PL164992B1 - Method of constructing a recombinet vector for cloning and/or expressing in bacterial host cells the production of polypeptide capable to generate antibodies specifically reacting with protein of the human tisue inhibitor of plasminogen activator - Google Patents

Method of constructing a recombinet vector for cloning and/or expressing in bacterial host cells the production of polypeptide capable to generate antibodies specifically reacting with protein of the human tisue inhibitor of plasminogen activator

Info

Publication number
PL164992B1
PL164992B1 PL30054590A PL30054590A PL164992B1 PL 164992 B1 PL164992 B1 PL 164992B1 PL 30054590 A PL30054590 A PL 30054590A PL 30054590 A PL30054590 A PL 30054590A PL 164992 B1 PL164992 B1 PL 164992B1
Authority
PL
Poland
Prior art keywords
fragment
antibodies
polypeptide
plasminogen activator
protein
Prior art date
Application number
PL30054590A
Other languages
Polish (pl)
Inventor
Maria Swiatkowska
Czeslaw Cierniewski
Andrzej Plucienniczak
Grazyna Plucienniczak
Wojciech J Stec
Andrzej Wilk
Original Assignee
Akad Medyczna
Pan
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Akad Medyczna, Pan filed Critical Akad Medyczna
Priority to PL30054590A priority Critical patent/PL164992B1/en
Publication of PL164992B1 publication Critical patent/PL164992B1/en

Links

Landscapes

  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

1. Process for building recombinant vector for cloning or expressing in bacterial host cells for creating a polypeptide capable of generating antibodies reacting specifically with the protein of the human tissue plasminogen activator inhibitor, and this polypeptide and/or reacting specifically with antibodies of tissue plasminogen activator inhibitor and with antibodies for this polypeptide, by linking DNA fragments, characterised in that the vector links with DNA coding polypeptide equal to a fragment with the formula (Y)a-A-(Z)b, where Y denotes amino acid sequence coded by a polylinker fragment, optimally by Glu, Ser, a=0 or 1; Z denotes sequence Glu, Ser and/or sequence coded by a polylinker fragment, b=0, 1 or 2; while A denotes fragment Asn172-Thr232 of the human tissue plasminogen activator inhibitor.

Description

Przedmiotem wynalazku jest sposób konstruowania zrekombinowanego wektora do klonowania i/lub ekspresji w komórkach gospodarza bakteryjnego do wytworzenia polipeptydu zdolnego do produkcji przeciwciał reagujących specyficznie z białkiem ludzkiego inhibitora tkankowego aktywatora plazminogenu (PAI-l).i tym polipeptydem; i/lub reagującego specyficznie z przeciwciałami dla tego inhibitora oraz z przeciwciałami dla tego polipeptydu. Aktywatory plazminogenu (PAI-1) pełnią ważną rolę podczas procesu fibrynolizy, a także w różnych innych procesach fizjologicznych, włączając proces regeneracji, owulacji, implantacji' embionu, różnicowania tkanek, transformacji nowotworowej. Precyzyjna regulacja aktywności aktywatorów plazminogenu stanowi krytyczny element wielu biologicznych systemów. Taka regulacja może odbywać się na poziomie tworzenia i rozpuszczania skrzepu lub na poziomie interakcji aktywatorów plazminogenu z komórkami czy też przez działanie specyficznych inhibitorów.The invention relates to a method of constructing a recombinant cloning vector and / or expression in bacterial host cells to produce a polypeptide capable of producing antibodies specifically reactive with a human tissue plasminogen activator inhibitor (PAI-1) protein and the polypeptide; and / or reacts specifically with antibodies to that inhibitor and with antibodies to that polypeptide. Plasminogen activators (PAI-1) play an important role during the fibrinolysis process, as well as in various other physiological processes, including the process of regeneration, ovulation, embionation, tissue differentiation, and neoplastic transformation. The precise regulation of plasminogen activator activity is a critical component of many biological systems. Such regulation may take place at the level of clot formation and dissolution, or by the interaction of plasminogen activators with cells, or by the action of specific inhibitors.

Większość oznaczeń aktywności tkankowego aktywatora plazminogenu jest dwuetapowa, zależy od obecności plazminy i nie odróżnia odmiennych rodzajów inhibitorów. Określenie inhibitorowej aktywności PAI mierzy się ilościowo przez zdolność do hamowania lizy włóknika znakowanego 125J, pośredniczonej aktywacją plazminogenu przez urokinazę (Loskutoff and Edington, Proc. Nat. Acad. Sci. USA, 74, 3903-3909, 1977). W tej metodzie jedną jednostkę aktywności PAI określa się jako ilość białka wymaganą do zredukowania aktywności 2IU UK do 50%. W celu oznaczenia ilości PAI używa się metody wiązania aktywatora plazminogenu do inhibitora (Schleef R. R., Wagner N. V., Loskutoff D. J., J. of CellularPhysiology, 134,269-274, 1989). Aktywność PAI można oznaczyć również posługując się metodą Verheijena, w której używa się wzrastających stężeń tPA (0-25 IU/ml), 1 μΜ plazminogenu oraz 1 μΜ fibrynogenu degradowanego bromocyjanem. W tych warunkach 1IU PAI-1 określa ilość inhibitora, która hamuje 1IU tPA (Verheijen J. H., Mullast D., Chang G. T. G., Kluft C., Wijngards G., Thromb. Haemostasis, 48,26(^^-^(36^, 1982). W niektórych badaniach określających poziom PAI we krwi stosuje się oznaczenia, w których podstawą jest neutralizacja tPA dodanego do próbek osocza, a mierzy się pozostałą aktywność tPA. Metody te są metodami pośrednimi i nie pozwalają precyzyjnie określić poziomu tego inhibitora.Most assays of tissue plasminogen activator activity are two-step, dependent on the presence of plasmin and do not distinguish between different types of inhibitors. Determination of the inhibitory activity of PAI is quantified by the ability to inhibit the lysis of 125 J-labeled fibrin mediated by urokinase activation of plasminogen (Loskutoff and Edington, Proc. Nat. Acad. Sci. USA, 74, 3903-3909, 1977). In this method, one unit of PAI activity is defined as the amount of protein required to reduce the 2IU UK activity to 50%. To quantify the amount of PAI, the method of binding the plasminogen activator to the inhibitor is used (Schleef RR, Wagner NV, Loskutoff DJ, J. of Cellular Physiology, 134, 269-274, 1989). PAI activity can also be determined using the Verheijen method, in which increasing concentrations of tPA (0-25 IU / ml), 1 μΜ of plasminogen and 1 μΜ of fibrinogen degraded by cyanogen bromide are used. Under these conditions, 1IU PAI-1 determines the amount of inhibitor that inhibits 1IU tPA (Verheijen JH, Mullast D., Chang GTG, Kluft C., Wijngards G., Thromb. Haemostasis, 48.26 (^^ - ^ (36 ^, 1982) Some studies of blood PAI use assays that neutralize tPA added to plasma samples and measure residual tPA activity, which are indirect methods and do not accurately determine the level of this inhibitor.

Ostatnio opracowano metodę enzymoimmunologicznego oznaczania ludzkiego PAI-1 w teście ELISA z wykorzystaniem przeciwciał dla tego białka. Test ten polega na tym, że inkubuje się przeciwciała dla PAI-1 z badaną próbką, w której oznacza się ten antygen i po odmyciu nieswoiście związanych białek, inkubuje się kompleks antygen-przeciwciało z przeciwciałami dla PAI-1 związanymi z peroksydazą chrzanową, po czym oznacza się antygen wykrywając znacznik.Recently, an enzyme-immunological ELISA assay for human PAI-1 has been developed using antibodies to this protein. In this test, the antibodies to PAI-1 are incubated with the test sample in which this antigen is determined, and after washing the non-specific bound proteins, the antigen-antibody complex is incubated with the antibodies to PAI-1 bound to horseradish peroxidase, and then the antigen is determined by detecting the label.

Wszystkie te metody wymagają zastosowania rodzimego białka PAI-1, zarówno do uzyskania krzywej wzorcowej, jak i swoistych przeciwciał. PAI-1 występuje w ilościach śladowych w płynach ustrojowych i komórkach, a uzyskanie tego białka metodami klasycznymi przez wyodrębnienie w ilościach wystarczających do przygotowania testu Elisa jest niezwykle skomplikowane i czasochłonne. Z drugiej strony otrzymywane dotychczas ludzkie białko PAI-1 jest niezwykle drogie i niezbyt dostępne.All these methods require the use of the native PAI-1 protein, both for the standard curve and for specific antibodies. PAI-1 is present in trace amounts in body fluids and cells, and obtaining this protein by classical methods by isolating it in amounts sufficient to prepare the Elisa test is extremely complicated and time-consuming. On the other hand, the human PAI-1 protein obtained so far is extremely expensive and not very accessible.

W szystkie omówione metody otrzymania rodzimego PAI-1 są niezwykle skomplikowane, pracochłonne i kosztowne, co zawyża w znacznym stopniu koszty całego testu.All of the discussed methods of obtaining native PAI-1 are extremely complicated, time-consuming and expensive, which significantly increases the cost of the entire test.

Nieoczekiwanie okazało się, że możliwe jest oznaczanie białka rodzimego PAI-1 metodą, w której stosuje się fragment peptydowy otrzymany przy pomocy zrekombinowanego wektora skonstruowanego sposobem według wynalazku. Stwierdzono, że można wykorzystać pełną reakcję krzyżową w teście immunologicznym przeciwciał otrzymanych dla fragmentu białka oraz rodzimej cząsteczki PAI-1.Surprisingly, it turned out that it is possible to determine the native PAI-1 protein by a method that uses a peptide fragment obtained with a recombinant vector constructed according to the invention. It has been found that a complete cross-reactivity can be used in the immunoassay of the antibodies obtained for the protein fragment and the native PAI-1 molecule.

W odróżnieniu od znanych metod oznaczania PAI-1, wytworzony przy pomocy zrekombinowanego wektora skonstruowanego sposobem według wynalazku, fragment peptydowy, a nie całe białko służy do produkcji swoistych przeciwciał rozpoznających w ten sposób zarówno fragment peptydowy, jak i rodzime białko PAI-1. Fragment ten również stosuje się do uzyskania krzywej wzorcowej.In contrast to the known methods of PAI-1 determination, the peptide fragment produced with the use of a recombinant vector constructed according to the invention, and not the whole protein, serves to produce specific antibodies thus recognizing both the peptide fragment and the native PAI-1 protein. This fragment is also used to obtain the standard curve.

Sposób konstruowania zrekombinowanego wektora do klonowania i/lub ekspresji w komórkach gospodarza bakteryjnego do wytworzenia polipeptydu zdolnego do wytwarzania przeciwciał reagujących specyficznie z białkiem ludzkiego inhibitora tkankowego aktywatora plazminogenu (PAI-1) i tym polipeptydem, przez łączenie fragmentów DNA, polega według wynalazku na tym, że wektor łączy się z DNA kodującym polipeptyd odpowiadający fragmen4 towi o wzorze (Y)a-A-(Z)b, w którym Y oznacza sekwencje aminokwasów kodowaną przez fragment polilinkera, korzystnie Glu, Ser, Z oznacza sekwencję Glu, Ser i/lub sekwencję kodowaną przez fragment polilinkera, a = 0 lub 1, b = 0, 1 lub 2, natomiast A oznacza fragment Asnr72 - Thr232 ludzkiego inhibitora tkankowego aktywatora plazminogenu.The method of constructing a recombinant vector for cloning and / or expression in bacterial host cells to produce a polypeptide capable of producing antibodies specifically reactive with the human tissue plasminogen activator inhibitor (PAI-1) protein and said polypeptide by joining DNA fragments according to the invention consists in: that the vector binds to a DNA encoding a polypeptide corresponding to the fragment of formula (Y) aA- (Z) b, wherein Y is the amino acid sequence encoded by the polylinker fragment, preferably Glu, Ser, Z is the sequence Glu, Ser and / or the encoded sequence by a polylinker fragment, a = 0 or 1, b = 0, 1 or 2, and A is the Asnr72-Thr232 fragment of the human tissue plasminogen activator inhibitor.

W sposobie według wynalazku zrekombinowany wektor otrzymuje się korzystnie przez łączenie wektora z zsyntezowanym chemicznie DNA odpowiadającym cDNA o sekwencji:In the method according to the invention, the recombinant vector is preferably obtained by linking the vector to the chemically synthesized DNA corresponding to the cDNA having the sequence:

( X ) „AACGGCCAGTGGAAGACACCATTCCCAGACAGTAGCACCCACCGCCGCCTCTT(X) 'AACGGCCAGTGGAAGACACCATTCCCAGACAGTAGCACCCACCGCCGCCTCTT

CCACAAATCAGACGGAAGCAGTGTCTCTGTGCCAATGATGGCTGAGACCAACAAATTCCACAAATCAGACGGAAGCAGTGTCTCTGTGCCAATGATGGCTGAGACCAACAAATT

CAACTATACTGAATTCACCACGCCAGATGGACATTACTACGACATCCTGGAACTGCCCAACTATACTGAATTCACCACGCCAGATGGACATTACTACGACATCCTGGAACTGCC

ATACCACGGAGACACT(X)m, gdzie X oznacza GAATCT, n przyjmuje wartość 1 lub 0, a m przyjmuje wartość 0, 1 lub 2.ATACCACGGAGACACT (X) m , where X is GAATCT, n is 1 or 0, and m is 0, 1 or 2.

Korzystnie w sposobie według wynalazku stosuje się zsyntezowany chemicznie DNA kodujący fragment cząsteczki PAI-1 od 172 do 232 aminokwasu od N-końca o sekwencji:Preferably, in the method according to the invention, chemically synthesized DNA encoding a fragment of the PAI-1 molecule from 172 to 232 amino acids from the N-terminus with the sequence:

172 177 182172 177 182

Asn-Gly-Gln-Trp-Lys-Thr-Pro-Phe-Pro-Asp-Ser-Sef—Thr—Hi s-Arg187 192 197Asn-Gly-Gln-Trp-Lys-Thr-Pro-Phe-Pro-Asp-Ser-Sef — Thr — Hi s-Arg 187 192 197

Arq-Leu-Phe-Hi s-Lys-Ser-Asp-Gl y-Ser-Thr-'7«* l -Ser-Va l -Pro-Met202 207 212Arq-Leu-Phe-Hi s-Lys-Ser-Asp-Gl y-Ser-Thr-'7 «* l -Ser-Va l -Pro-Met202 207 212

Met-Ala-Glu-Thr-Asn-Lys-Phe-Asn-Tyr-Thr-Glu-Phe-Thr-Thr-Pro217 r—,Met-Ala-Glu-Thr-Asn-Lys-Phe-Asn-Tyr-Thr-Glu-Phe-Thr-Thr-Pro217 r—,

-Gly-AspAsp-Gly-His-Tyr-Tyr-Asp-Ile-Leu-Glu-Leu-Pro-Tyr-His-Gly-AspAsp-Gly-His-Tyr-Tyr-Asp-Ile-Leu-Glu-Leu-Pro-Tyr-His

Zrekombinowany sposobem według wynalazku wektor służy do klonowania i/lub ekspresji w komórkach gospodarza bakteryjnego do wytworzenia fragmentu polipeptydowego zawierającego epitopy antygenowe rozpoznawane przez przeciwciała również w rodzimej cząsteczce PAI-1.The vector recombinant according to the invention is used for cloning and / or expression in bacterial host cells to produce a polypeptide fragment containing antigenic epitopes recognized by antibodies also in the native PAI-1 molecule.

Stosowany w procesie prowadzonym sposobem według wynalazku gen kodujący fragment polipeptydowy odpowiadający fragmentowi ludzkiego inhibitora tkankowego aktywatora plazminogenu można na przykład otrzymać z oligonukleotydowych fragmentów ligowanych in vitro.The gene encoding the polypeptide fragment corresponding to the fragment of the human tissue plasminogen activator inhibitor used in the process of the invention can be obtained, for example, from in vitro ligated oligonucleotide fragments.

Oligonukleotydowe fragmenty można zsyntetyzować chemicznie na nośniku poprzez kolejne przyłączanie nukleozydów z zablokowanymi grupami czynnymi. Korzystnie do ochrony funkcji aminowej stosuje się grupę izopropoksyacetylową, co przedstawiono w opisie patentowym RP nr 159 234.Oligonucleotide fragments can be chemically synthesized on the support by sequentially adding blocked active group nucleosides. Preferably, an isopropoxyacetyl group is used to protect the amine function, as described in the Polish patent specification No. 159,234.

Fragmenty oligonukleotydowe zsyntetyzowane chemicznie podaaje się enzymatycznej reakcji kinazowania, w trakcie której wprowadza się fosforan na końcach 5’ za pomocą kinazy polinukleotydowej i ATP. Kinazowane oligonukleotydy liguje się in vitro w dwuniciowe odcinki ograniczone sekwencjami rozpoznawanymi przez enzymy restrykcyjne. Zligowane odcinki klonuje się w wektorze pomocniczym, stosując właściwe miejsce restrykcyjne polilinkera. Poprawność sekwencji produktów ligowania i klonowania tych fragmentów sprawdza się poprzez sekwencjonowanie metodą Maxama-Gilberta. Można stosować różne wektory pomocnicze, np. plazmidowe lub fagowe, przy czym korzystne są plazmidy, np. pUC19. Sklonowane w wektorze odcinki DNA namnaża się w komórkach gospodarza, którymi mogą być bakterie, drożdże i inne. Wektory z wklonowanymi odcinkami izoluje się, a następnie odcinki odzyskuje się po trawieniu restryktazami na drodze elektroforezy w żelu poliakryloamidowym. Odzyskane odcinki włącza się do wektora ekspresyjnego po trawieniu odpowiednimi enzymami restrykcyjnymi. Na tym etapie stosuje się różne wektory ekspresyjne, korzystnie plazmidowe lub fagowe. Przykładowo plazmid ekspresyjny pWR 450.1. zawiera gen kodujący β-galaktozydazę. Komórki gospodarza, korzystnie bakterii, transformowane zrekombinowanym wektorem są po namnożeniu źródłem fragmentu białka ludzkiego PAI-1.Chemically synthesized oligonucleotide fragments are subjected to an enzymatic kinase reaction in which phosphate is introduced at the 5 'ends using polynucleotide kinase and ATP. The kinased oligonucleotides are ligated in vitro into double-stranded stretches delimited by restriction enzyme recognition sequences. The ligated segments are cloned into a helper vector using the appropriate polylinker restriction site. The correctness of the sequence of the ligation and cloning products of these fragments was checked by Maxam-Gilbert sequencing. Various helper vectors, e.g. plasmid or phage vectors, can be used, with plasmids, e.g. pUC19 being preferred. DNA stretches cloned in the vector are multiplied in host cells, which can be bacteria, yeast and others. Vectors with cloned sections are isolated, and the sections are then recovered after digestion with restrictionases by polyacrylamide gel electrophoresis. The recovered sections are inserted into the expression vector after digestion with the appropriate restriction enzymes. Various expression vectors, preferably plasmid or phage vectors, are used in this step. For example, the expression plasmid pWR 450.1. contains the gene encoding β-galactosidase. Host cells, preferably bacteria, transformed with the recombinant vector are the source of the human PAI-1 protein fragment after amplification.

Wytworzony sposobem według wynalazku zrekombinowany wektor służy do otrzymania fragmentu białka PAl-1, który można stosować do otrzymywania przeciwciał różnymi znanymi metodami, a także do wykreślenia krzywej wzorcowej niezbędnej do ilościowego oznaczania PAI-1.The recombinant vector produced by the method according to the invention serves to obtain a fragment of the PA1-1 protein, which can be used for the production of antibodies by various known methods, and also to plot a standard curve necessary for the quantification of PAI-1.

Przykładowy sposób wytwarzania przeciwciał poliklonalnych reagujących specyficznie z białkiem ludzkiego inhibitora tkankowego aktywatora plazminogenu polega na tym, że immunizuje się zwierzęta polipeptydem odpowiadającym fragmentowi o wzorze (Y)a-A-(Z)b, w którym symbole mają wyżej podane znaczenie, pobiera się krew i odzyskuje przeciwciała.An exemplary method of producing polyclonal antibodies reactive specifically with a human tissue plasminogen activator inhibitor protein is to immunize animals with a polypeptide corresponding to the fragment of formula (Y) aA- (Z) b, wherein the symbols have the above meanings, blood is collected and recovered. antibodies.

Otrzymane przy pomocy zrekombinowanego wektora wytworzonego sposobem według wynalazku przeciwciała można zastosować do oznaczania antygenu ludzkiego inhibitora tkankowego aktywatora plazminogenu oraz do otrzymania testu diagnostycznego do oznaczania tego antygenu.The antibodies obtained with the recombinant vector according to the invention can be used to determine the antigen of a human tissue plasminogen activator inhibitor and to obtain a diagnostic test for the determination of this antigen.

Przykładowy sposób oznaczania antygenu ludzkiego inhibitora tkankowego aktywatora plazminogenu polega na tym, że badaną próbkę, korzystnie materiału biologicznego, kontaktuje się z przeciwciałami dla polipeptydu odpowiadającego fragmentowi o wzorze (Y)a-A-(Z)b, w którym symbole mają wyżej podane znaczenie, po czym oznacza się wytworzony kompleks antygen-przeciwciało.An exemplary method of determining the antigen of a human tissue plasminogen activator inhibitor is that a test sample, preferably of biological material, is contacted with antibodies to the polypeptide corresponding to the fragment of formula (Y) a -A- (Z) b, wherein the symbols have the meaning given above. and the resulting antibody-antigen complex is determined.

W innej przykładowej metodzie najpierw wytwarza się kompleks dwuskładnikowy antygenu PAT-1 w próbce z pierwszym przeciwciałem zdolnym do reagowania ze wspomnianym antygenem, po czym wytwarza się kompleks trójskładnikowy przez skontaktowanie kompleksu dwuskładnikowego z drugim przeciwciałem zdolnym do reagowania ze wspomnianym antygenem, przy czym jako jedno z tych przeciwciał stosuje się przeciwciała dla polipeptydu odpowiadającego fragmentowi o wzorze (Y)a-A-(Z)t,, w którym symbole mają wyżej podane znaczenie. Obecność kompleksu trójskładnikowego wykrywa się za pomocą sygnału tworzonego przez odczynnik dający się oznaczyć analitycznie lub wyznakowanego przeciwciała przeciwimmunoglobulinowego.In another exemplary method, the binary complex of the PAT-1 antigen in the sample is first produced with a first antibody capable of reacting with said antigen, and then the ternary complex is formed by contacting the binary complex with a second antibody capable of reacting with said antigen, one of which of these antibodies, antibodies are used for the polypeptide corresponding to the fragment of formula (Y) a -A- (Z) t, wherein the symbols are as defined above. The presence of the ternary complex is detected by a signal generated by an analytically measurable reagent or a labeled anti-immunoglobulin antibody.

Badaną próbkę, w której wykrywa się i oznacza antygen PAI-1 kontaktuje się i inkubuje z przeciwciałami reagującymi specyficznie z tym antygenem. Utworzenie kompleksu dwuskładnikowego antygen-przeciwciało wykrywa się i oznacza za pomocą środka wykrywającego i sygnalizującego reakcję immunologiczną, jak na przykład przeciwciało reagujące specyficznie z PAI-1 znakowane odczynnikiem dającym się oznaczyć analitycznie.A test sample in which the PAI-1 antigen is detected and determined is contacted and incubated with antibodies reactive specifically with the antigen. The formation of a binary antigen-antibody complex is detected and determined by an immunological detection and signaling agent such as, for example, an antibody reactive specifically with PAI-1 labeled with an analytically determinable reagent.

Środek wykrywający i sygnalizujący reakcję immunologiczną może być obecny podczas inkubowania antygenu z przeciwciałem. Na przykład można bezpośrednio wyznakować przeciwciała kontaktowane z badaną próbką i po przemyciu produktu reakcji uzyskać sygnał. Środkiem jest wówczas sam znacznik. Środek wykrywający można też dodać dopiero po wytworzeniu kompleksu dwuskładnikowego i usunięciu nieprzereagowanego materiału. Wykrywanie i oznaczanie prowadzi się wówczas następująco: dwuskładnikowy kompleks antygenprzeciwciało po odmyciu kontaktuje się z drugim przeciwciałem reagującym specyficznie zAn agent for detecting and signaling an immune response may be present when the antigen is incubated with the antibody. For example, the antibodies contacted with the test sample can be directly labeled and the signal obtained after washing the reaction product. The center is then the marker itself. The detection agent can also be added only after the formation of the two-component complex and removal of unreacted material. Detection and determination are then carried out as follows: the two-component antigen-antibody complex after washing is contacted with a second antibody that reacts specifically with

164 992164 992

PAI-1, przy czym jako jedno z tych przeciwciał stosuje się przeciwciało dla polipeptydu odpowiadającego fragmentowi o wzorze (Y)a-A-(Z)b, w którym symbole mają wyżej podane znaczenie. Pozostałym (pierwszym lub drugim) przeciwciałem może być przeciwciało dla całej cząsteczki PAI-1. Otrzymuje się wówczas kompleks trójskładnikowy przeciwciało-antygenprzeciwciało. Drugie przeciwciała mogą być bezpośrednio znakowane odczynnikiem dającym się oznaczyć analitycznie. Alternatywnie, jako środek stosuje się układ dwuskładnikowy zawierający drugie przeciwciała tworzące kompleks trójskładnikowy, który wykrywa się za pomocą przeciwciała przeciwimmunoglobulinowego.PAI-1, wherein one of these antibodies is an antibody for a polypeptide corresponding to the fragment of formula (Y) a-A- (Z) b in which the symbols are as defined above. The residual (first or second) antibody can be the antibody to the entire PAI-1 molecule. The ternary antibody-antigen-antibody complex is then obtained. Second antibodies may be directly labeled with an analytically determinable reagent. Alternatively, the agent is a two-component system containing second antibodies forming a ternary complex that is detected by an anti-immunoglobulin antibody.

Do znakowania można stosować enzym, biotynę, izotop promieniotwórczy, przykładowo 125J lub inne znane odczynniki. Wykrywanie i oznaczanie prowadzi się za pomocą sygnału wytwarzanego przez znacznik.An enzyme, biotin, radioisotope, for example 125 J, or other known reagents can be used for labeling. Detection and determination are carried out by means of the signal produced by the label.

W tak prowadzonym procesie oznaczania lub wykrywania badaną próbkę oznaczany antygen lub jedno z przeciwciał, korzystnie pierwsze, unieruchamia się na stałym nośniku, takim jak płytka plastikowa, bibuła nitrocelulozowa lub inne.In such a determination or detection process, the test sample, the antigen to be determined or one of the antibodies, preferably the first, is immobilized on a solid support, such as a plastic plate, nitrocellulose paper or the like.

Wykrywanie i oznaczanie dogodnie jest prowadzić za pomocą testu diagnostycznego. Przykładowy test diagnostyczny zawiera przeciwciała dla polipeptydu odpowiadającego fragmentowi o wzorze (Y)a-A-(Z),, w którym symbole mają wyżej podane znaczenie, ewentualnie unieruchomione na stałym nośniku lub rozpuszczone w fazie ciekłej. Przeciwciała są związane z odczynnikiem dającym się wykryć analitycznie.Detection and determination is conveniently carried out by a diagnostic test. An exemplary diagnostic assay comprises antibodies to a polypeptide corresponding to a fragment of formula (Y) a-A- (Z), wherein the symbols have the above meanings, optionally immobilized on a solid support or dissolved in a liquid phase. The antibodies are bound to an analytically detectable reagent.

Alternatywnie test diagnostyczny zawiera pierwsze przeciwciała reagujące specyficznie z białkiem ludzkiego inhibitora tkankowego aktywatora plazminogenu oraz układ do wykrywania kompleksu antygen-przeciwciało zawierający drugie przeciwciała zdolne do specyficznego reagowania z ludzkim inhibitorem tkankowego aktywatora plazminogenu i ewentualnie przeciwciała przeciwimmunoglobulinowe, przy czym jedne z tych przeciwciał stanowią przeciwciała dla polipeptydu odpowiadającego fragmentowi o wzorze (Y)a-A-(Z), w którym symbole mają wyżej podane znaczenie.Alternatively, the diagnostic assay comprises first antibodies reactive specifically with a human tissue plasminogen activator inhibitor protein and a system for detecting an antigen-antibody complex comprising second antibodies capable of specifically reacting with a human tissue plasminogen activator inhibitor and optionally anti-immunoglobulin antibodies, one of which is antibodies to a polypeptide corresponding to the fragment of formula (Y) aA- (Z), wherein the symbols are as defined above.

Korzystnie pierwsze przeciwciała są związane z fazą stałą lub ciekłą.Preferably the first antibodies are bound to a solid or a liquid phase.

Test może dodatkowo zawierać nośnik stały lub ciekły dla związania próbki zawierającej antygen.The test may additionally contain a solid or a liquid carrier to bind the sample containing the antigen.

Układ do wykrywania kompleksu antygen-przeciwciało zawiera drugie przeciwciała bezpośrednio związane z odczynnikiem dającym się wykryć analitycznie albo też układ ten zawiera trzecie przeciwciała przeciwimmunoglobulinowe związane ze znacznikiem.The system for detecting an antigen-antibody complex comprises second antibodies directly linked to an analytically detectable reagent, or the system comprises third anti-immunoglobulin antibodies bound to a label.

W sposobie i testach do oznaczania ludzkiego tkankowego aktywatora plazminogenu można stosować przeciwciła dla polipeptydu odpowiadającego fragmentowi o wzorze (Y)a-A(Z)b, w którym symbole mają wyżej podane znaczenie, wytworzone różnymi metodami.In the method and assays for determining human tissue plasminogen activator, antibodies to a polypeptide corresponding to the fragment of formula (Y) a-A (Z) b, wherein the symbols have the above meanings, prepared by various methods.

Celem uproszczenia w opisie i przykładach używane są następujące skróty:For simplicity, the following abbreviations are used in the description and examples:

A: adeninaA: adenine

C: cytozynaC: cytosine

G: guaninaG: guanine

T: _ tyminaT: _ thymine

Ala: alaninaAla: alanine

Arg: argininaArg: arginine

Asn: asparaginaAsn: asparagine

Asp: kwas asparaginowyAsp: aspartic acid

Cys: cysteinaCys: cysteine

Gin: glutaminaGin: glutamine

Glu: kwas glutaminowyGlu: glutamic acid

Gly: glicynaGly: glycine

His: histydynaHis: Histidine

Ile: izoleucynaHow much: isoleucine

Leu: leucynaLeu: leucine

Lys: lizynaLys: lysine

Met: metioninaMet: methionine

Phe: fenyloalaninaPhe: phenylalanine

Pro: prolinaPro: proline

Ser: serynaCheese: serine

Thr: treoninaThr: threonine

Trp: tryptofanTrp: tryptophan

Tyr: tyrozynaTyr: tyrosine

Val: walinaVal: valine

DNA: kwas dezoksyrybonukleinowy cDNA: komplementarny DNADNA: deoxyribonucleic acid cDNA: complementary DNA

Tris-HCl: chlorowodorek trójhydroksymetyloaminometanuTris-HCl: trihydroxymethylaminomethane hydrochloride

EDTA: kwas etylenodwuaminoczterooctowy x bufor Eco R1 100M Tris-HCl pH 7,5EDTA: ethylenediaminetetraacetic acid x Eco R1 buffer 100M Tris-HCl pH 7.5

MNaCl x bufor do kinazowania x bufor ligacyjny:MNaCl x kinase buffer x ligation buffer:

Bufor do ekstrakcjiExtraction buffer

Pożywka LBLB medium

Bufor TETE buffer

Bufor z SDSSDS buffer

Bufor do lizy komórekCell lysis buffer

Bufor RIRI buffer

Bufor R ΠBuffer R Π

Bufor R III mM β-merkaptoetanol OT M Tris-HCl pH 7,6 0.1MMgCl2 50 mM ditiotreitol 660 mM Tris-HCl pH Ifi 50 mM MgCl2 50 mM ditiotreitol 10 mM ATP 50mMTris-HCl pH 8,0 300 mM octan sodu 0.2% SDS 4 mM EDTA 10g Bacto Trypton 5g Yeast Extract 5g NaCl na 1 litr roztworu mM Tris-HCl pH 8,0 1 mM EDTA 0 OglCri-HCCl pH 8,0 77g glicynyBuffer R III mM β-mercaptoethanol OT M Tris-HCl pH 7.6 0.1MMgCl2 50 mM dithiothreitol 660 mM Tris-HCl pH Ifi 50 mM MgCl2 50 mM dithiothreitol 10 mM ATP 50mMTris-HCl pH 8.0 300 mM sodium acetate 0.2% SDS 4 mM EDTA 10g Bacto Trypton 5g Yeast Extract 5g NaCl per 1 liter of mM Tris-HCl solution pH 8.0 1 mM EDTA 0 OglCri-HCCl pH 8.0 77g glycine

1g SDS na 1 litr roztworu 15 mg TriT1 g of SDS per liter of 15 mg of TriT solution

400 mg SDS ml β-merkaptoetanol ml glicerolu ml wody400 mg SDS ml β-mercaptoethanol ml glycerol ml water

M mM EDTA mM Tris-HCL pH 8,0 4 mg/ml lizozymu (Pharmacia) 0,2 M NaOOM mM EDTA mM Tris-HCL pH 8.0 4 mg / ml Lysozyme (Pharmacia) 0.2 M NaOO

1% SDS ml 5 M octan potasu1% SDS ml 5M potassium acetate

11.5 ml kwas octowy lodowaty11.5 ml glacial acetic acid

28.5 ml H2O28.5 ml of H2O

DTT: ditiotreitolDTT: dithiothreitol

PMSF: fluorek kwasu fenylometylosulfonowego SDS: siarczan dodecylu soduPMSF: phenylmethylsulfonic acid fluoride SDS: sodium dodecyl sulfate

BSA: albumina surowicy wołu (Bovine Serum Albumin) PBS: zbuforowany roztwór soli fizjologicznej ATP: trójfosforan adenozynyBSA: Bovine Serum Albumin PBS: buffered saline ATP: adenosine triphosphate

HPLC: wysokociśnieniowa chromatografia cieczowaHPLC: high pressure liquid chromatography

164 992164 992

EDTA: etylenodiaminotetraoctanEDTA: ethylenediaminetetraacetate

Na załączonych rysunkach fig. 1 przedstawia wykres hydrofobowości łańcucha polipeptydowego PAI-1. Figura 2 przedstawia sekwencję fragmentu genu ludzkiego PAI-1 podzieloną na fragmenty syntetyzowane chemicznie. Figura 3 przedstawia schemat konstrukcji fragmentu genu dla PAJ-1 sklonowanego w wektorze rekombinacyjnym pUC-19 oraz ekspresyjnym pWR 450. Figura 4 przedstawia elektroforezę w żelu poliakryloamidowym zawierającym SDS ekstraktów białkowych otrzymanych z komórek E.coli oraz oczyszczonego kompleksu białkowego PAI-1 z β-galaktozydazą: 1 - ciałka inkluzyjne rozpuszczone w zbuforowanym roztworze 6molowego mocznika, 2 - oczyszczone białko hydrobowe β-galaktozydaza - fragment peptydowy PAI-1. Figura 5 przedstawia schemat rozbicia kompleksu białkowego i oczyszczania fragmentu Asn172-Thr232 PAI-1. Przedstawione odcinki β-galaktozydazy przypadają na długość od 4 do 182 aminokwasów. Fragment PAI-1 po rozbiciu komplesku składa się z 61 aminokwasów.In the accompanying drawings, Figure 1 is a graph of the hydrophobicity of the PAI-1 polypeptide chain. Figure 2 shows the sequence of the human PAI-1 gene fragment divided into chemically synthesized fragments. Figure 3 shows a diagram of the construction of a gene fragment for PAJ-1 cloned in the pUC-19 recombinant vector and the pWR 450 expression vector. Figure 4 shows SDS polyacrylamide gel electrophoresis of protein extracts obtained from E. coli cells and the purified PAI-1 protein complex with β- with galactosidase: 1 - inclusion bodies dissolved in a buffered solution of 6mol urea, 2 - purified hydrobial protein β-galactosidase - PAI-1 peptide fragment. Figure 5 shows a scheme for the disruption of the protein complex and the purification of the Asn172-Thr232 fragment of PAI-1. The portions of β-galactosidase shown are 4 to 182 amino acids long. The PAI-1 fragment after disruption of the complex consists of 61 amino acids.

Wynalazek jest bliżej wyjaśniony w przykładach wykonania nie ograniczających jego zakresu.The invention is explained in more detail in non-limiting examples.

Przykład LExample L.

Etap 1.Level 1.

A. Synteza oligonukleotydów.A. Oligonucleotide synthesis.

Syntezę 10 oligonukleotydowych fragmentów (fig. 2) przeprowadza się metodą amidofosforynową na stałym nośniku. Jako nośnik stosuje się szkło o kontrolowanej porowatości, typu LCA-CPG, ze związaną pierwszą jednostką nukleozydową. Jednostka ta ma przyłączoną na końcu 5’ -OH deoksyrybozy blokującą grupę kwasolabilną - dimetoksytrityl (DMT), którą usuwa się w środowisku kwaśnym. Odsłonięta w ten sposób grupa 5’-OH jednostki nukleozydowej przyłącza prekursor kolejnej jednostki 3’-amidofosforyn odpowiedniego nukleozydu. Za pomocą jodu w obecności wody dokonuje się utlenienia grupy fosforynowej do fosforanu. Następnie usuwa się DMT z przyłączonej jednostki - tym samym cykl rozpoczyna się na nowo. W celu usunięcia nieprzereagowanych jednostek z wolnymi grupami 5’-OH stosuje się t.zw. capping, tj. zablokowanie pomyłkowych sekwencji przez acetylowanie bezwodnikiem octowym w obecności aktywatorów. Po utworzeniu żądanego oligonukleotydu odcina się go od złoża i usuwa inne grupy wodnym roztworem amoniaku, oczyszcza elektroforetycznie następnie odsala metodą HPLC, (Waters C-18 RP, 10 gm). Oligonukleotydy przechowuje się w porcjach po około 0,5 OD.The synthesis of 10 oligonucleotide fragments (Fig. 2) is carried out by the phosphoramidite method on a solid support. A controlled pore glass, LCA-CPG type, bonded to the first nucleoside unit is used as the support. This unit has an acid labile blocking group dimethoxytrityl (DMT) attached to the 5'-OH end of deoxyribose, which is removed in an acidic environment. The thus exposed 5'-OH group of the nucleoside unit joins the precursor of the next 3'-phosphoramidite unit of the corresponding nucleoside. With the help of iodine in the presence of water, the phosphite group is oxidized to phosphate. The DMT is then removed from the attached unit - thereby starting the cycle all over again. In order to remove unreacted units with free 5'-OH groups, the so-called capping, ie blocking of wrong sequences by acetylation with acetic anhydride in the presence of activators. After formation of the desired oligonucleotide, it is cleaved from the bed and the other groups are removed with aqueous ammonia, purified by electrophoresis then desalted by HPLC (Waters C-18 RP, 10 gm). Oligonucleotides are stored in aliquots of about 0.5 OD.

B. Proces kinazowania i ligacji.B. The kinase and ligation process.

Poszczególne fragmenty nici DNA rozpuszcza się w wodzie destylowanej, tak aby w 5 gl znajdował się 1 gg fragmentu. Miesza się po 5 gl roztworu fragmentów od 1 do< 5 (I nić DNA) i od 5 do 10 (Π nić DNA). Do mieszaniny fragmentów dodaje się OJ objętości bufom do kinazowania (50 mM Tris-HCl, 5 gM MgCh), 5 gl 20mM ATP, 1 gl kinazy polinukleotydowej B (T4 polinukleotide kinase). Reakcję prowadzi się przez 4 godziny w temperaturze 37°C. Miesza się obie nici i inkubuje przez 20 minut w· temperaturze 100°C. Po powolnym ostudzeniu dodaje się do każdej próbki po 0,1 objętości buforu do ligacji, po 1 gl 200 mM ATP, 1 gl ligazy T4. Po dokładnym wymieszaniu reakcję prowadzi się przez 12 godzin w temperaturze 4°C.The individual fragments of the DNA strand are dissolved in distilled water so that there is 1 gg of the fragment in 5 gL. 5 g of fragment solution from 1 to <5 (1 strand of DNA) and 5 to 10 (1 strand of DNA) are mixed. To the fragment mixture, OJ volumes of kinase buffers (50 mM Tris-HCl, 5 gM MgCl 3), 5 gM of 20mM ATP, 1 g of polynucleotide kinase B (T4 polynucleotide kinase) are added. The reaction is carried out for 4 hours at 37 ° C. Both strands are mixed and incubated for 20 minutes at 100 ° C. After slow cooling, 0.1 volume of ligation buffer, 1 µl of 200 mM ATP, 1 µl of T4 ligase are added to each sample. After mixing thoroughly, the reaction is run for 12 hours at 4 ° C.

C. Hydroliza enzymami.C. Hydrolysis with enzymes.

Do rozpuszczonego DNA (80 gl) dodaje się 10x10 gl buforu EcoRi, 2U restryktazy EcoRI (firmy Pharmacia) oraz wody do objętości 100 gl. Mieszaninę inkubuje się w temperaturze 37°C przez 2 godziny. Po tym czasie DNA strąca się etanolem, dodając 3 objętości alkoholu etylowego (99.8%), wymraża się w -20°C przez 5 minut, a następnie odwirowuje się przy 15 tys. obr., przez 5 minut. Osad rozpuszcza się w 20 gl buforu TE. W ten sam sposób postępuje się podczas hydrolizy restryktazą Pst I.To the dissolved DNA (80 µl) is added 10x10 µl of EcoRi buffer, 2U of EcoRI restrictase (from Pharmacia) and water to a volume of 100 µl. The mixture is incubated at 37 ° C for 2 hours. After this time, the DNA was precipitated with ethanol by adding 3 volumes of ethyl alcohol (99.8%), frozen at -20 ° C for 5 minutes, and then centrifuged at 15,000. rotate for 5 minutes. The pellet is dissolved in 20 g of TE buffer. The same is done for the hydrolysis with Pst I-restrictionase.

D. Rozdział elektroforetyczny.D. Electrophoretic separation.

W celu sprawdzenia czy zligowane fragmenty DNA mają odpowiednią długość, rozdziela się je w 8% żelu poliakryloamidowym z SDS w TBE. Rozdział prowadzi się przy napięciu 130V w ciągu 3 godzin. Żel zabarwia się bromkiem etydyny (0,5 gg/ml - firmy Serva) przez 20 minut w temperaturze pokojowej, następnie płucze się 2 x wodą destylowaną. Rozdzielone produkty obserwuje się pod lampą Uv. W celu oceny wielkości fragmentów DNA podczas elektroforezy używa się następujących wzorców: pUC 19 trawiony Msp, pUC 19 trawiony Bsp RI. ZligowaneIn order to check that the ligated DNA fragments are of the correct length, they are separated on an 8% SDS polyacrylamide gel in TBE. Separation is carried out at 130V for 3 hours. The gel is stained with ethidium bromide (0.5 gg / ml - by Serva) for 20 minutes at room temperature, then rinsed twice with distilled water. The separated products are observed under a Uv lamp. The following standards were used to estimate the size of the DNA fragments during electrophoresis: pUC 19 digested with Msp, pUC 19 digested with Bsp RI. Obliged

164 992 fragmenty posiadają oczekiwaną długość. Po elektroforezie sprawdzającej wykonuje się elektroforezę preparatywną i uzyskuje się tą drogą fragment, który następnie liguje się z plazmidem pUC 19 trawionym Eco RI i PstI w sposób wyżej opisany.164,992 fragments are of the expected length. After checking electrophoresis, preparative electrophoresis is performed and a fragment is obtained in this way, which is then ligated with the pUC19 plasmid digested with Eco RI and PstI as described above.

E. Przygotowanie kompetentnych komórek.E. Preparation of competent cells.

Z płytki z wysianymi bakteriami DH5, pobiera się jedną kolonię, którą szczepi się na 5 ml pożywki LB. Bakterie hoduje się w temperaturze 37°C przez 18 godzin. Do 100 ml pożywki LB dodaje się 2 ml otrzymanej hodowli i prowadzi się hodowlę do gęstości optycznej OD 600=0,3. Zawiesinę bakterii zwirowuje się (5 tys. obr. 20 min.), a osad bakteryjny schładza się i zawiesza w 50 ml buforu SB i umieszcza w temperaturze 0°C. Zwirowuje się jak wyżej, a osad zawiesza w 1/2 objętości wyjściowej buforem Sb. Inkubuje się 20 minut w temperaturze 0°C. Po tym czasie z zawieszonych komórek pobiera się do sterylnych probówek po 200 pl zawiesiny komórek i inkubuje 30 minut w 0°C. Dodaje się 7 pl DTT i plazmidy (20 pl). Inkubuje się w lodzie (0°C) 30 minut, a następnie 45 sekund w 45°C. Ochładza się w lodzie i dodaje 800 pl pożywki LB, a następnie inkubuje 1 godzinę w 37°C. Po tym czasie posiewa się na płytki. Wylewa się 200 pl mieszaniny ligacyjnej na płytkę i inkubuje się w 37°C przez 18 godzin.From the DH5 plate, one colony is picked and inoculated onto 5 ml of LB medium. The bacteria are grown at 37 ° C for 18 hours. 2 ml of the obtained culture are added to 100 ml of LB medium and the culture is cultivated to an optical density of OD 600 = 0.3. The bacterial suspension is centrifuged (5,000 rotations, 20 minutes), and the bacterial pellet is cooled and suspended in 50 ml of SB buffer and placed at 0 ° C. It is centrifuged as above and the pellet is suspended in 1/2 of its original volume in buffer Sb. Incubation is made for 20 minutes at 0 ° C. After this time, 200 µl of the cell suspension are collected from the suspended cells into sterile tubes and incubated for 30 minutes at 0 ° C. 7 µl of DTT and plasmids (20 µl) are added. Incubation on ice (0 ° C) for 30 minutes followed by 45 seconds at 45 ° C. It is cooled on ice and 800 µl of LB medium is added, followed by incubation for 1 hour at 37 ° C. After this time, it is seeded into plates. 200 µl of the ligation mixture is poured onto the plate and incubated at 37 ° C for 18 hours.

F. Analiza otrzymanych transformantów.F. Analysis of the obtained transformants.

Po 18 godzinach na płytce z wysianą mieszaniną transformacyjną obserwuje się pojedyncze kolonie. Do dalszej analizy wybiera się 10 kolonii. 5 ml pożywki szczepi się pojedynczymi koloniami i hoduje w 37°C przez 18 godzin, a następnie izoluje plazmidowy DNA. Preparatyka plazmidowego DNA z 5 ml pożywki przebiega w następujący sposób.Single colonies are observed on the plate with the inoculated transformation mixture after 18 hours. 10 colonies are selected for further analysis. 5 ml of medium is inoculated with single colonies and cultured at 37 ° C for 18 hours, followed by isolation of plasmid DNA. Preparation of plasmid DNA from 5 ml of medium is as follows.

Bakterie zwirowuje się (5 minut 5 obrJmin.). Osad bakteryjny zawiesza się w 200 pl buforu RI i przetrzymuje 5 minut w temperaturze 0°C. Dodaje się 400 pl RII (0°C), a następnie 300 pl RUI (0°C). Całość zwirowuje się (15 tys. obr./min., 5 minut). Supernatant przenosi się znad osadu do nowej probówki i dodaje się 2,5 objętości izopropanolu. Wymraża się w -20°C, zwirowuje, osad płucze 70% etanolem i suszy pod próżnią. Osad rozpuszcza się w 200 pl TE i dodaje 20 pl roztworu RNazy o stężeniu 1 mg/ml. Inkubuje się 30 minut w 37°C. Dodaje się 200 pl fenolu. Zbiera się fazę wodną i dodaje 200 pl mieszaniny chloroform/alkohol izoamylowy (24:1, v/v). Zwirowuje się, zbiera supematant, czynność powtarza się jeszcze raz. Do fazy wodnej dodaje się 0,1 objętości 3 M octanu sodu (pH=5,2) oraz 2,5 objętości etanolu i wymraża 30 minut w -20°C. Zwirowuje się (15 tys. obr./min.), a osad przemywa 70% etanolem i suszy. Osad plazmidowego DNA rozpuszcza się w 40 pl buforu TE.The bacteria are centrifuged (5 minutes 5 rpm). The bacterial pellet is resuspended in 200 µl of RI buffer and kept for 5 minutes at 0 ° C. Add 400 µl RII (0 ° C) followed by 300 µl RUI (0 ° C). The whole is spun down (15,000 rpm, 5 minutes). The supernatant is transferred from the pellet to a new tube and 2.5 volumes of isopropanol are added. It is frozen at -20 ° C, centrifuged, rinsed with 70% ethanol and dried in vacuo. The precipitate is dissolved in 200 µl of TE and 20 µl of RNase solution at 1 mg / ml is added. Incubation is 30 minutes at 37 ° C. 200 µl of phenol are added. The aqueous phase is collected and 200 µl of chloroform / isoamyl alcohol (24: 1, v / v) are added. It spins, collects the supematant, the activity is repeated once more. 0.1 volumes of 3M sodium acetate (pH = 5.2) and 2.5 volumes of ethanol are added to the aqueous phase and frozen for 30 minutes at -20 ° C. It is centrifuged (15,000 rpm), and the precipitate is washed with 70% ethanol and dried. The plasmid DNA pellet is dissolved in 40 µl of TE buffer.

W celu wybrania klonu zawierającego plazmid pUC 19 z wklonowanym dwuniciowym fragmentem, przeprowadza się analizę otrzymanych DNA plazmidowych przy użyciu enzymów restrykcyjnych EcoRI i Pst I, a produkty trawienia rozdziela się w żelu poliakryloamidowym. Trawienie przeprowadza się jak w punkcie C, a rozdział elektroforetyczny jak w D.In order to select a clone containing the pUC19 plasmid with the cloned double-stranded fragment, analysis of the obtained plasmid DNA is performed with the restriction enzymes EcoRI and Pst I, and the digestion products are separated on a polyacrylamide gel. Etching is performed as in point C and electrophoretic separation as in D.

G. Sprawdzenie sekwencji sklonowanych fragmentów.G. Check the sequence of cloned fragments.

W celu upewnienia się czy sekwencja sklonowanego fragmentujest prawidłowa, fragmenty sekwencjonuje się metodą Maxama i Gilberta (Maxam & Gilbert, Methods in Enzymology, 1980, 65).To ensure that the sequence of the cloned fragment is correct, the fragments are sequenced by the method of Maxam and Gilbert (Maxam & Gilbert, Methods in Enzymology, 1980, 65).

H. Konstrukcja wektora ekspresyjnego.H. Construction of the expression vector.

Sprawdzony dwuniciowy fragment DNA kodujący polipeptyd Asnm- Thr232, liguje się z wektorem ekspresyjnym pWR.450 trawionym enzymami restrykcyjnymi EcoRI i Pst.I. Uzyskuje się zrekombinowany plazmid ekspresyjny pW-PAI-1. Transformowanie komórek bakteryjnych prowadzi się jak w punkcie E.A verified double-stranded DNA fragment encoding the Asnm-Thr232 polypeptide is ligated with the pWR.450 expression vector digested with the restriction enzymes EcoRI and Pst.I. A recombinant pW-PAI-1 expression plasmid is obtained. The transformation of bacterial cells is carried out as in point E.

I. Czyszczenie ciałekI. Cleaning of corpuscles

Bakterie z kolonii bakteryjnej zawierającej zrekombinowany plazmid przenosi się do probówki zawierającej 1 ml pożywki LB + 5 pl ampicyliny o stężeniu 100 g/ml i inkubuje przezBacteria from the bacterial colony containing the recombinant plasmid are transferred to a tube containing 1 ml LB medium + 5 µl ampicillin at a concentration of 100 g / ml and incubated for

2-5 godzin w temperaturze 37°C, z ciągłym wytrząsaniem. Zawiesinę bakterii namnożonych w tej probówce przenosi się do kolby zawierającej 11 pożywki LB + 1ml ampicyliny o stężeniu 100 pg/ml. Hodowlę prowadzi się 14 godzin, w temperaturze 37°C z ciągłym wytrząsaniem. Następnie bakterie zwirowuje się (15 min., 5000 obr./min.) i osad zawiesza się w 200 ml 0,1 M CaCl2 (buforowanym Trisem, pH=7,5). Po inkubacji przez 20 minut w łaźni lodowej, zawiesinę wiruje się przez 20 minut przy 12000 obr./min. w temperaturze +4°C i osad ponownie zawiesza się w 200 ml 0,1 M CaCl2. Po kolejnej inkubacji przez 2 godziny w łaźni lodowej zawiesinę wiruje się (w dwóch probówkach wirowniczych) j.w. Osad zawiesza się w 20 ml (do obu probówek dodaje się po 20 ml) buforu fosforanowego, pH 6.2, a następnie dodaje się po 200 gl i 1 M glicerolu i 400 μΐ 1% glicerolu do obu probówek. Ogrzewa się je do temperatury pokojowej, dodaje po 40 gl 0,5 M EDTA, pH 8,0 i po krótkiej inkubacji schładza w łaźni lodowej do temperatury około 0°C. Następnie probówki wstawia się na 1 minutę do łaźni o temperaturze 42°C (szok termiczny). Wiruje jak wyżej. Osad po schłodzeniu zawiesza się w 100 ml 100 mM Tris-Hcl, pH 8.0, zawierającym 10 mM EDTA, inkubuje przez 5 minut w temperaturze 0°C i odwirowuje. Osad zawiesza się w 35 ml 100 mM Tris-HCl, 10 mM EDTA, 100 mM β-ΜΕ, 1 mM PMSF, 1% Triton Χ-100, pH 8.0. Poddaje się go działaniu ultradźwięków -10 razy po 30 sek., po czym odwirowuje się (20 000 obr./min., 30 min., temp. +4°C) otrzymując w ten sposób osad ciałek inkluzyjnych, które następnie przemywa się zawieszając je w 35 ml buforu 50 mM Tris-HCl, pH 7,4,1 mM PMSF, 1 mM EDTA. Po ponownym ich żwirowaniu rozpuszcza się je w 9 M moczniku. W celu pozbycia się reszty zanieczyszczeń (nierozpuszczonych ciałek inkluzyjnych) zawiesinę ponownie wiruje się (20 000 obr./min., 30 min., temp. +4°C). W supematancie winna znajdować się główna część białka. Dalsze oczyszczania białka hybrydowego zawierającego fragment PAI-1 przeprowadza się na kolumnie chromatograficznej DEAESephacel.2-5 hours at 37 ° C with constant shaking. The suspension of bacteria grown in this tube is transferred to a flask containing 11 LB medium + 1 ml of 100 pg / ml ampicillin. The cultivation is carried out for 14 hours at 37 ° C with constant shaking. The bacteria are then centrifuged (15 min, 5000 rpm) and the pellet resuspended in 200 ml 0.1 M CaCl2 (Tris buffered, pH = 7.5). After incubating for 20 minutes in an ice bath, the suspension is centrifuged for 20 minutes at 12,000 rpm. at + 4 ° C and the pellet is resuspended in 200 ml 0.1 M CaCl2. After another incubation for 2 hours in an ice bath, the suspension is centrifuged (in two centrifuge tubes) as above. The pellet is resuspended in 20 ml (20 ml are added to both tubes) of phosphate buffer, pH 6.2, and then 200 µl and 1 M glycerol and 400 µl of 1% glycerol are added to both tubes. They are warmed to room temperature, 40 g of 0.5 M EDTA, pH 8.0 each, are added and, after a short incubation, cooled in an ice bath to about 0 ° C. The test tubes are then placed in a 42 ° C bath (thermal shock) for 1 minute. Whirls as above. After cooling, the pellet is resuspended in 100 ml of 100 mM Tris-Hcl, pH 8.0, containing 10 mM EDTA, incubated for 5 minutes at 0 ° C and centrifuged. The pellet is resuspended in 35 ml of 100 mM Tris-HCl, 10 mM EDTA, 100 mM β-, 1 mM PMSF, 1% Triton Χ-100, pH 8.0. It is subjected to ultrasound -10 times for 30 seconds, then centrifuged (20,000 rpm, 30 minutes, temperature + 4 ° C), thus obtaining a sediment of inclusion bodies, which are then washed with suspension. them in 35 ml of 50 mM Tris-HCl buffer, pH 7.4, 1 mM PMSF, 1 mM EDTA. After they are centrifuged again, they are dissolved in 9 M urea. In order to get rid of the remaining impurities (undissolved inclusion bodies), the suspension is again centrifuged (20,000 rpm, 30 min., Temperature + 4 ° C). The main part of the protein should be present in the supernatant. Further purifications of the hybrid protein containing the PAI-1 fragment are performed on a DEAESephacel chromatography column.

Białka zawarte w ciałkach inkluzyjnych rozpuszczone w 9 M moczniku dializuje się do roztworu 6 M mocznika, 50 mM Tris-HCl, pH 7.5, zawierającego 10 mM EDTA, 1 mM PMSF. Tym samym buforem równoważy się dwie kolumny wypełnione złożem DEAE-Sephacel (o wymiarach 2,5 x 10 cm). Na jedną z nich nanosi się roztwór białek. Część białka, która po przejściu przez kolumnę nie zwiąże się ze złożem, nanosi się (po 2-3 krotnym rozcieńczeniu tym samym buforem) na drugą kolumnę. Czyste białko hybrydowe wymywa się ze złoża 0,1 M NaCl.The proteins contained in the inclusion bodies dissolved in 9 M urea are dialyzed against a solution of 6 M urea, 50 mM Tris-HCl, pH 7.5, containing 10 mM EDTA, 1 mM PMSF. The same buffer is used to equilibrate two DEAE-Sephacel columns (2.5 x 10 cm). On one of them a protein solution is applied. The part of the protein which will not bind to the matrix after passing through the column is applied (after 2-3 fold dilution with the same buffer) to the second column. The pure hybrid protein is eluted from 0.1 M NaCl bed.

J. Rozbicie kompleksu na drodze reakcji chemicznej.J. Disruption of the complex by chemical reaction.

Oczyszczone białko hybrydowe złożone z fragmentu β-galaktozydazy oraz fragment Asn172-Thr232 PAI-1 dializuje się wobec buforu 10 mM Tris-HCl, pH 7.5 w celu usunięcia mocznika, a następnie liofilizuje. Rozszczepienie wiązania Asn-Gly przeprowadza się stosując 2M hydroksyloaminę w 6M chlorowodorku guanidyny, pH 9.3. Reakcję prowadzi się w temperaturze 45°C. Rozbicie koniugatu sprawdzano elektroforetycznie.The purified hybrid protein consisting of the β-galactosidase fragment and the Asn172-Thr232 PAI-1 fragment are dialyzed against 10 mM Tris-HCl buffer, pH 7.5 to remove urea, and then lyophilized. Cleavage of the Asn-Gly bond is performed using 2M hydroxylamine in 6M guanidine hydrochloride, pH 9.3. The reaction is carried out at a temperature of 45 ° C. The breakdown of the conjugate was checked by electrophoresis.

Produkty powstałe w wyniku tej reakcji analizuje się w żelu pcliakryloamidowym po elektroforezie.The products resulting from this reaction are analyzed on the pcliacrylamide gel after electrophoresis.

K. Sposób wyodrębniania fragmentu Asn172-Thr232 (PAI-1) ludzkiego inhibitora tkankowego aktywatora plazminogenu za pomocą HPLC.K. Method for isolation of the Asn172-Thr232 (PAI-1) fragment of the human tissue plasminogen activator inhibitor by HPLC.

Fragment polipeptydowy odpowiadający fragmentowi Asn172-Thr232 (PAI-1) ludzkiego inhibitora tkankowego aktywatora plazminogenu izoluje się z hydrolizatu otrzymanego w sposób opisany w punkcie I za pomocą HPLC. Rozdział chromatograficzny przeprowadzono na kolumnie semipreparatywnej TSK G3000SW firmy LKB, Szwecja.The polypeptide fragment corresponding to the Asn172-Thr232 (PAI-1) fragment of the human tissue plasminogen activator inhibitor is isolated from the hydrolyzate prepared as described in point I by HPLC. The chromatographic separation was performed on a TSK G3000SW semi-preparative column from LKB, Sweden.

Etap 2.Stage 2.

A. Otrzymanie przeciwciał.A. Obtaining antibodies.

W celu otrzymania surowicy poliklonalnej dla fragmentu białka ludzkiego PAI-1 immunizuje się tym białkiem króliki. Śródskórnie podaje się na drodze 30 - 40 injekcji dawki 50 gg antygenu w 0,5 ml PBS i wymieszanego z 0,5 ml kompletnego adiuwantu Freuda. Po 7 dniach od każdego szczepienia pobiera się krew z żyły usznej królików. Po wykrzepieniu w temperaturze 37°C przez 0,5 -1.0 godziny, skrzep oddziela się od ścianek probówki i całość pozostawia w temperaturze 4°C na 12 - 24 godziny. Następnie surowice odciąga się do jałowych probówek wirówkowych i wiruje przy 3000 obr/min przez 20 minut. Surowicę inaktywuje się podczas inkubacji przez 30 minut w temperaturze 56°C. Miano poszczególnych próbek surowic określa się metodą radioimmunologiczną, oznaczając ich zdolność do wiązania znakowanego antygenu. Surowice o najwyższym mianie przeciwciał przechowuje się w temperaturze -20°C.In order to obtain a polyclonal serum for a fragment of the human PAI-1 protein, rabbits are immunized with this protein. The intradermal route is 30-40 injections of 50 g of antigen in 0.5 ml of PBS mixed with 0.5 ml of Freud's complete adjuvant. The ear vein of rabbits is blood collected 7 days after each vaccination. After clotting at 37 ° C for 0.5-1.0 hours, the clot is detached from the walls of the tube and left at 4 ° C for 12-24 hours. The sera are then withdrawn into sterile centrifuge tubes and centrifuged at 3000 rpm for 20 minutes. The serum is inactivated by incubation for 30 minutes at 56 ° C. The titer of individual sera samples is determined by radioimmunoassay, determining their ability to bind the labeled antigen. Sera with the highest antibody titer are stored at -20 ° C.

B. Oczyszczanie przeciwciał.B. Purification of antibodies.

Przeciwciała dla fragmentu PAI-1 oczyszcza się z surowicy odpornościowej za pomocą chromatografii powinowactwa. Immunoadsorbent zawiera fragment białka PAI-1 związany ze złożem CNBr-Sepharose 4B (Pharmacia). W celu przygotowania immunoadsorbentu 1g złożaAntibodies to the PAI-1 fragment are purified from the antiserum by affinity chromatography. The immunoadsorbent contains a PAI-1 protein fragment bound to CNBr-Sepharose 4B resin (Pharmacia). In order to prepare the immunoadsorbent, 1 g of resin

164 992 przemywa się 200 ml roztworu 0,001 mol/l HCl i następnie zawiesza w buforze boranowym (pH 8.3). Natychmiast dodaje się 20 mg fragmentu białka PAI-1 rozpuszczonego w PBS i delikatnie miesza w temperaturze 4°C przez 2 godziny. Po odwirowaniu sprawdza się stężenie białka w supematancie. Złoże zawiesza się następnie w roztworze glicyny (2 mol/l) w buforze boranowym o pH 8.3. Po 1-godzinnej inkubacji odwirowuje się je (10 min. 4 000 obi./min.) i przemywa się je 3 x buforem boranowym (pH 8.3), 1 x wodą dest., 3 x buforem octanowym (pH 4.0), 1 x wodą dest. i 2 x buforem boranowym (pH 8.3). Z otrzymanym w ten sposób złożem inkubuje się 15 ml surowicy otrzymanej po immunizacji fragmentem białka PAI-1, delikatnie mieszając przez 12-14 godzin w temperaturze 4°C. Do mieszaniny dodaje się 1 mM PMSF (Sigma) oraz 1 mM chlorku benzamidyny (Biochemical). Po odwirowaniu (10min., 3000 obrJmin.) złoże przemywa się 4% buforem (PBS z 1% Tween 20), a następnie 4xbuforem (1 M/1 NaCl z 1% Tween 20 w PBS). Po każdym wirowaniu sprawdza się zawartość białek w supemantancie poprzez pomiar adsorpcji światła przy 400 nm. Następnie złoże umieszcza się w kolumnie (0.7 x 10 cm). Przeciwciała specyficznie związane z unieruchomionym na złożu białkiem eluuje się roztworem 0,5 mol/l kwasu octowego i zbiera się do probówek zawierających 100 l roztworu 2 mol/l Tris. Frakcje o dużej zawartości białka łączy się i dializuje wobec PBS przez 24 godziny w 4°C.The 164,992 is washed with 200 ml of 0.001 mol / l HCl solution and then suspended in borate buffer (pH 8.3). 20 mg of the PAI-1 protein fragment dissolved in PBS is immediately added and gently stirred at 4 ° C for 2 hours. After centrifugation, the protein concentration in the supernatant is checked. The bed is then suspended in a glycine solution (2 mol / l) in borate buffer pH 8.3. After incubation for 1 hour, they are centrifuged (10 min. 4,000 rpm) and washed 3 x with borate buffer (pH 8.3), 1 x with distilled water, 3 x with acetate buffer (pH 4.0), 1 x distilled water and 2 × borate buffer (pH 8.3). The resin obtained in this way is incubated with 15 ml of serum obtained after immunization with the PAI-1 protein fragment, with gentle agitation for 12-14 hours at 4 ° C. 1 mM PMSF (Sigma) and 1 mM benzamidine chloride (Biochemical) are added to the mixture. After centrifugation (10 min, 3000 rpm), the media is washed with 4% buffer (PBS with 1% Tween 20) followed by 4x buffer (1 M / 1 NaCl with 1% Tween 20 in PBS). After each centrifugation, the protein content of the supemantant is checked by measuring the light adsorption at 400 nm. The bed is then placed in a column (0.7 x 10 cm). Antibodies specifically bound to the protein immobilized on the resin are eluted with 0.5 mol / L acetic acid and collected in tubes containing 100 L of 2 mol / L Tris. High protein fractions are pooled and dialyzed against PBS for 24 hours at 4 ° C.

C. Sprzęganie przeciwciał z peroksydazą.C. Conjugation of antibodies to peroxidase.

U zyskane w ten sposób przeciwciała dla fragmentu białka PAI-1 sprzęga się z peroksydazą. W tym celu rozpuszcza się 5 mg HRPO w 1ml świeżo przygotowanego 0.3 M kwaśnego węglanu sodu (NaHCO3), pH 8.1. Następnie dodaje się 0,1 ml 1% FDNB w alkoholu absolutnym. Delikatnie wytrząsa się przez 1 godzinę w temperaturze pokojowej. Dodaje 0.04 - 0.08 M NaJO4 (rozpuszcz. w wodzie destyl.), delikatnie miesza przez 30 minut w temperaturze pokojowej. Kolor tego roztworu winien stać się zielonożółty. Nstępnie dodaje się 1,0 ml 0,16 M glikolu etylenowego (rozp. w wodzie dest.) i delikatnie miesza w temperaturze pokojowej przez 1 godzinę. Po zakończeniu inkubacji roztwór dializuje się wobec 0.01 M węglanu sodu, pH 9.5, temperatura 4°C (co najmniej 3 1-litrowe zmiany). Do 3 ml roztworu tak przygotowanego aldehydu peroksydazy (HRPO) dodaje się 5 mg IgG i delikatnie miesza przez 2-3 godziny w temperaturze pokojowej. IgG rozpuszcza się w 1 ml buforu węglanowego przed zmieszaniem lub dodaje w postaci zliofilizowanego proszku wolnego od soli. Po dodaniu IgG wprowadza się 5 mg NaBH4 i pozostawia w 4°C od 3 do 12 godzin. Następnie roztwór dializuje się w 4°C wobec PBS. Jeśli powstaje precypitat, usuwa się go przez wirowanie. Próbkę nanosi się na kolumnę (85 x 1,5 cm), Sephadex G-100, zrównoważoną PBS. Zbiera się frakcje po 1,5 ml i poziom białka w poszczególnych frakcjach oznacza spektrofotometrycznie. Frakcja IgG znakowanych HRPO schodzi w pierwszym szczycie. Roztwory tego koniugatu przechowuje się w obecności albuminy surowicy wołowej o stężeniu 10 mg/ml w temperaturze -20°C.The thus obtained antibodies to the PAI-1 protein fragment are conjugated to peroxidase. For this purpose, 5 mg of HRPO are dissolved in 1 ml of freshly prepared 0.3 M sodium bicarbonate (NaHCO3), pH 8.1. Then 0.1 ml of 1% FDNB in absolute alcohol is added. It is shaken gently for 1 hour at room temperature. Add 0.04 - 0.08 M NaJO4 (dissolved in distilled water), gently stir for 30 minutes at room temperature. The color of this solution should turn green-yellow. First, 1.0 ml of 0.16 M ethylene glycol (dissolved in distilled water) are added and the mixture is gently stirred at room temperature for 1 hour. After incubation, the solution is dialyzed against 0.01 M sodium carbonate, pH 9.5, temperature 4 ° C (at least 3 1 liter changes). 5 mg of IgG are added to 3 ml of the thus prepared peroxidase aldehyde (HRPO) solution and gently stirred for 2-3 hours at room temperature. IgG is dissolved in 1 ml of carbonate buffer before mixing or added as a salt-free lyophilized powder. After the addition of IgG, 5 mg of NaBH4 are introduced and the mixture is left at 4 ° C for 3 to 12 hours. The solution is then dialyzed at 4 ° C against PBS. If a precipitate is formed, it is removed by centrifugation. The sample is applied to a column (85 x 1.5 cm), Sephadex G-100, equilibrated in PBS. Fractions of 1.5 ml are collected and the protein level in the individual fractions is determined spectrophotometrically. The HRPO labeled IgG fraction comes down in the first peak. Solutions of this conjugate are stored in the presence of 10 mg / ml bovine serum albumin at -20 ° C.

Etap 3.Stage 3.

Opłaszczanie płytki przeciwciałami i wykonanie testu ELISA.Coating the plate with antibodies and performing an ELISA test.

Studzienki w płytce do testu ELISA opłaszcza się przeciwciałami poliklonalnymi dla fragmentu polipeptydowego Asn172-Thr232 białka PAI-1 o stężeniu 10 gg/ml, zawieszonymi w 50 mM buforze fosforanowym o pH 7.5. Niezwiązane białko odmywa się, a powierzchnię studzienek opłaszcza albuminą surowiczą. Testowane próbki osocza rozcieńcza się przed oznaczeniem 50 mM buforem fosforanowym, pH 7.5, zawierającym 0.15 M NaCl, 10 mM EDTA, 1% Tween 20 i 1% BSA i dodaje się po 200 gl/dołek. Inkubuje się przez 2 godziny w temperaturze pokojowej. Po zakończeniu inkubacji płytki 5-krotnie przemywa się 0,15 M NaCl zawierającym 0,1% Tween 20. Następnie dodaje 200 gl koniugatu IgG-HRP (przeciwciała poliklonalne dla całej cząsteczki PAI-1 związane z peroksydazą) o stężeniu 5 fig/ml. Inkubuje 2 godziny w temperaturze pokojowej i ponownie 5-krotnie przemywa. W celu wywołania reakcji enzymatycznej dodaje się po 200 gl roztworu substratu (0,4 mg/ml ortofenylodiaminy w 0,05 M buforze cytrynianowym, pH 5,0, zawierającym 0.02% H2O2). Po 15 minutach inkubacji pojawia się zabarwienie i reakcję jamuje się przez dodanie 50 gl 3 M kwasu siarkowego. Adsorbancję mierzy się przy 490 nm.The wells of the ELISA plate are coated with polyclonal antibodies to the polypeptide fragment of the PAI-1 protein Asn172-Thr232 at a concentration of 10 gg / ml, suspended in 50 mM phosphate buffer at pH 7.5. Unbound protein is washed away and the surface of the wells is coated with serum albumin. The test plasma samples are diluted prior to assay with 50 mM phosphate buffer, pH 7.5, containing 0.15 M NaCl, 10 mM EDTA, 1% Tween 20 and 1% BSA, and 200 g / well are added. Incubate for 2 hours at room temperature. After incubation, the plates are washed 5 times with 0.15 M NaCl containing 0.1% Tween 20. Then 200 g of IgG-HRP conjugate (polyclonal antibodies for the whole PAI-1 molecule bound to peroxidase) are added at a concentration of 5 g / ml. Incubates 2 hours at room temperature and washes again 5 times. 200 g of substrate solution (0.4 mg / ml of orthophenyldiamine in 0.05 M citrate buffer, pH 5.0 containing 0.02% H 2 O 2) are added to induce the enzymatic reaction. Color appears after 15 minutes of incubation and the reaction is jammed by adding 50 µl of 3M sulfuric acid. Adsorbance is measured at 490 nm.

Przykład II. Detekcja antygenu PAI-1 w badanej próbce za pomocą przeciwciał dla fragmentu polipeptydowego odpowiadającego fragmentowi Asn172-Thr232 ludzkiego inhibitora tkankowego aktywatora plazminogenu.Example II. Detection of the PAI-1 antigen in the test sample with antibodies to the polypeptide fragment corresponding to the Asn172-Thr232 fragment of the human tissue plasminogen activator inhibitor.

164 992164 992

Do unieruchomionego antygenu dodaje się wyznakowane peroksydazą przeciwciała dla fragmentu polipeptydowego odpowiadającego fragmentowi Asnr72-Thr232 ludzkiego inhibitora tkankowego aktywatora plazminogenu i inkubuje się przez 2 godziny w temperaturze pokojowej. Do wywołania reakcji enzymatycznej stosuje się roztwór substratu - ortofenylodiaminy w 0,05 M buforze cytrynianowym pH 5,0, zawierającym 0,02% H2O2). Po 6 minutach inkubacji pojawia się zabarwienie i reakcję hamuje się przez dodanie 50 μΐ 3M kwasu siarkowego. Adsorbancję mierzy się przy 490 nm. Wynik odczytuje się z krzywej wzorcowej dla standardowego roztworu PAI-1.The peroxidase-labeled antibodies for the polypeptide fragment corresponding to the Asnr72-Thr232 fragment of the human tissue plasminogen activator inhibitor are added to the immobilized antigen and incubated for 2 hours at room temperature. To induce the enzymatic reaction, a substrate solution - orthophenyldiamine in 0.05 M citrate buffer pH 5.0 containing 0.02% H2O2) is used. After 6 minutes of incubation, color appears and the reaction is stopped by the addition of 50 µM of 3M sulfuric acid. Adsorbance is measured at 490 nm. The result is read from the standard curve for the standard PAI-1 solution.

Przykład DI. Diagnostyczny zestaw testowy dla oznaczania poziomu ludzkiego inhibitora tkankowego aktywatora plazminogenu składa się z: pojemnika zawierającego zbuforowany roztwór soli fizjologicznej (PBS), pH 7.5, EDTA, Tween 20; pojemniczka z albuminą surowiczą; pojemniczka z przeciwciałami dla fragmentu polipeptydowego odpowiadającego fragmentowi Asnr72-Thr232 ludzkiego inhibitora tkankowego aktywatora plazminogenu; pojemniczka z wyznakowanymi peroksydazą przeciwciałami dla PAI-1; pojemniczka z substratem (ortofenylodiaminą); pojemniczka z buforem cytrynianowym, pH 5.0 i pojemniczka z 3 M kwasem siarkowym.Example DI. A diagnostic test kit for determining the level of human tissue plasminogen activator inhibitor consists of: a container containing a buffered saline solution (PBS), pH 7.5, EDTA, Tween 20; a container with serum albumin; an antibody container for the polypeptide fragment corresponding to the Asnr72-Thr232 fragment of the human tissue plasminogen activator inhibitor; a container with peroxidase labeled antibodies to PAI-1; a container with a substrate (orthophenyldiamine); a container with citrate buffer, pH 5.0 and a container with 3 M sulfuric acid.

164 992164 992

GAATCTAACGGCCAGTGGfiAGACACCAATCCGAGACAClAGCACCCACCGCCGCCTCTiCCAGAATCTAACGGCCAGTGGfiAGACACCAATCCGAGACAClAGCACCCACCGCCGCCTCTiCCA

GAUGCCGGTCACCTTCTGTGGT.A AGGGTCTGT<CATCGT.JGGIGGCGGCGGAGAAGGIGAUGCCGGTCACCTTCTGTGGT.A AGGGTCTGT <CATCGT.JGGIGGCGGCGGAGAAGGI

CAAAICAGΛCGGΛΛGCCCCITCTCTGTGCCAATGAIGGCIGAGΛCCAAC/tAAIICAACIAIACAAAICAGΛCGGΛΛGCCCCITCTCTGTGCCAATGAIGGCIGAGΛCCAAC / tAAIICAACIAIA

GIIIAGICIGCCIICGIGACA,GAGΛCΛCGGTTΛCTΛCCGACTGTGGIIGIIIAAGIIGAIAIGIIIAGICIGCCIICGIGACA, GAGΛCΛCGGTTΛCTΛCCGACTGTGGIIGIIIAAGIIGAIAI

CIGAAIICACCACGCCAGATGGACATTACIACGACAICCIGGAACIGCCAιIACCACGGAQACCIGAAIICACCACGCCAGATGGACATTACIACGACAICCIGGAACIGCCAιIACCACGGAQAC

GACTIAAGTGGTGCGGTCTΛCCTGTAATGATGCTGTAGGACCIIGACGGIΛIGGIGCCICTGGACTIAAGTGGTGCGGTCTΛCCTGTAATGATGCTGTAGGACCIIGACGGIΛIGGIGCCICTG

ACT ^AATCTACT ^ AATCT

3' 5'3 '5'

1. CGGICACCIICIGIGGIAAGGGICIGIC1. CGGICACCIICIGIGGIAAGGGICIGIC

2. AICGIGGGIGGCGGCCGAOAAAGTITITΛA;TCTGCCIICG dddna nić;2. AICGIGGGIGGCGGCCGAOAAAGTITITΛA ; TCTGCCIICG dddna thread;

3.IGACAGAGACΛCGGTTΛCTACCG.ACTCIGGIIG3.IGACAGAGACΛCGGTTΛCTACCG.ACTCIGGIIG

4.IIIAAGIIGAIAIGACIIAAGIGGIGCGGTCIACCIGIAA4.IIIAAGIIGAIAIGACIIAAGIGGIGCGGTCIACCIGIAA

5. IGAIG.CIGIA.GGACCTIGACGGTΛTGGTGCCCτCTGIGAAICI5. IGAIG.CIGIA.GGACCTIGACGGTΛTGGTGCCCτCTGIGAAICI

6. ICACAGAGGCA.CCAI.ACCGICAA^GGTCCTACAGCAICAιΊIAC6. ICACAGAGGCA.CCAI.ACCGICAA ^ GGTCCTACAGCAICAιΊIAC

7. A^GGIAGACCGCACCACTIAAGICAIAICAACI7. A ^ GGIAGACCGCACCACTIAAGICAIAICAACI

9. IAAACΛΆCCAGAGTCGGΪ/ΰTΛΛCCGTG7C7CIGIΓACGA górne nić9.IAAACΛΆCCAGAGTCGGΪ / ΰTΛΛCCGTG7C7CIGIΓACGA upper thread

9. AGGCAGACTΛA.ACACCTTCICCGCCGCCACCC.AC9. AGGCAGACTΛA.ACACCTTCICCGCCGCCACCC.AC

10. GAIGACAGACCCIIACCACAGAAGGTGACCGGCAAICIAAG.10. GAIGACAGACCCIIACCACAGAAGGTGACCGGCAAICIAAG.

Fig. 2Fig. 2

Eco RIEco RI

Pst IPst I

pWR450pWR450

EcoRi, Pst I »4 ~EcoRi, Pst I »4 ~

Fig.3Fig.3

164 992164 992

PAI-1PAI-1

. 4 BCTA - GALAKTOZYDAZA : BIAŁKO PAI. 4 BCTA - GALACTOSIDASE: PAI PROTEIN

produkty degradacji bela-galaktozydazy białko PAIdegradation products of bela-galactosidase protein PAI

oczyszczenie produktów hydrolizypurification of the hydrolysis products

Fig.5Fig 5

Departament Wydawnictw UP RP. Nakład 90 egz. Cena 10 000 złPublishing Department of the UP RP. Circulation of 90 copies. Price: PLN 10,000

Claims (4)

Zastrzeżenia patentowePatent claims 1. Sposób konstruowania zrekombinowanego wektora do klonowania i/lub ekspresji w komórkach gospodarza bakteryjnego do wytworzenia polipeptydu zdolnego do produkcji przeciwciał reagujących specyficznie z białkiem ludzkiego inhibitora tkankowego aktywatora plazminogenu i tym polipeptydem i/lub reagującego specyficznie z przeciwciałami dla inhibitora tkankowego aktywatora plazminogenu oraz z przeciwciałami dla tego polipeptydu, przez łączenie fragmentów DNA, znamienny tym, że wektor łączy się z DNA kodującym polipeptyd odpowiadający fragmentowi o wzorze (Y)a-A-(Z)b, w którym Y oznacza sekwencję aminokwasów kodowaną przez fragment polilinkera, korzystnie Glu, Ser; a = 0 lub 1; Z oznacza sekwencję Glu, Ser i/lub sekwencję kodowaną przez fragment polilinkera; b = 0, 1 lub 2; natomiast A oznacza sekwencję odpowiadającą fragmentowi Asn172-Thr232 ludzkiego inhibitora tkankowego aktywatora plazminogenu.A method of constructing a recombinant vector for cloning and / or expression in bacterial host cells to produce a polypeptide capable of producing antibodies specifically reactive with a human tissue plasminogen activator inhibitor protein and the polypeptide and / or reacting specifically with antibodies to the tissue plasminogen activator inhibitor and with antibodies for said polypeptide, by joining DNA fragments, characterized in that the vector is linked to DNA encoding a polypeptide corresponding to the fragment of formula (Y) a -A- (Z) b, wherein Y is the amino acid sequence encoded by the polylinker fragment, preferably Glu, Cheese; a = 0 or 1; Z represents the sequence Glu, Ser and / or the sequence encoded by the polylinker fragment; b = 0, 1 or 2; and A is the sequence corresponding to the Asn172-Thr232 fragment of the human tissue plasminogen activator inhibitor. 2. Sposób według zastrz. 1, znamienny tym, że stosuje się DNA kodujący polipeptyd o sekwencji:2. The method according to p. The method of claim 1, wherein the DNA encoding the polypeptide has the sequence: Asn-Gl y-Gln-Trp-Lys-Thr-Fro-Phe-Pro-Asp-Ser- -Ser-Thr-His-Arg Arg-L eu-Fhe-His-Ly=-Ser-Asp-Gl y -Ser-Thr-b-Sprl-Fro-MetMet-A la-Glu-Thr-Asn-Lvs-Fhe-Asn-T yr-Thr-G l u-Fhe-Thr-Thr-Fro Asp-Gly-His-Tyr—T yr-Asp-1le-Leu-Glu-Leu-Pro-Tyr-Ηχ s-G1y-AspThr.Asn-Gl y-Gln-Trp-Lys-Thr-Fro-Phe-Pro-Asp-Ser- -Ser-Thr-His-Arg Arg-L eu-Fhe-His-Ly = -Ser-Asp-Gl y - Ser-Thr-b-Sprl-Fro-MetMet-A la-Glu-Thr-Asn-Lvs-Fhe-Asn-T yr-Thr-G l u-Fhe-Thr-Thr-Fro Asp-Gly-His-Tyr —T yr-Asp-1le-Leu-Glu-Leu-Pro-Tyr-Ηχ s-G1y-AspThr. 3. Sposób według zastrz. 1, znamienny tym, że stosuje się zsyntezowany chemicznie DNA.3. The method according to p. The process of claim 1, wherein chemically synthesized DNA is used. 4. Sposób według zastrz. 3, znamienny tym, że stosuje się zsyntezowany chemicznie DNA o sekwencji:4. The method according to p. 3. A method according to claim 3, characterized in that the chemically synthesized DNA has the sequence: f O^AACGGCCAGTGGAAGACACCATTCCrAGACAGTAGCACCCACCGCCGCCTCTTf O ^ AACGGCCAGTGGAAGACACCATTCCrAGACAGTAGCACCCACCGCCGCCTCTT CCACAAATCAGACGGAAGCACTGTCTCTGTGCCAATGATGGCTGAGACCAACAAAT TCCACAAATCAGACGGAAGCACTGTCTCTGTGCCAATGATGGCTGAGACCAACAAAT T CAACTATACTGAATTCACCACGCCAGATGGACATTACTACGACATCCTGGAACTGCCCAACTATACTGAATTCACCACGCCAGATGGACATTACTACGACATCCTGGAACTGCC ATACCACGGAGACACT ι X) m, gdzie X oznacza GAATCT, n przyjmuje wartość 1 lub 0, a m przyjmuje wartość 0,1 lub 2.ATACCACGGAGACACT ι X) m , where X is GAATCT, n is 1 or 0, and m is 0.1 or 2.
PL30054590A 1990-04-25 1990-04-25 Method of constructing a recombinet vector for cloning and/or expressing in bacterial host cells the production of polypeptide capable to generate antibodies specifically reacting with protein of the human tisue inhibitor of plasminogen activator PL164992B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PL30054590A PL164992B1 (en) 1990-04-25 1990-04-25 Method of constructing a recombinet vector for cloning and/or expressing in bacterial host cells the production of polypeptide capable to generate antibodies specifically reacting with protein of the human tisue inhibitor of plasminogen activator

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PL30054590A PL164992B1 (en) 1990-04-25 1990-04-25 Method of constructing a recombinet vector for cloning and/or expressing in bacterial host cells the production of polypeptide capable to generate antibodies specifically reacting with protein of the human tisue inhibitor of plasminogen activator

Publications (1)

Publication Number Publication Date
PL164992B1 true PL164992B1 (en) 1994-10-31

Family

ID=20060940

Family Applications (1)

Application Number Title Priority Date Filing Date
PL30054590A PL164992B1 (en) 1990-04-25 1990-04-25 Method of constructing a recombinet vector for cloning and/or expressing in bacterial host cells the production of polypeptide capable to generate antibodies specifically reacting with protein of the human tisue inhibitor of plasminogen activator

Country Status (1)

Country Link
PL (1) PL164992B1 (en)

Similar Documents

Publication Publication Date Title
Gitt et al. Evidence that a human soluble beta-galactoside-binding lectin is encoded by a family of genes.
Aota et al. The short amino acid sequence Pro-His-Ser-Arg-Asn in human fibronectin enhances cell-adhesive function.
AU697227B2 (en) Enzyme for cleavage of the anchor region of surface proteins from gram positive bacteria
BENGTSSON‐OLIVECRONA et al. Lipoprotein lipases from cow, guinea‐pig and man: Structural characterization and identification of protease‐sensitive internal regions
US5457029A (en) Nuclear antigen La
Donahue et al. Three-dimensional structure of the platelet integrin recognition segment of the fibrinogen gamma chain obtained by carrier protein-driven crystallization.
EP0255011A2 (en) Human inter-alpha-trypsin inhibitor gene
US5445820A (en) Streptolysin O peptide antigens and methods for the determination of streptolysin antibodies
Routsias et al. Epitope mapping of the Ro/SSA60KD autoantigen reveals disease‐specific antibody‐binding profiles
CA2103551A1 (en) Method for production of an iga binding protein derived from group b streptococci
Kotula et al. Functional characterization of recombinant human red cell alpha-spectrin polypeptides containing the tetramer binding site
Morgan et al. The structure of streptokinase I. Cyanogen bromide fragmentation, amino acid composition and partial amino acid sequences
Ahmed et al. Opioid binding properties of the purified kappa receptor from human placenta
KUPRYSZEWSKI et al. Solid‐phase synthesis of trypsin inhibitor CMTI III from squash seeds (Cucurbita maxima)
Hitchcock-DeGregori et al. Tropomyosin lysine reactivities and relationship to coiled-coil structure
PL164992B1 (en) Method of constructing a recombinet vector for cloning and/or expressing in bacterial host cells the production of polypeptide capable to generate antibodies specifically reacting with protein of the human tisue inhibitor of plasminogen activator
PL164991B1 (en) Method of producing polyclonal antibodies specifically reacting with protein of the human tissue inhibitor of plasminogen activator
Cahill et al. An immunochemical approach to the identification of the MBTA binding site of the nicotinic acetylcholine receptor of Torpedocalifornica
PL164952B1 (en) Method of determining and/or detecting the antigen of human tissue inhibitor of plasminogen activator and diagnostic test therefor
PL165793B1 (en) A method of producing a polypeptide capable of producing antibodies that react specifically with the human tissue plasminogen activator inhibitor protein
PL165020B1 (en) Method of determining and/or detecting the antigen of human tissue inhibitor of plasminogen activator and diagnostic test therefor
JP2634683B2 (en) Antibodies to fibrin; immunogenic peptides suitable for antibody preparation, methods for determining fibrin, and antibody-based preparations
PL164564B1 (en) Method for making polypeptides, recombined vector and method for its forming, method for making antibodies, method and test for determination of human tissue activator of plasminogen or antibodies for that protein
PL164144B1 (en) Method for making polypeptides, recombined vector and method for its forming, method for making antibodies, method and test for determination of human tissue activator of plasminogen or antibodies for that protein
US5039791A (en) Peptide fragments of tissue plasminogen activator