PL184188B1 - Method of stimulating non-fibroblast epithelium cells - Google Patents

Abstract

1. The method of stimulating the production of non-fibroblast epithelium cells - Characterized in that: Non-fibroblast epithelium cells are contacted with an effective amount of an analogue of the native Keratinocyte growth factor (KGF), defined by amino acid sequence 32-194 in the SEQ ID NO:2, with or without the signalling sequence, with the amino acid sequence characteristic for KGF, but with a modification of one or more amino acids 32-55 in the SEQ ID NO:2. In the analogue, each of the cystein rests in the position of amino acid 32 in SEQ ID NO:2 and in the position of amino acid 46 in SEQ ID NO:2 (Cys1 and Cys15, respectively), is either removed or substituted with another amino acid.

Description

The present invention relates to a new method for stimulating the production of non-fibroblast epithelial cells.

The present invention relates to recombinant DNA and protein engineering technologies used in connection with the keratinocyte growth factor KGF, which is a potent mitogen in non-fibroblast growth of epithelial cells.

18-4 188

The complex process of tissue generation and regeneration is mediated by a number of protein factors, sometimes called soft tissue growth factors. These types of molecules are usually made by one type of cell, and affect the reproduction of other types of cells. (Rubin et al. (1989), Proc. Natl. Acad. Sci. USA, 86: 802-806). Certain soft tissue growth factors are secreted by particular cell types and influence the reproduction, differentiation and / or maturation of the cells concerned during the development of intercellular organisms (Finch et al. (1989), Science 245: 752-755). In addition to their role in the development of organisms, some of them are essential for continued health and the maintenance of more mature systems. For example, in the case of mammals, there are many systems where rapid cellular processing occurs. Such systems include the skin and the gastro-absorbent system, both involving epithelial cells. This group of soft tissue growth factors includes the family of proteins known as fibroblast growth factors (FGFs).

Currently, eight proteins belonging to the FGF family are known, which share a common structure in their basic structure: the basic fibroblast growth factor - bFGF (Abraham et al. (1986), EMBOJ, 5: 2523-2528); acid fibroblast growth factor-aFGF (Jaye et al. (1986), Scicncc, 233: 541-545); int-2 gene product, int-2 (Dickson & Peters (1987), Naturc, 326; 833); hst / kFGF (Dell-Bovi et al (1987), Ccli, 50: 729-737 and Yoshida et al (1987), Proc. Natl. Acad. Sci. USA, 84: 7305-7309); FGF-5 (Zhan et al. (1988), Mol. Cell. Biol., 8: 3487-3495); FGF-6 (Maries et al (1989), Oncogene, 4: 335-340); keratinocyte growth factor KGF (Finch et al. (1989), Science, 24: 752-755); and hisactophilin (hisactophilin) (Habazzettl et al. (1992), Nature 359: 855-858).

In the FGF family of proteins, keratinocyte growth factor ("KGF") is a unique effector for non-fibroblast (especially keratinocyte) reproduction of epithelial cells derived from disc tissues. The term "native KGF" refers to a natural human (hKGF) or recombinant (rKGF) polypeptide (with or without a signal sequence), as defined by the amino acid sequence of SEQ IDNO: 2, or an allyl variant thereof. [Unless otherwise specified, the numbering of the amino acids in the molecules described herein should follow the numbering of the amino acids in the mature form of the parent molecule (i.e., excluding the signal sequence), as defined as amino acids 32 to 194 in SEQ ID NO: 2 .]

Native KGF can be extracted from natural human sources (hKGF) or be made by recombinant DNA techniques (rKGF) (Finch et al. (1989) supra; Rubini et al. (1989) supra. Roni associates (1993), The Journal of Biological Chemistry, 268 (4): 2984-2988; and Yan et al. (1991), In Vitro Cell. Dcv. Biol., 27A: 437-438).

It is generally known that native KGF is relatively unstable when hydrated and that during processing and storage it undergoes chemical and physical degradation leading to loss of biological activity (Chen et al. (1994), Pharmaceutical Research, 11: 1582-1589). Native KGF is also prone to aggregation at elevated temperature and is inactivated in an acidic environment (Rubin et al. (1989), Proc. Natl. Acad. Sci. USA, 86: 802-806). Aggregation of native KGF in aqueous solutions also leads to protein inactivation. This is disadvantageous because such loss of activity makes it impractical to store aqueous solutions of native KGF proteins for longer periods or to administer this protein for extended periods. Moreover, it is particularly troublesome in the preparation of pharmaceutical compositions since aggregated proteins are known to become immunogenic (Cleland et al. (1993), Crit Rcv. Therapeutic Drug Carrier Systems, 10: 307-377; Robbins et al. (^ TJ Diabetes, 36: 838-845; and Pinckard et al (1967), Clin. Exp. Immunol, 2: 331-340).

Native KGF contains five cysteine residues viz. Amino acids at positions 1,15, 40, 102 and 106 (Finch et al. (1989), Scicncc, 24: 752-755). Although

184 188 information on the cysteine content of native KGF has already been published, but the role of cysteine residues in terms of activity (for example, their importance for biological activity) and tertiary structure (for example, their tendency to create unfavorable intramolecular or intermolecular disulfide bonds) has not yet been clarified. . Thus, the prior art does not provide information as to which cysteine residues, if any, are essential to or involved in the formation of the disadvantageous disulfide bonds that render the protein aggregation prone and / or unstable.

Protein engineering may be used to improve or otherwise alter one or more of the characteristics of native KGF. Recombinant DNA technology was used to modify the sequence in native KGF.

Ron et al. (1993), J. Biol. Chem., 268 (4): 2984l-2988D> are modified KGF polypeptides having amino acids deleted at the N-terminus at positions 3, 8, 27, 38 or 49. Only polypeptides with residues 3, 8 or 27 missing on the N - finally retained the ability to bind heparin; and the others did not retain this capacity. At the same time, it was reported that the polypeptides lacking residues 3 and 8 were fully active, while the form without residue 27 was 10 to 20 times less mitogenic and the forms without amino acids 38 or 49 showed no mitogenic activity. The stability of such modified KGF polypeptides has not been discussed or otherwise discussed.

PCT Publication No. 90/08771, supra, also discloses the production of a chimeric protein in which the first about 40 N-terminal amino acids from the mature form of native KGF are fused to the C-terminal portion (about 140 amino acids) of aFGF. It was found that the chimeric compound thus obtained recognizes keratinocytes similar to KGF, but lacks the susceptibility to interaction with heparin, which is characteristic of aFGF but not KGF. No information on the stability of this chimeric compound has been discussed or given.

Thus, no information has been published in the literature about a modified KGF molecule that would be characterized by increased stability compared to the native KGF. Moreover, the data in the literature do not provide a sufficient explanation or indication to justify predictions on how to effectively produce KGF particles with these desired properties.

In general, the effect that an amino acid change has on the biological activity of a protein varies and depends on a number of factors, including the three-dimensional structure of the protein and whether or not the modifications affect the receptor binding region in the primary sequence of the protein. Since neither the three-dimensional structure of the protein nor the receptor binding region of the primary native structure of native KGF has been published so far, the prior art knowledge does not permit general statements about the effect that amino acid modifications will have in native KGF based on the effects induced by amino acid modification in well-known proteins .

It is therefore an object of the present invention to provide a method for stimulating the production of non-fibroblast epithelial cells based on the use of KGF analogues with increased stability, for example when subjected to typical conditions of pH, temperature and / or other parameters during storage - compared to native KGF.

The method of stimulating the production of non-fibroblast epithelial cells according to the invention is that the non-fibroblast epithelial cells are contacted with an effective amount of the native keratinocyte growth factor analog KGF, defined by the sequence of amino acids 32-194 in SEQ ID NO: 2 with or without a signal sequence, o the specific amino acid sequence of KGF but comprising modification of one or more of amino acids 32-55 in sEq ID NO: 2, wherein each cysteine residue is: at amino acid 32 in SEQ ED NO: 2 and at amino acid 46 in SEQ ID NO: 2 (Cys ¹ and Cys ^{15, respectively} ), is either removed or substituted with a different amino acid.

18 4 188

Preferably, a KGF polypeptide analog is used in the method of the invention in which the cysteine residue at amino acid position 32 in SEQ ID NO: 2 and the cysteine residue at amino acid position 46 in SEQ ID NO: 2 are deleted.

Preferably, the method of the invention uses a KGF polypeptide analog in which amino acids 32-55 in SEQ ID NO: 2 are cut off.

Preferably, the method of the invention uses a KGF polypeptide analog in which the cysteine residue at amino acid position 32 in SeQ ID NO: 2 is deleted and the cysteine residue at amino acid position 46 in SEQ ID NO: 2 is substituted with a different amino acid.

Preferably, a KGF polypeptide analog is used in the method of the invention wherein the first to fourteen N-terminal amino acids are cleaved and the cysteine residue at amino acid position 46 in SEQ ID NO: 2 is substituted with another amino acid.

Preferably, a KGF polypeptide analogue is used in the method of the invention in which the cysteine residue at amino acid position 32 in SEQ ID NO: 2 and the cysteine residue at amino acid position 46 in SEQ ID NO: 2 are substituted with another amino acid.

Preferably, the method of the invention uses a KGF polypeptide analog in which the cysteine residue is substituted with an amino acid residue selected from the group consisting of alanine, leucine, and serine residues.

Particularly preferably, a KGF polypeptide analog is used in the method of the invention in which a serine residue is substituted for a cysteine residue.

Preferably, in the method of the invention a KGF polypeptide analog is used, in which there is an additional charge-altering substitution at an amino acid position selected from: an arginine residue in amino acid position 72 in SEQ IDNO: 2, a glutamic acid residue at amino acid position 74 in SEQ ID NO: 2, a lysine residue at amino acid position 86 in SEQ ID NO: 2, a lysine residue at amino acid position 126 in sEq ID nO: 2, an aspartic residue at amino acid position 168 in sEq ID NO: 2, glutamic acid residues at amino acid position 169 in SEQ ID NO: 2, a lysine residue in amino acid position 170 in SEQ ID NO: 2, an arginine residue in amino acid position 175 in sEq ID NO: 2, a lysine residue in amino acid position 178 in SEQ ID NO: 2, a glutamine residue in amino acid position 183 in SEQ ID NO: 2, a lysine residue in position of amino acid 184 in SeQ ID NO: 2 or the threonine residue at amino acid 185 in SEQ ID NO: 2.

Preferably, in the method according to the invention, a KGF polypeptide analog is used, which additionally has a modification such that at least one amino acid in the loop-forming sequence of amino acid residues in positions Asn ¹⁴⁶ - Thr ¹⁵⁰ in SEQ ID NO: 2 - is replaced with a residue of another amino acid having a higher loop formation potential.

Preferably, the method of the invention uses a KGF polypeptide analog in which the amino acid residues at positions 32-54 in SEQ ID NO: 2 are deleted and both the above-mentioned types of additional modifications are simultaneously present.

Preferably, the method of the invention uses a KGF polypeptide analog selected from the group of analogs consisting of C (1.15) S (corresponding to the sequence of SEQ ID NO: 32, wherein the starting methionine is considered to be the "0" residue and optionally present), C (1,15,40) S (corresponding to the sequence of SEQ ID NO: 78, where the starting methionine is considered to be the "0" residue and is optionally present), C (1,15,102) S (corresponding to the sequence of SEQ ID NO: 80, in whose initial methionine is considered to be the "0" residue and is optionally present), C (1, 15,102,106) S (corresponding to the sequence of SEQ ID NO: 82, where the initial methionine is considered to be the "0" residue and is optionally present), ADN15 (SEQ ID NO: 42 where starting methionine is considered to be the residue "0" and is optionally present) DN16 (corresponding to the sequence of SEQ ID NO: 44 where starting methionine is considered to be the residue "0" and is optionally present), AN17 (corresponding to the sequence SEQ ID NO: 46, wherein the starting methionine is considered to be the residue "0" and there is an optional no), ANI 8 (corresponding to the sequence of SEQ ID NO: 48 where the starting methionine is considered to be the "0" residue and is optionally present), AN 19 (corresponding to the sequence of SEQ ID NO: 50 where the starting methionine is considered to be the "0" residue "And occurs

184 188 optionally), AN20 (corresponding to the sequence of SEQ ID NO: 52 where the starting methionine is considered to be the "0" residue and there is nothing else), AN21 (corresponding to the sequence of SEQ ID NO: 54 where the starting methionine is considered to be the "0" residue "And is optionally), AN22 (corresponding to the sequence of SEQ ID NO: 56 where the initial methionine is considered to be the residue" 0 "and is optionally present, ADN23 (corresponding to the sequence of SEQ ID NO: 58 where the initial motionina is considered to be the residue" 0 " and is optionally present), ΔΝ24 (corresponding to the sequence of SEQ ID NO: 60 where the starting methionine is considered to be the residue "0" and is optionally present), AN1 ^ / ^ (15) S (corresponding to the sequence of SEQ ID NO: 34, in which starting methionine is considered to be the "0" residue and is optionally present), A ^ <3 / ^ (15) - (corresponding to the sequence of SEQ ID NO: 36, where the starting methionine is considered to be the "0" residue and is optionally present), AN8 / C (15) S (corresponding to the sequence SEQIDNO: 38 where the starting methionine is u nana as the residue "0" and is optionally present), AN8 / C (15) - (corresponding to the sequence of SEQ ID N0: 40, where the starting methionine is considered to be the residue "0" and is optionally present), C (1.15) S / R (144) E (corresponding to the sequence of SEQ ID NO: 62 where the starting methionine is considered to be the residue "0" and is optionally present), C (1.15) S / R (144) Q (corresponding to the sequence of SEQ IDNO: 64, where the initial motion is considered to be the residue "0" and is optionally present), AN23 / H (116) G (corresponding to the amino acid sequence 54-194 in SEQ ID NO: 2), with a histidine residue at amino acid position 147 substituted with glycine, AN23 / N (137) E (corresponding to the sequence of SEQ ID NO: 84 where the initial methionine is considered to be the residue "0" and is optionally present), AN23 / K (139) E (corresponding to the sequence of SEQ ID NO: 86 where the initial methionine is considered to be the "0" residue and is optionally present), AN23 / K (139) Q (corresponding to the sequence of SEQ ID NO: 88 where the starting methionine is considered to be the "0" residue and is optional), AN2 3 / R (144) A (corresponding to the sequence of SEQ ID NO: 90, where the starting methionine is considered to be the residue "0" and possibly present), AN23 / R (144) E corresponding to the sequence of SEQ ID NO: 92, where the initial methionine is considered to be the "0" residue and occurs ovontual.nio), AN23 / R (144) L (corresponding to the sequence of SEQ ID NO: 94 where the starting methionine is considered to be the "0" residue and is optionally present), AN23 / K (147) E (corresponding to the sequence of SEQ ID NO: 96 where the starting methionine is considered to be the residue "0" and is optionally present), AN23 / K (147) Q (corresponding to the sequence of SEQ ID NO: 98 where the starting methionine is the residue "0" and possibly present), AN23 / N (153) E (corresponding to the sequence of SEQ ID NO: 100, where the starting methionine is considered to be the residue "0" and possibly present), AN23 / NK (.153) Q (corresponding to the sequence of SEQ ID NO: 102, where the starting methionine is considered to be the residue "0" and is optionally present), AN23 / Q (152) E / K (153) E (corresponding to the sequence of SEQ ID NO: 104, wherein the starting methionine is considered to be the "0" residue and is optionally present) and AN121 _i / R (144) Q (corresponding to the sequence of SEQ ID NO: 66 where the starting methionine is considered to be the "0" residue and is optional).

Preferably, the DN16 analogue (corresponding to the sequence of SEQ ID NO: 44 where the starting methionine is considered to be the residue "0" and is optionally present) is used in the method of the invention.

Preferably, in the process of this invention siępolipeptydowy KGF analog having sequences may or amino-signaling końco hose residue _{motioninową>} a particular polypeptide analog of KGF, wherein the signal sequence is amino acids 1-31 of SEQ ID NO: 2.

Preferably, a KGF polypeptide analog covalently linked to a chemical moiety is used in the method of the invention, in particular a KGF polypeptide analog in which the chemical moiety is polyethylene glycol.

Preferably, the method of the invention employs a KGF polypeptide analog which is AN23 (corresponding to the sequence of SEQ ID NO: 58 where the starting methionine is considered to be the "0" residue and is optionally present), covalently linked to the moiety

18-4188 chemical, in particular a KGF polypeptide analog, in which the chemical moiety is polyethylene glycol.

Preferably, the KGF polypeptide analog in a lyophilized form is used in the method of the invention.

Particularly preferably, the method of the invention uses a KGF polypeptide analog produced by a method involving the cultivation under appropriate nutritional conditions of a prokaryotic or eukaryotic host cell stably transformed with a recombinant nucleic acid molecule encoding the native keratinocyte growth factor analog KGF, as defined by the amino acid sequence 32-194 in SEQ ID NO: 2, with or without the signal sequence, defined by the amino acid sequence specific to KGF, including modification of one or more of amino acids 32-55 in SEQ ID NO: 2, wherein each of the cistern residues: at amino acid position 32 in SEQ ID NO: 2 and at amino acid position 46 in SEQ ID NO: 2 (Cys1 and Cys ¹ 5, respectively), is either deleted or substituted with another amino acid or with a biologically functional vector containing a recombinant nucleic acid molecule encoding a native keratinocyte growth factor analog - KGF, defined by the sequence of amino acids 32-194 in sEq ID NO: 2, with or without a signal sequence, defined by the amino acid sequence specific to KGF, including modification of one or more amino acids 32-55 in the sequence of SEQ ID NO: 2, wherein each of cistern residues: at amino acid position 32 in SEQ ID NO: 2 and at amino acid position 46 in SEQ ID NO: 2 (Cys1 and Cys ¹ 5, respectively), are either deleted or substituted with a different amino acid, and cultured in a manner that permits expression of the encoded KGF analogue, followed by isolation of the KGF analogue thus prepared.

The present invention provides a new method of stimulating the production of non-fibroblast epithelial cells using biologically active KGF polypeptide analogs for non-medical use.

For the purposes of the present invention, the term "KGF" includes native KGF and proteins characterized by a peptide sequence essentially the same as that of the native KGF peptide sequence which retains the cysteine residues corresponding to Cys1 and Cys ^{1 of} native KGF (Cys32 and Cys ⁴⁶ in SEQ ID NO: 2) and which retains some or all of the biological activities of native KGF, in particular the ability of non-fibroblast proliferation of epithelial cells. [When referring to Figures 4, 7-24 and 37-50 and indicating the positions and individual amino acids, the initial methionine residue should be considered the group number "0"]. The term "characterized by a peptide sequence essentially the same as the native KGF peptide sequence" means a peptide sequence encoded by a DNA sequence capable of hybridizing to nucleotides 201 to 684 in SEQ ID NO: 1, preferably under stringent hybridization conditions.

Determining the corresponding amino acid positions between two amino acid sequences can be accomplished by aligning the two sequences next to each other and maximizing the alignment of residues, including shifting the amino and / or carboxyl termini, inserting a break when necessary, and / or removing residues present as inserts in the candidate molecule. Database searches, sequence analysis, and manipulations can be performed using well-known and routinely used algorithmic homology / identity scanning programs for matching sequences (e.g., Pearson and Lipman (1988), Proc. Natl. Acad. Sci. USA. 85: 2444-2448; Altschul et al. (1990; J. Mol. Biol., 215: 403-410; Lipan and Pearson (1985), Scicncc, 222: 1435 or Devereux et al. (1984), Nuc. AcidsRcs. 12: 387-395.

The term "stringent conditions" in the context of hybridization refers to a specific combination of salt conditions, temperature, organic solvents, and other parameters typically controlled in hybridization reactions. An example of a stringent hybridization condition is that of a hybridization in 4 X SSC at 62-67 ° C, followed by a washing in 0.1 X SSC at 62-67 ° C for about one hour.

184 188

Alternatively, an exemplary specified hybridization condition is for hybridization in 45-55% formamide, 4 X SSC at 40-45 ° C. [See T. Maniatis et al., Molecular Cłoning (A Laboratory Manual); issued by Cold Spring Harbor Laboratory (1982), pages 387 to 389].

Thus, the proteins used in the method of the invention include allelic variations, or deletions (deletions), amino acid substitution (s), or insertion (s), including fragments, chimeric or hybrid native KGF molecules. One example of KGF includes charged altered polypeptides in which one or more amino acid residues 41-154 of native KGF (preferably residues Arg ⁴ 1 Gln ⁴³ , Lys55, Lys ⁹ 5, Lys ¹²⁸ , Asn ^ ⁷ , Gln ⁿ⁸ , Lys ¹³⁹ , Arg ¹⁴⁴ , Lys ¹⁴⁷ , Gln ^ ² , Lys ^ 3, or Thr ¹ *) have been removed or substituted with a neutral residue or a negatively charged residue selected to obtain a protein with reduced positively charge (as reported in US Application No.

SN 08/323, 337, filed on October 13, 1994 also for the benefit of the current holder), especially R (144) Q, i.e. KGF having a substitution of glutamine for arginine at position 144 of the native KGF. Another example of KGF includes proteins made by replacing with at least one amino acid having a higher potential for looping at least one amino acid within the loop-forming region: Asn ⁿ 5 -His ¹ ' ⁶ -Tyr ^ -Asn ¹ ^ -Thr ¹¹⁹ native KGF (as reported in application no. USSN 08 / 323,473, filed October 13, 1994 also for the benefit of the present owner), especially H (116) G, i.e. KGF having a glycine for histidine substitution at position 116 of the native KGF. Still a further example includes proteins having one or more amino acid substitutions, deletions or insertions in the range 123-133 (amino acids 15-4-164 in SEQ ID NO: 2) native KGF; these proteins may exhibit agonist or antagonist activity.

It has surprisingly been found that preferably a KGF molecule (i.e. parent molecule) is used having cysteine residues corresponding to (as determined by the techniques described above) Cys1 and Cys1 native KGF (cysteine residues 32 and 46 in SEQ ID NO: 2) modified by replacing them with other residues as the KGF analogue thus obtained shows improved stability compared to the original parent molecule. In addition to the use of compounds with increased stability, the invention preferably employs those KGF analogs which simultaneously show complete biological activity (i.e. at least substantially similar receptor binding capacity or substantially similar receptor affinity) compared to native KGF.

KGF analogs preferably used in the process of the invention can be made by biotechnological methods. Nucleic acid molecules encoding various biologically active KGF polypeptide analogs have now been described, purified and isolated. Constructs of such nucleic acids can be used to stably transform a prokaryotic or eukaryotic host cell, and by culturing the host cell of interest under appropriate feeding conditions, in a manner allowing expression of the KGF analog, the resulting recombinant polypeptide can be isolated and purified after expression. The KGF analogue produced is adapted to stimulate non-fibroblast epithelial cells.

The present invention is based on the use of the novel compounds and in this respect the present invention will be illustrated by the accompanying drawings in which:

Figures 1A and 1B show the nucleotide (SEQ ED NO: 1) and amino acid (SEQ ID NO: 2) sequence of native KGF (the nucleotide encoding the mature form of native KGF is represented by bases 201 to 684 in SEQ ID NO: 1 and the mature form of KGF is defined by amino acid residues 32 to 194 in SEQ ED NO: 2).

Figures 2A, 2B and 2C show the plasmid maps of pCFM1156, pCFM1656 and pCFM3102, respectively.

Figure 3 shows the nucleotide (SEQ ID NO: 3) and amino acid (SEQ ID NO: 4) sequences for the RSH-KGF construct.

184 188

Figure 4 shows the nucleotide (SEQ ID NO: 5) and amino acid (SEQ ID NO: 6) sequences for the construct contained in the KGF plasmid.

Figure 5 shows chemically synthesized compounds of the OLIGO type (OLIGO # 6 to OLIGO # 11; SEQ ID NO: 1 (2-17) respectively used to replace the DNA sequence between the KpnI site and the EcoRI site (from amino acid positions 46 to 85 in SEQ ID NO. : 6), in a construct contained in the KGF plasmid to generate a construct in the KGF plasmid (dsd).

Figure 6 shows chemically synthesized compounds of the OLIGO type (OLIGO # 12 to OLIGO # 24, SEQ ID NOs: 18-30, respectively) used to construct KGF (Optimized Codon).

Figure 7 shows the nucleotide (SEQ ID NO: 31) and amino acid (SEQ ID NO: 32) sequences for compound C (1.15) S - kGf analog having a serine for cysteine substitution at amino acid positions 1 and 15 of native KGF.

Figure 8 shows the nucleotide (SEQ ID NO: 33) and amino acid (SEQ ID NO: 34) sequences for the compound AN3 / C (15) S - KGF analog with the first three amino acids removed from the N-terminus and the serine substituted for cysteine. at amino acid position 15 of the native KGF.

Figure 9 shows the nucleotide (SEQ ID NO: 35) and amino acid (SEQ ID NO: 36) sequences for the compound AN3 / C (15) - KGF analog, in which the first three amino acids from the N-terminus were removed and the cysteine at position was removed. the native amino acid KGF.

Figure 10 shows the nucleotide (SEQ ID NO: 37) and amino acid (SEQ ID NO: 38) sequences for AN8 / C (15) S - KGF analogue sequence in which the first eight amino acids from the N-terminus were removed and serine was substituted for cysteine. at amino acid position 15 of the native KGF.

Figure 11 shows the nucleotide (SEQ ID NO: 39) and amino acid (SEQ ID NO: 40) sequences for the compound AN8 / C (15) - KGF analog in which the first eight amino acids at the N-terminus were removed and the cysteine at position was removed. the native amino acid KGF.

Figure 12 shows the nucleotide (SEQ ID NO: 41) and amino acid (SEQ ID NO: 42) sequences for the KGF analog compound AN15 in which the first 15 amino acids from the N-terminus of the native KGF were deleted.

Figure 13 shows the nucleotide (SEQ ID NO: 43) and amino acid (5EQ ID NO: 44) sequences for the compound ΔΝ16 - KGF analog in which the first 16 amino acids from the N-terminus of the native KGF were deleted.

Figure 14 shows the nucleotide (SEQ ID NO: 45) and amino acid (SEQ ID NO: 46) sequences for the compound ΔΜ7 - KGF analog in which the first 17 amino acids from the N-terminus of the native KGF were deleted.

Figure 15 shows the nucleotide (SEQ ID NO: 47) and amino acid (SEQ ID NO: 48) sequences for the compound ΔΧ18 - KGF analog in which the first 18 amino acids from the N-terminus of native KGF are deleted.

Figure 16 shows the nucleotide (SEQ ID NO: 49), and amino acid (SEQ ID NO: 50) sequences for the compound ΔΜ9 - KGF analog in which the first 19 amino acids from the N-terminus of the native KGF were deleted.

Figure 17 shows the nucleotide (SEQ ID NO: 51) and amino acid (SEQ ID NO: 52) sequences for the compound 1 1 N 20 - KGF analog in which the first 20 amino acids from the N-terminus of native KGF were deleted.

Figure 18 shows the nucleotide (SEQ ID NO: 53) and amino acid (SEQ ID NO: 54) sequences for the compound ΔΚ21 - KGF analog in which the first 21 amino acids of the N-terminus of native KGF are deleted.

Figure 19 shows the nucleotide (SEQ ID NO: 55) and amino acid (SEQ ID NO: 56) sequences for the compound ΔΗ22 - KGF analog in which the first 22 amino acids from the N-terminus of the native KGF are deleted.

184 188

Figure 20 shows the nucleotide (SEQ ID NO: 57) and amino acid (SEQ ID NO: 58) sequences for the KGF analog compound AN23 in which the first 23 amino acids of the N-terminus of the native kGf were deleted.

Figure 21 shows the (SEQ ID NO: 59) and amino acid (SEQ ID NO: 60) sequences for the KGF analog compound AN24 in which the first 24 amino acids were deleted from the N-terminus of the native KGF.

Figure 22 shows the nucleotide (SEQ ID NO: 61) and amino acid (SEQ ID NO: 62) sequences for compound C (1.15) S / R (144) E - KGF analog having serine for cysteine substitutions at amino acid positions 1 and 15 and the substitution of glutamic acid for arginine at amino acid position 144 of the native KGF.

Figure 23 shows the nucleotide sequence. (SEQ ID NO: 63) and amino acid (SEQ ID NO: 64) for compound C (1.15) S / R (144) Q - KGF analog having serine for cysteine substitutions at amino acid positions 1 and 15 and a glutamine for arginine substitution in amino acid position 144 of the native KGF.

Figure 24 shows the nucleotide (SEQ ID NO: 65) and amino acid (SEQ ID NO: 66) sequences for the compound AN23 / R (144) Q - KGF analog with the first 23 amino acids removed from the N-terminus and glutamine substituted for arginine. at amino acid position 144 of the native KGF.

Figure 25 shows the amount of soluble protein remaining when native KGF and C (1.15) S were kept in 20 mM sodium phosphate, 0.15 M NaCl, pH = 7.0 at 37 ° C for 27 hours.

Figure 26 NaCl shows the amount of soluble protein remaining when native KGF and C (1.15) S were kept in PBS and 50 mM NaPO4, 0.15 MNaCl, pH-7.0 at 37 ° C for 27 hours.

Figure 27 shows the amount of native KGF protein soluble, C (1.15) S, C (1.15) S / R (1-44) and C (1.15) S / R (144) Q - determined by HPLC with size exclusion as a function of incubation time at 37 ° C.

Figure 28 shows the estimated melting point (T _m ) as a function of pH for native KGF, C (1.15) S, C (1.15) S / R (144) Q and C (1.15) S / R (144 ) E.

Figure 29 shows the typical profile of mitogenic C (1.15) S activity as determined by measuring [ ³ H] -thymidine incorporation during DNA synthesis and comparing the results with the native KGF standard curve.

Figure 30 shows the typical profile of mitogenic AN15 activity as determined by measuring pH1-thymidine incorporation during DNA synthesis and comparing the results with the native KGF standard curve.

Figure 31 shows the typical profile of mitogenic AN23 activity as determined by measuring [3 H] -thymidine binding during DNA synthesis and comparing the results with the native KGF standard curve.

Figure 32 shows the typical profile of mitogenic AN23 / R (144) Q activity as determined by measuring [3 H] -thymidine incorporation during DNA synthesis and comparing the results with the native KGF standard curve.

Figure 33 shows the typical profile of mitogenic C (1.15) S / R (144) Q activity as determined by measuring [3 H] -thymidine incorporation during DNA synthesis and comparing the results with the native KGF standard curve.

Figure 34 shows the typical profile of mitogenic C (1.15) S / R (144) E activity as determined by measuring [3 H] -thymidine incorporation during DNA synthesis and comparing the results with the standard curve of native KGF.

Figure 3 shows the effect of native KGF, KGF-a AN15, C (1.15) Si AN23 on serum chemistry.

Figure 36 shows the nucleotide (SEQ ID NO: 77) and amino acid sequences. (SEQ ID NO: 78) for compound C (1,15,40) S - KGF analog in which serine has been substituted for cysteine at amino acid positions 1, 15 and 40 of native KGF.

184 188

Figure 37 shows the nucleotide (SEQ ID NO: 79) and amino acid (SEQ ID NO: 80) sequences for compound C (1,15,102) S - KGF analog in which serine has been substituted for cysteine at amino acid positions 1, 15 and 102 of native KGF .

Figure 38 shows the nucleotide (SEQ ID NO: 81) and amino acid (SEQ ID NO: 82) sequences for compound C (1,15,102,106) S - KGF analog in which serine has been substituted for cysteine at amino acid positions 1, 15, 102 and 106 of the native KGF.

Figure 39 shows the nucleotide (SEQ ID NO: 83) and amino acid (SEQ ID NO: 84) sequences for the compound DN23 / N (137) E - KGF analog with the first 23 amino acids removed from the N-terminus and glutamic acid substituted with asparagine at amino acid position 137 of the native KGF.

Figure 40 shows the nucleotide (SEQ ID NO: 85) and amino acid (SEQ ID NO: 86) sequences for compound AN23 / K (139) E - KGF analog in which the first 23 amino acids from the N-terminus have been removed and glutamic acid substituted for lysine in nutrient and the native amino acid 139 KGF.

Figure 41 shows the nucleotide (SEQ ID NO: 87) and amino acid (SEQ ID NO: 88) sequences for AN23 / K (139) Q - KGF analogue with the first 23 amino acids removed from the N-terminus and glutamine substituted with lysine at amino acid 139 of the native KGF.

Figure 42 shows the nucleotide (SEQ ID NO: 89) and amino acid (SEQ ID NO: 90) sequences for compound AN23 / R (144) A - KGF analog in which the first 23 amino acids were removed from the N-terminus and alanine was substituted for arginine at amino acid position 144 of the native KGF.

Figure 43 shows the nucleotide (SEQ ID NO: 91) and amino acid (SEQ ID NO: 92) sequences for AN23 / R (144) E, KGF analogue, in which the first 23 amino acids from the N-terminus are removed and glutamic acid is substituted for arginine at amino acid position 144 of the native KGF.

Figure 44 shows the nucleotide (SEQ ID NO: 93) and amino acid (SEQ ID NO: 94) sequences for compound AN23 / R (144) E - KGF analog in which the first 23 amino acids from the N-terminus are removed and leucine is substituted for arginine at amino acid position 144 of the native KGF.

Figure 45 shows the nucleotide (SEQ ID NO: 95) and amino acid (SEQ ID NO: 96) sequences for the compound AN23 / K (147) E - KGF analog with the first 23 amino acids removed from the N-terminus and glutamic acid substituted with lysine at amino acid position 147 of the native KGF.

Figure 46 shows the nucleotide (SEQ ID NO: 97) and amino acid (SEQ ID NO: 98) sequences for AN23 / K (147) Q - KGF analogue with the first 23 amino acids removed from the N-terminus and glutamine substituted with lysine at amino acid position 147 of the native KGF.

Figure 47 shows the nucleotide (SEQ ID NO: 99) and amino acid (SEQ ID NO: 100) sequences for the compound AN23 / K (153) E - KGF analog in which the first 23 amino acids from the N-terminus have been removed and glutamic acid substituted for lysine at amino acid position 153 of the native KGF.

Figure 48 shows the nucleotide (SEQ ID NO: 101) and amino acid (SEQ ID NO: 102) sequences for compound AN23 / K (153) Q - KGF analog with the first 23 amino acids removed from the N-terminal end and glutamine substituted with lysine at amino acid position 153 of the native KGF.

Figure 49 shows the nucleotide (SEQ ID NO: 103) and amino acid (SEQ ID NO: 104) sequences for the compound AN23 / Q (152) E / K (153) E-analogue of KGF in which the first 23 amino acids from N- the end and substituted glutamic acid for glutamine at amino acid position 152 and glutamic acid for lysine at position 153 of the native KGF.

184 188

Figure 50 shows the effect of AN23 on streptozotocin induced diabetes in Sprague-Dawley rats.

The present invention provides a method for stimulating the production of non-broblast epithelial cells which uses new KGf analogs. The finding, the four cysteine residues contained in the native KGF (Cys1 and ^ Cys, and Cys ^"52 and Cys DEG 6) mająudział in the formation of two bridges dwusulfidowych. Cys ⁴ 0 does not participate in the formation of intramolecular binding dwusulfidowego. Thus, KGF contains two small disulfide loops separated by nearly 90 amino acids. Based on the first findings, it was determined which cysteine residues are involved in the formation of disulfide bridges, indicates which cysteines are free to form unfavorable intermolecular cross-links or intramolecular bonds that may cause the protein to assume an unfavorable tertiary structure (for example a conformation that reduces protein activity) .

It was surprisingly found that modifying KGF by removing or substituting amino acid residues for cysteine residues at positions 1 and 15 of KGF (positions 32 and 46 in SEQ ID NO: 2) resulted in a KGF analog having significantly improved stability (e.g. caused by misfolding, intermolecular disulfide bond formation and / or protein aggregation). For example, KGF analogs can in principle be purified with a higher yield of suitably soluble folded proteins. Moreover, the material that has been purified once will be more resistant to pH, temperature and so on compared to the stability of the original molecule, and therefore more advantageous for use in the method of the invention. It is believed that Cys "and Cys" in KGF - in addition to forming an intermolecular disulfide bridge and an N-terminal disulfide loop - also exist under certain conditions as free cysteines, which are capable of forming intermolecular disulfide bridges, leading to instability and protein aggregation. Moreover, it has been found that removal of the N-terminal disulfide loop is not important for receptor binding or mitogenic activity and usefulness in the method of the invention.

As adopted in the present invention, "KGF analog" or "KGF polypeptide analog" shall mean any of the described natural or non-naturally occurring polypeptides differing in structure from KGF by having a modification in the peptide sequence corresponding to the 24 amino acid N-terminus of KGF (amino acids 32 to 55 in SEQ ID NO: 2), while Cys "and Cys" 5 of KGF (amino acids 32 to 46 in SeQ ID NO: 2) have been replaced or deleted. The method by which the cysteines have been replaced or deleted is not critical and the method of the invention uses, for example, polypeptide analogs containing one or more amino acid deletions and / or substitutions. Thus, according to the invention, a family of novel keratinocyte growth factor proteins is used, in which several groups of proteins can be distinguished.

One group of KGF analogs includes molecules in which the cysteines at positions 1 and 15 of KGF are replaced with amino acids, including those not found naturally in proteins. Strategies for making such substitution analogs include site-directed mutagenesis (Ho et al. (1989), Gene, 77: 51-59; Innis et al. "PRC Protocols", Academic Press, Inc. San Diego, CA). [KGF analogs containing an amino acid substitution are specified by specifying the residue at the substitution position in the mature protein molecule (minus the signal sequence) of the described sequence SEQ ID NO: 2, followed by that amino acid position in parentheses, and after parentheses new amino acid. For example, an analog containing cysteine substituted with serine at position 15 in KGF (position 46 in SEQ ID NO: 2) is described as "C (15) S"]. It is preferable to convert cysteine to a neutral amino acid such as glycine, valine, alanine, leucine, isoleucine, tyrosine, phenylalanine, histidine, tryptophan, serine, threonine and methionine, the most preferred amino acids of which, due to their greatest similarity to cysteine, are threonine and alanine. Example I in detail

18-4188 discusses the production of C (1,15) S by partial gene synthesis (in conjunction with other recombinant techniques). followed by recombinant expression in a stably transformed bacterial host.

Another group of KGF analogs includes molecules in which cysteine has been removed at positions 1 and 15 of KGF. Various strategies can be used to obtain KGF analogs such as N-terminal cuts or site specific deletions, or a combination of both.

The term "N-terminal cut-off" refers to a modification of KGF where 1 to 24 N-terminal amino acid residues of KGF (amino acids 32 to 55 in SEQ ID NO: 2) including Cys ¹ and Cys ^] 5 have been deleted. [KGF analogs containing an amino acid cutoff will be determined by indicating the residue deleted at a given position of the mature protein (not including the signal sequence) shown in SEQ ID NO: 2, starting from the point of removal and by indicating the number of residues removed. For example, a KGF analog having an N-terminal cleavage of 24 residues from KGF (residues 1-55 in SEQ NO: 2) would be referred to as an "AN24" analog]. In particular, this group will include analogs of native KGF AN23 in which one or more amino acid residues 41-154 (amino acids 72-185 in SEQ ID NO: 2), including especially amino acid residues ^^ 3-133 (amino acids 15-4 -164 in SEQ NO: 2), are removed or substituted with neutral or negatively charged residues selected so as to result in a protein with a reduced positive charge. The residues preferred for modification are the residues Arg 4 ', Gb 2, Lys ⁵ , Lys ⁹⁵ , Asn' / ⁷ , Gln ¹³⁸ , Lys ^ ⁹ , Arg ¹⁴⁴ , Lys ¹⁴⁷ , Gln ¹ ^, Lys ^! Thr 53 or ^'54, in particular Gln' ^ Lys'39, Arg ^144, Lys ^ ^ Gln or Lys' ^, among which Arg144 being most preferred. Also in this group are the AN32 analogs of native KGF having loop forming modifications in the loop-forming region: Asn ^ His' ¹⁶ -Tyr ^ Asn ¹ '-Thr ¹ ' (amino acids 146-150 in SEQ ID NO: 2), preferably including a modification to alter charge of amino acid residue 116, especially the Gly substitution at position 116. Furthermore, encompassed are analogs of native KGF AN23 having one or more amino acid substitutions, deletions or additions within the region (amino acids 154-164 of SEQ

ID NO: 2) native KGF.

Example I details the systematic generation of N-terminal truncations made by partial gene synthesis in combination with other recombinant techniques followed by recombinant expression in a stably transformed bacterial host. Such example N-terminal truncations would be AN15 to AN24. Moreover, Example III details the expression - in mammalian cell culture of DNA encoding native KGF and heterogeneous N-terminal glycosylated isoforms, purification of a preferably glycosylated isoform having N-terminal amino acid truncation 1-23 of the mature form of native KGF.

In contrast, site-specific deletion refers to a KGF modification in which one or more amino acid residues (for example, Cys' or Cys ¹⁵ ) have been removed. When Cys' or Cys'5 KGF is specifically removed, the resulting analog is one amino acid shorter than KGF. [KGF analogs containing an amino acid deletion are identified by specifying the residue at a specific position in the mature protein (without signal sequence) shown in SEQ ID NO: 2, followed by the amino acid position in parentheses, and a minus sign after the parentheses. For example, an analog of this group involving the removal of a cysteine at position 15 of KGF (position 36 in SEQ IDNO: 2) is referred to as "C (15) -"]. Site-specific deletions can be obtained by site-directed mutagenesis as described above.

This group also includes analogues in which Cys 'and Cys' 5 were removed from KGF by cutting and removing. For example, representative representatives of such KGF analogs include a truncation of the first three amino acid residues (Cys-Asn-Asp) of KGF or a truncation of the first eight amino acids (Cys-Asn-Asp-Met-Thr-Pro-Glu-Glu) of KGF coupled with cysteine removal in 15 KGF (these analogs are labeled "AN ^ C ^) -" and "DN8 / C (15) -" respectively). As the methionine residue is naturally present as the fourth

184,188 and the ninth amino acid in native KGF, no additional Met codon is needed to allow translation to start correctly.

Still a further group includes molecules in which the cysteines at the 1 and 15 position of KGF are replaced by truncation and substitution. For example, a representative of such KGF analogs are AN3 / C (15) S and AN8 / C (15) S. These analogs include truncation of the first three amino-terminal amino acid residues in KGF or removal of the first eight amino-terminal amino acid residues, coupled to a substitution of cysteine at position 15 with another amino acid, for example serine.

When KGF analogs are produced biologically, e.g. they are the product of cellular expression as opposed to solid state synthesis For proteolytic or enzymatic derivatization of naturally occurring products etc., the nucleic acids encoding such polypeptides will differ in one or more nucleotides as compared to the sequence. native KGF nucleotide. Such nucleotides can be expressed and the resulting polypeptides purified by any of a number of recombinant technological methods known to those skilled in the art.

The DNA sequences encoding all or part of the KGF analogs may include, inter alia, incorporated "preferred" codons for expression in selected host cells (for example, E. coli expression codons). Provide restriction enzyme disruption sites; and provide additional starting, terminal, or intermediate nucleotide sequences (for example, the initial methionine amino acid residue for expression in E. coli cells). To facilitate the construction of easily expressed vectors.

The method of the present invention makes use of KGF analogs obtained by using suitable recombinant molecules or vectors for use in the method of expressing these polypeptides. Such vectors may contain DNA or RNA, and may be circular, linear, or single-stranded or double-stranded, and may exist in nature or be a set of many components, both naturally occurring and synthetic. Many examples of such expression vectors are known. The components of these vectors, for example replicons, selection genes, enhancers, promoters and the like, can be obtained from natural sources or synthesized by known methods. In any event, the expression vectors useful for producing the polypeptides used in the method of the invention will contain at least one expression control element operably linked to the inserted nucleic acid molecule encoding the KGF peptide analog. This control element is responsible for regulating the expression of the polypeptide from the corresponding nucleic acid molecule. Useful control elements include, for example, lac system, trp system, phage X operators and promoters, yeast glycolytic promoter, yeast acid phosphatase gene promoter, yeast alpha-associative factor, and promoters derived from adenovirus, E-pstem-Barna virus, polyoma , simian virus as well as various other derived retroviruses. However, numerous other vectors and control elements suitable for prokaryotic or eukaryotic expression are known in the art and may be used in the practical preparation of the polypeptides used in the method of the present invention.

Examples of suitable prokaryotic cloning vectors may include E. coli plasmids (e.g., pBR322, col E1, pUC, and factor F), with the preferred plasmids being pCFM1156 (ATCC 69702), pCFM1656 (ATCC 69576), and pCFM3102 (described below in the Examples section of ). Other suitable expression vectors, many types of which are known in the art to be suitable for expression in mammalian, insect, yeast, fungal, and bacterial cells, can now also be used for this purpose. Transfection of these vectors into appropriate host cells can lead to expression of the KGF polypeptide analogs used in the method of the invention.

The host microorganisms useful in the production of KGF analogs used in the method of the invention can be both prokaryotic and eukaryotic.

18-4 188

Suitable prokaryotic hosts are various strains of E. coli (for example FM5, HB101DH5alphaDR10 and MC1061), Pseudomonas, Bacillus and Streptomyces, with E. coli being a preferred prokaryotocene host. Suitable eukaryotic host cells include yeast and other fungal cells, insect cells, plant and animal cells such as COS (e.g. COS-1 and COS-7) and monkey cell lines CV-1, 3T3 cell lines derived from Swiss mice, Balb-c and NIH, mouse HeLa and L-929 cells, and hamster cells: CHO, BHK or HaK. Depending on the host chosen, the recombinant polypeptides used in accordance with the present invention will be glycosylated with mammalian or other eukaryotic carbohydrates, or they may be non-glycosylated.

The preferred method for producing the desired KGF analogues will vary and depend on many factors and considerations; the optimal production procedure for a given situation will be clearly understood by those skilled in the art, with little experience. The expression product obtained can then be purified to an almost homogeneous state by known methods. A typical purification method in prokaryotic cell production involves disrupting the cell walls by high pressure or other means, centrifugation or filtration to remove cell debris, followed by supernatant or filtrate ion exchange chromatography, and finally hydrophobic interaction chromatography. If the analog is formed in an insoluble form, another method of purification is first to dissolve the inclusion bodies containing the analogs produced, followed by ion exchange chromatography and protein refolding, and finally by interactive hydrophobic chromatography. Exemplary purification methods are shown in U.S. Application No. S.N. 08 / 323,339 filed on October 13, 1994, made for the benefit of the same rightholder. Generally, U.S. Application No. S.N. 08 / 323,339 discloses a method for purifying a Koratinocyte Growth Factor comprising: a) obtaining a solution containing the desired KGF; b) binding the KGF from the solution of step a) to an ion exchange resin; c) eluting KGF in an ion exchange resin eluent solution; d) either passing the eluate solution from step c) through a suitable molecular weight separation matrix or subjecting the eluate solution from step c) to hydrophobic interactive chromatography; and e) recovering the desired KGF from the separation matrix by mass or from the hydrophobic interaction chromatography.

Of course, the KGF analogs used in the method of the present invention may be rapidly screened to determine their physical properties. The following examples section discusses various well known stability assays, although the selection of a particular assay for testing a particular analog is not critical. Moreover, the level of biological activity (e.g. receptor binding ability and / or receptor affinity, mitogenesis, cell proliferation and / or in vivo activity) can also be tested by a variety of assays, some of which are shown in the experimental section below. Numerous assays are well known and can be used to rapidly screen current KGF analogs to determine whether or not they have an acceptable level of biological activity. One such attempt specifically tests KGF analogs for their ability to bind to the KGF receptor (KGFR) through competition with ^I25 I-KGF binding (Bottaro et al. (1990,), J Biol. Chem. 2665, 12767-12770; Ron et al. (1993), J. Biol. Chem. 268,2984-2988). An alternative way to check the interaction of KGFR with the KGF analogue is based on the use of techniques such as real-time biospecific interaction analysis (BIA) (Felder et al. (1993), Molecular & Cellular Biology, 13: 1449-1455). Additionally, the mitogonicen assay can be used to test the ability of KGF analogs to stimulate DNA synthesis (Rubin et al. (1989), cited above). Ultimately, cell proliferation assays can be used to evaluate the ability of KGF analogs to stimulate cell proliferation (Falco et al. Oncogene 2; 573-578). By applying

Any attempt discussed above, KGF analogs can be rapidly tested for their biological activity.

In a preferred embodiment, the present invention employs KGF analogs that retain complete (i.e. at least substantially similar) biological activity (BIA) compared to native KGF. Examples of KGF analogues with these properties when tested with one or more of the above tests are:

C (1,15) SAN3 / C (15) SAN3 / C (15) -AN8 / C (15) SAN8 / C (15) -AN15AN16AN17AN18nN19 AN20AN21AN22AN23AN24 or AN23 / R (144) Q.

KGF analogs can be further modified to contain additional chemical moieties not normally part of the peptide. Such derivatized molecules can improve the solubility, absorption, biological half-life and other properties of the present KGF analog. Such residues may also alternatively eliminate or attenuate any undesirable side effects of the protein and the like. The moieties capable of mediating the achievement of such effects are described, for example, in REMINGTON'S PHARMACEUTICAL SCIENCES, 18th Edition, Mack Publishing Co., Easton, PA (1990). Covalent modifications can be made to the molecule by reacting a selected amino acid residue in the peptide molecule with an organic derivatizing compound that is capable of reacting with selected side chains or terminal residues (TE Creighton (1983), PROTEINS: STRUCTURE AND MOLECULE PROPERTIES, WH Freeman & Co. ., San Francisco, pp. 79-86). Polyethylene glycol ("PEG") is one such chemical moiety that is widely used in the preparation of therapeutic protein products. For some proteins, the attachment of polyethylene glycol has been shown to protect against proteolysis. Sada et al. (1991), J. Fermentation Bioengineering, 71: 137-139. At the same time, there are ways to attach certain polyethylene glycol residues. See US Patent No. 4,179,337 to Davis et al., "New Immunological Polypeptides," issued December 18, 1979, and US Patent No. 4,002,531, Royer, "Enzyme Modification by Polyethylene Glycols and Products Thus" issued January 11, 1977. For a review, see: Abuchowski et al., In Enzymes as Medicines (Enzymes as Drugs). (Holcerberg and Roberts (editors), pp. 367-383 (1981). For polyethylene glycol, numerous agents have been used to attach the polyethylene glycol molecule to the protein. In general, the polyethylene glycol molecules are attached to the protein via a reactive group found in Amine groups such as in the amino group of the lysine residue or at the N-terminus are convenient for such attachment.For example, Royer (US Patent No. 4,002,531, described above) teaches that reductive alkylation was used to link the polyethylene glycol molecule to the protein. to the enzyme European Patent No. EP 0 539 167 published April 28, 1993, Wright "PEG Imidates and Protein Derivates Thereof" reports that peptides and organic compounds with a free (free) group (s) ) amine (s) are modified with imide derivatives of PEG or related water-soluble polymers US Patent No. 4,904,584, Shaw, issued Feb. 27 1990, refers to the modification of numerous lysine residues in proteins to add polyethylene glycol molecules via reactive amino groups.

The KGF analogs used in the method of the invention are also of pharmaceutical use, and pharmaceutical compositions containing these analogs in unit doses may be used for parenteral or oral administration in the treatment of warm-blooded animals (such as humans). Pharmaceuticals of this type may be in a lyophilized form or in any other form of dehydrated therapeutic or diagnostic agent which can be reconstituted by adding a physiologically acceptable solvent. Such a solvent may be any medium such as sterile water, saline saline, glucose solution, or other aqueous carbohydrate solution (for example a polyol such as mannitol, xylitol, or glycerin) capable of dissolving the dry composition, compatible with the selected route of administration, and which does not interact.

184 188 negatively with the active substance and with the used reconstructive stabilizers.

KGF analogs used in the method of the present invention may be useful as therapeutic and diagnostic agents, and as research agents. Thus, KGF analogs can be used in in vitro and / or in vivo assays to quantify KGF in a tissue or organ sample, or to identify and / or isolate cells that express KGFR (Bottaro et al. (1990), J. Biol Chem., 265: 12767-2770; Ron et al. (1993), J. Biol. Chem., 268: 2984-2988). In tissue or organ assays, there will be less radioactivity than the ¹²⁵ I-KGF analog binding kGfR compared to the standardized (benchmark) binding curve of the ¹²⁵ I-KGF analog, due to binding of unlabeled native KGF to KGFR. Likewise, the I-KGF analog ¹²⁵ can be used to detect the presence of KGFR in a variety of cell types.

It is also possible to use the KGF analogue in question to generate antibodies raised against the peptide, which antibodies also bind to native KGF. Such antibodies are monoclonal or polyclone derived antibodies and are produced using the KGF analog. The obtained antibodies bind primarily to native KgF, especially when this protein is in its natural (biologically active) conformation. Such antibodies can be used to detect or purify native KGF.

Moreover, KGF analogs can be used to discover highly related or unrelated KGF binding molecules having therapeutic utility, for example, as a means of efficiently delivering KGf or as an inhibitor of KGF activity. The thermal stability of KGF analogues is important for identifying such binding molecules under physiological conditions (for example at 37 ° C) since their ability to bind to KGF may be highly temperature dependent and may be unpredictably different from that of binding at temperature 4 ° C.

For in vivo applications, KGF analogs can be formulated into compositions with various additives. Such additives include buffers, carriers, stabilizers, inert additives (pharmaceutical fillers), preservatives, tonicity-adjusting agents, antioxidants, and the like (e.g., viscosity-adjusting compounds or diluents). The choice of these specific additives will depend on the form of storage (i.e., liquid or lyophilized form) and the routes of administration of the KGF analogs. Suitable compositions known in the art can be found in REMINGTON'SPHARMACEUTICAL SCIENCES (latest edition), Mack Publishing Company, Easton, PA.

KGF analogs can be used therapeutically, in effective amounts, to tissues that are specifically damaged or - clinically insufficient in non-fibroblast epithelial cells. Areas where KGF analogs can be successfully administered include, but are not limited to: stimulation, proliferation and differentiation of adnexal structures such as hair follicles, sweat glands, and sebaceous glands in patients with burns and other partial or full thickness lesions; accelerated epithelial regeneration during injuries caused by bullosa epidermis, which is a defect in adherence of the epidermis to the underlying skin, leading to frequently open, painful blisters that can cause significant morbidity; prevention of chemotherapy-induced alopecia and treatment of male-typical baldness or progressive hair loss in both men and women, treatment of gastric ulcer and duodenal ulcer; the treatment of inflammatory bowel diseases such as Crohn's disease (affecting primarily the small intestine) and ulcerative bowel disease (affecting essentially the large intestine); preventing or reducing gilt poisoning during a radiation treatment regime or treatment chemotherapy regimen (for example pre-treatment and / or final treatment) to produce a cellular protective effect (cytoprotection), or regeneration thereof, or both; inducing the production of mucus throughout the gastro-absorbable tract; triggering the proliferation and differentiation of type II lung cells (pneumocytes), which may be helpful in treating or preventing diseases such as body membrane disease

184 188 vitreous (for example, infantile respiratory disease syndrome and bronchopulmonary dyspnea (dysplasia) in premature infants; acceleration of proliferation and differentiation of bronchial epithelium and / or alveoli in acute or chronic lung injury, or its deficiency caused by inhalation injury (including too much high oxygen levels), emphysema, use of lung-damaging chemicals, respiratory damage, or other lung-damaging conditions; increased liver function to treat or prevent cirrhosis, explosive liver injury, acute viral jaundice and / or toxic liver injury; inducing the regeneration of corneal cells, for example when treating corneal lesions; inducing the regeneration of epithelial cells to treat progressive gum disease; inducing the regeneration of tympanic epithelial cells during the treatment of the ears eardrum, and treatment or prevention of the onset of diabetes mellitus, or as an aid to an islet transplant.

A patient in need of therapy for the proliferation of non-fibroblast epithelial cells will receive doses of effective amounts of the KGF analog. By "effective amount" is meant the amount of the KGF analogue that is required to achieve a desired response in the treated patient, and will therefore generally be determined by the attending physician. Factors influencing the amount of KGF analogue administered will include the age and general condition of the patient, the type of disease being treated, and so on. Typical dosages will range from 0.001 mg per kg body weight to 500 mg / kg body weight.

The KGF analog can be safely dosed parenterally (e.g. intravenously - IV, intra-tissue - IT, intramuscular - IM, subcutaneous - SC or intraperitoneal - IP), orally or topically topically to warm-blooded animals (such as humans). The KGF analog may be administered once or may be administered in multiple doses depending on the disease and condition of the patient. In some cases, the KGF analog may be dosed as an adjunct to other therapies and also together with other pharmaceutical compositions.

The following examples are intended to more fully illustrate the KGF analogs used in the process of the present invention. It is understood that modifications may be made to the procedures set forth.

Standard methods found in many of the procedures described in the examples below, or suitable alternative procedures, are available in widely known molecular biology textbooks such as, for example, Molecular Cloning, Second Edition, Sambrook et al., Cold Spring Harbor Labboratory Press (1987 ) and Current Protocols in Molecular Biology, Ausabel et al., Green Publishing Associates / Wiley Interscience, New York (1990).

Example I. Preparation of DNA encoding KGF and KGF analogs

Cloning of the full-length human KGF gene (encoding a polypeptide with a sequence from native KGF) was carried out both by the polymerization chain reaction (PCR) of RNA from animal cells and by PCR of chemically synthesized (codon optimized forE coli) oligonucleotides ("OLIGO" compounds ). Both procedures are described below:

PCR amplification (PCR amplification) of RNA isolated from cells known to produce KGF polypeptide was performed. First, cells from the human fibroblast cell line AG1523A (obtained from the Human Genetic Mutant Cell Culture Repository Institute For Medical Research, Camden, NJ) were disrupted with guanidinium thiocyanate, and then from the Human Genetically Altered Mutant Cell Culture Repository. they were subjected to extraction (according to the method of Chomyzinski et al. (1987), Anal. Biochem. 172: 156). KGF cDNA was generated using the standard reverse transcriptase protocol for all RNA. PCR amplification (PCR # 1) of the KGF gene was performed using KGF cDNA as a template and primers OLIGO71 and OLIGO # 2 encoding DNA sequences in the immediate vicinity of the 5 'and 3' ends of the KGF gene [Model 9600 thermocycler (Perkin-Elmer Cetus,

184 188

Norwalk, CT); 28 cycles; each cycle consisted of one minute at 94 ° C for denaturation (strand separation). Two minutes at 60 ° C for annealing and then 3 minutes at 72 ° C for synthesis (elongation - elongation)]. Small samples of the product from PCR reaction # 1 were used as nαend as template for the second PCR amplification (PCR # 2) of KGF, identical in terms of the individual cycle conditions to that described above, except that the convolution temperature was 50 ° C. For the expressive cloning of the KGF gene, nested PCR primers were used to generate convenient restriction sites at both ends of the KGF gene. OLIGO13 and OLIGO14 were used to modify the KGF DNA product from the PCR12 reaction to include the MluI and BamHI restriction sites at the 5 'and 3' ends of the [PCR # 3; 30 cycles; each cycle of one minute at 94 ° C for denaturation Two minutes at 60 ° C for stranding and three minutes at 72 ° C for elongation]. This DNA was then cleaved with MluI and BamHI, phenol extracted and ethanol precipitated. They were then resuspended and ligated (using a T4 ligase) to plasmid pCFM1156 (Fig. 2A), which contained the "RSH" signal sequence to generate the RSH-KGF construct (Fig. 3).

The ligation products were transformed (by the method of Hanahan (1983), J. Mol. Biol., 166: 557) into E. coli strain FM5 (ATCC: 53911) and plated on LB + kanamycin plates at 28 ° C. Several transformants were selected and grown in small liquid cultures containing 20 ftg / ml kanamycin. The RSH-KGF plasmid was isolated from the cells of each culture and DNA sequencing was performed. Due to an internal Ndcl site in the KGF gene, it was not possible to directly clone the natural sequence of the gene into the desired expression vector with the extreme restriction sites of Ndcl and BamHI. This was achieved in a three-step ligation. The RSH-KGF plasmid was cleaved at its unique BsmI and Sstl restriction sites, and after electrophoresis on a 1% agarose gel, a DNA fragment (covering the 3 'end of the KGF gene) of approx. 3 kilobases (kbp) was isolated. . PCR amplification (PCR # 4) was performed as described for PCR13 with the only difference that OLIGO # 5 was substituted for OLIGO # 3. The resulting PCR DNA product was then cleaved with NdeI and BsmI and the 311 bp DNA fragment was isolated by electrophoresis on a 4% agarose gel. The third element of the ligation is a 1.8 kbp DNA fragment from plasmid pCFM1156, cleaved with NdeI and Sstl and isolated by electrophoresis on a 1% agarose gel. After ligation (T4 ligase), transformation, kanamycin selection, and DNA sequencing as described above, a clone was obtained containing the construct shown in Figure 4 and a plasmid designated KGF. Due to the intrinsic iibosome binding site that produces truncated products, the KGF DNA sequence between the unique KpnI and EcoRI sites has been replaced by chemically synthesized OLIGO compounds (OLIGO # 6 to OLIGO # 11) in order to minimize the use of this internal start site Fig. 5)

OLIGO # 1 (SEQ ID NO: 7):

5'-C.AATGACCT.AGGAGTAACAATC'AAC-3 '

OLIGO # 2 (SEQ ID NO: 8):

5'-AAAACAAACATAAATGCACAAGTCCA-3 '

OLIGO # 3 (SEQ ID NO: 9):

5'-ACAACGCGTGCAATGACATGACTCCA-3 '

OLIGO # 4 (SEQ ID NO: 10):

5'-ACAGGATCCTATTAA

GTTATTGCCATAGGAA-3 '

OLIGO # 5 (SEQ ID NO: 11):

5'-ACACATATGTGCAATG

ACATGACTCCA-3 '

OLIGO # 6 (SEQ ID NO: 12):

5'-CTGCGTATCGACAAACGC

GGCAAAGTCAAGGGCACCC-3 '

184 188

OLIGO # 7 (SEQ ID NO: 13):

5'AAGAGATGyAAAAACAACTAC

AATATTATGGAAATCCGTACTGTT-3 '

OLIGO # 8 (SEQ ID NO: 14):

5 '-GCTGTTGGTATCG

TTGCAATCAAAGGTGTTGAATCTG-3 '

OLIGO # 9 (SEQID NO: 15):

5'-TCTTGG <GT (^ (^ (^ (CTTG.ACTTTGCCGCGTTTGTCG

ATACGCAGGTAC3 '

OLIGO # 10 (SEQ ID NO: 16):

5'-ACAGCAACAGTACGGAT

TTCCATAATATTG

TAGTTGnTTTCATC-3'OLIGO # 11 (SEQ ID NO: 17):

5 '-AATTCAGAT

TCAACACCTTTGATTGCAACGATACCA-3 '. OLIGO compounds were phosphorylated with the polynucleotide T4 kinase and then denatured by heating. The single-stranded (ss) OLIGO compounds were then allowed to form a double-stranded (ds) DNA fragment by letting the temperature slowly fall to room temperature. T4 ligase was then used to covalently bind both inner sticky ends of OLIGO compounds and the entire double-stranded (ds) fragment of OLIGO to the KGF plasmid cleaved with KpnI and EcoRI. The new plasmid was designated KGF (dsd).

The complete KGF gene with E. coli optimized codon was constructed by PCR amplification of chemically synthesized OLIGO compounds # 12 to # 24.

OLIGO # 12 (SEQ ID NO: 18):

5'AGTTTTGAT (CT ^ <^. AAG <^. AGG-3 '

OLIGO # 13 (SEQ ID NO: 19):

5'-TCAAAACTGGATCCTATTj ^ .A-3 '

OLIGO # 14 (SEQ ID N0: 20): 5'-AGTTTTGATCTAGAAGGAGGA

ATAACATAAGTGCAACGACATG-ACTCCGGAACAGATGGCTACCA

ACGTTAACTGCTCCAGCCCGGAACGTOLIGO # 15 (SEQ ID NO: 21):

5'-CACACCCGTAGCT

ACGACTACATGGAA <TTTGGTGACATCCGT-GTTCGTCGTCTGTTCTTCCGTACCC

AGTGTTACCTGCTTATCGACAAA-3 '

OLIGO # 16 (SEQ ID NO: 22):

5'CGTGGTAAAGTT ^ AAGGTACCC

AGGAAATt ^ yAAAAACAACTACAACATC-ATGGAAATCCGTACTGrTGCTG

TTGGT, A ^ <^ (^ ^r ^ ^r ^ (^ <^, AA ^ (^ CAAA-3 '

OLIGO # 17 (SEQ ID NO: 23): 5'-GGTGTTGAATCTGAAT

TTCTACCTGGC

AATGAACAAAGAAGGTAAACT-GTACGCAAAAAAAGA

AT <^ <^. ^^ <^^ jA ^ <^ 2 ^ <CT <^ <^. ^ <CTTC.AAAGAA-3 '

OLIGO # 18 (SEQ ID NO: 24):

5'-CTGAT <^ CT »^ (^ jAAA ^ (CC.ACTACAACACC

TACTCATCTGCTAAΛΪGGAC-CCACAACTGTTTTTAAATGTTC

TTTGCTCTGAACCAGAAATTT-3 '

OLIGO # 19 (SEQ ID NO: 25):

5'-ATCCCTTTTCTTT

TτTAAΛΛAAACCAAAAA.ATAACAGAAAACCTCTC-ACTTCCTGCCTATGTCA

ATCACTTAATATT

184 188

ATCCAGTTTTGA-3 '

OLIGO # 20 (SEQ ID NO: 26): 5'-TA

CGGGTGTGACGTTCCGGG-3 '

OLIGO # 21 (SEQ ID NO: 27):

5'-CTTTACCACGTTTGTCGATA-3 '

OLIGO # 22 (SEQ ID NO: 28):

5'-ATTCAACACCTTTGATTGCA-3 '

OLIGO # 23 (SEQ ID NO: 29):

5'-CCAGGATCAGTTCTTTGAAG- / '

OLIGO # 24 (SEQ ID NO: 30):

5'-GAACCGGGATACCTTTCTGG-3 '

The OLIGO compounds # 12 to 24 were designed in such a way that the complete DNA sequence encoding native KGF was presented by OLIGO compounds from either the "Watson" or the "Craig" strand, and after PCR amplification were able to generate the desired double-stranded DNA sequence ( Fig. 6) [PCR # 5, Model 9600 thermocycler, Perkin-Elmer Cetus]; 21 cycles, each cycle consisting of 3 seconds at 94 ° C to denature, 31 seconds at 50 ° C for convolution and 31 seconds at 73 ° C for elongation; after 21 cycles the polymerization chain reaction was terminated by carrying out a final extension step for 7 minutes]. After PCR amplification, the generated DNA fragment was cleaved with Xbal and BamHI and the 521 bp fragment was ligated into the expression plasmid pCFM'156 cleaved with the same enzymes. In PCR # 5, the external primers (100 pinoH / OG pl rxn) OLIGO # '2 and OLIGO # 13 and 1 pl / 100 rxn of the KGF matrix obtained by ligation (using T4 ligase) of OLIGO # 14 compounds to OLIGO #' 9 were used (OLIGO # 15 to OLIGO # 18 were phosphorylated with T4 polynecleotide kinase) using OLIGO # 20 through OLIGO4234 as band-enhancing oligo compounds (Jayaraman et al. (1992), Biotechniques, 12: 392) for ligation. The final construct was designated KGF (optimized codon).

All KGF analogs described herein consist in part of the DNA sequences found in KGF (dsd) or in KGF (optimized codon), or combinations thereof. These sequences are further modified by inserting into the appropriate restriction sites DNA sequences encoding the amino acids of a particular KGF analog, made using one or more of the above-described techniques for synthesizing DNA fragments. Any of these analogs can be made entirely by the above-mentioned techniques. However, £ optimized codons were used. coli where appropriate - as part of the overall OLIGO project, although the presence of E. coli optimized codons in some or all of the genes where it was tested did not result in a significant increase in the yield of proteins that could be obtained from cultured bacterial cells. Figures 7 to 24 and Figures 37 to 50 show suitable examples of the nucleotide and amino acid sequence structures of individual KGF analogs:

CO ^ jS (Fig. 7); AN3 / C (15) S (Fig. 8); AN3 / C (15) - (Fig. 9); AN8 / C (15) S (Fig. 10); AN8 / C (15) - (Fig. 11); ANI 5 (Fig. 12); AN16 (Figure 13); AN17 (Fig. 14); AN18ffig. 15); ADN19 (Fig. 16); AN20 (Fig. 17); AN21 (Fig. 18); AN22 (Fig. 19); AN23 (Fig. 20); AN24 (Fig. 21); 0x15 ^ (144 ^ (Fig. 22); CG ^ S / R ^^ (Fig. 23); AN23 / R (144) Q (Fig. 24); C (1,15,40) S (Fig. 36) ); C (1,15,102 ^ (Fig. 37); C (I, 15,1G2,406) S (Fig. 38); ΔN23 / N (4/7) E (Fig. 39); AN23 / KG39) E (Fig. 40); ΔN23 / K (4/9) Q (Fig. 41); AN23 / R (144) A (Fig. 42); AN23 / R (144) E (Fig. 43); AN23 / R (144) L (Fig. 44); AN23'K ('47) E (Fig. 45); AN23 / 'K (447) Q (Fig. 46); AN23 / K (153) E (Fig. 47) ); AN23 / K (153) Q (Fig. 48);

and AN23 / Q (152) EAK (153) E (Fig. 49). All KGF analog constructs described herein had a confirmed DNA sequence.

Example II. Production in E. coli A.

Expression of KGF analogues

Three different expression plasmids were used to clone the KGF analog genes. They were: pCFM'156 (ATCC # 69702), pCFM'656 (ATCC # 69576) and pCFM3102 (respectively

Figures 2A, 2B and 2C). Plasmid p3102 can be obtained from plasmid pCFM1656 by performing a series of base changes at specific sites by mutagenetic PRC amplification of overlapping oligo compounds. Starting from the .Z1-II site (pCFM1656 - bp # 180, respectively) directly 5 'to the plasmid replication promoter, PcopB, and advancing towards the plasmid replication genes, the base pair changes are as follows:

# a few rules base pair base pair changed wpCFM1656 in DCFM1656 in pCFM3102 # 204 T / A C / G # 4128 A / T G / C # 509 G / C A / T # 617 - - insert two G / C bp # ^ 77 G / C T / A # ^ 78 T / A C / G # 992 G / C A / T # 1002 A / T C / G # 1005 C / G T / A # 1026 A / T T / A # 1045 C / G T / A # 1176 G / C T / A # 1464 G / C T / A # 2026 G / C base pair removal # 2186 C / G T / A # 24179 A / T T / A # 2498-2501 AGTG GTCA TCAC CAGT # 2641-2647 TCCGAGC AGGCTCG base pair removal # 3441 G / C A / T # 3452 G / C A / T # 3649 A / T T / A # 41556 insert base pairs

(SEQ ID NO: 67) 5'- GAGCTCACTAGTGTCGACCTGCAG-3 '(SEQ ID NO: 68) 3'- CTCGAGTGATCACAGCTGGACGTC-5'

As can be seen from the above, pCFM1 156, pCFM1656, and pCFM3102 are very similar to each other and have the same restriction sites. These plasmids were selected for convenience, and vector DNA components can be readily replaced for new constructs. The host used for all clonings was E. coli FM5 (ATCC: 53911) and transformations were carried out by the Hanahan (1983) (supra) method, or by electro-washing using a Gene Pulser ™ transfection device (BioRad Laboratories, Inc., Herc ^ es, CA) in accordance with the factory manual.

Initially, a small fresh culture of the inoculum of the desired E. coli recombinant clone storing the desired construct on one of the three pCFM vectors was initiated by transferring 0.1 ml of frozen glycerin with the original appropriate bacterial strain into a 2 L vessel containing 500 ml of broth Luria. The culture was shaken for 16 hours at 30 ° C, after which the culture was transferred to a 15 L fermentation vessel containing 8 L of sterilized medium (Tsai, et al. (1987), J. Industrial Microbiol, \: 181-187).

The batch fermentation was started with Feed # 1 (Tsai, et al. (1987), supra). When the OD 600 had reached 35, expression of the desired analog was induced

184 188

KGF by rapidly raising the culture temperature to 37 ° C for two hours and then to 42 ° C causing the CI repressor to be denatured. The addition of Feed 1 was stopped and the addition of Feed 2 was started, with an initial addition rate of 300 ml / hour. Feed 2 consisted of 175 g / L peptone tripticase, 87.5 g / L yeast extract and 260 g / L glucose. After one hour at 42 ° C, the culture temperature was reduced to 36 ° C and this temperature was maintained for a further 6 hours.

Then the fermentation was stopped and the cells were collected by centrifugation into plastic bags placed in 1 liter centrifuge bottles.

Cells were pelleted by centrifugation at 400 rpm for 60 minutes, after which the supernatant was removed and the cell paste was cooled to -90 ° C.

After expression of various KGF analogs in E. coli, native KGF and proteins C (1.15) S, C (1.15) S / R (144) E, C (1.15) S / R (144) Q AN15AN23 and AN23 / R (144) Q were purified using the following procedure. Fermentation cell paste, high cell density, was dispersed at 4 ° C in a 10-20% (w / v) solution containing 0.2 M NaCl and 20 mM NaPO4, pH = 7.5, using an appropriate high-cut mixer. Subsequently, the suspended cells were lysed by passing the solution three times through a homogenizer (APV Gaulin, Inc., Everett, MA). The outgoing homogenate was cooled to 4-8 ° C using a suitable heat exchanger. Wash waste (Debris) was removed by centrifugation of the lysate in a J-6B ™ type centrifuge (Beckman Instruments, Inc., Brea, CA) equipped with a JS 4.2 rotor, running at 4200 rpm for 30-60 minutes at 4 ° C. . The supernatant solution was then carefully decanted and applied to a previously prepared 450 ml column (5 cm x 23 cm) filled with S-Sepharose Fast Flow ™ resin (Pharmacia, Piscataway, NJ) equilibrated with 0.2 M NaCl solution , 20 mM NPO4, pH = 7.5 at 4 ° C. The column was then washed with a solution of 0.4 M NaCl, 20 mM NaPO4, p.H = 7.5 at 4 ° C, with a volume equal to five column volumes (2250 ml). The desired protein was eluted by washing the column with 5 liters of a solution containing 0.5 M NaCl, and 20 ml of NaPO4 at pH = 7.5. Fractions of 50 ml were collected and the A280 value in the eluate was monitored continuously. Fractions identified by A280 as containing elution material were then analyzed by SPD-PAGE on a 14% gel to confirm the presence of the desired polypeptide.

Then, fractions containing the expected proteins were pooled, and then the same volume of distilled water was added. The diluted sample was then placed on a previously prepared 450 ml S-Sepharose Fast Flow column (5 cm x 23 cm) equilibrated with a solution of 0.4 M NaCl and 20 mM NPO4, pH = 6.8 at 4 ° C. The column was washed with 2250 ml of a solution containing 0.4 M NaCl, 20 mM NaPO4 at pH = 6.8 and the desired protein was eluted from the column by washing with a solution volume equal to 20 column volumes with a linear concentration gradient from 0.4 M NaCl and 20 mM NaPO4 and pH = 6.8 to 0.6 mM NaCl and 20 mM NaPO4 and pH = 6.8. Fractions of 50 ml were collected again by continuously monitoring the amount of A280 in the fluid exiting the column. Fractions containing protein (determined by 14% SPD-PAGE) were pooled and then concentrated by passing through a YM-10 membrane (10,000 molecular weight cutoff) in 350 cc centrifuge vessels (Amicon, Inc. Mayberry, MA) to a volume of 30-40 ml.

The concentrate was then applied to a pre-prepared 1300 ml (4.4 cm x 85 cm) column filled with Superdex-75 ™ resin (Pharmacia) and equilibrated with CIX PBS-containing column buffer (Dulbecco's Phosphate Buffered Saline, "D-PBS", free of calcium and magnesium) or 0.15 M NaCl solution, 20 mM NPO4 at pH = 7.0. After allowing the sample to enter the column, the protein was eluted from the filter gel matrix using column buffer. Then 10 ml fractions and fractions containing the desired analog were recovered

The 184,188 (determined by 14% SPD-PAGE) was pooled. Typically, the protein concentration was about 5-10 mg / ml in the pooled fractions. All the above operations were carried out at 4-8 ° C, unless otherwise noted.

An alternative purification method was used to purify native KGF, C (1.15) S and AN23. This procedure involves the following steps and - unless otherwise noted, all procedures, solutions and materials were carried out at 23 5 ° C.

After the production step of the bacterial fermentation process was completed, the cell culture was cooled to 4-8 ° C and the cells were harvested by centrifugation or other similar method. On the basis of the expected protein yield per unit mass of cell paste and the required amount of purified protein, the appropriate amount of cell paste, determined by weight, was suspended in a buffer solution containing 20 mM NaPO 4.0.2 M NaCl at pH = 7.5, in an amount by weight about five times the weight of the cell paste to be slurried. The cells were dispersed to a homogeneous solution using a high shear mixer. The temperature of the cell paste was kept at 4-8 ° C during the homogenization.

The cells were then lysed by pressure, for example by passing the cell paste twice through an appropriately sized homogenizing vessel. The homogenate was stored chilled to a temperature of 5 ± 3 ° C. In order to clarify the cell lysate, a previously prepared depth filter housing (Cuno, Inc., Meriden, CT) was used, equipped with a filter with an appropriate size of the filtering surface. Equilibrated with an appropriate volume of 0.2 M NaCl 20 mM NaPO4 solution, with pH = 7.5. Both equilibration and clarification were performed at 5 ± 3 ° C. Prior to the clarification process, an appropriate amount of filter aid was used to pre-coat the filter and thoroughly mix with the cell lysate, and the lysate was clarified by passing the solution through a filter device. The filter was washed with a solution of 0.2 M NaCl and 20 mM NaPO4, pH = 7.5. The filtrate and the subsequent wash solution were collected in an appropriate volume refrigerated vessel and all operations were carried out below 10 ° C.

After clarification, the lysate was passed through a previously prepared S-Sepharose Fast Flow column containing at least 1 ml of resin per 2 g of cell paste. The S-Sepharose Fast Flow column was equilibrated with a cold (5 ± 3 ° C) solution of 0.2 M NaCl, 20 mM NaPO4, pH = 7.5. The column was kept below 10 ° C. The clarified li: congested (5 ± 3 ° C) was then loaded onto an ion exchange column, and continuously monitored for absorbance of the eluate at 280 nm (A2 ₈ q). After loading the sample, the column was washed with a cold solution of 0.2 M NaCl, 20 mM NaPO4, pH = 7.5, and then washed with a solution of 0.3 M NaCl, 20 mM NaPO4, pH = 7.5 at 23 ± 5 ° C.

In order to elute the desired protein, solutions with a linear concentration gradient ranging from 0.2 to 1 M NaCl, 20 mM NaPO4 at pH = 7.5 were used. The product was collected in several fractions based on the A2 ₈ size of the ₍₎ eluate. These fractions were pooled after collection and the volume was recorded.

An oxidation operation was performed to oxidize the free sulfhydryl groups. In the case of proteins with an altered arrangement of cistern residues - compared to the native KGF, the oxidizing agent (e.g. cystamine dihydrochloride or another suitable oxidizing agent, e.g. cystine, oxidized glutathione or divalent copper) was added in such an amount that the final concentration was 1-20 mM The pH was adjusted to 7-9.5, with 9.0 ± 0.3 being the preferred pH when cystamine dihydrochloride is used. The oxidation was carried out at 10-30 ° C for an appropriate period of time. In the case of the native KGF protein, oxidation was accomplished by adding the appropriate amount

184 188 (NH4) 2SO4, for example 1-2 M (NH4) -SO4 by bringing the pH of the solution to a value of 7.5 ± 0.5 and keeping the temperature in the range of 23 ± 5 ° C for a suitable period of time.

After oxidation, the pH of the solution was adjusted to 6.5-9.5. If necessary, solid (NH4) 2SO4 was added to the solution until a final concentration of 2M was reached. The solution was passed through appropriate clarifying filters to remove insoluble solids.

The filtered, oxidized product was then subjected to hydrophobic interaction chromatography (HIC). The HIC matrix was a resin named Butyl-650M Toyopearl ™ (Tosohaas, Inc., Montgomeryville, PA). The protein-containing solution was applied to the chromatography column, which was previously equilibrated with a solution of 2 M (NH4) 2SO4, 0.15 M NaCl, 20 mM NaPO4, pH 7.0. After placing the sample, the column was washed with a 2M solution (NfRRSCty, 0.15 NaCl and 20 mM NaPO4 pH == 7.0. Then the desired protein was eluted with a solution with a linearly decreasing concentration gradient (NH4) 2SO4 in the range of 2 to 0 M, developed in 0.15 M NaCl, 20 mM NaPO4, pH 7.0. When elution of the desired protein began, as indicated by an increase in A A eluate, fractions were collected. An aliquot of each fraction was then analyzed by SDS-PAGE The fractions containing the desired protein were combined. Thoroughly mixed and the volumes of the pooled fractions and the protein concentration were determined.

The pooled HIC protein-containing eluate was then concentrated and the elution buffer was exchanged. Typically, proteins were dependent on a concentration of 5.0-10.0 mg / ml. Ultrafiltration was performed using an ultrafiltration device equipped with a PTGC Pellicon ™ cassette system (Millipore, Inc., Bedford, MA) with an appropriately selected cut-off membrane.

After concentration, the sample was diafiltered against an appropriate buffer. The concentrated solution from the concentration step was diafiltered against a solution of 0.15 M NaCl, 20 mM NaPO4, pH - '7.0 until the conductivity of the diafiltered solution was within 5% of the conductivity of 0.15 M NaCl solution , 20 mM NPO4, pH = 7.0.

Additionally, the concentrated and diafiltered sample containing the desired protein was passed through a 0.1 µm Posidyne ™ filter (Pali, Inc., Cortland, NY) to remove deposits and bacterial endotoxins that might be present. After determining the protein concentration in the solution and based on the desired final product concentration, the purified solution as above was diluted with a solution containing 0.15 M NaCl, 20 mM sodium phosphate, pH = 7.0 to the desired final concentration. Final aseptic filtration was then performed through a 0.22 µm filter, transferring the final product to pyrogen-free containers for storage (at about 5 ° C) for later use in the preparation of various galenic forms.

B. Analysis

The native KGF was analyzed; C (1.15) S; C (1.15) S / R (144) Q; AN15;

AN23 and AN23 / R (144) Q, produced in E. coli cells.

Conformational stability

The polypeptides were compared in terms of their storage stability, transition temperature to the separated (unwoven) form (Tm) and stability over a wide pH range.

Stability during storage

Figure 25 shows a comparison of native KGF and C (1.15) S after storage in a 20 mM NPO4, 0.15 M NaCl solution at pH 7.0 at 37 ° C for 27 hours. C (1,15) S shows a significantly higher amount of soluble protein compared to the native KGF.

184 188

Figure 26 shows a comparison of the stability of native KGFAN15 (data not shown) and C (1.15) S in PB S and in 50 mM NaPO ₄ , 0.15 M NaCl at pH 7.0 after storage at 37 ° C. C for 18 hours. Recovery of dissolved protein is significantly greater in a concentrated phosphate solution than in PBS. AN 15 as well as C (1.15) S show a significant increase in durability compared to the native KGF. AN15 and C (1, 15) S also show approximately one hundred percent recoveries in a concentrated solution containing phosphates, as expected from the results for the native KGF.

However, a single preliminary storage stability comparison study between C (1,15,40) S and C (40) S (which is encoded with bases 201 to 684 in SEQ ID NO: 1, except that Ser ⁴⁰ is encoded by AGA), and between C (1,15,102) and C (102) S (which is encoded with bases 201 to 684 in SEQ ID NO: 1, except that Ser ™ ² is encoded by AGG). Results (not shown) indicate a reduced stability (ie: less soluble protein after storage at 37 ° C). However, the amount of soluble correctly folded protein C (1,15,40) S that was purified from the culture medium was greater than the amount of protein C (40) S, suggesting that the C analog (1,15,40) S may be in fact more durable, also the results of the above comparative study are not conclusive. The present invention preferably includes a KGF analog having other than-substitution Cys40, Cys ¹ 02 Cys ™ ^6, and more preferably does not include C (1,15,40) S, C (1,15,102) S and C (1,15,40,102,106 ) S.

The ability of native KGF, C (1.15) SAN23, C (1.15) S / R (144) E, C (1.15) S / R (144) Q and AN23 / R (144) Q to preventing aggregation at elevated temperatures. Samples were prepared containing 0.5 mg / ml protein in D-PBS. 0.5 ml of each sample was collected into 3 cm type 1 glass vials. The vials were closed with rubber stoppers and additionally 13 mm aluminum clamps were applied. The vials were then placed in an incubator at 37 ° C. At predetermined time intervals, the vials were opened and analyzed for loss of soluble protein. Noticeable deposits were removed by centrifuging 250 µl of each sample in a 0.22 µm Spin-X ™ filter unit (Costar, Cambridge, MA). The soluble protein contained in the filtrate was then subjected to size exclusion analysis by high performance liquid chromatography (HPLC). The amount of soluble protein was determined by integration of the area under the chromatographic peak (HPLC) and the results for KGF, C (1.15) S, C (1.15) S / R (144) E and C (1.15) S / R (144) Q is plotted versus incubation time at 37 ° C (AN23 and AN23 / R data (144) Q not shown). The results are shown in Figure 27.

The half-life of the soluble monomeric protein was then determined from these kinetic curves. Table 1 shows the half-life of the soluble KGF remaining in the solution during storage at 37 ° C.

Table 1

Half-time of soluble monomeric protein

Protein 11/2 (days) native KGF 0.6 AN23 1.1 C (1.15) S 1.2 C (1.15) S / R (144) Q 13.3 AN23./R(144)Q 22.3 C (1.15) S / R (144) E 38.0

184 188

As can be seen from Table 1 above and Figure 27, native KGF aggregates most rapidly, with a half-life of the soluble form of 0.6 days. C (1.15) S / R (144) Q AN23 / R (144) Q and C (1.15) S / R (144) Q show a significant increase in the half-life of soluble monomers to 13.3, 22.3, respectively and 38 days.

Thermal separation (unraveling)

Thermal separation (de-interleaving) was monitored by circular dichroism (CD) at 230 nm using a J-720 ™ spectropolarimeter (Jasco, Inc., Easton, MD) equipped with a PTC-343 Peltier type temperature control system. For CD analysis, separate samples were prepared containing 0.1 mg / ml of the polypeptide to be analyzed in D-PBS (Life Technologies, Inc., Grand Island, NY). Approximately 2.5 ml of each sample was placed in a rectangular Supraśli ™ quartz (Heraeus OaTzschmelze, Gmbh, Hanau, Germany) fluorescent vessel (Heima Cells, lnc., Jamaica, NY) with an optical path length of 10 mm . The pan was then placed on a Peltier type temperature control system on a spectropolar meter. Thermal separation (de-interleaving) was carried out at a temperature change rate of 50 ° C / hour. The changes in ellipticity were monitored at 230 nm to detect separation (disruption). The Tm temperature for each sample was determined from the determination of the temperature at which 50% of the protein molecules in the solution were in a separated (disentangled) form (Biophysical Chemistry, Cantor and Schimmel (eds), WH Freeman and Co. San Francisco (1980). Table 2 summarizes the estimated T _m temperatures for each of the three proteins.

Table 2

Estimated "melting" points

Protein Tm (° C) native KGF 54.0 ADN15 55.0 C (1.15) S 55.0 AN23 56.0 C (1.15) S / R (144) Q 62.5 AN23 / ^/ R (144) Q 63.0 C (1.15) S / R (144) E 63.5

As can be seen from the above results, C (1.15) S and DN15 show an increase in temperature T _m by 1 ° C as compared to natural KGF. For DN23, the Tm temperature increases by one additional degree. However, substitution of R144Q to C (1.15) S / R (144) Q or DN23 increases the Tm temperature by more than 6 ° C and more than 7 ° C compared to native KGF. Moreover, C (1.15) S / R (144) E is more than 9 ° C more stable compared to the native KGF.

Acidity, pH

The acid stability of C (1.15) S / R (144) Q and C (1.15) S / R (144) E was also compared with native KGF by adjusting D-PBS to different pH values by adding concentrated HCl or NaOH. Approximately 2.35 ml of D-PBS at different pH values was mixed in a quartz cup with 100 μΐ of the KGF protein solution at a concentration of 2.45 mg / ml. These samples were thermally unfolded at a rate of 50 ° C / hour and monitored by circular dichroism (CD) at 230 nm. Figure 28 shows the dependence of the Tm temperature on the pH of native KGF, C (1.15) S / R (144) Q and C (1.15) S / R (144) E. In the studied pH area, C (1.15) S / R (144) Q and C (1.15) S / R (144) E always showed a higher Tm temperature than KGF.

184 188

In vitro biological activity

The mitogenic activity in vitro of proteins C (1.15) SAN 15AN23 / R (144) Q, C (1.15) S / R (144) Q and C (1.15) S / R (144) S were also determined in concentration of protein and concentrations of półmaksymalnych by measuring the uptake of ^[3 HJ-thymidine incorporation by BALB / MK (according to the methods Ruby al. (1989), supra). In general, the concentrations of each of the KGF analogues compared to the known standard native KGF were determined using an in vitro bioassay. Then, each KGF analog was diluted and tested for biological activity using the Balb / MK mitogenic assay. The samples were initially diluted in biosample medium consisting of 50% Eagle's MEM (user prepared), 50% F12 (prepared by the user), 5 pg / ml transferrin, 5 pg / ml sodium selenite, 0.0005% HSA, and 0.005% Tween 20. Next, the KGF samples were plated on 96-well Falcon Primeria plates on which Balb / MK cells were inoculated. [3HJ-thymidine incorporation during DNA synthesis was measured and converted to input native KGF concentration by comparison with the native KGF standard curve. The results are shown in Figures 29-34. As can be seen from these figures, the tested KGF analogs described in Figures 28-33 have comparable activity to the native KGF.

Example III. Produced in cell culture using cells from a mammalian body

The present example describes the expression, isolation and characterization of two biologically active recombinant KGF (rKGF) forms produced in an expression system derived from a mammalian organism.

The human KGF gene was isolated by PCR amplification of cDNA obtained from normal human skin-derived fibroblast cells (Clonetec, Inc., San Diego, CA). After the cDNA was obtained using reverse transcriptase, the PCR method was used to amplify the KGF gene. Compounds OLIGO # 25 and OLIGO # 26 were used to amplify the gene from cDNA and OLIGO # 27 and OLIGO # 28 were used to place restriction sites Hind1 III and Bg1 II at the ends of this fragment by a second PCR amplification as shown in Figure 1A and 1B.

OLIGO # 25 (SEQ ID NO: 69): 5'-CAATCTACAATTCACAGA-3 '

OLIGO # 26 (SEQ ID N0: 70): 5'-TTAAGTTATTGCCATAGG-3 '

OLIGO # 27 (SEQ ID NO: 71):

5'-AACAAAGCTTCTACAATTCACAGATAGGA-3 '

OLIGO # 28 (SEQ ID NO: 72):

5'-AACAAGATCTTAAGTTATTGCCATAGG-3 '

After cloning and confirming the DNA sequence, the DNA of the KGF gene was then used. Amplification was accomplished using OLIGO # 29 compounds and

OLIGO # 30.

OLIGO # 29 (SEQ ID NO: 73):

5'-CGGTCTAGACCACCATGCACAAATGGATACTGACATGG-3 '

OLIGO # 30 (SEQ ID NO: 74) 5 ^, -GCCGTCGACCTATTAAGTTATTGCCATAGGAAG-3 '

The sense primer, OLIGO # 29, included an XbaI site and a Kozak consensus translation sequence (5'-CCACC-3 /) upstream of the ATG start codon. The antisense primer, OLIGO # 30, included a Sal cloning site and an additional stop-codon. After 18 cycles of PCR amplification (denaturation for 30 seconds at 94 ° C, convolution annealing for 40 seconds at 55 ° C and extension for 40 seconds at 72 ° C), the product was etched with Xbal and Sali and ligated with a similar etch. converted DNA from pDSRa2 (according to the method of Bourdrel et al. (1993), Protein Exp. & Purif., 4: 130-140 and Lui et al. (1992), Arch. Biochem. Biophys, 298: 150-158) . The KGjF / pDSR plasmid was obtained (c2 in which this human KGF gene was located between the SV40 early promoter and a-FSH polyadenylation sequences. Two clones were selected and DNA sequence analysis confirmed the construction of the desired vector.

18 * 4188

Two micrograms of KGF / pDSRa2 DNA were then linearized with Pvul. Chinese hamster ovary (CHO) cells inoculated the day before at 0.8 x K) 6 cells / 60 mm flat culture vessel, transfected with the treated DNA using standard pelleting method calcium phosphate (Bourdrel et al., supra). Two weeks later, single colonies were picked and transferred to 24-well plates. Conditioned media was considered serum-free when cells became fluid and their samples were analyzed by Western blotting using rabbit polyclonal antiserum reactive with human KGF expressed in E. coli.

Western blotting was performed by running the samples through 12.5% (w / v) polyacrylamide SDS gels, followed by electroblotting for 1 hour with 400 mA on niirocellulose membranes and using a dry transfer device (Hoefer Scientific Instruments, San Francisco, CA). A solution of 20 mM Tris, 150 mM glycine and 20% methanol served as the transfer buffer. Nitrocellulose sheets were blocked by incubation with 10% normal goat serum in PBS. Rabbit antiserum reactive with KGF expressed in E. coli was used as the primary antibody. For use, it was diluted in a 1 / 10,000 ratio in 1% normal goat serum in PBS and incubated with blocked nitrocellulose sheets for 12 hours at room temperature, after which excess antibody was removed by washing three times in PBS for 30 minutes. The nitrocellulose membranes were then incubated in 100 ml of a 1% normal goat serum in PBS supplemented with Veltastin ™ - biotinylated goat anti-rabbit IgG (secondary antibody, Vector Labs, Burlingame, CA) for 30 minutes at room temperature. After washing for three 10 minutes in PBS, a 30 minute injection at room temperature was performed in 100 ml of a 1% normal goat serum solution containing streptavidin and biotinylated peroxidase prepared according to the manufacturer's instructions (Vector Labs). Then it was washed three times in PBS and the material of the cross-reactive KGF was visualized by incubating in a mixture of 60 µl of 30% (w / v) H 2 O 2 in 100 ml PBS and 50 mg

4-chloronaphthol in 20 ml of methanol. The reaction was stopped after 10 minutes by rinsing with water.

Analysis of the blots revealed that the KGF-specific antibody was associated with three separate bands of proteins - two of which were closely related, having molecular weights of around 25-29 kDa, and one having an estimated molecular weight of around 17 kDa - compared to an expected molecular weight of around 18 , 8 for the mature protein of 163 amino acids. Additionally, several high-expression clones secreting more than 2.0 mg rKGF per liter were selected as judged by Western blot analysis, selected and expanded into cylindrical bottles (according to the method given by Lu et al., Supra) to produce large volumes of serum free conditioned medium for the purification of KGF by cation exchange chromatography and by gel filtration as given below.

KGF from 3 liters of serum-free conditioned medium was purified by applying the medium directly to a cation exchange column (5 x 24 cm) packed with 450 ml of sulfoethyl S-Sepharose Fast Flow column (Pharmacia) pre-conditioned with 20 mM sodium phosphate solution, pH = 7.5. After washing with five column volumes of a 20 mM sodium phosphate, 0.2 M NaCl pH = 7.5 solution, rKGF was eluted using a 20-fold column volume of the solution with a linearly varying NaCl concentration gradient from 0.2 to 1.0 M in 20 mM sodium phosphate, pH = 7.5. Fractions of 50 ml were collected with continuous monitoring of A280. The presence of the KGF protein was determined by subjecting a sample of each fraction to SDS-PAGE analysis. SDS-PAGE analysis was performed by electrophoresis (Novex, San Diego, CA) using a pre-prepared 14% trighcin gel (according to the method of Laemmli (1970) Nature, 227: 680-685). The samples were mixed with non-reducing SDS buffer without heating before loading. The presence of proteins was detected by staining with Coomassie blue or silver.

184 188

Two late elution peaks were observed containing protein bands corresponding to the 25-29 kDs and 17 kDa bands detected in the Western blot assays. Fractions containing each of these peaks were separately concentrated to a volume of less than 1.0 ml and subjected to gel filtration.

In gel filtration, columns filled with resin (HR

10/30, Pharmacia) pre-equilibrated with PBS at pH = 7.2 and calibrated with the following known molecular weight standards (BioRad, San Francisco, CA): thyroglobulin (670 kDa), g-globulin (158 kDa), ovalbumin (44 kDa), myoglobin (17 kDa) and vitamin B-12 (1.4 kDa). The above purification steps resulted in an approximately 2000 fold purification of rKGF containing in particular 17 kDa and 30 kDa material as judged by silver staining.

For the higher molecular weight material, rKGF eluted as the major symmetric peak (detected by A1) which was named KGF-a. Based on SDS-PAGE analysis of less of this material - 3 µg / strip versus 6 µg / strip, two bands with a molecular weight difference of less than 1-2 kDa were separated. In the case of a lower molecular weight substance called KGF-b, gel filtration resulted in the protein pre-apparatus with the expected mobility. For both materials (KGF-a and KGF-b) the overall yield after purification was about 30-40%.

The amino acid sequences of KGF-a and KGF-b were also analyzed. These analyzes were performed on an automated sequencing instrument (Model 477A or 470A, Applied Biosystem, Inc., Foster City, CA) equipped with a PTH Model 120A amino acid analyzer for on-line analysis and a Model 900A data acquisition system (according to the method given by Lu et al. (1991), J. Biol. Chem., 266: 8102-81071 Edman analysis of the KGF-a sequence revealed a major N-terminal sequence X ₁ -NDMTPEQMATNVX - X3-S [SEQ ID NO: 75]. the sequence starting with the third N-terminal amino acid, aspartic acid, was also present in 1.6% of the total sequenced protein. X _b X2 and Χ3 were not identified due to the lack of phenylthiohydantoinyl (PHT) amino acid signals during sequence analysis. N-terminal sequence. The amino acid KGF predicted from the cDNA sequence indicates that Xj and Χ3 are Cys and X2 is asparagine. The absence of Χ1 and Χ3 indicates that these two cysteines can form disulfide bonds. Based on the N-terminal the spliced Asn-X-Ser consensus sequence, the absence of the predicted Asn residue corresponding to X2 indicates that it is a potential N-glycosylation site.

Interestingly, sequence analysis of the N-terminus of KGF-b revealed the N-terminal amino acid sequence of SYDYMEGGDIRY- (SEQ ID NO: 76) indicating that it is an N-terminally truncated form of KGF proteolytically cleaved at the Arg ^ Ser * ¹ peptide linkage.

To further characterize the purified KGF-a and KGF-b, the protein was treated with glycosidases (neuramidase, O-glycanase, and / or N-glycanase) using known techniques (Sasaki et al. (1987), J. Biol. Chem., 262. : 12059-12076); Takeuchi et al. (1988), J. Biol. Chem., 263: 3657-3663:

Zsebo et al. (1990), Cell, 62j.l95-201). The data thus obtained indicates that KGF-a contains nitrogen-bound carbohydrates N- or oxygen O-, although the lower molecular weight form of KGF-a likely contains only N-linked sugar. Treatment with glycosidases did not reduce the molecular weight of KGF-b, indicating that its molecule was not glycosylated.

The glycosylation pattern of KGF-a was further investigated by mass spectroscopy of peptides produced by the Glu-C endoproteinase as described above. The elucidation of the carbohydrate structure of glycopeptides by the stepwise exit of mass spectrometric analysis has proven effective in relation to other proteins (Huddleston et al. (1993), Anal Chem, 65: 877-884; Carr et al. (1993), Prot. Sci., 2: 183-196). As confirmed by isolation of the unglycosylated peptide, the Thr- residue appears to be partially glycosylated. A similar mass spectrometric analysis of Asn ¹ 4 suggested

Microheterogeneity in glycosylation with two, three and four "tentacle" structures with varying degrees of sialylation.

Table 3A shows KGF concentrations to stimulate keratinocyte incorporation of [ ³ H] -thymidine to a semi-maximum extent (according to the method reported by Rubin et al. (1989), Supra). The interaction with the KGF receptor was investigated using KGF receptor membrane preparations prepared from the epidermal keratinocytes of Balb / MK mice (following the procedure described by Massague (1983), J. Biol. Chem., 258.13614-13620). More specifically, the various KGF forms were diluted with 50 mM Tris-HCl buffer, pH = 7.5, containing 0.2% bovine serum albumin to obtain concentrations ranging from 0.8 ng to 100 ng in 50 µl. They were separately incubated with the membrane preparation (75 ng / ml) and 25 µl labeled KGF expressed in E. coli (1.5 ng). Receptor binding experiments and competition studies were performed at 4 ° C for 16 hours after which the samples were centrifuged and washed twice with the above dilution buffer to remove unbound and non-specifically bound labeled KGF. The residual radioactivity of the samples was counted. The receptor binding curves between the KGF samples and labeled KGF were constructed by plotting the percent non-competition with respect to the concentrations of each KGF sample. Table 3B lists the KGF concentrations needed to achieve 60% uncompetition against labeled KGF derived from E. coli, expressed in ng / ml.

Table 3A

The concentration of KGF used to stimulate the incorporation of [ ³ H] -thymidine into keranocytes to a semi-maximum degree

Forms ng / ml KGF from E coli 10 KGF thirty KGF-b thirty

Table a 3B

Concentration of KGF used for competitive binding of the receptor at ¹²⁵ J iodine labeled KGF with a 60% degree of non-competition

Forms ng / ml KGF from E. coli 65.8 KGF 93.5 KGF-b 89.1

As shown in Table 3A, KGF-a and KGF-b stimulate comparative incorporation of [3 H] -thymidine, with the half-maximum degree of incorporation being stimulated by about 30 ng / mL of each analog. Thus, truncation does not reduce the biological activity of the molecule. However, these two analogs are about three times less active than the full-length KGF obtained with E. coli. As shown in Table 3B, the non-competition studies by the radioreceptor assay indicated that KGF obtained with E. coli, KGF-a and KGF-b had similar receptor binding activity.

Example IV. In vivo biological assay applied to KGF polypeptides produced in E. coli and cell culture of mammalian cells

It was found that a single subcutaneous dose of KGF produced a dose-dependent increase in serum cholesterol levels in mice within 24 hours. The ability of the native KGF was assessed,

184 188

KGF-a, C (1.15) S ANI 5 and AN23 for increasing serum cholesterol in a dose dependent manner.

Each test group included five female Balb / c mice (18-20 grams) obtained from CRL. The protein was diluted with 0.9% saline to give a final injection volume of 100 µg / mouse. Each mouse was given a single subcutaneous injection at the following doses:

Group The ingredient served Dose (mg / kg) 1 native KGF 0Ί native KGF 0.25 native KGF 0.5 native KGF 1 native KGF 5 2 CG ^ S 0Ί CG, '5) S. 0.25 C (1.15) S 0.5 C (1.15) S 1 C (1.15) S 5 3 ΔΝ15 0.25 AN15 0.5 AN15 1 AN15 5 4 ΔΝ23 0 ’ AN23 0.5 AN23 1 AN23 5 5 KGF 0.01 KGF 0.05 KGF 0 ’ KGF 0.5 6 salt solution (control) -

24 hours after injection, the mice were sacrificed and exsanguinated by cardiac puncture. Blood samples were processed to determine serum cholesterol.

As shown in Figure 35, it was found that each KGF analog tested increased serum cholesterol in a dose dependent manner.

There was also no apparent difference in bioactivity between the KGF analogues tested.

In vivo model of diabetes

Models of chemically induced diabetes in various animal species have been used classically to study the disease and its treatment. Streptozotocin causes diabetes in mice, rat, hamster, dog, and monkey although studies in rats and mice are the most commonly used. Junod et al., Proc. Soc. Exp. Pio. Mcd. 126: 210-205 (1967); Rerup, Pharm. Rcv. 22: 485-518 (1970); Rossini et al., P.N.A.S. 74: 2485-2489 (1977); and ArRajab andAhrcn, Pancreas 8: 50-57 (1993). In rats, streptozotocin doses of 45 to 70 mg / kg, administered as a single intravenous dose, induce persistent disease. Doses of less than 45 mg / kg in (tdc), a progressive disease state that is reversible. One day after injection of streptozotocin, a hyperglycemic state is induced. Blood insulin levels remain substantially unchanged compared to normal rats; however, the total insulin and C-peptide content in the pancreas is strongly reduced. Rats display the classic signs and symptoms of diabetes in humans: increased blood glucose levels (hyperglycemia), glucose in the urine (glycosuria), increased thirst (polydipsia), increased urine output (polyuria), increased appetite (hyperphagia).

18 * 4 188

The studies described in this report were performed using a Streptozotocin-induced diabetes model in Sprague-Dawloo rats. Male rats weighing 200-260 grams at the start of the study were used. Diabetes was induced by a single intravenous injection of 50 mg streptozotocin in sodium citrate buffer per kilogram of body weight. Non-diabetic control rats received a single intravenous injection of sodium citrate buffer for control purposes. KGF was administered daily by subcutaneous injection. The KGF dose was 3 or 5 mg / kz / aeień, depending on the experiment. In the first experiment, KGF therapy was initiated two days before diabetes induction and continued after diabetes induction for a total of eight injections. In the second and third experiments, subcutaneous KGF therapy was initiated one day after diabetes induction with Streptozotocin. In the fourth experiment, 7-year KGF therapy was initiated 7 days after treatment with Streptozotocin and the animals were monitored for a further 12 weeks. In all experiments, except for the fourth experiment, blood glucose levels, urine glucose levels and urine volume were used as analysis endpoints. Additionally, in some experiments, water consumption, urinary C-peptide levels, or total pancreatic insulin and C-peptide levels were measured. In the fourth experiment, the only endpoint assessed was blood glucose.

Since much of the insulin is cleared from the circulation by the liver, the measurement of peripheral insulin levels reflects the phenomena of post-hepatic metabolism rather than pancreatic insulin secretion. Therefore, C-peptide measurements are frequently made and used as a peripheral marker of insulin secretion. C-peptide is produced by converting pro-insulin to insulin. Insulin and C-peptide are secreted from beta cells in equimolar amounts and only a small amount of C-peptide is extracted by the liver.

The following study looked at the effect of rKGF on diabetes ί ^ υΚο via streptosotocin in Sprazuo-Dawley rats. On day "zero", groups of rats were treated with either 45 or 50 mg / kg itreptozotocin (STZ). Thereafter, non-fasting blood glucose levels were monitored daily to assess the severity of islet cell damage. On the fifth day, the STZ-treated animals were divided into two groups of 20 per group depending on the degree of hyperglycemia. The cut-off point was blood glucose of 300 mg / dL. A group of animals not treated with STZ served as a control group. From the seventh day onwards, ten animals from each hyperglycemia group were administered ΔΝ23 (3 mg / kg / day) or PBS by subcutaneous injection for 7 days. Thereafter, blood glucose was monitored daily, every other day or weekly as shown in Figure 50. It should be noted that the STZ-treated animals of the two ΔΝ23 groups showed significant decreases in blood glucose levels during the ΔΝ23 administration period. Importantly, the mean decrease in blood glucose for STZ-treated animals in the group with baseline blood glucose> 300 mg / dL stabilized at approximately 150 mg / dL, and for the group with baseline blood glucose> At 300 mg / dL, this decrease was only temporary. Note that the day scale in the figure is non-linear.

While the lower ejinnamon has been found in the category of the preferred embodiments, it is to be understood that other variations and modifications will be appreciated by those skilled in the art in light of the foregoing description.

184 188

184 188

F! G. 1A human KGF (+ signal sequence) | - OLIGO # 25 ----- 1 | ------- OLIGO # 1 --------- 1 '-CAATCTACAATTCACAGA-3' 5 '-CAATGACCTAGGAGTAACAATCAAC -3 '

5 '-CAATCTACAATTCACAGATAGGAAGAGGTCAATGACCTAGGAGTAACAATCAACTCAAGA -------- v - + --------- + --------- + --------- + ----- ---- + --------- _{+ 6θ}

-TTCATTTTCATTATGTTATTCATGAACACCCGGAGCACTACACTATAATGCACAAATGGA --------- ₊ --------- + --------- + --------- + -------- - + --------- + ₁₂ q

Μ Η K W I

-TACTGACATGGATCCTGCCAACTTTGCTCTACAGATCATGCTTTCACATTATCTGTCTAG --------- ₊ --------- ₊ --------- ₊ --------- ₊ -------- - + --------- ₊ ] _QQ

LTWILPTLLYRSCFHIICLV

-TGGGTACTATATCTTTAGCTTGCAATGACATGACTCCAGAGCAAATGGCTACAAATGTGA --------- ₊ --------- ₊ --------- ₊ --------- ₊ -------- - + --------- + 240

GTISLACNDMTPEQMATNVN

-ACTGTTCCAGCCCTGAGCGACACACAAGAAGTTATGATTACATGGAAGGAGGGGATATAA --------- ₊ --------- ₊ --------- ₊ --------- ₊ -------- - + --------- ₊ 3QQ

CSSPERHTRSYDYMEGGDIR

-GAGTGAGAAGACTCTTCTGTCGAACACAGTGGTACCTGAGGATCGATAAAAGAGGCAAAG --------- + --------- + --------- + --------- ₊ -------- - ₊ --------- ₊ 36q

VRRLFCRTQWYLRIDKRGKV

-TAAAAGGGACCCAAGAGATGAAGAATAATTACAATATCATGGAAATCAGGACAGTGGCAG --------- ₊ --------- ₊ --------- ₊ --------- + -------- - + --------- ₊ 420

KGTQEMKNNYNIMEIRTVAV

-TTGGAATTGTGGCAATCAAAGGGGTGGAAAGTGAATTCTATCTTGCAATGAACAAGGAAG --------- ₊ --------- + --------- + --------- + -------- - + --------- + 480

GIVAIKGVESEFYLAMNKEG

-GAAAACTCTATGCAAAGAAAGAATGCAATGAAGATTGTAACTTCAAAGAACTAATTCTGG --------- + --------- + --------- ₊ --------- + -------- - ₊ --------- ₊ 540

KLYAKKECNEDCNFKELILE

- AAAACCATTACAACACATATGCATCAGCTAAATGGACACACAACGGAGGGGAAAIGTTTG --------- ₊ --------- + --------- ₊ --------- ₊ -------- - + --------- ₊ 600

NHYNTYASAKWTHNGGEMFV

-TTGCCTTAAATCAAAAGGGGATTCCTGTAAGAGGAAAAAAAACGAAGAAAGAACAAAAA --------- ₊ --------- ₊ --------- ₊ --------- ₊ -------- - ₊ --------- ₊ 660

ALNQKGIPVRGKKTKKEQKT

184 188

(continued)

CAGCCCACTTTCTTCCTATGGCAATAACTTAATTGCATATGGTATATAAAGAACCCAGTT --------- + --------- ₊ --------- ₊ --------- ₊ --------- + --------- + 720

AHFLPMAIT *

3'-GGATACCGTTATTGAATT-5 '

I ---- OLIGO # 26 ---- j

CCAGCAGGGAGAITrCTTTAAGTGGACTGTTTTCTTTCTTCTCAAAATTTTCTTTCCTTT --------- + --------- + --------- ₊ --------- ₊ --------- ₊ --------- + 780

TATTTTTTAGTAATCAAGAAAGGCTGGAAAAACTACTGAAAAACTGATCAAGCTGGACTT --------- ₊ ---------------- ₊ --------- ₊ --------- + - ------- + 840

3'-ACCTGAAGTGCATTTATGTTTGTTTTAAG-3 '

--------- + --------- + __ 862

CACGTAAATACAAACAAAA- 5 '—OLIGO # 2 -------- 1

184 188

184 188 (continued)

Nde Xbol Clol 4500

FIG.2B

4000

3500 »APHII (Kon)»

<rep Al «<< repA4«

2500

184 188

BamHI

3500

2000

2500Ί

BstElI

184 188

F1G.3A

RSH-KGF plasmid DNA sequence

The bodies of Xbal Ndel

-ATCGATTTGATTCTAGAAGGAGGAATAACATATGAAAAAG- 4 O

Μ K K signal sequence rsh Mlul

-CGCGCACGTGCTATCGCCATTGCTGTGGCTCTGGCAGGTTTCGCAACTAGTGCACA-3 '

RARAIAIAVALAGFATSAHA-96

Mlul

5 '-CGCGTGCAATGACATGACTCCAGAGCAAATGGCTACAAATGTGAACTGTTCCAGCCCTGA --------- ₊ --------- + --------- ₊ --------- ₊ ------ --- ₊ --------- ₊ 156

-CNDMTPEQMATNVNCSSPE

-GCGACACACAAGAAGTTATGATTACATGGAAGGAGGGGATATAAGAGTGAGAAGACTCTT ---------- and ----------- 1 ---------- ₃ ---------- 4 --- -------- | ----------- 1- 216

RHTRSYDYMEGGDIRVRRLF

KpnI Bodies

-CTGTCGAACACAGTGGTACCTGAGGATCGATAAAAGAGGCAAAGTAAAAGGGACCCAAGA --------- ₊ --------- + --------- + --------- + -------- - + --------- + 276

CRTQWYLRIDKRGKVKGTQE

-GATGAAGAATAATTACAATATATGGAAATCAGGACAGTGGCAGTTGGAATTGTGGCAAT --------- ₊ --------- ₊ --------- ₊ --------- ₊ -------- - + --------- + 336

MKNNYNIMEIRTVAVGIVAI

EcoRI

-CAAAGGGGTGGAAAGTGAATTCTATCTTGCAATGAACAAGGAAGGAAAACTCTATGCAAA --------- ₊ --------- + --------- + --------- + -------- - + --------- + 396

KGVESEFYLAMNKEGKLYAK

Bsmł

-GAAAGAATGCAATGAAGATTGTAACTTCAAAGAACTAATTCTGGAAAACCATTACAACAC --------- ₊ --------- ₊ --------- ₊ --------- ₊ -------- - + --------- + 456

KECNEDCNFKELILENHYNT

Ndel

-ATATGCATCAGCTAAATGGACACACAACGGAGGGGAAATGTTTGTTGCCTTAAATCAAAA --------- ₊ --------- + --------- + --------- + -------- - + --------- + 516

YASAKWTHNGGEMFVALNQK

-GGGGATTCCTGTAAGAGGAAAAAAAACGAAGAAAGAACAAAAAACAGCCCACTTTCTTCC --------- ₊ --------- ₊ --------- ₊ --------- ₊ -------- - + --------- + 576

Gl PVRGKKTKKEQKTAHFLP

184 188

FIG.3B

BamHI

TATGGCAATAACTTAATAG-3 '

--------- + --------- + - 595

Μ AIT * ⁴ plasmid DNA sequence

184 188

FIG. 4

KGF

Ndel

5 '-TATGTGCAATGACATGACTCCAGAGCAAATGGCTACAAATGTGAACTGTTCCAGCCCTGA --------- ₊ --------- + --------- ₊ --------- * ------ --- ₊ --------- ₊ it

MCNDMTPEQMATNVNCSSPE

-GCGACACACAAGAAGTTATGATTACATGGAAGGAGGGGATATAAGAGTGAGAAGACTCTT --------- 4 --------- 4 .--------- + --------- 4 .------ --- 4 .--------- 4 120

RHTRSYDYMEGGDIRVRRLF

KpnI Bodies

-CTGTCGAACACAGTGGTACCTGAGGATCGATAAAAGAGGCAAAGTAAAAGGGACCCAAGA --------- ₊ --------- 4 .--------- 4 .--------- 4 .----- ---- 4 .--------- 4. Igo

CRTQWYLRIDKRGKVKGTQE

-GATGAAGAATAATTACAATATCATGGAAATCAGGACAGTGGCAGTTGGAATTGTGGCAAT --------- ₊ --------- 4 .--------- 4 .--------- 4 ------ --- + --------- 4. 240

MKNNYNIMEIR TVAVGIVAI

EcoRI

-CAAAGGGGTGGAAAGTGAATTCTATCTTGCAATGAACAAGGAAGGAAAACTCTATGCAAA --------- 4 .--------- 4 .--------- 4 .--------- 4 .---- ----- 4 .--------- + 300

KGVESEFYLAMNKEGKLYAK

BsmI

-GAAAGAATGCAATGAAGATTGTAACTTCAAAGAACTAATTCTGGAAAACCATTACAACAC --------- ₊ --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 360

KECNEDCNFKELILENHYNT

Ndel

-ATATGCATCAGCTAAATGGACACACAACGGAGGGGAAATGTTTGTTGCCTTAAATCAAAA --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- + 420

YASAKWTHNGGEMFVALNQK

-GGGGATTCCTGTAAGAGGAAAAAAAACGAAGAAAGAACAAAAAACAGCCCACTTTCTTCC --------- 4 --------- 4 --------- 4 --------- 4 -------- - + --------- + 480

GIPVRGKKTKKEQKTAHFLP

BamHI

-TATGGCAATAACTTAATAG-3 *

--------- 4 --------- 4

Μ A I T *

503

184 188

FIG5

KpnI | ----------- 0LIG0 # 6 ----------------- J | ------ OLIGO # 7 ------ --5 '-CTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGAGATGAAAAACAACTACAAT3' -CATGGACGCATAGCTGTTTGCGCCGTTTCAGTTCCCGTGGGTTCTCTIGTTTTTA----------0 # 9 —OLIGOłlO -------- LRIDKRGKVKGTOEMKNNYNEcoRI

-------------------- J | --------- OIGO # 8 ---------------- --- 1

5 '-ATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTTGAATCTG-3'

3 '-TAATACCTTTAGGCATGACAACGACAACCATAGCAACGTTAGTTTCCACAACTTAGACTTAA-5

------------------------- 1 | ---- OLIGO # 11 ---------------- ------ 1

IMEIRTVAVGIVAIKGVESE184 188

KGF (codon optimized)

Xbal | ----- 0LIG0U2 ----- 1

5 '-AGTTTTGATCTAGAAGGAGG-3' | --------------------------- OLIGO # 14 ------------ ------------ 5 '-AGTTTTGATCTAGAAGGAGGAATAACATATGTGCAACGACATGACTCCGGAACAGATGGCT

----------------------------- | -------------- OLIGO # 15 --- ----- ACCAACGTTAACTGCTCCAGCCCGGAACGTCACACCCGTAGCTACGACTACATGGAAGGTG

3'-GGGCCTTGCAGTGTGGGCAT-5 '| ----- OLIGO # 20 -------------------------- OLIGO # 15 ----- ----------------------- | | -GTGACATCCGTGTTCGTCGTCTGTTCTGCCGTACCCAGTGGTACCTGCGTATCGACAAACG 3'-ATAGCTGTTTGC | -OLIGO # 21 -

---------------------- OLIGO # 16 ------------------------- ------ TGGTAAAGTTAAAGGTACCCAGGAAATGAAAAACAACTACAACATCATGGAAATCCGTACT

-ACCATTTC-5 '

-------------------------- | | ------------- OLIGO # 17 ------------ GTTGCTGTTGGTATCGTTGCAATCAAAGGTGTTGAATCTGAATTCTACCTGGCAATGAACA3'-ACGTTAGTTTCCACAACTTA-5 '(----- OLIGO # 22 ----- 1

------------------ OLIGO # 17 ----------------------------- | 1 ---- AAGAAGGTAAACTGTACGCAAAAAAAGAATGCAACGAAGACTGCAACTTCAAAGAACTGAT 3'-GAAGTTTCTTGACTA —OLIGO # 23—

---------------------- OLIGO # 18 ------------------------- ------ CCTGGAAAACCACTACAACACCTACGCATCTGCTAAATGGACCCACAACGGTGGTGAAATG

-GGACC-5 '

----------------------- 1 | ------------------- OLIGO # 19 --- ------ TTCGTTGCTCTGAACCAGAAAGGTATCCCGGTTCGTGGTAAAAAAACCAAAAAAGAACAGA

3'-GGTCTTTCCATAGGGCCAAG-5 '

----- OLIGO # 24 ----- 1

------- OLIGO # 19 ----------------------------------- 1

- AAACCGCTCACTTCCTGCCGATGGCAATCACTTAATAGGATCCAGTTTTGA-3 '

3'-AATTATCCTAGGTCAAAACT-5 '| ---- OLIGO # 13 ------ |

BamHI

184 188

FUG. 7

KGF C (1, X5) S

5 '-ATGTCTAATGATATGACTCCGGAACAGATGGCTACCAACGTTAACTCCTCCTCCCCGGAA --------- 4 --------- 4 ---------- 4 ---------- [---- ------- f .--------- 4. him

MSNDMTPEQMATNVNSSSPE

-CGTCACACGCGTTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCIGTTC --------- 4 --------- 4 --------- 4 ---------- (. --- .-- ----- (.--------- 4 120

RHTRSYDYMEGGDIRVRRLF

-TGCCGTACCCAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAG --------- ₊ --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 jgo

CRTQWYLRIDKRGKVKGTQE

-ATGAAAAACAACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATC --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 240

MKNNYNIMEIRTVAVGIVAI

-AAAGGTGTTGAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCAAAA --------- 4 --------- 4 --------- 4 --------- 4 -------- - ₊ --------- 4 300

KGVESEFYLAMNKEGKLYAK

-AAAGAATGCAACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACC --------- 4 ----------------------------- 4 -------- --4 --------- 4 360

KECNEDCNFKELILENHYNT

-TACGCATCTGCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAA --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 420

YASAKWTHNGGEMFV ALNQK

-GGTATCCCGGTTCGTGGTAAAAAAACCAAAAAAGAACAGAAAACCGCTCACTTCCTGCCG --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 480

GIPVRGKKTKKEQKTAHFLP

-ATGGCAATCACTTAA-3 '

--------- 4 ----- 495

Μ A I T *

184 188

FIG. 8

KGF ńN3 / C {15) S '-ATGACTCCGGAACAGATGGCTACCAACGTTAACTCCTCCTCCCCGGAACGTCACACGCGT --------- ₊ --------- ₊ --------- + --------- ₊ --------- ₊ --------- _{+ 60}

MTPEQMATNVNSSSPERHTR

-TCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACCCAG --------- ₊ --------- ₊ --------- ₊ --------- ₊ -------- - ₊ --------- ₊ 120

SYDYMEGGDIRVRRLFCRTQ

-TGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAACAAC --------- ₊ --------- ₊ --------- ₊ --------- ₊ -------- - ₊ --------- ₊ Igo

WYLRIDKRGKVKGTQEMKNN

-TACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTTGAA --------- ₊ --------- 4 ---------- + --------- + ------- - ₊ --------- ₊ 240

YNIMEIRTVAVGIVAIKGVE

-TCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCAAAAAAAGAATGCAAC --------- ₊ --------- ₊ --------- ₊ --------- + -------- - + --------- ₊ 300

SEFYLAMNKEGKLYAKKECN

-GAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACCTACGCATCTGCT --------- ₊ --------- + --------- + --------- + -------- - ₊ --------- + 300

EDCNFKELILENHYNTYASA

-AAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAAGGTATCCCGGTT --------- ₊ --------- ₊ --------- + --------- + -------- - + --------- + 420

KWTHNGGEMFVALNQKGI P V

-CGTGGTAAAAAAACCAAAAAAGAACAGAAAACCGCTCACTTCCTGCCGATGGCAATCACT --------- 4 .---------- μ --------- 4 ---------- 4 ----- ----- 4 ---------- 4- 480

RGKKTKKEQKTAHFLPMAIT

-TAA-3 ¹ - 483 *

184 188

FIG. 9

KGF ńN3 / C (15) ~ * -ATGACTCCGGAACAGATGGCTACCAACGTTAACTCTTCTCCTGAACGTCATACGCGTTCC ---------- 1 ---------- j ---------- 4 ------ --- + --------- j ---------- + gQ

MTPEQMATWVNSSPERHTRS

-TACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACCCAGTGG --------- ₊ --------- + --------- ₊ --------- ₊ -------- - ₊ --------- 4 120

YDYMEGGDIRVRRLFCRTQW

-TACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAAACAACTAC --------- 4 ----------- 1 ---------- 4 ---------- 1 ---- ------- 1 ---------- 4. 130

YLRIDKRGKVKGTQEMKNNY

-AATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTTGAATCT --------- 4 --------- 4 .--------- 4 --------- 4 ------- --4 ---------- ₊ 240

NIMEIRTVAVGIVAIKGVES

-GAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCAAAAAAAGAATGCAACGAA --------- 4 .--------- 4 .--------- 4 .--------- 4 .---- ----- 4 --------- 4 3oo

EFYLAMNKEGKLYAKKECNE

-GACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACCTACGCATCTGCTAAA --------- 4 .--------- 4 .--------- 4 --------- 4 ------ --- 4 --------- 4 360

DCNFKELILENHYNTYASAK

-TGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAAGGTATCCCGGTTCGT --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 420

WTHNGGEMFVALNQKGIPVR

-GGTAAAAAAACCAAAAAAGAACAGAAAACCGCTCACTTCCTGCCGATGGCAATCACTTAA- 3 '

--------- 4 --------- 4 --------- 4 --------- 4 --------- 4 --------- 4 480

GKKTKKEQKTAHFLPMAIT *

184 188

KGF AN8 / C (15) S

5 '-ATGGCTACTAATGTTAACTCCTCTTCTCCTGAACGTCATACGCGTTCCTACGACTACATG --------- + --------- + --------- + --------- + ------ --- 4 ---------- ₊ him

MATNVNSSSPERHTRSYDYM

-GAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACCCAGTGGTACCTGCGTATC --------- ₊ --------- ₊ --------- + --------- + -------- - ₊ --------- ₊ 420

EGGDIRVRRLFCRTQWYLRI

-GACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAAACAACTACAATATTATGGAA ---------- 1 ----------- | ----------- | ----------- 1. --------- 4 .--------- 4. 130

DKRGKVKGTQEMKNNYNIME

-ATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTTGAATCTGAATTCTACCTG --------- 4 .--------- ₊ --------- 4 .--------- 4 .----- ---- 4 .--------- 4. 240

IRTVAVGIVAIKGVESEFYL

-GCAATGAACAAAGAAGGTAAACTGTACGCAAAAAAAGAATGCAACGAAGACTGCAACTTC --------- 4 .--------- 4 .--------- 4 .--------- 4 .---- ----- 4 ---------- 4. 300

AMNKEGKLYAKKECNEDCNF

-AAAGAACTGATCCTGGAAAACCACTACAACACCTACGCATCTGCTAAATGGACCCACAAC --------- 4 .--------- 4 .--------- ₊ --------- 4 .----- ---- 4 .--------- 4. 360

KELILENHYNTYASAKWTHN

-GGTGGTGAAATGTTCGTTGCTCTGAACCAGAAAGGTATCCCGGTTCGTGGTAAAAAAACC --------- 4 ----------- 1 ----------- j .--------- 4 .-- ------- 4 ----------- 1- 420

GGEMFVALNQKGIPVRGKKT

-AAAAAAGAACAGAAAACCGCTCACTTCCTGCCGATGGCAATCACTTAA-3 *

--------- 4 .--------- 4 .--------- + --------- + -------- 468

KKEQKTAHFLPMAIT *

184 188

KGF AN8 / C155 * -ATGGCTACTAATGTTAACTCTTCTCCTGAACGTCATACGCGTTCCTACGACTACATGGAA ---------- + --------- + --------- + ---------- I- --------- 4 ---------- 4- 0Q

MATNVNSSPERHTRSYDYME

-GGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACCCAGTGGTACCTGCGTATCGAC ---------- μ --------- 4 .--------- 4 .--------- 4 .---- ----- 4 .--------- 4. 120

GGDIRVRRLFCRTQWYLRID

-AAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAAACAACTACAATATTATGGAAATC --------- 4 .--------- 4 .--------- 4 .--------- 4 .---- ----- 4 .--------- + Igo

KRGKVKGTQEMKNNYNIMEI

-CGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTTGAATCTGAATTCTACCTGGCA --------- 4 .--------- 4 .--------- 4 .--------- 4 ----- ----- 4 .--------- 4. 240

RTVAVGIVAIKGVESEFYLA

-ATGAACAAAGAAGGTAAACTGTACGCAAAAAAAGAATGCAACGAAGACTGCAACTTCAAA --------- 4 .--------- 4 .--------- ₊ --------- 4 ------ --- 4 --------- 4 300

MNKEGKLYAKKECNEDCNFK

-GAACTGATCCTGGAAAACCACTACAACACCTACGCATCTGCTAAATGGACCCACAACGGT --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 300

ELILENHYNTYASAKWTHNG

-GGTGAAATGTTCGTTGCTCTGAACCAGAAAGGTATCCCGGTTCGTGGTAAAAAAACCAAA --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 420

GEMFVALNQKGIPVRGKKTK

-AAAGAACAGAAAACCGCTCACTTCCTGCCGATGGCAATCACTTAA-3 '

--------- 4 --------- 4 --------- 4 --------- 4 ----- 405

KEQKTAHFLPMAIT *

184 188

KGF ΔΝ15

5-ATGTCTTCTCCTGAACGTCATACGCGTTCCTACGACTACATGGAAGGTGGTGACATCCGC --------- ₊ --------- 4 --------- + --------- 4 ------- --4 --------- _{+ 60}

MSSPERHTRSYDYMEGGDIR

-GTACGTCGTCTGTTCTGCCGTACCCAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTC --------- j ---------- 4 --------- 4 --------- 4 ------- --- 4 --------- 4 120

VRRLFCRTQWYLRIDKRGKV

-AAGGGCACCCAAGAGATGAAAAACAACTACAATATTATGGAAATCCGTACTGTTGCTGTT --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 180

KGTQEMKNNYNIMEIRTVAV

-GGTATCGTTGCAATCAAAGGTGTTGAATCTGAATTCTACCTGGCAATGAACAAAGAAGGT --------- 4 ---------- (.--------- 4 --------- 4 ------ --- 4 --------- 4 240

GIVAIKGVESEFYLAMNKEG

-AAACTGTACGCAAAAAAAGAATGCAACGAAGACTGCAACTTCAAAGAACTGATCCTGGAA --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 300

KLYAKKECNEDCNFKELILE

-AACCACTACAACACCTACGCATCTGCTAAATGGACCCACAACGGTGGTGAAATGTTCGTT --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 360

NHYNTYASAKWTHNGGEMFV

-GCTCTGAACCAGAAAGGTATCCCGGTTCGTGGTAAAAAAACCAAAAAAGAACAGAAAACC --------- 4 --------- 4 --------- ₊ --------- 4 --------- -4 --------- 4 420

ALNQKGIPVRGKKTKKEQKT

-GCTCACTTCCTGCCGATGGCAATCACTTAA-3 '

--------- 4 --------- 4 --------- 4 450

AHFLPMAIT *

184 188

FIG. 13

KGF ΔΝ16 '-ATGTCTCCTGAACGTCATACGCGTTCCTACGACTACATGGAAGGTGGTGACATCCGCGTA --------- ₊ --------- ₊ --------- + --------- + ----- ---- + --------- + ₆₀

MSPERHTRSYDYMEGGDI RV

-CGTCGTCTGTTCTGCCGTACCCAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAG --------- ₊ --------- + --------- + --------- + -------- - + --------- + ₁₂ 0

RRLFCRTQWYLRIDKRGKVK

-GGCACCCAAGAGATGAAAAACAACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGT --------- + --------- + --------- + --------- + -------- - ₊ --------- +] _gQ

GTQEMKNNYNIMEIRTVAVG

-ATCGTTGCAATCAAAGGTGTTGAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAA --------- ₊ --------- ₊ --------- ₊ --------- ₊ -------- - + --------- ₊ 240

IVAIKGVESEFYLAMWKEGK

-CTGTACGCAAAAAAAGAATGCAACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAAC --------- ₊ --------- ₊ --------- ₊ --------- ₊ -------- - ₊ --------- + 30θ

LYAKKECNEDCNFKELILEN

-CACTACAACACCTACGCATCTGCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCT --------- ₊ --------- ₊ --------- + --------- ₊ -------- - ₊ --------- ₊ 36Q

HYNTYASAKWTHNGGEMFVA

-CTGAACCAGAAAGGTATCCCGGTTCGTGGTAAAAAAACCAAAAAAGAACAGAAAACCGCT --------- ₊ --------- ₊ --------- + --------- + -------- - ₊ --------- ₊ 420

LNQKGIPVRGKKTKKEQKTA

-CACTTCCTGCCGATGGCAATCACTTAA-3 '

--------- + --------- + ------- 447

HFLPMAIT *

184 188

FIG "I 4

KGF ΔΝΧ7

5 '-ATGCCTGAACGTCATACGCGTTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGT --------- 4 ---------- 4 ---------- j .--------- 4 --- ------ 4 ---------- 4 gQ

MPERHTRSYDYMEGGDIRVR

-CGTCTGTTCTGCCGTACCCAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGC --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 ---------- 4 120

RLFCRTQWYLRIDKRGKVKG

-ACCCAAGAGATGAAAAACAACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATC ---------- p --------- 4 --------- 4 ---------- 1 ------ ---- 4 ----------- H 180

TQEMKNNYNIMEIRTVAVGI

-GTTGCAATCAAAGGTGTTGAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTG --------- 4 --------- ₊ --------- 4 --------- 4 -------- -4 --------- 4 240

VAIKGVESEFYLAMNKEGKL

-TACGCAAAAAAAGAATGCAACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCAC --------- ₊ --------- ₊ --------- ₊ --------- 4 -------- -4 --------- 4 300

YAKKECNEDCNFKELILENH

-TACAACACCTACGCATCTGCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTG --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 360

YNTYASAKWTHNGGEMFVAL

-AACCAGAAAGGTATCCCGGTTCGTGGTAAAAAAACCAAAAAAGAACAGAAAACCGCTCAC --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 420

NQKGIPVRGKKTKKEQKTAH

-TTCCTGCCGATGGCAATCACTTAA-3 '

--------- + --------- + ---- 444

FLPMAIT *

184 188

KGF ΔΝΧ3 '-ATGGAACGTCATACGCGTTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGT --------- + --------- + --------- + --------- + ----- ---- + --------- + gQ

MERHTRSYDYMEGGDIRVRR

-CTGTTCTGCCGTACCCAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACC --------- + --------- + --------- + --------- + -------- - + --------- + 220

LFCRTQWYLRIDKRGKVKGT

-CAAGAGATGAAAAACAACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTT --------- + --------- + --------- + --------- ₊ -------- - ₊ --------- ₊ 280

QEMKNNYNIMEIRTVAVGIV

-GCAATCAAAGGTGTTGAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTAC --------- ₊ --------- ₊ --------- ₊ --------- + -------- - ₊ --------- ₊ 240

AIKGVESEFYLAMNKEGKLiY

-GCAAAAAAAGAATGCAACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTAC --------- + --------- + --------- + --------- + -------- - + --------- + 300

AKKECNEDCNFKELILENHY

-AACACCTACGCATCTGCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAAC --------- ₊ --------- + --------- + --------- ₊ -------- - + --------- + 300

NTYASAKWTHNGGEMFVALN

-CAGAAAGGTATCCCGGTTCGTGGTAAAAAAACCAAAAAAGAACAGAAAACCGCTCACTTC --------- + --------- + --------- ₊ --------- + -------- - + --------- + 420

QKGIPVRGKKTKKEQKTAHF

-CTGCCGATGGCAATCACTTAA-3 '

--------- ₊ --------- + - 442

L P Μ A I T *

184 188

F5 G »115

KGF ΔΝ19 '-ATGCGTCATACGCGTTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTG --------- 4 --------- + --------- + --------- 4 ----- ---- 4 --------- 4 0Q

MRHTRSYDYMEGGDIRVRRL

-TTCTGCCGTACCCAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAA ---------- 1 ---------- 4 --------- 4 --------- 4 ------ --- 4 ---------- μ 120

FCRTQWYLRIDKRGKVKGTQ

-GAGATGAAAAACAACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCA ----------, ----------- 1 ----------- | ---------- 4-- --------- 1 ----------- μ 130

EMKNNYNIMEIRTVAVGIVA

-ATCAAAGGTGTTGAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCA --------- 4 --------- 4 --------- 4 --------- 4 -------- - + --------- 4 240

IKGVESEFYLAMNKEGKLYA

-AAAAAAGAATGCAACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAAC --------- 4 --------- 4 --------- 4 --------- ₊ -------- -4 --------- ₊ 300

KKECNEDCNFKELILENHYN

-ACCTACGCATCTGCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAG --------- ₊ --------- 4 --------- 4 --------- 4 -------- -4 --------- ₊ 300

TYASAKWTHNGGEMFVALNQ

-AAAGGTATCCCGGTTCGTGGTAAAAAAACCAAAAAAGAACAGAAAACCGCTCACTTCCTG --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 420

KGIPVRGKKTKKEQKTAHFL

-CCGATGGCAATCACTTAA-3 '

--------- + -------- 438

P Μ A I T *

184 188

FIG.I7

KGF ΔΝ20

5 '-ATGCATACTCGTTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTC ---- ----- 4 .--------- 4 .--------- 4 .--------- 4 .-- ---. — .-- 4 .--------- 4. gQ

MHTRSYDYMEGGDIRVRRLF

-TGCCGTACCCAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAG --------- 4 .--------- 4 .--------- 4 .--------- 4 .---- ----- 4 .--------- 4. 220

CRTQWYLRIDKRGKVKGTQE

-ATGAAAAACAACTACAATATTATGGAAATCCGTACIOTTGCTGTTGGTATCGTTGCAATC --------- 4 ----------- j .--------- 4 .----------, --- ------- 4 .---------- j. I80

MKNNYNIMEIRTVAVGIVAI

-AAAGGTGTTGAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCAAAA --------- 4 .--------- 4 .--------- 4 .--------- 4 .---- ----- 4 .--------- 4. 240

KGVESEFYLAMNKEGKLYAK

-AAAGAATGCAACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACC --------- 4 .--------- 4 .--------- 4 .--------- 4 .---- ----- 4 .--------- 4. 300

KECNEDCNFKELILENHYNT

-TACGCATCTGCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAA --------- 4 .--------- 4 .--------- 4 .--------- 4 .---- ----- 4 .--------- 4. 3rd

YASAKWTHNGGEMFVALNQK

-GGTATCCCGGTTCGTGGTAAAAAAACCAAAAAAGAACAGAAAACCGCTCACTTCCTGCCG --------- 4 .--------- 4 .--------- 4 .--------- 4 .---- ----- 4 .--------- 4. 420

GIPVRGKKTKKEQKTAHFLP

-ATGGCAATCACTTAA-3 '

--------- 4 .----- 435

Μ A I T *

184 188

KGF ΔΝ21

5 '-ATGACTCGTTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGC --------- 4 --------- 4 --------- 4 --------- 4 ------ --- 4 --------- 4 gO

MTRSYDYMEGGDIRVRRLFC

-CGTACCCAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATG --------- 4 --------- 4 ---------- j .---------- 1 ----- ----- 4 --------- 4 120

RTQWYLRIDKRGKVKGTQEM

-AAAAACAACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAA --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 130

KNNYNIMEIRTVAVGIVAIK

-GGTGTTGAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCAAAAAAA --------- 4 --------- 4 --------- ₊ --------- 4 --------- -4 --------- 4 240

GVESEFYLAMNKEGKLYAKK

-GAATGCAACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACCTAC --------- 4 --------- ₊ --------- 4 --------- ₊ -------- - ₊ --------- 4 300

ECNEDCŃFKELILENHYNTY

-GCATCTGCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAAGGT ---------- I ---------- 4 ---------- 1 ----------- j --- -------- 1 ---------- 4 360

ASAKWTHNGGEMFVALNQKG

-ATCCCGGTTCGTGGTAAAAAAACCAAAAAAGAACAGAAAACCGCTCACTTCCTGCCGATG --------- 4 --------- 4 --------- 4 --------- 4 -------- --μ --------- 4 420

IPVRGKKTKKEQKTAHFLPM

-GCAATCACTTAA-3 '

--------- + __ 432

A AND T *

184 188

KGF ΔΝ22

5 '-ATGCGTTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGT --------- ₊ --------- ₊ --------- ₊ --------- ₊ ------ --- ₊ --------- ₊ it

MRSYDYMEGGDIRVRRLFCR

-ACCCAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAA --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4] _20

TQWYLRIDKRGKVKGTQEMK

-AACAACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGT --------- 4 --------- 4 --------- 4 --------- 4 -------- --4 ---------- 4 180

NNYNIMEIRTVAVGIVAIKG

-GTTGAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCAAAAAAAGAA --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 240

VESEFYLAMNKEGKLYAKKE

-TGCAACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACCTACGCA --------- ₊ --------- 4 --------- ₊ --------- 4 -------- - ₊ --------- 4 300

CNEDCNFKELILENHYNTYA

-TCTGCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAAGGTATC --------- 4 --------- 4 --------- ₊ --------- 4 -------- - ₊ --------- 4 360

SAKWTHNGGEMFVALNQKGI

-CCGGTTCGTGGTAAAAAAACCAAAAAAGAACAGAAAACCGCTCACTTCCTGCCGATGGCA --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 420

PVRGKKTKKEQKTAHFLPMA

-ATCACTTAA-3 '

--------- 429

And T.

184 188

FSG.20

KGF ΔΝ23 '-ATGTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACC --------- ₊ --------- ₊ --------- ₊ --------- ₊ ----- ---- ₊ --------- ₊ οθ

MSYDYMEGGDIRVRRLFCRT

-CAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAAAC --------- ₊ --------- ₊ --------- + --------- + -------- - ₊ --------- ₊ 120

QWYLRIDKRGKVKGTQEMKN

-AACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTT --------- ₊ --------- ₊ --------- 4 --------- 4 -------- -4 --------- 4 180

NYNIMEIRTVAVGIVAIKGV

-GAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCAAAAAAAGAATGC ---------- 1 ----------- 1 ----------- 1 ---------- 4-- -------- μ ---------- μ 240

ESEFYLAMNKEGKLYAKKEC

-AACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACCTACGCATCT --------- ₊ --------- 4 --------- 4 --------- 4 -------- -4 --------- ₊ 300

NEDCNFKELILENHYNTYAS

-GCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAAGGTATCCCG --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 300

AKWTHNGGEMFVALNQKGIP

-GTTCGTGGTAAAAAAACCAAAAAAGAACAGAAAACCGCTCACTTCCTGCCGATGGCAATC --------- 4 ------------------- 4 --------- 4 -------- -j ---------- 4,420

VRGKKTKKEQKTAHFLPMAI

-ACTTAA-3 '

------ 420

184 188

KGF ΔΝ24 '-ATGTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACCCAG --------- + --------- + --------- + --------- ₊ ----- ---- 4 --------- 4 ₆ Q

MYDYMEGGDIRVRRLFCRTQ

-TGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAACAAC --------- 4 --------- + --------- + --------- + -------- -4 --------- + 120

WYLRIDKRGKVKGTQEMKNN

-TACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTTGAA --------- 4 --------- 4 --------- + --------- + -------- - + --------- 4 180

YNIMEIRTVAVGIVAIKGVE

-TCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCAAAAAAAGAATGCAAC --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 240

SEFYLAMNKEGKLYAKKECN

-GAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACCTACGCATCTGCT --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 300

EDCNFKELILENHYNTYASA

-AAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAAGGTATCCCGGTT --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 350

KWTHNGGEMFVALNQKG I P V

-CGTGGTAAAAAAACCAAAAAAGAACAGAAAACCGCTCACTTCCTGCCGATGGCAATCACT --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 420

RGKKTKKEQKTAHFLPMAIT

-TAA-3 '

--- 423

184 188

KGF C (1,15) S / R (144) E '-ATGTCTAATGATATGACTCCGGAACAGATGGCTACCAACGTTAACTCCTCCTCCCCGGAA --------- ₊ --------- + --------- + --- ------ + --------- + --------- _{+ 60}

MSNDMTPEQMATNVNSSSPE

-CGTCACACGCGTTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTC --------- + --------- + --------- ₊ --------- ₊ -------- - + --------- + ₁₂₀

RHTRSYDYMEGGDIRVRRLF

-TGCCGTACCCAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAG --------- ₊ --------- + --------- ₊ --------- ₊ -------- - ₊ --------- + igQ

CRTQWYLRIDKRGKVKGTQE

-ATGAAAAACAACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATC --------- ₊ --------- ₊ --------- ₊ --------- ₊ -------- - ₊ --------- ₊ 240

MKNNYNIMEIRTVAVGIVAI

-AAAGGTGTTGAATCTGAATTCTATCTTGCAATGAACAAGGAAGGAAAACTCTATGCAAAG --------- ₊ --------- ₊ --------- + --------- ₊ -------- - ₊ --------- + 300

KGVESEFYLAMNKEGKLYAK

-AAAGAATGCAATGAAGATTGTAACTTCAAAGAACTAATTCTGGAAAACCATTACAACACA --------- ₊ --------- ₊ --------- ₊ --------- ₊ -------- - ₊ --------- ₊ 360

KECNEDCNFKELILENHYNT

-TATGCATCTGCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAA --------- 4 ---------- f ---------- 1 ---------- + ----- ----- 1 ---------- 4. 420

YASAKWTHNGGEMFVALNQK

-GGTATCCCTGTTGAAGGTAAGAAAACCAAGAAAGAACAGAAAACCGCTCACTTCCTGCCG --------- ₊ --------- + --------- ₊ --------- ₊ -------- - + --------- + 4th

GIPVEGKKTKKEQKTAHFLP

-ATGGCAATCACTTAA-3 '

--------- + ----- 495

Μ A I T *

184 188

KGF C (X, 15) S / R <144) Q '-ATGTCTAATGATATGACTCCGGAACAGATGGCTACCAACGTTAACTCCTCCTCCCCGGAA --------- + ------------------ + ---- ----- 4 ---------- 4 .--------- 4. gQ

MSNDMTPEQMATNVNSSSPE

-CGTCACACGCGTTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTC --------- 4 ---------- 4 ---------- 4 ---------- 4 ----- ----- 4 .--------- 4. 120

RHTRSYDYMEGGDIRVRRLF

-TGCCGTACCCAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAG --------- 4 .--------- 4 .--------- 4 .--------- 4 .---- ----- 4 .--------- 4. igo

CRTQWYLRIDKRGKVKGTQE

-ATGAAAAACAACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATC --------- 4 .--------- 4 .--------- 4 .--------- 4 .---- ----- 4 .--------- 4. 240

MKNNYNIMEIRTVAVGIVAI

-AAAGGTGTTGAATCTGAATTCTATCTTGCAATGAACAAGGAAGGAAAACTCTATGCAAAG --------- 4 .--------- 4 ---------- 4 ---------- 4 .---- ----- 4 .--------- 4. 300

KGVESEFYLAMNKEGKLYAK

-AAAGAATGCAATGAAGATTGTAACTTCAAAGAACTAATTCTGGAAAACCATTACAACACA --------- 4 .--------- ₊ --------- 4 .--------- + ------ --- 4 .--------- 4. 3gQ

KECNEDCNFKELILENHYNT

-TATGCATCTGCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAA --------- 4 .--------- 4 .--------- 4 .--------- 4 .---- ----- 4 .--------- 4. 420

YASAKWTHNGGEMFVALNQK

-GGTATCCCTGTTCAAGGTAAGAAAACCAAGAAAGAACAGAAAACCGCTCACTTCCTGCCG --------- 4 .--------- 4 ---------- 4 ---------- + ----- ---- 4 .--------- 4. 480

Gl PVQGKKTKKEQKTAHFLP

-ATGGCAATCACTTAA-3 '

--------- + ----- 495

Μ A I T *

184 188

FIG. 24

KGF AN23 / R (144) Q

5 '-ATGTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACC --------- 4 --------- 4 --------- 4 --------- 4 ------ ---- 4 --------- 4 6Q

MSYDYMEGGDIRVRRLFCRT

-CAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAAAC --------- + --------- + --------- 4 --------- 4 -------- -4 --------- + 120

QWYLRIDKRGKVKGTQEMKN

-AACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTT --------- j ---------- 4 ---------- 1 ----------- 1 ---- ------- 1 ----------- 1- 180

NYNIMEIRTVAVGIVAIKGV

-GAATCTGAATTCTATCTTGCAATGAACAAGGAAGGAAAACTCTATGCAAAGAAAGAATGC --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 240

ESEFYLAMNKEGKLYAKKEC-AATGAAGATTGTAACTTCAAAGAACTAATTCTGGAAAACCATTACAACACATATGCATCT --------- 4 --------- ₊ --------- 4 --------- 4 ------- --4 --------- 4 300

NEDCNFKELILENHYNTYAS

-GCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAAGGTATCCCT --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 360

AKWTHNGGEMFVALNQKGIP

-GTTCAAGGTAAGAAAACCAAGAAAGAACAGAAAACCGCTCACTTCCTGCCGATGGCAATC --------- 4 --------- 4 --------- 4 --------- 4 -------- -4 --------- 4 420

VQGKKTKKEQKTAHFLPMAI

-ACTTAA-3 '

------ 426

184 188

LL

Ο χ:

ω

ί)

Ο

LL

Ο

184 188

is η

(κ ίΖ:

β • Η

Ν

Ό • ri

C.

Μ <U ca ο

Ή οι

0)

0 «ω

ίη> »β

• Η

Ν τι φ

• Η

C.

Λ

Μ

Ο

Μ

IN

Ο

Ή i

CO *** »m

184 188

residual soluble KGF

Incubation time at 37 * C (days)

184 188

apparent (° C)

ss KGF C (1.15) S / R (144) E * KGF C (1.15) S / R (144) Q O KGF C (1.15) S ArhKGF

184 188

CPM

I-1

-3.00

®— rhKGF c— KGFC (1.15) S

184 188

log ng / well fi— rhKGF o— KGFAN15

184 188

FIG. 31

log ng / cavity "- rhKGF o— KGF ΔΝ23

184 188

log ng / basin © no rhKGF o— KGF AN23 / R (144) Q

184 188

log ng / cavity «- rhKGF o— KGF C (1,15) S / R (144) Q

184 188

log ng / cavities ©

0-rhKGF o— KGF C (1.15) S / R (144) E

184 188

KGFC (1.15) S A KGFAN15 γ KGF ΔΝ23

CHO

184 188

FIG. 36

KGF cfL, X5.40) s

5 '-CTAGAAGGAGGAATAACATATGTCTAATGATATGACTCCGGAACAGATGGCTACCAACGT

--------- ₊ --------- 4 --------- ₊ --------- 4 --------- ₊ --------- _{+ 6θ}

MSNDMTPEQMATNV

TAACTCCTCCTCCCCGGAACGTCACACGCGTTCCTACGACTACATGGAAGGTGGTGACAT

--------- 4 --------- 4 --------- 4 --------- 4 --------- ₊ --------- ₊ 120

NSSSPERHTRSYDYMEGGDI

CCGCGTACGCCGTTTGTTCTCTCGTACCCAGTGGTACCTGCGTATCGACAAACGCGGCAA

--------- 4 --------- 4 --------- + --------- 4 --------- 4 --------- 4 180

RVRRLFSRTQWYLRIDKRGK

AGTCAAGGGCACCCAAGAGATGAAAAACAACTACAATATTATGGAAATCCGTACTGTTGC

--------- 4 --------- 4 --------- 4 --------- 4 --------- 4 --------- 4 240

VKGTQEMKNNYNIMEIRTVA

TGTTGGTATCGTTGCAATCAAAGGTGTTGAATCTGAATTCTATCTTGCAATGAACAAGGA

--------- 4 --------- 4 --------- 4 --------- 4 --------- 4 --------- 4 300

VGIVAIKGVESEFYLAMNKE

AGGAAAACTCTATGCAAAGAAAGAATGCAATGAAGATTGTAACTTCAAAGAACTAATTCT

--------- + --------- 4 --------- 4 --------- 4 --------- 4 --------- + 300

GKLYAKKECNEDCNFKELIL

GGAAAACCATTACAACACATATGCATCAGCTAAATGGACACACAACGGAGGGGAAATGTT --------- 4 --------- 4 --------- 4 --------- 4 --------- 4 --------- ₊ 420

ENHYNTYASAKWTHNGGEMF

TGTTGCCTTAAATCAAAAGGGGATTCCTGTAAGAGGAAAAAAAACGAAGAAAGAACAAAA --------- 4 --------- 4 --------- 4 --------- 4 --------- 4 --------- 4 480

VALNQKGIPVRGKKTKKEQK

AACAGCCCACTTTCTTCCTATGGCAATAACTTAATAG-3 '

--- 4 ----- + --------- 4 --------- 4 --------- 4- 521

TAHFLPMAIT * *

184 188

KGF C |, 15.102 ^

5 '-CTAGAAGGAGGAATAACATATGTCTAATGATATGACTCCGGAACAGATGGCTACCAACGT

--------- 4 --------- 4 --------- + --------- 4 --------- 4 --------- 4 gQ

MSNDMTPEQMATNV

TAACTCCTCCTCCCCGGAACGTCACACGCGTTCCTACGACTACATGGAAGGTGGTGACAT

--------- 4 --------- 4 --------- 4 --------- 4 --------- 4 --------- 4 120

NSSSPERHTRSYDYMEGGDI

CCGCGTACGTCGTCTGTTCTGCCGTACCCAGTGGTACCTGCGTATCGACAAACGCGGCAA

--------- 4 --------- 4 --------- 4 --------- 4 --------- 4 ---------- l · Igo

RVRRLFCRTQWYLRIDKRGK

AGTCAAGGGCACCCAAGAGATGAAAAACAACTACAATATTATGGAAATCCGTACTGTTGC

--------- 4 --------- 4 --------- 4 --------- 4 --------- 4 --------- 4 240

VKGTQEMKNNYNIMEIRTVA

TGTTGGTATCGTTGCAATCAAAGGTGTTGAATCTGAATTCTACCTGGCTATGAACAAAGA

--------- + --------- + --------- 4 --------- 4 --------- 4 --------- 4 300

VGIVAIKGVESEFYLAMNKE

AGGTAAACTGTACGCTAAAAAAGAATCCAATGAAGATTGTAACTTCAAAGAACTAATTCT --------- 4 --------- ₊ --------- 4 --------- ₊ --------- 4 --------- 4 360

GKLYAKKESNEDCNFKELIL

GGAAAACCATTACAACACATATGCATCAGCTAAATGGACACACAACGGAGGGGAAATGTT

--------- 4 --------- 4 --------- 4 --------- 4 --------- 4 --------- 4 420

EN-HYNTYASAKWTHNGGEMF

TGTTGCCTTAAATCAAAAGGGGATTCCTGTAAGAGGAAAAAAAACGAAGAAAGAACAAAA

--------- 4 --------- 4 --------- 4 --------- 4 --------- 4 --------- 4 480

VALNQKGIPVRGKKTKKEQK

AACAGCCCACTTTCTTCCTATGGCAATAACTTAATAG-3 *

--------- 4 ----------- 1 ----------- (----------- 521

TAHFLPMAIT * *

184 188

KGF C &, 15, X02.10 $ S '-CTAGAAGGAGGAATAACATATGTCTAATGATATGACTCCGGAACAGATGGCTACCAACGT --------- ₊ --------- ₊ --------- + ------- - + --------- + --------- _{+ 6θ}

MSNDMTPEQMATNV

TAACTCCTCCTCCCCGGAACGTCACACGCGTTCCTACGACTACATGGAAGGTGGTGACAT

--------- ₊ --------- ₊ --------- ₊ --------- + --------- + --------- + ₁₂ q

NSSSPERHTRSYDYMEGGDI

CCGCGTACGTCGTCTGTTCTGCCGTACCCAGTGGTACCTGCGTATCGACAAACGCGGCAA

--------- ₊ --------- ₊ --------- + --------- ₊ --------- + --------- ₊ 280

RVRRLFCRTQWYLRIDKRGK

AGTCAAGGGCACCCAAGAGATGAAAAACAACTACAATATTATGGAAATCCGTACTGTTGC

--------- + --------- ₊ --------- ₊ --------- ₊ --------- ₊ --------- ₊ 240

VKGTQEMKNNYNIMEIRTVA

TGTTGGTATCGTTGCAATCAAAGGTGTTGAATCTGAATTCTACCTGGCTATGAACAAAGA

--------- ₊ --------- ₊ --------- + --------- ₊ --------- ₊ --------- + 3QQ

VGIVAIKGVESEFYLAMNKE

AGGTAAACTGTACGCTAAAAAAGAATCCAATGAAGATTCTAACTTCAAAGAACTAATTCT --------- ₊ --------- + --------- + --------- + --------- + --------- ₊ 360

GKLYAKKESNEDSNFKELIL

GGAAAACCATTACAACACATATGCATCAGCTAAATGGACACACAACGGAGGGGAAATGTT --------- ₊ --------- + --------- ₊ --------- ₊ --------- ₊ --------- ₊ 420

ENHYNTYASAKWTHNGGEMF

TGTTGCCTTAAATCAAAAGGGGATTCCTGTAAGAGGAAAAAAAACGAAGAAAGAACAAAA ---------- 1 -----------) ----------- 1 ----------- 1-- --------- 1 ----------- f- 480

VALNQKGIPVRGKKTKKEQK

AACAGCCCACTTTCTTCCTATGGCAATAACTTAATAG-3 '

--------- ₊ --------- + --------- + --------- ₊ _ 522

TAHFLPMAIT * *

184 188

FIG. 39

ΔΝ23 / Ν (137) Ε

5 '-ATGTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACC4 --------- + --------- + --------- + --------- ₊ ------ --- 4 --------- g ₀

MSYDYMEGGDIRVRRLFCRT-CAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAAAC4 --------- 4 --------- 4 --------- + --------- 4 ------- --4 --------- 120

QWYLRIDKRGKVKGTQEMKN-AACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTT4 --------- 4 --------- 4 --------- 4 --------- + ------- --4 --------- 180

NYNIMEIRTVAVGIVAIKGV-GAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCAAAAAAAGAATGC4 ---------- 4 ---------- 4 ----------- μ ---------- 1-- --------- 1 ---------- 240

ESEFYLAMNKEGKLYAKKEC-AACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACCTACGCATCT4 --------- 4 --------- 4 --------- 4 --------- 4 ------- --4 --------- 300

NEDCNFKELILENHYNTYAS-GCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGGAACAGAAAGGTATCCCT + --------- 4 --------- 4 --------- 4 --------- 4 ------- --4 --------- 360

AKWTHNGGEMFVALEQKGIP-GTTCGTGGTAAGAAAACCAAGAAAGAACAGAAAACCGCTCACTTCCTGCCGATGGCAATC4 --------- 4 --------- 4 --------- 4 --------- 4 ------- - + --------- 420

VRGKKTKKEQKTAHFLPMAI -ACTTAA-3 '+ ----- 426 rp *

184 188

ΔΝ23 / Κ (139) Ε

5 '-ATGTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACC + --------- ί ---------- + --------- + --------- + ----- ---- + --------- 60

MSYDYMEGGDIRVRRLFCRT-CAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAAAC + --------- + --------- + --------- + --------- 4 ------ --- + --------- 120

QWYLRIDKRGKVKGTQEMKN-AACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTT4 --------- 4 --------- 4 --------- 4 --------- ₊ ------- - ₊ --------- 13Q

NYNIMEIRTVAVGIVAIKGV-GAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCAAAAAAAGAATGC4 --------- 4 --------- 4 --------- 4 --------- 4 ------- --4 --------- 240

ESEFYLAMNKEGKLYAKKEC -AACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACCTACGCATCT

4 --------- ₊ --------- ₊ --------- 4 --------- ₊ --------- 4 --------- 300

NEDCNFKELILENHYNTYAS -GCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGGAAGGTATCCCT4 --------- 4 --------- 4 --------- 4 --------- 4 ------- --4 --------- 360

AKWTHNGGEMFVALNQEGIP -GTTCGTGGTAAGAAAACCAAGAAAGAACAGAAAACCGCTCACTTCCTGCCGATGGCAATC ₊ --------- ₊ --------- 4 --------- 4 --------- 4 ------ --- 4 --------- 420

VRGKKTKKEQKTAHFLPMAI -ACTTAA-3 '+ ----- 426

T *

184 188

FI (5.48 ńN23 / K (139) Q

5 '-ATGTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACC ₊ --------- + --------- + --------- ₊ --------- + ----- ---- ₊ --------- ₆₀

MSYDYMEGGDIRVRRLFCRT-CAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAAAC ₊ --------- + --------- ₊ --------- ₊ --------- ₊ ------ --- ₊ --------- i20

QWYLRIDKRGKVKGTQEMKN-AACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTT ₊ --------- ₊ --------- ₊ --------- ₊ --------- ₊ ------ --- ₊ --------- Igo

NYNIMEIRTVAVGIVAIKGV-GAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCAAAAAAAGAATGC + --------- ₊ --------- ₊ --------- ₊ --------- ₊ ------- - ₊ --------- 240

ESEFYLAMNKEGKLYAKKEC-AACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACCTACGCATCT + --------- + --------- ₊ --------- ₊ --------- ₊ ------- - ₊ ------, - 300

NEDCNFKELILENHYNTYAS-GCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGCAAGGTATCCCT + --------- ₊ --------- + --------- ₊ --------- ₊ ------- --4 ---------- 360

AKWTHNGGEMFVALNQQGI P -GTTCGTGGTAAGAAAACCAAGAAAGAACAGAAAACCGCTCACTTCCTGCCGATGGCAATC4 ---------- 4 ---------- 4 ---------- 4 .--------- 4-- -------- 4 ---------- 420

VRGKKTKKEQKTAHFLPMAI -ACTTAA-3 '

4 ------ 426

T *

184 188

AN23 / R (144) A '-ATGTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACC + --------- + --------- 4 --------- 4 --------- 4 --------- 4 --------- 60

MSYDYMEGGDIRVRRLFCRT-CAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAAAC + --------- + --------- 4 --------- 4 --------- 4 ------- --4 --------- 120

QWYLRIDKRGKVKGTQEMKN-AACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTT + --------- + --------- + --------- 4 --------- + ------- --4 --------- 180

NYNIMEIRTVAVGIVAIKGV-GAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCAAAAAAAGAATGCESEFYLAMNKEGKLYAKKEC-AACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACCTACGCATCT4 --------- + --------- ₊ --------- --------- 4 4 ----- ---- 4 --------- 300

NEDCNFKELILENHYNTYAS -GCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAAGGTATCCCT4 --------- ₊ --------- 4 --------- 4 --------- ₊ ------- --4 --------- 360

AKWTHNGGEMFVALNQKG IP -GTTGCTGGTAAGAAAACCAAGAAAGAACAGAAAACCGCTCACTTCCTGCCGATGGCAATC4 --------- 4 --------- 4 --------- 4 --------- 4 ------ --- 4 --------- 420

VAGKKTKKEQKTAHFLPMAI-ACTTAA-3 '

4 ----- 426 rp »

184 188 ńN23 / R (144) E

5 '-ATGTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACC + --------- 4 --------- + ---------- μ --------- 4 ----- ---- 4 --------- 00

MSYDYMEGGDIRVRRLFCRT-CAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAAAC4 --------- 4 --------- 4 --------- 4 --------- 4 ------- --4 --------- 120

QWYLRIDKRGKVKGTQEMKN-AACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTT4 --------- 4 --------- 4 --------- 4 --------- 4 ------- --4 --------- 180

NYN IMEIRTVAVGIVAIKGV-GAATCTGAATTCTATCTTGCAATGAACAAGGAAGGAAAACTCTATGCAAAGAAAGAATGC ₊ --------- 4 --------- 4 --------- 4 --------- 4 ----- ---- 4 --------- 240

ESEFYLAMNKEGKLYAKKEC -AATGAAGATTGTAACTTCAAAGAACTAATTCTGGAAAACCATTACAACACATATGCATCT ₊ --------- 4 --------- 4 --------- 4 --------- ₊ ------ --- 4 --------- 300

NEDCNFKELILENHYNTYAS -GCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAAGGTATCCCT4 --------- 4 --------- 4 --------- 4 --------- 4 ------- --4 --------- 300

AKWTHNGGEMFVALNQKGIP -GTTGAAGGTAAGAAAACCAAGAAAGAACAGAAAACCGCTCACTTCCTGCCGATGGCAATC ₊ --------- ₊ --------- 4 --------- ₊ --------- 4 ------ --- 4 --------- 420

VEGKKTKKEQKTAHFLPMAI -ACTTAA-3 '+ ----- 420 ip *

184 188

FS G. 44

AN23 / R (144) L '-ATGTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACC + --------- + --------- ₊ --------- ₊ --------- ₊ --------- ₊ --------- go

MSYDYMEGGDIRVRRLFCRT-CAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAAAC + --------- + --------- ₊ --------- ₊ --------- + ------- - ₊ --------- 220

QWYLRIDKRGKVKGTQEMKN-AACTACAATAITATCGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTT + --------- + --------- + --------- + --------- + ------- - + --------- 280

NYNIMEIRTVAVGIVAIKGV-GAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCAAAAAAAGAATGC + --------- ₊ --------- + --------- + --------- + ------- - ₊ --------- 240

ESEFYLAMNKEGKLYAKKEC-AACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACCTACGCATCT + --------- + --------- ₊ --------- ₊ --------- + ------- - + --------- 3oo

NEDCNFKELILENHYNTYAS-GCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAAGGTATCCCT + --------- + --------- + --------- + --------- + ------- - + --------- 360

AKWTHNGGEMFVALNQKGIP-GTTCTGGGTAAGAAAACCAAGAAAGAACAGAAAACCGCTCACTTCCTGCCGATGGCAATC + --------- ₊ --------- + --------- + --------- + ------- - + --------- 420

VLGKKTKKEQKTAHFLPMAI-ACTTAA-3 '+ ----- 426 ip *

184 188

5 '-ATGTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACC + --------- ₊ --------- 4 --------- + --------- + ------ --- + --------- 60

MSYDYMEGGDIRVRRLFCRT-CAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAAAC4 --------- 4 --------- 4 --------- 4 --------- 4 ------- -.) ---------- 120

QWYLRIDKRGKVKGTQEMKN-AACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTT4 --------- 4 --------- 4 --------- 4 --------- 4 ------- --4 --------- 180

NYNIMEIRTVAVGIVAIKGV-GAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCAAAAAAAGAATGC4 --------- 4 --------- 4 --------- 4 --------- 4 ------- --4 --------- 240

ESEFYLAMNKEGKLYAKKEC -AACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACCTACGCATCT4 --------- 4 -----, --- 4 --------- 4 --------- 4 ------- --4 --------- 300

NEDCNFKELILENHYNTYAS-GCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAAGGTATTCCT4 --------- 4 --------- 4 --------- 4 --------- 4 ------- --4 --------- 360

AKWTHNGGEMFVALNQKGIP-GTTCGTGGTAAGGAAACCAAGAAAGAACAGAAAACCGCTCACTTCCTGCCGATGGCAATC4 --------- ₊ --------- 4 --------- 4 --------- ₊ ------- --4 --------- 420

VRGKETKKEQKTAHFLPMAI -ACTTAA-3 '+ ----- 426

T *

184 188

FIG. 46

AN23 / K (147) Q

5 '-ATGTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACC + --------- ₊ --------- + --------- 4 --------- 4 ------ --- 4 --------- ₆ Q

MSYDYMEGGDIRVRRLFCRT-CAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAAAC + --------- + --------- + --------- + --------- + ------- --4 --------- Χ20

QWYLRIDKRGKVKGTQEMKN-AACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTT + --------- 4 --------- + --------- + --------- 4 ------- --4 --------- 130

NYNIMEIRTVAVGIVAIKGV-GAATCTGAATTCTACCTGGCAATGAACAAAGAAGCTAAACTGTACGCAAAAAAAGAATGC ₊ --------- 4 --------- 4 --------- 4 --------- 4 ------ --- 4 --------- 240

ESEFYLAMNKEGKLYAKKEC-AACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACCTACGCATCT4 --------- ₊ --------- ₊ --------- ₊ --------- 4 ------- --4 --------- 300

NEDCNFKELILENHYNTYAS-GCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAAGGTATCCCT4 --------- 4 --------- 4 --------- 4 --------- 4 ------- --4 --------- 360

AKWTHNGGEMFVALNQKGIP-GTTCGTGGTAAGCAAACCAAGAAAGAACAGAAAACCGCTCACTTCCTGCCGATGGCAATC4 --------- 4 --------- ₊ --------- ₊ --------- 4 ------- --4 --------- 420

VRGKQTKKEQKTAHFLPMAI -ACTTAA-3 '

4 ----- 426

T *

184 188

FlG.47

ΔΝ23 / Κ (153) Ε

5 '-ATGTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACC ₊ --------- + --------- + --------- ₊ --------- ₊ ----- ---- ₊ --------- ₆₀

MSYDYMEGGDIRVRRLFCRT-CAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAAAC4 --------- + --------- + --------- + --------- 4 ------- --4 --------- 120

QWYLRIDKRGKVKGTQEMKN-AACTACAATATTATGGAAATCCGTACIGTTGCTGTTGGTATCGITGCAATCAAAGGTGTT + --------- 4 --------- 4 --------- 4 --------- 4 ------- --4 --------- 130

NYNIMEIRTVAVGIVAIKGV-GAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCAAAAAAAGAATGC4 --------- 4 --------- 4 --------- 4 --------- 4 ------- --4 --------- 240

ESEFYLAMNKEGKLYAKKEC -AACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACCTACGCATCT4 --------- ₊ --------- 4 --------- 4 --------- ₊ ------- --4 --------- 300

NEDCNFKELILENHYNTYAS -GCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAAGGTATCCCT + --------- 4 --------- ₊ --------- 4 --------- 4 ------- --4 --------- 360

AKWTHNGGEMFVALNQKGI P -GTTCGTGGTAAGAAAACCAAGAAAGAACAGGAAACCGCTCACTTCCTGCCGATGGCAATC4 --------- 4 --------- 4 ---------- (.--------- 4 ---- ----- 4 --------- 420

VRGKKTKKEQETAHFLPMAI -ACTTAA-3 '+ ----- 426

T *

18 * 4 188

FI G.48

ΔΝ23 / Κ (153) Ο

5 '-ATGTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACC + --------- + --------- + --------- + --------- 4 ------ --- 4 --------- gO

MSYDYMEGGDIRVRRLFCRT- CAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAAAC + --------- + --------- + --------- + --------- + ------ --- ₊ --------- 120

QWYLRIDKRGKVKGTQEMKN-AACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTT + --------- + --------- 4 --------- 4 --------- 4 ------- --4 --------- Igo

NYNIMEIRTVAVGIVAIKGV-GAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCAAAAAAAGAATGC4 -------------------- 1 ---------- 4 --------- 4 ----- ----.) ---------- 240

ESEFYLAMNKEGKLYAKKEC-AACGAAGACTGCAACTTCAAAGAACTGATCCTGGAAAACCACTACAACACCTACGCATCT4 --------- 4 --------- 4 --------- 4 --------- 4 ------- --4 --------- 300

NEDCNFKELILENHYNTYAS-GCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAAGGTATCCCT4 --------- 4 --------- 4 --------- 4 --------- 4 ------- --4 --------- 360

AKWTHNGGEMFVALNQKGIP-GTTCGTGGTAAGAAAACCAAGAAAGAACAGCAAACCGCTCACTTCCTGCCGATGGCAATC4 --------- 4 --------- 4 --------- 4 --------- 4 ------- --4 --------- 420

VRGKKTKKEQQTAHFLPMAI -ACTTAA-3 '+ ----- 426

T * 184 188

F! G .49

AN23 / Q (152) E / K (153) E * -ATOTCCTACGACTACATGGAAGGTGGTGACATCCGCGTACGTCGTCTGTTCTGCCGTACC + --------- + --------- + --------- + ---- ----- + --------- + --------- 60

MSYDYMEGGDIRVRRLFCRT-CAGTGGTACCTGCGTATCGACAAACGCGGCAAAGTCAAGGGCACCCAAGAGATGAAAAAC + --------- + --------- + --------- + --------- ₊ ------- - + --------- i20

QWYLRIDKRGKVKGTQEMKN-AACTACAATATTATGGAAATCCGTACTGTTGCTGTTGGTATCGTTGCAATCAAAGGTGTT + --------- + --------- + --------- 4 --------- + ------- - ₊ --------- Igo

NYNIMEIRTVAVGIVAIKGV-GAATCTGAATTCTACCTGGCAATGAACAAAGAAGGTAAACTGTACGCAAAAAAAGAATGC + --------- + --------- + --------- + --------- + ------ --- + --------- 240

ESEFYLAMNKEGKLYAKKEC-aacgaagactgcaacttcaaagaactgatcctggaaaaccactacaacacctacgcatct + --------- + --------- + --------- + --------- + ------- - + --------- 300

NEDCNFKELILENHYNTYAS-GCTAAATGGACCCACAACGGTGGTGAAATGTTCGTTGCTCTGAACCAGAAAGGTATCCCT ₊ --------- ₊ --------- ₊ --------- ₊ --------- ₊ ------ --- + --------- 360

AKWTHNGGEMFVALNQKGIP-GTTCGTGGTAAGAAAACCAAGAAAGAAGAGGAAACCGCTCACTTCCTGCCGATGGCAATC + --------- ₊ --------- ₊ --------- ₊ --------- 4 ------- --4 --------- 420

VRGKKTKKEEETAHFLPMAI-ACTTAA-3 '+ ----- 426

T *

184 188

ABOUT cont ΓΟ cont CD ro Λ V CD WHAT Ll_ >. c about about ΓΟ CD WHAT AT- about about ro Λ CD r4 (tf V cs> CD CD + g CQ + WHAT r-u r-j l * M 1— 0 1— ł— ł— WHAT with What What WHAT

Ł

I-Γ o o cd cd co uo

(ąp / fim) τωχ θμ Αζο ^ ριχβ morzom

Publishing Department of the UP RP. Circulation of 70 copies

Price PLN 6.00.

Claims (21)

Patent claims A method for stimulating the production of non-fibroblast epithelial cells, characterized in that the non-fibroblast epithelial cells are contacted with an effective amount of the native keratinocyte growth factor analog KGF, defined by the sequence of amino acids 32-194 in SEQ ID NO: 2 with or without a signal sequence, o the amino acid sequence of KGF but comprising the modification of one or more of amino acids 32-55 in SEQ ID NO: 2, wherein each cistern residue: at amino acid 32 in SEQ ID NO: 2 and at amino acid 46 in SEQ ID NO: 2 ( Cys ¹ and Cys ^{15, respectively} ), is either removed or substituted with a different amino acid. 2. The method according to p. The method of claim 1, wherein the KGF polypeptide analog is used in which the cysteine residue at amino acid position 32 in SEQ ID NO: 2 and the cysteine residue at amino acid position 46 in SEQ ID NO: 2 are deleted. 3. The method according to p. The method of claim 1, wherein the KGF polypeptide analog in which amino acids 32-55 in SEQ ID NO: 2 are cut off. 4. The method according to p. The method of claim 1, wherein the KGF polypeptide analog is used in which the cysteine residue at amino acid position 32 in SEq ID NO: 2 is deleted and the cysteine residue at amino acid position 46 in SEQ ID NO: 2 is substituted with a different amino acid. 5. The method according to p. The method of claim 1, wherein the KGF polypeptide analog is used, the first of which is up to fourteen; The N-terminal amino acid is cleaved and the cysteine residue at amino acid position 46 in SEQ ID NO: 2 is substituted with a different amino acid. 6. The method according to p. The method of claim 1, wherein the KGF polypeptide analog is used, wherein the cysteine residue at amino acid position 32 in sEq ID NO: 2 and the cysteine residue at amino acid position 46 in SEQ ID NO: 2 are substituted with a different amino acid. 7. The method according to p. The method of claim 4, 5 or 6, wherein the KGF polypeptide analog is used in which the cysteine residue is substituted with an amino acid residue selected from the group consisting of alanine, leucine and serine residues. 8. The method according to p. The method of claim 7, wherein the KGF polypeptide analog is used in which the serine residue is substituted for a cistern moiety. 9. The method according to p. The method of claim 1, wherein the KGF polypeptide analog is used, wherein there is an additional charge-altering substitution at an amino acid position selected from: an arginine residue at position and amino acid 72 in SEQ ID NO: 2, a glutamic acid residue at amino acid position 74 in SEQ ID NO: 2, a lysine residue at amino acid position 86 in SEQ ID NO: 2, a lysine residue at amino acid position 126 in SEQ ID NO: 2, an aspartic residue at amino acid position 168 in SEQ ID NO: 2, a glutamic acid residue at amino acid position 169 in SEQ ID NO: 2, a lysine residue at amino acid position 170 in SEQ ID nO: 2, an arginine residue at amino acid position 175 in SEQ ID NO: 2, a lysine residue at amino acid position 178 in SEQ ID NO: 2, a glutamine residue at amino acid position 183 in SeQ ID NO: 2, a lysine residue at amino acid position 184 in SEQ ID NO: 2, or a threonine residue at amino acid position 185 in SEQ ID NO: 2. 10. The method of claims 1, characterized in that the lipeptypical analog g KGF is used, in which there is additionally a modification consisting in the fact that at least one amino acid in the loop-forming sequence of amino acid residues in positions Asn ¹⁴⁶ -Thr ¹⁵⁰ in SEQ ID NO: 2 -is replaced with a residue another amino acid having a higher loop formation potential. 184 188 11. The method according to p. The method of claim 9 or 10, wherein the KGF polypeptide analog is used, wherein the amino acid residues positions 32-54 in SEQ ID NO: 2 are deleted. 12. The method according to p. The method of claim 1, wherein the KGF polypeptide analog is used selected from the group of analogs consisting of C (1.15) S (corresponding to the sequence of SEQ ID NO: 32, wherein the starting methionine is considered to be the residue "0" and is optionally present). C (1,15,40) S (corresponding to the sequence of SEQ ID NO: 78, where the starting methionine is considered to be the "0" residue and is optionally present), C (1,15,102) S (corresponding to the sequence of SEQ ID NO: 80, in which the starting methionine is considered to be the "0" residue and is optionally present), C (1, 15,102,106) 8 (corresponding to the sequence of SEQ ID NO: 82 in which the starting methionine is considered to be the "0" residue and is optionally present), ADN15 ( SEQ ID NO: 42, where starting methionine is considered to be the residue "0" and is optionally present), AN16 (corresponding to the sequence of SEQ ID NO: 44, where starting methionine is considered to be the residue "0" and is optionally present), AN 17 (corresponding to the sequence of SEQ ID NO: 46 where the starting methionine is considered to be the residue "0" and is optionally present), AN 18 (corresponds to: ^ j ^ cy of the sequence SEQ ID NO: 48 where the starting methionine is considered to be the residue "0" and is optionally present), ANI 9 (corresponding to the sequence of SEQ ID NO: 50, where the starting methionine is considered to be the residue "0" and the if applicable), AN20 (corresponding to the sequence of SEQ ID NO: 52 where the starting methionine is considered to be the "0" residue and is optionally present), AN21 (corresponding to the sequence of SEQ ID NO: 54 where the starting methionine is considered to be "0" and is optionally present), AN22 (corresponding to the sequence of SEQ ID NO: 56 where the starting methionine is considered to be the "0" residue and is optionally present), AN23 (corresponding to the sequence of SEQ ID NO: 58 where the starting methionine is considered to be "0" "And is optionally present), AN24 (corresponding to the sequence of SEQ ID NO: 60 where the starting methionine is considered to be the residue" 0 "and is optionally present), AN3 / C (15) S (corresponding to the sequence of SEQ ID NO: 34, in which the starting methionine is considered to be the "0" residue and is optionally present), AN3 / C (15) - (corresponding to the sequence of SEQ ID NQ: 36, where the starting methionine is considered to be the "0" residue and is optional), AN8 / C ( 15) S (corresponding to the sequence of SEQ ID NO: 38 in which the starting methionine is recognized and for the residue "0" and is optionally present), AN8 / C (15) - (corresponding to the sequence of SEQ ID NO: 40, where the starting methionine is considered to be the residue "0" and is optionally present), C (1.15) S / R (144) E (corresponding to the sequence of SEQ ID NO: 62 where the starting methionine is considered to be the "0" residue and is optionally present), C (1.15) S / R (144) Q (corresponding to the sequence of SEQ ID NO: 64, where the starting methionine is considered to be the "0" residue and is optionally present) DN23 / H (116) G (corresponding to the amino acid sequence 54-194 in SEQ ID NO: 2), with the histidine residue at amino acid position 147 substituted with glycine , AN23 / N (137) E (corresponding to the sequence of SEQ ID NO: 84, where the starting methionine is considered to be the residue "0" and possibly present), AN23 / K (139) E (corresponding to the sequence of SEQ ID NO: 86, in where initial methionine is considered to be the residue "0" and is optionally present), AID ^ ^ and ^ / ^ (139) Q (corresponding to the sequence of SEQ ID NO: 88 where initial methionine is considered to be the residue "0" and is optionally present ), AN23 / R (144) A (corresponding to the sequence of SEQ ID NO: 90 where the starting methionine is considered to be the residue "0" and is optionally present), AN23 / R (144) E corresponding to the sequence of SEQ ID NO: 92 where the starting methionine is the residue "0" and possibly present), AN23 / R (144) L (corresponding to the sequence of SEQ ID NO: 94, where the initial methionine is regarded as the residue "0" and present optionally), A ^ Ć ^ (^ / ^ ('U47) E (corresponding to the sequence of SEQ ID NO: 96 where the starting methionine is considered to be the residue "0" and is optionally present), AN23 / K (147) Q (corresponding to the sequence of SEQ ID NO: 98 where the initial methionine is considered to be the "0" residue and is optional), AN23 / N (153) E (corresponding to the sequence of SEQ ID NO: 100, where the starting methionine is considered to be the "0" residue and is optional), AN23 / NK (153 ) Q (corresponding to the sequence of SEQ ID NO: 102 where the starting methionine is considered to be the residue "0" and there is 184 188 possibly), AN23 / Q (152) E / K (153) E (corresponding to the sequence of SEQ ID NO: 104, where the starting methionine is considered to be the residue "0" and possibly present) and AN23 // R (144) Q (corresponding to the sequence of SEQ ID NO: 66 where the starting methionine is considered the residue "0" and is optionally present). 13. The method according to p. The method of claim 12, wherein the AN'16 analog (corresponding to the sequence of SEQ ID NO: 44 where the starting methionine is considered to be the residue "0" and is optionally present). 14. The method according to p. The method of claim 1, wherein the KGF polypeptide analog having the sequence, signal, or amino-terminal methionine residue is used. 15. The method according to p. The method of claim 14, wherein the KGF polypeptide analog is used, wherein the signal sequence is amino acids 1-31 in SEQ ID NO: 2. 16. The method according to p. The method of claim 1, wherein the KGF polypeptide analog is covalently linked to a chemical moiety. 17. The method according to p. The method of claim 16, wherein the polypeptide analogue of KGF is used, wherein the chemical moiety is polyethylene glycol. 18. The method according to claim The method of claim 1, wherein the KGF polypeptide analog is AN23 (corresponding to the sequence of SEQ ID NO: 58 wherein the starting methionine is considered to be the "0" residue and is optionally present) covalently linked to a chemical moiety. 19. The method according to p. The method of claim 18, wherein the polypeptide analogue of KGF is used, wherein the chemical moiety is polyethylene glycol. 20. The method according to p. The method of claim 1, wherein the KGF polypeptide analog is in lyophilized form. 21. The method of p. The method of claim 1, wherein the KGF polypeptide analog is produced by a method involving the cultivation under appropriate nutritional conditions of a prokaryotic or eukaryotic host cell stably transformed with a recombinant nucleic acid molecule encoding an analog of the native keratinocyte growth factor KGF, defined by the sequence, amino acids 32-194 in SEQ IDNO: 2, with or without a signal sequence, defined by the amino acid sequence specific to KGF, including the modification of one or more of amino acids 32-55 in the sequence of SEQ ID NO: 2, wherein each of the cistern residues: at amino acid position 3 2 in SEQ ID NO: 2 and at amino acid position 46 in SEQ ID NO: 2 (Cys ¹ and Cys ^{15, respectively} ), is either deleted or substituted with another amino acid or a biologically functional vector containing a molecule of such recombinant nucleic acid encoding a native keratinocyte growth factor analog - KGF , specified by the sequence am of ino acids 32-194 in SEQ ED NO: 2, with or without a signal sequence, defined by the amino acid sequence specific to KGF, including the modification of one or more amino acids 32-55 in the sequence of SEQ ID NO: 2, each from cistern residues: at amino acid position 32 in SEQ ID NO: 2 and at amino acid position 46 in SEQ ID NO: 2 (Cys1 and Cys2, respectively), is either deleted or substituted with a different amino acid, and cultured in a manner allowing expression of the encoded KGF analogue, followed by isolation of the KGF analogue thus prepared.