatt g 21 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Primer &lt; 4 0 0 &gt; 25 aaccctaaac accctgtatt g 21 &lt; 210 &gt; 26 <211> 21 <212> DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Primer &lt; 4 0 0 &gt; 26 aacgcgaaaa accctatatt g 21 &lt; 210 &gt; 27 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 22 3 &gt; Primer &lt; 400 &gt; 27 taccctaaag accctatact g 21 &lt; 210 &gt; 28 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Primer &lt; 4 0 0 &gt; 28 aactctaaat accctatact g 21 &lt; 210 &gt; 29 <211> 21 <212> DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Primer &lt; 4 0 0 &gt; 29 aacgtgaaat acacgatatt g 21 &lt; 210 &gt; &Lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Primer &lt; 4 0 0 &gt; 30 cacacggaac accctgtact g 21 &lt; 210 &gt; 31 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 22 3 &gt; Primer &lt; 400 &gt; 31 caccctaaac accctatatt g ??? 21 &lt; 210 &gt; 32 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Primer &lt; 4 0 0 &gt; 32 aacccgaaac actcgatact g 21 &lt; 210 &gt; 33 &lt; 211 &gt; 23 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 33 gggtcatcct tatttttcca taa 23 74 &lt; 210 &gt; &Lt; 211 &gt; 25 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 34 gggacatcca tattactcta tcaaa &lt; 210 &gt; &Lt; 211 &gt; 27 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 400 &gt; 35 ggtcaccctt attactctat tacaaaa &lt; 210 &gt; &Lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 22 3 &gt; Probe &lt; 400 &gt; 36 cacccatatt tcccccttaa at 21 &lt; 210 &gt; &Lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 37 acgaccagca aacaagacac &lt; 210 &gt; 38 21 <211> 25 <212> DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 38 caataacaa atattagtte ctaaa 25 &lt; 210 &gt; 39 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 39 tatcctgctt attgccacc ??? 19 &lt; 210 &gt; 40 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Probe &lt; 400 &gt; 40 catacctaaa tctg acaatc c 21 &lt; 210 &gt; 41 &lt; 211 &gt; 24 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 41 ttttttagcg ttagtaggat tttt 24 &lt; 210 &gt; 42 &lt; 211 &gt; 25 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 42 aaaacaagat tctaataaaa tagca &lt; 210 &gt; 43 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 43 ttaaagtggg tatgaatggt tg &lt; 210 &gt; 44 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 44 gctgttccta aggtatccg ??? 19 &lt; 210 &gt; 45 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 223 &gt; Probe &lt; 4Ο0 &gt; 45 77 agcacgcgtt gaggtttta 19 &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 46 agttttagtt cccaaggtgt c 21 &lt; 210 &gt; 47 &lt; 211 &gt; 23 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 22 3 &gt; Probe &lt; 400 &gt; 47 ctgtgactaa ggacaatacc aaa &lt; 210 &gt; 48 &lt; 211 &gt; 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 48 ttccatcaaa agtcccaata ac &lt; 210 &gt; 49 <211> 22 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 220 &gt; &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 49 aaaggtggta atggtagaca gg &lt; 210 &gt; 50 &lt; 211 &gt; 23 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 50 aatctggtac caaaacaaac ata 23 &lt; 210 &gt; 51 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 51 ttaaggttcc tatgtctggg g ??? 21 &lt; 210 &gt; 52 &lt; 211 &gt; 24 &lt; 212 &gt; DNA &lt; 213 &gt; &lt; 22 &gt; Artificial &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 52 tgacatagat ccccatagac agtt 24 &lt; 210 &gt; 53 &lt; 211 &gt; 135 &lt; 212 &gt; DNA &lt; 213 &gt; Hpv2a &lt; 4 0 0 &gt; 53 79 cggactaatg tgtattacca tggtggcagt tctaggcttc tcactgtggg tcatccatat 60 tactctataa agaagagtaa taataaggtg gctgtgccca aggtatctgg gtaccaatat 120 cgtgtatttc acgtg 135 &lt; 210 &gt; 54 &lt; 211 &gt; 138 &lt; 212 &gt; DNA &lt; 213 &gt; HPV3. &lt; 400 &gt; 54 cgcaccaaca tttattatta tgcaggcagt tctcgcttgc tgaccgtggg tcatccttat 60 tttgctatcc ccaaatcttc taattccaag atggatattc ctaaggtgtc cgcctttcaa 120 tatagagtgt ttagggtg 138 &lt; 210 &gt; 55 &lt; 211 &gt; 132 &lt; 212 &gt; DNA &lt; 213 &gt; HPV6 &lt; 400 &gt; 55 cgcaccaaca tattttatca tgccagcagt tctagacttc ttgcagtggg tcatccttat 60 ttttccataa aacgggctaa caaaactgtt gtgccaaagg tgtcaggata tcaatacagg 120 gtatttaagg tg 132 &lt; 213 &gt; hpvll &lt; 400 &gt; 56 cgcaccaaca tattttatca tgccagcagt tctagactcc ttgctgtggg acatccatat 60 tactctatca aaaaagttaa caaaacagtt gtaccaaagg tgtctggata tcaatataga 120 gtgtttaagg ta 132 &lt; 210 &gt; 57 &lt; 211 &gt; 132 &lt; 212 &gt; DNA &lt; 213 &gt; HPV13 &lt; 400 &gt; 57 80 80 60 120 132 cgtaccaaca tattttatca tgctagcagt tctagactac ttgcagtggg aaatccttat tttcctatta agaaacaaaa caaaactgtt gtccctaagg tatctggtta tcagtttagg gtatttaaag tt &lt; 210 &gt; 58 &lt; 211 &gt; 138 &lt; 212 &gt; DNA &lt; 213 &gt; HPV16 &lt; 400 &gt; 58 cgcacaaaca tatattatca tgcaggaaca tccagactac ttgcagttgg acatccctat 60 tttcctatta aaaaacctaa caataacaaa atattagttc ctaaagtatc aggattacaa 120 tacagggtat ttagaata 138 &lt; 210 &gt; 59 &lt; 211 &gt; 138 &lt; 212 &gt; DNA &lt; 213 &gt; HPV18 &lt; 400 &gt; 59 cccacaagca tattttatca tgctggcagc tctagattat taactgttgg taatccatat 60 tttagggttc ctgcaggtgg tggcaataag caggatattc ctaaggtttc tgcataccaa 120 tatagagtat ttagggtg 138 &lt; 210 &gt; 60 &lt; 211 &gt; 135 &lt; 212 &gt; DNA &lt; 213 &gt; HPV26 &lt; 400 &gt; 60 cgcaccggca tatattatta tgcgggcagc tctcgtttat taacattagg acatccatat 60 ttttccatac ctaaaactgg ccaaaaggcc gaaattccta aggtatctgc ctatcagtac 120 agggtattta gagtg 135 &lt; 210 &gt; 61 &lt; 211 &gt; 138 &lt; 212 &gt; DNA &lt; 213 &gt; HPV27 &lt; 4Ο0 &gt; 61 cggacgaatg tctattacca tggtggcagt tctaggctcc tcactgtcgg ccacccatat 60 tattctataa agaagggtag caataatagg ttggcagtgc ctaaggtgtc cggctaccaa 120 taccgtgtat ttcacgtt 138 &lt; 210 &gt; 62 &lt; 211 &gt; 138 &lt; 212 &gt; DNA &lt; 213 &gt; HPV28 &lt; 400 &gt; 62 cgcaccaata tttattatta tgcaggcact tctcggttgc tgaccgtggg tcatccttat 60 tttcccattc ctaaatcatc cactaacaaa gcagatgtgc ccaaagtgtc cgcctttcag 120 tatagggtat tccgggtg 138 &lt; 210 &gt; 63 &lt; 211 &gt; 138 &lt; 212 &gt; DNA &lt; 213 &gt; HPV29 &lt; 400 &gt; 63 cgcacaaata tttattatta tgcaggcagt tctcgcctgc tcactgtggg tcatccacat 60 tattcaattc ccaaatcctc tggtaataag gtagatgtgc ctaaggtgtc tgcatttcag 120 tacagggttt tccgtgtg 138 &lt; 210 &gt; 64 &lt; 211 &gt; 138 &lt; 212 &gt; DNA &lt; 213 &gt; HPV30 cgcaccaata tattttatca tgcaggcagc tcacgtttgc ttgctgttgg acatccatat 60 tattctattt ctaaggctgg taattccaaa acagatgttc ccaaggtgtc tgcatttcag 120 tatagggtct ttagggtc 138

&lt; 210 &gt; 65 &lt; 211 &gt; 141 &lt; 212 &gt; DNA 82 &lt; 213 &gt; HPV31 &lt; 400 &gt; 65 60 120 141 cgaaccaaca tatattatca cgcaggcagt gctaggctgc ttacagtagg ccatccatat tattccatac ctaaatctga caatcctaaa aaaatagttg taccaaaggt gtcaggatta caatataggg tatttagggt t &lt; 210 &gt; 66 &lt; 211 &gt; 140 &lt; 212 &gt; DNA &lt; 213 &gt; HPV33 &lt; 400 &gt; 66 60 120 140 cgcacaagca tttattatta tgctggtagt tccagacttc ttgctgttgg ccatccatat ttttctatta aaatcctact aacgctaaaa aattattggt acccaaagta tcaggcttgc aatatagggt ttttagggtc &lt; 210 &gt; 67 &lt; 211 &gt; 141 &lt; 212 &gt; DNA &lt; 213 &gt; HPV34 &lt; 400 &gt; 67 60 120 141 cgcacaaata tatattatta tgcaggtagt acacgcttgc tggcagtagg acatccctat tatcctataa aggatactaa tgggaaacgt aagattgctg tacctaaagt ttcaggtttg caatacaggg tatttagaat a &lt; 210 &gt; 68 &lt; 211 &gt; 137 &lt; 212 &gt; DNA &lt; 213 &gt; HPV35 &lt; 400 &gt; 68 60 120 137 cgcacaaaca tctactatca tgcaggcagt tctaggctat tagctgtggg tcacccatac tatgctatta aaaaacaaga ttctaataaa atagcagtac ccaaggtatc tggtttgcaa tacagagtat ttagagt &lt; 210 &gt; 69 &lt; 211 &gt; 138

&lt; 212 &gt; DNA 83 &lt; 213 &gt; HPV39 &lt; 4 Ο Ο &gt; 6 9 cgcacagçjca tatattatta tgctggcagc tctagattat taacagtagg acatccatat 60 tttaaagtgg gtatgaatgg tggtcgcaag caggacattc caaaggtgtc tgcatatcaa 120 tatagggtat ttcgcgtg 138 &lt; 210 &gt; 70 &lt; 211 &gt; 135 &lt; 212 &gt; DNA &lt; 213 &gt; HPV40 &lt; 400 &gt; 70 egcaccagtt tatattatca tgctggtagt gccaggttac tgactatagg acatccatac 60 tttgagttaa aaaaacccaa tggtgacatt tcagtgccta aggtttctgg acatcaatac 120 agggtattta gggta 135 &lt; 210 &gt; 71 &lt; 211 &gt; 135 &lt; 212 &gt; DNA &lt; 213 &gt; HPV42 &lt; 400 &gt; 71 cgcaccaact acttttacca tgccagcagt tctaggctat tggttgttgg tcacccttat 60 tactctatta caaaaaggcc aaataagaca tctatcccca aagtgtctgg tttacagtac 120 agagtattta gagtt 135 &lt; 210 &gt; 72 &lt; 211 &gt; 135 &lt; 212 &gt; DNA &lt; 213 &gt; HPV43 &lt; 400 &gt; 72 cgcaccaact tattttatta tgctggcagt tcacgtttgc ttgcagtggg tcacccatat 60 ttccccctta aaaattcctc tggtaaaata actgtaccta aggtttctgg ttatcaatac 120 agagtattta gagtt 135 &lt; 210 &gt; 73 &lt; 211 &gt; 132 &lt; 212 &gt; DNA &lt; 213 &gt; HPV44 &lt; 400 &gt; 73 cgcaccaaca tatattacca tgctagcagt tctagacttc ttgctgtggg caacccttat 60 tttgccatac gaccagcaaa caagacactt gtgcctaagg tttcgggatt tcaatatagg 120 gtttttaaga tg 132 &lt; 210 &gt; 74 &lt; 211 &gt; 141 &lt; 212 &gt; DNA &lt; 213 &gt; HPV45 &lt; 400 &gt; 74 cgcacaagca tctattatta tgcaggcagt tctcgattac taacagtagg acatccctat 60 ttttctatta aaaacaccag tagtggtaat ggtaaaaaag ttttagttcc caaggtgtct 120 ggcctgcaat acagggtatt tagaatt 147 &lt; 210 &gt; 77 &lt; 211 &gt; 132 &lt; 212 &gt; DNA &lt; 213 &gt; HPV53 &lt; 400 &gt; 77 cgcaccacta tattttatca tgctggaagc tctcgcttgc ttaccgtggg acatccttat 60 taccccattt ctaaatctgg taaagcagac atccctaagg tgtctgcatt tcagtatagg 120 gtgtttagag ta 132 &lt; 210 &gt; 78 &lt; 211 &gt; 135 &lt; 212 &gt; DNA &lt; 213 &gt; HPV54 &lt; 400 &gt; 78 cgcacaagca tatactatca tgcaagcagc tctagattat tggctgttgg acatccatat 60 tttaaagtac aaaaaaccaa taataagcaa agtattccta aagtatcagg atatcaatat 120 agggtgttta gggtg 135 &lt; 210 &gt; 79 &lt; 211 &gt; 132 &lt; 212 &gt; DNA &lt; 213 &gt; HPV55 &lt; 4Ο0 &gt; 79 cgcaccaaca tagtttacca tgctagcagt tctagacttc ttgctgtagg caacccttat 60 tttgccatac gaccagcaaa caagacactt gtgcctaaag tttcaggatt tcaatatagg 120 gtttttaagg tg 132 &lt; 210 &gt; 80 &lt; 211 &gt; 135 &lt; 212 &gt; DNA &lt; 213 &gt; HPV56 &lt; 400 &gt; 80 cgcactagta tattttatca tgcaggcagt tcacgattgc ttgccgtagg acatccctat 60 tactctgtga ctaaggacaa taccaaaaca aacattccca aagttagtgc atatcaatat 120 agggtattta gggta 135 &lt; 210 &gt; 81 &lt; 211 &gt; 138 &lt; 212 &gt; DNA &lt; 213 &gt; HPV57 &lt; 400 &gt; 81 cggacgaatg tttattatca tggtgggagc tctcggctcc tcacagtagg ccatccatat 60 tattctataa aaaaaagtgg caataataag gtgtctgtgc ccaaggtatc gggctaccag 120 taccgtgtgt tccatgtg 138 &lt; 210 &gt; 82 &lt; 211 &gt; 141 &lt; 212 &gt; DNA &lt; 213 &gt; HPV58 &lt; 400 &gt; 82 cgcacaagca tttattatta tgctggcagt tccagacttt tggctgttgg caatccatat 60 ttttccatca aaagtcccaa taacaataaa aaagtattag ttcccaaggt atcaggctta 120 cagtataggg tctttagggt g &lt; 210 &gt; 83 <211> 138 &lt; 212 &gt; DNA &lt; 213 &gt; HPV59 &lt; 400 &gt; 83 cgtaccagta ttttctacca cgcaggcagt tccagacttc ttacagttgg acatccatat 60 tttaaagtac ctaaaggtgg taatggtaga caggatgttc ctaaggtgtc tgcatatcaa 120 tacagagtat ttagggtt 138 &lt; 210 &gt; 84 &lt; 211 &gt; 144 &lt; 212 &gt; DNA &lt; 213 &gt; HPV61 &lt; 400 &gt; 84 60 120 144 60 120 cgcaccaact tattttatta tggtggcagt tcccgtctgc ttactgtagg acatccctat tgtagtttgc agcttgatgg gctgcagggc aagaaaaaca ctatccccaa ggtgtctggc tatcaatata gggtgtttag ggta &lt; 210 &gt; 85 &lt; 211 &gt; 138 &lt; 212 &gt; DNA &lt; 213 &gt; HPV62 &lt; 400 &gt; 85 cgcaccaacc ttttttatta tgggggcagc tcccgccttc ttactgtggg acatccatat tgtactttac aggttggcca gggtaaacgg gccaccattc ctaaggtgtc tgggtatcag tacagggtgt ttcgtgtg 138 &lt; 210 &gt; 86 &lt; 211 &gt; 135 &lt; 212 &gt; DNA &lt; 213 &gt; HPV66 &lt; 400 &gt; 86 87 cgtaccagta tattttatca tgcaggtagc tctaggttgc ttgctgttgg ccatccttat 60 tactctgttt ccaaatctgg taccaaaaca aacatcccta aagttagtgc atatcagtat 120 agagtgttta gggta 135 &lt; 210 &gt; 87 &lt; 211 &gt; 141 &lt; 212 &gt; DNA &lt; 213 &gt; HPV67 &lt; 400 &gt; 87 cgcacaagca tttactatta cgctggtagc tccagacttt tagctgtagg ccatccttac 60 ttttccattc ctaatccctc caacactaaa aaggtgttag tgcccaaggt gtcaggtttg 120 cagtataggg tatttagggt 141 &lt; 210 &gt; 88 &lt; 211 &gt; 138 &lt; 212 &gt; DNA &lt; 213 &gt; HPV68 &lt; 400 &gt; 88 cgcactggca tgtattacta tgctggtaca tctaggttat taactgtagg ccatccatat 60 tttaaggttc ctatgtctgg gggccgcaag cagggcattc ctaaggtgtc tgcatatcaa 120 tacagagtgt ttagggtt &lt; 210 &gt; 89 &lt; 211 &gt; 134 &lt; 212 &gt; DNA &lt; 213 &gt; HPV69 cgcaccggat atattactat gcaggcagct ctcgattatt aactttgggt catccctatt 60 ttccaattcc taaatctggt tcaacagcag aaattcctaa agtgtctgct taccaatata 120 gggtttttcg tgtt 134 &lt; 210 &gt; 90 &lt; 211 &gt; 138 &lt; 212 &gt; DNA &lt; 213 &gt; HPV70 &lt; 400 &gt; 90 88 cgtacaggca tatattatta tgctggaagc tctcgcttat taacagtagg gcatccttat 60 tttaaggtac ctgtaaatgg tggccgcaag caggaaatac ctaaggtgtc tgcatatcag 120 tatagggtat ttagggta 138 &lt; 210 &gt; 91 &lt; 211 &gt; 141 &lt; 212 &gt; DNA &lt; 213 &gt; HPV72 &lt; 400 &gt; 91 cgcaccaacc tctattatta tggtggcagt tctcgtctac taactgtagg acatccttac 60 tgtgccatac ctctcaacgg acagggcaaa aaaaacacca ttcctaaggt ttcggggtat 120 caatacaggg tgtttagagt a 141 &lt; 210 &gt; 92 &lt; 211 &gt; 138 &lt; 212 &gt; DNA &lt; 213 &gt; HPV73 &lt; 400 &gt; 92 âgâacaaatâ tatattatta tgcaggtagc acacgtttgt tggctgtggg acacccatat 60 tttcctatca aggattctca aaaacgtaaa accatagttc ctaaagtttc aggtttgcaa 120 tacagggtgt ttaggctt 138 &lt; 210 &gt; 93 &lt; 211 &gt; 132 &lt; 212 &gt; DNA &lt; 213 &gt; HPV74 cgcaccaaca tcttttatca tgctagcagt tctagactac ttgctgtagg aaatccctat 60 ttccctataa aacaggttaa caaaacagtt gttcctaaag tgtctggata tcaatttagg 120 gtgtttaagg tg 132 &lt; 210 &gt; 94 &lt; 211 &gt; 141 &lt; 212 &gt; DNA &lt; 213 &gt; HPV81 &lt; 400 &gt; 94 60 120 141 cgcaccaacc ttttttatta tgggggcagt tcccgccttc ttactgtagg gcatccatat tgtacattaa ctattggtac ccaaggaaag cgttccacta ttcccaaggt gtctgggtat cagtaccggg tgtttcgtgt g &lt; 210 &gt; 95 &lt; 211 &gt; 135 &lt; 212 &gt; DNA &lt; 213 &gt; HPV82 &lt; 400 &gt; 95 60 120 135 cgcaccggca tatattatta tgcaggcagt tccagactta ttaccttagg acatccatat ttttcaatac ccaaaaccaa tacacgtgct gaaataccta aggtatctgc ctttcagtat agggtgttta gggta &lt; 210 &gt; 96 &lt; 211 &gt; 141 &lt; 212 &gt; DNA &lt; 213 &gt; HPV83 &lt; 4 0 0 &gt; 96 60 120 141 cgcaccaacc tcttttatta cggtggcagc tccagacttc ttaccgtagg acatccatat tatcctgtac aggttaatgg tcaaggaaaa aaagccacta tccccaaggt ttctggctac caatataggg tgtttcgcat t &lt; 210 &gt; 97 &lt; 211 &gt; 150 &lt; 212 &gt; DNA &lt; 213 &gt; HPV84 60 120 150 cgcaccaact tattttatta tggtggtagt tctcgcctgc ttactgtggg acatccatat tattctgttc ctgtgtctac ccctgggcaa aacaacaaaa aggccactat ccccaaggtt tctgggtatc aatacagggt gtttagggtc &lt; 210 &gt; 98 &lt; 211 &gt; 138 &lt; 212 &gt; DNA &lt; 213 &gt; HPV85 &lt; 400 &gt; 98 90 90 60 120 138 cgtaccagta cattttatca tgctggcagc tctaggcttc taaccgttgg acatccatac tataaagtta cctcaaatgg aggccgcaag caagacattc ctaaagtgtc tgcctatcag tatcgagtgt ttcgggtt &lt; 210 &gt; 99 &lt; 211 &gt; 153 &lt; 212 &gt; DNA &lt; 213 &gt; HPV86 &lt; 400 &gt; 99 60 120 153 cgtaccaacc tattttatta tggtggtagt tcccgcttgc ttactgtggg ccatccatat tatcctgtta ctgtttcctc cagccctgga caaaacaaca aaaaggccaa tattcccaag gtttcggggt atcaatacag ggtttttagg gtg &lt; 210 &gt; 100 &lt; 211 &gt; 147 &lt; 212 &gt; DNA &lt; 213 &gt; HPV87 &lt; 400 &gt; 100 60 120 147 cgcaccaact tattttatta tggtggcagt tctcgcctgc ttactgtggg tcacccttac tatccagtta ctgttaccac ccctggtcag aacaagaaat ccaatattcc aaaggtgtct ggctatcagt acagggtgtt tcgggtg &lt; 210 &gt; 101 &lt; 211 &gt; 141 &lt; 212 &gt; DNA &lt; 213 &gt; HPV89 60 120 cgtaccaacc tgtactatta tggaggcagc tcccgcctta ttacagttgg ccacccttat tatactgtac aggtcaatgg tgctaacaaa aaggccaaca tacctaaggt atcagggtat caatacaggg tatttagggt a &lt; 210 &gt; 102 &lt; 211 &gt; 141 &lt; 212 &gt; DNA &lt; 213 &gt; HPV90 &lt; 400 &gt; 102 141 91 agaacaaaca tatattatta tgcaggcagt tcccgactgt taactgttgg ccatccttat 60 tttgctatca aaaagcaatc aggaaaaaac cctatagtgg ttcccaaggt gtctggatat 120 caatataggg tgtttagggt a 141 &lt; 210 &gt; 103 &lt; 211 &gt; 135 &lt; 212 &gt; DNA &lt; 213 &gt; HPV91 &lt; 400 &gt; 103 cgcaccaact tattttacca tgctggcagt tcccgtttac tggctgtggg ccaccctttt 60 tttcctataa aaaataattc tggtaaagta attgttccta aagtttcagg tcaccaatat 120 agggtgttta gagtt 135 &lt; 210 &gt; 104 &lt; 211 &gt; 140 &lt; 212 &gt; DNA &lt; 213 &gt; HPV-IC &lt; 400 &gt; 104 cggacgaatg tttattacca gatagataga gatagatacc catatacaga taatgacata 60 gatccccata gacagtttat acagatcagt agcagttttt atatatgaga tgatgatagc 120 aatacagagt atttagggta 140 &lt; 210 &gt; 105 &lt; 211 &gt; 25

&lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 220 &gt; &lt; 223 &gt; Probe &lt; 400 &gt; 105 aaaacagttg taccaaaggt gtctg ??? 26 &lt; 210 &gt; 106 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 0 &gt; 92

&lt; 223 &gt; Probe &lt; 4 0 0 &gt; 106 caaaaaggcc aaataagaca &lt; 210 &gt; 107 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 107 cccccttaaa aattcctct 19 &lt; 210 &gt; 108 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 22 3 &gt; Probe &lt; 40 &gt; 108 atacgaccag caaacaagac &lt; 210 &gt; 109 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 109 tatgaatggt ggtcgcaag 19 &lt; 210 &gt; 110 &lt; 211 &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial 93 &lt; 22 &gt; &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 110 aaaacaccag tagtgctaat g &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 111 ccaaaaaa cattcccaa 1 &lt; 210 &gt; 112 &lt; 211: &gt; 24 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 112 atccatattt taaagtacct aaag &lt; 2 1 0 &gt; 113 &lt; 211: &gt; 21 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 220 &gt; &lt; 223 &gt; Probe &lt; 400 &gt; 113 caaatctggt accaaaacaa a &lt; 210 &gt; 114 &lt; 211: &gt; 24 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 223 &gt; Probe 94 &lt; 4 0 0 &gt; 114 cccatagaca gtttatacag atca &lt; 210 &gt; 115 &lt; 211 &gt; 19 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 22 3 &gt; Probe &lt; 400 &gt; 115 ataaaacggg ctaacaaaa 1 &lt; 210 &gt; 116 &lt; 211: &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 3 &gt; Probe &lt; 400 &gt; 116 tacctaaaac tggccaaaag 5 &lt; 210 &gt; 117 <211: &gt; 26 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial &lt; 22 0 &gt; &lt; 223 &gt; Probe &lt; 4 0 0 &gt; 117 attctaataa aatagcagta cccaag 26 95

REFERENCES CITED IN DESCRIPTION

This list of references cited by the applicant is for the reader's convenience only. It is not part of the European patent document. Despite the careful compilation of references, errors or omissions can not be excluded and the IEP rejects all responsibility in this regard.

Patent documents cited in the disclosure:

us 4. 683. 195 A us 4. 683. 202 A us 5. 447. 839 A 4. 849. 332 A us 5. 705. 627 A us 5. 364. 758 A 4. 9 9 6. 143 A us 5 565 322 A us 5. 849. 489 A US 6. 162. 603 A wo 84 0328 5 A us 4. 980. 460 A 4. 725. 677 A us 4. 415. 732 A 4. 458. 066 A 4. 973. 679 A wo 9. 746. 707 A wo 9. 746. 714 A wo 9. 746. 712 A US 60 .737 .00 (; B

GB 0523250 A 96

Literature, not related to patents, cited in the description: • deVilliers. J. Virology, 1989, vol. 63, 4898-4903 Kleter, B. et al. Am. J. of Pathology, 1998, vol. 153 (6), 1731-39 • Tsourkasetal. Briefings in functional genomics and proteomics, 2003, vol. I (4), 372-384 • PCR Protocols. Academic Press, 1989 • Sambrooketal. Molecular Cloning. Cold Spring Har-bour Laboratory, 1989 • Gut et al. Virol. Methods, 1999, vol. 77 (1), 37-46 • Yajima et al. Clin. Chem, 1998, vol. 44 (12), 2441-2445 Martell et al. J. Clin. Microbiol., 1999, vol. 37 (2), 327-332 • Predhomme et al. Leukemia, 1999, vol. 13 (6), 957-964 Ozaki et al. Nuc. Acids Res., 1992, vol. 20, 5205-5214 Agrawal et al. Nuc. Acids Res., 1990, vol. 18, 5419-5423 • Beaucage; Iyer. Tetrahedron, 1992, vol. 48, 2223-2311 Karlin; Altschul. Proc. Natl. Acad. Know. USA, 1990, vol. 87, 2264-2268 Karlin; Altschul. Proc. Natl. Acad. Know. USA, 1993, vol. 90, 5873-5877 • Altschul et al. J. Mol. Biol, 1990, vol. 215, 403-410 25, 97 vol vol • Altschul et al. Nucleic Acids Res., 1997, 3389-3402 • Myers; Miller. CABIOS, 1989 • Torellis; Robotti. Compu. Appl. Biosci., 10, 3-5 • Pearson; Lipman. Proc. Natl. Acad. Sci., 85, 2444-8 vol. 1994, 1988,

Lisbon, 10/05/2010

Claims (40)

A method of detecting the presence of at least one pathogen comprising contacting a nucleic acid obtained from a sample with a kit comprising at least four probes, wherein each of said probes includes a sequence complementary to a pathogenic sequence flanked by four complementary base pairs, said bases pairing together forming a stem structure in the absence of hybridization with a nucleic acid of the pathogen, wherein said probe is labeled with a first interactive marker and a second interactive marker, such that hybridization of said probe with a nucleic acid of said pathogen causes a change in the detected signal. A method as claimed in claim 1, wherein the first interactive marker and the second interactive marker referred to are a FRET donor and a FRET acceptor. A method as claimed in claim 2, wherein the FRET receptor is a quencher. A method as claimed in any one of claims 1 to 3, wherein said complementary sequence of a sequence of a pathogen is attached to the complementary base pair (s) 2 at both ends by binding sequences. A method as claimed in any one of claims 1 to 4, wherein said complementary base pairs include C-G pairs. A method as claimed in claim 5, wherein said probe includes the sequence 3 '- CGCG-F - single sequence for the pathogen -F'- CGCG -5' where F 'and F' are sequences options. A method as claimed in any one of claims 1 to 6, wherein the unique sequence for the pathogen present in the probe contains at least one mismatch with the genomic sequence of the pathogen. A method as claimed in any one of claims 1 to 7, wherein each of said probes can be distinguished from each of the other mentioned probes. A method as claimed in any one of claims 1 to 8, wherein each of said probes is attached to a solid support at a defined site. 3 A method as claimed in any one of claims 1 to 9, wherein said probe group includes at least 10, at least 15 or at least 20 probes. A method as claimed in any one of claims 1 to 10, wherein said method further comprises determining the melt temperature of the double-stranded nucleic acid molecule formed by one of said probes and complementary nucleic acid obtained from of said sample. A method as claimed in any one of claims 1 to 11, wherein said nucleic acid obtained from a sample is amplified before being brought into contact with said probe group. A method as claimed in claim 12, wherein said amplification is conducted using the polymerase chain reaction (PCR). The method of claim 12 or claim 13, wherein the production of the amplified nucleic acid is monitored continuously. A method as claimed in any one of claims 12 to 15, wherein said amplified nucleic acid is contacted with the aforementioned probe group after an amplification cycle. 4 A method as claimed in any one of claims 12 to 15, wherein the amplified nucleic acid is contacted with the said probe group after each amplification cycle. A method as claimed in any one of claims 12 to 16, wherein said amplification is conducted in the presence of said probe group. A method as claimed in any one of claims 12 to 17, wherein said method further includes amplifying an internal control. A method as claimed in any one of claims 12 to 18, wherein amplification of contaminating nucleic acid is avoided. A method as claimed in claim 19, wherein said contaminating nucleic acid amplification is prevented by amplification in the presence of uracil. A method as claimed in claim 20 which further includes treating said nucleic acid with uracil DNA glycosylase prior to amplification. A method as claimed in any one of claims 1 to 21, wherein said sample is selected from bronchial aspirates, urine, liquid obtained by prostatic massage, ejaculate, cytological samples of blood and the cervix , vulvar, genital, anus, skin or larynx, smears or biopsies. A method as claimed in any one of claims 1 to 22 for detecting an organism associated with sexually transmitted disease. A method as claimed in any one of claims 1 to 23 for detecting the presence of at least one HPV genotype. A method as claimed in claim 24 for detecting high-risk or low-risk HPV genotypes. A method as claimed in claim 24 or claim 25, wherein said probe group includes at least one probe which includes at least one of the sequences selected from SEQ. ID. We. 33 to 52 or SEQ ID NOS. 105-117. A method as claimed in any one of claims 24 to 26, wherein said nucleic acid obtained from said sample is amplified using at least one primer selected from Seq IDs. Nos. 1 to 32. A method as claimed in claim 27, wherein the nucleic acid obtained from said sample is amplified using a primer mix comprising Seq ID. Nos. 1 to 32. A group of probes comprising at least four probes, wherein each of the probes includes a sequence complementary to a sequence of a pathogen flanked by four complementary base pairs, wherein said bases pair to form a in the absence of hybridization with a pathogenic nucleic acid, wherein the probe is labeled by a first interactive marker and a second interactive marker such that hybridization of said probe with a nucleic acid of said pathogen causes a change in the signal detected. The set of probes as claimed in claim 29, wherein the first interactive marker and the second interactive marker referred to are a FRET donor and a FRET receptor. The set of probes as claimed in claim 30, wherein the FRET receptor is a quencher. The set of probes as claimed in any one of claims 29 to 31, wherein said complementary sequence of a sequence of a pathogen is linked to the complementary base pair (s) in both the ends by binding sequences. The group of probes as claimed in any one of claims 29 to 32, wherein said complementary base pairs include C-G pairs. The set of probes as claimed in claim 23, wherein each of said probes includes a sequence. 3 '- CGCG-F - single sequence for the pathogen -F' -CGCG -5 'where F' and F 'are optional binding sequences. The group of probes as claimed in any one of claims 29 to 34, wherein the unique sequence for the pathogen present in the probe contains at least one mismatch with the genomic sequence of the pathogen. The group of probes as claimed in any one of claims 29 to 35, wherein each of said probes can be distinguished from each of the other said probes. The array of probes as claimed in any one of claims 29 to 36, wherein each of said probes is attached to a solid support at a defined site. The group of probes as claimed in any one of claims 29 to 37, wherein said pathogen is an organism associated with a sexually transmitted disease. The group of probes as claimed in claim 38, wherein said organism is a virus. 40. The group of probes as claimed in claim 39, wherein said virus is a human papillomavirus. The set of probes as claimed in claim 40, wherein each of said probes includes a sequence that is complementary to an HPV genotype. The set of probes as claimed in claim 41, wherein each of said probes includes a sequence that is complementary to a high-risk HPV genotype. The set of probes as claimed in claim 41, wherein each of said probes includes a sequence that is complementary to a low-risk HPV genotype. The group of probes as claimed in any one of claims 40 to 43, wherein said probe group includes at least one probe which includes one of the sequences selected from SEQ ID NOs. 33 to 52 or SEQ ID NOS. 105-117. The group of probes of claim 44, wherein each probe of said probe group includes a sequence selected from SEQ ID NOs. 33 to 52 or SEQ ID NOS. 105-117. The group of probes of claim 44 or claim 45, wherein each probe of said probe group includes a sequence selected from SEQ ID NOs. 33 to 52. A kit for detecting one or more pathogens comprising a group of probes as claimed in any one of claims 29 to 46. A kit as claimed in claim 47, wherein said pathogen is an organism associated with sexually transmitted disease. A kit for detecting one or more HPV genotypes which includes a group of probes as claimed in any one of claims 29 to 46. The kit as claimed in any one of claims 47 to 49 further including an internal control. The method of claim 13, further including the heating step to approximately 55øC for about 5 minutes prior to amplification. Lisbon, 10/05/2010