PL217808B1 - Transgenic plant, especially flax, method for obtaining and application thereof - Google Patents

Description

The invention relates to a novel transgenic plant, preferably flax, a method for its production and obtaining an extract therefrom and its uses.

One of the earliest stages of pathogenic infection in plants is the appearance of a free radical reaction (Fig. 1). Reactive oxygen species (RPT) can damage proteins, lipids and DNA. ROS are formed in the mitochondria by the electron transfer reaction from common reduced compounds directly to oxygen. Many environmental factors, such as cold, wounding, drought, osmotic stress and pathogenic attack lead to the inhibition of mitochondrial electron transport and the subsequent formation of ROS. Strengthening, therefore, the anti-oxidative capacity of plants should result in their greater resistance to environmental stress. Important cellular antioxidants are water-soluble compounds from the phenylpropanoid pathway and highly unsaturated fatty acids, which oxidize and eliminate ROS [1]. Similar to plants, in the human body, mechanical, physical, chemical and medical treatments lead to the formation of wounds and lead to the disturbance of the pro and antioxidant balance in cells and result in oxidative stress, the basis of which is the accumulation of oxygen free radicals (Fig. 1). . ROS react unspecifically with cell components, damaging and modifying them, which leads to the formation of free radicals of organic substances - proteins, lipids, nucleic acids and sugar sugars. The first target of ROS attack are lipids and membrane proteins, which in turn leads to lipid peroxidation [1]. ROS cause defects in cells, accelerate aging processes and disrupt energy production (ATP), which is extremely dangerous for cells of the nervous and muscular systems. They are believed to play a role in the process of developing and complicating the treatment of chronic wounds. Lipid peroxidation is a particularly dangerous process, because it does not end with the oxidation of the first component, but a chain reaction occurs, which leads to a decrease in the activity of various membrane proteins, changes in membrane permeability and even destruction of the entire cell. Thus, the common denominator for pathogenic plant infection and damage to the human body is the disturbance of the homeostasis of pro and antioxidant processes and the appearance of an excess of free radicals (Fig. 1). The response of both the human and plant organism to excess ROS is the synthesis of anti-inflammatory factors. In the case of chronic wounds, the accumulation of endogenous antioxidants is insufficient to neutralize ROS. Therefore, antioxidants should be delivered to the damaged and accumulating sites of ROS. The task of antioxidants (antioxidants) is to maintain the homeostasis of pro and antioxidant processes. The presence of strong antioxidants in the plant has two meanings: it protects the plant against the adverse effects of environmental factors and provides a new raw material for direct biomedical use, including as a new alternative antibiotic to compensate for reactive oxygen species in wounds and to counteract primary and secondary bacterial and fungal infections. In an in vitro experiment, it was found that phenylpropanoids are the most effective compounds in quenching the free radical reaction [2]. Plant phenylpropanoids are an extensive group of low molecular weight secondary metabolite compounds including phenolic acids, phenols, flavonoids, lignans and tannins (Fig. 2).

The central metabolite of the phenylpropanoid pathway is hydroxycinnamic acid, which is formed from the deamination of phenylalanine, which gives rise to all phenylpropanoid compounds. Hydroxycinnamates undergo side chain degradation reactions, which lead to simple phenolic compounds-hydroxybenzoates (e.g. gallic acid, a precursor of tannins), condensation with malonylCoA, which leads to the synthesis of flavonoids, reduction, which leads to the synthesis of appropriate alcohols as lignin precursors, and conjugation reactions it leads to the formation of esters or, less frequently, amides. Common plant hydroxybenzoates such as common 4-hydroxybenzoate, protocatechinate, vanillate, gallate, and syringinate are soluble or cell-wall-bound conjugates and are constituents of lignins. The trihydroxy benzoate derivative (gallate) is a component of the hydrolysable tannins. Simple phenolic compounds, in addition to their strong antioxidant properties, are involved in the phenomenon of allelopathy. Water-soluble acids such as ferulic, syringinic and coffee acids easily leak from the leaves and roots into the soil where their function is to inhibit germination.

The complex phenolic compounds are flavonoids and more than 9,000 compounds belonging to this group have been identified. The beginning of the synthesis of flavonoids is the hydroxycinnamonyl-CoA thioester, which, by condensing with three malonyl-CoA molecules, gives rise to the synthesis of chalcones, precursors

The synthesis of flavonoids, lignin monomers, coumarin and simple esters (e.g. chlorogenic acid). Flavonoids are water-soluble compounds accumulated in the vacuoles of cells. Most of the flavonoids are colored compounds with a wide range of colors and the main group of colored compounds are anthocyanins. Moreover, flavonoids, similarly to simple phenols, act as antioxidants, chelators of divalent cations, photoreceptors and attractants [3]. Flavonoids protect the plant against pathogenic microorganisms [4], herbivores, UV radiation [5] and oxidative stress.

Another important group of compounds derived from hydroxycinnamates are lignans and lignins. These compounds are synthesized from monolignols, i.e. alcohol derivatives of coumaric, coniferyl and sinapinic acids by hydroxylation and methylation reactions. Dimerization or polymerization of monolignols leads to lignans or lignins, but the chemistry of these processes has so far been poorly understood. Lignins contribute to the maintenance of plant rigidity and, similarly to other phenylpropanoids, show antioxidant properties.

In summary, all compounds of the phenylpropanoid pathway exhibit strong antioxidant properties. An important property of this pathway is also the flow of metabolites within the pathway, and it has been documented that enhancement of flavonoid synthesis is associated with reduced accumulation of phenolic acids [6].

Fatty acids provided in food play an important role in the proper development and functioning of the human body. They are a source of energy, are components of cell membranes and eicosanoid biosynthesis; prostaglandins, prostacyclines, thromboxanes and leukotrienes. They function as hormones and intracellular messengers [7]. An important factor is the type and appropriate proportions of fatty acids consumed. Studies have shown that an unbalanced fat intake can lead to diseases such as atherosclerosis, heart disease, hypertension, obesity and many others. An important role in preventing these diseases is played by polyunsaturated fatty acids (PUFA) [8, 9]. The PUFA group includes compounds with eighteen or more carbon atoms in the alkyl chain and containing at least two double bonds. Among them, we distinguish two families: ω-6 and ω-3. The name of the groups derives from the position of the double bond of the terminal CH3 group (omega carbon). The most important PUFAs include: linoleic acid (LA) (C18: 2, ω-6), α-linolenic acid (ALA) (C18: 3, ω-3), γ-linolenic acid (GLA) (C18: 3, ω-6) ), arachidonic (AA) (C20: 4, ω-6), eicosapentaenoic (EPA) (C20: 5, ω-3), and docosahexaenoic (DHA) (C22: 6, ω-3).

The precursors of these groups, linoleic acid and a-linolenic acid, constitute a pool of essential unsaturated fatty acids (EFAs), as they are not synthesized in the human body and must be supplied with food [10]. The main source of ALA is linseed, linseed, rapeseed and soybean oil, and walnuts. DHA and EPA are found in oily ocean fish [7, 11]. Numerous epidemiological studies on the influence of ω-3 acids have proved their positive influence on the human body. Ω-3 acids play a special role in the prevention of cardiovascular diseases [7, 12], the nervous system [13], the immune system: allergies, inflammations [14], cancer, a diet rich in DHA and EPA reduces the risk of cancer, especially breast, intestinal and prostate cancer [15] as well as metabolic and cutaneous cancer [10].

Linoleic acid occurs mainly in oils: sunflower, soybean, safflower, grape seed, sesame, peanut, wheat germ and corn [10]. In the case of acids from the ω-6 family, positive effects were also found in the treatment of gastric ulcer and duodenal ulcer, obesity and diabetes. However, studies from recent years show that too much supply, mainly of linoleic acid, increases the risk of cancer (mainly breast, intestine and prostate), metastases and induces angiogenesis. It is related to the action of the tissue hormones arachidonic acid, formed from LA, which increase the invasiveness of cancer cells [15]. Therefore, it is very important to provide the right proportion of PUFAs. The appropriate ratio of ω-6 / ω-3 acids in the diet should be kept at a level no greater than 5-10: 1.

Bacterial strains resistant to this antibiotic were isolated shortly after the introduction of penicillin therapy. Currently, over 90% of staphylococci, but also pneumococci and enterococci are insensitive to the effects of natural penicillins. Resistance of microorganisms to isoxazolyl penicillins (cloxacillin) and those with beta-lactamase inhibitors (amoxicillin) and to methicillin is also spreading rapidly. Staphylococcal strains resistant to methicillin pose a special threat, because until recently, sensitive only to glycopeptides (vancomycin), in recent years cases of the emergence of strains moderately sensitive to vancomycin have been reported. Vancomycin is often the last resort antibiotic for treating staphylococcal infections. The incidence of both nosocomial and community-acquired infections caused by multiresistant cocci strains

PL 217 808 B1

Gram-positive substances are constantly increasing, which necessitates the search for new drugs and other therapeutic options, such as, for example, immunostimulation or anti-infection prophylaxis. The therapeutic problem is also caused by primary and secondary fungal infections, both nosocomial and community-acquired, caused especially by the Candida species.

Bacterial and fungal infections are particularly unfavorable in the treatment of chronic wounds. Clinically chronic wounds are skin lesions characterized by impaired healing progress, ie progression through the subsequent stages of wound healing under the influence of topical treatment for 8 weeks [16, 17]. It is estimated that the problem of chronic wounds affects 3-5% of the world's population over 65 years of age. Chronic wounds are a serious complication of many diseases associated with the local reduction of blood flow in the veins, arteries or microcirculation. The most common in clinical practice are venous leg ulcers (45-60%), ischemic wounds (10-20%), diabetic foot syndrome (15-25%), or combinations of these types. Less common are bedsores (trophic ulcers), wounds resulting from burns (chemical, thermal, electricity), frostbite, postoperative wounds, neoplastic ulcers, wounds associated with congenital vascular malformations and rare diseases on the border of interna and dermatology and iatrogenic origin as expression of treatment complications [17]. Ulcers are not only a serious clinical and nursing problem, but also a social, social and economic problem. Prolonged healing and difficult wound management methods, as well as the suffering of patients, constitute a major challenge for modern medicine [18]. Especially since traditional ulcer treatment strategies have had extremely limited success. Despite the many types of chronic wounds and numerous methods of their classification distinguished in the literature, in terms of biochemistry, they can be characterized as an imbalance between oxidants and antioxidants towards the oxidation reaction, which is caused by the increase in the production of oxygen free radicals, e.g. by neutrophils in the wound and / or a decrease in antioxidant activity, leading to a situation known as oxidative stress [19, 20]. Research on difficult-to-heal, chronic wounds suggests that local oxidative stress intensifies the inflammatory process in the wound, thus interfering with the healing process, regardless of the cause of the wound [21, 22]. The effect of oxidative stress is the influence on factors playing a key role in regulating wound healing [17, 19]. In chronic wounds, the constant, excessive production of ROS leads to a constant level of oxidative stress. It is believed that therefore chronic wounds stagnate in the inflammatory phase and show no spontaneous tendency to produce granulation tissue [23]. It is expected that future strategies for the treatment of chronic ulcers, in addition to good standard therapies, will include reduction of oxidative stress in the wound [24]. One of the elements of the treatment of chronic wounds, apart from surgical intervention, general antibiotic therapy, anticoagulant and analgesic treatment, is local antibiotic therapy, whose task is, among other things, to remove microorganisms from the ulcer. The most common infections are Gram positive cocci. Treatment of staphylococcal infections, however, is increasingly limited by the emergence of multi-resistant strains of these bacteria. A necessary condition for the renewal of mass flax cultivation is constant care for the quality of seeds, and in particular the constant search for ways to strengthen plant resistance. It is estimated that about 20% of the loss in flax cultivation is due to fusariosis. Although research on the response of flax to pathogenic infection has been conducted for many years, so far there is no utility type on the market in which the resistance feature would be added using new biotechnology methods. There were also no utility types in which the feature of resistance to environmental stress would be correlated with the new properties of plants.

The primary object of the present invention is therefore to produce a transgenic plant, especially flax, which is resistant to environmental stress, especially fusariosis, preferably with further improved properties of products derived therefrom.

Unexpectedly, the above stated object has been achieved in the present invention. The subject of the invention is a transgenic plant, especially flax, transformed with a sequence coding phenylpropanoid synthesis enzymes selected from the group consisting of: chalcone synthases, chalcone flavanone isomerases and 4-dihydroflavonone reductase, characterized in that it contains a repressed endogenous gene encoding the synthesis of the said plant, has improved resistance to fusariosis. Preferably, in tissues and organs, especially seeds, plants according to the invention stably accumulate higher concentrations of polyunsaturated fatty acids and antioxidants than in the tissues and seeds of the reference plants, and the seeds thereof also preferably contain an increased concentration of tannins. Preferably the fatty acids accumulate in the tissues

PL 217 808 B1 and plant seeds are ω-6 and ω-3 acids, preferably in the dietally optimal ω-6: ω-3 ratio, while antioxidants accumulating in plant tissues and seeds are phenylpropanoids and terpenoids. Preferably, the chalcone synthase coding sequence comprises the sequence shown as Seq. No. 1 as the coding sequence for the chalcone flavanone isomerase includes the sequence shown as SEQ. No. 2, and as the coding sequence for 4-dihydroflavonone reductase it comprises the sequence shown as SEQ. No. 3. Particularly preferably, the transgenic plant according to the invention is transformed with the sequence shown as SEQ. No. 4.

Another subject of the invention is a method of obtaining a transgenic plant, especially flax, with increased resistance to environmental factors, characterized by the fact that plant cells are transformed with a sequence encoding phenylpropanoid synthesis enzymes selected from the group consisting of: chalcone synthases, chalcone flavanone isomerases and 4-dihydroflavone reductase, the endogenous gene encoding chalcone synthase is repressed, and the resulting transgenic plant has improved resistance to fusariosis.

Preferably, the sequence shown as Seq. No. 1, the sequence shown as SEQ. No. 2, the sequence shown as SEQ. No. 3, and it is particularly preferred to use the sequence shown in Seq. No. 4.

Another object of the invention is a plant extract obtained from a transgenic plant as defined above or obtained by a method as defined above. Preferably the extract is in a form selected from: plant tissue hydrolyzate, oil pressed from transgenic flax seed, tissue expeller of transgenic flax, isolated seeds, preferably purified.

Another object of the invention is the use of an extract according to the invention as defined above for the production of a medicinal preparation, the produced medicinal preparation is intended for the treatment and / or prophylaxis of diseases selected from the group consisting of: cardiovascular diseases, especially atherosclerosis, metabolic diseases, especially diabetes and islet atrophy. pancreatic diseases, neoplastic diseases, skin diseases, bacterial or fungal infections. Preferably, the formulation is in the form of a gel formulation, external preparation, internal preparation.

Another object of the invention is the use of an extract according to the invention as defined above for the production of a food supplement that changes the nutritional value of food for animals and humans, the food supplement produced having antioxidant properties or being a nutritional source of polyunsaturated fatty acids, preferably ω-6 and ω-3 acids, for animals and people.

The transgenic plants obtained according to the invention surprisingly have improved resistance to fusariosis, which evidently improves their utility values. Moreover, they have a number of additional advantages.

In an exemplary embodiment, the transgenic plant is new flax, which has at least the same antipathogenic resistance and therefore productivity as the unmodified plants. Products derived from it (fiber, oil, seed expeller) are the basis of preparations of biomedical importance, in particular activators of linen dressing intended for the treatment of chronic wounds. Due to the beneficial properties of tannins, such as inhibition of oxidation, binding to proteins and antipathogenic activity, it was decided to modify the flax in such a way as to increase the accumulation of these compounds. To achieve this goal, a new strategy was used to silence the unwanted metabolic pathway along the phenylpropanoid pathway and redistribute the substrates for the synthesis of tannins. Increasing the accumulation of tannins as a result of reducing the synthesis of chalcones by inhibiting chalcone synthase, the main enzyme of their synthesis, resulted in an increased resistance of plants to pathogenic infection, but also the synthesis of polyunsaturated fatty acids increased towards the optimal ratio of ω6 / ω3 acids and the resistance of oil to oxidation increased . Moreover, the presence of bioactive compounds in the expeller of seeds of these plants was found, including the particularly interesting terpenophenol-cannabidiol with anti-inflammatory activity. This relationship was first identified in linen.

The transgenic flax described in the exemplary embodiment is resistant to environmental stress. The new strategy used in the invention consists in strengthening the plant defense mechanisms by activating the secondary metabolite biosynthetic pathways and should lead not only to increasing plant resistance, but also to increasing the biomedical and industrial usefulness of the products.

And derived therefrom. The consequence of modifying the biosynthetic pathways of secondary metabolites is the accumulation of chemical compounds in plants with a diverse structure and chemical and biological properties. Among the compounds whose level has been increased in the new linseed are mainly tannins and polyunsaturated fatty acids necessary for the human diet, as well as compounds with antiatherosclerotic function and, in general, nutraceuticals supporting human health (phenylpropanoids). The common property of all these compounds is their anti-oxidative function and due to the fact that the first stage of pathogenic infection and environmental stress in general is the excessive production of free radicals, these compounds protect the plant against adverse environmental influences. Moreover, it was found that the obtained transgenic plants produce an optimal composition of ω-3 and ω-6 fatty acids as well as water-soluble and lipid-soluble antioxidants.

The advantage of growing the new transgenic flax according to the present invention, preferably W92.86 plants, is the production of linseed oil not only with increased stability but also with an optimal fatty acid composition for the consumer. Such oil has a wide range of applications, including as a component of an antiatherosclerotic preparation and as an activator of a linseed dressing for the treatment of chronic wounds.

The analysis of fiber hydrolysates (Table 1) and bagasse hydrolysates (Table 2) showed their diverse metabolic composition.

T a b e l a 1:

Content of antioxidant compounds in the hydrolysates of unmodified and modified flax fibers (W92.86)

The plant is unmodified W92.86 Phenolic compounds: Ferulic acid 290 μg / g 350 μg / g Vanillin 460 μg / g 480 μg / g 4-hydroxybenzoic acid 300 μg / g 350 μg / g Acetowanilone 70 μg / g 100 μg / g Cannabidiol 4.88 μg / g 5.03 μg / g Lutein and μg / g 4.01 g / g

T a b e l a 2

The content of antioxidant compounds in the expeller hydrolysates of unmodified and modified flax seeds (W92.86) expressed

Plant unmodified W92.86 Phenolic compounds: Secoisolariciresinol diglucoside 2400 μg / g 25,000 μg / g Ferulic acid 520 μg / g 720 μg / g P-coumaric acid 150 μg / g 190 μg / g P-coumaric acid glucoside 1230 μg / g 1840 μg / g Ferulic acid glucoside 1060 μg / g 1440 μg / g Kampferol 5.4 μg / g 9.9 μg / g Quercitin 4.1 μg / g 7.8 μg / g Proanthocyanidins 14.8 μg / g 26.5 μg / g Hydrolysable tannins 77.1 μg / g 288.5 μg / g Cannabidiol 2.4 μg / g 4.88 μg / g Lutein 2.2 μg / g 4.5 μg / g

Thus, pomace hydrolysates mainly contain ferulic and coumaric acids and their glucosides, lignans (SDG) and cannabidiol, kaempferol and quercetin, lutein and non-hydrolyzable and hydrolysable tannins, while fiber hydrolysates contain antioxidants such as acetowanilon, vanillin and 4 -hydroxybenzoic acid, which, with the exception of ferulic acid, is absent in the pomace. Lutein and cannabidiol, identified for the first time in flax, deserve special attention, both compounds are present in both pomace and fiber hydrolysates. The latter is especially important for its anti-inflammatory and analgesic properties.

It is therefore possible that the high antioxidant content of the seed skins counteracts the auto-oxidation of the fatty acids by increasing their oil content and stability. Too much extra

The antioxidant stability of the oil may be enhanced by adding hydrolysates from fibers manifested by the presence of a broad spectrum of antioxidant compounds to the oil. In addition, the hydrolysates of expeller and fibers, characterized by the presence of a wide range of antioxidants, can be used as an activator of the linseed dressing, enhancing its healing properties.

On the basis of the obtained transgenic plants, it is possible to produce an alternative antibiotic. A unique preparation in the form of a gel with both antibacterial and antifungal activity was made using the seed expeller of the transgenic W92.86 lines as a raw material. The preparation is dedicated to the treatment of skin wounds and chronic wounds of various etiology. The obtained experimental data show that the alkaline hydrolysates of the seed pomace of the transgenic W92.86 plants in fact inhibit the growth of the bacterial strains used in the antibiotic resistance tests.

A similar effect was also observed with fungi of the Candida species. The addition of a fungal hydrolyzate from flax seed expeller to the medium causes lysis of the fungal cells.

Increased accumulation of tannins in the seed coat of this transgenic line significantly improved the plant resistance to infection with fungal pathogens. To sum up, the produced antibiotic preparation in the form of a gel will be a raw material source based on the expeller of plants W92.86, which will provide a wide range of possibilities to counteract bacterial and fungal infections complicating the treatment of skin diseases.

In addition to the toxic effect on microbial cells, the compounds of the phenylpropanoid pathway have generally known antioxidant properties favorable to humans, controlling the homeostasis of pro and anti-inflammatory processes. The aforementioned properties of phenylpropanoids in the prevention of ischemic heart diseases and in preventing the negative effects of environmental stresses make the proposed new antibiotic preparation fit well with expectations, on the one hand having biocidal activity against microorganisms and constituting the basis for a new therapeutic option based on anti-infection prophylaxis.

New generation flax produced by new biotechnology methods is a raw material for the separation of compounds (mainly phenylpropanoids) with potential antioxidant, anti-inflammatory, antitumor, bactericidal and fungicidal functions and for the production of an antibiotic preparation, as well as a source of stable oil enriched with water-soluble antioxidants.

The disclosed transgenic plants can be used to produce new agents against metabolic diseases.

The antioxidant properties of lignans (SDGs) are also used in the protection against the destruction of pancreatic islets. The most important factor causing the destruction of pancreatic islets and the induction of type I diabetes mellitus are oxygen free radicals (ROS). Their destructive power manifests itself through the peroxidation of phospholipid membranes, resulting in the formation of malonyldialdehyde molecules - MDA. Most importantly, however, they lead to changes in membrane permeability and integrity. Studies in rats that are models for studies in type I and II diabetes have shown that SDG can delay disease progression in both cases [25, 26]. It is worth mentioning that SDG is a suppressor of PEPCK (phosphoenolpyruvate carboxykinase) gene expression. On the other hand, PEPCK is an enzyme that regulates the rate of gluconeogenesis in the liver. This information seems to be significant because hyperglycemia results from an increase in the expression of this gene [27]. This is another feature of SDG that demonstrates its ability to inhibit the development of diabetes. The main health problem of a significant part of the society, which is a consequence of chronic systemic diseases, nowadays growing to the rank of civilization diseases (type 2 diabetes, obesity, generalized atherosclerosis, chronic advanced venous insufficiency) are long-term, difficult-to-heal skin ulcers. Venous insufficiency leads to the aggregation of leukocytes, the release of inflammatory factors and oxygen free radicals, which leads to the disturbance of the pro and antioxidant balance in cells and, consequently, the formation of chronic wounds [28].

In the human body, mechanical, physical, chemical, surgical and other procedures also lead to the formation of wounds and lead to the imbalance of pro and antioxidant cells in cells and result in excessive accumulation of reactive oxygen species (ROS). Excess ROS is the cause of many diseases [29-31]. They are attributed a causative role in the aging process, heart disease, cancer, degenerative diseases such as cataracts and multiple sclerosis. Lipid peroxidation is a particularly dangerous process, because it does not end with the oxidation of the first component, but a chain reaction occurs, which in turn leads to a decrease in the activity of

Of different membrane proteins, thereby altering the permeability of the membranes and even destroying the entire cell.

Therefore, the damaged and accumulating ROS sites should be provided with neutralizing substances (antioxidants) and their damaging effects [32]. The task of antioxidants (antioxidants) is to maintain the homeostasis of pro and antioxidant processes.

Hence, the interest in flavonoids and phenolic acids is justified due to their antioxidant properties and inhibitory effect on viruses, bacteria and fungi [33].

Thus, the genetically engineered production of a new type of flax, the fibers and seeds of which would be equipped with naturally synthesized and powerful antioxidants, could be an effective method of counteracting the build-up of free radicals. The presence of strong antioxidants in the plant can have two meanings: it protects the plant against the adverse effects of environmental factors and provides the raw material for direct biomedical use, including as activators of a new dressing product compensating reactive oxygen species in wounds.

The disclosed transgenic plants can be used to produce an alternative anti-cancer agent.

Due to the high content of lignans in flax seeds, it is also possible to use them in anti-cancer prophylaxis. New flax seeds are a source of valuable oil which, apart from high nutritional value, due to the high content of polyunsaturated fatty acids, also contains a wide spectrum of compounds with potential antibacterial and antifungal properties. The seed pomace of these plants contains many beneficial compounds from one of the most important secondary metabolism pathways, namely phenylpropanoid (phenolic acids, flavonoids, lignans, tannins).

Particularly noteworthy are lignans that accumulate in the expeller of transgenic flax W92.86 in a much greater amount than in control plants. Plant lignans are primarily strong antioxidants, but also precursors of enterolactone and enterodiol, estrogenic compounds classified as mammalian lignans. These compounds prevent the development of various types of cancer, including breast cancer, prostate cancer and colon cancer [34]. Experiments have shown that feeding rats with flaxseeds (5% of the diet) in the early stage of promoting carcinogenesis causes changes in the size of the neoplastic tumor. Moreover, the consumption of flax seeds can also reduce the size of the tumor, which is at the stage of late promotion. In addition, it has been proven that flax does not interfere with the action of tamoxifen (one of the most popular drugs used in women with breast cancer), on the contrary - it strengthens its inhibitory effect both in individuals with low and high levels of estradiol [35]. This observation indicates the potential use of flaxseed / seed expeller or flax-derived preparations as an adjuvant in the treatment of hormone-dependent tumors with the drugs used so far. Lignans also inhibit diseases related to prostate enlargement by blocking the activity of the enzyme-5a-reductase, which is responsible for the conversion of testosterone into dihydrotestosterone. Lignans increase the amount of SHBG - sex hormone binding protein. Theoretically, an increase in SHBG should result in less testosterone availability, and thus less likelihood of excessive prostate hyperplasia. It was also observed that lignans caused a marked reduction in the size and number of abnormal foci of intestinal crypts - a symptom of precancerous intestinal cancer. In this case, the mechanism of action of lignans is based rather on their strong antioxidant properties.

Thus, it has been disclosed that a new transgenic flax has been genetically engineered, the fibers and seeds of which would synthesize a wide spectrum of natural and potent antioxidants. Preferably, the above-mentioned antioxidants are tannins, phenolic acids and flavonoids.

Subsequently, the production of transgenic flax with partially silenced expression of the endogenous gene encoding chalcone synthase and enhanced expression of the genes encoding chalcone isomerase and 4-dihydroflavone reductase (CHS, CHI and DFR) was disclosed to enhance the accumulation of tannins and other phenylpropanoids in plant seeds and tissues.

It is then disclosed to produce transgenic flax that synthesizes and stores fatty acids stably, with the fatty acids preferably being polyunsaturated fatty acids, even more preferably being ω3 and ω6, most preferably being ω3 and ω6 in the proportion optimal from the point of view of human dietetics, i.e. in the ratio ω6 / ω3 not greater than 5-10 / 1. Subsequently, the preparation of an oil containing the transgenic flax was disclosed

The optimal proportion of ω3 and ω6 acids, preferably the oil is extracted from the seeds of the transgenic flax.

Further disclosed is the use of transgenic flax as a dietary supplement for animals including humans, preferably using whole seeds as a supplement, and equally preferably using seed extract and also using transgenic flax seed oil.

Thereafter, the preparation of an extract from the transgenic flax is disclosed, the extract preferably being a hydrolyzate.

Thereafter, it is disclosed to prepare a transgenic flax preparation, preferably from an extract of transgenic flax, preferably a gel preparation for medical use.

Thereafter, an alternative antibiotic made from transgenic flax, preferably from transgenic flax extract, and most preferably in the form of a gel preparation based on an extract of transgenic flax, is disclosed.

Subsequently, the use of transgenic flax as an alternative antibiotic was disclosed. Preferably, a transgenic flax extract is used, and most preferably a gel preparation based on an extract of transgenic flax. Preferably the antibiotic is effective against bacteria and fungi.

Further disclosed is an alternative antitumor agent for animals, including humans, made from transgenic flax, preferably from transgenic flax seed expeller, preferably administered as a food additive.

Next, the use of transgenic flax as an alternative anti-cancer agent was disclosed. Preferably, transgenic flax seed extract is used, and most preferably a hydrolyzed expeller extract of transgenic flax is used. Preferably, the alternative anti-cancer agent is administered as an additive to food for animals, including humans.

Subsequently, a novel agent for combating metabolic diseases in animals, including humans, made from transgenic flax, preferably from transgenic flax seed expeller, preferably administered as a food supplement, was disclosed.

Next, the use of transgenic flax as an alternative agent against metabolic diseases was disclosed. Preferably, transgenic flax seed extract is used, and most preferably transgenic flax seed oil. Preferably, the alternative agent against metabolic diseases is administered as an additive to food for animals, including humans.

In order to better illustrate the essence of the present solution, the description is enriched with the attached figures and the following examples of implementation, which, however, do not exhaust its scope.

Description of the figures

Fig. 1. ROS are a common denominator of the early-stage damage to the human body and pathogenic plant infection. The diagram shows the main pathways for the transmission of the inflammatory signal (left diagram) along with the body's response to the production of endocannabinoids (e.g. arachidonyl glycerol), which are equivalent to plant cannabinoids (e.g. cannabidiol); the right diagram shows the plant's reaction to a free radical reaction resulting in the synthesis of antioxidants (phenylpropanoids, terpenoids, and others).

Figure 2. Schematic of the phenylpropanoid pathway, the scheme shows the enzymes controlling the major routes of metabolism.

Fig. 3. Scheme of the procedure used to identify genes differentiating control plants from those treated with fusariosis.

Figure 4. Early infection response genes of flax (arrows indicate increase or decrease in expression) identified by sequence similarity to genes listed in the http://www.ncbi.nlm.nih.gov/ database and grouped by potential function; sequences of genes hitherto unknown in flax were placed in the database (numbering under the genes).

Fig. 5. The diagram (left) shows the PCA analysis (IC01, IC02) of the metabolome of plants infected with two Fusarium strains and treated with two concentrations of salicylic acid as a control (six biological replicates), and the metabolites contributing to the IC01 and IC02 values are listed; on the right is a diagram showing the antioxidant capacity of various metabolites.

Fig. 6. Content of free and accumulating compounds (upper panel) in the cell wall (expressed as a percentage of the control) and agarose gel separation of gene expression products (lower panel) of the phenylpropanoid pathway (semi-quantitative PCR) of control flax seedlings (CTRL or C) and treated with the pathogens F. oxysporum (F. ox or Fo) and F. culmorum (Fe). PAL, ammoniaolase

Phenylalanine; CCR, cinnamon reductase; CAD, cinnamon dehydrogenase; GT, glucose transferase; TD, tyrosine decarboxylase; CHS, chalcone synthase; ACTIN, actin.

Fig. 7. Preselection and selection of transgenic plants.

(a) Agarose gel separation of the PCR reaction products with neomycin phosphotransferase (nptII) specific staters on genomic DNA as template. C - DNA from untransformed plants (negative control); P - plasmid DNA used for transformation (positive control); numbered- DNA from transgenic plants.

(b) Northern blot analysis of RNA isolated from untransformants (C) and independent transgenic lines (numbered). Nitrocellulose membranes with resolved total RNA were hybridized with ³² P-labeled cDNAs encoding CHS (1.4 kb), CHI (0.8 kb) and DFR (1.3 kb) cDNA. Ribosomal RNA (28S rRNA) stained with ethidium bromide served as the control.

Figure 8. Detection of transgenes in the genome of homozygous transgenic plants. Agarose gel separation of PCR products on genomic DNA as a template and with primers specific for transgenes encoding CHS (746 bp), CHI (312 bp), DFR (505 bp) and the endogenous CHS gene (CHS flax-472 bp). P - positive control (plasmid DNA); C - DNA from untransformed plants; DNA from independent transgenic lines was numbered.

Fig. 9. Content of metabolites of the phenylpropanoid pathway in seeds of control plants (C) and transgenic plants of the F3 generation (numbered). The seeds were extracted with methanol (anthocyanins, flavanons, secoisolariciresinol diglucoside, phenolic acids), n-butanol-HCL mixture (proanthocyanins) or acetone (hydrolysable tannins). The content of anthocyanidins, flavanones, proanthocyanates and hydrolysable tannins glucosides was determined spectrophotometrically and expressed as standard equivalents (cyanidin-3-O-glucoside, naringenin, catechin and gallic acid). The content of SDG and phenolic acids was assessed by the UPLC technique against the relevant standards.

Fig. 10. Resistance of control plants (C) and homozygous transgenic plants of the F3 generation (numbered) to infection by Fusarium oxysporum and Fusarium culmorum infection (percentage of plant seedlings infected, statistical significance is marked with an asterisk, P <0.05).

Fig. 11. Agarose gel separation of PCR reaction products on an mRNA template from control plants (C) and homozygous transgenic plants of the F3 generation (numbered) and with primers specific for the transgene CHS and endogenous CHS. Expression of the actin gene (Actin) was the control.

Fig. 12. Effect of W92.86 plant pomace hydrolysates on the growth of standard bacterial strains used in antibiotic resistance tests and on the growth curve of P. aeruginosa strain over time (K-control without hydrolyzate, the amount of added hydrolyzate was expressed in μg of the main component, i.e. . lignan-SDG).

Fig. 13. Effect of W92.86 plant pomace hydrolysates on the growth of standard fungal strains and the C. neoformans growth curve over time (K-control without hydrolyzate, the amount of hydrolyzate added was expressed in μg of the main component, ie lignan-SDG).

Fig. 14. Number of fibroblast cells grown in DMEM medium (control) and with the addition of preparations 1 or 2 at various concentrations from 1 fold (1x, the concentration of active compounds as in Table 5) to 25 fold (25x); cells were counted under a microscope in a Burker chamber.

Fig. 15. The three-gene construct described in Example 3 and shown as Seq. No. 4.

P r z k ł a d 1.

Identification of plant genes in response to pathogenic infection. The experimental material was flax (Linum usitatissimum L.) unexposed and treated with mushroom inoculum. Two separate cultures of Fusarium were prepared: Fusarium oxysporum f. Lineage and a mixture of five species together (F. avenaceum, F. culmorum, F. gibbosum, F. sambucinum and F. poae) according to the procedure described by us earlier [36]. 12-14 day old flax seedlings were infected for 24 hours, after which time the seedlings were harvested and frozen in liquid nitrogen and stored at -80 ° C until use. Frozen tissue was used for mRNA isolation according to a standard technique and for the extraction and analysis of metabolites according to the procedure described [37]. It was expected to obtain information which of the secondary metabolism genes respond to the earliest stage of infection, ie the free radical reaction. For this purpose, a cDNA subtraction (differential) library was made to differentiate the infected plant from the control according to the scheme (Fig. 3).

CDNA libraries were generated using polyA ⁺ mRNA isolated from control plant seed sprouts and treated with the pathogen using the reagent kit manufacturer's procedure. In order to select the pathogen resistance genes, differential hybridization of the control and post-infection cDNA was performed using the PCR-Select cDNA Subtraction Kit (Clontech,

PL 217 808 B1 cat. Well. 637401). In the first version, the tester was cDNA isolated from infected plants, and in the second version, cDNA from control plants. This procedure allows the isolation of both over-expressed and repressed cDNAs as a result of infection. The obtained differential cDNA was cloned into the pCR2.1-TOPO vector and transformed into E. coli cells of strain DH10B by electroporation. 47 differential clones were obtained, sequenced and their potential function determined based on in silico analysis (Fig. 4).

Among the wide spectrum of differentiating genes (Fig. 4) are those involved in phenylpropanoid, isoprenoid, pectin and lignin metabolism and the regulation of photosynthesis and protein phosphorylation.

P r z k ł a d 2.

Verification of the gene profile with the use of flax metabolic profile.

Subsequently, data from the gene profile were verified by determining the metabolic profile of infected plants and its reference to control plants. It was expected that a change in the expression of secondary metabolism genes in plants after infection would result in a change in their accumulation.

Identification and analysis of metabolites in flax before and after pathogen inoculation was performed using standard gas chromatograph mass detector (GC-MS) procedures and the obtained data were analyzed using a standard bioinformatics method such as PCA (principal component analysis). Particular attention was paid to the analysis of secondary metabolites of potential importance in plant defense (antioxidants).

In the PCA analysis, the first principal component contains the largest part of the observed variability. The next groups of correlated relationships are changed into successive main components, corresponding to the decreasing variability in the tested samples. In this way, PCA converts a large number of variables (concentrations of individual compounds) correlated into a smaller number of non-correlated variables (a group of compounds, e.g. from one metabolic pathway). Thus, the results of the analysis of a large number of compounds (metabolome) can be presented, for example, in the form of two component variable PCA. It has been shown that it is possible to distinguish different genotypes in this way, and to show the influence of genetic transformation or environmental stress on the transgenic organism [38].

The data from the gene profile was verified by determining the metabolic profile of infected plants and its reference to control plants (Fig. 5). An alteration in the expression of secondary metabolism genes in post-infection plants has been shown to alter the accumulation of compounds in the phenylpropanoid and terpenoid pathways.

Verification of data from the metabolic profile of uninfected and post-infection plants was performed by independent detailed determinations of free and cell wall bound metabolites in high performance liquid chromatography (UPLC) and verification of subtraction library data of the response of the obtained genes to infection in semi-quantitative PCR (Fig. 6).

The obtained data show that, in fact, the change in the expression of genes, especially those involved in the regulation of the phenylpropanoid pathway after infection with flax, is manifested by changes in the accumulation of secondary metabolism compounds (Fig. 6). It has been found that after infection the level of catecholamines, phenolic acids, lignin precursors and flavonoids increases. The increase in the accumulation of these compounds corresponds to the increased expression of the relevant genes. The increase in the expression of phenylalanine ammoniaolase, cinnamon reductase (CCR), cinnamon dehydrogenase, glucose transferase and tyrosine decarboxylase causes the accumulation of metabolites corresponding to these enzymes. Unexpectedly, a decrease in the expression of chalcone synthase was observed. The observation became the basis for the production of transgenic flax plants with overexpression of three genes with the intention of enhancing the phenylpropanoid metabolism pathway controlled by chalcone synthase and thus increasing plant resistance and obtaining a new raw material for the production of linen fabric and more stable oil.

P r z k ł a d 3.

Construction of transgenic flax with overexpression of the three genes of chalcone synthase, chalcone isomerase and 4-dihydroflavonone reductase (CHS, CHI and DFR). A binary vector was prepared according to the previously described method, which contained a three-gene construct for the synthesis of flavonoids [39] equipped with the genes of chalcone synthase (CHS), chalcone isomerase (CHI) and dihydroflavonone reductase (DFR) in sense orientation, all under the control of the 35S CaMV promoter and a terminator OCS. The construct contained petunia cDNA (Petunia hybrida) and a marker gene encoding neomycin phosphotransferase

PL 217 808 B1 (nptII). The construction was checked for completeness and orientation of the coding sequence by sequencing.

The obtained construct was transformed with Agrobacterium tumefaciens and the presence of the construct in the bacteria was confirmed by restriction analysis.

Linola oleaginous flax leaf explants were transformed with Agrobacterium according to a known method, which contained a three-gene construct encoding CHS, CHI and DFR. A series of regenerates grown on the selection medium with kanamycin was obtained.

P r z k ł a d 4.

Study of gene expression in transgenic flax plants.

Regenerants grown on kanamycin selection medium were pre-selected by PCR (Fig. 7) using primers specific for the neomycin phosphotransferase (nptII) marker gene.

Plants showing the presence of 495 base pairs of fragment (nptII) in genomic DNA (Fig. 7) were selected for the presence of mRNA encoded by the introduced genes using standard northern blot technique. Three transgenic lines (Fig. 7) with the highest expression of the three introduced transgenes (W92.40, W92.72) or one of them (W92.86) were selected for the study. Plants of these lines were sown on standard MS medium with the addition of kanamycin (100 mg / l) and the seeds obtained from kanamycin resistant transgenic plants were grown in a greenhouse to obtain F1 generation plants. The seeds of the F1 generation were then grown in the field for two consecutive years producing seeds of the F3 generation. Each generation of plants was analyzed for the presence of the three introduced genes (CHS, CHI, DFR) and the endogenous CHS gene in a standard PCR technique using specific primers. As a result, homozygous transgenic plants (W92.40, W92.72, W92.86) of the F3 generation were obtained containing all three introduced genes in their genome (Fig. 8).

Then, the expression analysis of the introduced genes and the endogenous CHS gene was performed in the plants of the three transgenic lines mentioned.

Selected homozygous transgenic lines were cultivated under field conditions and the F3 generation of W92.40 and W92.72 plants (from the 2008 growing season) showed the expression of transgenes unchanged compared to the F1 generation (Fig. 7).

The expression of genes encoding the main enzymes of the flavonoid biosynthetic pathway in these plants was manifested by an increase in the content of the corresponding metabolites (Fig. 9). A positive effect of an increased amount of flavonoids in transgenic plants (W92.40, W92.72) on plant resistance was observed (Fig. 10).

The unexpected exception was the W92.86 transgenic line plants in which the endogenous CHS gene was partially silenced (Fig. 11).

Seeds of W92.86 plants already after the first growing season in the field (F1 generation) had a different phenotype (brown color as opposed to light yellow seed variety and the W92.40 and W92.72 transgenes), which was caused by the accumulation of tannins in the seeds (Fig. 9).

The plant resistance of this line was comparable to the W92.40 and W92.72 transgenes (Fig. 10). The cause of the accumulation of tannins and thus the change in seed color is presumably the repression of the endogenous CHS gene.

The described phenomenon of endogenous gene silencing due to the introduction of a highly homologous (66% homology) CHS gene from petunia, previously called co-suppression, most likely occurs due to RNA interference. Excessive production of mRNA from the transgene provokes the formation of siRNA, which by binding to the complementary endogenous mRNA of the CHS gene leads to its rapid degradation.

Plants of the W92.86 line accumulate large amounts of hydrolysable tannins in their seeds, which is probably the direct cause of their color change, and moreover, this feature is stable in subsequent generations of plants. This further means that partial silencing of the key gene (CHS) for chalcone synthesis redirected substrates for the synthesis of flavonoid compounds to the synthesis route of hydrolysed tannins, which in turn indicates the free flow of substrates within the phenylpropanoid pathway.

So far, the synthesis route of hydrolysable tannins has not been clearly defined. At least three alternative routes for the synthesis of the tannin precursor gallic acid are postulated, namely α-oxidation of cinnamic acid, and two routes through the shikimic acid synthesis pathway, one of which is the hydration of protocatechinic acid and the other is the direct dehydration of 3-dehydroshikimic acid (Fig. 2). ). It is not known which of these pathways is activated in W92.86 plants.

PL 217 808 B1

P r z k ł a d 5.

New flax shows increased resistance to fusariosis.

The seeds of the flax transgenic W92.86 lines were immersed in 96% ethanol for 1 min, then, after washing three times with sterile water, they were placed in a petri dish containing standard MS medium. After 7 days, the flax seedlings were transferred to a fungal inoculum (fungi were grown for 7 days at 18 ° C in standard PDA medium) containing F. culmorum or F. oxysporum. After 10-14 days from transferring the seedlings to the fungal inoculum, the infected seedlings were counted. The entire procedure is used as standard [40].

The transgenic plants (W92.86) showed an increase in resistance to fusariosis (Fig. 10). Plant resistance increased in the range from 30% to 40%. Thus, the accumulation of hydrolysed and non-hydrolysed tannins with antioxidant properties turned out to be an effective method of increasing plant resistance.

P r z k ł a d 6.

Production of fatty acids with optimal composition from transgenic flax seeds.

The oil production was carried out according to the known method of grinding the seeds and extrusion using an industrial press (Oil PressDD85G, IBG Monoforts Oekotec GmbH & Co). On average, 25% of oil and 75% of pomace were obtained. The fatty acid content in the oil was determined according to the known method involving the extraction of acid methyl esters with 0.5 M KOH in methanol. The extracts were then neutralized with 1.25 M HCl in methanol. Fatty acid methyl esters were extracted with hexane. The hexane extracts were concentrated under a stream of nitrogen and stored at -20 ° C. The quantitative analysis of fatty acid methyl esters was performed by gas chromatography (Agilent Technology 6890N) with the FID detector [41]. W92.86 seed oil is characterized by high stability (in relation to control) and a high content of linolenic acid, which allows to achieve the ideal for human diet, recommended by FAO / WHO ratio of linoleic acid (ω 6) to linolenic acid (ω3), at the level of 1-2: 1 (Table 3). In the diet of modern people in the USA and Western Europe, this ratio ranges from 10: 1 to 25: 1.

T a b e l a 3.

Composition of the main fatty acid fractions in oil from seeds of control plants and homozygous transgenic plants W92.86 and for comparison W92.40 expressed in μg / ml of oil.

Fatty acid ^ g / ml] Control plant W92.40 W92.86 (16: 0) 11.33 14.68 13.60 (16: 1) 0.16 0.27 0.22 (16: 2) 0.12 0.18 0.17 (16: 3) 0.10 0.15 0.10 (18: 0) 6.38 7.32 7.63 (18: 1) 32.57 34.55 40.05 (18: 2) 158.57 236.55 153.91 (18: 3) 3.64 5.86 105.70 (20: 0) 0.26 0.16 0.26 (20: 1) 0.19 0.30 0.19 (22: 0) 0.12 0.15 0.14 (22: 1) 0.10 0.20 0.18 (24: 0) 0.03 0.05 0.06 ω6: ω3 44: 1 40: 1 1.5: 1 Kw. saturated fat 18.13 22.36 21.70 Kw. unsaturated fatty acids 195.44 278.06 300.52 General level of fatty acids 213.57 300.42 322.22

PL 217 808 B1

The molecular basis of ω3 acid accumulation in plant seeds is not known so far

W92.86. It seems likely that the high content of compounds with antioxidant activity accumulating in the seed casings and thus also in the oil (Table 4) may protect polyunsaturated fatty acids against auto-oxidation.

T a b e l a 4.

The content of compounds with an antioxidant function in the oil of control plants and homozygous transgenic plants W92.86 of the F3 generation and W92.40 for comparison, expressed in μg / ml of oil.

[pg / ml] Control plant W92.40 W92.86 Phenolic compounds 11.9 12.7 13.2 Tocopherols 833.7 835.6 841.5 Plastochromanol-8 114.8 131.8 121.5 β-carotene 1.4 1.6 1.5 Lutein 2.1 3.9 4.3

P r z k ł a d 7.

Manufacture of an alternative antibiotic based on products from new flax W92.86.

Aqueous solutions of W92.86 plant seed pomace extract hydrolyzate with major component SDG concentrations of 25 μο / ml, 15 μο / ml and 5 μο / ml were used as a supplement to the standard minimum nutrient medium for microbial growth. Then, 1.5 ml portions of the medium prepared in this way were inoculated by adding 15 μg of a twelve-hour culture of bacterial or yeast strains.

Control cultures were carried out in minimal medium without any supplementation.

The growth analysis of bacteria (Fig. 12) and fungi (Fig. 13) was recorded spectrophotometrically at 620 nm after 24 hours incubation.

The experimental data obtained show that the alkaline hydrolysates of the seed pomace of the transgenic W92.86 plants in fact inhibit the growth of the bacterial and fungal strains used in the antibiotic resistance tests.

P r z k ł a d 8.

Production of an alternative agent for promoting and inhibiting the proliferation of fibroblasts in culture from new flax W92.86.

Based on two raw material sources, preparations of hydrolysed pomace were produced. The expeller completely defatted with hexane was the raw material source for preparation 1, while untreated with hexane was the source of preparation 2. The expeller (100 g) was extracted three times with 400 ml of 80% methanol (v / v) for 15 min at 80 ° C. The extract was centrifuged and the methanol was evaporated at 40 ° C. The aqueous fraction of the extract was hydrolyzed with a final NaOH concentration of 0.3 M for 2 days at room temperature and then neutralized with 2M HCl. The extract was then centrifuged and the supernatant filtered through 0.22 µg Acrodisc filters (Gelman Sciences, Ann Arbor, MI) or autoclaved at 120 ° C for 20 min. The chemical composition of the obtained preparations was determined (Table 5). The main component of both preparations was SDG. The preparations differed in the content of tocopherol and fatty acids.

T a b e l a 5.

Chemical composition of two preparations prepared from alkaline hydrolysates of seed pomace from W92.86 plants, degreased with hexane (preparation 1) and non-fat (preparation 2), analyzed by standard UPLC technique.

Bioactive compounds ^ g / ml] W92.86 Preparation 1 W92.86 Preparation 2 1 2 3 Diglucoside secoisolariciresinol 1650 1865 Ferulic acid 47.5 58.42 P-coumaric acid 12.5 16.25 Coumaric acid glucoside 121.4 129.89

PL 217 808 B1 cont. table 5

1 2 3 Acid glucoside 95 109.25 ferulowy Kampferol 0.65 0.74 Quercitin 0.5 0.58 Proanthocyanidins 1.75 1.92 Hydrolysable tannins 8.95 10.74 Cannabidiol 0.32 0.35 Lutein 0.29 0.30 Tocopherols 0.00 0.20 Plastochromanol-8 0.00 0.03 Total fatty acids 0.00 0.80 18: 1 0.00 0.10 18: 2 (ω6) 0.00 0.38 18: 3 (ω3) 0.00 0.26

Both preparations were used to evaluate their effect on the proliferation of murine fibroblasts (Balb 3T3). Fibroblasts were grown in standard DMEM medium according to a known procedure. Preparations 1 or 2 were added to the cultures at a concentration as in Table 5 or 1-fold to 25-fold dilutions as marked in the graph (Fig. 14). Formulation 1 at the concentrations shown in Table 5 showed strong fibroblast proliferation stimulating properties which decreased with dilution. The preparation, therefore with such a composition, is dedicated as an activator of a linen dressing to treat any body injuries.

The preparation 2, on the other hand, showed strong properties of inhibiting the proliferation of fibroblasts, which decreased with the dilution of the preparation. Thus, formulation 2 is a potential anti-cancer agent.

Literature

1. Droge W. Free radicals in the physiological control of cell function. Physiol. Rev., 2002, 82, 47-95.

2. Kostyn Κ., Czemplik M., Bortniczuk M., Kulma A., Skała J., Sens T., Szopa J. Genes of phenylpropanoid pathway produce most efficient antioxidants in early response to Fusarium attack in flax plant. 2010, submitted.

3. Harbome J.B., Williams C. Ha., Advances in flavonoids research since 1992. Phytochemistry 2000, 55, 481-504.

4. Cushnie P.T., Lamb A.J., Antimicrobial activity of flavonoids. Int J Antimicrob Agents 2005, 26, 343-56.

5. Ryan K.G., Swinny E.E., Markham K.R., Winefield C. Flavonoid gene expression and UV photoprotection in transgenic and mutant Petunia leaves. Phytochemistry 2002, 59, 23-32.

6. Aksamit- Stachurska A., Korobczak-Sosna A., Kulma A., Szopa J. Glycosyltransferase efficiently controls phenylpropanoid pathway. BMC Biotechnol. 2008, 8, 25

7. Wcisło T., Rogowski W., The role of omega-3 polyunsaturated fatty acids in the human body., Cardiovascular Forum, 2006, 11, 39-43.

8. Drexler H., Spiekermann-Meyer A., Domergue F., Zank T., Sperling P., Abbadi A. and Heinz E., Metabolic engineering of fatty acids for breeding of new oilseed crops: strategies, problems and first results ., J. Plant Physiol. 2003, 160, 779-802.

9. Shapiro H., Could n-3 polyunsaturated fatty acids reduce pathological pain by direct actions on the nervous system; Prostaglandins, Leukotrienes and Essential Fatty Acids, 2003, 68, 219-224.

10. Bojarowicz H. and Woźniak B., Polyunsaturated fatty acids and their effect on the skin, Problems of Hygiene and Epidemiology, 2008, 89, 71-475.

11. Fedacko J., Pella D., Mechirovά V., Horvath P., Rybάr R., Varjassyovά P. and να ^ ονά V., n-3 PUFAs - From dietary supplements to medicines., Pathophysiology, 2007, 14, 127-132.

PL 217 808 B1

12. Landmark K., Alm C.S., Alpha-Iinolenic acid, cardiovascular disease and sudden death Tidsskr Nor Laegeforen, 2006, 126, 2792-2794.

13. Buydens-Branchey L. and Branchey M., Long-chain n-3 polyunsaturated fatty acids decrease feelings of anger in substance abusers., Psychiatry Res. 2008, 157, 95-104.

14. Shaikh S.R., Edidin M., Polyunsaturated fatty acids and membrane organization: elucidating mechanisms to balance immunotherapy and susceptibility to infection. Chem. Phys. Lipids 2008,

153, 24-33.

15. Sommer E., Sommer S., Skopińska-Różewska E., Unsaturated fatty acids and cancer. Contemporary Oncology, 2002, 6, 60-63.

16. Menke N.B., Ward K.R., Witten T.M. Impaired wound healing. Clin. Dermatol. 2007, 25, 19-25.

17. Chadwick P., Acton C., The use of amelogenin protein in the treatment of hard-to-heal wounds., Br. J. Nursing, 2009 (Tissue ViabiliTy supplemenT), 18, 6.

18. Brem H., Stojadinovic O., Diegelmann R.F., Entero H., Lee B., Pastar I. Molecular Markers in Patients with Chronic Wounds to Guide Surgical Debridement. Moth. Med. 2007,13, 30-39.

19. Cullen B., Watt P.W., Lundqvist C., Silcock D., Schmidt R.J., Bogan D. and Light N. D. The role of oxidized regenerated cellulose / collagen in chronic wound repair and its potential mechanism of action., Intern. J. Biochem. Cell Biol. 2002, 34, 1544-1556.

20. Piotrowska-Jastrzębska J., Mikołów B., Motkowski R., The role of nutritional antioxidants in health and disease; Nutritional antioxidants in health and disease. Therapy Year X, 2002, 2 (116), 43-49.

21. Mustoe T. A., O'Shaughnessy K., Kloeters O. Chronic Wound Pathogenesis and Current Treatment Strategies: A Unifying Hypothesis., Plastic Reconstruct. Surgery, 2006, 117, 35S-41S.

22. Moseley R., Hilton J.R., Waddington R.J., Harding K.G., Stephens P., Thomas D.W., Comparison of oxidative stress biomarker profiles between acute and chronic wound environments.,

Wound Rep. Regen. 2004, 12, 419-429.

23. Dissemond J., Goos M., Wagner S.N., The meaning of oxidative stress in the pathogenesis and therapy of chronic wounds., (German). Hautzart, 2002, 53, 718-723.

24. Sen C.K., The general case for redox control in wound repair. Wound Rep. Reg. 2003, 11,

431-438.

25. Prasad K. Oxidative stress as a mechanism of diabetes in diabetic BB prone rats: Effect of secoisolariciresinol diglucoside (SDG)., Mol. Objective. Biochem. 2000, 209, 89-96.

26. Prasad K., Secoizolariciresinol diglucoside from flaxseed delays the development of type 2 diabetes in Zucker rat., J. Lab. Clin. Med. 2001, 138, 32-39.

27. Prasad Κ., Suppression of Phosphoenolpyruvate Carboxykinase Gene Expression by Secoisolariciresinol Diglucoside (SDG), a New Antidiabetic Agent. Int. J. Angiol. 2002, 11, 107-109.

28. Skórkowska-Telichowska K., Bugajska-Prusak A., Pluciński P., Rybak Z, Szopa J. Practical Dermatology 5, 15-29, 2009

29. GISSI-HF Investigators. Effect of n-3 polyunsaturated fatty acids in patients with chronic heart failure (the GISSI-HF trial): a randomized, double-blind, placebo-controlled trial. Lancet, DOI: 10.1016 / S0140-6736 (08) 61239-8, 2008.

30. Lau S.T., Lin Z.X., Leung P.S. Role of reactive oxygen species in brucein D-mediated p38-mitogen-activated protein kinase and nuclear factor-kappaB signalling pathways in human pancreatic adenocarcinoma cells. Br.J. Cancer Jn 12. PMID: 20068565, 2010

31. Aikawa C., Nozawa T., Maruyama F., Tsumoto K., Hamada S., Nakagawa I. Reactive oxygen species induced by Streptococcus pyogenes invasion trigger apoptotic cell death in infected epithelial cells. Cell Microbiol. Jan 11. PMID: 20070306, 2010.

32. Esmaeili M.A., Sonboli A. Antioxidant, free radical scavenging activities of Salvia brachyantha and its protective effect against oxidative cardiac cell injury. Food Chem.Toxicol. Dec 28. PMID: 20036303, 2009.

33. Cowan M.M. Plant products as antimicrobial agents. Clin.Microbiol.Rev. 564-582, Oct. 1999.

34. Adlercreutz H., Phytoestrogens and cancer. Oncol lancet. 2002, 3, 364-373.

35. Lin X., Pan A., Sun J., Chen Y., Ye X., Li H., Yu Z., Wang Y., Gu W., Zhang X., Chen X.,

Demark-Wahnefried W., Liu Y .; Effects of a Flaxseed-Derived Lignan Supplement in Type 2 Diabetic Patients: A Randomized, Double-Blind, Cross Over Trial., PLoS ONE 2007,2, 11.

PL 217 808 B1

36. Rutkowska-Krause I., Mańkowska G., Łukaszewicz M., Szopa J. Regeneration of flax (Linum usitatissimum) plants from anther culture and somatic tissue with increased resisatance to Fusarium oxysporum. Plant Cell Rep. 22, 110-116, 2003

37. Szopa J., Wróbel M., Matysiak-Kata I., Świędrych A. The metabolic profile of the 14-3-3 repressed transgenic potato tubers. Plant Sci. 161, 1075-1082, 2001.

38. Lorenc-Kukuła K., Żuk M., Łukaszewicz M., Szopa J. Metabolome of transgenic plants - application to evaluate the impact of transformation on the genome of transgene recipient. Plant Genomics and Bioinformatics (ed. J. Chełkowski and G. Koczyk), pp. 85-102, Poznań 2005.

39. Lorenc-Kukuła K., Amarowicz R., Oszmiański J., Doermann P., Starzycki M., Skała J., Żuk M., Kulma A., Szopa J. Pleiotropic effect of phenolic compounds content increases in transgenic flax plant . J.Agric. Food Chem. 53, 3685-3692, 2005.

40. Starzycki M. Study on resistance of winter oilseed rape (Brassicanapus L.) to Leptosphaeria maculans (Desm.) Ces. et de Not./ Phoma Lingam (Tode ex Fr.) Desm., pathogen causing stem cancer of Brassicas. 1998 monographs and dissertations, 1.

41. Prescha A., Biernat J., Szopa J. Quantitative and qualitative analysis of lipids in genetically modified potato tubers with varying rates of 14-3-3 protein synthesis. Nahrung / Food 2002, 46, 179-183.

PL 217 808 B1

Sequence list <110> Linum Foundation

Szopa-Skórkowski, Jar.

<120> Transgenic plant, especially flax, method of its production and applications <130,> PK / 1141 / RW <ieo> 4 <170> Patentln version 3.3 <210> 1 <211> 1170 <212> DNA <213> Linum usitafclssinmm Ł.

<4C0> 1 alggtgacag tcgaggagta tcgtaaggca caacgtgctg aaggtccagc cactgtcatg 60 gcnattggaa cagccacacc tacaaactgt gttgatcaaa gcacttaccc tgattattar 120 ttccgtatca ctaacagtga gcacaagact gatcttaagg agaaatztaa gcgcatgtgt 180 gaaaaatcaa tgattaagaa aaggtacatg cacttaacag aggaaatctt gaaagagaat 240 cctagtatgt gtgaatacat ggcaccttct cttgatgcta ggcaagacat agtggtggtt 300 gaagtgccca aacttggcaa agaggcagcc caaaaggcta tcaaggaatg gggccagccc 360 aagtccaaaa Łtacccattt ggtcttttgc acaactagtg gtgtggacat gcctgggtgt 420 gaetatcaac tcactaagct acttgggctt cgtccatcgg teaagaggct catgatgtac 480 caacaaggtt gctttgctgg tggcacggtt cttcggttag ccaaggactt ggcggaaaac 540 aacaagggcg ctcgagtcct tgttgtttgt tcagaaatca ccgcggt.cac cttcegtggg 600 ccaaatgata ctcatttgga tagtttagtt ggccaagccc tttttggtga tggggcgggc 660 gcgatcatta taggttctga tccaattcca ggagtcgaga ggcctttgtt cgagctcgtt 720 tcageagccc aaactcttct cccagatagc catggtgcta ttgatggcca tctccgtgaa 780 gttgggcrta cattcc- actt actcaaagat gttcctgggc tgatctcaaa aaatattgag 840 aagagccttg agaaagcatt taaaccttt.g ggc & trtctg attggaactc tctattctgg 900 attgctcatc caggtgggcc tgcaattttg gaccaagttg aaataaagtt gggcctaaag 960 cccgagaaac ttaaggctac aaggaatgtg tagtgtac. 1020

t.gtgtactgt ttattttgga tgaaatgaga aaggcctcag ccaaagaagg tttaggaact 1080 actggtgaag ggcttgagtg gggtgttctt tttggatttg ggcctgggct aacagttgag 1140 actgttgtcc t.ccacagtgt tgctacttaa '1170 <210> 2 <211> 726 <212> DNA <213> Linum usitatissimum L. <400> 2 atgtctcctc gtgaaccctg gagatagaag attccttttc gagttcttta ttgcccttga aaggggatag ttocggagtg ttgttgacga gagaacaagc cctgcggcaa gaagaggcat gtctag cagtgtccgt ctggttccac ggaagtttgt.

tggccgaaaa gggatgttgt cgggcaagca gaacgtatac aaacttttcc ttagcttcyc agttgtctga agtgtagtgt ctgtttttgg tactaaaatg caataccttg taagt.ttacg atggaaaggc tacaggtc.ca gtactcggag tgatgatgag acctggtgct taaagatgat agcagtgctg cgctgaaaga aaaaccggag eaggttgaga ttccttgctg gcgataggtg aaaacccccc tttgagaaat aaggtggcgg ggtcgtgcca tccatca rgt tcagtaactg yaatcaataa gtagcggaac accgagaaat attacgcttt gtgctgggca tgtatctaga aggagttgac ttactcgagt agaattgtgt ttgagaagtt ttactcaatc gcactgcgaa ttgygaagca tgctcaaaaa ctactattce cgcaccgacc tagaggtctg agagagtgct tgactcggtc tactatgatc tgcgcattag tctagatgtt acccctaggg tgctgttata tggagtttet gagctatgct agtgattgga

120

180

240

300

360

420

480

540

600

660

720

726 <210> 3 <211> 1122 <212> DNA <213> Linun * usitatissimum L.

<400> 3 atgccccttc acctccggtg cagtgcgaca gtttgcgtca ctggagctgc tggatttatt 60 ggctcttggc ttgtcatgag actccttgaa cgcggttaca atgttcacgc tactgttcgt 120 gatcctgaga acaagaagaa ggtgaaacat ctgctggaac tgccaaaggc tgatacgaac 180 ttaacactgt tgaaagcgga cttgacagta gaaggaagct ttgacgaggc cattcaa.ggc 240 tgtcaaggag tatttcatgt agcaacacct atggatttcg agtccaaaga ccctgagaat 300 gaagtaatca agccaacagt ccggggaatg ctaagcatca ttgaateatg tgctaaagca 360 aacacagtga agaggctggt tttcacttca tctgctygaa ctctcgatgt gcaagagcaa 420 caaaaacttt tctatgacca gaccagctgg agcgacttgg acttcatata tgctaagaag 480

GB 217 808 B1 atgacaggat ggatgtattt tgcttccaag atactggcag agaaagccgc aatggaagaa 540 gctaaaaaga agaacattga tttcattagc atcataccac cactggttgt tggtccattc 600 atcacaccta catttccccc tagtttaatc actgcccttt cactaattac tgggaatgaa 660 gctcattact gcstcattaa acaaggtcaa tatgtgcatt tggatgatct ttgtgaggct 720 cacatattcc tgtatgagca ccccaaggca gatggaagat tcatttgctc gtcccaccat 780 gctatcatct acgatgtggc taagatggtc cgagagaaat ggccagagta ctatgttcct 840 actgagttta aagggatcga taaagacctg ccagtggtgt ctttttcatc aaagaagctg 900 acagatatgg gttttcagtt caagtacact ttggaggata tgtataaagg ggceatcgat 960 acttgtcgac agaagcagct gcttcccttt tctacccgaa gtgctgaags caatggacat '1020 aaccgagaag ccattgccat ttctgctcaa aactatgcaa gtggcaaaga gaatgcacca 1080 gttgcaaatc atacagaaat gttaagcaat gttgaagtct ag 1122 <210> 4 <211> 91S6 <212> DNA <213> artificial <22 0 >

<223> gencwa structure (CHS, CHI and DFRi <400> 4 tggcagęata tattgtggtg taaacaaatt gacgcttaga caacttaata acacattgcg 60 gacgttttta atgtactggg gtggtttttc ttttcaccag tgagacgggc aacagctgat 120 tgeccttcac cgcct.ggccc tgagagagtt gcagcaagcg gtccaccctg gtttgcccca 180 gcaggcgaaa atcctgtttg atggtggttc cgaaatcggc aaaatccctt ataaatcaaa Ξ40 agaatagccc gagatagggt tgagtgttgt tccagtttgg aacaagagtc cactattaaa 300 gaacgtggac tecaacgtca aagggcgaaa aaccgtctat cagggcgatg gcccactacg 360 tgaaccatca ccc.aaatcaa gttttttggg gtcgaggtgc cgtaaagcac taaatcggaa 420 ccctaaaggg agcccccgat ttagagcttg acggggaaag ccggcgaacg tggcgagaaa 480 ggaagggaag aaagcgaaag gagcgggcgc cattcaggct gcgcaactgt tgggaagggc 540 gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa agggggatgt gctgcaaggc SPA gat.taagttg ggtaacgcca gggttttccc agt.:··! · .- ·:. = Cg ttgtaaaacg acggccagtg 560 aattaggccg gccgaattco catggagtca aagafcteaaa tagaggacct aacagaactc 720 gccgtaaaga ctggcgaaca gttcatacag agtctcttac gactcaatga caagaagacgtca 780ctcttac gactcaatga caagaagacgtca ACG cttgtctact ccaaaaatat caaagataca 840 gtctcagaag accaaagggc aattgagact tttcaacaaa gggtaatatc cggaaacctc 900 ctcggattcc attgcccagc tatctgtc.ac tttattgtga agatagtgga aaaggaaggt 960 ggctcctaca aatgccatca ttgcgataaa ggaaaggcca tcgttgaaga tgcctctgcc 1020 gacagtgętc ccaaagatgg acccccaccc acgaggagca tcgtggaaaa agaagacgtt 1080 ccaaccacgt cttcaaagca agtggattga tgtgatatct ccactgacgt aagggatcac 1140 gcacaatccc actatccttc gcaaęaccct tcctctatat aaggaagttc atttcatttg 1200 gagaggacag gtaccgggcc ccccctcgag gtcgacggta tcgataagct tgatatcgaa 1260 ttcctgcagc ccaattccgt aatttaacta ctagtaagtc cactaaaatt aacaaatctt 1320 aaqtecgaet ttccaacttc catatctgat aatggcaagt gaagcsgttc atgccccttc 1380 acctccggtg cagtgcgaca gtttgcgtca ctggagctgc tggatttatt ggctcttggc 1440 ttgtcatgag actccttgaa cgcggttaca atattcacgc atctgttcgt gatcctgaga 1500 acaaęaagaa ggtgaaacat ctgctggaac tgccaaaggc tgatacgaac Ltaacactgt 1560 tgaaagcgga cttgacagta gaaggaagct ttgacgagge catteaaggc tgtcaaggag 1620 tatttcatgt agcaacacct atggatttcg agtc caaaga ccctgagaat gaagtaatca 1680 agccaacagt ccggggaatg ctaagcatca ttgaatcatg tgct.aaagca aacacagtga 1740 • agaggctggt tttcacttca tctgctggaa ctctcgatgt gcaagagcaa caaaaacttt 1800 tctatgacca gaccagctgg agcgacttgc acttcatata tgctaagaag atgacaggat 1860 ggatgtattt tgcttccaag atactggcag agaaagccgc aatggaagaa gctaaaaaga 1920 agaacattga tttcattagc atcataccac cactggttgt tggtccattc atcacaccta 1S80 catttccccc tagtttaatc actgcccttt cactaattac tgggaatgaa gctcattact 2040 gcatcattaa acaaggtcaa tatętęcatt tggatgatct ttgtgaggct cacatattcc 2100 tgtatgagca ccccaaggca gatggaagat tcatttgctc gtcccaccat gctatcatct 2160 acgatgtggc taagatggtc cgagagaaat ggccagagta ctatgttcct actgagttta 2220 aagggatcga taaagacctg ccagtggtgt cttttt.catc aaagaagctg acagatatgg 2280 gttttcagtt caagtacact ttggaggata tgtataaagg ggccatcgat acttgtcgac 2340 agaagcaget gcttcccttt tctacccgaa gtgetgaaga caatggacat aaccgagaag 2400 ccattgccat ttctgctcaa aactatgcaa gtggcaaaga gaatgcacca gttgcaaatc 2460 atacagaaat gttaagcaat gttgaagtct agaaetg CAA tcttacaaga taaagaaagc 2520 ttgccaagca atatgtttgc tactaagttc tttgtcatct gtttgagggt tttcaaaact 2580 aaatcagtaa atttttcaat gcgggggatc ctctagagtc gacctgcagg catgccctgc 2640 tttaatgaga tatgcgagac gcctatgat.c gcatgatatt tgctttcaat tccgttgtgc 2700 acgttgtaaa aaacctgagc atgtgtagct cagatcctta ccgccggttt cggttcattc 2760 taatgaatat atcacccgtt actatcgtat ttttatgaat aatattctoc gttcaattta 2820 ccgattgtcc aagcttggcc ggccaagctt ggacaatcag taaattgaac ggagaatatt 2880 actcataaaa atacgatagt aacgggtgat atattcatta gaatgaaccg aaaccggcgg 2940

PL 217 808 B1 taaggatctg aatatcatgc gactctagag acatrttact. gttttccaaa cagcgacact ctgcttcaga cLttagcgaa caggtggaaa catcagtata agtactgctt ctgŁaacaac tccatttttc actt.aacaaa tattggtgga tagtaacgga atcgataccg tccttatata agtggagata cacgatgctc aacgatggcc tatcttcaca taccctttgt tttggagtag gagtcgtaag ctctatttga ttgaacggag gaaccgaaac aacagaattg ggcatgcctg caatatcaaa aaaataaaca gaggacaaca cccttcacca aaacagtaca aagtttctcg tggatgagca c tcaaggctc tgtaagccca ttgggctgct tataatgatc agtatcattt agcgcccttg gcaaccttgt gagttgatag aattttggac tttgggcact acacatacta cattgatttt aętqatacga tgttccaatg gsetgtcacc caagcttatc atgaacttcc. ttacgtcagt ctttttccac catcttcaac tttccactat cggatattac tgatattttt tgtcattgag ttaggtcctc ggcgtaatca caacatacga cacattaatt gcattaatga agggcgacat aggtgaatta agctacacat gatcataggc gatcccccgg tgtcctaaac aacagatgcc acactttgcc caactgcttg gctaatcgtc agtttcactc cgttcctatc gcccgtcaag atccctaaag ggccagaaaa cttcccttct accagcaggg cactggagga tcgaectcga gaggaagggt tcacatcaat ctcgtgggtg tttcctttat ataaagtgac tgaaaagtct acaagcgtgt auactctgta atctttgact astattattc cggcggtaag aaagcaaata caggtcgact ctaaagcaaa attacacttc gtctcaactg gtagttccta caagcacttg ggctttaggc atccagaata ttctcaatat acttcacgga gaaacgagct gegcctgccc cgcccacgga ttgttttccg tggtacatca tcacacccag ttgggctggc tcaaccacca ggattctctt tcacacatgc aaataataat gccatgacag atttttgett gataccgtcg ttatatagag ggagatatca gatgctcctc gatggccttt cttcacaata cctttgttga ggagtagaca tcgtaagaga tatttgaatc tggtcatagc gccggaagca gcgttgcgct atcggccaac tcaaccgatt tcaccgtcac gctcaggttt gtctcgcata gctgcaggaa tagactccaa tcttcaacat ocaggagaaa ttctctataa aacaaccota cggaaaacat cccttccaat ggcaagatca aactcgaccg ggaatagcac atctccagac ttcacggtcg gacatttttg gggggggccc cttgcgaagg ccacttgctt ggggtccatc cgcaatgatg agatagctcg caattgccct cgtgctccac tgaactgttc ccatgggaat ataaaaatac gatctgagct tcatgcgatc etagaggatc tacattcatg aattcatata ttagcccagg aaccttcttt acatgttacc ccaactttat gagaottcea tttttgagat gatggccatc cgaacaaagg catcaccaaa aggtgaccgc ccaagtcctt tgaącctctt gcatgtccac cccattcctt ctatgtcttg tcaagatttc gcttaaattt cagggtaagt tggctggacc gaaaaagttt acctcgaggg gaagggtctt catcaatcca gtgggtgggg cctttatcgc aagtgacaga aaagtetcaa agcgtg.cgt ctctgtatga tttgactcca tgtttcctgt taaag tg taa cactgcccge gcgcggggag gagggaggga cgacttgagc tttacaacgt tctcattaaa ttccatttga tcactggaat agctcttttt ctccatgctt cagcattcgc gcggtgattg ctagaaactt gcgcaacaca tegtaactcg agtcagtcaa tctcttctag ctctatgccc gtgcgaaagc ctctactttt ggtaccLg tc atagtgggat fcgaagacgtg tttgggacca geatttgtag gcaa tggaat ttggtcttct catgttgacg gccagtcttt tcggcgcgcc gatagtaacg acacatgctc ataggcgtct ccccgggctg gcaaacgaaa AGCC caaccc cccaaatcca ggctgaggcc atagtcactt t tcaacttgg atcagaaatg cagcccagga aatagcacea cctctcgact aagggcttgg ggtgatttct ggctaaccga gaccgatgga accactagtt gatagccttt cctagcatca ctctgttaag ctccttaaga gctttgatca ttcagcacgt ggtatttttt ggggcccggt gcgaaggata cttgctttga gtccatcttt aatgatggca tagctgggca ttgccctttg gctccaccat actgttcgcc tgggaattcg gtgaaattgt agcctggggt tctccagtcg aggcggtttg aggtaaatat catttgggaa gcacaacaga gcagggcatg caagggaatt agtagatttc gagcagttcc cccaattatt agtgccagtt agtaaacatg ctcaatggca attctccgcc agtaaatttc ctcctggggg atacacacctagcaccagca gtaattctca acgaattcga ctctccaaat tgtgcgt.cat.

gttggaacgt ctgtcggcag gagccacctt ccgaggaggt gagactgcat aagattttct acggcgagtt aagcttggac ggt.gststat aggtttttta cgcatatctc cagattttta taaatteaac acttaagtag aaaagaacac tttctcattt aacacattcc tccaaaattg cccaaaggtt acatctttga tggctatctg cctggaattg ccaactaaac gaacaaacaa agaaccgtgc cgaagcccaa gtgcaaaaga tgggctgcct agagaaggtg tgcatgtacc tcagtcttgt acacagtttg tgtgccttac tttttttatg acctgtcctc gtgggattgt agaegtggtt gggaccactg tttgtaggag atggaatccg gtcttctgag gttgacgaag agtctttacg gcgcgccacc tatccgctca gcctaatgag ggaaacctgt cgtattgggc tgacggaaat ttagagccag attgaaagca cctgcaggtc cagcactaaa tcggtctccg gctactcttt gattccagca actgaatcat atggaagcac cgacccteat accttctccę tcaaatggac gLtttgectl atcgccgtaa aggaacaagg acctgcattt tatcaagctt gaaatgaact cccttacgtc cttctttttc aggcatcttc ccttttccac ttccggatat ctfctgatatt tcttgtcatt ctgttaggtc aatcagtaaa tcattagaat caacgtggac attaaagcag tttgcaagtg cccaagaaac caacactgtg cccactcaag catccaaaat ttgtagcctt caggcccacc taaatgcttc gtaagtggaa ggagaagagt gatcagaacc tatccaaa tg caaggactcg caccagcaaa gcagcttagt ccaaatgggt ctttgccaag ccatgtattc ttttcttaat gctcactgtt taggtgtggc gatactcctc aattcgatat tccaaatgaa gcgtcatccc ggaacgtctt tcggcagagg ccaccttcct aggaggtttc actgtatctt attttcttct gcgagttetg aggtgagct.t caattccaca tgagctaacc cgtgccagct tattcattaa caaaatcacc

3000 30 60 3120 3ΙΘ0 32 «33CO 3360 3420 3480 3540 3600 3660 3720 3780 3840 3900 3960 4020 4080 4140 4200 4260 4320 4380 4440 4500 4560 4520 4680 4740 4800 4860 4920 4980 5040 5100 5160 5220 5280 5340 5400 5460 5520 5580 564 0 5700 5760 5820 5880 5940 6000 6060 6120 6180 6240 6300 6360 6420 6480 654 0 6600 6660 6720 6780 6840 6900 6960 7020

GB 217 808 B1 agtagcacca ttaccattag caaggccgga aacgtcacca atgaaaccat cgatagcagc 7080 accgtaatca gtagcgacag aatcaagttt gcctttagcg tcagactgt.a gcgcgttttc 7140 atcggcattt tcggtcatag cccccttatt agcgtttgcc atcttttcat aatcaaaatc 7200 accggaacca gagccaccac cggaaccgcc tccctcagag ccgccaccct cagaaccgcc 7260 accctcagag ccaccaccct cagagccgcc accagaacca ccaccagagc cgccgccagc 7320 attgacagga ggcccgatct agtaacatag atgacaccgc gcgcgataat ttatcctagt 7380 ttgcgcgcta tattttgttt tctatcgcgt attaaatgta taattgcggg actctaatca 7440 taaaaaccca tctcataaat aacgtcatgc attacatgtt aattattaca tgcttaacgt 7500 aattcaacag aaattatatg ataatcatcg caagaccggc aacaggattc aatcttaaga 7560 aactttattg ccaaatgttt gaacgatcgg ggatcatccg ggtctgtggc gggaactcca 7620 cgaaaatatc cgaacgcagc aagatatcgc ggtgcatctc ggtcttgcct gggcagtcgc 7680 cgccgacgcc gttgatgtgg acgccgggcc cgatcatatt gtcgctcagg atcgtggcgt 7740 tgtgcttgtc ggccgttgct gtcgtaatga tatcggcacc ttcgaecgcc tgttccgcag 7800 agatcccgtg ggcgaagaac tccagcatga gatccccgcg ctggaggatc atccagc CGG 7860 cgtcccggaa aacgattccg aagcccaacc tttcatagaa ggcggcggtg gaatcgaaat 7920 etcgtgatgg caggttgggc gtcgcttggt cggtcatttc gaaccccaga gtcccgctca 7980 gaagaactcg tcaagaaggc gatagaaggc gatgcgctgc gaatcgggag cggcgatacc 8040 gtaaagcacg aggaagcggt cagcccattc gccgccaagc tcttcagcaa tatcacgggt 8100 agccaacgct atgtcctgat agcggtccgc cacacccagc cggccacagt cgatgaatcc 8160 agaaaagcgg ccattttcca ccatgatatt cggcaagcag gcatcgccat gggtcacgac 8220 gagatcatcg ccgtcgggca tgcgcgcctt gagcctggcg aacagttcgg ctggcgcgag 8280 cccctgatgc tcttcgtcca gatcatcctg atcgacaaga ccggcttcca tccgagtacg 8340 tgctcgctcg atgcgatgtt tcgcttggtg gtcgaatggg caggtagccg gatcaagcgt 8400 atgcagccgc cgcattgcat cagccatgat ggatactttc tcggcaggag caaggtgaga 8460 tgacaggaga tcctgccccg gcacttcgcc caatagcagc cagtcccttc ccgcttcagt 8520 gacaacgtcg agcacagctg cgcaaggaac gcccgtcgtg gccagccacg atagccgcgc 8580 tgcctcgtcc tgcagttcat tcagggcacc ggacaggtcg gtcttgacaa aaagaaccga 8640 gcgcccctgc gctgacagcc ggaacacggc ggcatcagag cagccgattg tctgttgtgc 87 00 ccagtcatag ccgaatagcc tctccaccca agcggccgga gaacctgcgt gcaatccatc 8760 ttgttcaatc atgcgaaacg atccagatcc ggtgcagatt atttggattg agagtgaata 8820 tgagactcta attggatacc gaggggaatt tatggaacgt cagtggagca tttttgacaa 8880 gaaatatttg ctagctgata gtgaccttag gcgacttttg aacgcgcaat aatggtttct 8940 gacgtatgtg cttagctcat taaactccag aaacccgcgg ctgagtggct ccttcaacgt 9000 tgcggttctg tcagttccaa acgtaaaacg gcttgtcccg cgtcatcggc gggggtcata 9060 acgtgactcc cttaattctc cgctcatgat cagattgtcg tttcccgcct tcagtttaaa 9120 cfcatcagtgt ttgacaggat atattggcgg gtaaac 9156

Claims (19)

1. A transgenic plant, especially flax, transformed with a sequence coding for phenylpropanoid synthesis enzymes selected from the group consisting of: chalcone synthases, chalcone flavanone isomerases and 4-dihydroflavonone reductases, characterized in that it contains the repressed endogenous gene coding for chalcone synthesis, said resistance to fusariosis. 2. A transgenic plant according to claim 1 The method according to claim 1, characterized in that in its tissues and organs, especially seeds, increased concentrations of polyunsaturated fatty acids and antioxidants stably accumulate than in the tissues and seeds of the reference plants. 3. A transgenic plant according to claim 1 2. The seed of claim 1, wherein its seeds contain an increased concentration of tannins. 4. A transgenic plant according to claim 1 The method according to claim 1 or 2, characterized in that the fatty acids accumulating in the tissues and seeds of plants are ω-6 and ω-3, preferably in a dietetically optimal ratio of ω-6: ω-3. 5. The transgenic plant according to claim 1 The method of claim 1 or 2, characterized in that the antioxidants accumulating in the tissues and seeds of the plants are phenylpropanoids and terpenoids. 6. The transgenic plant according to claim 1 The method of claim 1, wherein the coding sequence for the chalcone synthase comprises the sequence shown as Seq. No. 1. 7. A transgenic plant according to any of the preceding claims The method of claim 1, wherein the coding sequence for the chalcone flavanone isomerase comprises the sequence shown in Seq. No. 2. PL 217 808 B1 8. A transgenic plant according to any of the preceding claims The method of claim 1, wherein the 4-dihydroflavonone reductase coding sequence comprises the sequence shown as Seq. No. 3. 9. A transgenic plant according to any of the preceding claims The method of claim 1, which is transformed with the sequence shown in Seq. No. 4. 10. A method of obtaining a transgenic plant, especially flax, with increased resistance to environmental factors, characterized in that the plant cells are transformed with a sequence encoding phenylpropanoid synthesis enzymes selected from the group consisting of: chalcone synthase, chalcone flavanone isomerase and 4-dihydroflavonone reductase are repressed an endogenous gene encoding chalcone synthase, whereby the resulting transgenic plant has improved resistance to fusariosis. 11. The method according to p. The method of claim 10, wherein the coding sequence for the chalcone synthase is the sequence shown in Seq. No. 1. 12. The method according to p. The method of claim 10, wherein the coding sequence for the chalcone flavanone isomerase is the sequence shown in Seq. No. 2. 13. The method according to p. The method of claim 10, wherein the 4-dihydroflavonone reductase coding sequence is the sequence shown in Seq. No. 3. 14. The method according to p. 10. A method according to claim 10, characterized in that the sequence shown as Seq. No. 4. 15. A plant extract, characterized in that it has been obtained from a transgenic plant as defined in claim 1, 1 to 9 or obtained by a method according to claims 1 to 9 from 10 to 15. 16. A plant extract according to claims The process of claim 15, characterized in that it is in a form selected from: hydrolyzate of plant tissues, oil pressed from transgenic flax seed, tissue expeller from transgenic flax, isolated seeds, preferably purified. 17. Use of an extract as defined in claim 15 for the manufacture of a medicament preparation, wherein the medicament produced is intended for the treatment and / or prophylaxis of diseases selected from the group consisting of: cardiovascular diseases, especially atherosclerosis, metabolic diseases, especially diabetes and atrophy of pancreatic islets, neoplastic diseases, skin diseases, bacterial infections or fungal. 18. Use according to claim 1 17, characterized in that the preparation is produced in the form of a gel preparation, preparation for external use, preparation for internal use. 19. Use of an extract as defined in claim For the production of a food additive that changes the nutritional value of food for animals and humans, the food additive being produced having antioxidant properties or being a food source of polyunsaturated fatty acids, preferably ω-6 and ω-3 acids, for animals and humans.