PL222795B1 - Rekombinant fusion protein ProSTAT and its application - Google Patents

Abstract

The invention provides recombinant fusion protein ProSTAT, comprising a transporting cassette which enables the protein to enter into the cell, and an active cassette comprising the sequence of the human BID protein, which selectively sensitizes cancer cells, in particular of prostate cancer, cervix carcinoma, non-small cell lung cancer, as well as composition comprising it and their use as anticancer medicaments or agents sensitizing to apoptosis or inducing apoptosis.

Description

Description of the invention

The field of technology

The present invention relates to a recombinant ProSTAT fusion protein comprising a transport cassette allowing the protein to enter a cell, particularly TAT, and an active cassette comprising a sequence of a human BID protein that selectively sensitizes tumor cells, in particular advanced prostate cancer cells, to apoptosis-inducing anti-cancer drugs for use in the treatment of prostate cancer, more preferably advanced prostate cancer and non-small cell lung cancer.

State of the art

Prostate cancer is the third most common form of cancer in men, accounting for about 10% of all cancers in this group. At the same time, prostate cancer is one of the most commonly diagnosed cancers and is the second most common cancer-related cause of death in men; it's only second to lung cancer. In 2010, it was estimated that approximately 1,750,000 men were affected by prostate cancer in the seven major anticancer drug markets (The Cancer Market Outlook to 2016, 2011). In Poland, 8,300 cases and approximately 4,000 deaths due to prostate cancer were recorded in 2008 (Jassem et al. (Eds), 2013). According to WHO data, high-income countries have ten times higher incidence of prostate cancer than others (Global Health Observatory Data Repository. WHO). In the 27 countries of the European Union (EU-27), the highest incidence of prostate cancer is in Ireland (183.2 new cases per 100,000) and the lowest in Greece (27.9 cases per 100,000), with an average of 105.6 cases per 100,000. 100,000 (European Age-Standardized Rates, 2011). The epidemiological forecast up to 2016 shows a moderate increase in the incidence of prostate cancer in seven major markets, with the increase still high relative to other types of cancer.

The method of prostate cancer treatment depends on the degree of risk as well as the patient's age and coexisting conditions (Heidenreich et al., 2008). The standard treatment for low and intermediate risk prostate cancer is removal of the prostate gland (radical prostatectomy), radiotherapy and hormone treatment. The latter involves blocking androgen receptors with antiandrogens (flutamide, bicalutamide) or inhibiting androgen secretion with analogs of luteinizing hormone releasing hormone (gorselin, leuproleline). By the nature of their action, these drugs target hormone-responsive cancer cells. In prostate cancer, many patients who respond well to hormone therapy develop resistance to hormone therapy over time (so-called castration-resistant prostate cancer; CRPC). The chemotherapy used at that time has a rather poor set of effective cytostatics, mainly taxoid derivatives (docetaxel (Heidenreich et al., 2008), cabazitaxel (Jassem et al. (Eds), 2013) and mitoxantrone (Heidenreich et al., 2008; Jassem et al. (eds), 2013) Therefore, despite the success of some combination therapies using cytotoxic agents, new drugs are needed, especially for the treatment of advanced prostate cancer.

Reduced sensitivity to factors inducing death by apoptosis is a common feature of neoplastic cells. It is usually associated with a decreased level of the active pro-apoptotic protein or proteins or an increased level of anti-apoptotic proteins. This is the case in prostate cancer cells that contain, inter alia, very little of the BID protein essential for apoptosis. The BID protein is used in type II cells to transmit the signal between death receptors and mitochondria (Kantari & Walczak, 2011), as well as regulate the response to DNA damage (Liu et al., 2011). In the former case, the BID protein is cleaved by caspase 8, creating an active form that triggers the subsequent stages of apoptosis. Previous attempts to therapeutically enrich prostate cancer cells with BID consisted of overexpression from DNA vectors delivered to cells (Tsuno et al. 2012; Yi et al., 2003; Song et al. 2008) or introduced into cells by viruses (Miao et al., 2006 ; Fukazawa et al., 2003). The disadvantage of this approach is that it cannot control the amount of BID delivered to the cell. Excess BID in a cell may spontaneously induce death by apoptosis (Fukazawa et al., 2003). This creates the risk of excessively high levels of BID in cells, which in turn may lead to the death of not only cancer cells. Admittedly, trials were carried out with expression vectors enabling the expression of pro-apoptotic proteins under the control of tumor-specific promoters, e.g. the hTERT promoter (telomerase component) (e.g. Wirth et al., 2003) also for the BID protein (Kazhdan et al., 2006), however, the activity of such a promoter may

It is also high in many types of stem cells and in the hepatocytes of individuals with cirrhosis (Kotoula et al., 2002). For some tumors, new, more specific promoter systems have been developed, e.g. the TTS system, used, inter alia, to obtain specific expression of the introduced gene encoding the BID protein in lung cancer (Fukazawa et al., 2009), however, such systems are not available for most cancers, including prostate cancer. There is therefore a need to develop new drugs that could be used in the treatment of tumors that are poorly responsive to factors inducing death through apoptosis, for example to known cytostatics or proteins inducing death through apoptosis, in particular drugs for treating or supporting the treatment of prostate cancer, especially drugs enabling specific sensitization of neoplastic cells to factors inducing death by apoptosis, for example to treatment with known cytostatics or proteins inducing apoptosis, without high cytotoxicity for healthy cells.

Detailed Description of the Invention

A recombinant ProSTAT fusion protein (short for: Protein Selectively Triggering Apoptosis in Tumor cells) with potential therapeutic properties, selectively sensitizing neoplastic cells, in particular prostate cancer cells, non-small cell lung cancer cells, especially advanced prostate cancer, to anti-cancer drugs inducing apoptosis and its applications.

The invention is based on the unexpected finding that a recombinant protein containing a transport cassette, preferably comprising a TAT protein-derived peptide, and an active cassette containing a human BID protein, can, by entering cells, allow controlled, relatively small amounts of BID to be delivered to cells without inducing them apoptosis, but only sensitizing them to apoptosis induced by anticancer drugs. The inventors have surprisingly found that it is possible to administer the BID protein in the form of the ProSTAT fusion protein, which is delivered in a dose such that it does not induce apoptosis by itself, but selectively sensitizes tumor cells, in particular prostate cancer cells, non-small cell lung cancer cells, especially advanced prostate cancer cells. to another apoptosis-inducing factor therein, e.g. known anti-cancer drugs that induce apoptosis. Such sensitization of tumor cells by administering a sensitizing amount of the recombinant ProSTAT fusion protein in combination with another apoptosis-inducing antitumor agent not only allows obtaining a synergistic effect of enhancing the action of another antitumor agent through the synergistic action of both compounds, but also allows the use of the additional agent in a reduced amount, and hence, reduced side effects of such therapy are observed and safer for the patient. Such sensitization of cancer cells by administering a sensitizing amount of the recombinant ProSTAT fusion protein allows cancer cells to enter the path of apoptosis with the use of another antitumor agent that previously had no effect on these cells or had a very limited use, or to reduce the doses of previously used drugs, thus limiting the toxicity of therapy or the observed side effects.

The invention therefore relates to a recombinant ProSTAT fusion protein comprising a transport cassette which allows the protein to enter the cell and an active cassette, the transport cassette comprising a short peptide derived from the TAT protein and wherein the active cassette comprises a sequence of a human BID protein for use in the treatment of prostate cancer. , more preferably advanced prostate cancer and non-small cell lung cancer, wherein said recombinant ProSTAT fusion protein is used in an amount in which it alone does not significantly reduce cell viability and does not induce apoptosis in them, but only selectively sensitizes tumor cells to apoptosis induced by anti-cancer drugs, and wherein said recombinant ProSTAT fusion protein is used in combination with an apoptosis-inducing anti-cancer drug, preferably a TRAIL protein, a camptothecin or a derivative thereof.

A preferred recombinant protein for use in therapy is characterized in that the transport cassette comprises the sequence of SEQ ID NO: 4.

In a preferred recombinant protein for use in therapy, the active cassette comprises a human BID (L) protein sequence, isoform 1, preferably the sequence shown in SEQ ID NO: 2.

Preferably, the recombinant protein for use in therapy comprises the sequence SEQ ID NO

ID: 6.

A preferred recombinant protein for use in therapy is a functional variant of the recombinant protein ProSTAT protected against phosphorylation by CK2 kinase.

PL 222 795 B1

A preferred recombinant protein for use in therapy has the T58A and S75A mutations introduced into the active cassette, more preferably the T58A and S75A mutations in SEQ ID NO: 2.

Described is a recombinant ProSTAT fusion protein, or a functional variant thereof, which is an artificial fusion protein comprising a transport cassette which allows the protein to enter a cell, preferably a TAT transport cassette, preferably comprising the sequence shown in SEQ ID NO: 4, operably linked to an active cassette that is selectively sensitizes neoplastic cells, preferably prostate cancer, non-small cell lung cancer, more preferably advanced prostate cancer cells, to apoptosis-inducing anti-neoplastic drugs, the active cassette comprising a human BID protein sequence or a functional variant thereof, preferably the active cassette comprises a human BID (L) protein sequence , isoform 1, preferably the sequence set forth in SEQ ID NO: 2.

The recombinant ProSTAT fusion protein is more preferably a protein comprising the sequence as set forth in SEQ ID NO: 6 or a functional variant thereof, e.g. protected against phosphorylation by CK2 kinase, preferably having introduced mutations T58A and S75A in the active cassette (i.e. threonine and serine found in positions corresponding to 58 and 75 are replaced by alanine), preferably the mutations T58A and S75A have been introduced with respect to SEQ ID NO: 2 as the active cassette sequence.

Also described is a functional ProSTAT fusion protein variant being a recombinant protein with an amino acid sequence highly homologous, more preferably highly identical to SEQ ID NO: 6, or a functional ProSTAT fusion protein variant being a protein comprising a transport cassette sequence with an amino acid sequence highly homologous, more preferably highly identical to SEQ ID NO: 6. Further comprising an active cassette sequence operably linked to a transport cassette sequence with an amino acid sequence highly homologous, more preferably highly identical to SEQ ID NO: 2, wherein the homologous, more preferably highly identical sequence comprises deletions, additions and substitutions in the sequence, as long as the protein functions in sensitizing cells to the action of anti-cancer drugs that induce apoptosis as defined herein. In this regard, particularly preferred substitutions will usually be conservative in nature, i.e. preferably substitutions that take place within a family of amino acids. For example, amino acids typically fall into four families: (1) acidic - aspartate and glutamate; (2) basic - lysine, arginine, histidine; (3) non-polar - glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, cysteine, methionine, tryptophan; and (4) uncharged, polar asparagine, glutamine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. It is reasonably predictable that an isolated change from leucine to isoleucine or valine, or vice versa; aspartate to glutamate or vice versa; threonine to serine or vice versa; or a similar conservative replacement of an amino acid with a structurally related amino acid will have little effect on biological activity.

In particular, the present invention comprises a functional variant of a CK2-protected ProSTAT fusion protein, preferably in which active cassette threonine and serine at positions 58 and 75, preferably at positions 58 and 75 in SEQ ID NO: 2, are replaced by by alanine, hereinafter ProSTAT ^{T58A / S75A} (the amino acid positions in the active cassette here and hereafter refer to SEQ ID NO: 2, which differs from the sequence of the human BID protein found in protein databases, e.g. number P55957 in that it lacks the first amino acid of the human BID protein - methionine). Without being bound by theory, such a modified functional variant of the ProSTAT fusion protein will be more effective when used in the treatment of cancers which are characterized by a high level of endogenous BID protein which is however inactive due to phosphorylation by CK2 kinase. Such a functional variant of the ProSTAT ^{T58A / S75A} fusion protein would thus be better for use in sensitizing certain tumor cells to anti-tumor drug-induced apoptosis in tumors such as non-small cell lung cancer, as the unmodified form of the ProSTAT fusion protein would be less effective in this case.

Proteins having substantially the same amino acid sequence as the reference molecule, but containing minor amino acid substitutions that do not significantly affect the protein sensitizing effect of anti-cancer drugs, therefore fall within the definition of a recombinant ProSTAT fusion protein according to the invention. A highly homologous sequence means that the sequence is similar, more preferably identical to at least 70%, more preferably 80%, more preferably 90%, most preferably at least 95%. It will be apparent to one skilled in the art that

The above changes also apply to nucleic acid sequences encoding or comprising such recombinant ProSTAT fusion proteins of the invention or their building cassettes (e.g., SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5), as well as functional recombinant protein variants of the invention (e.g., a functional variant of the ProSTAT fusion protein protected against phosphorylation by CK2 kinase).

In a preferred embodiment, the recombinant ProSTAT fusion protein also includes additional cassettes, for example allowing the isolation of the recombinant ProSTAT fusion protein, such as the 6xHis cassette, or the identification of the recombinant ProSTAT fusion protein by immunological methods such as the HA cassette or cassettes, or by microscopy such as the cassette EGFP. Additional cassettes in the sequence of the recombinant ProSTAT fusion protein may also advantageously include sequences encoding elements that enhance selectivity of action over selected tumor cells.

Also described is a pharmaceutical composition comprising a recombinant ProSTAT fusion protein, preferably also comprising one or more pharmaceutically acceptable excipients and / or carriers. Preferably, the pharmaceutical composition comprises pharmaceutically acceptable substances which decrease the sensitivity of the recombinant ProSTAT fusion protein to proteolytic degradation, and / or decrease the immunogenicity of the recombinant ProSTAT fusion protein. This applies both to the classic methods of modulating the immunogenicity of protein drugs and increasing their stability by glycosylation and pegylation (van Beers & Bardor, 2012), as well as placing them in nanoparticles made of biodegradable polymers (Danhier et al., 2012).

A preferred pharmaceutical composition further comprises another apoptosis-inducing anti-cancer agent, preferably a TRAIL protein, camptothecin or derivatives thereof.

A described recombinant ProSTAT fusion protein or pharmaceutical composition can be used for use as a drug. In one preferred embodiment, the recombinant ProSTAT fusion protein or pharmaceutical composition is used in the treatment of cancer, preferably prostate cancer, non-small cell lung cancer, in particular advanced prostate cancer.

In a preferred embodiment, the recombinant ProSTAT fusion protein or pharmaceutical composition is used in the treatment of cancer, preferably prostate cancer, non-small cell lung cancer, in particular advanced prostate cancer, in combination with at least one apoptosis-inducing anti-cancer drug, preferably TRAIL protein, camptothecin derivatives or others. anti-cancer drugs.

In another preferred embodiment, the recombinant ProSTAT fusion protein or pharmaceutical composition is used in the treatment of cancer, in particular prostate cancer, non-small cell lung cancer, more particularly advanced prostate cancer, in combination with at least one anti-cancer drug, such as an antibody or antibodies, a small molecule anti-cancer compound. such as an antimetabolite, an alkylating agent, a topoisomerase inhibitor, an anti-microtubule agent, a kinase inhibitor, a protein synthesis inhibitor, an immunotherapeutic agent, a hormone or analogue thereof, a somatostatin analogue, a glucocorticoid, an aromatase inhibitor, an mTOR inhibitor.

The recombinant ProSTAT fusion protein or a functional variant or pharmaceutical composition thereof can be used to sensitize tumor cells to the induction of apoptosis in the treatment of various cancers such as prostate cancer, lung cancer, cervical cancer, ovarian cancer, non-small cell lung cancer and other types of cancer. .

In one embodiment, a recombinant ProSTAT fusion protein, or a functional variant or pharmaceutical composition thereof, is used by administering to a cancer subject a therapeutically effective dose of a recombinant ProSTAT fusion protein or pharmaceutical composition. By "therapeutically effective dose" is meant the dose that produces the effect for which it is administered. The exact dose will depend on the purpose of the treatment and will be verifiable by one skilled in the art using known techniques. As is known in the art, adjustments for systemic or local delivery, age, body weight, general health, sex, diet, timing of administration, drug interactions, and disease severity may be necessary and will be verifiable by routine experimentation by those skilled in the art. field.

The ProSTAT recombinant fusion protein or pharmaceutical composition can be administered by one or more routes of administration using one or more of a variety of methods.

Are known in the art. The skilled artisan will appreciate that routes and / or modes of administration will vary depending on the desired results. Preferred routes of administration for the inventive recombinant ProSTAT fusion protein or pharmaceutical composition include intravenous, intramuscular, intradermal, intraperitoneal, subcutaneous, intramedullary or other parenteral routes of administration, for example injection or infusion. As used herein, parenteral administration means methods of administration other than enteral or topical administration, typically by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intracapsular, intradermal, intraperitoneal, subcutaneous, subcutaneous, injection and infusion. Alternatively, the recombinant ProSTAT fusion protein or pharmaceutical composition can be administered by a non-parenteral route, such as by topical or epidermal administration.

ProSTAT recombinant fusion protein can be prepared with carriers that will protect the compound against rapid release, such as controlled release formulations, including implants, transdermal patches, and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Many methods of making such formulations have been patented or are generally known to those skilled in the art (see, e.g., Sustained and Controlled Release Drug Delivery Systems, J.R. Robinson, ed., Marcel Dekker, Inc., New York, 1978).

In a preferred embodiment, the recombinant ProSTAT fusion protein or pharmaceutical composition is administered in combination with one or more other anti-cancer substances, the administration may be timed or simultaneous.

Also described is an expression vector comprising the sequence of a recombinant ProSTAT fusion protein, or a functional variant thereof, for producing and purifying a recombinant ProSTAT fusion protein. Preferably, the expression vector comprises the sequence of any vector used to express proteins in bacterial, yeast, insect, mammalian or other cell based systems into which a sequence encoding a ProSTAT recombinant fusion protein has been inserted, preferably with SEQ ID NO: 6, with the preferred sequence being coding is SEQ ID NO: 5.

The use of a recombinant ProSTAT fusion protein or a functional variant thereof or a pharmaceutical composition as a medicament for the treatment of cancer, preferably prostate cancer, non-small cell lung cancer, more preferably advanced prostate cancer, has been disclosed.

In particular, it has been disclosed the use of a recombinant ProSTAT fusion protein or a functional variant or a pharmaceutical composition thereof as an agent for selectively sensitizing tumor cells to apoptosis-inducing anti-tumor drugs, preferably the tumor cells are prostate cancer cells, non-small cell lung cancer cells, more preferably advanced prostate cancer.

Preferably, the recombinant ProSTAT fusion protein or a functional variant or pharmaceutical composition thereof is used as an agent for selectively sensitizing cancer cells to apoptosis-inducing anti-cancer drugs in combination with at least one apoptosis-inducing anti-cancer drug, preferably a TRAIL protein, camptothecin derivatives or other anti-cancer drugs.

Publications cited in this specification and references therein are herein incorporated by reference in their entirety.

For a better understanding of the invention, it has been illustrated in the embodiments and in the accompanying drawing figures.

Brief description of the figures of the drawing

Figure 1 shows the cassette organization of the ProSTAT fusion protein in one preferred embodiment (Scheme A) and the changes made to the active cassette in the CK2-unphosphorylated ^{mutant (ProSTAT T58A / S75A} ; Scheme B) and in the non-caspase-8 cleaved mutant (ProSTAT ^D59E). scheme C).

Figure 2 shows the purity of protein preparations used for assays: ProSTAT fusion protein, ProSTAT fusion protein mutated at sites phosphorylated by CK2 kinase (ProSTAT ^{T58A / S75A} ), ProSTAT fusion protein mutated at the caspase 8 cleavage ^site (ProSTAT D59E), and TRAIL protein . The preparations were analyzed by SDS-PAGE electrophoresis. M is the molecular weight standards, in kDa.

PL 222 795 B1

Figure 3 shows the dose-dependency of the level of the recombinant ProSTAT fusion protein in PC3 prostate cancer cells (A) and the dose-dependency of the ProSTAT fusion protein in two cell types: PC3 and LNCaP (B and C). The content of the ProSTAT fusion protein was determined in the cell extracts using anti-HA or anti-BID antibodies after prior electrophoretic separation of the proteins. A. Cells of the PC3 line were cultured in the presence of the ProSTAT fusion protein at a concentration of 15 pg / ml. B. Cells of the PC3 and LNCaP lines were cultured in the presence of varying amounts of the ProSTAT fusion protein for 120 min. As a control of the amount of the extract applied to the electrophoretic gel, the GAPDH protein in the extract was used, the amount of which was determined using anti-GAPDH antibodies. The graph shows the amount of ProSTAT fusion protein in cells per cell.

Fig. 4 shows the results of the analysis of viability of control and PC3 cells treated with the ProSTAT fusion protein for 24 h using the MTT assay. Relative cell viability (± SD) is shown.

Figure 5 shows the results of the analysis of the sensitization of cells of different cell lines to TRAIL by the ProSTAT fusion protein. The relative viability of cells (± SD) treated with ProSTAT fusion protein (30 µg / ml for PC3 and LNCaP cells and 40 µg / ml for HeLa and A549 cells), TRAIL protein (100 ng / ml) or both are shown. The analysis was performed using the MTT test. Statistically significant differences are shown as p value <0.05 (*), p <0.01 (**), p <0.001 (***).

Figure 6 shows the results of the analysis of the camptothecin (CPT) sensitization of cells of different cell lines by ProSTAT fusion protein. The relative viability of cells (± SD) treated with ProSTAT fusion protein (30 pg / ml for PC3 and LNCaP cells and 40 pg / ml for HeLa and A549 cells), CPT (0.2 μΜ for HeLa cells and 1 μΜ for cells of other lines) or both. The analysis was performed using the MTT test. The statistically significant differences are shown as in Fig. 5.

Figure 7 shows the results of analysis of the effects of mutant forms of the ProSTAT fusion protein on PC3 and A549 cells. A. Lack of sensitization of PC3 cells by protein not cleaved by caspase 8 (ProSTAT ^D59E ), administered at 30 µg / ml, on TRAIL (100 ng / ml) and CPT (1 µM). B. Sensitization of A549 cells treated with wild-type and mutant ProSTAT fusion protein at sites phosphorylated by CK2 kinase (ProSTAT ^{T58A / S75A} ), both administered at 40 µg / ml and TRAIL administered at 100 ng / ml. The figure shows the average results of two series of experiments performed independently for wild-type ProSTAT (light bars) and ProSTAT mutated at sites phosphorylated by CK2 kinase (ProSTAT ^{T58A / S75A} , dark bars). The analysis was performed using the MTT test. Relative cell viability (± SD) is shown.

Figure 8 shows the results of cytometric analysis of the sensitization of PC3 cells to TRAIL-induced apoptosis by the ProSTAT fusion protein and microscopic images of these cells. A. Percentage of cells at apoptosis (± SD). Cells were treated with the fusion protein ProSTAT (30 µg / ml), TRAIL (100 ng / ml), or both for 24 h. Apoptotic cells were identified by flow cytometry. The statistically significant differences are shown as in Fig. 5. B-E. Exemplary cytograms of one of the experiments, the results of which are shown in Fig. 8A. F-l. Sample microscopic photos of cells used in one of the experiments taken with a Nikon Eclipse TE200 microscope using Hoffman modulation contrast (HMC), the results of which are shown in Fig. 8A. B, F control cells. C, G - cells treated with ProSTAT fusion protein. D, H cells treated with TRAIL. E, I - cells treated with the ProSTAT and TRAIL fusion protein.

PL 222 795 B1

Examples

The following examples used the standard materials and methods described in Sambrook J. et al., "Molecular Cloning: A Laboratory manual, 2nd edition, unless otherwise indicated." 1989. Cold Spring Harbor, N.Y. Cold Spring Harbor Laboratory Press ”or the manufacturers' recommendations for specific materials and methods have been followed.

P r z k ł a d 1:

Construction of recombinant ProSTAT protein

The DNA segment encoding the human BID protein (BID (L), 194 amino acid isoform 1 (according to UniProtKB / Swiss-Prot P55957), without the START and STOP codons (SEQ ID NO: 1) was amplified by PCR using the Pfx polymerase (Invitrogen) and the primers BIDIong.EcoRI.For (CGGAATTCGACTGTGAGGTCAACAACGG; (SEQ ID NO: 7) and BIDIong.Hindlll.Rev (CCCAAGCTTGGTCCATCCCATTTCTGGCTAAGC; (SEQ ID NO: 8) on the matrix of the full-length cD970Cen36 plasmid BID970C1136 from 467 to 1054 nt, with the BID (L) coding sequence between 629 and 1054 nt). The DNA segment thus obtained was cloned between the nucleotide sequences recognized by the restriction enzymes EcoRI and HindIII into the expression vector pET28a (Novagen), which was previously modified in in the following way:

- between the nucleotide sequences recognized by the restriction enzymes NotI and Xhol, a nucleotide sequence has been added:

TACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCCG ACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCT; (SEQ ID NO: 9), encoding the three repeats of the HA epitope (fragment of the influenza hemagglutinin protein), separated by one or two amino acids, with the final amino acid sequence:

YPYDVPDYAGYPYDVPDYAGSYPYDVPDYA; (SEQ ID NO: 10), recognized by anti-HA antibodies.

- among the nucleotide sequences recognized by the restriction enzymes NdeI and EcoRI, the nucleotide sequence recognized by the restriction enzyme BamHI was partially removed (GGA was left from the GGATCC sequence) and a DNA segment with the sequence SEQ ID NO: 3, encoding the TAT domain (amino acid residues HIV-1 Tat protein 47 to 57).

The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 1 is the active cassette of the ProSTAT fusion protein (SEQ ID NO: 2). The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 3 is the ProSTAT fusion protein transport cassette (SEQ ID NO: 4). The final nucleotide sequence encoding the ProSTAT fusion protein, inserted into the pET28a expression vector (Novagen), is shown as SEQ ID NO: 5. The amino acid sequence of the ProSTAT fusion protein is shown as SEQ ID NO: 6.

In addition to the ProSTAT fusion protein with the sequence shown in SEQ ID NO: 6, two variants of the ProSTAT ^{T58A / S75A} mutant not phosphorylated by CK2 kinase, with threonine at position 58 and serine at position 75 in with respect to SEQ ID NO: 2, replaced with alanine and the ProSTATD59E mutant not cleaved by caspase 8, with aspartic acid at position 59 with respect to SEQ ID NO: 2 replaced with glutamic acid. All mutations were performed by standard point mutagenesis method and verified by sequencing the obtained DNA.

P r z k ł a d 2

ProSTAT recombinant protein production and purification

The ProSTAT fusion protein was produced in Escherichia coli BL21 (DE3) bacterial cells transformed with a plasmid containing the sequence encoding the ProSTAT fusion protein (SEQ ID NO: 5) described in Example 1. Ni-NTA agarose affinity chromatography (Sigma ALDRICH) was used for protein purification. and molecular filtration on Applixchange-G25M (AppliChem Panreac). Fig. 2 shows the purity of ProSTAT protein preparations obtained as described: the ProSTAT fusion protein and its mutants: ProSTAT ^{T58A / S75A} and ProSTAT ^D59E , as well as the TRAIL protein used for apoptosis induction.

P r z k ł a d 3

Assessment of the time and dose dependent penetration of recombinant ProSTAT fusion protein into cells

PL 222 795 B1

PC3 and LNCaP cells, obtained from the European Collection of Cell Cultures (ECACC), were grown under standard conditions at 37 ° C in 5% CO ₂ , in 96- or 24-well plates or plates. The ProSTAT fusion protein was added directly to the medium in the presence of a soybean trypsin inhibitor (final concentration 0.005%). To determine the time-dependent penetration of the ProSTAT fusion protein into the PC3 cell culture, the protein was added to a final concentration of 15 pg / ml for 0, 30, or 60 min. To determine the dose-dependent penetration of the ProSTAT fusion protein, various amounts of this protein (final concentration 0-30 pg / ml) were added to the cultures of PC3 and LNCaP cells for 120 min. The cells were then washed from the medium, counted, resuspended in Laemmli buffer to a concentration of 2x10 ⁴ cells / µl and heated for 20 min at 100 ° C. Protein concentration was determined by the method of Bradford (Compton & Jones, 1985) and applied to the electrophoretic gel in an amount of at least 30 µg / well. Proteins were separated on a polyacrylamide gel under denaturing conditions, then transferred to a PVDF membrane. Proteins were detected by Western blot with anti-HA (1: 5000, Sigma Aldrich), anti-Bid (1: 1000, Santa Cruz; 1: 1000, Cell Signaling) or anti-GAPDH (1: 10,000, Sigma Aldrich) antibodies ). The amount of protein was determined densitometrically using the ChemiDocXRS apparatus (BioRad).

As seen in Figure 3A, the ProSTAT fusion protein penetrates into PC3 cells in an amount dependent on the time of administration. This protein also enters the cells in an amount dependent on the dose administered (Fig. 3B and C). The dose-dependency of the intracellular concentration of ProSTAT depends on the cell type: ProSTAT penetrates more easily into LNCaP cells (Fig. 3C) than into PC3 cells (Fig. 3B). For a specific type of cell, i.e. a specific type of tumor, the concentration of intracellular ProSTAT can be kept constant by controlling both parameters, i.e. the time of administration and the dose.

P r z k ł a d 4

Evaluation of the cytotoxicity of the ProSTAT fusion protein

PC3 cells were grown in 96-well plates. ProSTAT fusion protein was added directly to the cultures to a final concentration of 0-40pg / ml in the presence of a soybean trypsin inhibitor (final concentration 0.005%) and the cells were cultured for 24 hours. The medium was then removed, the MTT mixture (Twentyman & Luscombe, 1987) was added to a concentration of 0.5 mg / ml and the cells were cultured for an additional 2 hours. Formazan crystals were dissolved in DMSO: isopropanol 1: 1) and the absorption was measured at 570 nm using a VICTOR Multilabel Plate Reader (Perkin-Elmer).

As can be seen in Fig. 4, the presence of the ProSTAT fusion protein in the culture medium only slightly influences cell viability (less than 10% viability reduction) up to 40 pg / ml.

P r z k ł a d 5

Evaluation of the sensitization of cells of different cell lines to TRAIL by the ProSTAT fusion protein

The sensitization to ProSTAT of four cell lines was compared: two prostate cancer lines (PC3 and LNCaP) and one non-small cell lung cancer line (A549) and one cervical cancer line (HeLa). Cells were grown and their viability analyzed as described in Example 4, except that for the HeLa line, the MTT mixture was added to a concentration of 2.5 mg / ml. ProSTAT fusion protein was added to the culture to a concentration of 30 µg / ml and TRAIL to a concentration of 100 µg / ml and the cells were cultured for 24 h. As can be seen in Fig. 5, cells of all lines except LNCaP are sensitized by the ProSTAT protein to the action of TRAIL with the following efficiency: PC3> A549> HeLa. Taking into account the different dependence of ProSTAT entry into cells of different cell lines described in Example 3, experiments with an increased dose of the ProSTAT fusion protein were carried out. Increasing the dose of ProSTAT to 50 pg / ml does not change the efficiency of sensitizing cells to TRAIL. The lack of sensitization of LNCaP cells is most likely related to the insensitivity of these cells to TRAIL, due to the constant expression of the c-FLIP protein (Zhang et al., 2004).

P r z k ł a d 6

Evaluation of the sensitization of cells of various cell lines to camptothecin (CPT) by ProSTAT

The evaluation was performed as described in Example 5, with the difference that in place of TRAIL, camptothecin was added to the culture to a concentration of 1 pM (for HeLa cells to a concentration of 0.2 pM). As can be seen in Fig. 6, ProSTAT sensitizes to CPT in a statistically significant manner only cells of the PC3 line; the cells of the remaining lines are not statistically significantly sensitized.

PL 222 795 B1

P r z k ł a d 7

Evaluation of how the ProSTAT fusion protein is used by the sensitized cells

The BID protein, which is the active cassette of the ProSTAT fusion protein, is used in type II cells to signal between death receptors and the mitochondria and is cleaved by caspase 8 to form the active form. To evaluate the use of the ProSTAT fusion protein in the sensitized cells, the effect of administering to them mutant ProSTAT ^D59E fusion protein not cleaved by caspase 8 in which aspartic acid at position 59 of the BID protein with respect to SEQ ID NO: 2 was replaced by glutamic acid was examined. The evaluation was performed as described in Example 5 with the difference that a mutant variant was added to the culture in place of the wild-type ProSTAT fusion protein. As seen in Fig. 7A, ProSTAT ^D59E , the Caspase 8 non-cleaved ProSTAT fusion protein mutant, does not sensitize PC3 cells to either TRAIL or CPT, thus indicating that the ProSTAT fusion protein supports the apoptotic signaling pathway between death receptors and mitochondria.

In most cancer cells, including prostate cancer cells, the activity of CK2 kinase is significantly increased (Wang et al., 2006), which inactivates some apoptotic proteins, including possibly the BID protein, which is the active cassette of the fusion protein. ProSTAT. To verify that the cell sensitization efficiency of the ProSTAT fusion protein could not be increased by rendering the active cassette non-susceptible to phosphorylation by CK2 kinase, the effect of the mutant protein ProSTAT ^{T58A / S75A was investigated} in which the threonine at position 58 and serine at position 75 of the BID protein in with respect to SEQ ID NO: 2 have been replaced by alanine residues. The evaluation was performed as described in Example 5 with the difference that the mutant ProSTAT ^{T58A / S75A} variant was added to the culture in place of the wild ProSTAT fusion protein. The experiments performed on the PC3 and HeLa cell lines showed that the mutant not phosphorylated by the CK2 kinase sensitized cells of these lines similarly to the non-mutant protein. In the case of A549 cells, as seen in Fig. 7B, the mutant not phosphorylated by CK2 kinase sensitizes these cells better than the non-mutant protein. The functional variant of the ProSTAT ^{T58A / S75A} fusion protein may therefore be a better option for the sensitization of certain tumor cells to anticancer drug-induced apoptosis in tumors such as non-small cell lung cancer from which A549 cells are derived, as the unmodified form of the ProSTAT fusion protein is less in this case. effective.

P r z k ł a d 8

Assessment of the sensitization of PC3 cells by the ProSTAT fusion protein to TRAIL-induced apoptosis

The PC3 cells that showed the greatest sensitivity to both TRAIL (Example 5) and CPT (Example 6) were used for the study. Cells were treated for 24 h. ProSTAT fusion protein (30 µg / ml), TRAIL protein (100 µg / ml), or both. Both cells detached from the plate surface and adherent cells were collected for analysis. Both fractions were combined. Cells were stained with annexin V-FITC and propidium iodide. Apoptotic cells were detected by flow cytometry using FACSCalibur (Becton Dickinson) and analyzed using the BD FACSDiva software. The microscopic observations were made with a Nikon Eclipse TE200 microscope using Hoffman modulating contrast (HMC). As seen in Fig. 8, the ProSTAT fusion protein causes only a slight increase in the number of apoptotic cells (about 5%), as does a small concentration of TRAIL. However, both of these proteins, when used together, lead to an increase in the number of apoptotic cells by about 20%. These results indicate that the effects observed in Examples 5-7 are due to the sensitization of cells by the ProSTAT fusion protein to the induction of apoptosis. Such sensitization of tumor cells by administering the ProSTAT fusion protein in combination with another apoptosis-inducing anti-tumor agent made it possible to obtain a synergistic effect of enhancing the action of the other anti-tumor agent through the synergistic action of both compounds.

In the case of non-small cell lung cancer neoplastic cells, an increased synergistic effect will be particularly advantageously seen when ProSTAT ^{T58A / S75A is used} in combination with another apoptosis-inducing anti-neoplastic agent.

The unexpected synergistic effect presented in the above examples is possible by external administration of the BID protein in the form of the ProSTAT fusion protein, which is delivered in a controlled dose, such that ProSTAT itself practically does not induce apoptosis but selectively sensitizes tumor cells to another factor that induces apoptosis in them. which will allow a more effective use of the additional agent, the use of a lower concentration of the additional agent, thereby reducing the side effects of such therapy and making it safer for the patient.

Literature:

Compton, S.J. & Jones, C.G. (1985) Anal. Biochem. 151, 369-374.

Danhier, F. et al. (2012) J. Control. Release 161, 505-522.

Dearnaley, D.P. et al. (1999) Lancet 353, 267-272.

Desagher, S. et al. (2001) Mol. Cell 8, 601-611.

European age-standardized rates calculated by the Statistical Information Team at Cancer Research UK (2011) using data from GLOBOCAN 2008, v1.2 http://globocan.iarc.fr Fukazawa, T. et al. (2003) J. Biol. Chem. 278, 25428-25434.

Fukazawa, T. et al. (2009) Int. J. Cancer. 125, 1975-1984.

Global Health Observatory Data Repository. Cancer Mortality and Morbidity. Situation and Trends. WHO.

Griffith, T.S. & Kemp, T.J. (2003) Cancer Chemother. Pharmacol. 52, 175-184 Heidenreich, A. et al. (2008) Eur. Urol. 53, 68-80.

Jassem, J. et al. (eds) (2013) Neoplasms of the genitourinary system. Via Medica, Gdańsk. Kantari, C. & Walczak, H. (2011) Biochim Biophys Acta 1813, 558-563.

Kazhdan, Let al. (2006) Cancer GeneTher. 13,141-149.

Kotoula, V. et al. (2002) Liver 22, 57-69.

Liu, Y. et al. (2011) Mol. Cell. Biol. 31,4298-4309.

Miao, J. et al. (2006) Int. J. Cancer 119, 1985-1993.

Robinson, J.R. (ed) (1978) Sustained and Controlled Release Drug Delivery Systems., Marcel Dekker Inc., New York.

Song, G. et al. (2008) Apoptosis 13, 693-701.

Tang, D.G. & Porter, A.T. (1997) Prostate 32, 284-293.

The Cancer Market Outlook to 2016. Competitive landscape, market size, pipeline analysis, and growth opportunities (2011) Reference Code: BI00042-009.

Tsuno, T. et al. (2012) J. Immunother. 35, 23-31.

Twentyman, P.R. & Luscombe, M. (1987) Br. J. Cancer 56,279-285.

Yi, X. et al. (2003) J. Biol. Chem. 278, 16992-16999.

van Beers, M.M.C & Bardor, M. (2012) Biotechnol. J. 7, 1-12.

Wang, G. et al. (2006) J. Cell. Biochem. 99, 382-391.

Wirth, T. et al. (2003) Cancer Res. 63, 3181-3188.

Zhang, X. et al. (2004) Cancer Res. 64, 7086-7091.

Sequence list - list

SEQ ID NO: 1 - Nucleotide sequence encoding the ProSTAT active cassette;

SEQ ID NO: 2 - Amino acid sequence of the ProSTAT Active Cassette;

SEQ ID NO: 3 - Nucleotide sequence encoding the transport cassette;

SEQ ID NO: 4 - Amino acid sequence of the transport cassette;

SEQ ID NO: 5 - Nucleotide sequence encoding a preferred ProSTAT fusion protein;

SEQ ID NO: 6 - Amino acid sequence of a preferred ProSTAT fusion protein.

PL 222 795 B1

SEQUENCE LISTING <110> University of Warsaw <120> Recombinant protein fusion ProSTAT <130> PK / 2206 / AGR <160> 6 <170> Patentln version 3.5 <210> 1 <211> 5S2 <212> DNA <213> Homo sapiens and the PPLICATIONS <400> 1 gactgtgagg tttggcttcc cacgagctgc aaccgcagca atcatccgga cctccgggcc gaccggaaca atggagaagg caaacgccgt ctacgcacct tcaacaacgg tccaaagctg cagtgctggc gccactcccg atattgccag tggtgaacgg gggacctggc agaagaccat ccttgctccg acgtgaggag ttccagcctc ttctgacaac tccccagtgg cttgggaaga gcacctcgcc cctggccctg cactgccctg gctggtgctg tgatgtcttt cttagccaga agggatgagt agcttccgca gagggctacg atagaggcag caggtcgggg cagctcagga gagcagctgc gccctgctgc cacacaacag aatgggatgg gcatcacaaa gagagctgga atgagctgca attctgaaag acagcatgga acaccagccg tgcaggccta tggccaagaa tgaactttat ac cctactggtg cgcactgggc gactgatggc tcaagaagac ccgtagcatc gtcggaggag ccctagagac ggtggccagt taaccagaac

12 0 180 240 300 360 420 480 540 582 <210> 2 <211> 194 <212> PRT <213> Homo sapiens <400> 2

Asp Cys Glu Val Asn Asn Gly Cheese Cheese Leu Arg Asp Glu Cys How much Thr 1 5 10 15 Asn Leu Leu Val Phe Gly Phe Leu Gin Cheese Cys Cheese Asp Asn Cheese Phe twenty 25 thirty Arg Arg Glu Leu Asp Ala Leu Gly His Glu Leu Pro Val Leu Ala Pro 35 40 45 Gin Trp Glu Gly Tyr Asp Glu Leu Gin Thr Asp Gly Asn Arg Cheese Cheese 50 55 60 His Cheese Arg Leu Gly Arg How much Glu Ala Asp Cheese Glu Cheese Gin Glu Asp 65 70 75 80 How much How much Arg Asn How much Ala Arg His Leu Ala Gin Val Gly Asp Cheese Underworld 85 90 95 Asp Arg Cheese How much Pro Pro Gly Leu Val Asn Gly Leu Ala Leu Gin Leu 100 105 110 Arg Asn Thr Cheese Arg Cheese Glu Glu Asp Arg Asn Arg Asp Leu Ala Thr 115 120 125 Ala Leu Glu Gin Leu Leu Gin Ala Tyr Pro Arg Asp Underworld Glu Lys Glu 130 135 140 Lys Thr Underworld Leu Val Leu Ala Leu Leu Leu Ala Lys Lys Val Ala Cheese 145 150 155 160 Gin Thr Pro Cheese Leu Leu Arg Asp Val Phe His Thr Thr Val Asn Phe 165 170 175 How much Asn Gin Asn Leu Arg Thr Tyr Val Arg Cheese Leu Ala Arg Asn Gly 180 185 190 Underworld Asp

<210> 3 <211> 33 <212> DNA <213> Human immunodeficiency virus <400> 3 tacggccgca agaaacgccg ccagcgccgc aga 33

PL 222 795 B1 <210> 4 <211> 11 <212> PRT <213> Human immunodeficiency virus <400> 4

Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg 1 5 10 <210> 5 <211> 804 <212> DNA <213> artificial <400> 5 atgggcagca atgtacggcc aacggttcca agctgttctg ctggctcccc tcccgcttgg gccaggcacc aacggcctgg ctggccactg accatgctgg ctccgtgatg aggagcttag gactatgcgg ccagattacg gccatcatca gcaagaaacg gcctcaggga acaacagctt agtgggaggg gaagaataga tcgcccaggt ccctgcagct ccctggagca tgctggccct tctttcacac ccagaaatgg gctatcccta ctgctcagtg tcatcatcac ccgccagcgc tgagtgcatc ccgcagagag ctacgatgag ggcagattct cggggacagc caggaacacc gctgctgcag gctgctggcc aacagtgaac gatggaccaa tgacgtcccc ctga agcagcggcc cgcagaggag acaaacctac ctggacgcac ctgcagactg gaaagtcaag atggaccgta agccggtcgg gcctacccta aagaaggtgg tttattaacc gcttgcggcc gactatgcag tggtgccgcg aattcgactg tggtgtttgg tgggccacga atggcaaccg aagacatcat gcatccctcc aggaggaccg gagacatgga ccagtcaaac agaacctacg gctacccata gatcctatcc cggcagccat tgaggtcaac cttcctccaa gctgccagtg cagcagccac ccggaatatt gggcctggtg gaacagggac gaaggagaag gccgtccttg cacctacgtg cgatgttttcct atatgacgtg

120 180 240 300 360 420 480 54 0 600 660 720 780 804 <210> 6 <211> 265 <212> PRT <213> artificial <220>

<223> Fusion protein <400> 6

Underworld Gly Cheese Cheese His His His His His His Cheese Cheese Gly Leu Val Pro 1 5 10 15 Arg Gly Cheese His Underworld Tyr Gly Arg Lys Lys Arg Arg Gin Arg Arg Arg twenty 25 thirty Gly Glu Phe Asp Cys Glu Val Asn Asn Gly Cheese Cheese Leu Arg Asp Glu 35 40 45 Cys How much Thr Asn Leu Leu Val Phe Gly Phe Leu Gin Cheese Cys Cheese Asp 50 55 60 Asn Cheese Phe Arg Arg Glu Leu Asp Ala Leu Gly His Glu Leu Pro Val 65 70 75 80 Leu Ala Pro Gin Trp Glu Gly Tyr Asp Glu Leu Gin Thr Asp Gly Asn 85 90 95 Arg Cheese Cheese His Cheese Arg Leu Gly Arg How much Glu Ala Asp Cheese Glu Cheese 100 105 110 Gin Glu Asp How much How much Arg Asn How much Ala Arg His Leu Ala Gin Val Gly 115 120 125 Asp Cheese Underworld Asp Arg Cheese How much Pro Pro Gly Leu Val Asn Gly Leu Ala 130 135 140 Leu Gin Leu Arg Asn Thr Cheese Arg Cheese Glu Glu Asp Arg Asn Arg Asp 145 150 155 160 Leu Ala Thr Ala Leu Glu Gin Leu Leu Gin Ala Tyr Pro Arg Asp Underworld 165 170 175 Glu Lys Glu Lys Thr Underworld Leu Val Leu Ala Leu Leu Leu Ala Lys Lys 180 185 190

PL 222 795 B1

Val Ala Cheese 195 Gin Thr Pro Cheese Leu 200 Leu Arg Asp Val Phe 205 His Thr Thr Val Asn Phe How much Asn Gin Asn Leu Arg Thr Tyr Val Arg Cheese Leu Ala 210 215 220 Arg Asn Gly Underworld Asp Gin Ala Cys Gly Arg Tyr Pro Tyr Asp Val Pro 225 230 235 240 Asp Tyr Ala Gly Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Gly Cheese Tyr 245 250 255 Pro Tyr Asp Val Pro Asp Tyr Ala Ala 260 265

Patent claims

Claims (6)

Patent claims CLAIMS 1. A recombinant ProSTAT fusion protein comprising a transport cassette which allows the protein to enter a cell and an active cassette, the transport cassette comprising a short peptide derived from a TAT protein and wherein the active cassette comprises a sequence of a human BID protein for use in the treatment of prostate cancer, more preferably advanced prostate cancer and non-small cell lung cancer, wherein said recombinant ProSTAT fusion protein is used in an amount in which it alone does not significantly reduce the viability of cells and does not induce apoptosis in them, but only selectively sensitizes cancer cells to apoptosis induced by anticancer drugs, and wherein said recombinant ProSTAT fusion protein is used in combination with an apoptosis-inducing anti-cancer drug, preferably a TRAIL protein, a camptothecin or a derivative thereof. 2. A recombinant protein for use according to claim 1, The method of claim 1, wherein the transport cassette comprises the sequence SEQ ID NO: 4. 3. A recombinant protein for use according to claim 1, The method according to claim 1 or 2, characterized in that the active cassette comprises the sequence of the human BID (L) protein, isoform 1, preferably the sequence shown in SEQ ID NO: 2. 4. A recombinant protein for use according to claim 1, 1-3, characterized in that it comprises the sequence SEQ ID NO: 6. 5. A recombinant protein for use according to any one of claims 1 to 5. CK2 kinase protected functional variant of the recombinant ProSTAT protein as to be protected against phosphorylation by CK2. 6. A recombinant protein for use according to claim 1 5. The method according to claim 5, characterized in that the T58A and S75A mutations have been introduced in the active cassette, more preferably the T58A and S75A mutations in SEQ ID NO: 2.