PT107663B - MINI-CIRCLE PURIFICATION PROCESS - Google Patents

Abstract

THIS INVENTION DESCRIBES A PROCESS FOR THE PRODUCTION AND PURIFICATION OF SUPERENROLED MINICULES THAT IS EASILY TRANSFERABLE TO INDUSTRIAL RANGE. THESE MINI-CIRCLES CAN BE USED BY INDUSTRIAL BIOTECHNOLOGY AND HEALTH INDUSTRIES, SPECIFICALLY IN THE FIELDS OF DNA VACCINATION, GENE CELL AND THERAPY AND PRODUCTION OF RECOMBINANT ANAL CELL PROTEINS.

Description

MINI-CIRCLE PURIFICATION PROCESS

Field of the invention

Technical field to which the invention belongs

The present invention describes processes for the purification of supercoiled double stranded DNA mini-circles (4) that contain all the functional units necessary for gene expression in eukaryotic cells. These minicircles (4) can be used in the fields of DNA vaccination, cell and gene therapy and recombinant protein production in animal cells via transient transfection. The invention relates to the technical field of Biochemical Engineering / Biotechnology.

State of the art

Numerous work has been developed over the past 20 years on the use of plasmid DNA vectors to transiently transfer and express genes in animal cells and tissues, either in the laboratory environment or in vivo. This capability is crucial for a number of medical and biotechnology applications. For example, gene transfer can potentially be used: i) in gene therapy to treat acquired diseases (eg cancer, AIDS) and genetic disorders (eg cystic fibrosis), ii) vaccination with DNA, to immunize against infectious diseases (eg influenza, malaria, etc.) and iii) in the production of recombinant proteins (eg antibodies) by culturing animal cells in bioreactors.

Typical plasmid DNA vector contains regions of bacterial origin, which are required for its production in a bacterial host, and a eukaryotic expression cassette, which is responsible for producing the antigen or protein of interest in animal cells. Bacterial DNA sequences (eg origin of replication) and genes required for the propagation of plasmid vectors into microbial cells (eg an antibiotic check mark) are a concern for regulatory agencies as there is a risk that they may be acquired by Enterobacteriacea living in the intestinal tract of human and animal subjects, and thereafter disseminated to other species via horizontal gene transfer.

In addition, those sequences can severely impair the expression of the function encoded in the eukaryotic expression cassette. For example, the peak of plasmid vector-mediated expression, which typically occurs within the first 48 hours after transfection of animal cells, usually begins to decline dramatically due to mutation of transgene expression. This silencing is related to the presence of unmethylated cytosine phosphate-guanine (CpG) motifs in said bacterial sequences which, by stimulating the innate immune system and cytokine production, suppress expression. Bacterial sequences in the plasmid vector may also contribute to silence expression by forming heterochromatin, a highly compact form of DNA that propagates toward regulatory regions necessary for eukaryotic expression. This dense form of DNA does not allow the binding of transcription factors, thus inhibiting the expression of transgene-encoded genetic function.

Minicircles are gene transfer vectors derived from plasmid DNA that contain only the eukaryotic expression cassette. These vectors have already demonstrated superior gene transfer performance when compared to conventional plasmid vectors. In addition to greater biological safety due to the absence of said bacterial sequences, the smaller size of the mini-circles also translates into higher bioavailability and longer transgene expression (Schleef et al., 2008).

Mini-circles are produced in vivo by specific intramolecular recombination of a parent plasmid (PP) through two specific recognition sites flanking the eukaryotic expression cassette. This recombination event gives rise to two supercoiled plasmid DNA molecules: i) a minicircle (MC) containing the eukaryotic expression cassette required for expression of the target transgene in target animal cells and ii) a replicating miniplasmid (MP) containing the undesirable bacterial elements (Figure 2). Minicircles have been produced in vivo in Escherichia coli (E. coli) host strains with the aid of different recombines expressed under the action of inducible promoters. For example, phage integrase λ (Darquet et al., 1999) is induced by a temperature rise to 42 ° C which inactivates the promoter repressor cI587 protein, whereas Cre recombinase, φΟ31 integrase (eg Chen et al. , 2003) and ParA resolvase (eg Kobelt et al., 2012) are regulated by the pBAD / araC expression system.

Achieving recombination of parental plasmids in vivo is not a trivial process. For example, placing a copy of a recombinase gene on the E. coli chromosome (Bigger et al., 2001; Darquet et al., 1999, 1997; Kreiss et al., 1998) resulted in low recombination efficiency, around 60%. Jechlinger and colleagues, among others, have shown that complete recombination can be obtained if each parental plasmid encodes its own recombinase (Jechlinger et al., 2004). Only when ten copies of integrase φΟ31 were placed on the E. coli host strain chromosome did all parental plasmids recombine into the corresponding minicircles and miniplasmids (Kay et al., 2010). The type of strain, the copy number of the gene encoding the recombinase in question and the fermentation strategy are other factors that influence recombination efficiency.

Beyond recombination itself, one of the most important challenges in a production approach is the purification of host impurities minicircles (ie proteins, genomic DNA, RNA, lipopolysaccharides) and recombination byproducts (ie miniplasmid and non-recombining parent plasmids). ) (Schmeer et al., 2008). The first purification protocols described in the literature depended on the linearization of miniplasmids and non-recombinant parental plasmids by restriction endonucleases, followed by cesium-ethidium bromide (CsCl-EtBr) density gradient ultracentrifugation. The maximum yields obtained with this laborious method are of the order of 1 mg minicircle per liter of bacterial culture (Bigger et al, 2001; Chen et al, 2003; Darquet et al., 1997; Kreiss et al., 1998). Linear fragments obtained after restriction can also be separated from the supercoiled mini-circles by agarose gel electrophoresis (Nehlsen et al., 2006).

Chen and colleagues have developed an elegant one-step strategy for purifying minicircles that depends on: i) simultaneous expression of PhiC31 integrase and I-Scel endonuclease under control of the pBAD / araC system and ii) presence of a site miniplasmid sequence base pair recognition factor for IScel endonuclease (Che net al., 2005b). With this system, in vivo recombination of the parental plasmid into minicircle and miniplasmid is followed by in vivo restriction mediated by the miniplasmid I-Scel enzyme and subsequent degradation of the resulting linear DNA fragments by bacterial nucleases. Optimally, the lysates obtained from these cells will thus be free of parent plasmids and miniplasmids and thus the minicircles may be isolated and purified by means of a standard plasmid purification kit. The coexpression of bacteriophage PhiC31 integrase and IScel endonuclease normally results in low yields since a large number of parental plasmids are destroyed prior to formation of the mini-circles by recombination. To circumvent this problem, Chen and colleagues inserted two additional copies of pBAD-PhiC31 into the bacterial region of the parental plasmid and used a low temperature of 32 ° C and a low pH to favor recombination and then a higher temperature of 37 ° C. ° C and the addition of fresh Luria-Bertani (LB) medium at pH 8 to increase I-Scel activity. These efforts to decouple linearization recombination have been rewarded with yields of up to 1.8 mg minicircle per liter and minicircle purity of the order of 95% (Chen et al., 2005). The method was further improved by inserting ten copies of pBAD-PhiC31 and six copies of pBAD-I-Scel into the E. coli strain BW27783 chromosome. As a result overall yields of 3.4- 4.8 mg minicircles / L with 0.4-1.5% impurities were obtained (Kay et al., 2010). Thanks to this new strain the mini-circle production method has been greatly simplified, making it comparable in complexity to laboratory methods of conventional plasmid production. Despite these improvements, yield and purity of minicircles remains highly dependent on host strain physiology and dominant environmental factors during growth, recombination replication.

In 2008, Mayrhofer and colleagues introduced a very efficient chromatography-based mini-circle purification protocol that explores protein-DNA affinity interactions (Mayrhofer et al., 2008). The method depends on the integration of two lacOs (lactose operator sites) sites in the parental plasmid, in a position located in the minicircle region. LacO sites are short recognition sequences that have high affinity for the lactose operon repressor protein (LacI repressor). The LacI repressor was then synthesized, biotinylated modified and immobilized on porous Sepharose particles containing covalently linked tetrameric streptavidin to construct a selective affinity chromatographic matrix for the lacO site minicircles. Samples containing the minicircles and miniplasmids were then purified by chromatographic separation in the usual binding-wash-elution mode. Non-specific binding of the miniplasmid (i.e. plasmids without lacOs sites) was minimized by increasing the NaCl concentration in the wash buffer to 400 mM. The minicircles were then eluted with a buffer containing 50 mM Tris, pH 8, 500 mM NaCl and 5 mM isopropyl β-D-1 thiogalactopyranoside (IPTG). The column capacity averaged 0.184 ± 0.045 mg minicircle per ml chromatographic matrix. A quantitative polymerase chain reaction (q-PCR) analysis revealed that the DNA eluted after a single purification step with the immobilized LacI repressor affinity matrix consisted of 98.8% minicircle, 1% miniplasmid and 0, 2% parental plasmid (Mayrhofer et al., 2008). This method thus presents itself as a promising option for purifying mini-circles, resulting in a product that meets the recommendations of regulatory agencies in terms of final quality. However, the method is not capable of separating minicircles from non-recombined parent plasmids since the two molecules contain the lacO recognition sites. This means that highly efficient recombination is required in order to ultimately obtain free minicircles of parental plasmids.

US8236548B2 describes a minicircle production protocol that utilizes a strain containing genes encoding PhiC31 recombinase and endonuclease I-Scel. Simultaneous expression of these two enzymes is necessary to i) recombine the parent plasmid into minicircle and miniplasmid and ii) specifically linearize the miniplasmid and non-recombinant parent plasmid molecules in vivo. The linearized DNA molecules thus obtained are concomitantly digested by bacterial nucleases such that at the end of the cell culture process the cells contain only minicircles.

EP1620559B1 describes a minicircle purification method that exploits DNA protein affinity interactions. The minicircle structure contains two lacO sites that have high affinity for the lactose operon repressor protein (LacI). Minicircle capture from a complex mixture is accomplished using immobilized LacI chromatographic supports.

US7622252B2 describes a minicircle production method that utilizes a bacterial strain under conditions such that topoisomerase IV activity is inhibited, thereby producing a variety of concatenated minicircles and miniplasmids. The supercoiled minicircles are then released from the catenanes using a restriction enzyme that linearises the miniplasm and subsequently purified by a state of the art method such as chromatography or gel electrophoresis.

EP2439276 describes a process for preparing a circular DNA vector in supercoiled form using a parental plasmid containing the sequence of interest flanked by two restriction sites. After production in a bacterial host, parental plasmids are linearized in vitro with a restriction enzyme that recognizes said sites and the sequence of interest is purified and circularized. After purification of the other ligation products, the relaxed circular DNA molecule is coiled by a gyrase to produce the supercoiled DNA molecule.

Accordingly, there is a need to develop a process for producing and purifying DNA minicircles free from the host impurities of the recombination byproducts, which is easily transferable to industrial scale.

summary

Minicircles (4) are small circular DNA molecules that can be used to transiently transfer and express genes in animal cells. The unique safety and efficiency profiles of the mini-circles (4) make them especially useful in applications in the fields of DNA vaccination, cell and gene therapy and recombinant protein production in animal cells. The application of minicircles (4) in these areas has been hampered by the lack of production technologies capable of generating the gram / kilogram quantities needed to carry out preclinical and clinical trials or to set up recombinant protein production campaigns. The present invention describes a method of producing and purifying minicircles (4) that can be transposed to industrial scale.

Detailed Description of the Invention

The invention relates to a process suitable for the purification of supercoiled mini-circles (4) which is easily transferable to industrial scale. These minicircles (4) are supercoiled circular DNA molecules that contain a functional eukaryotic expression cassette that are free of bacterial sequences and other impurities. These minicircles (4) can be used as gene delivery vectors in the fields of DNA vaccination, cell and gene therapy, and recombinant protein production in animal cells.

The unique feature of the process described herein is that minicircles (4) can be produced in high purity, free of miniplasmids (5) or parent plasmids (3), using generic chromatographic processes (e.g. ion exchange or hydrophobic interaction chromatography). This feature greatly contributes to the ease of scaling up the process, making it possible for the first time to foresee the possibility of economically manufacturing large quantities of mini-circles (4).

The term plasmid DNA (pDNA) or plasmid vector or plasmid refers to an extrachromosomal genetic unit composed of a double strand of deoxyribonucleic acid capable of autonomous intracellular replication.

The term parental plasmid (3) refers to the plasmid molecule (pDNA) composed of a functional eukaryotic expression cassette flanked by two multimer resolution sites recognized by resolvase to and by bacterial sequences essential for propagation of the plasmid in the bacterial host. The bacterial part of the parental plasmid (3) has several restriction endonuclease specific recognition sites capable of introducing double (e.g. PvuII) or single (e.g. Nb.BbvCI) cuts into the DNA phosphate sugar chain.

The term minicircle (4) refers to a plasmid having the functional eukaryotic expression cassette which may additionally have other functional eukaryotic elements and one of the multimeric resolution sites.

The term miniplasmid (5) refers to a plasmid derived from the parent plasmid (3) that has restriction endonuclease specific recognition sites at regular locations along the sequence and one of the multimeric resolution sites.

The term "recombination products" refers to covalently circularized DNA molecules that are obtained after intramolecular recombination of the parent plasmid (3), namely minicircle (4), miniplasmid (5), and residual non-recombined parental plasmid (3).

The term endonuclease-specific recognition sites refers to sites in the miniplasmid (5) that are recognized by restriction endonucleases, which concomitantly modify the structure of the miniplasmids (5) by specific enzymatic action (eg single or double stranded DNA restriction). . Such sequences are genetically introduced so that it is possible to hydrolyze the miniplasmid (5) into small linear DNA fragments (6) or to transform the supercoiled miniplasmid (5) into relaxed miniplasmid (5).

In some embodiments of the invention the restriction enzymes are specifically the enzyme PvuII or the enzyme Nb.BbvCI.

The term linear DNA fragments (6) refers to the enzymatic hydrolysis products of the miniplasmid (5) and the parent plasmid (3) by restriction endonucleases that cut the two DNA strands.

The term relaxed miniplasmid (5) refers to the enzyme hydrolysis product of the supercoiled miniplasmid (5) by the action of restriction endonucleases that cut only one of the two strands of DNA.

The term miniplasmid-derived molecules (5) refers to linear DNA fragments (6) and / or the relaxed miniplasmid (5).

Appropriate cell density moment refers to the moment preceding the exponential phase of cell growth, which may have a more or less extended duration depending on the physiological state of the culture used as inoculum and the growth conditions. This moment should be understood as the initial stationary phase of cell growth.

Parental plasmid (3) at the heart of the process described herein is constructed so that it is possible to obtain high purity minicircles (4) suitable for pharmaceutical applications by a chromatographic step-based process that is easy to implement on an industrial scale. . The process steps used to produce the mini-circles (4) are shown schematically in Figure 1.

Parental plasmid (3) contains: i) the polynucleotide of interest, typically a eukaryotic expression cassette that contains the target gene suitable for the particular application, flanked by two targeted recombination sites that are recognized by a specific recombinase and ii) a backbone having sequences of essentially bacterial origin containing the elements necessary for the propagation of parental plasmid (3) in a bacterial guest, including an origin of replication and a check mark, which contain at least one and generally several restriction sites (single or double). not present in the polynucleotide of interest and recombination sites (Figure 2). This parental plasmid (3) is primarily used to transform a bacterial strain suitable for plasmid DNA production, usually deficient in functional endonuclease I and recombinase A (e.g. Escherichia coli DH5a).

The steps of the production and purification process, object of the present invention, are described below:

Step 1: Fermentation + recombination.

E. coli cells containing the parental plasmid (3) are normally grown in Erlenmeyer flasks or in a fermenter using appropriate culture media, temperature and pH. The pH value should be kept between 7 and 8, especially during the intramolecular recombination process. Growth is allowed to progress to an appropriate cell density and growth phase (e.g. initial stationary phase) to maximize parental plasmid yields (3). Intramolecular recombination of parental plasmid (3) into minicircle (4) and miniplasmid (5) is then triggered by introducing an induction factor into the cell culture. Growth is maintained for a period of time sufficient to maximize recombination efficiency.

Parental plasmid (3) used in this invention contains the multimeric resolution (MRS) sites of the parABCDE operon of the broad spectrum plasmid RK2. The specific recombinase acting on MRS is resolvase ParA (1) whose expression is under the control of the pBAD / araC system (Figure 3). Recombinant DNA cassettes (either pBAD / araC-parA or pBAD / araC-RBS-parA, which contain a synthetic ribosome binding site (RBS)) can be placed: 1) on the parental plasmid (3) , 11) a low copy helper plasmid containing a different origin of replication from that found in the parent plasmid (3) or iii) the bacterial host chromosome used for plasmid propagation.

The AraC protein acts negatively in the absence of arabinose, inhibiting ParA resolvase (1) expression from the BAD promoter. When present, L- (+) arabinose (2) binds to AraC, positively stimulating ParA resolvase expression (1) (Figure 3). Glucose, and at a later stage low cAMP levels, inhibit uncontrolled expression of ParA resolvase (1) from the pBAD promoter, preventing premature recombination from occurring. Since miniplasmids (5) contain the origin of replication, this tight control of ParA resolvase expression (1) is essential to prevent miniplasmids (5) from propagating and overlapping parental plasmids (3), thus leading to loss. mini-circles (4). Normally 0.5% -1% glucose is added to the culture medium during cell bank preparation, pre-inoculum growth and plasmid manipulation to ensure that parental plasmid (3) remains intact and predominant in cells

Induction of ParA resolvase (1) from the expression cassettes described above is performed by the addition of L- (+) arabinose (2) to the culture medium at pH 7-8 and 37 ° C. The expressed ParA resolvase (1) will then catalyze specific intramolecular recombination of the two MRS flanking the expression cassette in the parental plasmid (3) (Figure 4). This event gives rise to two supercoiled closed circular DNA molecules: i) a minicircle (4) (MC) containing the eukaryotic transcription cassette needed to express the target gene and ii) a replicative (5) miniplasmid (MP) containing the sequences of unwanted bacterial origin (Figure 4). The recombination process is allowed to take place long enough to maximize its efficiency.

In this invention, expression control by the pBAD / araC system was further improved using an E. coli strain (BW27783) optimized to incorporate arabinose (Khlebnikov et al., 2001). These cells continually express the AraE membrane transporter that delivers arabinose rapidly and uniformly within the cells, thereby eliminating all-or-nothing induction of pBAD. As a result much smaller amounts of L - (+) arabinose (2) (about 10,000 times less) can be used to induce pBAD.

Step 2: Preparation of the recombination products.

After collection, E. coli cells undergo a cell disruption process, for example by alkaline, mechanical, thermal or enzymatic lysis, which allows the recombination, minicircle (4) and miniplasmid (5) products to be released from the cells. The obtained lysates are then treated to provide the appropriate environmental conditions to promote the activity of the selected restriction endonuclease on the miniplasmids (5). In some situations treatment involves the addition of isopropanol to the lysates to promote precipitation of parental plasmids (3), miniplasmids (5), minicircles (4) and DNA in general. After centrifugation and re-solubilization of the DNA precipitates in a suitable buffer, enzyme restriction can be performed directly on the clarified lysates by adding appropriate amounts of the selected restriction enzymes. Preferably, and in order to obtain high purity minicircles (4), the recombination products are first isolated by a process using hydrophobic interaction chromatography. A molecular exclusion chromatography step is then used to replace the buffer with one more suitable for the following enzymatic hydrolysis. Preparation of the recombination products prior to enzymatic hydrolysis may also be performed using any prior art purification technique (e.g. ion exchange chromatography).

Step 3: In vitro enzymatic hydrolysis of miniplasmid (5) and parental plasmid (3) by restriction endonucleases.

In this step, the mixture of recombination products obtained in the previous step is subjected to an in vitro selective enzymatic hydrolysis reaction by restriction endonucleases in order to modify the structure of the miniplasmid (5) and parental plasmid molecules. (3) not recombined. Restriction endonucleases that act on endonuclease-specific recognition sites that have been placed on the bacterial portion of the parental plasmid (3) are used.

In one embodiment of the invention, specific restriction enzymes are used which act by cutting the two DNA strands by means of two incisions, one in each of the sugar phosphate chains (eg PvuII), thus yielding linear DNA fragments (6). Double stranded.

In the case of plasmid pMINI8, schematically described in Figure 2, hydrolysis with restriction endonuclease PvuII yields short linear DNA fragments between 337 and 414 base pairs (bp) in size, and fragments of 337 and 414 base pairs plus a fragment with (x + 281) base pairs, which originate from parental plasmids (3) that may be present in the mixture, where x corresponds to the size of the minicircle (4) (which depends on the gene of interest). that was cloned) (Figure 5).

Enzyme restriction may be carried out by adding appropriate amounts of the restriction enzyme to the clarified lysate containing the recombination products or to the solutions containing the purified recombination products. The optimal temperature for the PvuII restriction enzyme is 37 ° C and the restriction is conducted for 1-8 hours by adding 0.5-4.0 enzyme units per μρ of total plasmid in a suitable buffer. Desirably the linearized DNA fragments should be as small as possible in order to maximize the separation of minicircle molecules (4) from DNA impurities during subsequent chromatographic steps.

In some embodiments of the invention, additional smaller or larger linear DNA fragments (6) may appear depending on the construction of the parental plasmid (3) and where the ParA resolvase expression pBAD / araC-parA cassette (1) is placed . If the ParA resolvase expression cassette (1) is placed on a low copy helper plasmid that also contains PvuII restriction sites, that plasmid will also be digested, resulting in a set of restriction constructs of its own. If the cassette is placed on the parental plasmid (3), the fragment set generated from the restriction of the miniplasmid (5) and the parental plasmid (3) will also change. In this case, additional genetic modifications should be considered to create additional PvuII restriction sites so that satisfactory separation can be maintained between minicircles (4) and linear DNA fragments (6) during the subsequent separation process. Alternatively, different restriction sites recognizable by non-PvuII restriction endonucleases acting by cutting the two DNA strands can be placed on the parental plasmid (3) at slightly different sites.

In other embodiments of the invention, specific restriction endonucleases acting only by cutting one of the DNA strands (eg Nb.BbvCI) may be used, as an alternative to restriction endonucleases that produce linear DNA fragments (6) from the miniplasmid (5). ). In these cases, the supercoiled mini-plasmids (5) are transformed into relaxed mini-plasmids (5), which can then be separated from the supercoiled mini-circle molecules (4) by a suitable chromatographic technique.

Restriction endonuclease (single or double) may be a commercially available pure enzyme or an enzyme produced in bacterial cells by recombinant DNA technology. In the latter case, a partially purified enzyme may be sufficient to achieve complete hydrolysis of the recombination products.

Step 4: Separation of the mini-circles (4) from the enzymatic hydrolysis products.

In this step, the supercoiled minicircles (4) are separated from the molecules derived from the miniplasmids (5), non-recombinant parental plasmids (3) obtained in the previous step of selective in vitro enzymatic hydrolysis and other process impurities.

In one embodiment of the invention the robust, reproducible and scalable separation of linear DNA fragments (6) obtained by specific restriction enzymes acting by cutting the two DNA strands through two incisions of the supercoiled minicircles (4) was achieved by: (i) modifying the parental plasmid (3) to obtain DNA fragments after hydrolysis of miniplasmids (5) and parental plasmids (3) with sizes that facilitate chromatographic separation of minicircles (4), (ii ) DEAE (diethyl aminoethyl) anion exchange ligands that separate DNA molecules based on their charge density, which is in turn a function of their length and (iii) a chromatographic support that allows scalable, robust and minicircles (4).

In one embodiment of the invention, a DEAE anion exchange monolith is used to efficiently purify the mini-circles (4) of the linear DNA fragments (6). A typical monolith consists of a continuous bed made of a block of highly porous solid material with pore sizes of 600-750 nm (Smrekar et al., 2010, Urthaler et al., 2005). The main feature of these monoliths is that they allow the fluid phase to flow through these large pores, thereby increasing convective mass transport compared to the slow diffusion processes prevailing in conventional chromatographic particles. On the other hand, plasmids are relatively large molecules (super-helix axes about 560-1700 nm for 4-12 kilo base pair plasmids) that typically adsorb on the outer surface of the chromatographic particles. By comparison, in the case of monoliths the area available for adsorption of plasmid molecules is considerably larger (Smrekar et al., 2010). In addition, monolith separations are extremely rapid as a result of the high flow rates at low pressures at which they can operate and are typically characterized by high bonding capacities, yields and resolution. These characteristics are independent of flow rates and scale, which makes monoliths particularly suitable for the preparation of large-scale minicircles (4).

Commercially available polymethacrylate monoliths under the name Convective Interaction Media (CIM) (BIA Separations, Ljubljana, Slovenia) were used.

20 µg of recombination products were separated into a CIM-DEAE monolith (BIA Separations, V = 0.34 mL) equilibrated with 20 mM Tris-HCl, pH 8 using a 590 mM NaCl increasing gradient at 670 mM ( 24 column volumes, gradient gradient 10% B / min, where buffer B contains 1 M NaCl in 20 mM Tris-HCl, pH 8). However, separation resolution was found to decrease with increasing feed loading (75 μg of pMINI7GFPVEGF) as shown in Figure 7. In order to increase the loading and therefore the separation productivity in the same column, Mobile phase pH was optimized as described below.

diethyl amino ethyl weak anion exchanger (DEAE) amine group is positively charged at pH <9. At higher pH values, the DEAE groups deprotonate, losing their charge. DNA is a large, strongly electronegative molecule that interacts with anion exchange matrices across multiple sites, establishing a very strong interaction. At higher pH values, the number of DEAE groups charged is smaller and therefore fewer binding sites are involved in DNA binding. It is thus possible to elute DNA molecules with lower salt concentrations. For example, at pH 9 a 30 mM NaCl concentration was sufficient to elute DNA compared to 711 mM and 757 mM NaCl concentrations at pH 8 and pH 7, respectively (Figure 9). Moreover, at pH 9 the resolution between the short DNA fragments and the minicircles (4) increased, eluting the two molecule groups with a 20 mM NaCl difference. This difference allows the separation to be optimized by introducing a step gradient.

The salt concentration corresponding to the tail of the impurity peak was used to guide the establishment of a step elution scheme using 20 mM Tris-HCl buffers, pH 9 (buffer A) and 1 M NaCl in 20 mM Tris, pH 9 ( buffer B). In a typical experiment, 2 mL of a solution containing minicircles (4) and digested DNA impurities (26 μg) were injected into a CIM-DEAE monolith (0.34 mL) previously equilibrated to room temperature with 5 column volumes (CVs) of a mixture of buffers A and B with an initial NaCl concentration of 210 mM. The minicircles (4) were separated from the linear DNA fragments (6) of impurities by a step gradient using a flow rate of 1 mL / min. The salt concentration required to elute impurities ranged from 230 mM to 330 mM NaCl, depending on sample lots and buffers or environmental factors such as temperature. A long elution step of 15 CVs was used to ensure complete elution of impurities even when using high loads. The minicircles (4) eluted during the elution step at 40% buffer B as a narrow peak. At the end of each run the column was regenerated with 5 CV of a 1 M NaCl solution.

The process of separating minicircles (4) from linear DNA fragments (6) described in this invention is robust and scalable. These characteristics make it suitable for the production of minicircle quantities (4) of the order of gram-kilograms necessary for conducting preclinical and clinical trials or for establishing transient transfection protein production campaigns.

The present invention may be practiced using other ligands and chromatographic supports, such as monoliths, membranes and particles, capable of separating linear DNA fragments (6) from supercoiled minicircle (4) molecules. Other monolithic supports may also be used such as silica or polyacrylamide based monoliths. These monoliths may have varying pore sizes and active group densities.

In some embodiments of the invention, when enzymatic hydrolysis is performed directly on clarified lysates and not purified recombinant products, additional chromatography steps will be required to obtain final pharmaceutical purity grade mini-circles (4).

In other embodiments of the invention using specific restriction endonucleases acting by cutting only one of the DNA strands, the obtained relaxed miniplasmids (5) may be separated from the supercoiled minicircle molecules (4) by known chromatographic techniques as being capable of separating plasmid isoforms.

Step 5: Buffer Change

After separation of the linear DNA fragments (6) or the relaxed mini-plasmids (5), the purified mini-circles (4) are found in the buffer used to elute the chromatographic support. This buffer is usually exchanged for a formulation buffer suitable for the end use of the mini-circles (4) (eg in vivo and in vitro studies). Prior art methods for exchanging buffers of DNA containing solutions such as molecular exclusion chromatography, dialysis or DNA precipitation are suitable for this purpose.

Description of the figures

Figure 1 schematically depicts the process used to produce and purify minicircles (4).

Figure 2 schematically depicts the parental plasmids (3), pMINI5 and pMINI8. Bacterial sequences contain an origin of replication derived from the plasmid pUC (pUC ORI), a kanamycin resistance selection marker (KanR), naturally occurring PvuII restriction sites and those genetically engineered (PvuII) marked in black. . Functional eukaryotic expression cassettes contain a eukaryotic promoter (Peuk), the gene of interest (GOI) and a termination polyadenylation signal (polyA) marked in light gray. Bacterial sequences and functional eukaryotic expression cassettes are flanked on either side by similarly oriented multimer resolution (MRS) sites, which are recognized by a specific recombinase of these sites.

Figure 3 is a schematic diagram of the DNA cassette that has the ParA (1) resolvase responsible for recombination. The ParA gene is under the control of the BAD promoter (pBAD) and AraC repressor (araC) expression. The AraC protein acts negatively in the absence of arabinose, inhibiting BAD promoter-regulated ParA (1) expression. When L- (+) arabinose (2) is present, it binds to AraC, positively stimulating the expression of ParA resolvase (1). The ribosome binding site (RBS) is illustrated in the non-proportional size scheme.

Figure 4 schematically depicts, by way of example, the formation of minicircle (4) and miniplasmid (5) resulting from the recombination of parental plasmid (3) pMINI8 catalyzed by L (+) arabinose (2) induced ParA (1) resolvase . Minicircle (4) contains the eukaryotic expression cassette and one of the multimer resolution sites and miniplasmid (5) contains the bacterial elements and one of the multimer resolution sites.

Figure 5 schematically shows in vitro hydrolysis by restriction endonuclease PvuII of a mixture containing miniplasmids (5), minicircles (4) and parental plasmids (3). Hydrolysis yields small 337-414 bp linear DNA (6) fragments from miniplasmid (5) and 337-414 bp long fragments and a (x + 281) bp fragment from the parent plasmid (3). ), where x is the dimension of minicircles (4). The mini-circles (4) are left intact by PvuII.

Figures 6A and 6B illustrate a PvuII restriction enzyme hydrolysis of the recombination products present in purified samples or clarified lysates.

Figure 6A shows agarose gel electrophoresis analysis of a mixture obtained by PvuII hydrolysis of the parent plasmid (3) pMINI8 containing the purified GFP gene pMINI8GFP. Purified recombinant plasmids were subjected to enzymatic hydrolysis for 1-3 hours at 37 ° C by adding 0.1-1 U of the restriction enzyme PvuII (Thermo Scientific) per microgram of recombinant products in appropriate buffer (0.1 mL). The pMINI8GFP hydrolysis pattern consists of small linear DNA fragments (6) ranging in size from 337 to 414 bp and a large 2162 bp fragment that corresponds to the unrecombined parental plasmid (3).

Figure 6B shows agarose gel electrophoresis analysis of a mixture obtained by hydrolysis with PvuII (0.1-1 U PvuII / µg for 1-3 hours at 37 ° C) of a clarified lysate containing the parent plasmid ( 3) pMINI5GFP (pMINI5 containing the GFP gene) and the helper plasmid pMMBpar2A. The hydrolysis pattern of pMINI5GFP consists of 751, 731, 698, 360 bp linear DNA fragments (6) from the miniplasmid (5) and an additional 2162 bp fragment belonging to the parental plasmid (3) not recombined. Helper plasmid pMMBpar2A also has five cleavage sites for the enzyme PvuII, resulting in linear DNA fragments (6) of 6414, 3356, 836, 416, 281 and 93 bp. The last four fragments mentioned have a low relative mass and are therefore not visible on the agarose gel. Lane 61- purified recombination products. Lane 6 - recombination products from the clarified lysate, lane 6 - hydrolysis of the recombination products present in the clarified lysates, lane 6 - hydrolysis of the recombination products present in purified samples, lane M - molecular weight markers.

Figure 7 shows the separation, obtained by chromatography on a DEAE anion exchange monolith, between the recombination products and the linear DNA fragments (6).

Figures 7A and 7B illustrate a chromatographic separation on a 21 pg previously digested pMINI5GFPVEGF and pMMBpar2A CIM-DEAE monolith disk (V = 0.34 ml; BIA Separations).

panel A shows the chromatogram obtained with an increasing gradient of 590-670 mM NaCl over 24 column volumes (gradient gradient of 1% B / min). Buffer A: 20 mM Tris-HCl, pH 8, Buffer B: 1 M NaCl in 20 mM Tris-HCl, pH 8. Peak 71 corresponds to small linear fragments of about 350 bp, peak 711 contains 750 fragments. bp and peak 7111 corresponds to the mini-circle (4) overcoiled MC-GFPVEGF.

Panel B shows agarose gel electrophoresis analysis (1%) of the fractions of each peak. Lane 7mix loaded column, lane M-molecular weight markers, lanes 7i-fractions corresponding to peak 7i, lanes 7ii-fractions corresponding to peak 7ii, lanes 7iii-fractions corresponding to peak 7iii.

Figures 8A and 8B illustrate a chromatographic separation on a CIM-DEAE monolith disk (V = 0.34 mL; BIA Separations).

panel A shows the chromatogram obtained with an increasing NaCl gradient of 690-770 mM NaCl over 48 column volumes (gradient gradient 0.5% B / min). Buffer A: 20 mM Tris-HCl, pH 8, Buffer B: 1 M NaCl (in 20 mM TrisHCl, pH 8). Peak 8i corresponds to the linear DNA fragments (6) of about 350 bp, peak 8ii corresponds to the 750 bp fragments and peak 8iii corresponds to the supercoiled MC-VEGF minicircle (4).

Panel B shows agarose gel electrophoresis analysis (1%) of the fractions of each peak. Lane 8iv corresponds to pMINI7VEGF recombination products after induction at the time of collection and lane 8v shows the column-loaded PvuII digested mixture. The tracks grouped under the names 8i, 8ii and 8iii correspond to the fractions of peaks 8i, 8ii and 8iii, respectively.

Figure 9 shows the effect of mobile phase pH on binding, retention and elution of 13 pg of digested recombinant products, chromatographic separation performed on a CIM-DEAE monolithic disk (BIA Separations). With increasing pH fewer DEAE groups are charged and due to weaker retention, a lower salt concentration is required for DNA elution. % B represents the percentage of buffer B used.

Figures 10A and 10B illustrate chromatographic separation on a previously digested pMINI8GFP pg (pMINI8 containing the GFP gene) CIM-DEAE monolith disk (V = 0.34 mL; BIA Separations).

panel A shows the chromatogram obtained with a rising gradient of 210-290 mM NaCl in 24 column volumes (gradient gradient of 1% B / min.) Buffer A: 20 mM Tris-HCl, pH 9, Buffer B: NaCl 1 M (in 20 mM Tris-HCl, pH 9). Peak 101 at 7-8 minutes corresponds to small linear DNA fragments (6) of about 350 bp and peak 1011 at 9.5 minutes corresponds to minicircle (4) MC-GFP.

Panel B shows agarose gel electrophoresis analysis (1%) of the fractions of each peak. Lane 10111 corresponds to the column-loaded PvuII digested recombinant product mixture, lanes 101 correspond to fractions relative to peak 101, and lanes 1011 correspond to fractions relative to peak 1011.

Figures 11A and 11B illustrate chromatographic separation on a CIM-DEAE monolithic disk (V = 0.34 mL; BIA Separations) of 48 pg of previously digested pMINI8GFP.

Panel A shows the chromatogram obtained with a succession of step gradient NaCl: 21% B (5 column volumes), 25.9% B (15 column volumes), 40% B (5 column volumes). column) and 100% B (5 column volumes). Buffer A: 20 mM Tris-HCl, pH 9, Buffer B: 1 M NaCl (in 20 mM Tris-HCl, pH 9). Peak 111 corresponds to linear DNA fragments (6) and peak 1111 corresponds to minicircle (4) MC-GFP.

Panel B shows agarose gel electrophoresis analysis (1%) of the fractions of each peak. Lane 11 corresponds to the column-loaded mixture of PvuII digested recombinant products, lanes 111 correspond to fractions for peak 111, and lanes

1111 correspond to the fractions relative to peak 1111.

Examples

The following examples are presented to provide those skilled in the art with a complete disclosure of how to make and use the present invention. These examples are not intended to limit the scope of the invention nor are they intended to represent that the experiments below are all or the only experiments performed.

EXAMPLE 1

Plasmids and bacterial strains.

Construction of pVAXmini, pMINIGFP, pMINI5GFP, pMINI8GFP parental plasmid (3) pVAXmini (5944 bp) containing the pBAD / araC-ParA cassette, two parABCDE operon multimer (MRS) resolution sites and the green fluorescent protein (GFP) gene ), was constructed using the following base plasmids: i) pVAXIGFP (3697 bp), which contains the GFP gene, and was derived from pVAXILacZ (Invitrogen, Carlsbad, CA) as described previously (Azzoni et al., 2007) and ii) pUC57cas, which contains a cassette with the ParA resolvase gene (1) under BAD promoter regulation, the antisense AraC repressor gene, and a multimer resolution site (MRS) upstream of pBAD (obtained from NZYTech Lda , Lisbon, Portugal). Firstly, cleavage sites for restriction enzymes Nsil and SalI were introduced into pVAXIGFP by directed mutagenesis using 0.3μΜ of the MutNSilSalIfwd primer (CTATGGCTTCTAATGCATGGTTTTTGTCGACAGCAGACCGGTGACTAGTCATATTCTATATATCACTATACTAGACTAGACTAGTACTAGTACTAGACTAGTACTAGTACTAGACTGATATGACTAGTACTAGACTGATACAGA pVAXIGFP mold. An MRS site for ParA resolvase (1) was generated by polymerase chain reaction (PCR) amplification using 0.6 μΜ MRS2fwd (CATGCATTCGCGATTGGTCAAATTGGG) containing the NruI (underlined) restriction site, 0.6 μΜ MRS2rev ( TGCAAGCAACGCGTTAGCACATATGTG) containing the MluI restriction site (underlined) and 10 ng pUC57cas template DNA. The PCR fragment and plasmid pVAXIGFP were digested with MluI and NruI. For cloning, a 2x Clonables ™ binding premix (Novagen) was used to obtain plasmid pVAXMRS. The pBAD / araC-MRS cassette was amplified using the casParAfwd primer (CCCTCATGCATTCCCCCTTGG), which contains the Nsil restriction site (underlined), the casParArev primer (AGCCGTCGACTGCCCGGCTTA), which contains the Sall (also underlined) restriction site. plasmid pUC57cas as template DNA. The PCR fragment and plasmid pVAXMRS were digested and subsequently ligated (Clonables ™ 2x binding premix, Novagen) to yield pVAXmini (5944 bp).

Parental plasmid (3) pMINIGFP (4702 bp) originated from pVAXmini (5944 bp), removing the pBAD / araCParA region by hydrolysis with Sfil and EcoRV, and treating the mung bean endonuclease mixture (New England Biolabs) , to remove single stranded ends and allow re-ligation using T4 DNA ligase (Promega).

Plasmids pMINI5GFP, pMINI6GFP, pMINI7GFP, pMINI8GFP (4702bp) were constructed by introducing into pMINIGFP respectively three, four and five additional PvuII endonuclease restriction sites. PMINIGFP already has two PvuII locations (Figure 2). Primers for directed mutagenesis were obtained from STABvida (Lisbon, Portugal) and their sequences are shown in Table 1. Targeted mutagenesis was performed by PCR with 1 pL KOD Hot Start DNA polymerase (Novagen), 5 pL 10x KOD buffer, 4.5 pL MgSO4, 5 pL dNTPs, 10 ng pMINI template DNA and 0.2 pM of each forward and reverse primer in a total volume of 50 pL. The PCR conditions (Whatman Biometra Tgradient) were as follows: 2 min of 95Â ° C DNA polymerase activation, and 16 cycles of 20s at 95Â ° C, 10s at 69Â ° C and 2.5 minutes (approximately 30s / kb ) at 70 ° C. Ten units (1 mL) of the DpnI restriction enzyme (Promega) were added directly to the PCR mix to digest the methylated DNA, i.e. the unchanged template plasmid, for 1 hour at 37 ° C. E. coli DH5alpha cells were transformed by the addition of 20 µl of the enzymatically treated PCR mixture and positive colonies were confirmed by the restriction pattern of the new plasmid DNA.

Table 1: Primer sequences used to create pMINI8GFP by introducing cleavage sites for restriction enzyme PvuII into pMINIGFP by directed mutagenesis.

Name of

Sequence 5'-3 'direct primer: the reverse CTATGGAAAAACGCCAGCTGCGCGGCCTTTTTACGGTT pMINI5 _____________________________________________________: Direct AACCGTAAAAAGGCCGCGCAGCTGGCGTTTTTCCATAG: CCCTATGCTACTCCGTCCAGCTGTCAATTGTCTGATTCG pMINI5_b ___________________________________________________ reverse: Direct CGAATCAGACAATTGACAGCTGGACGGAGTAGCATAGGG: GACAATAACCCTGATAAATGCTTCAATAATAGCAGCTGCT AAAAC CAT T T T T T TAAT TAAAA pMINI5_c ___________________________________________________ reverse: TTTTAAATTAAAAATGAAGTTTTAGCAGCTGCTATTATT

GAAGCATTTATCAGGGTTATTGTC direct: TGCCTGGCGTGGTGCAGCTGTCGGAGCTGG pMINI6 ___________________________________________________________ reverse: CCAGCTCCGACAGCTGCACCACGCCAGGCA

pMINI7 direct: GCTAATCCTGTTACCAGCTGCTGCTGCCAGTGG reverse : CCACTGGCAGCAGCAGCTGGTAACAGGATTAGC pMINI8 direct: CGTGACCCATGGCGACAGCTGCTTGCCGAATATC reverse : GATATTCGGCAAGCAGCTGTCGCCATGGGTCACG

Construction of Plasmids pMMBparA, pMMBpar2A low copy number plasmid pMMB206 was purchased from ATCC (37808 ™). Inserting the ParA-araC cassette with the original or synthetic ribosome binding sites (RBS) into this plasmid gave plasmids pMMBparA and pMMBpar2A, respectively. The strength of the synthetic RBS was calculated and the sequence was drawn using the online RBS calculator (Sali set al., 2009).

Original RBS ... C®1®®TTTCTCCATACCCGTTTTTTTGGATGG

6 AU (Par) AGTGAAACGATGGCGACGC. ··

Synthetic RBS ... CIRCUITTTCTCCATACTAAAACGAAGAGTAGG 20000 AU (Par2A) AGGAGACCAATGGCGACGC. ··

Synthetic RBS was introduced upstream of ParA, replacing the original RBS of the pBAD / araC inducible system with SOEing PCR. Firstly, two similar sized fragments showing overlap of 27 bp (underlined nucleotides) of the new RBS were synthesized by conventional PCR using sets of Spar2Afwd primers (CGAAGCAGGGATTCTGCAAAC) and Spar2Arev (TGGTCTCCTCCTACTCTTCGTTTTAGTATGGAGAAACAGTAGAGAGTTGCGA) or Spar2Bfwd (ACTAAAACGAAGAGTAGGAGGAGACCAATGGCGACGCGAGAGCAAC) and Spar2Brev (TGATAGCGGTCCGCCACA) and pVAXmini as template DNA. In the second step, the two synthesized fragments were paired by complementary regions and subjected to 5 cycles without primers and thus creating a template for the next PCR reaction with Spar2Afwd and Spar2Brev end primers. Figure 3 shows a schematic drawing of the pBAD / araC-RBS-ParA cassette.

BWAA strain construction

E. coli strain BVI21183 [F-, Δ (araD-araB) 567,

AlacZ4787 (:: rrnB-3), λ ~, Δ (araH-araF) 570 (:: FRT), AaraEp532 :: FRT, (pP _C p8araE535, rph-1, A (rhaD-rhaB) 568, hsdR514] for enhanced arabinose absorption was purchased from The Coli Genetic Stock Center at Yale (New Haven, CT) In order to obtain a strain suitable for plasmid production, the genes responsible for non-specific DNA hydrolysis (endA) and homologous recombination. (recA) strain BW27783 were knocked out by PI transduction (Baba et al. 2006), resulting in E. coli strain BWAA.

BW2P strain construction

E. coli strain BW2P was obtained from strain BW27783 by replacing the endA gene with the ParA resolvase gene (1) fused to the synthetic ribosome binding site (RBS) and by knockout of the recA gene. The insertion of the pBAD / araC-RBS-ParA cassette was performed by an adapted λRed recombination as described by Datsenko and Wanner (2000) and recA knockout was performed by PI transduction using techniques known to the skilled artisan (producing the new strain E. coli BW2P.

Briefly, the pBAD / araC-RBS-ParA cassette located in the pTKIPpar2A template plasmid was amplified between Sall and Smal (Kuhlman & Cox, 2010) using Platinum PCR Supermix (Invitrogen) and 300 nM from each primer (par2Afwd: TCGAGGTCGACTGCCCGGCT). and AraCSalIrev: TCCGTCAAGCCGTCGACTGTCTG).

The ParA-araC-RBS-ParA cassette was purified from an agarose gel and was then cloned into the SalI site of plasmid pKD13 using techniques known to the skilled artisan. 0 resulting plasmid was then used to amplify the complete recombination Kan cassette (kanamycin) using 300 nM each of primers EndA_cass_for2: ATCTGGCTGATTGCATACCAAAACAGCTTTCGCTACGTTGCTGGCTCGTTTTAACACGG AGTAAGTGATGGTGTAGGCTGGAGCTGCTTC and EndAPar2Acasrev: GTTGTACGCGTGGGGTAGGGGTTAACAAAAAGAATCCCGCTAGTGTAGGTTAGCTCTTT CGCGCCTGGCATTAATTCCGGGGATCCGTCG. The homology of the target endA gene in the genome is underlined. The Kan cassette was used to transform E. coli BW27783 / pKD46recA electrocompetent cells to allow homologous recombination. The kanamycin resistance gene was removed by FLP recombinase encoded by plasmid pCP20 (Datsenko and Wanner, 2000).

RecA knockout in the newly formed E. coli strain was performed by PI transduction. Briefly, PI transduction allows the transfer of genetic material from a donor strain to a receptor strain. The donor strain from the Keio collection contains a kanamycin resistance cassette (KanR) in a single gene knocking out that gene. Donor cells are infected by PI phage and their DNA is used to transfect the recipient cells. The kanamycin resistance gene is removed using the FLP recombinase enzyme (from the helper plasmid pCP20) as it acts on the FRT sites flanking the KanR gene (Baba et al., 2006).

EXAMPLE 2

Growth of E. coli BWAA pMINI5GFP with helper plasmid pMMBpar2A in shake flask culture.

mL of LB medium (Luria Bertani) supplemented with the appropriate antibiotics (30 pg / mL kanamycin, 34 pg / mL chloramphenicol) and 0.5% (w / v) glucose were inoculated with a frozen E-cell loop. coli containing the parent plasmid (3) together with the helper plasmid and incubated overnight at 30 ° C, 250 rpm. An appropriate volume of this inoculum was then used to inoculate 250 mL of LB medium containing antibiotics with an optical density (OD) of 0.1. This medium was incubated for about 4 hours at 37 ° C, 250 rpm, until reaching the stationary phase, which in the case of the present invention typically occurs at cell density values between 3.5 and 4.5. At that time, transcription of ParA resolvase (1) was induced by the addition of 0.01% L- (+) arabinose (2) (Merck) directly to the medium and the cells were further incubated for an additional one or two hours. allow recombination of the parental plasmid (3). A schematic drawing showing parental plasmid recombination (3) is shown in Figure 4. This type of production process yielded 8.2 ± 1.0 mg / L of recombinant products in which the highest recombination efficiency was 95%. obtained after 2 hours of induction.

EXAMPLE 3

E. coli BW2P / pMINI8GFP growth in bioreactor.

A pre-inoculum was prepared by transferring cells from frozen cells (1% v / v) to 5 ml complex medium [Bacto-peptone 10 g / l, yeast extract 10 g / l, (NH ₄ ) ₂ SO ₄ 3 g / l, K ₂ HPO ₄ 3.5 g / l, KH ₂ PO ₄ 3.5 g / l, thiamine 199 mg / l, MgSO ₄ 1.99 g / l, trace element solution 1 ml / L] supplemented with 30 pg / ml kanamycin and 5 g / L glucose.

Cells were grown overnight at 30 ° C and 250 rpm. The next day, an inoculum was prepared by inoculating 100 mL of complex medium supplemented with 2 g / L glycerol with 1% of the preculture inoculum. These cells were cultured to the initial exponential phase, to OD values at a wavelength of 600 nm of about 1.1 at 37 ° C and 250 rpm. Fermentations were performed in a Fermac 360 (Electrolab) bioreactor with a working volume of 1.1 L. Firstly, 1 L of complex medium was autoclaved in the bioreactor and the medium supplements, trace element solution, kanamycin (30 mg / L) and glycerol (20 g / L or 40 g / L) were added. The reactor was then inoculated with the required inoculum volume to obtain an OD at the initial 600 nm wavelength of 0.1. The setpoint for dissolved oxygen was adjusted to 30% using a stirring cascade (200 rpm to 800 rpm) and air was supplied at a flow rate of 1 vvm. The pH was maintained at 7.10 using 2 M NaOH and 2 H2 H 2 SO 4. The antifoam was added manually as needed. Samples were taken periodically from the bioreactor to quantify biomass, glycerol, acetate and plasmid DNA. The yield of plasmid DNA volumetric production analyzed by HPLC was 53.7 + 6.2 mg / L after 24 hours of growth. The recombination efficiency and mini-circle molar fraction (4) in the plasmid population varied depending on the induction scheme. Induction of intramolecular recombination by 0.01% L- (+) arabinose (2) exponentially (4 hours, OD about 10) resulted in 100% recombination after 2 hours of additional growth containing 10% of the amount. of mini circles. Early stationary induction (12 hours, with an OD value of about 40) for 12 hours resulted in 75% recombination with minicircles (4) representing 50% minicircle (4) of total plasmid.

EXAMPLE 4

Preparation of purified pDNA.

Total plasmid DNA was purified from cells harvested at the end of fermentation using a process that combines cell disruption by alkaline lysis, isopropanol and ammonium sulfate precipitation, hydrophobic interaction chromatography (HIC) and molecular exclusion chromatography (SEC) , adapted from Diogo (2000, 2005). Briefly, cells corresponding to 500 ml bioreactor culture were resuspended in 110 ml 50 mM glucose, 10 mM EDTA and 25 mM Tris pH 8. Lysis was performed by adding 110 ml 200 mM NaOH, the 1% (w / v) sodium dodecyl sulfate (SDS) in ice, and quenched by the addition of pre-cooled 110 mL of a 5 M acetate / 3 M potassium acetate pH 5.0 solution. Cell debris and genomic DNA / protein precipitates were removed by centrifugation (40 min, 9,000 rpm, 4 ° C) and nucleic acids in the supernatant (about 300 mL) were precipitated by adding 0.7 volumes of isopropanol to room temperature, 1 hour at 4 ° C. The precipitate was recovered by centrifugation (40 minutes, 13,300 rpm, 4 ° C) and ethanol wash (70% v / v).

The pellet containing the plasmid was then resuspended in 10 mM Tris (pH 8) (1 mL for each 25 mL of original lysate). Solid ammonium sulfate was then dissolved in the plasmid solution to a 2.5 M concentration to condition the sample prior to hydrophobic interaction chromatography. After incubation on ice (15 minutes), some impurities precipitated and were removed by centrifugation (15 minutes, 13200 g, 4 ° C) and discarded. The supernatant containing the plasmid (about 8 mL) was loaded onto a 25 mL glass column filled with Phenyl Sepharose (GE Healthcare) and pre-equilibrated with 1.5 M ammonium sulfate in 10 mM Tris, pH 8 (2 mL). / min) using an Akta Purifier 10 system. Isocratic elution with 1.5 M ammonium sulfate in 10 mM Tris-HCl, pH 8 was performed at a flow rate of 2 mL / min. After elution of unbound and weakly retained molecules with 1.5 M salt, the ionic strength of the buffer was reduced (10 mM Tris-HCl, pH 8) to elute bound species. 0.5 mL fractions were collected in 1.5 mL tubes. Fractions containing the plasmid were then subjected to molecular exclusion chromatography on the same column (6 mL of the charge) using an isocratic 10 mM Tris run, pH 8 (1 mL / min) as the equilibration and run buffer. 0.5 mL fractions were collected in 1.5 mL tubes.

EXAMPLE 5

Hydrolysis of recombination product impurities (plasmid DNA).

The hydrolysis of the impurities (miniplasmid (5) and non-recombined parent plasmid (3)) of the plasmid DNA is shown schematically in Figure 5. The purified and recombinant plasmids were subjected to enzymatic hydrolysis in vitro for 1-3 hours at 37 °. C is by adding 0.1-1 U of the restriction enzyme PvuII (ThermoScientific) per µg of recombinant products in an appropriate buffer. Digested samples were analyzed by gel electrophoresis (Figure 6A). Hydrolysis was performed in volumes ranging from 0.1 to 7 mL. Complete hydrolysis was observed using 1 U enzyme per microgram plasmid in one hour or 0.5 U enzyme in 3 hours. The digested pattern of pMINI8GFP consists of short linear DNA fragments (6) ranging in size from 337 to 414 bp and 2,162 bp of the long fragment corresponding to the non-recombined parent plasmid (3). Recombinant products can also be digested directly into the clarified lysate obtained after precipitation with isopropanol under the same conditions used in the hydrolysis of purified samples (Figure 6B). The hydrolysis pattern of pMINI5GFP consists of 751, 731, 698, 360 bp fragments from miniplasmid species (5) and an additional 2,162 bp fragment corresponding to the non-recombined parent plasmid (3). Helper plasmid pMMBpar2A also exhibits five cleavage sites for the PvuII enzyme, resulting in linear DNA fragments (6) of 6,414, 3,356, 836, 416, 281 and 93 bp, although as the last four fragments mentioned exhibit unrelated low relative mass. are visible appear on the agarose gel.

EXAMPLE 6

Purification of the MC-GFP, MC-VEGF and MCGFPVEGF minicircles (4) on a CIM-DEAE disc using a pH 8 elution gradient.

The Convective monolithic disk (diethylamino, anion exchanger Ljubljana, Slovenia), with one in the AKTA Purifier system 10 following minicircles (4): (1,730 bp) (see Figure 7) and Figure 8).

Corresponding sequences have five or seven loci d

Interaction Media (CIM) -Weak Single DEAE (BIA Separations, 0.34 mL volume was used (GE) for separation of MC-GFP (1,881 bp), MC-VEGF

MC-GFPVEGF (2,457 bp) (see Parental Plasmids (3) 3 PvuII restriction, yielding linear DNA fragments (6) of about 750 bp and about 350 bp after hydrolysis with PvuII. Buffer A consisted of 20 mM Tris -HCl (pH 8) and 1 M NaCl Buffer B (in 20 mM Tris-HCl, pH 8.) More than 50 µl of the PvuII hydrolysis mixtures were injected manually or with an automatic injector into the column previously equilibrated with the initial NaCl concentration at room temperature.The minicircles (4) were separated from the linearized impurities using a rising gradient of B (50% to 80% B) with a slope of 0.5% or 1% B / min with 1 mL / min flow rate The absorbance of the eluate was continuously measured at around 260 nm at the disc exit 0.3 ml fractions were collected in 96-well plates The mixture containing the minicircle peak fractions (4 ) was buffer exchanged by dialysis or using Microcon 3K or 50K tubes (Millipore).

EXAMPLE 7

Purification of the minicircle (4) MC-GFP on a gradient eluted CIM-DEAE disc at pH 9.

The Convective Interaction Media (CIM) -DEAE monolithic disk (diethylamino, weak anion exchanger) (BIA Separations, Ljubljana, Slovenia) with a volume of 0.34 mL was used in the AKTA Purifier 10 (GE) system for minicircle separation (4) MC-GFP. MC-GFP is obtained from a parental plasmid (3) containing eight PvuII restriction sites that originates from the miniplasmid (5) linear DNA fragments (6) of about 350 bp following hydrolysis with PvuII. Elution buffer A consisted of 20 mM Tris-HCl (pH 9) and 1 M NaCl buffer B (in 20 mM Tris-HCl, pH 9). 1 or 2 mL of digested recombination products were manually injected into a pre-equilibrated disc at room temperature with 5 column volumes of buffer containing

NaCl at desired initial concentration. The minicircle (4) was separated from the linearized impurities using an increasing gradient of B (20% to 40% B) with a gradient of 1% B / min and a flow rate of 1 mL / min.

The eluate absorbance was continuously measured at c.d.o. 260 nm at the disk output. 0.2 ml fractions were collected in 96-well plates. The mixture containing the minicircle peak fractions (4) was dialysed buffered against 10 mM Tris-HCl, pH 8. The chromatogram and representative fractions are shown in Figure 10.

EXAMPLE 8

Purification of the MC-GFP mini-circle (4) on a step-eluting CIM-DEAE disc at pH 9.

The Convective Interaction Media (CIM) -DEAE monolithic disk (diethylamino, weak anion exchanger) (BIA Separations, Ljubljana, Slovenia) with a volume of 0.34 mL was used in the AKTA Purifier 10 (GE) system for minicircle separation (4) MC-GFP. MC-GFP is obtained from a parental plasmid (3) containing eight PvuII restriction sites that originates from the miniplasmid (5) linear DNA fragments (6) of about 350 bp following hydrolysis with PvuII. Elution buffer A consisted of 20 mM Tris-HCl (pH 9) and 1 M NaCl buffer B (in 20 mM Tris-HCl, pH 9). 2 mL of digested recombination products were manually injected into a pre-equilibrated disc at room temperature with 5 column volumes of NaCl buffer at an initial concentration of 210 mM. The minicircle (4) was separated from the linearized impurities using a step gradient series with a flow rate of 1 mL / min.

The salt concentration required for elution of the impurities may range from 230-330 mM NaCl, depending on the sample lot or preparation of the elution buffers. A long elution step using 15 column volumes was used to ensure complete elution of the impurities. The minicircle (4) eluted as a narrow peak during the 40% B elution step. At the end of each run, the column was regenerated with 5 column volumes of 1 M NaCl. For the exact identification of the most critical step: the elution of impurities, a main elution gradient of 50 microliters of sample with a gradient gradient of 1% B / min, allowed the specific identification of conductivity at the end of the impurity peak and therefore , identify the corresponding% B required to define the step gradient elution scheme.

The eluate absorbance was continuously measured at c.d.o.

260 nm at the disk output. 0.2 ml fractions were collected in 96-well plates. The mixture containing the minicircle peak fractions (4) was dialysed buffered against 10 mM Tris-HCl, pH 8. The chromatogram and representative fractions are shown in Figure 11.

Bibliographic references

Azzoni, A. R., Ribeiro, S. C., Monteiro, G. A., & Prazeres, D. M. F. (2007). The impact of polyadenylation signs on ptasmid nuclease-resistance and transgene expression. Journal of Gene Medicine, 9 (5), 392-402.

Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, K.A., Tomita, M., Wanner, B.L., Mori, H. (2006). Construction of Escherichia coli K-12 single-frame knockout mutants: the Keio collection.

Molecular Systems Biology

2, 2006,0008.

Bigger, B.W.

Tolmachov, O., Collombet

J.M. Fragkos

M., Palaszewski, I., & Coutelle, C.

(2001). An araCcontrolled bacterial cre expression system to produce

DNA minicircle vectors for nuclear and mitochondrial gene therapy. Journal of Biological Chemistry, 276 (25)

23018-23027.

Chen, Z., He, C., Ehrdfardt, A., & Kay, Μ. A. (2003).

Minicircle DNA Vectors Devoid of Bacterial DNA Results

Persistent and High-Level

Transgene Expression

I live. Molecular

Therapy

Chen, Z. Y., He

C. Y., & Kay

Μ A. (2005). Improved production and purification of minicircle

Free vector DNA of bacterial plasmid sequences and capable of persistent transgene expression alive.

Human gene

Therapy

16 (1), 126-131.

Darquet, A.

M., Cameron, B., Wils, P.

Scherman, D., &

Crouzet

J. (1997). A new DNA vehicle for nonviral gene delivery:

supercoiled minicircle. Gene Therapy, 4 (12)

1341-1349.

Darquet

A. M., Rangara

R., Kreiss

P . , Schwartz

Naimi

Delaere

P.

Crouzet

Scherman

D.

Minicircle:

an improved DNA molecule for and in vivo gene transfer. Gene Therapy, 6 (2)

209-218.

Datsenko

Wanner

B. L. (2000). One-step inactivation of

K-12 using chromosomal PCR genes in Escherichia coli products. Proceedings of the National

Academy of Sciences of the United States of America, 97 (12), 6640-6645.

Jechlinger, W., Tabrizi, C.A., Lubitz, W., & Mayrhofer, P. (2004). Minicircle DNA immobilized in bacterial ghosts: In vivo production of safe non-viral DNA delivery vehicles. Journal of Molecular Microbiology and Biotechnology, 9 (4), 222-231.

Kay, Μ. A., He, C. Y., & Chen, Z. Y. (2010). A robust system for the production of minicircle DNA vectors. Nature Biotechnology, 29 (12), 1287-1289.

Khlebnikov, A., Datsenko, K. A, Skaug, T., Wanner, B. L., & Keasling, J. D. (2001). Homogeneous expression of the P (BAD) promoter in Escherichia coli by constitutive expression of the low-affinity high-capacity AraE transporter. Microbiology (Reading, England), 141 (Pt

12), 3241-7.

Kobelt, D., Schleef, M., Schmeer, M., Aumann, J., Schlag, P. M., & Walther, W. (2012). Performance of high

Quality Minicircle DNA for In Vitro and In Vivo Gene Transfer. Molecular Biotechnology, 1-10.

Kreiss, P., Cameron, B., Darquet, A.M., Scherman, D., & Crouzet, J. (1998). Production of a new DNA vehicle for gene transfer using site-specific recombination.

Applied Microbiology and Biotechnology, 49 (5), 560-567.

Kuhlman, T.E., & Cox, E.C. (2010). Site-specific chromosomal integration of large synthetic constructs.

Nucleic Acids Research, 38 (6), e92.

Mayrhofer, P., Blaesen, M., Schleef, M., & Jechlinger, W. (2008). Minicircle-DNA production by site-specific recombination and protein-DNA interaction chromatography. Journal of Gene Medicine, 10 (11), 12531269.

Nehlsen, K., Broll, S., & Bode, J. (2006). Replicating minicircles: Generation of nonviral episodes for efficient modification of dividing cells, Gene Therapy and Molecular Biology, 10, 233-244.

Salis, Η. M., Mirsky, E.A., & Voigt, C.A. (2009).

Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology, 27 (10), 946-50.

Schleef, M., Blaesen, M., Schmeer, M., Mayrhofer, P., Jechlinger, W., & Baier, R. (2008). Minicircle-DNA-a safe and efficient vector system for gene therapy and vaccination. Human Gene Therapy, 12 (10), 1089-1090.

Schmeer, M., Blaesen, M., Mayrhofer, P., Jechlinger, W., Baier, R., & Schleef, M. (2008). Large scale minicircle-DNA production becomes reality. Human Gene Therapy, 12 (10), 1152.

Smrekar, F., Podgornik, A., Ciringer, M., Kontrec, S., Raspor, P., Strancar, A., and Peterka, M. (2010).

Preparation of pharmaceutical-grade plasmid DNA using methacrylate monolithic columns. Vaccine, 22 (8), 203945.

Urthaler, J., Schlegl, R., Podgornik, A., Strancar, A., Jungbauer, A., & Necina, R. (2005). Application of monoliths for plasmid DNA purification. Journal of

Chromatography A, 1065 {1}, 93-106.

Claims (3)

1. Process for the purification of mini-circles (4) of supercoiled DNA containing the steps of: a) production of bacterial cells containing a circular parental plasmid (3) and induction of intramolecular recombination; b) cell disruption of cells and preparation of a mixture of recombination products containing minicircles (4), miniplasmids (5) and non-recombined parent plasmid (3); characterized by further containing the steps of: c) incubating, in vitro, said mixture of recombination products with a restriction endonuclease, which specifically recognizes and cleaves restriction sites placed on the bacterial sequences of the non-recombinant miniplasmids (5) and parental plasmids (3) to obtain a mixture of intact minicircles (4) and molecules derived from miniplasmids (5) and non-recombinant parental plasmids (3), both modified, by said restriction endonuclease; d) separation of intact supercoiled minicircles (4) from molecules derived from miniplasmids (5), parental plasmids (3), both modified, by chromatographic procedures using supports lacking affinity ligands. Process according to Claim 1, characterized in that the modification of molecules derived from non-recombinant miniplasmids (5) and parental plasmids (3) is effected by a specific restriction endonuclease acting at the restriction site by cutting off the two DNA strands. by two incisions, one in each of the sugar-phosphate chains, and the molecules derived from the non-recombinant miniplasmids (5) and parental plasmids (3) being linear fragments of double stranded DNA. Process according to Claim 2, characterized in that the modification of molecules derived from non-recombinant miniplasmids (5) and parental plasmids (3) is carried out alternatively by a specific restriction endonuclease acting at the restriction site by cutting only one of the DNA strands by an incision in one of the sugar phosphate chains, and because the molecules derived from non-recombinant miniplasmids (5) and parental plasmids (3) are relaxed.