PT1481075E - L-threonine-producing bacteria and a process for preparing l-threonine - Google Patents

Description

1

DESCRIPTION

" AMINO ACID PRODUCING BACTERIA AND A PROCESS FOR PREPARING L-AMINO ACIDS " The invention relates to L-threonine producing bacteria of the species Escherichia coli, which contain an amber-type stop codon in the nucleotide sequence of the coding region of the rpoS gene and the corresponding stop codon suppressor, supber amber suppressor. This invention also relates to a process for preparing L-threonine using these bacteria.

TECHNICAL BACKGROUND

L-amino acids, in particular L-threonine, are used in human medicine and the pharmaceutical industry, in the food industry and particularly in feed.

It is known that L-amino acids are prepared by fermentation of Enterobacteriaceae strains, in particular Escherichia coli (E. coli) and Serratia marcescens. Improvements in preparation methods are always being sought because of the great importance of this process. Process improvements may relate to technological measures of fermentation such as, for example, agitation and oxygen supply, or to the composition of the nutrient media such as for example the concentration of sugar during fermentation, or to obtain the product form through for example ion exchange chromatography, or the intrinsic performance characteristics of the microorganism itself. 2

To improve the performance characteristics of these microorganisms, methods of mutagenesis, selection and selection of mutant are used. In this way, strains are obtained which are resistant to antimetabolites such as for example the analog of the threonine α-amino-β-hydroxyvaleric acid (AHV) or which are autotrophic for important regulatory metabolites and produce L-amino acids such as for example L-threonine .

Recombinant DNA engineering methods have also been used for several years for the enhancement of the L-amino acid producing strains of the Enterobacteriaceae family by individual amplification of the amino acid biosynthesis genes and testing for effects on production. The rpoS gene, which is known as the katF gene, encodes a protein that is called the o38 factor or the o35 factor, the o38 protein or the σ38 subunit or also the RpoS protein. The following names for the rpoS gene are also found in the literature, although less commonly: abrD, dpeB, appR, sigS, otsX and snrA. The factor as a RNA polymerase subunit controls the expression of a wide variety of different gene groups (Loewen et al., Canadian Journal of Microbiology 44 (8): 707-717 (1998)), where the mechanisms are often unclear.

Data on the nucleotide sequence of the rpoS or katF gene can be found in Mulvey and Loewen (Nucleic Acids Research 17 (23): 9979-9991 (1989)) and in Blattner et al. (Science 277: 1453-1462 (1997)). Corresponding data can also be found in the National Center for Biotechnology Information (NCBI) of the National Library of Medicine (Bethesda, MD, USA) under the registration numbers 3 Χ16400 and AE000358. The initiation of the translation or initiation codon of the rpoS gene were determined by Loewen et al. (Journal of Bacteriology 175 (7): 2150-2153 (1993)).

In addition, various rpoS alleles are known in Escherichia coli strains, for example in W3110-type strains (Ivanova et al., Nucleic Acids Research 20 (20): 5479-5480 (1992) and Jishage and Ishihama; Bacteriology 179 (3): 959-963 (1997)).

In WO 01/05939 it is shown that, after completely turning off the σ38 factor by incorporating a deletion into the rpoS gene of an L-glutamic acid producer, the production of glutamic acid is improved.

Nagano et al. (Bioscience Biotechnology and Biochemistry 64 (9): 2012-2017 (2000)) report an Escherichia coli strain W3110 and L-lysine-producing mutants W196 which both contain an rpoS allele which contains an amber stop codon (TAG ) at the point corresponding to position 33 in the amino acid sequence of the σ38 protein. Strain W196 also contains a mutation in the gene being a gene encoding L-serine tRNA which is called supD.

Description of the invention

Where amino acids or L-amino acids are mentioned below, this is meant to cover all proteinogenic amino acids with the exception of L-lysine. This in particular means L-threonine, L-isoleucine, L-homoserine, L-methionine, L-glutamic acid, L-valine and L-tryptophan, wherein L-threonine is preferred. " Proteinogenic amino acids " are understood to be those amino acids which are constituents of proteins. 4

These include the amino acids L-glycine, L-alanine, L-valine, L-leucine, L-isoleucine, L-serine, L-threonine, L-cysteine, L-methionine, L-proline, L-phenylalanine, L- tyrosine, L-tryptophan, L-asparagine, L-glutamine, L-aspartic acid, L-glutamic acid, L-arginine, L-lysine, L-histidine and L-selenocysteine. The invention provides L-threonine producing bacteria of the species Escherichia coli which are resistant to α-amino-β-hydroxyvaleric acid (= AHV) and which 1) contain an amber-like stop codon in the nucleotide sequence of the coding region of the rpoS gene and 2) contain the corresponding suppressor for the amE suppressor termination codon supE wherein the amber termination codon is within the coding region of the rpoS gene corresponding to position 33 in the amino acid sequence of the RpoS protein, according to SEQ ID No. 2.

The bacteria provided by the present invention can produce L-threonine from glucose, sucrose, lactose, fructose, maltose, molasses, optionally starch, optionally cellulose or from glycerin and ethanol. They are representative of the family Enterobacteriaceae, chosen from the species Escherichia coli.

The threonine producing bacteria provided by the present invention may, among others, optionally produce L-lysine as a byproduct in addition to the desired L-amino acid. The bacteria according to the invention produce at most 0 to 40% or 0 to 20%, preferably at most 0 to 10%, particularly preferably at most 0 to 5% L-lysine as compared to the amount of L-amino acid desired . This percentage data corresponds to percent by weight. 5

The L-threonine producing strains of the family Enterobacteriaceae preferably have, inter alia, one or more of the genetic or phenotypic characteristics selected from the group: resistance to Î ± -amino-β-hydroxyvaleric acid, resistance to thialisin, resistance to ethionine, resistance α-methylserine, diaminosuccinic acid resistance, α-aminobutyric acid resistance, borrelidine resistance, rifampicin resistance, resistance to valine analogs such as, for example, valine hydroxamate, resistance to purine analogues such as, for example , 6-dimethylaminopurine, a need for L-methionine, optionally partial and compensable need of L-isoleucine, a need for meso-diaminopimmemic acid, auxotrophy with respect to dipeptides containing threonine, L-threonine resistance, L-homoserine resistance, resistance to L-lysine, resistance to L-methionine, resistance to L-glutamic acid, resistance to L- aspartate, resistance to L-leucine, resistance to L-phenylalanine, resistance to L-serine, resistance to L-cysteine, resistance to L-valine, sensitivity to fluoropyruvate, defective threonine dehydrogenase, optionally a capacity for the use of sucrose, improvement of threonine operon, improvement of homoserine dehydrogenase I-aspartate kinase I preferably resistant feed-back form, homoserine kinase improvement, threonine synthase improvement, aspartate kinase improvement, optionally resistant feed-back form, aspartate semialdehyde dehydrogenase improvement, phosphoenolpyruvate carboxylase enhancement, optionally resistant feed-back form, improvement of phosphoenolpyruvate synthase, improvement of transhydrogenase, improvement of RhtB gene product, improvement of RhtC gene product, improvement of YfiK gene product, improvement of a pyruvate carboxylase, and attenuation of the formation of acetic acid.

An amber termination codon is understood to be a stop codon with the base sequence TAG in the coding strand in a DNA molecule corresponding to UAG in the mRNA read by this DNA molecule.

An ocher termination codon according to the description is understood to be a stop codon having the base sequence TAA in the coding strand in a DNA molecule corresponding to UAA in the mRNA read by this DNA molecule.

An opal termination codon according to the disclosure is understood to be a stop codon having the base sequence TGA in a coding strand on a DNA molecule corresponding to UGA in the mRNA read by this DNA molecule.

The mentioned stop codons are also called nonsense mutations (Edward A. Birge: Bacterial and Bacteriophage Genetics (Third Edition), Springer Verlag, Berlin, Germany, 1994). The nucleotide sequence for the rpoS gene can be obtained from the prior art. The nucleotide sequence of the rpoS gene corresponding to the Registration No. AE000358 is given as SEQ ID NO. 1. The amino acid sequence of the relevant RpoS gene product or protein is given in SEQ ID NO. 2. The nucleotide sequence for an rpoS allele which contains an amber-type stop codon at the point in the nucleotide sequence corresponding to the 33-position in the 7 amino acid sequence of the rpoS gene product or protein corresponding to SEQ ID NO. 1 and SEQ ID NO. 2 respectively, is given in SEQ ID NO. 3. The concentration of σ38 factor can be determined by the method of " Western blot " quantitative study as described in Jishage and Ishima (Journal of Bacteriology 177 (23): 6832-6835 (1995)), Jishage et al. (Journal of Bacteriology 178 (18): 5447-5451 (1996)) and Jishage and Ishima (Journal of Bacteriology 179 (3): 959-963 (1997)). Deletion is generally understood to be the effect where the effects of the mutation in a " first " gene are offset or suppressed by a mutation in a " second " gene. The second mutated gene or the second mutation is generally called a suppressor or suppressor gene.

A special case of suppressors relates to tRNA gene alleles that encode the abnormal tRNA molecules that can recognize termination codons so that the incorporation of an amino acid occurs instead of the termination of the strand during translation. Extensive explanations of deletion can be found in genetic textbooks such as, for example, the textbook of Rolf Knippers " Molekulare Genetik " (6th edition, Georg Thieme Verlag, Stuttgart, Germany, 1995) or the Ernst-L textbook. Winnacker " Gene und Klone, Einfhrung in die Gentechnologie " (Dritter, altered reprint, VCH Verlagsgesellschaft, Weinheim, Germany, 1990) or the textbook by F. C. Neidhard (Ed.) Escherichia coli and Salmonella, Cellular and Molecular Biology " (2nd Edition, ASM Press, Washington, D.C., USA, 1996). The suppression listed in Tables 1, 2 and 3 are, among others, tRNA genes or suppressor alleles or tRNAs known in the prior art that can suppress amber, ocher or opal terminus codons and are therefore called amber suppressors, ocher suppressors or suppressors opal. Names for the particular genes or alleles and suppressors were formed from references cited.

Table 1

List of amber suppressors

Name of the gene / allele suppressor Name of the tRNA Amino acid incorporated Ref. SupD (= Sul) Serine tRNA 2 Ser 1 supE Glutamine tRNA2 Gin 1 supF Tyrosine tRNA 1 Tyr 1 supP (= Su6) Leucine tRNA 5 Leu 1 supU (= su7) Tryptophan tRNA Trp 1 supZ Tyrosine tRNA 2 Tyr 1 t-RNAftspCUA Asp tRNA (CUA) Lys, Ala, Gin, Arg 2 tRNAPheCUA Phenylalanine tRNA Phe 3 tRNACysCUA Cysteine tRNA Cys 3 suIII + amber Tyrosine tRNA 1 Tyr 4 Su +271 Gln / Trp tRNA Gin 5 ARG Arginine tRNA Arg, Lys 6 ARGII Arginine tRNA Arg, Gin 6 LysA2 0 Lysine tRNA Lys 6 trpT175 Tryptophan tRNA Gin 7 Su7 9 (= trpT17 9) Tryptophan tRNA Trp 8 tRNACysCUA Cysteine tRNA Cys 9 t -RNAAsnCUA Asparagine tRNA Gin 10 Ala2 Alanine tRNA Ala 11 Cys Cysteine tRNA Lys 11 ProH Proline tRNA Pro 11 HisA Histidine tRNA His 11 Gly2 Glycine tRNA Gly, Gin 11 Glyl Glycine tRNA Gly 11 Ilel Isoleucine tRNA Gin, Lys 11 Met (f) Methionine tRNA Lys 11 Ile2 Isoleucine tRNA Lys 11 AspM Asparagine tRNA Lys 11 Arg Arginine tRNA Lys, Ar g 11 Thr2 Thr2 Threonine tRNA Lys, Thr 11 Val Valine tRNA Lys, Val 11 GluA Glutamic acid tRNA Glu, Gin, Tyr, Arg 11 ECF Phenylalanine tRNA Phe 12 ECF9 Phenylalanine tRNA Phe 12 ECF5-2 Phenylalanine tRNA Phe, Thr, Tyr 12 ECF10 Phenylalanine tRNA Phe 12 ECF602 Phenylalanine tRNA Phe 12 ECF60 Phenylalanine tRNA Phe 12 ECF60 Phenylalanine tRNA Phe 12 ECF60 Phenylalanine tRNA Phe 12 ECF60 Phenylalanine tRNA Phe 12 ECF406 Phenylalanine tRNA Phe 12 ECF606 Phenylalanine tRNA Phe 12 ECF60 Phenylalanine tRNA Phe 12 ECF403G45 Phenylalanine tRNA Lys 12 ECF5 Phenylalanine tRNA Phe 12 ECFG73 Phenylalanine tRNA Phe, Gin 12

References (Ref.) To Table 1: 1) Neidhard (Ed.) &Quot; Escherichia coli and Salmonella,

Cellular and Molecular Biology " (2nd edition, ASM Press, Washington, DC, USA, 1996) 2) Martin et al, RNA 2 (9): 919-927, 1996 3) Normanly et al, Proceedings of the National Academy of Science USA, 83 (17) ): 6548-6552, 1986 4) Registration number K01197 5) Yarus et al, Proceedings of the National Academy of Science USA, 77 (9): 5092-5096, 1990 6) McClain et al, Proceedings of the National Academy of Science USA, 87 (23): 9260-9264,1990 7) Raftery et al, Journal of Bacteriology 158 (3): 849-859, 1984 8) Raftery et al, Journal of Molecular Biology 190 (3): 513-517 , 1986) 9) Komatsoulis und Abelson, Biochemistry 32 (29): 7435-7444, 1993 10) Martin et al, Nucleic Acids Research 23 (5): 779-784, 1995 11) Normanly et al, Journal of Molecular Biology 213 ( 4): 719-726, 1990 12) McClain and Foss, Journal of Molecular Biology, 202 (4): 697-709, 1988

Table 2

List of ocher suppressors according to the description

Gene name / suppressor allele Name of tRNA Amino acid incorporated Ref. SupB Glutamine tRNA 1 Gin 1 supC Tyrosine tRNA 1 Tyr 1 supD Serine tRNA 3 Ser 1 supG (= supL, supN) Lysine tRNA Lys 1 supM (= supB15) Tyrosine tRNA 2 Tyr 1 supU (= su8) Tryptophan tRNA Trp 1 supV Tryptophan tRNA Trp 1 tRNAt ± u-Suoc2 05 Glutamic acid tRNA Glu 2 suIII + ocher Tyrosine tRNA 1 Tyr 3 trpT177 Tryptophan tRNA Gin 4 Su7 9 (= trpT17 9) Tryptophan tRNA Trp 5 References (Ref.) To Table 2: 1) Neidhard (Ed.) &Quot; Escherichia coli and Salmonella, Cellular and Molecular Biology " (2nd edition, ASM Press, Washington, DC, USA, 1996) 2) Raftery und Yarus, EMBO Journal 6 (5): 1499-1506, 1987 3) Registration number K01197 4) Raftery et al, Journal of Bacteriology 158 3): 849-859, 1984 5) Raftery et al, Journal of Molecular Biology 190 (3): 513-517, 1986 10

Table 3

List of opal suppressors according to the description

Gene name / suppressor allele Name of tRNA Amino acid embedded Ref. SupT Glycine tRNA 1 Gly 1 sumA Glycine tRNA 2 Gly 1 ims, mutA Glycine tRNA 3 Gly 1 supU (= su9) Tryptophan tRNA Trp 1 selC Serine tRNA Selenocysteine 2 GLNA3U7 0 Glutamine tRNA Gin 3 trpT17 6 Tryptophan tRNA Trp 4 ARG Arginine tRNA Arg 5 ARGII Arginine tRNA Arg 5 LysA20 Lysine tRNA Arg 5 Neidhard (Ed.) From Table 3: Escherichia coli and Salmonella, Cellular and Molecular Biology " (2nd edition, ASM Press, Washington, DC, USA, 1996) 2) Schon et al., Nucleic Acids Research 17 (18: 7159-7165, 1989) Weygand-Durasevic et al., Journal of Molecular Biology 240 (2): 111-118, 1994 4) Raftery et al, Journal of Bacteriology 158 (3): 849-859, 1984 5) McClain et al, Proceedings of the National Science USA, 87 (23): 9260-9264, 1990 Academy of

In a first aspect of the invention, the L-threonine producing bacteria of the Escherichia coli species which are AHV resistant and which contain an amber-type stop codon have been found to be further improved in their potential to produce amino acids when a suppressor tRNA of the amber suppressor is incorporated herein, wherein the amber-type stop codon remains within the coding region of the rpoS gene corresponding to position 33 in the amino acid sequence of the RpoS protein, according to SEQ ID No.2.

As a result of the measurements according to the invention, the activity or concentration of the RpoS protein or σ38 factor is generally decreased to > 0 to 75%, for example 1 to 75%, to > 0 to 50%, for example 0.5 to 50%, to > 0 to 25% for example 0.25 to 25%, to > 0 to 10%, for example 0.1 to 10%, or to > 0 to 5%, for example 0.05 to 5% of the activity or concentration of the wild type protein, or 11 of the activity or concentration of the protein in the starting microorganism. The presence of the mentioned suppressor (s) prevents the activity of RpoS proteins or σ38 factor falling down to 0.

Accordingly, the invention provides a process for decreasing the intracellular activity or concentration of RpoS proteins or σ38 factor in Escherichia coli L-threonine producing bacteria which are resistant to AHV and, in which in these bacteria 1) a stop codon amber type is incorporated into the coding region of the rpoS gene, and 2) the corresponding suppressor tRNA gene (s) or allele (s) encoding the SupE amber suppressor tRNA is / are incorporated (s) in these bacteria wherein the amber-type stop codon is within the coding region of the rpoS gene corresponding to position 33 in the amino acid sequence of the RpoS protein, according to SEQ ID No. 2. The invention also provides a process for preparing L-threonine producing bacteria of the species Escherichia coli which are resistant to AHV and in which in these bacteria 1) an amber type stop codon is incorporated into the coding region that of the rpoS gene and that 2) a DSup E amber suppressor tRNA is incorporated into these bacteria in which the amber stop codon is within the coding region of the rpoS gene corresponding to position 33 in the amino acid sequence of the RpoS protein, according to SEQ ID No. 2.

Finally, the invention provides L-threonine producing bacteria of the species Escherichia coli, which are AHV resistant and contain an amber-type stop codon in the coding region of the rpoS gene, and contains the corresponding suppressor tRNA sup E, in that the amber termination codon is within the coding region of the rpoS gene corresponding to position 33 in the amino acid sequence of the RpoS protein, according to SEQ ID No. 2.

With respect to the coding region of the rpoS gene, the following segments proved to be particularly advantageous for the incorporation of a termination codon chosen from the amber, ocher and opal group, preferably amber: • segment of the coding region between positions 2 and 95, for example position 33, corresponding to the amino acid sequence of the RpoS protein, given in SEQ ID No. 1 or SEQ ID No. 2, segment of the coding region between positions 99 and 168, for example position 148, corresponding to amino acid sequence of the RpoS protein given in SEQ ID No. 1 or SEQ ID No. 2, segment of the coding region between positions 190 and 245 corresponding to the amino acid sequence of the RpoS protein given in SEQ ID No. 1 or SEQ ID No. 2, segment of the coding region between positions 266 and 281, for example position 270 corresponding to the amino acid sequence of RpoS protein, given in SEQ ID No. 1 SEQ ID No. 2, and segment of the coding region between positions 287 and 314, for example position 304, corresponding to 13

amino acid sequence of the RpoS protein given in SEQ ID No. 1 or SEQ ID No. 2.

According to the description in the event that the coding region of the rpoS gene has an amber-type stop codon, an amber suppressor chosen from the group of Table 1 is preferably used.

According to the disclosure in the event that the coding region of the rpoS gene has an ocher-type stop codon, an ocher suppressor selected from the group of Table 2 is preferably used.

According to the description in the case where the coding region of the rpoS gene has an opal termination codon, an opal suppressor chosen from the group of Table 3 is preferably used.

Depending on the suppressor used, the bacterium forms a RpoS gene product or σ38 factor which contains, at position 33 of the amino acid sequence according to SEQ ID NO. 2, instead of L-glutamine, an amino acid chosen from the group L-serine, L-tyrosine, L-leucine, L-tryptophan, L-lysine, L-alanine, L-arginine, L-phenylalanine, L- cysteine, L-proline, L-histidine, L-threonine and L-valine. Thus, for example when suppressor supD is used, L-serine is incorporated in place of L-glutamine. When suppressors incorporating the amino acid L-glutamine at position 33 of the rpoS gene product or factor o38, such as for example supE, the amino acid sequence is not altered.

The L-threonine producing bacteria of the Escherichia coli species containing the rpoS allele given in SEQ ID NO. 14 and the suppressor supE given in SEQ ID NO. 4 are very particularly preferred. The invention also provides, corresponding to this first aspect of the invention, a process for preparing amino acids or food additives containing amino acids in which the following steps are carried out: a) fermentation of bacteria of the Escherichia coli species, which are resistant to α-amino acid -B-hydroxyvaleric acid and which contain 1) within the coding region of the rpoS gene corresponding to position 33 in the amino acid sequence of the RpoS protein according to SEQ ID No. 2 an amber stop codon and 2) the corresponding suppressor of amber supE, in a suitable medium, b) enrichment of L-threonine in the medium or cells of the microorganisms, and c) isolation of L-threonine, when optionally the constituents of the fermentation broth and / or the biomass in its entirety, or a proportion of these (at 0 to 100), remain in the product.

The food additives according to the invention may be further processed in liquid form and also in solid form.

Mutations through which a stop codon is introduced into the rpoS gene reading frame can be produced directly in the relevant host by classical mutagenesis methods using mutagenic substances such as, for example, N-methyl-N'-nitro-N -nitrosoguanidine, or ultraviolet light. 15

In addition, in vitro methods using isolated rpoS DNA such as, for example, hydroxylamine treatment can be used for mutagenesis (JH Miller: A Short Course in Bacterial Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1992) . Finally, methods for site-directed mutagenesis using mutagenic oligonucleotides (TA Brown: Gentechnologie fur Einsteiger, Spektrum Akademischer Verlag, Heidelberg, 1993) or the polymerase chain reaction (PCR) can be used, as described in the book by Newton and Graham (PCR, Spektrum Akademischer Verlag, Heidelberg, 1994). Mutations produced can be determined and tested by DNA sequencing, for example using the method of Sanger et al. (Proceedings of the National Academy of Science USA 74 (12): 5463-5467 (1977)).

Suitable mutations can be incorporated into the desired strains with the aid of recombinant processes by means of replacement of genes or alleles. One commonly used method is the method of gene replacement with the aid of a conditional replicant pMAK705 derived from pSClO1 as described by Hamilton et al. (Journal of Bacteriology 171 (9): 4617-4622 (1989)). Other methods described in the prior art such as, for example, the method of Martinez-Morales et al. (Journal of Bacteriology 181 (22): 7143-7148 (1999)) or the method of Boyd et al. (Journal of Bacteriology 182 (3): 842-847 (2000)) can be used. It is also possible to transfer mutations to the desired strains by conjugation or transduction.

Finally, it is possible to use alleles of the rpoS gene known from the prior art which contain a stop codon 16 in the reading frame and introduce these into the desired strains using the methods described above.

The strains obtained by the method described above are preferably mutants, transformants, recombinants, transdutants or transconjugants.

In order to produce suppressor mutations in the tRNA genes, basically the same methods described for the rpoS gene can be used. Methods using oligonucleotide engineering, such as those used, for example, by Khorana (Science 203 (4381): 614-625 (1979)), may also be used. In addition, the suppressor tRNA genes used in the prior art can be used in particular. Methods for screening, characterizing, and determining the efficiency of suppressor tRNAs are described in the prior art, for example in Miller and Albertini (Journal of Molecular Biology 164 (1): 59-71 (1983)), in McClain and Foss (Journal of Molecular Biology 202 (4): 697-709 (1988)), in Normanly et al. (Journal of Molecular Biology 213 (4): 719-726 (1990)) in Kleina et al. (Journal of Molecular Biology 213: 705-717 (1990)) in Lesley et al. (Promega Notes Magazine 46, page 02. (1994)) and in Martin et al. (Nucleic Acids Research 23 (5): 779-784 (1995)).

Furthermore, for the production of L-threonine with bacteria of the species Escherichia coli, it may be advantageous to further incorporate a stop codon into the coding region of the rpoS gene and a corresponding suppressor into a stop codon, to increase one or more enzymes the known step of threonine biosynthesis or enzyme (s) for anaplasthetic metabolism or enzymes for the production of reduced nicotinamide adenine dinucleotide phosphate or enzymes for glycolysis or PTS enzymes or enzymes for sulfur metabolism. The " improvement " in this connection describes an increase in intracellular activity or concentration of one or more enzymes or proteins in a microorganism which are encoded by the corresponding DNA through, for example, increasing the number of copies of the gene or genes using a strong promoter or a gene encoding a corresponding enzyme or protein with higher activity and optionally combining these measures. The use of endogenous genes is generally preferred. " Endogenous genes " or " endogenous nucleotide sequences " are understood to be the genes or nucleotide sequences that are present in the population of a species.

Using the enhancement measures, in particular overexpression, activity or concentration of the corresponding protein is generally increased by at least 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400% or 500%, up to 1000% or 2000%, relative to the wild-type protein or to the activity or concentration of the protein in the starting microorganism.

Thus, for example, one or more genes selected from the following group may be improved, especially over expressed: the thrABC operon encoding aspartate kinase, homoserine dehydrogenase, homoserine kinase and threonine synthase (US-A-4,278,765), 18 • the pcp gene encoding pyruvate carboxylase (DE-A-19 831 609), • the pps gene encoding phosphoenolpyruvate synthase (Molecular and General Genetics 231 (2): 332-336 (1992)), • the ppc gene which encodes phosphoenolpyruvate carboxylase (Gene 31: 279-283 (1984)), the pntA and pntB genes encoding the transhydrogenase (European Journal of Biochemistry 158: 647-653 (1986)), the rhtB gene that confers resistance to homoserine (EP-A-0 994 190), the mqo gene coding for malate: quinone oxidoreductase (DE 100 348 33.5), the threonine resistance rhtC gene (EP-A-1,013,765), gene thrE of Corynebacterium glutamicum encoding the threonine export protein (DE 100 264 94.8), the gdhA gene q encoding glutamate dehydrogenase (Nucleic Acids Research 11: 5257-5266 (1983); Gene 23: 199-209 (1983)), the hns gene encoding the DNA binding protein HLP-II (Molecular and General Genetics 212: 199-202 (1988)), the pgm gene encoding phosphoglucomutase ( Journal of Bacteriology 176: 5847-5851 (1994)), the fba gene encoding fructose bisphosphate aldolase (Biochemical Journal 257: 529-534 (1989)), the pts1 gene of the ptsHIcrr operon, which encodes enzyme I in phosphotransferase system (PTS) (Journal of Biological Chemistry 262: 16241-16253 (1987)), the ptsH gene of the ptsHIcrr operon, which encodes the phosphohistidine hexose phosphotransferase protein in the phosphotransferase system (PTS) (Journal of Biological Chemistry 262: 16241 -16253 (1987)), • the ptsHIcrr operon gene, which encodes the glucose specific component IIA in the phosphotransferase system (PTS) (Journal of Biological Chemistry 262: 16241-16253 (1987)), • the ptsG gene encoding the glucose-specific IIBC component in the phosphotransferase (PTS) system (Journal of Biol Chem. 261: 16398-16403 (1986)), the lrp gene encoding the leucine regulatory regulator (Journal of Biological Chemistry 266: 10768-10774 (1991)), the csrA gene encoding the overall regulator Bacteriology 175: 4744-4755 (1993)), the fadR gene encoding the fad regulatory regulator (Nucleic Acids Research 16: 7995-8009 (1988)), the iclR gene encoding the central intermediate metabolism regulator Journal of Bacteriology 172: 2642-2649 (1990)), the mopB gene encoding the accompanying 10 Kd (Journal of Biological Chemistry 261: 12414-12419 (1986)), which is also known by the name groES, of the ahpCF operon, which encodes the small subunit in the alkyl hydroperoxide reductase (Proceedings of the National Academy of Sciences USA 92: 7617-7621 (1995)) • the ahpF gene of the ahpCF operon, which encodes the broad subunit in alkyl reductase hydroperoxide (Proceedings of the National Academy of Sciences USA 92: 7617-7621 ( 1995)) • the cysK gene encoding cysteine synthase A (Journal of Bacteriology 170: 3150-3157 (1988)) • the cysB gene encoding the cys regulatory regulator (Journal of Biological Chemistry 262: 5999-6005 (1987) ), The cysJ gene of the cysJIH operon, which codes for flavoprotein in NADPH sulfite reductase (Journal of Biological Chemistry 264: 15796-15808 (1989), Journal of Biological Chemistry 264: 15726-15737 (1989)), the cysH gene cysJIH, which codes for adenylylsulfate reductase (Journal of Biological Chemistry 264: 15796-15808 (1989), Journal of

Biological Chemistry 264: 15726-15737 (1989)), and the cysl gene of the cysJIH operon, which codes for haemoprotein in NADPH sulfite reductase (Journal of Biological Chemistry 264: 15796-15808 (1989), Journal of Biological Chemistry 264: 15726- 15737 (1989)).

In addition, it may be advantageous to produce L-threonine with bacteria of the Escherichia coli species, additionally incorporate a stop codon into the coding region of the rpoS gene and the corresponding stop codon suppressor, in particular to attenuate the detachment or reducing the expression of, one or more genes chosen from the following group: the tdh gene encoding threonine dehydrogenase (Ravnikar und Somerville; Journal of Bacteriology 169: 4716-4721 (1987)), the mdh gene encoding to malate dehydrogenase (EC 1.1.1.37) (Vogel et al., Archives in Microbiology 149: 36-42 (1987)), the open reading frame (orf) yjfA (AAC77180 Register Number of the National Center for Biotechnology Information (NCBI, Bethesda, MD, USA)), 21 • the open reading frame (orf) ytfP gene product (National Center for Biotechnology Information Registry (NCBI, Bethesda, MD, USA)); the pckA gene that encodes the enzyme phosphoenolpyruvate carboxykinase (Medina et al. ; Journal of Bacteriology 172: 7151-7156 (1990)), the poxB gene encoding pyruvate oxidase (Grabau und

Cronan; Nucleic Acids Research 14 (13): 5449-5460 (1986)), the aceA gene encoding the enzyme isocitrate lyase (Matsuoko and McFadden, Journal of Bacteriology 170: 4528-4536 (1988)), the dgsA gene encoding the DgsA regulator in the phosphotransferase system (Hosono et al., Bioscience,

Biotechnology and Biochemistry 59: 256-261 (1995)), which is also known by the gene name mlc, and the fruR gene encoding the fructose repressor (Jahreis et al., Molecular and General Genetics 226: 332-336 (1991)), which is also known by the name of gene cra. The " attenuation " in this connection describes the decrease in or withdrawal of intracellular activity or concentration of one or more enzymes or proteins in a microorganism which are encoded by the corresponding DNA, for example using a weak promoter or a gene or allele encoding the corresponding enzyme with a low activity or inactivates the corresponding enzyme, protein or gene and optionally combining these measures.

Using attenuation measures, including decreasing expression, the activity or concentration of the corresponding protein is generally decreased to 0 to 75%, 0 to 50%, 0 to 25%, 0 to 10% or 0 to 5% of the activity or The concentration of the wild type protein, or the activity or concentration of the protein in the starting microorganism.

It has also been demonstrated that in the case of the tdh, mdh, pckA, poxB, aceA, dgsA and fruR genes mentioned above and the open reading frames (ORF) yj fA and ytfP and also for the ugpB genes (gene encoding periplastic binding protein in the transport system sn-glycerin-3-phosphate), aspA (aspartate amine lyase gene), aceB (gene encoding malate synthase A) and aceK (gene encoding the enzyme isocitrate dehydrogenase kinase / phosphatase), the attenuation can be achieved by 1) incorporating a stop codon, chosen from the amber, ocher and opal group, in the coding region of these genes and 2) simultaneously a suppressor for the corresponding stop codon, chosen from amber suppressor group, ocher suppressor and opal suppressor. The use of the amber termination codon and the supE amber suppressor proved to be particularly advantageous. The described methodology can be transferred to any genes whose attenuation or disconnection is understood to be produced.

Microorganisms according to the invention may be cultured in a batch process, a fed batch process or a batch repeat process. A review of known culture methods is given in the Chmiel textbook (Bioprozesstechnik 1. Einfhrung in die Bioverfahrenstechnik (Gustav Fischer Verlag, Stuttgart, 1991)) or the Storhas textbook (Bioreaktoren und periphere Einrichtungen (Vieweg Verlag, Braunschweig / Wiesbaden, 1994)). The culture medium to be used must suitably meet the requirements of the specific strains. Descriptions of the culture medium for different microorganisms are given in the book " Manual of Methods for General Bacteriology " by the American Society for Bacteriology (Washington D. C., USA, 1981).

Carbon sources which may be used are sugar and carbohydrates such as for example glucose, sucrose, lactose, fructose, maltose, molasses, starch and optionally cellulose, oils and fats such as for example soybean oil, sunflower oil, peanut oil and coconut fat, fatty acids such as, for example, palmitic acid, stearic acid and linoleic acid, alcohols such as for example glycerin and ethanol and organic acids such as for example acetic acid. These substances can be used individually or as mixtures.

Sources of nitrogen which may be used are organic nitrogen containing compounds such as peptones, yeast extract, meat extract, malt extract, corn steep liquor, soya bean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. Sources of nitrogen may be used individually or as mixtures.

Sources of phosphorus which may be used are phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts. The culture medium should also contain metal salts, such as for example magnesium sulfate or iron sulfate, which are necessary for growth. Finally essential growth substances such as amino acids 24 and vitamins have to be used in addition to the substances mentioned above. Suitable precursors may also be added to the culture medium. The above-mentioned starting materials may be added to the culture in the form of a single portion or they may be fed appropriately during the culturing.

To control the pH of the culture, basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or ammoniacal water or acidic compounds such as phosphoric acid or sulfuric acid are suitably used. To control the development of foam, antifoam agents such as for example polyglycol fatty acid esters are used. To maintain the stability of the plasmids, suitable selectively acting substances such as for example antibiotics may be added to the medium. In order to maintain aerobic conditions, oxygen or oxygen-containing gas mixtures such as for example air is introduced into the culture. The temperature of the culture is usually 25 ° C to 45 ° C and is preferably 30 ° C to 40 ° C. The culture is maintained until a maximum of L-amino acids is formed. This goal is usually achieved in 10 hours up to 160 hours. Amino acid analysis can be performed using anion exchange chromatography followed by ninhydrin derivatization as described in Spackman et al. (Analytical Chemistry 30: 1190-1206 (1958)), or can be performed using reverse phase HPLC as described in Lindroth et al. (Analytical Chemistry (1979) 51: 1167-1174).

The following microorganisms were deposited as a pure culture on September 9, 2002 in the German Collection 25 of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany) according to the Budapest Treaty: • Escherichia coli DM1690 strain as DSM 15189. strain DSM 15189 contains an amber-type stop codon at the point corresponding to position 33 in the amino acid sequence of the RpoS protein and an amber suppressor and produces threonine. The process according to the invention is used for the fermentative preparation of L-threonine. The present invention is explained in more detail below by making use of working examples.

The minimal (M9) and universal (LB) media for E. coli are described by J. H. Miller (A Short Course in Bacterial Genetics (1992), Cold Spring Harbor Laboratory Press). Isolation of E. coli plasmid DNA and all restriction and Klenow-related techniques and alkaline phosphatase treatment are performed as described by Sambrook et al. (Molecular Cloning, A Laboratory Manual (1989), Cold Spring Harbor Laboratory Press). Transformation of E. coli, unless otherwise described, is performed as described in Chung et al. (Proceedings of the National Academy of Sciences of the United States of America 86: 2172-2175 (1989)). PI transductions are performed as described by Lengeler et al. (Journal of Bacteriology 124: 26-38 (1975)).

Example 1 26

Transduction of the scr gene site in E. coli K12 strain MG1655 The scr regulation in naturally occurring pUR400 plasmids (Schmid et al., Molecular Microbiology 2: 1-8 (1988)) promotes the ability to utilize sucrose as a source of carbon. With the help of plasmid pKJL710 (Ulmke et al., Journal of Bacteriology 181: 1920-1923 (1999)), which contains the scr regulation between the two reverse sequence repeats of Tn1721 transposon (Ubben and Schmitt, Gene 41: 154- 152 (1986)), followed by transformation, transposition, conjugation and transduction, the scr regulatory can be transferred to the chromosome of Escherichia coli K12. A strain called LJ210 contains the scr regulation integrated in the chromosome at position 6 minutes according to Berlyn-Karte. The bacteriophage PI is multiplied in this strain and the E. coli K12 strain MG1655 (Guyer et al., Cold Spring Harbor Symp., Quant. Biology 45: 135-140 (1981)) is infected with the isolated phage lysate. By plating in minimal medium (2 g / L) containing sucrose, MG1655 transdutants are obtained which can use sucrose as a carbon source. The selected clone is given the name MG1655scr.

Example 2

In vivo Mutagenesis of MG1655scr strain From MG1655scr, after incubation at 37øC on minimal agar to which 2 g / L sucrose and 4 g / L DL-β-hydroxynorvaline (Sigma, Deisenhofen, Germany) were added, are isolated spontaneous mutants that are resistant to Î ± -amino-β-hydroxyvaleric acid (AHV) analogue of threonine. The selected mutant is given the name MG1655scrAHVRI. 27

Example 3

Incorporation of a termination codon mutation into the rpoS gene in MG1655scrAHVR1 by site-specific mutagenesis 3.1 Cloning of the rpoS gene from MG1655 Escherichia coli strain MG1655 is used as a chromosomal DNA donor. A DNA fragment containing the region of the rpoS gene to be mutated in the middle region is amplified using the polymerase chain reaction (PCR) and the synthetic oligonucleotides. From the rpoS gene sequence (SEQ ID NO: 1) for Escherichia coli K12, the following primer oligonucleotides (MWG Biotech, Ebersberg, Germany) are chosen for PCR: rpoS9 (SEQ ID No. 7) : 5'CAGT TATAGCGGCAGTACC 3 'rpoS4 (SEQ ID No. 8): 5' GGACAGTGTTAACGACCATTCTC 3 'Chromosomal DNA from E. coli K12 is isolated according to the manufacturer's data using " Qiagen Genomic-tips 100 / G " (Qiagen, Hilden, Germany). DNA fragments of approximately 2 kbp in length may be isolated using the specific primers under standard PCR conditions (Innis et al. (1990) PCR Protocols.) A Guide to Methods and

Applications, Academic Press) with vent polymerase (New England Biolabs GmbH, Frankfurt, Germany). The amplified DNA fragment is identified using gel electrophoresis on an agarose gel (0.8%) and purified with the QIAquick PCR Purification Kit (Qiagen, Hilden, 28

Germany). The purified PCR product is ligated according to the manufacturer's data using the pCR-Blunt II-TOPO vector (Zero Blunt TOP PCR Cloning Kit, Invitrogen, Groningen, Holland) and transformed into E. coli TOPIO strain (Invitrogen, Groningen , Holland). Plasmid-containing cell selection is performed on LB agar to which 50 mg / L kanamycin has been added. After isolation of plasmid DNA, the vector is tested using restriction cleavage and agarose gel separation (0.8%). The amplified DNA fragment is tested by sequence analysis. The sequence in the PCR product is in accordance with the sequence given in SEQ ID NO. 9. The plasmid obtained is given the name pCRBluntrpoS9-4. 3.2 Replacement of the codon glutamine with vim amber termination codon by site-specific mutagenesis

Site-directed mutagenesis is performed with the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, USA). The following primer oligonucleotides are chosen for linear amplification: rpoSambarl (SEQ ID No. 10): 5'-GGCCTTAGTAGAA (TAG) GAACCCAGTGATAACG 3 'rpoSambar2 (SEQ ID No. 11): 5'-CGTTATCACTGGGTTC (CTA) TTCTACTAAGGCC 3'

These primers are synthesized by MWG Biotech. The amber terminus codon which is intended to replace glutamine at position 33 in the amino acid sequence is marked with parentheses in the nucleotide sequence shown above. The plasmid pCRBluntrpoS9-4 described in example 3.1 is used with each of the two primers complementary to the filament in the plasmid for linear amplification through PfuTurbo DNA polymerase. A mutated plasmid with broken circular filaments is produced during this elongation of primer. The linear amplification product is treated with DpnI. This endonuclease specifically cuts the methylated and semi-methylated DNA model. The novel splitted, mutated DNA vector is transformed into E. coli XL1 Blue strain (Bullock, Fernandez and Short, BioTechniques 5 (4) 376-379 (1987)). After transformation, XL1 Blue cells repair the breaks in the mutated plasmids. The selection of the transformants is performed in LB medium with 50 mg / L kanamycin. The plasmid obtained is tested after isolation of the DNA by means of restriction cleavage and agarose gel separation (0.8%). The DNA sequence of the mutated DNA fragment is tested by sequence analysis. The sequence is according to the sequence given in SEQ ID NO. 3 in the rpoS gene region. The plasmid obtained is given the name pCRBluntrpoSambar. 3.3 Construction of the pMAK705rpoSamber Replacement Vector The plasmid pCRBluntrpoSambar described in Example 3.2 is cleaved with restriction enzymes BamHI and Xbal (Gibco Life Technologies GmbH, Karlsruhe, Germany). After separation on an agarose gel (0.8%) the approximately 2.1 kbp rpoS fragment containing the mutation is isolated with the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). Plasmid pMAK705 described in Hamilton et al. (Journal of Bacteriology 171: 4617-4622 (1989)) is cleaved with restriction enzymes BamHI and XbaI and ligated with the isolated rpoS fragment (T4-DNA Ligase, Amersham-Pharmacia, Freiburg, Germany). E. coli strain DH5a (Grant et al., Proceedings of the National Academy of Sciences USA 87: 4645-4649 (1990)) is transformed with the binding batch 30 (Hanahan, In. DNA Cloning, A Practical Approach Vol. 1, ILR-Press, Cold Spring Habor, New York, 1989). The selection of cells containing the plasmid is performed by plating the transformation batch into LB agar (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Habor, New York, 1989) which is supplemented with 20 mg / L chloramphenicol. Plasmid DNA is isolated from a transformant using the QIAquick Spin Miniprep Kit from Qiagen and tested for restriction cleavage with the enzymes BamHI, EcoRI, EcoRV, StuI and XbaI followed by agarose gel electrophoresis. The plasmid is given the name pMAK7. A map of the plasmid is shown in Figure 1. 3.4 Site-specific mutagenesis of the rpoS gene of E. coli strain MG1655scrAHVR1

For site-specific mutagenesis of the rpoS gene, strain MG1655scrAHVR1 described in example 2 is transformed with plasmid pMAK705 rpoSambar. Gene replacement is performed using the selection procedure described in Hamilton et al. (Journal of Bacteriology 171: 4617-4622 (1989)). Proof that the rpoSambar allele mutation occurred on the chromosome is performed using LightCycler from Roche Diagnostics (Mannheim, Germany). The LightCycler is a combined instrument consisting of a thermocycler and a fluorometer.

In the first step, a DNA section approximately 0.3 kbp long containing the mutation site is amplified by PCR (Innis et al., PCR Protocols, A Guide to Methods and Applications, 1990, Academic Press) using the following primer oligonucleotides: rpoSLC1 (SEQ ID No. 12): 5'CGGAACCAGGCTTTTGCTTG 3 'rpoSLC2 (SEQ ID No. 13): 5'GCGCGACGCGCAAAATAAAC 3'

In the second phase the presence of the mutation is proved using fusion curve analysis (Lay et al., Clinical Chemistry 43: 2262-2267 (1997)) with two additional oligonucleotides of different lengths and labeled with different fluorescent dyes (LightCycler (LC) -Red640 and fluorescein) which hybridize to a region of the mutation site using the " Fluorescence Resonance Energy Transfer " method. (FRET). rpoSamberC (SEQ ID No. 14): 5'LC-Red640 - CTTAGTAGAACAGGAACCCAGTG - (P) 3 'rpoSamberA (SEQ ID No. 15): 5'GATGAGAACGGAGTTGAGGTTTTTGACGAAAAGG - 3'

Primers presented for PCR are synthesized by MWG Biotech (Ebersberg, Germany) and the oligonucleotides for hybridization are synthesized by TIB MOLBIOL (Berlin, Germany).

Thus, a clone containing a thymidine base is identified instead of a cytosine base at position 952 in a DNA sequence for the PCR product rpoS (SEQ ID No. 9). The triplet thymine adenine guanine base is present at position 97-99 of the rpoS allele coding sequence (SEQ ID No. 3) and encodes an amber termination codon leading to translation termination. This clone is given the name MG1655scrAHVRlrS. 32

Example 4

In vivo selection of an amber mutation suppressor in strain MG1655scrAHVRlrS 4.1 Construction of a vector with an amber stop codon in the Cat gene

For selection of a mutation suppressor, an amber stop codon is incorporated into the cat gene encoding chloramphenicol acetyl transferase and confers resistance to the antibiotic chloramphenicol.

To this end, the Cat gene block is linked to the linearized pTrc99A HindIII vector (both from Pharmacia Biotech, Freiburg, Germany). E. coli strain DH5oc (Grant et al., Proceedings of the National Academy of Sciences USA 87: 4645-4649 (1990)) is transformed with the binding batch (Hanahan, In. DNA Cloning, A Practical Approach Vol 1, ILR-Press, Cold Spring Habor, New York, 1989). The selection of cells containing the plasmid is performed by plating the transformation batch onto LB agar (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Habor, New York, 1989) which is supplemented with 50 mg / L ampicillin. Plasmid DNA is isolated from a transformant using the QIAquick Spin Miniprep Kit from Qiagen and tested by restriction cleavage followed by agarose gel electrophoresis. The plasmid is called pTrc99Acat.

To incorporate an amber stop codon into the cat gene coding region, starting from the sequence for the cat gene, the primers containing the cleavage sites for the restriction enzymes AccIII and MscI are synthesized by MWG Biotech, Ebersberg, Germany. The recognition sites for the restriction enzymes are labeled by underlining the nucleotide sequences shown below. In the first catAccIII, behind the AccIII cleavage site, two ATG codons encoding the amino acid methionine at positions 75 and 77 in the cat protein are changed into the TAG codons. The amber codons are shown in parentheses in the given nucleotide sequences below. catAccIII: 5 'GTCCATATTGGCCACGTTTAAATC 3' (SEQ ID No. 17) Plasmid DNA from vector pTrc99Acat is used for PCR. A DNA fragment of about 300 bp in length can be amplified with the specific primers under standard PCR conditions (Innis et al. (1990) PCR Protocols, A Guide to Methods and Applications, Academic Press) using Pfu DNA polymerase (Promega Corporation, Madison, USA). The PCR product is cleaved with the restriction enzymes AccIII and MscI. The pTrc99Acat vector is also digested with the enzymes AccIII and MscI, gel-separated and a 4.7 kbp fragment length is isolated using the QIAquick Gel Extraction Kit. The two fragments are ligated with T4 DNA ligase (Amersham-Pharmacia, Freiburg, Germany). E. coli strain XL1-Blue MRF '(Stratagene, La Jolla, USA) is transformed with the binding batch and the plasmid containing cells are screened on LB agar to which 50 μg / ml ampicillin has been added. The success of cloning can be proved after isolation of plasmid DNA by cleavage control using the EcoRI, PvuII, 34

SspI and Styl. The plasmid is called pTrc99Acatamber. A map of the plasmid is shown in figure 2. 4.2 Selection of clones with an amber suppressor The strain MG1655scrAHVRlrS described in Example 3 is transformed with the vectors pTrc99Acat and pTrc99Acatamber. The selection is performed on LB agar which was supplemented with 20 or 50 μρ / πιΐ chloramphenicol.

Chloramphenicol-resistant clones that were transformed with the pTrc99Acatamber vector are transferred to LB Agar to which 50 μl / ητμ of ampicillin has been added using a toothpick. Plasmid DNA is isolated from clones resistant to chloramphenicol and ampicillin. The pTrc99Acatamber vector is identified by restriction cleavage.

A chloramphenicol resistant transformant MG1655scrAHVRrpoS / pTrc99Acatambar is cured by the plasmid pTrc99Acatamber by over-inoculation several times in LB medium and is given the name DM1690. 4.3. Identification of amber mutation suppressor in DM1690

4.3.1. Test for the supD mutation

A known mutation leads to the suppression of amber codons present in the serU gene encoding serine tRNA-2. The allele is called supD, the tRNA recognizes the amber codons and incorporates serine. Following the supD60 gene (Registration number M10746) the antisense cytosine adenine adenine in the wild type serU gene is modified by substituting the base to give cytosine thymine adenine and thus recognizes the guaine uracil adenine codons.

A possible mutation in the chromosomal ser U gene can be detected using LightCycler from Roche Diagnostics (Mannheim, Germany). The LightCycler is a combined instrument consisting of a thermocycler and a fluorometer.

In the first step, a DNA section approximately 0.3 kbp long containing the mutation site is amplified by PCR (Innis et al., PCR Protocols, A Guide to Methods and Applications, 1990, Academic Press) using the following oligonucleotides primer: serULCl (SEQ ID No. 18): 5'-CTTGTACTTTCCAGGGCCAC 3 'serULC2 (SEQ ID No. 19): 5'-TT TAGGAAAAGCAAGGCGGG 3'

In the second phase the presence of mutation is proved using fusion curve analysis (Lay et al., Clinical Chemistry 43: 2262-2267 (1997)) with two additional oligonucleotides of different lengths and labeled with different fluorescent dyes (LightCycler (LC) -Red640 and fluorescein) which hybridize to a region of the mutation site using the " Fluorescence Resonance Energy Transfer " method. (FRET). serUC (SEQ ID No. 20): 5'LC-Red640 -TCCGGTTTTCGAGACCGGTC- (P) 3 'serUA (SEQ ID No. 21): 5'GAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTA-3' 36 Fluorescein

The PCR primers shown are synthesized by MWG Biotech (Ebersberg, Germany) and the hybridization oligonucleotides shown are synthesized by TIB MOLBIOL (Berlin, Germany).

It can be seen that the wild type U gene is present in DM1690 and thus there is no mutation supD. 4.3.2 Sequence analysis of the allele supE in DM1690

Another known mutation leading to suppression of the amber codons is present in the glnV gene encoding glutamine tRNA-2. The allele is called supE, the tRNA recognizes the amber codons and incorporates glutamine. Following the gene glnV (Registration Number AE000170) the cytosine antiserum thymine guanine in the wild type glnV gene is modified by replacing the base to give cytosine thymine adenine and recognizes the uracil codons adenine guanine.

Starting from the known sequence for the glnV region of Escherichia coli K12 (Registration number AE000170), the following oligonucleotide primers (MWG Biotech, Ebersberg, Germany) are chosen for PCR: glnXl (SEQ ID No. 22): 5'-CTGGCGTGTTGAAACGTCAG 3 ' glnX2 (SEQ ID No. 23): 5'-CACGCTGTTCGCAACCTAACC 3 '

DM1690 chromosomal DNA used for PCR is isolated according to the manufacturer's data using " Qiagen Genomic-tips 100 / G " (Qiagen, Hilden, Germany). A DNA fragment 37 of approximately 1 kbp in length may be isolated using the specific primers under standard PCR conditions (Innis et al. (1990) PCR Protocols, A Guide to Methods and Applications, Academic Press) with vent polymerase Biolabs GmbH, Frankfurt, Germany). The PCR product is purified with the QIAquick PCR Purification kit and sequenced by Qiagen Sequencing Services (Qiagen GmbH, Hilden, Germany). The sequence obtained is according to SEQ ID No. 4 in a region in the glnV gene. The DM1690 strain has the supE allele and suppresses amber codons by incorporation of glutamine.

Example 5

Preparation of L-threonine using strains MG1655scrAHVR1, MG1655scrAHVRlrSs and DM1690

Strains MG1655scrAHVR1, MG1655scrAHVRlrSs and DM1690 are multiplied in minimal medium with the following composition: 3.5 g / L Na2HP04 * 2H20, 1.5 g / L KH2P04, 1 g / L NH4 Cl, 0.1 g / L of MgSO 4 · 7H 2 O 2 g / L sucrose, 20 g / L agar. Cultures are incubated for 5 days at 37 ° C. The formation of L-threonine is monitored in 10-ml batch cultures which are contained in 100 ml Erlenmeyer flasks. To this end, 10 ml of preculture medium having the following composition: 2 g / l yeast extract, 10 g / L (NH 4) 2 SO 4, 1 g / L KH 2 PO 4, 0.5 g / l MgSO4 · 7H20, 15 g / L CaCO3, 20 g / L sucrose, are inoculated and the mixture is incubated for 16 hours at 37 ° C and 180 rpm in a ESR incubator from Kuhner AG (Birsfelden, Switzerland). 250 HL portions of this pre-culture in each case are transferred to 10 ml of production medium (25 g / L (NH4) 2 SO4, 2 g / L KH2 PO4, 1 g / L MgSO4 · 7H2 O, 0.03 g / L FeSO4 · 7H20, 0.0188 g / L MnSO4 · 1H2 O, 30 g / L CaCO3, 20 g / L sucrose) and incubated for 48 hours at 37Â ° C. After incubation, the optical density (OD) of the culture suspension is determined using a Dr. Lange LP2W photometer (Berlin, Germany) having a wavelength measurement of 660 nm.

When the concentration of L-threonine formed is determined in the filtered supernatant liquid sterilized using an amino acid analyzer from Eppendorf-BioTronik (Hamburg, Germany) by means of ion exchange chromatography and ninhydrin detection post-column reaction. Table 4 gives the results of the assay.

Table 4

Strain OD (660 nm) L-threonine g / L MG1655scrAHVRl 5, 6 2.15 MG1655scrAHVRlrSs 5.3 2.34 DM1690 5.2 2.46

Brief description of the Figures:

Figure 1: pMAK705rSambar Figure 2: pTrc99Acatambar

Data related to length are to be regarded as approximate data. Abbreviations and names used are defined as follows: cat chloramphenicol resistance gene rep-ts Region of temperature-sensitive replication of plasmid pSClO1

rpoS coding region of the rpoS gene 39

Amp gene resistant to ampicillin gene Gene for repressor gene in trc promoters

Ptrc promoter region trc, inducible IPTG

5S 5S region of rRNA

rrnBT rRNA termination region

Abbreviations for the restriction enzymes are defined as follows: • AccIII: restriction endonuclease from Acinetobacter calcoaceticus • BamHI restriction endonuclease from Bacillus amyloliquefaciens • EcoRI restriction endonuclease from Escherichia coli • EcoRV restriction endonuclease from Escherichia coli • Cl restriction Endonuclease from Microcossus species • PvuII Restriction endonuclease from Proteus vulgaris • Restriction Endonuclease SspI from Sphaerotilus species • StuI restriction Endonuclease from Streptomyces tubercidius • Styl Endonuclease from restriction from Salmonella typhi • Xbal Endonuclease restriction from Xanthomonas badrii 40

Sequence list

'110 &gt; Amino acid producing bacteria and a process for preparing L-amino acids &lt; 130 &gt; 018319 m &lt; I48 &gt; 23 <170 * Patentln version 3 * 1

&lt; 210 &gt; 1 &lt; 211 &gt; 993 &lt; 212 &gt; BE &lt; 213 &gt; E &amp;amp; coli &lt; 22G &gt;

&lt; 221 &gt; CUS &lt; 222 &gt; U> g (990i <22: 3> <400> 1 agg agat cag gat cata gat caat gat gat gaat gat gug gaa Ket Ser Gin Asn Tfer Leu Lys val HiS Asp Leu Asn Glu Asp Ala Glu 1 5 ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ ΊΌΓ gag gaa ctg tta tcg cag Gin Glu Pro Ser Asp Asn Asp Leu Ala Glu Glu Glu Leu Leu Ser Gin 35 40 g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g g d y Ala ·                                                                                                                                                · 0 75 80 cgfc cgc gca ctg gg gat gtc gcc tct cgc gc cgg afg g g Arg Arg Ala Leu Arg Gly Asp val Ala Ser Arg Arg Arg Mefc Ile Glu 85 90 95 agt aac ttg agt etg fftg gta aaa afct gcc cgc cgt tafc ggc aat cgt Ser Asn Leu Arg Leu Val val Lys He Ala Arg Arg Tyr Gly Asn Arg 100 105 ggfc etg gcg ttg ctg gac efct ata gaa gag ggc aac ctg ggg ctg Gly leu Ala Leu Leu Asp Leu lie Glu Glu Giy Asn Leu Gly Leu lie 115 120 cgc gcg gta gag aag fctt gac ccg gaa cgfc ggt tfcc cgc fcfce tca aca Arg Ala Go Glu LyS Phe Asp Pro Glu Arg Gly Phe Arg Phe Ser Thr 130 135 140 18 96 144 192 240 288 33 δ 384 432 tac gea acc tgg tgg att cgc cag acg att gaa egg gcg att atg aac

Tyr Ala Thr Trp Trp xle Arg Ola T & r lie Glu Arg Ala lie Met Asa

145 150 255 ISO caa acc cgt acfc att cgt fctg ecg att cac gta aag gag cfcg aac Gl »Hir Arg Thr 21e Arg leu Fro xle His Xle Va Lys Glu leu As» 16S 170 175 gtc g fctg tec cafc aag ctg gac cafc gaa val Tyr Leu Arg Thr Ala Arg Glu Leu Ser His Lys leu Asp His Glu 180 185 190 cca agt gcg gca gca gcc caa cfcg gat aag cca gtt gafc gac Pro Ser Ala Glu Glu Xle Ala Glu Gla Leu Asp Lys Pro Val Asp Asp 195 200 205 gtc age cgt atg ctt cgt ctt aac gag cgc att acc teg gta gac acc Val Ser Arg Hat Leu Arg Leu Asa Glu Arg Xle Thr Ser Val Asp Thr 210 215 220 ccg ctg ggt ggt gafc fccc gaa aaa gcg fctg cfcg gac afcc ctg gee gat

Pro Leu Gly Gly Asp Ser Glu Lys Ala Leu Leu Asp Xle Leu Ala Asp 225 230 235 240 gaa aaa gag aac ggt ccg gaa gat acc acg caa gat gac gat afcg aag

Glu Lys Glu As Gly Pro Glu Asp Thr Thr Gin Asp Asp Asp Mafc Lys 245, 250 255 cag age afcc gfce aaa fcgg ctg ttc gag ctg aac gee aaa cag cgt gaa Gl »Ser Ile Val Lys Trp Leu Ehe Glu Leu Asn Ala Lys Gla Arg Glu 260 265 270 gfcg ctg gea cgt ega fcfcc ggt fctg ctg ggg tac gaa gcg gea aca ctg Val Leu Ala Arg Arg Fhe Gly Leu Leu Gly Tyr Glu Ala Ala Thr Leu 275 280 285 gaa gat gta ggt ggt ga g att ggc ctc acc cgt gaa cgt gfcfc cgc cg Glu Asp Go Gly Arg Glu Xle Gly Leu Thr Arg Glu Arg Val Arg Gin 290 295 300 att cg gtt gaa ggc cfcg cgc cgt fctg cgc gaa till ctg caa acg cag Xle Gin Val Glu Gly Leu Arg Arg Leu Arg Glu Xle Leu Gla Thr Gla 305 310 315 320 ggg ctg aat ate gaa gcg ctg ttc cgc gag taa

Gly Leu Asn Xle Glu Ala Leu Fhe Arg Glu 325. 330 &lt; 210 &gt; 2 &lt; 211 &gt; 330

«212» FRT <213 »Escherichia coli« 400 »2

Met ser Gl 'Asn Thr Leu Lys Val His Asp Leu Asn Glu Asp Ala Glu 15 10 15

Phe Asp Glu Asn Gly Val Glu Val Fha Asp Glu 1¾¾ Ala Leu Val Glu 20 25 30 42

Gin Glu Pro Ser Asp As A A Leu Ala Glu Glu Glu Leu Leu Ser Gl 35 35 Gly Ala Thr Gl Arg Arg Leu Asp Ala Thr GlnLeu Tyr Leu Gly Glu 5 50 55 60 Ile Gly Tyr Ser Pro Leu Leu Thr Ala Glu Glu Glu Val Tyr Phe Ala 65 70 75 80 10 Arg Arg Ala Leu Arg Gly Asp Val Ala Ser Arg Arg Arg Met Ile Glu S5 90 95 Ser Assis. Leu Arg Leu Val Val Lys Ile Ala Arg Arg Tyr Gly Asn Arg 100 105 110 15 aiy Leu Ala Leu Leu Asp Leu lie Glu Glu Gly As »Leu Gly Leu Ile 115 120 125 Arg Ala Val Glu Lys The Asp Pro Glu Arg Gly Phe Arg Phe Ser Thr 20 130 135 140 Tyr Ala Thr Trp Trp Ile Arg 01 Thr Ile Glu Arg Ala Ile Met Asn 145 150 155 160 25 Gin Thr Arg Thr Ile Arg Leu Pro Ile His Ile Val Lys Glu Leu Asn 165 170 175 Go Tyr Leu Arg Thr Ala Arg Glu Leu Ser His Lys Leu Asp His Glu 180 185 190 30 Pro Ser Ala Glu Glu Ile Ala Glu Gl »Leu Asp Lys Pro Val Asp Asp 195 200 205 Val Ser Arg Mefc Leu Arg Leu As» Glu Arg Ile Thr Ser Val Asp Thr 35 210 215 220 Pro Leu Gly Gly Asp Ser Glu Lys Ala Leu Leu Asp Ile Leu Ala Asp 225 230 235 240 40 Glu Lys Glu As »Gly Pro Glu Asp Thr Thr Gin Asp Asp Asp Met Lys 245 250 255 Gin Ser Ile Val Lys Trp Leu Ph® Glu Leu Asn Ala Lys Gin Arg Glu 260 265 270 45 Val Leu Al Arg Arg Phe Gly Leu Leu Gly Tyr Glu Ala Ala Thr Leu 275 280 285 Glu Asp Val Gly Arg Glu Ile Gly Leu Thr Arg Glu Arg Val Arg Gin 50 290 295 300 Ile Gin Val GlU Gly Leu Arg Arg Leu Arg Glu Ile Leu Gin Thr Gin 305 310 315 320 55 Gly Leu As »Ile Glu Ala Leu pfae Arg Glu 325 330 &lt; 21ϋ &gt; 3 '211' 993 '212' ΟΚΑ &lt; 213 Escherichia coli 60 43 &lt; 220 &gt; &lt; 321 &gt; Allele &lt; 222 &gt; you-lso

&lt; 223 &gt; A &lt; 220 &gt; &lt; 221 &gt; misc_characteristics &lt; 222 &gt; (.97) *, (99) &lt; 223 &gt; Codon-amber &lt; 400 &gt; 3 atgagteaga atacgctgaa ggagttgagg tttttgacga gccgaag &amp; gg aactgttatc taccttggfcg agattggtta cgtcgcgcac tgcgtggaga ctggtggtaa aaattgcccg gaagagggca acctggggct cgcttcfccaa catacgcaae caaacccgta ctattcgtfct accgcacgfcg agttgtccea caacfcggata agccagttga tcggtagaca ccccgctggg gaaaaagaga acggtccgga aaatggctgt fccgagctgaa ctggggtacg aagcggcaac cgtgttcgce agattcaggt gggctgaata tcgaagcgct &lt; 210 &gt; 4 &lt; 211 &gt; 75

&lt; 212 &gt; DMA &lt; 223 &gt; Escherichia coli: agfefceatgat tt &amp; aatgaag aaaggcctts gtagaafcagg gcagggagcc acacagcgtg ttcaccactg fctaacggccg tgtcgeefcefc cgccgccgga ccgttatggc aatcgtggte gafcccgcgcg gtagagaagt ctggtggafcfc cgccagacga gccgattcac atcgtaaagg taagctggac catgaaccaa tgacgtcagc cgtatgctte tggtgattcc gaaaaagcgfc agataccacg caagafcgacg cgccaaacag cgtgaagfcgc actggaagat gtaggtcgtg fcgasggcofcg cgecgfcttgc gfcfcecgcgag taa atgcggaafcfc fcgafcgagaac aacceagtga taacgatttg Cgfcfeggacgc gactcagctt aagaagaagfc ttattttgcg fcgatcgagag taacttgcgfc tggcgfctgct ggaccttatc ttgacccgga acgfcggfcfctc ttgaacggge gattatgaac agctgaacgt ttacctgcga gtgcggaaga gatcgcagag gtettaacga gcgcatfcacc tgctggacat cctggccgat atatgaagca gagcatcgtc tggcacgtcg attcggtttg aaatfeggcct eaccogtgaa gcgaaatcct gaaaaegcag 60 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 993 &lt; 220 &gt; &lt; 222 &gt; tENA &lt; 222 &gt; (1). (75)

&lt; 223 &gt; allele-supE &lt; 400 &gt; 4 60 tggggtatcg ccaagcggfca aggcaccgga ttcfcaattcc ggcattccga ggfctcgaatc etcgtacocc agcca 75 &lt; 210 &gt; 5 &lt; 211 &gt; 714

&lt; 212 &gt; DNA &lt; 213 &gt; Escherichia coli &lt; 220 &gt; &lt; 221 &gt; CDS &lt; 222 &gt; (1) .. (711) &lt; 223 &gt; &lt; 400 &gt; 5 atg gag agt aac ttg cgt ctg gtg gta aaa att gee ege cgt tat 48 Met Ile Glu Ser Asn Leu Arg Leu Vai Lys Ile Ala Arg Arg Tyr 1 5 10 15 ggc aat cgt ggt ctg gcg ttg ctg gac ctt ate gaa gag ggc aac ctg 96 Gly Asn Arg Gly Leu Ala Leu Leu Asp Leu Ile Glu Glu Gly Asn Leu 20 25 30 ggg ctg to ege gc gta gag aag ttt gac ccg gaa cgt ggt ttc ege 144 Gly Leu Ile Arg Ala Go Glu Lys Phe Asp Pro Glu Arg Gly Phe Arg 35 40 45 ttc tea gca acc tgg tgg att e g cg acg att gaa cgg gcg 192 Phe Ser Thr Tyr Ala Thr Trp Trp Ile Arg Gin Thr Ile Glu Arg Ala 50 55 60 att atg aac caa acc cgt act att cgt ttg ccg att cac to gta aag 240 Ile Met Asn Gin Thr Arg Thr Ile Arg Leu Pro Ile His Ile Vai Lys 65 70 75 80 gag ctg aac gtt ctg cga gcc cgt gag ttg tcc cat aag ctg 288 Glu Leu Asn Vai Tyr Leu Arg Thr Ala Arg Glu Leu Ser His Lys Leu 85 90 95 gac cat gaa cca agt gcg gaa gag gca gag caa ct g gat aag cca 336 Asp His Glu Pro Ser Ala Glu Glu Ile Ala Glu Gin Leu Asp Lys Pro 100 105 110 gtt gat gac gtc age cgt atg ctt cgt ctt aac gag ege att acc teg 384 Go Asp Asp Will be Arg Met Leu Arg Leu Asn Glu Arg Ile Thr Ser 115 120 125 gta gac acc cg gt g gt g gt tg ga aaa gcg ttg gt gt 432 Go Asp Thr Pro Leu Gly Gly Asp Ser Glu Lys Ala Leu Leu Asp Ile 130 135 140 ctg gee gat gaa aaa gag aac ggt ccg gaa gat acc acg caa gat gac 480 Leu Ala Asp Glu Lys Glu Asn Gly Pro Glu Asp Thr Thr Gin Asp Asp 145 150 155 160 gat atg aag cag age till gtc aaa tgg ctg ttc gag ctg aac gee aaa 528 Asp Met Lys Gin Ser Ile Vai Lys Trp Leu Phe Glu Leu Asn Ala Lys 165 170 175 cag cgt gaa gtg ctg gca cgt cga gt cg gt gg tg gt gg gt gg gcg gcg 576 Gin Arg Glu Vai Leu Ala Arg Arg Phe Gly Leu Leu Gly Tyr Glu Ala 180 185 190 gca aca ctg gaa gat gta ggt cgt gaa att ggc ctc acc cgt gaa cgt 624 Ala Thr L I Glu Asp Gly Gly Arg Glu Gly Gly Leu Thr Arg Glu Arg 195 200 205 45 gtt cgc cag att cag gtt ga ggc ctg cgc cgt ttg cgc gaa till ctg Go Arg Gin Ile Gin Go Glu Gly Leu Arg Arg Leu Arg Glu Ile Leu 210 215 220 caa acg cag ggg ctg aat ate gaa gcg ctg ttc cgc gag taa Gin Thr Gin Gly Leu Asn Ile Glu Ala Leu Phe Arg Glu 225 230 235 &lt; 210 &gt; &Lt; 211 &gt; 237 &lt; 212 &gt; PRT &lt; 213 &gt; Escherichia coli &lt; 400 &gt; Gly Asn Arg Gly Leu Ala Leu Leu Asp Leu Ile Glu Glu Gly Asn Leu 20 25 30 Gly Leu Ile Arg Ala Glu Lys Phe Asp Pro Glu Arg Gly Phe Arg 35 40 45 Phe Ser Thr Tyr Ala Thr Trp Trp Ile Arg Gin Thr Ile Glu Arg Ala 50 55 60 Ile Met Asn Gin Thr Arg Thr Ile Arg Leu Pro Ile His Ile Val Lys 65 70 75 80 Glu Leu Asn Vai Tyr Leu Arg Thr Ala Arg Glu Leu Ser His Lys Leu 85 90 95 Asp His Glu Pro Ser Ala Glu Glu Ile Ala Glu Gin Leu Asp Lys Pro 100 105 110 Will Asp Asp Will Be Arg Met Leu Arg Leu Asn Glu Arg Ile Thr Ser 115 120 125 Go Asp Thr Pro Leu Gly Gly Asp Ser Glu Lys Ala Leu Leu Asp Ile 130 135 140 Leu Ala Asp Glu Lys Glu Asn Gly Pro Glu Asp Thr Thr Gin Asp Asp 145 150 155 160 Asp Met Lys Gin Ser Ile Vai Lys Trp Leu Phe Glu Leu Asn Ala Lys 165 170 175 Gin Arg Glu Vai Leu Ala Arg Arg Phe Gly Leu Leu Gly Ty r Glu Ala 180 185 190 Ala Thr Leu Glu Asp Gly Gly Arg Glu Ile Gly Leu Thr Arg Glu Arg 195 200 205 Go Arg Gin Ile Gin Go Glu Gly Leu Arg Arg Leu Arg Glu Ile Leu 210 215 220 Gin Thr Gin Gly Leu Asn Ile Glu Ala Leu Phe Arg Glu 225 230 235 672 714 46 46 &lt; 210 &quot; &lt; 2 n &gt; &lt; 212 Âμm &lt; 23.3 &gt; Synthetic &lt; 220 &gt; &lt; 232 &gt; Primec &lt; 222 &gt; (1), (19) &lt; 223 &gt; rpoS9 &lt; 4 &gt; 7 cagttatagc ggcagtacc &lt; 21G &lt; 211 &gt; 21 &lt; 212 &gt; μg &lt; 213 &gt; <220> <221> primitive <222> (11 .. (23) <223> rpoS4 <400> 8 ggacagtgtt aacgaccatt ctc 23 <21Q> 9 <211> 2012 <212> 3> g <213> Escherichia coli <221> 221 »DMA, <222 (1) .. (2012) <223> rpoS9 ~ 4 <400» 9 cagttatagc ggcagtaccfc ataccgtgaa aaaaggcgac acacttttct atatcgcctg 60 gattactggc aacgafcttcc gtgaccttgc tcagcgcaac aatattcagg caccataçgc 120 gctgaacgtt ggtcagacct tgcaggtggg taatgcttcc ggtacgccaa tcacfcggcgg 180 aaatgccatt acccaggccg acgcageaga gcaaggagtt gtgatoaagc ctgcacaaaa 240 ttecaccgfcfc gctgttgcgt cgcaaccgac aattacgtat tetgagtctt cgggtgaaca 300 gagtgctaac aaaattgttge cgaacaacaa gccaaetgcg accaoggtca cagcgcctgt 360 aacggtacca acagcaagca caaecgagee gactgtcagc agtacatcaa ccagtacgcc 420 tatctccacc tggcgctggc egactgaggg caaagtgate gaaacctttg gcgctfccfega 480 ggggggcaac aaggggatfeg atatcgcagg cagcaaagga caggc & afefca tcgcgaccgc 540 agatggccgc gttgfefctatg ctggtaacgc gctgegcggc tacggtaatc tgafctat cat 600 caaacataat gatgattacc tgagtgccta cgcceataac gacacaatgc tggtccggga 660 aeaacaagaa gfctaaggcgg ggcaaaaaat agcgaccatg ggfcageaccg gaaccagttc 72 © aacacgcttg cattttgaaa tfccgttacaa ggggaaatcc gtaaacccge tgcgtfcafcfct 780 47 gccgcagcga taaatcggcg gaaccaggct tttgcttgaa tgttccgtca agggatcaeg 840 ggfcaggagce acettafcgag tcagaatacg ctgaaagfcfcc atgatfctaaa tgaagatgcg 900 gaatttgatg agaacggagt tgaggttttt gacgaaaagg ccttagtaga acaggaaccc 968 I • u . 1 atttggccga agaggaactg ttatcgcagg gagccacaca gcgtgtgttg 1020 gacgcgactc agctfctacct tggtgagatt ggttatteac cactgttaac ggccgaagaa 1080 gaagtfctatfc ttgcgcgtcg cgcactgcgt ggagatgtcg cctctcgccg ccggatgatc 1140 gagagtaacfc tgcgtctggt ggtaaaaatt gcccgccgtt atggcaafccg tggtctggçg 1200 ttgctggaoc ttatcgaaga gggcaacetg gggctgatcc gcgcggfcaga gaagtttgac 1260 ccggaacgtg gtttccgctt ctcaacatac geaacctggt ggattcgcca gacgatfcgaa 1320 cgggcgatta tgaaccaaae ccgtactatt cgtfctgccga ttcacafccgt aaaggagctg 1380 aacgtfctacc tgcgaaccgc acgtgagttg fccccataagc tggaccatga accaagtgcg 1440 gaagagatcg cagagcaact ggataagcca gttgatgacg tcagccgtat gcttcgtett 1500 aacgagcgca ttacctcggt agacaccccg ctgggtggtg atjtccgaaaa agcgttgcfcg THAT gAC &amp; tectgg ecgatgaaaa agagaacggt ccggaagata ccaegcaaga tgacgatafcg 1620 aagcagagca tcgtcaaatg gctgttcgag ctgaacgcca aacagcgtga agtgctggca 1680 egtcgattcg gtttgcfcggg gfeacgaagcg gcaacactgg aagatgtagg tcgtgaaatt 1740 ggcctcaccc gtgaacgtgt tcgccagatt caggttgaag gcctgcgc 1800 CG tttgcgcgaa atectgeaaa cgeaggggcfe gaatatcgaa gcgctgttcc gcgagtaagfc aagcatctgt 1860 cagaaaggcc agtcfccaagc gaggctggcc fctttctgtgc acaataaa &amp; 1920 g gtccgatgcc catcggacct ttttattaag gtcaaattac cgcccatacg caccaggtaa fcfcaagaatec 1980 cc ggtaaaaceg agaatggtcg fctaacactgt 2012 &lt; 219 &gt; 10 &lt; 211 &gt; 31

&lt; 212 &gt; DNA &lt; 213 &gt; Synthetic sequence &lt; 220 &gt; &lt; 221 &gt; Primei &lt; 222 &gt; <210> 11 <211> 31 <210> 11 <211> 31 <223> <223>

&lt; 212 &gt; DNA &lt; 213 &gt; Synthetic sequence &lt; 220 &gt; &lt; 221 &gt; Pxixiox «222» {1}, {31}

&lt; 223 &gt; &lt; / RTI &gt; &lt; 400 &gt; &lt; / RTI &gt; (2x3 &gt; &lt; 22 &gt; &lt; 221 &gt; 221 &lt; 221 &gt; &lt; 221 &gt; &lt; 221 &gt; (21), synthetic sequence &lt; 220 &gt; 231 &lt; 232 &gt;

<223> rpoSLCS &lt; 490 &gt; 13g &gt; & aaataaae &lt; 210 14 &lt; 2U &gt; 23 <212> m <213> <220> synthetic sequence <221> Priiser <222> l 23 <223> rpoSss & erC <400 »14 cttagtagaa eagga & eeea gfcg <lt : <210> IS <211> 34 <212> <213>: synthetic looted <220> <221> Friteer <222> U), <34) <223> spoSasftepA <408 »15 gatgagaaog gagttgaggt fctttg & gag &lt; 218.16 &lt; 211.31 &lt; 3 &gt; m * S * 3 * Synthetic Sequence «320» § «222» ipjfiasg »« 22: 2 » 223 »mfc &amp; sem <40G» 1 «

If 10 gscfcfcfcfcfgfgfgfgfgfgfgfggfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfgfg 2? &lt; tll &gt; 34 «212» MS, IS * %%% »Synthetic sequence« S20 »

«Ml» MàStoX «m» m »~ mi

20 &lt; 222 &gt; K &amp; M & cX &lt; 4m &gt; 17% 4 gmmgttm mxe SS &lt; zm &gt; w <232> 30 «2.12» m «&3>; synthetic sequence 30 «220» «$ S3 * 3i'2s8®s« mo »m < &gt; tm «223» ssrOLCl

M 3 S «405» 3.8 f 8 8 t t t «« «« 220 220 220 220 220 220 220 38 2 «48« 312 »ΪΜ &amp; &lt; S33 &gt; Synthetic sequence '220' <221> wximx 4S '222' tm <222 'yes' x03C2 S0 ss ια «W» 38 tttasj »*» »8K» * SWe «8f <210» 20 « 3X120 &lt; 112 &gt; &lt; 3M &gt; Synthetic Sequence * «3M» «221 &gt; 1, 2, 3, 4, 5, 6, 8, 9, 10, 12 and 13

M

50 S &lt; 210 &gt; &lt; 211 &gt; <212> «213» 21 35sm Synthetic sequence

XO

&lt; 220 &gt; &lt; 221 &gt; Primaer <222> ¢ 3 <)> 353 <223> serone <400> 21 gagggggatt tgaacccccg gtagagttgc cccta 35 <210> 22 <211> 20 «212» DHA <213s-Synthetic Sequence 20 <220> <220> <210> <213> <213> <213> <213> <213> <213> <213> <213> <213> ; Synthetic sequence &lt; 220 &gt; <221> Pfiaier35 &lt; 222 &gt; (1) 211 &lt;233;

<400> 23 cacgctgttc gcaacCtaaC C 21

Lisbon, March 2, 2012

Claims (5)

L-threonine producing bacteria of the species Escherichia coli, which are resistant to Î ± -amino β-hydroxyvaleric acid, wherein said bacteria contain 1) in the coding region of the rpoS gene one (1) amber-type stop codon and 2) the corresponding SupE amber suppressor, wherein the amber-type stop codon is within the coding region of the rpoS gene corresponding to position 33 in the amino acid sequence of the RpoS protein, according to SEQ ID No. 2 L-threonine producing bacteria as claimed in claim 1, wherein they produce not more than 40% L-lysine as a byproduct as compared to the amount of L-threonine desired. L-threonine producing bacteria as claimed in claim 2, wherein they produce not more than 10% L-lysine as a byproduct, as compared to the amount of L-threonine desired. L-threonine producing bacteria as claimed in claim 2, wherein they produce not more than 5% L-lysine as a byproduct, as compared to the amount of L-threonine desired. L-threonine producing bacteria as claimed in claims 1-4, wherein one or more genes chosen from the group given below are simultaneously improved, in particular over-expressed: a) the thrABC operon encoding aspartate kinase, homoserine dehydrogenase (b) the pyc gene coding for pyruvate carboxylase, (c) the pps gene encoding phosphoenolpyruvate synthase, (d) the ppc gene encoding phosphoenolpyruvate carboxylase, (e) the pntA and pntB genes encoding transhydrogenase, f) the rhtB gene conferring homoserine resistance, g) the mqo gene encoding malate: quinone oxireductase, h) the threonine resistance rhtC gene, i) the Corynebacterium glutamicum thrE gene encoding the j) the gdhA gene encoding glutamate dehydrogenase, k) the hns gene encoding the DNA binding protein HLP-II, the pgm gene encoding phosphoglucomutase , 3) the fba gene encoding the fructose bisphosphate aldolase, η) the pts1 gene in the ptsHIcrr operon, which encodes the enzyme I in the phosphotransferase (PTS) system, o) the ptsH gene in the ptsHIcrr operon, which encodes the phosphohistidine hexose protein (PTS), p) the pcr gene in the ptsHIcrr operon, which encodes the glucose specific component IIA in the phosphotransferase system (PTS), q) the pts gene encoding the glucose specific IIBC component in the phosphotransferase system (PTS) ), r) the lrp gene encoding the regulator in the leucine regulator, s) the crsA gene encoding the overall regulator, t) the fadR gene coding for the regulator in the fad regulator, the iclR gene coding for the regulator in metabolism (v) the mopB gene coding for chaperone 10 Kd, which is also known by the name of groES, (w) the ahpC gene in the ahpCF operon, which encodes the small subunit of the hydroxy peroxide alkyl reductase, 4 χ) oper (a) the cysK gene encoding cysteine synthase A, (c) the cysB gene encoding the regulator in the cys regulatory, (aa) the cysJ gene in the cysJIH operon, which encodes the flavoprotein in NADPH sulphite reductase, (bb) the cysH gene in the cysJIH operon, which encodes adenylsulfate reductase, and cc) the cysl gene in the cysJIH operon, which encodes the hemoprotein in NADPH sulfite reductase. L-threonine producing bacteria as claimed in claims 1-5, wherein other genes are attenuated. A process for preparing L-threonine or L-threonine containing food additives which comprises the following steps: a) fermentation of Escherichia coli bacteria, which are resistant to α-amino-β-hydroxyvaleric acid and contain 1) in the region of encoding the rpoS gene corresponding to position 33 in the amino acid sequence of the RpoS protein according to SEQ ID No. 2 an amber-type stop codon and 2) the corresponding supE amber suppressor, b) enriching the L-threonine in the medium or in the cells of the microorganisms, and c) isolation of the L-threonine, wherein optionally the constituents of the fermentation broth and / or the biomass in its entirety, or a proportion thereof (> 0 bis 100), remain in the product. A process as claimed in claim 7, wherein the E. coli strain DM1690, deposited as DSM 15189, is used. 9. Escherichia coli DM1690 strain deposited as DMS 15189 in the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany). Lisbon, March 2, 2012