OA22136A - Pyrrole compounds. - Google Patents

Abstract

Provided herein are compounds of Formula (I), <img file="OA22136A_A0001.tif"/> or pharmaceutically acceptable salts thereof, pharmaceutical compositions that include a compound described herein (including pharmaceutically acceptable salts of a compound described herein) and methods of synthesizing the same. Also provided herein are methods of treating diseases and/or conditions with a compound of Formula (I), or a pharmaceutically acceptable salt thereof.

Description

PYRROLE COMPOUNDS

INCORPORATION BY REFERENCE ΤΟ ANY PRIORITY APPLICATIONS

[0001] Any and ail applications for which a foreign or domestic priority claim is identifled, for example, in the Application Data Sheet or Request as filed with the présent application, are hereby incorporated by reference under 37 CFR 1.57, and Rules 4.I8 and 20.6, including U.S. Provisional Application Nos. 62/828919, filed April 3, 2019 and 62/932686, filed November 8, 2019.

BACKGROUND

Field

[0002] The présent application relates to the fields of chemistry, biochemistry and medicine. Disclosed herein are compounds of Formula (l), or pharmaceutically acceptable salts thereof, pharmaceutical compositions that include a compotind described herein (including pharmaceutically acceptable salts of a compound described herein) and methods of synthesizing the same. Also disclosed herein are methods of treating diseases and/or conditions with a compound of Formula (I), or a pharmaceutically acceptable sait thereof.

Description

[0003] The hepatitis B virus (HBV) is a DNA virus and a member of the Hepadnaviridae family. HBV infects more than 300 million worldwide, and is a causative agent of liver cancer and liver disease such as chronic hepatitis, cirrhosis, and hepatocellular carcinoma. Although there are approved drugs for treating HBV, by either boosting the immune System or slowing down the réplication of the HBV virus, HBV continues to be a problem due to the drawbacks associated with each of the approved drugs.

SUMMARY |0004] Some embodiments disclosed herein relate to a compound of Formula (I), or a pharmaceutically acceptable sait thereof.

[0005] Some embodiments disclosed herein relate to a pharmaceutical composition that can contain an effective amount of a compound of Formula (I), or a pharmaceutically acceptable sait thereof.

[00061 Some embodiments described herein relate to a method of treating a HBV 5 and/or HDV infection that can include administering to a subject identified as suffering from the HBV and/or HDV infection an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein. Other embodiments described herein relate to a compound, or a pharmaceutically

I0 acceptable sait thereof, as described herein. or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein for the use of treating a HBV and/or HDV infection.

[0007] Some embodiments disclosed herein relate to a method of inhibiting réplication of HBV and/or HDV that can include contacting a cell infected with the HBV 15 and/or HDV with an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein. Other embodiments described herein relate to a compound, or a pharmaceutically acceptable sait thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein for the use of inhibiting the réplication HBV and/or HDV.

[0008] These are other embodiments are described in greater detail below

DETAILED DESCRIPTION

[0009] HBV is a partially double-stranded circulât DNA of about 3.2 kilobase (kb) pairs, and is classifîed into eight génotypes, A to H. The HBV réplication pathway has been studied in great detail. TJ. Lîang, Hepatology (2009) 49(5 Suppl):Sl 3-S21. On part of réplication includes the formation of the covalently closed circulât (cccDNA) form. The presence of the cccDNA gives rise to the risk of viral reemergence throughout the life of the host organism. HBV carriers can transmit the disease for many years. An estimated 300 million people are living with hepatitis B virus infection, and it is estimated that over

750,000 people worldwide die of hepatitis B each year. In addition, immunosuppressed individuals or individuals undergoing chemotherapy are especially at risk for réactivation of a HBV infection. HBV can be acute and/or chronic. Acute HBV infection can be either asymptomatic or présent with symptomatic acute hepatitis.

[0010] HBV can be transmitted by blood, semen, and/or another body fluid. This can occur through direct blood-to-blood contact, unprotected sex, sharing of needles, and from an infected mother to her baby during the delivery process. The HBV surface antigen (HBsAg) is most frequently used to screen for the presence of this infection. Currently available médications do not cure a HBV and/or HDV infection. Rather, the médications suppress réplication of the virus.

[0011] The hepatitis D virus (HDV) is a DNA virus, also in the Hepadnaviridae family of viruses. HDV can propagate only in the presence of HBV. The routes of transmission of HDV are similar to those for HBV. Transmission of HDV can occur either via simultaneous infection with HBV (coinfection) or in addition to chronic hepatitis B or hepatitis B carrier State (superinfection). Both superinfection and coinfection with HDV results in more severe complications compared to infection with HBV alone. These complications include a greater likelihood of experiencing liver faîlure in acute infections and a rapid progression to liver cirrhosis, with an increased risk of developing liver cancer in chronic infections. In combination with hepatitis B, hepatitis D has the highest fatality rate of ail the hepatitis infections, at 20%. There is currently no cure or vaccine for hepatitis D. Définitions |0012| Unless detlned otherwise, ail technical and scientific terms used herein hâve the same meaning as is commonly understood by one of ordinary skill in the art. Ail patents, applications, published applications and other publications referenced herein are incorporated by reference in their entirety unless stated otherwise. In the event that there are a plurality of définitions for a term herein, those in this section prevail unless stated otherwise.

[00131 Whenever a group is described as being “optionally substituted” that group may be unsubstituted or substituted with one or more of the indicated substituents. Likewîse, when a group is described as being “unsubstituted or substituted” if substituted, the substituent(s) may be selected from one or more of the indicated substituents. If no substitueras are indicated, it is meant that the indicated “optionally substituted” or “substituted” group may be substituted wîth one or more group(s) individually and independently selected from deuterium, alkyl, alkenyl, alkynyl, cycloalkyl. cycloalkenyi, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl), (heterocyclyl)alkyI, hydroxy, 5 alkoxy, acyl, cyano, halogen, thiocarbonyl, O-carbamyl, N-carbamyl, O-thiocarbamyl,

N-thiocarbamyl, C-amido, N-amido, S-sulfonamido, N-sulfonamido, C-carboxy, O-carboxy, isocyanato, thiocyanato, nitro, azido, silyl, sulfenyl, sulfinyl, sulfonyl, haloalkyl, haloalkoxy, trihalomethanesulfonyl, trihalomethanesulfonamido, an amino, a mono-substituted amino group and a di-substituted amino group.

|00l4| As used herein, “C_a to Cb” in which “a” and “b” are integers refer to the number of carbon atoms in an alkyl, alkenyl or alkynyl group, or the number of carbon atoms in the ring of a cycloalkyl, cycloalkenyi. ary l, heteroary l or heterocyclyl group. That is, the alkyl, alkenyl, alkynyl, ring of the cycloalkyl, ring of the cycloalkenyi, ring of the aryl, ring of the heteroaryl or ring of the heterocyclyl can contain from “a” to “b”, inclusive, carbon

I5 atoms. Thus, for example, a “Ci to C4 alkyl” group refers to ail alkyl groups having from l to 4 carbons, that is, CH3-, CH3CH2-, CH3CH2CH2-, (CHj^CH-, CH3CH2CH2CH2-, CHjCHiCHtCHj)- and (CHaJaC-, If no “a” and “b” are designated with regard to an alkyl, alkenyl, alkynyl, cycloalkyl cycloalkenyi, aryl, heteroaryl or heterocyclyl group, the broadest range described in these définitions is to be assumed.

[0015] As used herein, “alkyl” refers to a straight or branched hydrocarbon chain that comprises a fully saturated (no double or triple bonds) hydrocarbon group. The alkyl group may hâve I to 20 carbon atoms (whenever it appears herein, a numerical range such as “1 to 20” refers to each integer in the given range; e.g., “1 to 20 carbon atoms” means that the alkyl group may consist of I carbon atom, 2 carbon atoms, 3 carbon atoms. etc., up to and including 20 carbon atoms, although the présent définition also covers the occurrence of the term “alkyl” where no numerical range is designated). The alkyl group may also be a medium size alkyl having 1 to 10 carbon atoms. The alkyl group could also be a lower alkyl having 1 to 6 carbon atoms. The alkyl group of the compounds may be designated as “C1-C4 alkyl” or similar désignations. By way of example only, “C1-C4 alkyl” indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from methyl, ethyl, propyl, iso-propyl, n-butyl, iso-butyl, sec-butyl and t-butyl. Typical alkyl groups include, but are in no way limited to, methyl, ethyl, propyl. isopropyl, butyl, isobutyl, tertiary butyl, pentyl and hexyl. The alkyl group may be substituted or unsubstituted.

[00l6| As used herein, “alkenyl” refers to an alkyl group that contains in the straight or branched hydrocarbon chain one or more double bonds. The length of an alkenyl can vary. For example, the alkenyl can be a C2-4 alkenyl, C2-6 alkenyl or C2-8 alkenyl. Examples of alkenyl groups include allenyl, vinylmethyl and ethenyl. An alkenyl group may be unsubstituted or substituted.

[0017] As used herein, “alkynyl” refers to an alkyl group that contains in the straight or branched hydrocarbon chain one or more triple bonds. The length of an alkynyl can vary. For example, the alkynyl can be a C2-4 alkynyl, C2-6 alkynyl or C2-8 alkynyl. Examples of alkynyls include ethynyl and propynyl. An alkynyl group may be unsubstituted or substituted.

|0018] As used herein, “cycloalkyl” refers to a completely saturated (no double or triple bonds) mono- or multi- cyclic hydrocarbon ring System. When composed of two or more rings, the rings may be joined together in a fused fashion. Cycloalkyl groups can contain 3 to 10 atoms in the ring(s). 3 to 8 atoms in the ring(s) or 3 to 6 atoms in the ring(s). A cycloalkyl group may be unsubstituted or substituted. Typical cycloalkyl groups include, but are in no way limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl.

[0019] As used herein, “cycloalkenyl” refers to a mono- or multi- cyclic hydrocarbon ring System that contains one or more double bonds in at least one ring; although, if there is more than one, the double bonds cannot form a fully delocalized pielectron System throughout ail the rings (otherwise the group would be “aryl,” as defined herein). When composed of two or more rings, the rings may be connected together in a fused fashion. A cycloalkenyl can contain 3 to 10 atoms in the ring(s) or 3 to 8 atoms in the ring(s). A cycloalkenyl group may be unsubstituted or substituted.

[0020] As used herein, “aryl” refers to a carbocyclic (ail carbon) monocyclic or multicyclic aromatic ring System (including fused ring Systems where two carbocyclic rings share a Chemical bond) that has a fully delocalized pi-electron System throughout ail the rings. The number of carbon atoms in an aryl group can vary. For example, the ary l group can be a Cô-Cu aryl group, a Cô-Cio aryl group, or a C& aryl group. Examples of aryl

groups include, but are not limited to, benzene, naphthalene and azulene. An aryl group may be substituted or unsubstituted.

[0021] As used herein, “heteroaryl” refers to a monocyclic, bicyclic and tricyclic aromatic ring System (a ring System with fuily delocalized pi-electron System) that contain(s) 5 one or more heteroatoms (for e.xample. I to 5 heteroatoms), that is, an element other than carbon, including but not limited to, nitrogen. oxygen and sulfur. The number of atoms in the ring(s) of a heteroaryl group can vary. For example, the heteroaryl group can contain 4 to 14 atoms in the ring(s), 5 to 10 atoms in the ring(s) or 5 to 6 atoms in the ring(s). Furthermore, the term “heteroaryl” includes fused ring Systems where two rings, such as at least one ary l 10 ring and at least one heteroaryl ring, or at least two heteroaryl rings, share at least one Chemical bond. Examples of heteroaryl rings include, but are not limited to, furan. furazan, thiophene, benzothiophene, phthalazine, pyrrole, oxazole, benzoxazole, 1,2,3-oxadiazole, 1,2,4-oxadiazole, thiazole, 1,2,3-thiadiazole, 1,2,4-thiadiazole, benzothiazole, imidazole, benzimidazole, indole, indazole, pyrazole, benzopyrazole, isoxazole, benzoisoxazole, 15 isothiazole, triazole, benzotriazole, thiadiazole, tetrazole, pyridine, pyridazine, pyrimidine, pyrazine, purine, pteridine, quinoline, isoquinoline, quinazoline, quinoxaline, cinnoline and triazine. A heteroary l group may be substituted or unsubstituted.

[0022] As used herein, “heterocyclyl” refers to a monocyclic. bicyclic and tricyclic ring System wherein carbon atoms together with from 1 to 5 heteroatoms constitute 20 said ring System. A heterocycle may optionally contain one or more unsaturated bonds situated in such a way, however, that a fully delocalized pi-electron System does not occur throughout ail the rings. The number of atoms in the ring(s) of a heterocycly l group can vary. For example, the heterocycly l group can contain 4 to 14 atoms in the ring(s), 5 to 10 atoms in the ring(s) or 5 to 6 atoms in the ring(s). The heteroatom(s) is an element other than 25 carbon including, but not limited to, oxygen, sulfur and nitrogen. A heterocycle may further contain one or more carbonyl or thiocarbonyl functionalities, so as to make the définition include oxo-systems and thio-systems such as lactams, lactones, cyclic imides, cyclic thioimides and cyclic carbamates. When composed of two or more rings, the rings may be joined together in a fused fashion. Additionally, any nitrogens in a heterocyclyl may be 30 quaternized. Heterocyclyl groups may be unsubstituted or substituted. Examples of such “heterocyclyl groups include but are not limited to, 1,3-dioxin. 1,3-dioxane, 1.4-dioxane, 1,2 dioxolane, l,3-dioxolane, 1,4-dioxolane, l,3-oxathiane, l,4-oxathnn, l,3-oxathiolane, l,3dithiole, 1,3-dithiolane, l,4-oxathiane, tetrahydro-l,4-thiazine, 2H-l,2-oxazine, maleimide, succinimide, barbituric acid, thiobarbituric acid, dioxopiperazine, hydantoin, dihydrouracil, trioxane, hexahydro-l ,3,5-triazine, imidazoline, imidazolidine, isoxazoline. isoxazolidine, oxazoline, oxazolidine, oxazolidinone, thiazoline, thiazolidine, morpholine, oxirane, piperidine A-Oxide, piperidine, piperazine, pyrrolidine, pyrrolidone, pyrrolidione, 4piperidone, pyrazoline. pyrazolidine, 2-oxopyrrolidine, tetrahydropyran, 4H-pyran, tetrahydrothiopyran. thiamorpholine, thiamorpholine sulfoxide, thiamorpholîne sulfone and their benzo-fused analogs (e.g., benzimidazolidinone, tetrahydroquinoline and 3,4methylenedioxyphenyl).

[0023] As used herein, “aryl(alkyl)” refer to an aryl group connected, as a substituent, via a lower alkylene group. The lower alkylene and aryl group of an aryl(alkyl) may be substituted or unsubstituted. Examples include but are not limited to benzyl, 2phenyl(alkyl), 3-phenyl(alkyl), and naphthyl(alkyI).

[0024] As used herein, “heteroaryl(alkyl)” refer to a heteroaryl group connected, as a substituent, via a lower alkylene group. The lower alkylene and heteroaryl group of heteroaryl(alkyl) may be substituted or unsubstituted. Examples include but are not limited to 2-thienyIfalkyI), 3-thienyl(alkyI), furyl(alkyl), thienyIfalkyI), pyrroly l(alkyl), pyridyl(alkyl), isoxazolyl(alkyl), imidazolyl(alkyl), and their benzo-fused analogs.

[0025] A “(heterocyclyl)alkyl” refer to a heterocyclic group connected, as a substituent, via a lower alkylene group. The lower alkylene and heterocyclyl of a heterocyclyl(alkyl) may be substituted or unsubstituted. Examples include but are not limited tetrahydro-2H-pyran-4-yl(methyl), piperidin-4-yl(ethyl), piperidin-4-y l(propy I ), tetrahydro-2H-thiopyran-4-yl(methyl) and l,3-thiazinan-4-yl(methyl).

[0026] “Lower alkylene groups” are straight-chained -Cfb- tethering groups, forming bonds to connect molecular fragments via their terminal carbon atoms. Examples include but are not limited to methylene (-CH;-), ethylene (-CH2CH2-), propylene (CH2CH2CH2-) and butylène (-CH2CH2CH2CH2-). A lower alkylene group can be substituted by replacing one or more hydrogen of the lower alkylene group with a substituent(s) listed under the définition of “substituted.”

[0027] As used herein, “alkoxy” refers to the formula -OR wherein R is an alkyl, an alkenyl, an alkynyl, a cycloalkyl. a cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl) is defîned herein. A non-limiting list of alkoxys are methoxy, ethoxy, n-propoxy, l-methylethoxy (isopropoxy), n-butoxy, iso-butoxy. secbutoxy, tert-butoxy, phenoxy and benzoxy. An alkoxy may be substituted or unsubstituted.

|0028| As used herein, “acyl” refers to a hydrogen an alkyl, an alkenyl, an alkynyl, a cycloalkyl, a cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl) connected, as substîtuents, via a carbonyl group. Examples include formyl, acetyl, propanoyl. benzoyl, and acryl. An acyl may be substituted or unsubstituted.

|0029| As used herein, “hydroxyalkyl” refers to an alkyl group in which one or more of the hydrogen atoms are replaced by a hydroxy group. Exemplary hydroxyalkyl groups include but are not limited to, hydroxymethyl. I-hydroxyethyl, 2-hydroxyethyl, 3hydroxypropyl, 2-hydroxypropyl and 2,2-dihydroxyethyl. A hydroxyalkyl may be substituted or unsubstituted.

[0030] As used herein, “haloalkyl” refers to an alkyl group in which one or more of the hydrogen atoms are replaced by a halogen (e.g., mono-haloalkyl, di-haloalkyl and trihaloalkyl). Such groups include but are not limited to, chloromethyl, fluoromethyl, difluoromethyl, trifluoromethyl, l-chloro-2-fluoromethyl and 2-fluoroisobutyl. A haloalkyl may be substituted or unsubstituted.

[0031] As used herein, “haloalkoxy” refers to a O-alkyl group in which one or more of the hydrogen atoms are replaced by a halogen (e.g., mono-haloalkoxy, di-haloalkoxy and tri-haloalkoxy). Such groups include but are not limited to, chloromethoxy, fluoromethoxy, difluoromethoxy, trifluoromethoxy, l-chloro-2-fluoromethoxy and 2fluoroisobutoxy. A haloalkoxy may be substituted or unsubstituted.

|0032] A “sulfenyl” group refers to an “-SR” group in which R can be hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclvl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). A sulfenyl may be substituted or unsubstituted.

[00331 A “sulfmyl” group refers to an “-S(=O)-R” group in which R can be the same as defîned with respect to sulfenyl. A sulfinyl may be substituted or unsubstituted.

___J {0034] A “sulfbnyl” group refers to an “SO;R” group in which R can be the same as defincd with respect to sulfenyl. A sulfonyl may be substituted or unsubstituted.

[0035] An “O-carboxy” group refers to a “RC(=O)O-” group in which R can be hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl), as defined herein. An O-carboxy may be substituted or unsubstituted.

[0036] The terms “ester” and “C-carboxy” refer to a “-C(=O)OR” group in which R can be the same as defined with respect to O-carboxy. An ester and C-carboxy may be substituted or unsubstituted.

[00371 A “thiocarbonyl” group refers to a “-C(=S)R” group in which R can be the same as defined with respect to O-carboxy. A thiocarbonyl may be substituted or unsubstituted.

[0038| A “trihalomethanesulfonyl” group refers to an “X3CSO2-” group wherein each X is a halogen,

[0039] A “trihalomethanesulfonamido” group refers to an “XjCS(O)2N(Ra)-” group wherein each X is a halogen, and Ra is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl. heteroaryl, heterocyclyl, aryl(alkyl), heteroary l(alkyl) or heterocyclyl(alkyl).

[0040]	The terni “amino” as used herein refers to a -NI I2 group.
[0041]	As used herein, the term “hydroxy” refers to a -X)l I group.
[0042]	A “cyano” group refers to a “-CN” group.
|0043|	The term “azido” as used herein refers to a -N3 group.
|0044|	An “îsocyanato” group refers to a “-NCO” group.
|0045|	A “thiocyanato” group refers to a “-CNS” group.
[00461	An “isothiocyanato” group refers to an “ -NCS” group.
[0047|	A mercapto” group refers to an “-SH” group.
[0048|	A “carbonyl” group refers to a C-O group.
|0049[	An “S-sulfonamido” group refers to a “-SOiNIRaRb)” group in which Ra
and Rb can be	independently hydrogen, alkyl, alkenyl. alkynyl, cycloalkyl, cycloalkenyl,
aryl, heteroaryl,	heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). An

S-sulfonamido may be substituted or unsubstituted.

|0050| An “N-sulfonamido” group refers to a “RSOîMRa)-” group in which R and Ra can be independently hydrogen. alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). An N-sulfonamido may be substituted or unsubstituted.

|00511 An “O-carbamyl” group refers to a “-OC(=O)N(RaRb)” group in which Ra and Reî can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). An O-carbamyl may be substituted or unsubstituted.

[0052] An “N-carbamyl” group refers to an “ROC(=O)N(Ra)-” group in which R and Ra can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl. heteroaryl, heterocyclyl, aryl(alkyl), heteroary l(alkyl) or heterocyclyl(alkyl). An N-carbamyl may be substituted or unsubstituted.

|0053] An “O-thiocarbamyl” group refers to a “-OC(=S)-N(RaRb)” group in which Ra and Rb can be independently hydrogen. alkyl, alkenyl. alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroary l(alkyl) or heterocyclyl(alkyl). An O-thiocarbamyl may be substituted or unsubstituted.

[0054] An “N-thiocarbamyl” group refers to an “ROC(=S)N(R_a)-” group in which R and R_A can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroary l(alkyl) or heterocyclyl(alkyl). An N-thiocarbamy I may be substituted or unsubstituted.

[0055] A “C-amido” group refers to a “-C(=O)N(RaRb)” group in which Ra and Rb can be independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl. aryl, heteroaryl, heterocyclyl. aryl(alkyl), heteroaryl(alkyl) or heterocyclyl(alkyl). A C-amido may be substituted or unsubstituted.

[0056] An “Ν-amido” group refers to a “RC(=O)N(Ra)-” group in which R and Ra can be independently hydrogen, alkyl. alkenyl, alkynyl. cycloalkyl. cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyt), heteroaryl(alkyl) or heterocyclyl(alkyl). An N-amido may be substituted or unsubstituted.

[0057] The term “halogen atom” or “halogen” as used herein, means any one of the radio-stable atoms of column 7 of the Perîodic Table of the Eléments, such as, fluorine, chlorine, bromineand iodine.

|0058| As used herein, the term “α-amino acids” refers to any amino acid (both standard and non-standard amino acids). Examples of suitable α-amino acids include, but are not limited to, alanine, asparagine, aspartate, cysteine, glutamate, glutamine, glycine, proline, serine, tyrosine, arginine, histidine, isoleucine, leucine, lysine, méthionine, phenylalanine, threonine, tryptophan and valine.

[0059] As used herein, the term “phosphate” is used in its ordinary sense as

0' o=p-o-| understood by those ski lied in the art, and includes 0' along with its protonated

OHOH

I > I>

O=P—o—? O=P—ο—ξ

I * I* forms (for example, O’ and OH ).

[0060| Where the numbers of substituents is not specîfied (e.g. haloalkyl), there may be one or more substituents présent. For example “haloalkyl” may include one or more of the same or different halogens. As another example, “C1-C3 alkoxyphenyl” may include one or more of the same or different alkoxy groups containing one, two or three atoms.

[0061 ] As used herein, the abbreviations for any protective groups, amino acids and other compounds, are, unless indicated otherwise. in accord with their common usage, recognized abbreviations, or the IUPAC-IUB Commission on Biochemical Nomenclature (See, Biochem. 11:942-944 ( 1972)).

[0062] The term “pharmaceutically acceptable sait” refers to a sait of a compound that does not cause significant irritation to an organism to which it is administered and does not abrogate the biological activity and properties of the compound. In some embodiments, the sait is an acid addition sait of the compound. Pharmaceutical salts can be obtained by reacting a compound with inorganic acids such as hydrohalîc acid (e.g., hydrochloric acid or hydrobromic acid), sulfuric acid, nitric acid and phosphoric acid. Pharmaceutical salts can also be obtained by reacting a compound with an organic acid such as aliphatic or aromatic carboxylic or sulfonic acids, for example fonnic, acetic, succinic, lactic, malic, tartaric, citric, ascorbic, nicotinic, methanesulfonic, ethanesulfonic, p-toluenesulfonic, salicylic or naphthalenesulfonic acid. Pharmaceutical salts can also be obtained by reacting a compound with a base to form a sait such as an ammonium sait, an alkali métal sait, such as a sodium or

I2 a potassium sait, an alkaline earth métal sait, such as a calcium or a magnésium sait, a sait of organic bases such as dicyclohexylamine, N-methyl-D-glucamine, tris(hydroxymethyl)methylamine, C1-C7 alkylamine, cyclohexylamine, triethanolamine, ethylenediamine, and salts with ainino acids such as arginine and lysine.

[0063] Terms and phrases used in this application, and variations thereof, especially in the appended claims, unless otherwise expressly stated, should be construed as open ended as opposed to limiting. As examples of the foregoing, the terni ‘including’ should be read to mean ‘including, without limitation,’ ‘including but not limited to,’ or the like; the term ‘comprising’ as used herein is synonymous with ‘including,’ ‘containîng,’ or IO ‘characterized by,’ and is inclusive or open-ended and does not exclude additional, unrecited éléments or method steps; the term ‘having’ should be interpreted as ‘having at least;’ the term ‘includes’ should be interpreted as ‘includes but is not limited to;’ the term ‘example’ is used to provide exemplary instances of the item in discussion, not an exhaustive or limiting list thereof. In addition, the term “comprising” is to be interpreted synonymously with the I5 phrases having at least or including at least. When used in the context of a compound or composition, the term comprising means that the compound or composition includes at least the recited features or components, but may also include additional features or components.

[0064] With respect to the use of substantially any plural and/or singular terms 20 herein, those having ski II in the art can translate front the plural to the singular and/or from the singular to the plural as is appropriate to the context and/or application. The varions singular/plural permutations may be expressly set forth herein for sake of clarity. The indefînite article “a” or “an” does not exclude a plurality.

[0065] It is understood that, in any compound described herein having one or 25 more chiral centers, if an absolute stereochemistry is not expressly indicated, then each center may independently be of (R)-configuration or (S)-configuration or a mixture thereof. Thus, the compounds provided herein may be enantiomerically pure, enantiomerically enriched, racemic mixture, diastereomerically pure, diastereomerically enriched, or a stereoisomeric mixture. In addition it is understood that. in any compound described herein 30 having one or more double bond(s) generating geometrical isomers that can be detlned as E or Z, each double bond may independently be E or Z a mixture thereof. Likewise, it is understood that. in any compound described. ail tautomeric forms are also intended to be included.

[0066] It is to be understood that where compounds disclosed herein hâve unfdled valencies, then the valencies are to be filled with hydrogens or isotopes thereof, e.g., hydrogen-l (protium) and hydrogen-2 (deuterium).

|0067| It is understood that the compounds described herein can be labeled isotopically. Substitution with isotopes such as deuterium may af'ford certain therapeutîc advantages resulting front greater metabolic stability, such as, for example, increased in vivo half-life or reduced dosage requirements. Each Chemical element as represented in a compound structure may include any isotope of said element. For example, in a compound structure a hydrogen atom may be explicitly disclosed or understood to be présent in the compound. At any position of the compound that a hydrogen atom may be présent, the hydrogen atom can be any isotope of hydrogen, including but not limited to hydrogen-l (protium) and hydrogen-2 (deuterium). Thus, référencé herein to a compound encompasses ail potential isotopic forms unless the context clearly dictâtes otherwise.

[0068] Where a range of values is provided, it is understood that the upper and lower limit, and each intervening value between the upper and lower limit of the range is encompassed within the embodiments.

Compounds

[0069] Some embodiments disclosed herein relate to a compound of Formula (I). or a pharmaceutically acceptable sait thereof:

wherein: R¹ can be an unsubstituted or a substituted C2 alkenyl, an unsubstituted or a substituted C2 alkynyl, an unsubstituted C1-4 haloalkyl, an unsubstituted or a substituted monocyclic heteroaryl, an unsubstituted or a substituted bicyclic heteroaryl or an unsubstituted or a substituted monocyclic heterocyclyl, wherein when the C? alkenyl, the C2 alkynyl and the monocyclic heteroaryl are substituted, the C2 alkenyl, the C2 alkynyl and the monocyclic heteroaryl can be independently substituted with one or more substituents selected from halogen, an unsubstituted Cm alkyl, an unsubstituted C1.4 haloalkyl. an unsubstituted Ci-i hydroxyalkyl, an unsubstituted monocyclic C3-6 cycloalkyl and a hydroxysubstituted monocyclic C3-6 cycloalkyl; R² and R³ can be independently selected from hydrogen, an unsubstituted or a substituted Ci 4 alkyl, an unsubstituted Cm haloalkyl, an unsubstituted or a substituted monocyclic C3-6 cycloalkyl, an unsubstituted or a substituted monocyclic 3-6 membered heterocyclyl, an unsubstituted C1-4 hydroxyalkyl and an

I0 unsubstituted Ci-5 alkoxyalkyl. wherein when the monocyclic C3-6 cycloalkyl and the monocyclic 3-6 heterocyclyl are substituted, the monocyclic C3-6 cycloalkyl and the monocyclic 3-6 heterocyclyl can be independently substituted with one or more substituents selected from halogen or hydroxy, and wherein when the Cm alkyl is substituted, the Cm alkyl is substituted with one or more substituents selected from the group consisting of a

I5 phosphate, an O-linked α-amîno acid and an O-carboxy; or R² and R³ can be taken together along with the carbon to which R² and R³ are attached to form an unsubstituted or a substituted monocyclic C3.6 cycloalkyl or an unsubstituted or a substituted monocyclic 3-6 membered heterocyclyl, wherein when the C3-6 cycloalkyl and 3-6 membered heterocyclyl are substituted, the C3-6 cycloalkyl and the 3-6 membered heterocyclyl can be independently substituted with I or 2 substituents selected from halogen and hydroxy; R⁴ and R³ can be independently hydrogen, halogen, an unsubstituted Cm alkyl, a deuterated Cm alkyl or an unsubstituted C2-4 alkenyl; R⁶ can be hydrogen, an unsubstituted Cm alkyl, a deuterated Cm alkyl or an unsubstituted C3-4 alkenyl; and provided that at least one of R⁴. R⁵ and R⁶ is not hydrogen; or R⁵ can be hydrogen. halogen, an unsubstituted Cm alkyl or an unsubstituted C225 4 alkenyl; and R⁴ and R⁶ can be taken together to form an unsubstituted or substituted 5-6 membered heterocyclic ring; X¹ can be CR^A or N (nitrogen); R^7a, R^7b, R^7c and R^7d can be independently hydrogen. halogen, an unsubstituted Cm haloalkyl. cyano or an unsubstituted Cm alkoxy; R⁸ can be hydrogen, -CH2OC(=O)-(an unsubstituted C1-4 alkyl), -CH2OC(=O)O(an unsubstituted Cm alkyl), -CH2-(a-amino acid) or -CFh-phosphate; and R^A can be hydrogen, halogen, an unsubstituted Cm haloalkyl or cyano.

I5

[0070| Various groups can be attachée! to the pyrrole ring of Formula (I). As provided herein, the pyrrole ring can hâve hydrogen, halogen, an unsubstituted Cm alkyl, a deuterated Ci-4 alkyl and/or or an unsubstituted C2-4 alkenyl attached, provided that at least one of R⁴, R⁵ and R⁶ is not hydrogen. Examples of Cm alkyls include methyl, ethyl, npropyl, isopropyl, n-butyl, isobutyl and tert-butyl. In some embodîments, one of R⁴ and R³ can be halogen or an unsubstituted Cm alkyl and/or R⁶ can be an unsubstituted Cm alkyl. In other embodîments, R⁴ and/or R³ can be each independently halogen or an unsubstituted Cm alkyl and/or R⁶ can be an unsubstituted Cm alkyl. In still other embodîments, R⁴ and R⁵ can be each independently halogen or an unsubstituted Cm alkyl and R⁶ can be an unsubstituted Cm alkyl. In yet still other embodîments, one of R⁴, R⁵ and R⁶ can be an unsubstituted Cm alkyl and one of R⁴, R⁵ and R⁶ can be an unsubstituted C3-4 alkenyl. When one of R⁴, R⁵ and R⁶ is a deuterated Ci-4 alkyl, one or more hydrogens of a Cm alkyl can be replaced by deuteriums. For example, one of R⁴, R⁵ and R⁶ can be CFbD, CHD2, CDs, CH2CD3, CD2CD3, CH2CH2CD3, CH(CDa)2. In some embodîments, one of R⁴, R^s and R⁶ can be a deuterated Cm alkyl, and the other two of R⁴, R⁵ and R⁶ can be an unsubstituted Cm alkyl.

[00711 In some embodîments, R⁴ can be hydrogen; R⁵ can be hydrogen; and R⁶ can be an unsubstituted Cm alkyl. In other embodîments, R⁴ can be halogen; R⁵ can be hydrogen; and R⁶ can be an unsubstituted Cm alkyl. In still other embodîments, R⁴ can be hydrogen; R⁵ can be halogen; and R⁶ can be an unsubstituted Cm alkyl. In still other embodîments, R⁴ can be hydrogen; R⁵ can be an unsubstituted Cm alkyl; and R⁶ can be an unsubstituted C3-4 alkenyl.

[0072] In some embodîments, R⁴ can be hydrogen; R⁵ can be halogen; and R⁶ can be hydrogen. In other embodîments. R⁴ can be hydrogen; R⁵ can be halogen; and R⁶ can be hydrogen. In still other embodîments, R⁴ can be halogen; R⁵ can be halogen; and R⁶ can be hydrogen. In yet still other embodîments, R⁴ can be an unsubstituted Cm alkyl; R⁵ can be hydrogen; and R⁶ can be an unsubstituted Cm alkyl. In some embodîments. R⁴ can be an unsubstituted Cm alkyl; R⁵ can be halogen; and R⁶ can be an unsubstituted Cm alkyl. In other embodîments, R⁴ can be an unsubstituted Cm alkyl; R' can be an unsubstituted Cm alkyl; and R⁶ can be an unsubstituted Cm alkyl. In still other embodîments, when R⁴, R⁵ and/or R⁶ are an unsubstituted Cm alkyl, the unsubstituted Cm alkyl can be methyl. For example, R⁴, R⁵ and R⁶ can be each methyl. In yet still other embodîments. R⁴ can be

I6 hydrogen; and R^s and R⁶ can be each an unsubstituted Cm alkyl. In some embodiments, R⁴ can be halogen; and R^s and R⁶ can be each an unsubstituted Cm alkyl. In other embodiments, R³ can be halogen; and R⁴ and R⁶ can be each an unsubstituted Ci-a alkyl. In still other embodiments, R⁴ and R⁵ can be each hydrogen; and R⁶ can be an unsubstituted Cm alkyl. In yet still embodiments, R⁴ can be hydrogen; R⁵ can be halogen; and R⁶ can be an unsubstituted Cm alkyl. In some embodiments, R⁴ and R⁵ can be each halogen; and R⁶ can be an unsubstituted Cm alkyl. In other embodiments, R⁴ and R^s can be each an unsubstituted Cm alkyl; and R⁶ can be a deuterated Cm alkyl, such as CDj.

[00731 As provided herein, in some embodiments, R³ can be hydrogen. halogen, an unsubstituted Cm alkyl or an unsubstituted C2-4 alkenyl; and R⁴ and R⁶ can be taken together to form an unsubstituted or substituted 5-6 membered heterocyclic ring. For *N-^\ example, R⁴ and R⁶ can be taken together to form an unsubstituted or substituted ' or an unsubstituted or substituted wherein N* indicates the nitrogen of the pyrrolyl of Formula (I). In some embodiments. R⁵ can be hydrogen; and R⁴ and R⁶ can be taken together to form an unsubstituted or substituted 5-6 membered heterocyclic ring such as those described herein. In other embodiments, R⁵ can be halogen; and R⁴ and R⁶ can be taken together to form an unsubstituted or substituted 5-6 membered heterocyclic ring such as those described herein. In still other embodiments, R⁵ can be an unsubstituted Cm alkyl; and R⁴ and R⁶ can be taken together to form an unsubstituted or substituted 5-6 membered heterocyclic ring such as those described herein. In yet still other embodiments, R³ can be an unsubstituted C2-4 alkeny l; and R⁴ and R⁶ can be taken together to form an unsubstituted or substituted 5-6 membered heterocyclic ring such as those described herein.

[0074] The 6-membered aromatic ring that includes X¹ can be an optionally substituted phenyl or an optionally substituted pyridine. When X¹ is CR^A, the 6-membered ring can be an optionally substituted phenyl. The 6-membered aromatic ring can be an optionally substituted pyridine when X¹ is N (nitrogen). As provided herein, the 6membered aromatic ring that includes X¹ can be substituted. When substituted, the phenyl and/or pyridine can be substituted 1, 2 or 3 or more times. The substituted phenyl ring can be

I7 substituted at the para-position. Additionally or in the alternative, the phenyl ring can be substituted at the meta-position. In sonie embodiments. the phenyl ring can be substituted at the ortho-position.

[0075] In some embodiments. X¹ can be CU. In other embodiments. X¹ can be 5 CR^A. When X¹ is CR^A, R^A can be a non-hydrogen group. For example, in some embodiments. R^A can be halogen (such as F, Cl or Br). In other embodiments, R^A can be an unsubstituted Cm haloalkyl. Suitable C1-4 haloalkyls include, but are not limited to, -CHF2, CF3, CH2F, CHC1F AND CCI3. In still other embodiments, R^A can be cyano. In yet still other embodiments, R^A can be an unsubstituted C1-4 alkoxy. Example Cm alkoxys include 10 methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy and tert-butoxy.

|0076| As described herein, R^7b and/R^7c can be hydrogen. As with R'\ R^7b and/R^7c can be a non-hydrogen group, such as halogen, an unsubstituted Cm haloalkyl, cyano and an unsubstituted Ci-4 alkoxy. In some embodiments, R^7b can be hydrogen. In other embodiments, R^7bcan be halogen (for example, F, Cl or Br). In still other embodiments, R^7b 15 can be an unsubstituted C1-4 haloalkyl, such as those described herein and including -CHF2, CFa, and -CH2F. In yet still other embodiments, R^7bcan be cyano. In some embodiments. R^7b can be an unsubstituted Cm alkoxy. such as those described herein. In some embodiments. R^7l' can be hydrogen. In other embodiments, R^7c can be halogen, such as F, Cl or Br. In still other embodiments, R^7c can be an unsubstituted C1.4 haloalkyl, such as -CHF?, 20 -CF3,-CH2F,-CHCIF and-CCh. In yet still other embodiments. R^7c can be cyano. In some embodiments, R^7c can be an unsubstituted C1-4 alkoxy, for example, methoxy, ethoxy, npropoxy, isopropoxy, n-butoxy, isobutoxy and tert-butoxy.

[0077] As with other positions on the 6-membered aromatic ring that includes X¹, R^7a and/or R^7d can be hydrogen or a non-hydrogen group. In some embodiments, R^7a can be 25 hydrogen. In other embodiments, R^7a can be halogen, such as F, Cl or Br. In still other embodiments, R^7acan be an unsubstituted C1-4 haloalkyl, for example, -CHF2, -CF3, -CH2F, CHCIF and -CCI3. In yet still other embodiments, R^7acan be cyano. In some embodiments, R⁷“can be an unsubstituted C1-4 alkoxy, including, but not limited to, those described herein. In some embodiments, R^7d can be hydrogen. In other embodiments, R^7d can be halogen (for 30 example, F, Cl or Br). In still other embodiments, R^7d can be an unsubstituted Cm haloalkyl, including, but are not limited to, -CHF2, -CF3, -CH2F, -CHCIF and -CCh. In yet still other

I

I8 embodiments, R^7d can be cyano. In some embodiments. R^7d can be an unsubstituted Ci-4 alkoxy. For example. R^7d can be for example, methoxy, ethoxy, n-propoxy, isopropoxy, nbutoxy. isobutoxy or tert-butoxy.

[0078] In some embodiments, R^A can be a non-hydrogen group as described 5 herein; and R^7b or R^7c can be a non-hydrogen group as described herein. In other embodiments, R^A can be a non-hydrogen group as described herein; R^7b or R^7c can be a nonhydrogen group as described herein; and R^7a and R^7d are each hydrogen. In still other embodiments, R^A can be a non-hydrogen group as described herein; one of R^7b and R^7c can be a non-hydrogen group as described herein, and the other of R^7b and R^7c can be hydrogen;

and R^7a and R^7d are each hydrogen. The following are examples of 6-membered aromatic

ring that includes X':

|0079] In some embodiments, R² and R³ can be independently selected from hydrogen, an unsubstituted or a substituted Cm alkyl, an unsubstituted (.Ί-4 haloalkyl, an I5 unsubstituted or a substituted monocyclic C3-6 cycloalkyl, an unsubstituted or a substituted monocyclic 3-6 membered heterocyclyl, an unsubstituted C1-4 hydroxyalkyl and an unsubstituted Cm alkoxyalkyl, wherein when the monocyclic C3-6 cycloalkyl and the monocyclic 3-6 heterocyclyl are substituted, the monocyclic C3.6 cycloalkyl and the monocyclic 3-6 heterocyclyl can be independently substituted with one or more substituents 20 selected from halogen or hydroxy, and wherein when the C1-4 alkyl is substituted. the Ci-4 alkyl is substituted with one or more substituents selected from the group consisting of a phosphate, an O-linked α-amino acid and an O-carboxy. In other embodiments, R² and R³ are taken together along with the carbon to which R² and R³ are attached to form an unsubstituted or a substituted monocyclic C3-6 cycloalkyl or an unsubstituted or a substituted 25 monocyclic 3-6 membered heterocyclyl, wherein when the C3.6 cycloalkyl and 3-6 membered heterocyclyl are substituted, the C3-6 cycloalkyl and the 3-6 membered heterocyclyl are independently substituted with I or 2 substitueras selected from the group consisting of halogen and hydroxy.

[0080] The substituents for R² and R³ can be the same or different, or R² and R³ can be taken together along with the carbon to which R² and R³ are attached to form an unsubstituted or a substituted monocyclic C3-6 cycloalkyl or an unsubstituted or a substituted monocyclic 3-6 membered heterocyclyl. In some embodiments, R² and R³ can be each hydrogen. In other embodiments, R² and R³ can be each an unsubstituted Cm alkyl. Examples of suitable an unsubstituted Cm alkyls are described herein. For example, R² and R³ can be each methyl.

|00811 As described herein, R² and R³ can be different. As an example, one of R² and R³ can be hydrogen; and the other of R² and R³ can be an unsubstituted Cm alkyl, an unsubstituted Cm haloalkyl, an unsubstituted or a substituted monocyclic C3-6 cycloalkyl, an unsubstituted or a substituted monocyclic 3-6 membered heterocyclyl, an unsubstituted Cm hydroxyalkyl and an unsubstituted C1.5 alkoxyalkyl. In some embodiments, one of R² and R³ can be hydrogen; and the other of R² and R³ can be an unsubstituted Cm alkyl, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl and tert-butyl. In other embodiments, one of R² and R³ can be hydrogen; and the other of R² and R³ can be an unsubstituted Ci-4 haloalkyl. Exemplary Cm haloalkyls are described herein, and include, but are not limited to. -CHF2, -CF3, -CH2F, -CHCIF and -CCI3. In still other embodiments. one of R² and R³ can be hydrogen; and the other of R² and R³ can be an unsubstituted or a substituted monocyclic C3-6 cycloalkyl. For example, one of R² and R³ can be hydrogen; and the other of R² and R³ can be an unsubstituted cycloproyl, an unsubstituted cyclobutyl, an unsubstituted cyclopentyl and an unsubstituted cyclohexyl; or one of R² and R³ can be hydrogen; and the other of R² and R³ can be a substituted cycloproyl, a substituted cyclobutyl, a substituted cyclopentyl and a substituted cyclohexyl. When substituted. the substituted monocyclic C3-6 cycloalkyl can be substituted 1,2 or 3 or tintes with a substituent independently selected from halogen (F, Cl or Br) and hydroxy. In some embodiments, substituted monocyclic €3-6 cycloalkyl can be substituted with I or 2 halogens. For example, one of R² and R³ can be hydrogen; and the

Y other of R² and R³ can be ’^ΛΤ^ν'. In yet still other embodiments, one of R² and R³ can be hydrogen; and the other of R² and R³ can be an unsubstituted or a substituted monocyclic 3-6 membered heterocyclyl. Various monocyclic 3-6 membered heterocyclyls are suitable for R²/R³. In some embodiments, one of R² and R³ can be hydrogen; and the other of R² and R³ can be an unsubstituted Ci-4 hydroxyalkyl. As an example, one of R² and R³ can be hydrogen; and the other of R² and R³ can be -CH2OH. In other embodiments, one of R² and R³ can be hydrogen; and the other of R² and R³ can be an Linsubstituted C1-5 alkoxyalkyl. Examples of an unsubstituted C1-5 alkoxyalkyls include -CH2OCH3, -CH2CH2OCH3, CH2OCH2CH3. -CH2CH2OCH2CH3, -CH₂OCH(CH₃)2, -CH₂OCH₂CH(CH3)2 and CEECEkOCHfCHih.

[0082j A prodrug moiety can be présent at one of R² and R³. In some embodiments, one of R² and R³ can be an unsubstituted Cm alkyl (for example, methyl); and the other of R² and R³ can be a substituted Cm alkyl, w herein the Cm alkyl is substituted with one or more substituents selected from a phosphate, an O-linked α-amino acid and an O-carboxy. Suitable α-amino acids are described herein and include, but are not limited to, alanine, asparagine, aspartate, cysteine, glutamate, glutamine, glycine, proline, serine, tyrosine, arginine, histidine, isoleucine, leucine, lysine, méthionine, phenylalanine, threonine, tryptophan and valine. As used herein, an “-O-linked α-amino acid” refers to an a-amino acid that is attached to the indicated moiety via the hydroxy from its main-chain carboxylic acid group. When the α-amino acid is attached in an -O-linked α-amino acid, the hydrogen that is part of the hydroxy from its main-chain carboxylic acid group is not présent and the aamino acid is attached via the oxygen. In some embodiments. the -O-linked α-amino acid substituted on the Cm alkyl of R² or R³ can be an -O-linked-L-a-amino acid. In other embodiments, the -O-linked α-amino acid substituted on the Cm alkyl of R² or R³ can be an -O-linked-D-a-amino acid. Examples of -O-linked-a-amino acids are shown here with respect to R⁸. As another example of a prodrug moiety that can be présent on the substituted Cm alkyl of R² or R³ is an O-carboxy. In some embodiments. one of R² and R³ can be an unsubstituted Cm alkyl (such as. methyl); and the other of R² and R³ can be an O-carboxy substituted Cm alkyl. For example, the O-carboxy substituted Cm alkyl can hâve the structure -tCH₂)4-OC(=O)(an unsubstituted Cm alkyl). As described herein, the Cm alkyl of R² or R³ can be substituted with a phosphate. For example, when R² or R³ are a substituted Ci-4 alkyl with a phosphate, R² or R³ can be -CH?-O-P(=O)(O')2 or -CH2-OP(=O)(OH)2.

[0083| As provided herein. R² and R³ can be taken together along with the carbon to which R² and R³ are attached to form an unsubstituted or a substituted monocyclic C3-6 cycloalkyl or an unsubstituted or a substituted monocyclic 3-6 membered heterocyclyl are substituted, the C3-6 cycloalkyl and the 3-6 membered heterocyclyl are independently substituted with l or 2 substituents selected from the group consisting of halogen and hydroxy. In some embodiments, R² and R³ can be taken together along with the carbon to which R² and R³ are attached to form an unsubstituted monocyclic C3.6 cycloalkyl. In other embodiments, R² and R³ can be taken together along with the carbon to which R² and R³ are attached to form a substituted monocyclic C3-6 cycloalkyl. The C3-6 cycloalkyl can be an unsubstituted or a substituted cyclopropyl, an unsubstituted or a substituted cyclobutyl, an unsubstituted or a substituted cyclopentyl or an unsubstituted or a substituted cyclohexyl. When the C3-6 cycloalkyl is substituted. the C3-6 cycloalkyl can be substituted I, 2 or 3 or more times. When 2 or more substituents are présent, the substituents can be ail the same or at least different substituents can be présent. For example, in some embodiments, the C3-6 cycloalkyl can be substituted with l or 2 halogens (such as l or 2 fluoro substituents). In other embodiments, the C3-6 cycloalky l can be substituted with a hydroxy. Exemplary C3-6 cycloalkyls include unsubstituted cyclopropyl, unsubstituted cyclobutyl, unsubstituted cyclopentyl, unsubstituted cyclohexyl. fluoro-substituted cyclopropyl, fluoro-substituted cyclobutyl, fluoro-substituted cyclopenty l, fluoro-substituted cyclohexyl, hydroxy-substituted cyclopropyl, hydroxy-substituted cyclobutyl, hydroxy-substituted cyclopentyl, hydroxysubstituted cyclohexyl.

|0084| In some embodiments. R² and R³ can be taken together along with the carbon to which R² and R³ are attached to form an unsubstituted monocyclic 3-6 membered heterocyclyl. In some embodiments. R² and R³ can be taken together along with the carbon to which R² and R³ are attached to form a substituted monocyclic 3-6 membered heterocyclyl. For example, R² and R³ can be taken together along with the carbon to which R² and R³ are attached to form an unsubstituted or substituted monocyclic 3-membered heterocyclyl, an unsubstituted or substituted monocyclic 4-membered heterocyclyl, an unsubstituted or substituted monocyclic 5-membered heterocyclyl or an unsubstituted or substituted monocyclic 6-membered heterocyclyl. In some embodiments, R² and R³ can be taken together along with the carbon to which R² and R³ are attached to form an unsubstituted monocyclic, oxygen-containing 3-6 membered heterocyclyl. In other 5 embodiments, R² and R³ can be taken together along with the carbon to which R² and R³ are attached to form an unsubstituted monocyclic. nitrogen-containing 3-6 membered heterocyclyl. Suitable monocyclic 3-6 membered heterocyclyls include, but are not limited to, an unsubstituted or substituted oxetane.

an unsubstituted or substituted thietane, an

I0 unsubstituted or substituted unsubstituted or substituted

'0, an unsubstituted or substituted

an

,0 unsubstituted or substituted unsubstituted or substituted

O

O

an an ‘O and an unsubstituted or substituted O O. [n some embodiments, R² and R³ can be taken together along with the carbon to which R² and R³ are attached to form

(0085] Various unsaturated substituents can be présent at R¹. As described 15 herein, R¹ can be substituted or unsubstituted. In some embodiments, R¹ can be an unsubstituted Ci alkenyl. In other embodiments, R¹ can be a substituted C2 alkeny l that can be substituted with one or more substituents independently selected from halogen, an unsubstituted Ch haloalkyl an unsubstituted C1.4 hydroxyalkyl, an unsubstituted monocyclic C3-6 cycloalkyl and a hydroxy-substituted monocyclic C3-6 cycloalkyl. In some 20 embodiments, R¹ can be an unsubstituted C2 alkynyl. In other embodiments, R¹ can be a substituted C2 alkynyl. The C2 alkynyl can be substituted one or more times with a substituent independently selected from halogen, an unsubstituted Ch haloalkyl an unsubstituted Ch hydroxyalkyl, an unsubstituted monocyclic C>6 cycloalkyl and a hydroxy22136

substituted monocyclic C3-6 cycloalkyl. For example, the C2 alkynyl can be substituted one time with an unsubstituted monocyclic C3-6 cycloalkyl or the C2 alkynyl can be substituted one time with an unsubstituted Ci-ι haloalkyl. In some embodiments, R¹ can be an unsubstituted C[-4 haloalkyl, for example, CF3.

I0086J As described herein, severai cyclic moieties can be présent at R¹. In some embodiments, R¹ can be an unsubstituted monocyclic heteroaryl. In other embodiments, R¹ can be a substituted monocyclic heteroaryl. Severai suitable monocyclic heteroaryls are described herein. In some embodiments, R¹ can be an unsubstituted or a substituted nitrogen-containing monocyclic heteroary l, for example, R¹ can be an unsubstituted or a

). an unsubstituted or a substituted substituted 1,2,3-triazole (such as

substituted oxadiazole (for example,

wherein each of the structures shown can be unsubstituted or substituted (including where a hydrogen on a nitrogen can be replaced with a non-hydrogen substitutent). In some embodiments, R¹ can be an unsubstituted bicyclic heteroaryl. In other embodiments, R can be a substituted bicyclic heteroaryl. Exemplary bicyclic heteroaryls are provided herein, and include benzimîdazole. In some embodiments, R¹ can be an unsubstituted monocyclic heterocyclyl. In other embodiments. R¹ can be a substituted monocyclic heterocyclyl. Several examples of suitable monocyclic heterocyclyls are described herein. In some embodiments. R¹ can be an unsubstituted or substituted 2-oxo-l H-pyridinyl. When cyclic moieities of R¹ is substituted, varions substituents can be présent. Examples of substituents that can be présent on the monocyclic heteroaryl of R¹ include the following: an unsubstituted Cm alkyl, an unsubstituted cyclopropyl and an unsubstituted cyclobutyl.

[0087] Several substituents can be présent at R⁸. In some embodiments, R^s can be hydrogen. In other embodiments, R⁸ can be -CH2OC(=O)-(an unsubstituted Ci-4 alkyl). For example, R⁸ can be pivaloyloxymethyl (POM). In still other embodiments, R⁸ can be CH20C(=0)-0(an unsubstituted Cim alkyl), such as isopropyloxycarbonyloxymethyl (POC). In yet still other embodiments, R⁸ can be -CH2-(a-amino acid). Suitable α-amino acids include, but are not limited to, alanine, asparagine, aspartate, cysteine, glutamate, glutamine, glycine, proline, serine, tyrosine, arginine, histidine. isoleucine, leucine, lysine, méthionine, phenylalanine, threonine. tryptophan and valine. When R⁸ includes an α-amino acid, the carboxylic acid moiety is the portion connected to the -CH: of-CFh—(α-amino acid), and the hydrogen of the carboxylic acid is not présent. As some examples, R⁸ can be

embodiments, the -ct-amino acid of -CH?-(a-amino acid) of R⁸ can be an L-a-amino acid. In other embodiments, the -α-amino acid of -CH:-(a-amino acid) of R⁸ can be an D-ctOH or O । '—O—P=O amino acid. In some embodiments. R⁸ can be -CFL-phosphate ( O^H or 0' ).

|0Ü88] Compounds of Formula (I), along with pharmaceutically acceptable salts thereof, can hâve a variety of structures. In some embodiments, R¹ can be an unsubstituted or a substituted C2 alkenyl, an unsubstituted or a substituted C2 alkynyl, an unsubstituted or a substituted monocyclic heteroaryl, an unsubstituted or a substituted bicyclic heteroaryl or an unsubstituted or a substituted monocyclic heterocyclyl. wherein when the C2 alkenyl, the C2 alkynyl, an unsubstituted C1-4 haloalkyl and the monocyclic heteroaryl are substituted, the C2 alkenyl, the C2 alkynyl and the monocyclic heteroaryl are independently substituted with one or more substituents selected from halogen. an unsubstituted Cm alkyl, an unsubstituted Cm haloalkyl, an unsubstituted Cm hydroxyalkyl, an unsubstituted monocyclic C3-6 cycloalkyl and a hydroxy-substituted monocyclic C3-6 cycloalkyl; R² and R³ can be independently selected from hydrogen, an unsubstituted or a substituted Cm alkyl, an unsubstituted Cm haloalkyl, an unsubstituted or a substituted monocyclic C3-6 cycloalkyl, an unsubstituted or a substituted monocyclic 3-6 membered heterocyclyl, an unsubstituted Cm hydroxyalkyl and an unsubstituted C1-5 alkoxyalkyl, wherein when the monocyclic C3-6 cycloalkyl and the monocyclic 3-6 heterocyclyl are substituted, the monocyclic C3-6 cycloalkyl and the monocyclic 3-6 heterocyclyl are independently substituted with one or more substituents selected from halogen or hydroxy, and wherem when the Ci-4 alkyl is substituted, the Cj-4 alkyl is substituted with one or inore substituents selected from a phosphate, an O-linked aamino acid and an O-carboxy, and provided that at least one of R² and R³ is not hydrogen; R⁴ and R⁵ can be independently hydrogen, halogen, an unsubstituted Cm alkyl, a deuterated Cm alkyl or an unsubstituted C2-4 alkenyl; R⁶ can be hydrogen. an unsubstituted Cm alkyl, a deuterated Cm alkyl or an unsubstituted C3-4 alkenyl; and provided that at least one of R⁴, R³ and R⁶ is not hydrogen; X' can be CR^A or N; R^7a, R^7b, R^7c and R^7d can be independently hydrogen, halogen, an unsubstituted Cm haloalkyl, cyano or an unsubstituted Cm alkoxy; R⁸ can be hydrogen, -CH2OC(=O)-(an unsubstituted Cm alkyl), -CH2OC(=O)-O(an unsubstituted Cm alkyl), -CHz-fa-amino acid) or -CHE-phosphate; and R^A can be hydrogen, halogen, an unsubstituted Cm haloalkyl or cyano. For this paragraph, when at least one of R² and R³ is not hydrogen, the following for R² and R³ are provided: (!) R² and R³ can be each an unsubstituted Ci-4 alkyl, such as methyl, (2) a Cm alkyl substituted by a phosphate, an O-linked α-amino acid or an O-carboxy (for example, -O(C-O)(an unsubstituted Cm alkyl), (3) an unsubstituted Cm haloalkyl (for example, CF3), (4) an unsubstituted cyclopropyl and (5) an unsubstituted Cm hydroxyalkyl (such as -CH2OH).

[0089] In other embodîments, R¹ can be an unsubstituted or a substituted C2 alkenyl, an unsubstituted or a substituted C2 alkynyl, an unsubstituted or a substituted monocyclic heteroaryl, an unsubstituted or a substituted bicyclic heteroaryl or an unsubstituted or a substituted monocyclic heterocyclyl, wherein when the C2 alkeny l, the C2 alkynyl, an unsubstituted Cm haloalkyl and the monocyclic heteroaryl are substituted. the C2 alkenyl, the C2 alkynyl and the monocyclic heteroaryl are independently substituted with one or more substituents selected from halogen, an unsubstituted Cm alkyl, an unsubstituted Cm haloalkyl, an unsubstituted Cm hydroxyalkyl, an unsubstituted monocyclic C3-6 cycloalkyl and a hydroxy-substituted monocyclic C3-6 cycloalkyl; R² and R³ can be taken together along with the carbon to which R² and R³ are attached to form an unsubstituted or a substituted monocyclic C3.6 cycloalkyl or an unsubstituted or a substituted monocyclic 3-6 membered heterocyclyl, wherein when the C3-6 cycloalkyl and 3-6 membered heterocyclyl are substituted. the C3.6 cycloalkyl and the 3-6 membered heterocyclyl are independently substituted with 1 or 2 substituents selected from halogen and hydroxy; R⁴ and R⁵ can be independently hydrogen, halogen, an unsubstituted Cm alkyl, a deuterated Cm alkyl or an unsubstituted C2-4 alkenyl; R⁶ can be hydrogen, an unsubstituted Ci-4 alkyl, a deuterated Ci-4 alkyl or an unsubstituted C3.4 alkenyl; and provided that at least one of R⁴, R⁵ and R⁶ is not hydrogen; X¹ can be CR^A or N; R^7a, R^7b, R^7c and R^7d can be independently hydrogen, halogen, an unsubstituted Ci-4 haloalkyl, cyano or an unsubstituted Ci-4 alkoxy; R^s can be 5 hydrogen. -CTFOCi^OHan unsubstituted Cm alkyl), -CH2OC(=O)-O(an unsubstituted Ci4 alkyl), -CFT-ict-amino acid) or -CH2-phosphate; and R^A can be hydrogen. halogen, an unsubstituted Cm haloalkyl or cyano. As provided herein, R² and R³ can be taken together along with the carbon to which R² and R³ are attached form an unsubstituted cyclobutyl, a fluoro-substituted cyclobutyl, a hydroxy-substituted cyclobutyl or an unsubstituted oxetane.

[0090| In still other embodiments, R¹ can be an unsubstituted or a substituted C2 alkenyl, an unsubstituted or a substituted C2 alkynyl, an unsubstituted Ci-4 haloalkyl, an unsubstituted or a substituted monocyclic heteroaryl, an unsubstituted or a substituted bicyclic heteroaryl or an unsubstituted or a substituted monocyclic heterocyclyl, wherein when the C2 alkenyl. the C2 alkynyl and the monocyclic heteroaryl are substituted, the C2 alkeny l, the C2 alkyny l and the monocyclic heteroaryl can be independently substituted with one or more substituents selected from halogen, an unsubstituted Cm alkyl, an unsubstituted Cm haloalkyl, an unsubstituted Cm hydroxyalkyl, an unsubstituted monocyclic C3-6 cycloalkyl and a hydroxy-substituted monocyclic C3-6 cycloalkyl; R² and R³ can be independently selected from hydrogen, an unsubstituted or a substituted Cm alkyl, an unsubstituted Cm haloalkyl, an unsubstituted or a substituted monocyclic C3-6 cycloalkyl, an unsubstituted or a substituted monocyclic 3-6 membered heterocyclyl, an unsubstituted Cm hydroxyalkyl and an unsubstituted C1-5 alkoxyalkyl, wherein when the monocyclic C3-6 cycloalkyl and the monocyclic 3-6 heterocyclyl are substituted, the monocyclic C3-6 j cycloalkyl and the monocyclic 3-6 heterocyclyl can be independently substituted with one or more substituents selected from halogen or hydroxy, and wherein when the C1-4 alkyl is substituted, the Cm alkyl is substituted with one or more substituents selected from the group consisting of a phosphate, an O-linked α-amino acid and an O-carboxy; or R² and R³ can be taken together along with the carbon to which R² and R³ are attached to form an unsubstituted or a substituted monocyclic C3.6 cycloalkyl or an unsubstituted or a substituted monocyclic 3-6 membered heterocyclyl, wherein when the C3-6 cycloalkyl and 3-6 membered heterocyclyl are substituted, the C3-6 cycloalkyl and the 3-6 membered heterocyclyl can be

independently substituted with l or 2 substituents selected from halogen and hydroxy; R⁵ can be hydrogen. halogen, an unsubstituted Ci~+ alkyl or an unsubstituted 0-4 alkenyl; and R⁴ and R⁶ can be taken together to form an unsubstituted or substituted 5-6 membered heterocyclic ring; X^! can be CR^A or N (nitrogen); R^7a, R^7b, R^7c and R^7d can be independently hydrogen, halogen, an unsubstituted C1-4 haloalkyl, cyano or an unsubstituted Cm alkoxy; R⁸ can be hydrogen, -014:00(=0)-(an unsubstituted Cj-4 alkyl), -Oh0C(=0)-0(an unsubstituted C|. 4 alkyl), -CHHa-amino acid) or -CEE-phosphate; and R^A can be hydrogen. halogen. an unsubstituted C’iu haloalkyl or cyano.

[0091] Examples of compound of Formula (I), or a pharmaceutically acceptable

ΙΟ

Ι5 sait thereof, include the following:

NC , NC ___I

F₃C q,kxV^ ^F Br , ^F Br

-ρ-ΗχΧ^ 5>>φά“>

^FaC '5>-H Ac'

NC, NC 'ΧλΗχΥΧ'¹

NC, CiC x° pX-W’

NC^Z, NC

I

NC, NC ·ί>4Μ

F₃c ₍ FjHC^ jl-yUûÿ q ,Rûy^z ·5>κΑ^{!χΙ> Br} F, NC

F5

FF , F

O=p—0'

F , NC

NC , NC

NC , NC

HO

NC , NC

F₃C , F₃C

ο_;

NC , NC

pharmaceutically acceptable sait of any of the foregoing.

(0092] Further examples of compound of Formula (I), or a pharmaceutically acceptable sait thereof, include the following:

N , N,

N , N, ^N//

4I

I

F₃c , f₃c

NC , NC

NC . F₃C^Z

I

NC , ^r3^

HO

HO

NC , NC

any of the foregoing.

[0093] In some embodiments, a compound of Formula (l), or a pharmaceutically acceptable sait, cannot be one or more of the following compounds:

any of the foregoing. In some embodiments, a compound of Formula (I), or a pharmaceuticaliy acceptable sait, cannot be a compound provided in WO 2017/156255. In some embodiments, R¹ cannot be a difluoro-substituted phenyl. In some embodiments, R¹ cannot be an unsubstituted or substituted tetrazole, an unsubstituted or substituted 1,2,3triazole and/or an unsubstituted or substituted imidazole. In some embodiments, X¹ cannot be CR^a, wherein R^A is halogen (such as F); and R^7B cannot be halogen (such as F or Cl). In some embodiments, at least of R^A, R^7a, R^7b, R^7c and R^7d is an unsubstituted Cm haloalkyl, for example, CF3. In some embodiments, at least one of R⁴ and R⁵ is halogen. In some embodiments, at least one of R⁴, R⁵ and R⁶ is hydrogen.

Synthesis

[0094] Compounds of Formula (I) along with those described herein may be prepared in varions ways. General synthetic routes for preparîng compounds of Formula (I) are shown and described herein along with some examples of starting materials used to synthesize compounds described herein. The routes shown and descnbed herein are illustrative only and are not intended, nor are they to be construed, to limit the scope of the claims in any manner whatsoever. Those skilled in the art will be able to recognize modifications of the disclosed synthèses and to devise aiternate routes based on the disclosures herein; ail such modifications and aiternate routes are within the scope of the claims.

Scheme I

[0095] The synthesis of compounds of Formula (!) can be performed as outlined in Scheme I. An ester of general Formula (la) can be coupled with an amine of general Formula (Ib), în presence of a base, for example LiHMDS, in a suitable solvent (such as THF), to give an amide of general Formula (le). Reaction of general Formula (le) with ethyl 2-chloro-2-oxoacetate in presence of aluminium chloride in a suitable solvent (for example, DCM) can give ketoester of general Formula (Id). General Formula (Id) can subsequently be saponified in basic conditions, using for example lithium hydroxide in a mixture of methanol and water, to give the ketoacid dérivative of general Formula (le). Coupling of general Formula (le) with a substituted amine of general Formula (If) can be performed in the presence of a peptide coupling reagent, for example, HATU or EDCI/HOAT, in the presence of an organic amine base (such as EtiN or DI PEA), in a suitable solvent (for example DCM), to afford compound of Formula (l), and pharmaceutically acceptable salts thereof.

Pharmaceutical Compositions

[0096| Some embodiments described herein relate to a pharmaceutical composition, that can include an effective amount of a compound described herein (e.g., a compound. or a pharmaceutically acceptable sait thereof, as described herein) and a 5 pharmaceutically acceptable carrier, excipient or combination thereof. A pharmaceutical composition described herein is suitable for human and/or veterinary applications.

|0097] As used herein, a “carrier” refers to a compound that facilitâtes the incorporation of a compound into cells or tissues. For example, without limitation, dimethyl sulfoxide (DMSO) is a commonly utilized carrier that facilitâtes the uptake of many organic 10 compounds into cells or tissues of a subject.

[0098] As used herein, a “diluent” refers to an ingrédient in a pharmaceutical composition that lacks pharmacological activity but may be pharmaceutically necessary or désirable. For example, a diluent may be used to increase the bulk of a potent drug whose mass is too small for manufacture and/or administration. It may also be a liquid for the 15 dissolution of a drug to be adminîstered by injection, ingestion or inhalation. A common form of diluent in the art is a buffered aqueous solution such as, without limitation, phosphate buffered saline that mimics the composition of human blood.

[0099] As used herein, an “excipient” refers to an inert substance that is added to a pharmaceutical composition to provide, without limitation, bulk, consistency, stability, 20 binding ability, lubrication, disintegrating ability etc., to the composition, A “diluent” is a type of excipient.

[0100] Proper formulation is dépendent upon the route of administration chosen. Techniques for formulation and administration of the compounds described herein are known to those skilled in the art. Multiple techniques of administering a compound exist in the art 25 including, but not limited to, oral, rectal, topical, aérosol, injection and parentéral delivery, including intramuscular, subcutaneous, intravenous, intramedullary injections, intrathecal, direct intraventricular, intraperitoneal, intranasal and întraocular injections. Pharmaceutical compositions will generally be tailored to the spécifie intended route of administration.

[0101] One may also administer the compound in a local rather than systemic 30 manner, for example, via injection of the compound directly into the infected area, often in a depot or sustained release formulation. Furthermore, one may administer the compound in a targeted drug delivery System, for example, in a liposome coated with a tissue-specific antibody. The liposomes may be targeted to and taken up selectively by the organ.

|0102| The pharmaceutical compositions disclosed herein may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, 5 granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or tableting processes. As described herein, compounds used in a pharmaceutical composition may be provided as salts with pharmaceutîcally compatible counterions.

Methods of Use

[0103] Some embodiments described herein relate to a method of treating a HBV and/or HDV infection that can include administering to a subject identified as suffering from the HBV and/or HDV infection an effective amount of a compound, or a pharmaceutîcally acceptable sait thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein. Other embodiments described herein relate to using a compound, or a pharmaceutically acceptable sait thereof, as described herein in the manufacture of a médicament for treating a HBV and/or HDV infection. Still other embodiments described herein relate to the use of a compound, or a pharmaceutically acceptable sait thereof, as described herein or a pharmaceutical composition that includes a compound, or a pharmaceutically acceptable sait thereof, as described herein for treating a HBV and/or HDV infection.

[0104| Some embodiments disclosed herein relate to a method of treating a HBV and/or HDV infection that can include contacting a cell infected with the HBV and/or HDV with an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as 25 described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable sait thereof. as described herein. Other embodiments described herein relate to using a compound, or a pharmaceutically acceptable sait thereof. as described herein in the manufacture of a médicament for treating a HBV and/or HDV infection. Still other embodiments described herein relate to the use of a 30 compound. or a pharmaceutically acceptable sait thereof, as described herein described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein tor treating a HBV and/or HDV infection.

[0105] Some embodiments disclosed herein relate to a method of inhibiting réplication of HBV and/or HDV that can include contacting a cell infected with the HBV and/or HDV with an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein. Other embodiments described herein relate to using a compound, or a pharmaceutically acceptable sait thereof, as described herein in the manufacture of a médicament for inhibiting réplication of HBV and/or HDV. Still other embodiments described herein relate to the use of a compound, or a pharmaceutically acceptable sait thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein, for inhibiting réplication of HBV and/or HDV.

|0106] In some embodiments, the HBV infection can be an acute HBV infection. In some embodiments, the HBV infection can be a chronic HBV infection.

[0107] Some embodiments disclosed herein relate to a method of treating liver cirrhosis that is developed because of a HBV and/or HDV infection that can include administering to a subject suffering from liver cirrhosis and/or contacting a cell infected with the HBV and/or HDV in a subject suffering from liver cirrhosis with an effective amount ofa compound. or a pharmaceutically acceptable sait thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein. Other embodiments described herein relate to using a compound, or a pharmaceutically acceptable sait thereof, as described herein in the manufacture of a médicament for treating liver cirrhosis with an effective amount of the compound, or a pharmaceutically acceptable sait thereof. Still other embodiments described herein relate to the use of a compound, or a pharmaceutically acceptable sait thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound. or a pharmaceutically acceptable sait thereof. as described herein for treating liver cirrhosis.

[0108] Some embodiments disclosed herein relate to a method of treating liver cancer (such as hepatocellular carcinoma) that is developed because of a HBV and/or HDV infection that can include administering to a subject suffering from the liver cancer and/or contacting a cell infected with the HBV and/or HDV in a subject suffering from the liver 5 cancer with an effective amount of a compound, or a pharmaceutically acceptable sait thereof. as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein. Other embodiments described herein relate to using a compound. or a pharmaceutically acceptable sait thereof, as described herein in the manufacture of a médicament for treating 10 liver cancer (such as hepatocellular carcinoma). Still other embodiments described herein relate to the use of a compound, or a pharmaceutically acceptable sait thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein for treating liver cancer (such as hepatocellular carcinoma).

[0109] Some embodiments disclosed herein relate to a method of treating liver failure that is developed because of a HBV and/or HDV infection that can include administering to a subject suffering from liver failure and/or contacting a cell infected with the HBV and/or HDV in a subject suffering from liver failure with an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein, or a 20 pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein. Other embodiments described herein relate to using a compound, or a pharmaceutically acceptable sait thereof. as described herein in the manufacture of a médicament for treating liver failure. Still other embodiments described herein relate to the use of a compound, or a pharmaceutically acceptable sait 25 thereof, as described herein, or a pharmaceutical composition that includes an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein for treating liver failure.

[0110] Various indicators for determining the effectiveness of a method for treating an HBV and/or HDV infection are also known to those skilled in the art. Examples 30 of suitable indicators include, but are not limited to, a réduction in viral load indicated by réduction in HBV DNA (or load) (e.g., réduction <10'’ copîes/mL in sérum), HBV surface antigen (HBsAg) and HBV e-antigen (HBeAg), a réduction in plasma viral load, a réduction in viral réplication, a réduction in time to séroconversion (virus undetectable in patient sérum), an increase in the rate of sustained viral response to therapy, an improvement in hepatic function, and/or a réduction ofmorbidity or mortality in clinical outcomes.

|()I11] As used herein, the terms “treat,” “treatîng,” “treatment,” “therapeutic,” and “therapy” do not necessarily mean total cure or abolition of the disease or condition. Any alleviation of any undesired signs or symptoms of a disease or condition, to any extent can be considered treatment and/or therapy. Furthermore, treatment may include acts that may worsen the subject’s overall feeling of well-being or appearance.

[0112] As used herein, a “subject” refers to an animal that is the object of treatment, observation or experiment. “Animal” includes cold- and warm-blooded vertebrates and invertebrates such as flsh, shellfish, reptiles and, in particular, mammals. “Mammal” includes, without limitation, mice, rats, rabbits. guinea pigs, dogs, cats, sheep, goats. cows, horses, primates, such as monkeys, chimpanzees. and apes, and. in particular, humans. In some embodiments, the subject is human.

[0113] The term “effective amount” is used to indicate an amount of an active compound, or pharmaceutical agent, that elicits the biological or médicinal response indicated. For example, an effective amount of compound can be the amount needed to alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated. This response may occur in a tissue, System, animal or human and includes alleviation of the signs or symptoms of the disease being treated. Détermination of an effective amount is well within the capability of those skilled in the art, in view of the disclosure provided herein. The effective amount of the compounds disclosed herein required as a dose will dépend on the route of administration, the type of animal, including human, being treated, and the physical characteristics of the spécifie animal under considération. The dose can be tailored to achieve a desired effect, but will dépend on such factors as weight, diet, concurrent médication and other factors which those skilled in the medical arts will recognize.

[0114] In some embodiments, an effective amount of a compound, or a pharmaceutically acceptable sait thereof, as described herein is an amount that is effective to achieve a sustained virologie response, for example, a sustained viral response 12 month after completion of treatment.

|0115| Subjects who are clînically diagnosed with a HBV and/or HDV infection include “naïve” subjects (e.g., subjects not previously treated for HBV and/or HDV) and subjects who hâve failed prior treatment for HBV and/or HDV (“treatment failure” subjects). Treatment failure subjects include “non-responders” (subjects who did not achieve sufficient réduction in ALT (alanine aminotransferase) levels, for example, subject who failed to achieve more than l loglO decrease from base-line within 6 months of starting an anti-HBV and/or anti-HDV therapy) and “relapsers” (subjects who were previously treated for HBV and/or HDV whose ALT levels hâve increased, for example. ALT > twice the upper normal limit and détectable sérum HBV DNA by hybridization assays). Further examples of subjects include subjects with a HBV and/or HDV infection who are asymptomatic.

|0116| In some embodiments. a compound, or a pharmaceutically acceptable sait thereof, as described herein can be provided to a treatment failure subject suffering from HBV and/or HDV. In some embodiments. a compound. or a pharmaceutically acceptable sait thereof, as described herein can be provided to a non-responder subject suffering from HBV and/or HDV. In some embodiments, a compound, or a pharmaceutically acceptable sait thereof, as described herein can be provided to a relapser subject suffering from HBV and/or HDV. In some embodiments, the subject can hâve HBeAg positive chronic hepatitis B. In some embodiments, the subject can hâve HBeAg négative chronic hepatitis B. In some embodiments, the subject can hâve liver cirrhosis. In some embodiments, the subject can be asymptomatic, for example, the subject can be infected with HBV and/or HDV but does not exhibit any symptoms of the viral infection. In some embodiments, the subject can be immunocompromised. In some embodiments, the subject can be undergoing chemotherapy.

[0117| Examples of agents that hâve been used to treat HBV and/or HDV include immunomodulating agents, and nucleosides/nucleotides. Examples of immunomodulating agents include interferons (such as IFN-α and pegylated interferons that include PEG-IFN-a2a); and examples of nucleosides/nucleotides include lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide and tenofovir disoproxiL However, some of the drawbacks associated with interferon treatment are the adverse side effects, the need for subeutaneous administration and high cost. Potential advantages ofa compound of

Formula (I ), or a pharmaceutically acceptable sait of any of the toregoing, can be less adverse side eftects, delay in the onset of an adverse side effect and/or réduction in the severity of an adverse side effect. A drawback with nucleoside/nucleotide treatment can be the development of résistance, including cross-resistance.

[0118] Résistance can be a cause for treatment failure. The term “résistance” as used herein refers to a viral strain displaying a delayed, lessened and/or null response to an anti-viral agent. In some embodiments, a compound. or a pharmaceutically acceptable sait thereof, as described herein can be provided to a subject infected with an HBV and/or HDV strain that is résistant to one or more anti-HBV and/or anti-HDV agents. Examples of antiviral agents wherein résistance can develop include lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide and tenofovir disoproxil. In some embodiments, development of résistant HBV and/or HDV strains is delayed when a subject is treated with a compound, or a pharmaceutically acceptable sait thereof, as described herein compared to the development of HBV and/or HDV strains résistant to other HBV and/or HDV anti-viral agents, such as those described.

(0119] Previously known compounds, such as those provided in WO 2017/156255, were shown to form adducts with glutathione in in vitro assays. Formation of glutathione adducts can be a signal that a compound has the potential to induce liver injury. Thus. the formation of glutathione adducts can be used as a signal to predîct safety. Unexpectedly, compounds described herein. such as many compounds of Formula (1), and pharmaceutically acceptable salts thereof, hâve been shown not to form adducts with glutathione in in vitro assays. Further, known compounds (for example, those described in WO 2017/156255), hâve demonstrated potency in a HepG2.2.l5 cell based assay with an ECso of >1000 pM. Many compounds described herein. such as compounds of Formula (1), and pharmaceutically acceptable salts thereof, unexpectedly show improved potency in a HepG2.2.l5 cell based assay with an ECso <1000 pM range. Thus, compounds described herein, including compounds of Formula (I), and pharmaceutically acceptable salts thereof, can be at least 16 times more potent than previously known compounds. In some embodiments, improved potency can lead to a significantly lower dose requirement and therefore improve daily dose burden as well as lead to improved safety margins.

Combination Thérapies

[0120| In some embodiments. a compound. or a pharmaceutically acceptable sait thereof, as described herein can be used in combination with one or more additional agent(s) for treating and/or inhibiting réplication HBV and/or HDV. Additional agents include, but are not limited to, an interferon, nucleoside/nucleotide analogs, a sequence spécifie oligonucleotide (such as anti-sense oligonucleotide and siRNA), nucleic acid polymers (NAPs, such as nucleic acid polymers that reduce HBsAg levels) an entry inhibitor and/or a small molécule immunomodulator. Examples of additional agents include recombinant interferon alpha 2b, IFN-α, PEG-IFN-a-2a, lamîvudine, telbivudine, adefovir dipivoxil. clevudine, entecavir, tenofovir alafenamide and tenofovir disoproxil. Examples of NAPs include, but are not limited to, REP 2139, REP 2165 and those described in U.S. Application No. 62/757632, filed November 8, 2018, which is hereby incorporated by reference for the purpose of the NAPs described therein.

[01211 In some embodiments, a compound. or a pharmaceutically acceptable sait thereof, as described herein can be administered with one or more additional agent(s) together in a single pharmaceutical composition. In some embodiments. a compound, or a pharmaceutically acceptable sait thereof, can be administered with one or more additional agent(s) as two or more separate pharmaceutical compositions. Further, the order of administration of a compound, or a pharmaceutically acceptable sait thereof, as described herein with one or more additional agent(s) can vary.

EXAMPLES

[0122] Additional embodiments are disclosed in further detail in the following examples, which are not in any way intended to limit the scope of the daims.

EXAMPLE l

COMPOUNDA

|0123| A 250-mL 3-necked round-bottom flask purged and inaintained with an inert atmosphère of Nj was charged with 3-tert-butyl 4-methyl 2,2-dimethyl-l,3-oxazolidine3,4-dicarboxylate (5.00 g, I9.3 mmol, I.00 eq.), toluene (50 mL). Diisobutylaluminium hydride (38.6 mL, 38.6 mmol, 2.00 eq., IM in toluene) was slowly added at -78 °C. The rate of addition was adjusted so as to keep the internai température below -65 °C. The resulting solution was stirred for 2 h at -78 °C, and the reaction quenched by slowly adding cold CEhOH (10 mL). The mixture was slowly poured into ice-cold IM HCl (100 mL), and the mixture was extracted with ethyl acetate (3 x I00 mL). The combined organic layer was washed with brine, dried over anhydrous sodium sulfate and concentrated under vacuum to afford tert-butyl 4-formyl-2,2-dimethyl-l.3-oxazolidine-3-carboxylate (4.20 g. crude) of as a colorless oil.

|0l24] A 40-mL vial was charged with tert-butyl 4-formyl-2,2-dimethyl-l,3oxazolidine-3-carboxylate (4.20 g. I8.3 mmol, I.OO eq.), dimethyl (l-diazo-2oxopropyl)phosphonate (4.22 g, 22.0 mmol, I.20 eq.), K2CO3 (5.06 g, 36.6 mmol, 2.00 eq.) and methanol (20 mL). The resulting solution was stirred for overnight at room température (rt). The reaction was quenched by water (20 mL) and diluted with ethyl acetate (3 x 20 mL). The mixture was washed with brine (20 mL) and water (20 mL), dried over anhydrous sodium sulfate, fdtered and concentrated under reduced pressure. The residue was chromatographed on a silica gel column with ethyl acetate (EA):petroleum ether (PE) (l :10) to provide 3.20 g (70% yield) of tert-butyl 4-ethynyl-2.2-dimethyl-l,3-oxazolidine-3carboxylate as a yellow oil.

I

[0125] A solution of tert-butyl 4-ethynyl-2,2-dimethyl-l,3-oxazolidine-3carboxylate (1.00 g. 4.44 mmol), 4M hydrochloric acid in 1,4-dioxane (5 mL) and éthanol (10 mL) was stirred overnight at 60 °C. The mixture was concentrated under reduced pressure to provide 2-aminobut-3-yn-l-ol hydrochloride (538 mg, crude) as a yellow solid. 5 Ή NMR (300 MHz. Methanol-Λ) δ 4.14 (br, 1H), 3.89 (dd, ./= 1 1.6, 4.2 Hz, 1H), 3.75-3.68 (m, 1H), 3.25 (d, J= 2.4 Hz. I H). LCMS (ES) m/z = 86 (M+H-HCI)⁺.

EXAMPLE 2

COMPOUND B

B1 B2 \ / —Si

OH

I0 ^B

[0126| The mixture of 3-(benzyloxy)cyclobutan-l-one (5.00 g, 28.4 mmol, 1.00 eq.), titanium isopropylate (8.80 g, 30.9 mmol, 1.09 eq.), tert-butanesulfinamide (3.70 g, 30.5 mmol, 1.08 eq.) and dichloromethane (50 mL) was stirred overnight at 45 °C. The mixture was cooled to rt. Sat. sodium bicarbonate solution (5 mL) was added. The mixture was 15 stirred 30 min, and the solids were filtered off. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA:PE (1:10) to afford N-[3-(benzyloxy)cyclobutylidene]-2-methyipropane-2-sulfmamide (4.50 g, 57% yield) as a light yellow oil.

[0127] To a stirred mixture of trimethylsilylacetylene (4.70 g, 47.8 mmol, 2.97 20 eq.) in diethyl ether (100 mL) was added n-BuLi (13.0 mL, 32.5 mmol, 2.02 eq., 2.5 M in hexane) dropwise -78 °C under Lh atmosphère. The mixture was stirred for I h at -78 °C. N[3-(benzyloxy)cyclobutylidene]-2-methylpropane-2-sulfinamide (4.50 g, 16.1 mmol, 1.00

I eq.) in Et2O ( I0 mL ) was added dropwise at -78 °C. The mixture was stirred for 2 h at -78 °C. The reaction was quenched by water ( I00 mL). The mixture was extracted with EA (3 x 100 mL). The organic layers were combined, dried over with anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by Prep-TLC 5 (EA:PE=l:3) to afford N-[3-(benzyloxy)-l-[2-(trimethylsilyl)ethynyl]cyclobutyl]-2methylpropane-2-sulfinamide (950 mg. 16% yield) as a colorless oiL

[0128| To a stirred mixture of N-[3-(benzyloxy)-l-[2(trimethylsilyl)ethynyl]cyclobutyl]-2-methylpropane-2-sulfinamide (300 mg, 0.800 mmol. l.OO eq.) in chloromethane (5 mL) was added BBrs (3.00 mL, 3.00 mmol, 3.70 eq., I M in 10 DCM) at rt. The mixture was stirred for 2 h at rt. Water (0.1 ml) was added to the mixture and stirred for 0.5 h. The solids were filtered off. The filtrate was concentrated under reduced pressure to afford 3-amino-3-((trimethylsilyl)ethynyl)cyclobutan-l-ol hydrobromide sait ( I30 mg, 62% yield) as a light yellow solid. 'H NMR (400 MHz, Methanol-ίΛ) δ 4.424.31 (m, IH), 2.83 (ddt. J= 9.I, 7.0, 2.5 Hz. 2H), 2.37 (ddt. ./= 11.6, 7.6, 2.2 Hz. 2H), 0.22 15 (s, 9H). LCMS (ESI, m/z): 184 [M+H-HBr]⁺.

EXAMPLE 3

COMPOUNDC

C1

C2 C

[0129] The mixture of 3-oxetanone (5.00 g, 69.4 mmol, 1.00 eq.), tertbutanesulfinamide (9.20 g, 75.9 mmol, 1.10 eq.), titanium isopropylate (21.6 g, 76.0 mmol, 1.10 eq.) and dichloromethane (50.00 mL) was stirred overnight at 45 °C. The reaction was cooled to rt and quenched with sat. sodium bicarbonate solution (5.0 mL). The mixture was stirred 30 min. and the solids were filtered off. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA:PE ( 1:10) to afford 2-methyl-N-(oxetan-3-ylidene)propane-2-sulfinamide (5.00 g. 39% yield) as a light yellow oil. LCMS (ESI, m/z): 176 [M+H]⁺.

(0130| To a stirred mixture of trimethylsilylacetyiene (8.40 g, 85.5 mmol, 3.00 eq.) in THF (50.00 mL) was added n-BuLi (30.0 mL, 2.5 M in 5 hexane, 75.0 mmol. 2.63 eq.) dropwise at -78 °C under atmosphère. The mixture was stirred for I h at -78 °C. The mixture of 2-methyl-N-(oxetan-3-ylidene)propane-2sulfinamide (5.00 g, 28.5 mmol, I.OOeq.) in THF (10 mL ) was added dropwise at -78 °C. The reaction was stirred for 2 h at -78 °C, and then quenched by water (100 mL). The mixture was extracted with EA (3 x 100 mL). The organic phase was washed with water, 10 dried with anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA:PE ( 1:10) to afford 2-methyl-N-[3-[2-(trimethylsilyl)ethynyl]oxetan-3-yl]propane-2sulfinamide (7.00 g, 88% yield) as a yellow solid. LCMS (ESI, m/z): 274 [M+H]‘.

[0131] Hydrochloric acid (7.5 mL, 30.0 mmol, 2.05 eq., 4 M in 1,4-dioxane) was 15 added to the mixture of 2-methyl-N-[3-[2-(trimethylsilyl)ethynyl]oxetan-3-yl]propane-2sulfinamide (4.00 g, 14.6 mmol, 1.00 eq.) and 1,4-dioxane (50 mL). The mixture was stirred for 2 h at rt. The solid was collected by filtration, washed with PE and dried to afford 3-[2(trimethylsilyl)ethynyl]oxetan-3-amine hydrochloride (2.70 g, 89% yield) as a light yellow solid. LCMS (ESI. m/z): 170 [M+H-HCI]⁺.

EXAMPLE 4

COMPOUNDD

D1

[0132] A 250 mL round bottom flask was charged with ethyl 3,5-dimethyl-lH5 pyrrole-2-carboxylate (10.0 g, 59.8 mmol, L00 eq.) and dimethylsulfoxide (100 mL). KOH (5.03 g, 89.7 mmol, 1.50 eq.) was added in portions at 0 °C. The mixture was stirred 30 min at rt. Methyl iodide (10.2 g, 71.8 mmol, 1.20 eq.) was added dropwise at rt. The resulting solution was stirred for 4 h at rt. The reaction was quenched by water (100 mL) and diluted with EA (500 mL). The mixture was washed with brine (200 mL) and water (5 x 100 mL ).

dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to provide ethyl l,3,5-trimethyl-IH-pyrrole-2-carboxylate (10.1 g, 92% yield) as a white solid. LCMS (ESI, m/z): 182 [M+H]⁺.

[0133] A 100-mL three-necked round-bottom flask was placed ethyl 1,3,5trimethylpyrrole-2-carboxylate (2.00 g, 11.0 mmol, 1.00 eq.), 5-amino-2-fluorobenzonitrile 15 (3.00 g, 22.1 mmol, 2.00 eq.) and tetrahydrofuran (20 mL) under Nz. Lithium hexamethyldisilazide (33.0 mL, 33.0 mmol, 3.00 eq., IM in THF) was added dropwise to above mixture at 0 °C. The resulting solution was stirred overnight at rt. and the reaction quenched with a sat. ammonium chloride solution (50 mL). The mixture was extracted with EA (3 x 50 mL). The organic layers were combined, dried over anhydrous sodium sulfate 20 and concentrated under vacuum. The residue was purified by trituration with EA:hexane (1:1), and the solid was collected by filtration and dried to afford N-(3-cyano-41 fluorophenyl)-l,3,5-trimethylpyrrole-2-carboxamide (2.50 g, 75% yield) as awhite solid. LCMS (ESI, m/z): 272 [M+Hf.

[0134| Into a 50-mL 3-necked round-bottom flask was placed ethyl 1,3,5trimethyl-1 H-pyrrole-2-carboxylate (2.50 g, 13.8 mmol, 1.00 eq.) and dichloromethane (100 mL). Ethyl oxalochloridate (2.82 g, 20.0 mmol, 1.50 eq.) in dichloromethane (20 ml) was added dropwise to the mixture at 0 °C. Aluminium chloride (4.23 g, 31.7 mmol, 2.50 eq.) was added in portions at 0 °C. The solution was stirred overnight at rt, and the reaction was quenched with water/ice. The solution was extracted dichloromethane (3 x 100 mL). The organic layers were combined, washed with sat. sodium bicarbonate solution (100 mL) and water (100 mL). The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was purified by trituration with EA:hexane (1:1), and the solid was collected by filtration and dried to afford ethyl 4-(2-ethoxy-2-oxoacetyl)-l,3,5-trimethyl1 H-pyrrole-2-carboxylate (2.00 g, 56% yield) as a white solid. LCMS (ESI, m/z)\ 372 [M+H]⁺.

[0135] A 50 mL round bottom tlask was charged with ethyl 4-(2-ethoxy-2- oxoacetyI)-1,3,5-trimethyl-IH-pyrrole-2-carboxylate (2.00 g. 5.39 mmol, 1.00 eq.), lithium hydroxide (21.6 mg. 10.8 mmol, 2.00 eq.), methanol (50 mL) and water (10 mL). The resulting solution was stirred overnight at rt. The methanol was removed under reduced pressure. The residue was dissolved with water (50 mL) and extracted by EA (3 x 20 mL).

The pH value of the water layer was adjusted to 3 with hydrochloric acid (1 mol/L). The mixture was extracted EA (3 x 50 mL). The organic layers were combined. dried over anhydrous sulfate, filtered and concentrated under reduced pressure to provided desired product 2-(5-((3-cyano-4-fluoropheny l)carbamoyl)-1,2,4-trimethy I-1 H-pyrrol-3-y l)-2- oxoacetic acid (1.50 g, 81% yield ) as white solid. LCMS (ESI, m/z): 344 [M+HJL

6!

EXAMPLE 5

COMPOUND E

|(H36| A 250 mL round bottom tlask was charged with ethyl 3,5-dimethyl-l Hpyrrole-2-carboxylate (10.0 g, 59.8 mmol, L00 eq.) and dimethylsulfoxide (I00 mL). KOH (5.03 g. 89.7 mmol, I.50 eq.) was added in portions at 0 °C. The mixture was stirred 30 min at rt. Methyl iodide (10.2 g. 71.8 mmol. 1.20 eq.) was added dropwise to above mixture at rt. The resulting solution was stirred for 4 h at rt. The reaction was quenched by water (100 mL) and diluted with EA500 mL). The mixture was washed with brine (200 mL) and water (5 x I00 mL ), dried over anhydrous sodium sulfate, fîltered and concentrated under reduced pressure to provide ethyl l,3,5-trimethyl-lH-pyrrole-2-carboxylate (lO.l g, 92% yield) as a white solid. LCMS (ESI, m/z): 182[M+Hf.

[0137] Into a 250-mL round-bottom tlask purged and maintained with an inert atmosphère of N?, was placed ethyl l.3.5-trimethylpyrrole-2-carboxylate (5.00 g. 27.6 mmol, 1.00 eq.), 4-fluoro-3-(trifluoromethyl)aniline (7.40 g. 41.3 mmol, 1.50 eq.) and tetrahydrofuran (50.00 mL). LÎHMDS (80.0 mL, 80.0 mmol, 2.90 eq„ I mol/L in THF) was added dropwise to the mixture at 0 °C. The resulting solution was stirred overnight at rt, and the reaction was quenched with a sat. ammonium chloride solution (100 mL), The solution was extracted with EA (3 x 100 mL). The organic layers were combined. dried over anhydrous sodium sulfate, fîltered and concentrated under vacuum. The resîdue was purified by trituration with EAihexane (1:1). The solids were collected by filtration and dried to provide N-[4-fluoro-3-(trifluoromethyl)pheny l]-l,3.5-trimethylpyrrole-2-carboxamide (9.00 g. 93% yield) as a white solid. LCMS (ESI. m/=): 315 [M+H]'.

|0138] Into a 250-mL 3-necked round-bottom flask purged and maintained with an inert atmosphère of N:, was placed N-[4-fluoro-3-(trifluoromethyl)phenyl]-l,3,55 trimethylpyrrole-2-carboxamide (3.00 g, 9.55 mmol, l .00 eq.) and dichloromethane (I00 mL). A solution of ethyl chloroglyoxylate (I.56 g, 11.5 mmol, I.20 eq.) in dichloromethane (20 mL) was added dropwise to the mixture at 0 °C. Aluminium chloride (1.90 g. I4.3 mmol, 1.50 eq.) was added to above mixture in portions at 0 °C. The resulting solution was stirred overnight at rt. and the reaction quenched by ice/water (100 mL). The mixture was 10 extracted with dichloromethane (3 x 100 mL). The organic layers were combined. washed with sat. sodium bicarbonate solution (100 mL) and water (I00 mL), dried over anhydrous sodium, filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA:PE (1:2) to afford ethyl 2-(5~[[4-tluoro-3(trifluoromethyl)phenyl]carbamoyl]-l.2.44rimethylpyrrol-3-yl)-2-oxoacetate (2.00 g, 48% yield) as a white solid. LCMS (ESI. w/-): 415 [M+H]*.

|0l39] A 100 mL round bottom flask was charged with ethyl 2-(5-[[4-fluoro-3(trifluoromethyl)phenyl]carbamoyl]-l.2,4-trirnethylpynOl-3-yl)-2-oxoacetate (2.00 g. 4.83 mmol, I.00 eq.), LiOH (0,231 g. 9.65 mmol, 2.00 eq.). methanol (50.00 mL) and water (I0.00 mL). The resulting solution was stirred overnight at rt and diluted with water (100 20 mL). The pH value of the mixture was adjusted to 3 with hydrochloric acid (l mol/L). The mixture was extracted with EA (3 x I00 mL). The organic layers was combined, dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to provide (5-[[4fluoro-3-(trifluoromethyl)phenyl]carbamoyl]-l,2,4-trimethylpyrrol-3-yl)(oxo)acetic acid ( 1.85 g, 94% yield) as a white solid. LCMS (ESI, m/:): 387 [M+H]⁺.

EXAMPLE 6

COMPOUND 26

[0140] A mixture compound D (LOOg.

2.91 mmol, 1.00 eq.), HATU (3.30 g, 8.68 mmol, 2.98 eq.), E2-dichloromethane (50 mL), N.N-diisopropylethylamine (1.50 mL. 8.61 mmol, 2.96 eq.) and compound C (0.900 g, 4.37 mmol, 1.50 eq.) was stirred ovemight at rt. The reaction was quenched by water (200 mL). The mixture was extracted with dichloromethane (3 x 200 mL). The combined organic layers were washed with water (100 mL). dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by trituration with EA (50 mL), and the solid was collected by filtration and dried to afford N-(3-cyano-4fluorophenyl)-l,3.5-trimethyl-4-[([3-[2-(trimethylsilyl)ethynyl]oxetan-3yl]carbamoyl)carbonyl]pyrrole’2-carboxamide (1.30 g, 90% yield) as a whîte solid. LCMS (ESI. m s): 495 [M+H]⁺.

[0141] The mixture of N-(3-cyano-4-fluorophenyl)-l ,3,5-trimethyl-4-[([3-[2(trimethylsilyl)ethynyl]oxetan-3-yl]carbamoyl)carbonyl]pyrrole-2-carboxamide ( 1.30 g, 2.63 mmol, 1.00 eq.), potassium carbonate (1.10 g, 7.89 mmol. 3.00 eq.), methano! (5 mL) and N,N-dimethylformamide (20 mL) was stirred for 2 h at rt. The solids were filtrated off. The filtrate was concentrated under reduced pressure. The residue was trituration by water ( 100 mL), and the solid was collected by filtration and dried to afford N-(3-cyano-4fluorophenyl)-4-[[(3-ethynyloxetan-3-yl)carbamoyl]carbonyl]-l,3.5-trimethylpyrrole-2carboxamide (compound 26) (784.8 mg. 68% yield) as an off-white solid. 'H NMR (400 MHz. DMSO-Æ) δ 10.53 (s, 1H), 9.75 (s, 1H), 8.20 (dd, J = 5.8, 2.7 Hz, 1H), 7.95 (ddd, J =

8.0, 4.7, 2.6 Hz. IH), 7.53 (t, J = 9.I Hz, I H), 4.72 (d. J =6.6 Hz. 4H), 3.65 (s, I H). 3.59 (s, 3H). 2.4I (s. 3H), 2.25 (s, 3H). LCMS (ESI, m/z): 423 [M+Hf.

EXAMPLE 7

COMPOUNDS 3la AND3lb

31a

[0142] A 40 mL vial was charged with Compound A (240 mg. 1.97 mmol, 1.00 eq.), 1,2-dichloroethane (10 mL), Compound D (678 mg, 1.97 mmol, 1.00 eq.), 1[Bis(dimethylamîno)methylene]-I H-l ,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (751 mg. 1.97 mmol, 1.00 eq.) and N,N-diisopropylethylamine (766 mg. 5.92 mmol, 3.00 eq.). The resulting solution was stirred overnight at rt. and the reaction was quenched by water (10 mL). The mixture was extracted with EA (3 x 10 mL). The organic layers were combined, washed with brine (3x10 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The product mixture (360 mg) was 15 separated by pre-Chiral-HPLC (Column: CHIRALPAK IG, 20*250mm,5 um; Mobile Phase A:Hex(8mmol/L NH3.MeOH)-HPLC, Mobile Phase B:EtOH—HPLC; Flow rate: 18 mL/min; Gradient:50 B to 50 B in 22 min; 254/220 nm; RTL12.491; RT2:17.I62). The appropriate fractions were identified by UV absorbance (254 nm) to obtain pure the first eluting isomer N-(3-cyano-4-fluorophenyl)-4-([[(2S)-l-hydroxybut-3-yn-2-yl]carbamoyl|carbony 1)-1,3,520 trimethylpyrrole-2-carboxamide (125.6 mg, 0.306 mmol) as a white solid. LCMS (ES) m/z = 41 I (M+H)⁺. ¹H NMR (300 MHz. DMSO-î/ô) δ 10.52 (s, 1 H), 9.05 (d, J= 8.2 Hz. 1 H), 8.19 (dd. J= 5.8, 2.7 Hz, 1H). 7.92-7.98 (m, 1H), 7.53 (t../=9.2 Hz, 1 H), 5.13 (t, ./= 5.9 Hz, 1H), 4.58-4.65 (m, 1 H), 3.66-3.46 (m, 5H), 3.22 (d, J= 2.3 Hz. I H), 2.39 (s. 3H), 2.24 (s, 3H).

[0143] The second eluting isomer N-(3-cyano-4-fluorophenyl)-4-([[(2R)-lhydroxybut-3-yn-2-yl]carbamoyl]carbonyl)-l,3,5-trimethylpyrrole-2-carboxamide (133.5 mg, 0.326 mmol) as a white solid. LCMS (ES) m/z = 411 (M+H)⁺. 'H NMR (300 MHz. DMSO-i4>) 8 10.52 (d, .7 = 3.5 Hz, 1H), 9.07 (d, J = 8.2 Hz. 1H). 8.28-8.1 1 (m, IH), 7.927.98 (m, 1H), 7.60-7.45 (m, 1H), 5.14 (s, 1H), 4.61 (s, 1H). 3.57 (s, 5H), 3.21-3.23 (m, IH), 2.39 (d, J= 4.0 Hz. 3H). 2.24 (d, .7= 4.1 Hz, 3H).

EXAMPLE 8

COMPOUND 32

[0144] The mixture of Compound B (200 mg. 1.10 mmol, 1.00 eq.), Compound D (250 mg, 0.700 mmol, 0.67 eq.), ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (320 mg, 1.70 mmol, 1.50 eq.), l-hydroxy-7-azabenzotriazole (220 mg, 1.60 mmol, 1.50 eq.), N,N-diisopropylethylamine (220 mg, 1.70 mmol, 1.56 eq.) and 1,2dichloroethane (10 mL) was stirred overnight at rt and concentrated in reduced pressure. The residue was dissolved in EA (50 mL) and washed with water (3 x 20 mL). The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was purified by Prep-TLC (EA:PE=2:1 ) to afford N-(3-cyano-4-fluorophenyl)-4-[([3hydroxy-l-[2-(trimethyIsilyl)ethynyl]cyclobutyl]carbamoyl)carbonyl]-1,3,5trimethylpyrrole-2-carboxamide ( 170 mg. 46% yield) as a yellow solid. 'H NMR (400 MHz.

DMSO-î/ô) δ 10.55 (s, 1Η), 9.29 (s, IH), 8.22 (dd, J = 5.8. 2.7 Hz, 1H), 7.98 (ddd. J= 9.3, 4.9, 2.7 Hz, IH), 7.56 (t, ./=9.1 Hz, IH), 5.33 (d, J=6.7 Hz. IH), 4.14 (q, J = 7.2 Hz. 1H). 3.60 (s, 3H), 2.77 (ddd. ./=9.5, 6.9, 3.0 Hz, 2H), 2.43 (s, 3H), 2.28 (s, 3H), 2.22-2.10 (m, 211), 0.14 (s, 9H). LCMS (ESI, w/z): 509 [M+H]⁺.

[0145] The mixture of N-(3-cyano-4-fluorophenyl)-4-[([3-hydroxy-l-[2(trimethylsilyl)ethynyl]cyclobutyl]carbamoyl)carbonyl]-l,3,5-trimethylpyrrole-2carboxamide (170 mg, 0.30 mmol, 1.00 eq.), methanol (5 mL) and potassium carbonate (150 mg, 1.10 mmol, 3.22 eq.) was stirred for 2 h at rt. The solids were fïltered off. The fïltrate was concentrated under reduced pressure. The residue was purified by préparative HPLC using the following gradient conditions: Column: XBridge Cis OBD Prep Column. 19 mm x 250 mm; Mobile Phase A: Water (0.05% TFA), Mobile Phase B: THF-HPLC; Flow rate:25 mL/min; Gradient: 25% to 55% in 7 min; 220 nm. Purification resulted in N-(3-cyano-4fluorophenyl)-4-[[(l-ethynyl-3-hydroxycyclobutyl)carbamoyl]carbonyl]-1,3,5- trimethylpyrrole-2-carboxamide (26.1 mg, 18% yield) as ayellow solid. 'H NMR (300 MHz.

DMSO-îÇ) δ 10.50 (s, IH), 9.26 (s, IH), 8.20 (dd, ./= 5.8, 2.7 Hz, IH), 8.03-7.91 (m, 1 H), 7.53 (t,J=9.2 Hz. IH), 5.30 (d, J= 6.7 Hz. 111), 4.15 (q, J =7.3 Hz, IH). 3.60(s, 3H). 3.22 (s, IH), 2.83-2.71 (m. 2H), 2.42 (s, 3H), 2.27 (s, 3H), 2.17 (t. J = 10.1 Hz. 2H). LCMS (ESI, m/-): 437 [M+H]~.

EXAMPLE 9

COMPOUND 54

[0146] Césium carbonate (9.78 g, 30 mmol, 3 eq.) was added to a stirred solution of Compound 26 (4.22 g. 10 mmol), di-tert-butyI chloromethyl phosphate (3.89 g. 15 mmol. 1.5 eq.) and tetrabutylammonium iodide (738 mg. 2 mmol, 0.2 eq.) in anhydrous DMSO (40 mL). The mixture stirred overnight at rt and then partitioned between water and ethyl acetate. The organic phase was separated and washed with dihited brine (2x). The aqueous phases were back-extracted with ethyl acetate. The combined organic solution was dried over sodium sulfate and concentrated under reduced pressure to a give a yellow-beige foam (9 g). The residue was purified by column chromatography in 40 to 100% ethyl acetatehexane to give the bis-tert-butyl phosphate intermediate ( 1.72 g, 27%).

|0U7| To solution of the bis-tert-butyl phosphate intermediate from previous step (1.7 g, 2.6 mmol) in IPA (10 mL) were added 0.2M aq. sodium acetate solution (6 mL, 1.2 mmol, 0.46 eq.) and 0.2M aqueous acetic acid (2 mL, 0.4mmol, 0.15 eq.). The mixture was heated at 55-60 °C for 3 h. After cooling to rt, the mixture was made basic (pH 8.5) with 2N aq. NaOH (3.1 mL, 6.2 mmol). The resulting solution was concentrated under reduced pressure to-8 mL. Some precipitate was filtered-off and discarded. The fdtrate was diluted with acetone (40 mL), and resulting mixture was kept overnight at 4 °C. A fine crystalline solid formed and was collected by tiltration, rinsed with acetone and dried under vacuum to provide sodium (2-(5-((3-cyano-4-fluorophenyl)carbamoyl)-l.2.4-trimethyl-lH-pyrrol-3-yl)N-(3-ethynyloxetan-3-yl)-2-oxoacetamido)methyl phosphate (1.15 g, 76%). LC-MS: (ES, m/-): 531 [M-H]'. ’H NMR (400 MHz. D?O ). δ 7.94 (m. I H), 7.74 (m, I H), 7.31 (dd. 1 H).

5.16 (d. 2H), 5.0 (d. 2H). 4.82 (d, 2H), 3.56 (s, 3H). 2.45 (s. 3H). 2.28 (s. 3H).

EXAMPLE 10

COMPOUND 73

[0148] To a stirred at 0 °C solution of Compound 26 (844mg. 2 mmol) and chloromethyl isobutyrate (0.379 mL, 3 mmol, 1.5 eq.) in DMF (15 ml) was added sodium hydride (176 mg as 60% dispersion in minerai oil, 4.4 mmol, 2.2 eq.). The mixture was stirred at rt for 2 h, and then partitîoned between half-saturated aqueous solution ot ammonium chloride and ethyl acetate. The organic phase was separated, dried over sodium sulfate and concentrated under reduced pressure. [[2-[5-[(3-cyano-4-fluorophenyl)carbamoyl]-l ,2.4-trimethyl-pyrrol-3-yl]-2-oxo-acetyl]-(3-ethynyloxetan-3yl)amino]methyl 2-methylpropanoate (Compound 73, 530 mg, 50.8%) was isolated by column chromatography (5 to 25% ethyl acetate in dichloromethane) followed by crystallization from isopropyl acetate. LC-MS: (ES. m/z): 523 [M+H)]L ^lH NMR (400 MHz. DMSO-t/ô), δ 10.6 (bs. IH), 8.22 (dd, l H), 7.98 (m, IH), 7.55 (dd. IH), 5.47 (s, 2H), 4.93 (d, 2H), 4.65 (d, 2H), 3.71 (s, IH), 3.62 (s, 3H), 2.48 (m, IH), 2.45 (s, 3H), 2.28 (s, 3H), 1.05 (d,6H).

EXAMPLE l l COMPOUND 77

(0149] [[2-[5-[(3-cyano-4-fluoro-phenyl)carbamoyl]-l,2,4-trimethyl-pyrrol-3-yl]2-oxo-acetyl]-(3-ethynyloxetan-3-yl)amino]methyl 2.2-dimethylpropanoate was synthesized as described in Example 10 using pivaloyl chloride in place of chloromethyl isobutyrate. Compound 77 (800 mg, 74.6%) was isolated by column chromatography (5-25% ethyl acetate in dichloromethane) followed by crystallization from ethyl acetate:hexane. LC-MS: (ES, m/z): 537 [M+H)]⁺. Ή NMR (400 MHz, DMSO-ώ), δ 10.6 (bs, IH). 8.21 (dd, IH), 7.97 (m, IH), 7.55 (dd. IH), 5.46 (s. 2H), 4.93 (d, 2H). 4.66 (d, 2H), 3.73 (s, IH), 3.62 (s.

3H), 2.45 (s, 3H), 2.28 (s, 3H), 1.07 (s. 9H).

EXAMPLE I2

COMPOUND 78

|01501 [[2-[5-[(3-cyano-4-fluoro-phenyl)carbamoyl]-l,2,4-trimethyl-pyrrol-3-yl]2-oxo-acetyl]-(3-ethynyloxetan-3-yl)amino]methyl isopropyl carbonate was synthesized as described in Example 10 using chloromethyl isopropyl carbonate in place of chloromethyl isobutyrate. Compound 78 (770 ing. 71.6%) was isolated by column chromatography (530% ethyl acetate in dichloromethane) followed by crystallization from ethyl acetate:hexane. LC-MS: (ES, m/z): 539 [M+H)]'. Ή NMR (400 MHz. DMSO-A), δ 10.6 (bs, 1H). 8.22 (dd. IH), 7.98 (m. 1H). 7.56 (dd. I H). 5.49 (s. 2H). 4.92 (d. 2H). 4.71 (m, 1 H). 4.65 (d. 2H). 3.71 (s, 1 H). 3.62 (s. 3H), 2.44 (s, 3H), 2.27 (s. 3H). 1.20 (d, 6H).

EXAMPLE 13

COMPOUND 66b

(0151J 90% hydroxyacetone (16.59 g) and 4-dimethylaminopyridine (1.37 g, 0.05 eq.) were combined in a reactor and diluted with dichloromethane (100 mL). lerlbutyldiphenylsilyl chloride (63.40 g, 1.03 cq.) was added, and then rinsed with dichloromethane (230 mL). The solution was cooled with a rt water bath and stirred while triethylamine (36 mL, 1.15 eq.) was added over I min. After 3 mins. the solids began to precipitate. After 18 h. the mixture was concentrated and hexane (350 mL) and water (200 mL) were added. The aqueous phase removed via a separatory funnel. The organic phase was washed water (2 x 150 mL). dried with sodium sulfate and concentrated to provide I22136 ((/er/-butyIdiphenylsilyl)oxy)propan-2-one (72.62 g). H NMR (CDCh, 400 MHz): δ 7.70 (4H. d), 7.47 (6H, m), 4.20 (2H, s), 2.22 (3H. s), l. 13 (9H. s).

[0152| (R)-(+)-2-Methyl-2-propanesulfinamide (I8.47 g. I.O eq.), l-((/ertbutyldiphenylsilyl)oxy)propan-2-one (47.62 g, I.O eq.). and toluene (500 mL) were combined in a reactor under Ar. Titanium tetraisopropanoate (75.8 g, 1.75 eq.) was added, and then the mixture was rinsed with toluene (400 mL). The solution was heated at I00 °C for 23 h. After cooling to rt, sat. aq. sodium bicarbonate (50 mL) was added. and the mixture stirred for 2 mins. The resulting slurry was filtered through Celite, and the organic phase was dried with sodium sulfate. The solution was concentrated to a brown liquid that was purified by normal phase sîlica gel chromatography using an ethyl acetate-hexanes gradient to afford the product sulfinimine as a red oil (I3.8 g). The product was dîssolved in toluene (90 mL) and then loaded into an addition funnel above a reaction flask. The reaction flask was loaded with trimethylsilylacetylene (9.78 g. 3.0 eq.) and toluene (230 mL). An Ar atmosphère was established. and the mixture stirred and cooled with a dry ice-acetone bath. 2.5 M nbutyllithium in hexane (33.1 mL, 2.5 eq.) was added below an internai température of-6l °C. After stirring for l h and I0 mins. the sulfinimine solution was added over I h, and the internai température remained below -67 °C during this time. The mixture was stirred for 1.5 h before the cooling bath was removed. The mixture was warmed slowly by the agency of the surrounding air until -20 °C, when the reaction was warmed to 0 °C by immersion in a rtwater bath. Water (20 mL) was added, and the mixture was stirred for 2 mins. The mixture was then filtered through Celite. The organic phase was dried with sodium sulfate and concentrated to give a brown oil (16.8 g) that was purified by normal phase silica gel chromatography using a dichloromethane-ethyl acetate gradient to give (R)-A-((S)-l-((/erC butyldiphenylsilyl)oxy)-2-methyl-4-(trimethylsilyl)but-3-yn-2-yl)-2-methy!propane-2sulfinamide (6.00 g) as an orange oil. 'H NMR(CDCh, 400 MHz): Ô 7.75 (4H. m), 7.45 (6H, m). 3.90 (l H, s), 3.80 ( I H, d), 3.60 ( I H, d), l .50 (3H, s), l .25 (9H, s), 1. 10 (9H, s), 0.20 (9H, s).

[0153] (R)-A-(r5>-l-((/eri-butyldiphenylsilyl)oxy)-2-methyl-4-(trimethylsilyl)but3-yn-2-yl)-2-methylpropane-2-sulfinamide (6.00 g, 1.0 eq.) was dîssolved with 1,4-dioxane (70 mL) then 4M HCl (12 mL) in 1,4-dioxane (4.1 eq.). The solution was stirred for I h, and then concentrated. Toluene (75 mL) was added, and the solution was concentrated. To the

concentrate was added 2-(5-((4-fluoro-3-(trifluoromethyl)phenyl)carbamoyl)-1,2,4-trimethylI/f-pyrrol-3-yl)-2-oxoacetic acid (4.50 g, LO eq.), HATU (6.47 g. 1.46 eq.), N.Ndimethylformamide (250 mL), and N.N-diisopropylethylamine (I7.8 mL. 9.0 eq.). The solution was stirred for 21 h. and then concentrated. Ethyl acetate (250 mL) was added. The resulting solution was washed with water (I00 mL) and brine (50 mL), dried with sodium sulfate, concentrated and mixed with dichloromethane (60 mL). The slurry was filtered. The filtrate was concentrated and purified by normal phase silica gel chromatography using an ethyl acetate-hexane gradient to provide the product (7.58 g) as a yellow foam. ’H NMR (CDCh, 400 MHz): δ 7.90 (lH. m), 7.77 (5H, m), 7.63 (IH, s), 7.43 (6H, m), 7.25 (2H, m), I0 3.91 (IH, d), 3.85 (IH, d), 3.7! (3H, s), 2.4I (6H, s), l.7l (3H, s). 1.I2 (9H, s), 0.20 (9H, s).

LC-MS: (ES, m/z): 778 [M+l].

[0154] The starting material (7.58 g) was dissolved in THF (75 mL), and 1.0 M tetrabutylammonium fluoride (24 mL. 2.5 eq.) in THF was added. The solution was stirred for 2 h, and then concentrated. The concentrate was dissolved with ethyl acetate (100 mL).

The resulting solution was washed water (3 x 50 mL) and brine (30 mL), dried w ith sodium sulfate and concentrated to give a yellow oil (7.3 g). The oil was purified by normal phase silica gel chromatography using an ethyl acetate-hexane gradient to give a yellow foam (4.11 g) that was dissolved with DMF (30 mL). The mixture was stirred while slowly adding water (30 mL). Crystallization of white solids began after 3 minutes. Stirring of the 20 developing slurry was continued for I h and then it was cooled in an ice bath for 0.5 h. The slurry was filtered. washed with 2:1 watenDMF ( 10 mL), and then with water (20 mL). The filter cake was dried under vacuum at 65 °C to give i'.S'j-A-(4-fluoro-3(tri fluoromethyl)pheny 1)-4-(2-(( 1-hydroxy-2-methylbut-3-yn-2-yl)amino)-2-oxoacety 1)l,3.5-trimethyl-l/7-pyrrole-2-carboxamide (3.46 g) as a white powder. ^lH NMR (CDCh,

400 MHz): δ 10.50 (I H, s), 8.47 ( 1 H. s), 8.22 ( I H, m). 7.99 ( 1 H, m), 7.51 (1 H. t). 5.20 ( I H,

t). 3.70 ( I H, m), 3.60 (3H, s), 3.58 ( 1 H, m), 3.21 ( I H, s), 2.42 (3H, s), 2.30 (3H, s), 1.51 (3H, s). LC-MS: (ES, m/z): 468 [M+l]. a_D ²⁰ 20.6 °C (c = 1.03. MeOH).

EXAMPLE I4

COMPOUND 66a

[0155] (S)-(+)-2-Methyl-2-propanesulfinamide (4.82 g, 1.0 eq.), butyldiphenylsilyl)oxy)propan-2-one (12.43 g, 1.0 eq.), and toluene (310 mL) were combined in a reactor under Ar, Titanium tetraisopropanoate (13.57 g, 1.20 eq.) was added. and then the residue was rinsed with toluene (400 mL). The resulting solution was heated at 100 °C for 18 h. Aftercooling to rt, sat. aq. sodium bicarbonate (13 mL) was added, and the mixture stirred for 5 mins. The resulting slurry was filtered through Celite, and the organic 10 phase was dried with sodium sulfate. The solution was concentrated to give a brown liquid (16.5 g) that was purified by normal phase silica gel chromatography using an ethyl acetatehexanes gradient to afford the product sulfinimine (6.07 g) as an orange oil. The oil was dissolved in toluene (50 mL) and loaded into an addition tunnel above a reaction flask. The reaction flask was loaded with trimethylsilylacetylene (4.30 g. 3.0 eq.) and toluene (195 mL), 15 and an argon atmosphère established. The mixture was stirred and cooled with a dry iceacetone bath. 2.5 M n-buty11 ithium in hexane (14.6 mL, 2.5 eq.) was added below internai température of-63 °C. After stirring for I h and 10 minutes, the solution was warmed to -20 °C for 2 mins, The mixture was cooled below -67 °C while the sulfinimine solution was added over 14 mins. The mixture was stirred for I h from -73-(-67) °C, and then the cooling 20 bath was removed. The contents warmed slowly by the agency of the surrounding air until 40 °C, and when the reaction was warmed to 0 °C using immersion in a room temperaturewater bath. Water (10 mL) was added. The mixture was stirred for 5 mins, and then filtered through Celite. The organic phase was dried with sodium sulfate and concentrated to give an orange oil (7.55 g) that was partially purified using normal phase silica gel chromatography and an ethyl acetate-hexane gradient to give an orange oil (4.10 g). The oil was further purified using normal phase silica gel chromatography and an ethyl acetate-dichloromethane gradient to give- (S)-jV-((Æ)-l-((/É77-butyldiphenylsilyl)oxy)-2-methyl-4-(trimethylsilyl)but3-yn-2-yl)-2-methylpropane-2-sulfinamide (1.93 g) as a yellow oil. 'H NMR(CDCh, 400

MHz): δ 7.75 (4H, m), 7.45 (6H, m), 3.90 (IH, s), 3.80 (IH, d), 3.60 (IH. d). 1.50 (3H, s), l .25 (9H. s), l. 10 (9H, s). 0.20 (9H, s).

[0156] (5)-^-((/^-l-((/erAbutyldiphenylsilyl)oxy)-2-methyl-4-(trimethylsilyl)but3-yn-2-yl)-2-methylpropane-2-sulfinamide (1.93 g, 1.0 eq.) was dissolved with 1,4-dioxane (40 ml.) then 4M hydrogen chloride in 1,4-dioxane (4 mL 4.3 eq.) was added. The solution was stirred for 3 h, and then concentrated. To the concentrate was added 2-(5-((4-fluoro-3(trinuoromethyl)phenyl)carbamoyl)-l,2,4-trirnethyl-l/ï-pyrrol-3-yl)-2-oxoacetic acid (1.21 g. 0.83 eq.), HATU (1.79 g, 1.25 eq.), N,N-dimethylformamide (75 mL) and N,Ndiisopropylethylamine (4.2 mL, 6.42 eq.). The solution was stirred for 16 h. and then concentrated. Ethyl acetate (75 mL) was added. The solution was washed with water (30 mL) and brine (25 mL), dried with sodium sulfate and concentrated to a red solid (5.6 g) that was purified by normal phase silica gel chromatography using an ethyl acetate-hexane gradient to provide the product amide as a yellow foam (2.57 g). 'H NMR (CDCE, 400 MHz): δ 7.90 ( I H. m), 7.77 (5H, m), 7.63 ( I H, s), 7.43 (6H, m), 7.25 (2H. m), 3.91 (I H, d). 3.85 (1 H, d), 3.71 (3H, s), 2.41 (6H, s). 1.71 (3H, s), 1.12 (9H, s), 0.20 (9H, s). LC-MS: (ES, m/z): 778 |M+1], |0157| The starting material (2.57 g) was dissolved in THF (25 mL) and 1.0 M tetrabutylammonium fluoride in THF (8.2 mL, 2.5 eq.) was added. The solution was stirred for 1.5 h, and then concentrated. The concentrate was dissolved with ethyl acetate (30 mL). The solution was washed with water (3 x 20 mL) and then brine (15 mL). The solution was dried with sodium sulfate and concentrated to a yellow oil (2.6 g) that was purified by normal phase silica gel chromatography using an ethyl acetate-hexane gradient to give a yellow wax ( 1.4 g). The wax was dissolved with dichloromethane (80 mL), and then warmed to dissolve ail solids. The mixture was removed from heat and then stirred while the solution slowly cooled. A slurry developed over 1.5 h. The mixture was cooled for I h in an ice bath, and then filtered. The filter cake was washed with ice-cold dichloromethane, and then dried under vacuum at 60 °C to provide (7?>-jV-(4-fluoro-3-(tritluoromethyl)phenyl)-4-(2-((lhydroxy-2-methylbut-3-yn-2-yl)amino)-2-oxoacetyl)-l,3,5-trimethyl-l/7-pyrrole-2carboxamide (0.90 g) as a white powder. 'H NMR (CDCh, 400 MHz): δ 10.50 (IH, s), 8.47 (IH. s), 8.22 (IH. m), 7.99 (IH, m), 7.51 (IH, t), 5.20 ( 1 H, t), 3.70 (IH, m), 3.60 (3H, s).

3.58 (I H, m). 3.21 ( IH, s), 2.42 (3H, s), 2.30 (3H. s), l.5l (3H, s). LC-MS: (ES, m/z): 468 [M+l ]. an²⁰ -22.4 °C (c = 0.98, MeOH).

EXAMPLE 15

[0158] To a stirred solution of (R)-N-(4-fluoro-3-(trifluoromethyl)phenyl)-4-(2((l-hydroxy-2-methylbut-3-yn-2-yl)amino)-2-oxoacetyl)-l,3,5-trimethyl-lH-pyrrole-2carboxamide (233.5 mg. 0.5 mmol) in DCM (3 mL) and pyridine (0.2 mL) was added isobutyryl chloride (0.126 mL, 1.2 mmol). The mixture was warmed up to 40 °C and stirred overnight. After the reaction was quenched with methanol, the mixture was partitioned between isopropyl acetate and IM sodium dihydrogen phosphate. The organic layer was separated, and the solvent was removed under reduced pressure. The resîdue was purifled by column chromatography (20 to 50% ethyl acetate-hexane) to furnish 165a (192 mg. 71%) as a light-yellow foam. LC-MS: (ES, m/z): 538.4 [M+H]. 'H NMR(CDCh, 400 MHz): δ 7.91 (m, I H), 7.77 (m. 1 H), 7.65 (br. s. I H). 7.22 (dd, 1 H), 7.17 (br. s. 1 H), 4.46 (dd. 2H), 3.73 (s, 3H). 2.65 (m. I H), 2.46 (s, 1 H), 2.42 (s.. 3H), 2.41 (s, 3H). 1.75 (s, 3H), 1.22 (d. 6H).

[0159] The (S)-enantiomer was synthesized as described for the (R)-enantiomer using (S)-’N-(4-fluoro-3-(trifluoromethyl)pheny 1)-4-(2-(( 1 -hydroxy-2-methylbut-3-yn-220 yl)amino)-2-oxoacetyl)-l,3,5-trimethyl-lH-pyrrole-2-carboxamide. LC-MS: (ES, m/z): 538.4 [M+H],

EXAMPLE 16

COMPOUNDS I66a& 166b

[0160] Compounds 166a and 166b were synthesized from the parent aicohol (233 mg. 0.5 mmol) following the procedure described in Example 15 using pivaloyl chloride in place of isobutyryl chloride. 166a (237 mg, 86%). LC-MS: (ES, m/z): 552.5 [M+H]. 'H NMR (CDCh, 400 MHz): δ 7.91 (m, 1H). 7.77 (m. IH), 7.65 (br. s, 1H). 7.23 (dd, IH), 7.16 (br. s. IH), 7.44 (dd, 2H), 3.72 (s, 3H), 2.45 (s. IH), 2.42 (s, 3H), 2.40 (s, 3H), 1.75 (s, 3H), 1.26 (s, 911). 166b LC-MS: (ES, m/z): 552.5 [M+H],

EXAMPLE 17 COMPOUNDS 167a & 167b

[0161] To a stirred solution of Boc-L-valine (214 mg, 0.99 mmol) in acetonitrile (3 mL) was added carbonyldiîmidazole (160 mg, 0.99 mmol). After 1 h, a solution of the imidazolide was added to a solution of (S)-N-(4-fIuoro-3-(trifluoromethyl)phenyl)-4-(2-((lhydro.xy-2-methylbut-3-yn-2-y l)amino)-2-oxoacety 1)-1,3,5-trimethy 1-1 H-pyrrole-2carboxamide (307 mg. 0.66 mmol). DIPEA (0.343 mL, 1.97 mmol) and DMAP (16 mg, 0.13 mmol) in acetonitrile (2 mL). The reaction was allowed to proceed for 1 h at rt. and then the reaction was quenched with water. The solution was taken into isopropyl acetate and 1M sodium dihydrogen phosphate. The organic phase was separated, washed with sodium bicarbonate and concentrated under reduced pressure. The residue was purifled by column chromatography (20 to 50% ethyl acetate-hexane) to afford the Boc-protected intermediate as a siight yellow foam that was then dissolved in ethyl acetate (4 mL). The solution was treated with 4M hydrogen chloride solution in dioxane (1.9 mL, 7.6 mmol). After 3.5 h the mixture was concentrated under reduced pressure, and the residue was triturated with MTBE (5 mL). The resulting solid was isolated by filtration. The filter cake was rinsed with MTBE and the product (370 mg, 93%) was dried under vacuum. LC-MS: (ES, m/z): 567.7 [MHCI+H). Ή NMR (400 MHz. DMSO-Je) δ: 10.58 (s, IH), 9.00 (s, IH), 8.45 (br. s, 3H), 8.23 (m, IH), 7.98 (m, IH), 7.53 (dd. IH), 4.53 (dd, 2H), 3.53 (s, 3H), 3.48 (s, IH). 2.43 (s, 3H), 2.26 (s. 3H). 1.60 (s, 3H), l .03-0.93 (m, 7H).

|0l62| The (R)-enantiomer was obtained as described for the (S)-enantiomer using (R)-N-(4-fluoro-3-(trifluoromethyl)phenyl)-4-(2-(( l-hydroxy-2-methylbut-3-yn-2yl)amino)-2-oxoacetyl)-l,3,5-trimethyl-IH-pyrrole-2-carboxamide. LC-MS: (ES, m/z): 567.7 [M-HCl+H].

EXAMPLE 18 COMPOUNDS I68a& I68b

[0163] To a stirred at 0°C solution of (S)-N-(4-fluoro-3-(trifluoromethyl)phenyl)4-(2-(( l-hydroxy-2-methylbut-3-yn-2-yl)amino)-2-oxoacety 1)-1,3,5-trimethy 1-1 H-pyrrole-2carboxamide (4.82 g. 10.4 mmol) in THF (100 mL) and pyridine (2.44 mL, 31 mmol) was added phosphorus oxychloride (2.88 mL, 31 mmol). The mixture was stirred for 1 h at 0 °C. and then the reaction was quenched with water (30 mL). The mixture was warmed to rt and stirred fbr I h. The mixture was diluted with ethyl acetate. and the solution was washed with water (3x). The organic phase was concentrated to dryness. and the residue was dissolved in isopropanol ( I00 mL). An aqueous solution (2M) of NaOH was added slowly until pH ~8.5 (9.7 mL). A precipitate formed upon addition of NaOH and was isolated by filtration. The 5 filter cake was rinsed with isopropanol and dried under vacuum to afford the product(5.!9 g.

83%). LC-MS: (ES. m/z): 548.1 [M-2Na+3H]. Ή NMR (400 MHz. D?O) δ: 7.83 (m, H), 7.66 (m, I H), 7.31 (dd. I H), 3.91 (split dd. 2H), 3.54 (s. 3H). 2.80 (s, I H). 2.40 (s. 3H), 2.29 (s, 3H), l.6l (s. 3H). ³¹PNMR ( 162 MHz, D_;O) δ: 4.08 (s).

[0164| The (R)-enantiomer was obtained as described for the (S)-enantiomer 10 using (R)-N-(4-fluoro-3-(trifluoromethyl)phenyl)-4-(2-(( 1 -hydroxy-2-methy lbut-3-y n-2yl)amino)-2-oxoacetyl)-l,3,5-trimethyl-lH-pyrrole-2-carboxamide. LC-MS: (ES. m/z): 548.1 [M-2Na+3H].

EX AMPLE 19

[01651 The following compounds were made following similar procedures and starting materials as described in the Examples above.

Compound Name	Compound No.	Ή NMR
N-(3-cyano-4-fluoro-phenyl)-3-fluoro-1 methyl-4-[2-oxo-2-(prop-2ynylamino)acetyl]pyrrole-2-carboxamide	6	’H NMR (400 MHz. DMSO-</fi) δ 10.36 (s, IH), 9.22 (s. IH), 8.21-8.15 (m, 1H). 8.12 (d. J = 4.2 Hz. IH), 7.96 (s, 1H), 7.53 (t. J = 9.1 Hz. IH). 4.00-3.93 (s. 2H), 3.85 (s. 3H). 3.14 (s. IH)
4-[2-(allylamino)-2-oxo-acetyl]-N-(3cyano-4-fluoro-phenyl)-3-fluoro-1 -methylpyrrole-2-carboxamide	7	Ή NMR (400 MHz. DMSO-î/6) δ 10.35 (s, IH), 8.96 (t, J = 6.0 Hz. IH), 8.18 (dd. J = 5.9, 2.7 Hz. IH), 8.11 (d. J = 4.3 Hz, IH), 7.96 (m. IH). 7.54 (t. J = 9.1 Hz. IH), 5.85 (m. IH). 5.205.06 (m. 2H), 3.85 (s. 3H). 3.83 (d, J = 5.6 Hz, 2H)

Compound Name	Compound No.	Ή NMR
N-(3-cyano-4-fluoro-pheny l)-1,3-dimethyl- 4-[2-oxo-2-(prop-2- ynylamino)acetyl]pyrrole-2-carboxamide	8	'H NMR (300 MHz. DMSO-îA) δ 10.56-10.50 (m. 1 H). 9.09 (d. J = 5.6 Hz. 1 H), 8.20 (m. J = 5.8, 2.7 Hz, IH). 8.14 (s, IH), 8.037.91 (m, IH), 7.55 (t, J = 9.2 Hz, IH), 3.96 (m, J = 5.9, 2.5 Hz, 2H), 3.77 (s, 3H), 3.14 (t. J = 2.5 Hz, 1 H), 2.40 (s. 3H)
5-chloro-N-(3-cyano-4-fluoro-phenyl)-l,3dimethyl-4-[2-oxo-2-(prop-2ynylamino)acetyl]pyrrole-2-carboxamide	9	'H NMR (300 MHz. DMSO-ifc) δ 10.67 (s. IH). 9.21 (t. J = 5.7 Hz. IH), 8.20 (m. 1 H), 8.02-7.91 (m. 111). 7.56 (t. J = 9.1 Hz. IH). 4.01 (m,, 2H). 3.68 (s, 3H), 3.19 (t, J = 2.5 Hz. IH), 2.29 (s. 3H)
3-chloro-N-(3-cyano-4-fluoro-phenyl)-lmethyl-4-[2-oxo-2-(prop-2- ynylamÎno)acetyl]pyrrole-2-carboxamide	10	Ή NMR (300 MHz. DMSO-Æ) δ 10.76 (s, IH), 9.24 (t, J = 5.8 Hz, IH), 8.27 (s, IH), 8.22 (m, IH). 7.99 (m, IH). 7.57 (t, J = 9.1 Hz. IH), 3.98 (m. 2H). 3.87 (s.3H). 3.17 (t. J = 2.5 Hz. IH)
N-(3-cyano-4-fluoro-phenyl)-4-[2-( l.ldimethylprop-2-ynylamino)-2-oxo-acetyl]l.3,5-trirnethyl-pyrrole-2-carboxarnide	11	'H NMR (400 MHz. DMSO-rA) δ 10.52 (s, IH). 8.76 (s, IH), 8.22 (m, IH), 7.98 (m, IH), 7.54 (t, J = 9.1 Hz. III), 3.61 (s, 311), 3.20 (s, IH), 2.44 (s, 3H), 2.29 (s. 3H), 1.57 (s. 6H)
5-chloro-N-(3-cyano-4-fluoro-phenyl)-3fluoro-1 -methy l-4-[2-oxo-2-(prop-2ynylamino)acetyl]pyrrole-2-carboxamide	12	Ή NMR (400 MHz. DMSO-dr,) δ 10.57 (s, IH), 9.30 (t. J = 5.6 Hz. IH). 8.17 (m, IH). 7.96 (m, IH). 7.55 (t. J = 9.1 Hz. IH). 4.02 (m, 2H). 3.81 (s. 3H), 3.21 (t. J = 2.5 Hz. IH)
N-(3-cyano-4-t1uoro-phenyl)-3-tluoro-l,5dimethyl-4-[2-oxo-2-(prop-2ynylamino)acetyl]pyrrole-2-carboxamide	13	Ή NMR (300 MHz. MethanolΛ) δ 8.12 (dd, J = 5.7, 2.7 Hz, 111), 7.88 (m, lH). 7.34 (t, J = 9.0 Hz. 111),4.09 (d. J = 2.6 Hz. 2H). 3.81 (s, 3H), 2.65 (t, J = 2.6 Hz. 1 H). 2.53 (s. 3H)

Compound Name	Compound No.	*H NMR
N-(3-cyano-4-fluoro-phenyl)-4-[2-[( I et hy ny Icyc I opropy l )am i no]-2-oxo-accty I ] l,3,5-trimethyl-pyrrole-2-carboxamide	I4	Ή NMR (400 MHz. DMSO-ifc) δ 10.52 (s, IH), 9.27 (s. I H), 8.21 (dd, J = 5.8, 2.7 Hz, IH), 7.97 (m, l H), 7.54 (t, J = 9.2 Hz. IH), 3.59 (s, 3H), 3.06 (s. IH), 2.40 (s, 3H), 2.23 (s, 3H), I.2Il.!0(m,2H), l.l0-l.00(m, 2H)
N-(3-cyano-4-tluoro-phenyl)-4-[2-[( l ethynylcyclobutyl)amino]-2-oxo-acetyl]l ,3,5 -tr i methy l -py rro l e-2 -carboxam i de	15	'H NMR (400 MHz. DMSO-Λ) δ 10.53 (s, IH), 9.20 (s, I H), 8.22 (m, IH), 7.98 (m, IH), 7.55 (t. J = 9.1 Hz, IH), 3.61 (s, 3H), 3.23 (s, IH), 2.46-2.37 (m, 7H), 2.28 (s, 3H), l.97(m,2H)
5-bromo-3-chloro-N-(3-cyano-4-fluoropheny l)-1 -methy l-4-[2-oxo-2-(prop-2ynylamino)acetyl]pyrrole-2-carboxamide	I6	'H NMR (400 MHz. DMSO-î/ô) δ 10.93 (s, IH), 9.31 (t. J = 4.8 Hz, IH), 8.27 (s, IH), 7.97 (s, IH), 7.57 (t, J = 9.1 Hz, IH), 4.02 (d, J = 2.4 Hz. 2H), 3.75 (s, 3H), 3.20 (s, IH)
N-(3-cyano-4-fluoro-pheny I)-1,3,5trimethy l-4-[2-oxo-2-[[( l R)-1 -methylprop2-ynyl]amino]acetyl]pyrrole-2carboxamide	17a	’H NMR (300 MHz, DMSO-A) δ I0.54 (s, IH), 9.18 (d. J = 7.9 Hz. IH), 8.22 (m, IH), 7.98 (m, IH), 7.55 (t, J = 9.I Hz, IH), 4.76-4.64 (m, IH), 3.60 (s, 3H), 3.25 (d, J = 2.3 Hz. IH), 2.42 (s, 3H), 2.25 (s, 3H), I.38 (d, J = 7.0 Hz, 3H)
N-(3-cyano-4-fiuoro-phenyl)-1,3,5trîmethy l-4-[2-oxo-2-[[( l S)-1 -methylprop2-ynyl]amino]acetyl]pyrrole-2carboxamide	17b	'H NMR (300 MHz. DMSO-ùfe) δ I0.54 (s, IH), 9.18 (d. J = 7.9 Hz, IH), 8.22 (m, IH), 7.98 (m. IH), 7.55 (t, J = 9.I Hz, IH), 4.70 (m, IH), 3.60 (s, 3H), 3.25 (d. J = 2.3 Hz, IH), 2.42 (s, 3H), 2.25 (s, 3H), l.38(d. J = 7.0 Hz, 3H)
4-[2 -( a I ly l am i no )-2-oxo-acety I ] -N -( 3 cyano-4-tluoro-pheny l)-3-fliioro-1.5dimethyl-pyrrole-2-carboxamide	I8	Ή NMR (300 MHz. DMSCMû) δ I0.36 (s, IH), 8.88 (t. J = 5.9 Hz, IH), 8.18 (dd, J = 5.8, 2.8 Hz, IH), 8.00-7.87 (m, IH), 7.54 (t, J = 9.2 Hz, IH), 5.97-5.8! (m, IH), 5.31-5.09 (m,2H), 3.82 (t, J = 5.6 Hz. 2H), 3.72 (s, 3H), 2.55 (s, 3H)

Compound Name	Compound No.	Ή NMR
5-bromo-N-(3-cyano-4-fluoro-phenyl)-3fluoro-1 -methyl-4-[2-oxo-2-(prop-2ynylaiTiino)acetyl]pyrrole-2-carboxamide	20	!H NMR (400 MHz. DMSO-î/6) δ 9.27 (s, IH), 8.16 (m, 1H), 7.99-7.90 (m. 1H), 7.54 (t. J = 9.2 Hz, IH), 4.01 (dd. J = 5.6, 2.6 Hz, 2H), 3.81 (s, 3H), 3.19 (t. J = 2.6 Hz, 1 H)
3-chloro-N-(3-cyano-4-fluoro-phenyl)-1,5dimethyl-4-[2-oxo-2-(prop-2ynylamino)acetyl]pyrrole-2-carboxamide	21	Ή NMR (300 MHz. DMSO-î/î) δ 10.76 (s, IH), 9.20 (t. J = 5.6 Hz, IH), 8.22 (dd. J = 5.8, 2.7 Hz. IH), 7.99 (m, IH), 7.56 (t, J = 9.1 Hz, IH), 4.01 (dd, J = 5.6, 2.5 Hz, 2H), 3.66 (s, 3H), 3.18 (t. J = 2.5 Hz, 1 H), 2.51 (s,3H)
N-(3-cyano-4-fluoro-phenyl)-4-[2-(3cyclopropylprop-2-ynylamino)-2-oxoacetyl]-l,3,5-trimethyl-pyrrole-2carboxamide	22	Ή NMR (300 MHz, DMSO-îM δ 10.55 (s, IH), 9.05 (t. J = 5.6 Hz, IH), 8.22 (dd, J = 5.8, 2.7 Hz. IH), 7.97 (m, IH), 7.55 (t, J = 9.1 Hz, IH), 3.94 (dd. J = 5.6, 2.0 Hz, 2H), 3.61 (s, 3H), 2.40 (s. 3H), 2.24 (s, 3H), 1.36-1.20 (m. IH), 0.83-0.65 (m, 2H), 0.64-0.49 (m, 2H)
N-(3-cyano-4-fluoro-pheny I)-1,3,5trimethy l-4-[2-oxo-2-[ [( 1 R)-1 cyclopropylprop-2- ynyl]amino]acety!]pyrrole-2-carboxamtde	23a	‘H NMR (400 MHz. DMSO-cA,) δ 10.53 (s, IH), 9.30 (d. J = 8.2 Hz. IH), 8.21 (dd, J = 5.8, 2.7 Hz. IH), 7.97 (ddd. J = 9.2, 4.9, 2.7 Hz, IH), 7.54 (t. J = 9.1 Hz, IH), 4.35 (td. J = 7.9. 2.4 Hz. IH), 3.24 (d, J = 2.3 Hz. IH), 2.42 (s. 3H), 2.26 (s, 3H), 1.251.15 (m, IH), 0.69-0.14 (m, 4H)
5-chloro-N-(3-cyano-4-fluoro-phenyl)-1 methyl-4-[2-oxo-2-(prop-2- ynylamino)acetyl]pyrrole-2-carboxamide	25	Ή NMR (300 MHz. DMSO-îA) δ 10.58 (s, IH), 9.28 (t. J = 5.7 Hz. IH), 8.22 (m, IH), 8.09-7.97 (m, IH), 7.89 (s, IH), 7.55 (t, J = 9.1 Hz. IH). 4.02 (m, 2H), 3.93 (s, 3H), 3.18 (t. J = 2.5 Hz. IH)

Compound Name	Compound No.	lH NMR
N-(3-cyano-4-fluoro-phenyl)-4-[2-[[( 1S)-I(methoxymethyl)prop-2-ynyl]amino]-2oxo-acetyl]-l,3,5-trimethyl-pyrrole-2carboxamide	28a	'H NMR (300 MHz, DMSO-îA) δ 10.54 (s, IH), 9.21 (d. J = 8.3 Hz, 1 H), 8.22 (m, 1H), 7.98 (m, 1H), 7.55 (m, 1 H). 4.91-4.78 (m, 1H). 3.61-3.54 (m, 5H), 3.36 (m, 3H), 2.52 (s. IH), 2.42 (s, 3H), 2.26 (s, 3H)
N-(3-cyano-4-fluoro-pheny l)-4-[2-[[( l R)-1 (methoxymethyl)prop-2-ynyl]amino]-2oxo-acety I ]-1,3,5-trimethy l-py rrole-2carboxamide	28b	‘H NMR (300 MHz. DMSO-t/e) δ 10.54 (s, IH), 9.21 (d. J = 8.3 Hz. IH), 8.22 (m, IH). 7.98 (m, IH), 7.55 (m, 1 H), 4.91-4.78 (m, IH), 3.61 (m, 3H), 3.54 (m, 2H), 3.36 (m, 3H), 2.52 (s. IH), 2.42 (s,3H), 2.26 (s, 3H)
N-(3-cyano-4-fluoro-phenyl)-1,3,5trimethy l-4-[2-oxo-2-[[3-( l H-triazol-4yl)oxetan-3-yl]amino]acetyl]pyrrole-2carboxamide	29	Ή NMR (400 MHz. DMSO-ok) δ 15.01 (s. IH), 10.52 (s, IH), 9.90 (s, IH), 8.21 (t. J = 8.4 Hz, IH), 7.97 (s, IH), 7.83 (s, IH), 7.55 (t. J = 9.0 Hz, IH), 4.92 (s, 4H), 3.59 (s, 3H), 2.35 (s, 3H), 2.20 (s, 3H)
N-(3-cyano-4-fluoro-phenyl)-1,3,5trimethy l-4-[2-oxo-2-[[( 1 S)-1 -tertbutylprop-2-ynyl]amino]acetyl]pyrrole-2carboxamide	30b	Ή NMR (300 MHz, DMSCMs) δ 10.54 (s, IH), 9.03 (d. J = 9.3 Hz. IH), 8.22 (dd, J = 5.8, 2.7 Hz, IH), 7.95-8.01 (m. IH), 7.55 (t, J = 9.1 Hz. IH), 4.53 (dd, J = 9.2, 2.5 Hz, IH), 3.61 (s, 3H), 3.26 (d, J = 2.4 Hz. IH), 2.43 (s, 3H),2.27(s, 3H), 1.00 (s, 9H)
N-(3-cyano-4-fluoro-pheny 1)-1,3,5trimethy l-4-[2-oxo-2-[(3-viny loxetan-3y I )am i no] acety 1 ] py rro le-2-carboxam ide	33	lH NMR (400 MHz. DMSO-îA) δ 10.52 (s. IH), 9.42 (s, IH), 8.20 (dd. J = 5.8, 2.7 Hz. IH), 7.96 (ddd, J = 9.2. 4.9, 2.7 Hz, IH), 7.53 (t, J = 9.1 Hz, IH), 6.28 (dd, J = 17.2, 10.5 Hz, IH), 5.31 (dd, J = 17.3, 1.1 Hz, IH), 5.20 (dd, J = 10.5, 1.0 Hz. IH), 4.71 (d, J = 6.6 Hz. 2H),4.57(d, J = 6.6 Hz, 2H), 3.59 (s. 3H), 2.42 (s, 3H), 2.27 (s, 3H)

Compound Naine	Compound No.	'HNMR
4-[2-[(3-ethynyloxetan-3-yl)amino]-2-oxoacetyl]-N-[4-fluoro-3- (trifluoromethyl)phenyl]-1,3,5-trimethylpy rrole-2-carboxam ide	34	Ή NMR (400 MHz, DMSO-t^) δ 10.51 (s, IH), 9.74 (s, IH), 8.20 (dd, J = 6.6, 2.6 Hz. IH), 7.99-7.90 (m, IH), 7.50 (t, J = 9.8 Hz, 1 H), 4.72 (d, J = 6.6 Hz, 4H), 3.65 (s, IH), 3.59 (s, 3H), 2.41 (s. 3H),2.25 (s, 3H)
4-[2-( I, I -dimethy]prop-2-ynylarnino)-2oxo-acetyl]-N-[4-fluoro-3- (trifluoromethyl)phenyl]-l,3,5-trimethylpyrrole-2-carboxamide	35	'H NMR (300 MHz. DMSO-<76) δ 10.52 (s, IH), 8.77 (s, IH), 8.22 (dd, J = 6.7, 2.6 Hz. IH), 7.98 (dd, J = 9.0, 4.3 Hz. IH), 7.53 (t. J = 9.8 Hz, IH), 3.60 (s, 3H), 3.22 (s, IH). 2.44 (s, 3H), 2.28 (s, 3H), 1.57 (s, 6H)
N-(3-cyano-4-fluoro-phenyl)-l,3,5trimethy l-4-[2-oxo-2-[[( l R)-1 (trifluorornethyl)allyl]amino]acetyl]pyrrole2-carboxamide	36b	Ή NMR (300 MHz. DMSO-Æ) δ 10.57 (s, IH), 9.66 (d. J = 9.1 Hz. IH), 8.22 (dd, J = 5.8, 2.7 Hz, IH), 7.95-8.01 (m, IH), 7.55 (t. J = 9.1 Hz. IH), 5.86-5.98 (m, IH), 5.65 (d, J = 17.1 Hz, IH), 5.51 (d, J = 10.4 Hz, IH), 5.30 (q, J = 8.0 Hz. IH), 2.41 (s, 3H), 2.23 (s, 3H)
N-(3-cyano-4-fluoro-pheny 1)-1,3,5trimethyl-4-[2-oxo-2-[[(l S)-l(trifluoromethyl)allyl]aiTiino]acetyl]pyrrole- 2-carboxamide	36a	Ή NMR (300 MHz. DMSO-î/ô) δ 10.57 (s, IH), 9.66 (d. J = 9.1 Hz, IH), 8.22 (dd, J = 5.8, 2.7 Hz. IH), 7.95-8.01 (m. IH), 7.55 (t. J = 9.1 Hz. IH), 5.86-5.98 (m, IH), 5.65 (d. J = 17.1 Hz, IH), 5.51 (d, J = 10.4 Hz, IH), 5.30 (q, J = 8.0 Hz. 1 H), 2.41 (s. 3H), 2.23 (s, 3H)
4-[2-[( I -ethynyl-3,3-difluorocyclobutyl)amino]-2-oxo-acetyl]-N-[4fluoro-3-(trifluoromethyl)phenyl]-l,3,5trimethyl-pyrrole-2-carboxamide	37	lH NMR (300 MHz. DMSO-A) δ 10.53 (s. IH), 9.62 (s. IH), 8.22 (dd, J = 6.7, 2.6 Hz, IH), 7.97 (dt. J = 8.1, 3.8 Hz, IH), 7.54 (d, J = 9.9 Hz. 1 H), 3.61 (s, 3H), 3.53 (s, IH), 3.13 (t, J = 12.1 Hz. 4H), 2.43 (s, 3H), 2.27 (s.3H)

Compound Naine	Compound No.	Ή NMR
N-[4-fluoro-3-(trifluoromethyl)phenyl]l ,3,5-trimethy l-4-[2-oxo-2-[[( IR )-1 cyclopropylprop-2- ynyl]amino]acetyl]pyrrole-2-carboxamide	38a	Ή NMR (400 MHz. DMSO-Jô) δ I0.52 (s, IH), 9.30 (d. J = 8.2 Hz. IH), 8.20 (dd, J = 6.7. 2.7 Hz. IH), 7.98-7.90 (in, IH), 7.50 (t. J = 9.8 Hz, l H), 4.33 (td, J = 7.9, 2.4 Hz, IH), 3.58 (s, 3H), 3.24 (d, J = 2.4 Hz, IH), 2.41 (s, 3H), 2.25 (s, 3H), 1.I8 (dt, J = 8.0, 6.5 Hz, IH), 0.51 (dddd, J = 12.7, 7.0, 4.8, 3.2 Hz, 2H), 0.450.38 (m, IH), 0.37-0.30 (m. IH)
N-[4-fluoro-3-(trifluoroinethyl)phenyl]l ,3,5-trimethyl-4-[2-oxo-2-[[( l S)-1 cyclopropylprop-2- ynyl]ainino]acetyl]pynOle-2-carboxamide	38b	'H NMR (400 MHz. DMSO-tA) δ I0.52 (s, IH), 9.30 (d. J = 8.2 Hz. IH), 8.20 (dd. J = 6.6, 2.7 Hz. IH), 7.94 (dt. J = 7.6, 3.5 Hz. IH), 7.50 (t, J = 9.8 Hz. IH), 4.33 (td. J = 7.9, 2.4 Hz, IH), 3.58 (s, 3H), 3.24 (d, J = 2.3 Hz. IH), 2.41 (s, 3H). 2.25 (s, 3H), 1. 18 (dtd, J = I2.7, 7.9. 4.6 Hz. IH), 0.56-0.46 (m, 2II), 0.42 (ddd, J = 10.8, 5.6, 3.I Hz. I H), 0.34 (ddd, J = I0.7, 4.9, 2.3 Hz, IH)
5-chloro-N-(3-cyano-4-fluoro-phenyl)-4-[2[( I -ethynyl-3,3-difluorocyclobutyl)amino]-2-oxo-acetyl]-l,3dimethyl-pyrrole-2-carboxamide	39	‘H NMR (400 MHz, DMSO-i/fi) δ I0.67 (s, IH), 9.67 (s, IH), 8.I9 (dd, J = 5.8, 2.7 Hz, IH), 7.95 (ddd, J = 9.3, 4.8, 2.7 Hz. IH), 7.55 (t. J = 9.1 Hz, IH), 3.68 (s, 3H), 3.52 (s. IH), 3.I2 (t,J= I2.0 Hz, 4H), 2.29 (s, 3H)
5-chloro-N-(3-cyano-4-fluoro-phenyl)-4-[2[(3-ethynyloxetan-3-yl)aminoJ-2-oxoacetyl]-l,3-dimethyl-pyrrole-2carboxamide	40	‘H NMR (300 MHz. DMSO-t/e) δ 10.70 (s, IH), 9.84 (s, IH), 8.21 (dd, J = 5.8, 2.7 Hz. IH), 7.97 (ddd, J = 9.2, 4.9, 2.7 Hz, IH), 7.57 (t, J = 9.1 Hz, IH). 4.75 (d, J = 1.4 Hz, 4H), 3.70 (s, 3H). 3.68 (s. I H), 2.32 (s, 3H)

Compound Name	Compound No.	Ή NMR
5-chloro-N-(3-cyano-4-fluoro-pheny])-1,3dimethyl-4-[2-oxo-2-[(3-vinyloxetan-3y I ) am I no] acety l ] py rrol e-2-carboxam i de	41	Ή N MR (300 MHz. DMSO-Λ) δ 10.69 (s, IH), 9.52 (s. 1 H), 8.22 (dd, J = 5.8, 2.6 Hz, IH), 7.98 (ddd, J = 9.2, 4.9. 2.7 Hz. IH). 7.57 (t, J = 9.1 Hz, IH), 6.31 (dd, J= 17.2, 10.5 Hz, IH), 5.38-5.17 (m, 2H), 4.77 (d, J = 6.6 Hz. 2H), 4.60 (d, J = 6.6 Hz, 2H). 3.71 (s, 3H), 2.33 (s. 3H)
N-(3-cyano-4-fluoro-pheny I)-1,3,5trimethy l-4-[2-oxo-2-[[( 1R)-I(trifluoromethyl)prop-2- ynyl]amino]acetyl]pyrrole-2-carboxamide	42a	Ή NMR (300 MHz. DMSGMQ δ 10.58 (s, IH). 10.08 (d. J -8.8 Hz, IH), 8.22 (dd. J = 5.8, 2.7 Hz. IH), 8.01-7.95 (m, IH), 7.55 (t. J = 9.1 Hz, IH), 5.99-5.58 (m, IH), 3.81 (d. J = 2.5 Hz. IH), 3.61 (s, 3H), 2.42 (s, 3H), 2.24 (s, 3H)
N-(3-cyano-4-fltioro-phenyl)-l ,3,5trimethyl-4-[2-oxo-2-[[( l S )-1 (trifluoromethyl)prop-2ynyl]amino]acetyl]pyrrole-2-carboxamide	42b	Ή NMR (300 MHz. DMSO-î/è) δ 10.58 (s, IH), 10.08 (d. J = 8.8 Hz. IH), 8.22 (dd. J = 5.8, 2.7 Hz. IH), 8.01-7.95 (m, IH), 7.55 (t. J = 9.1 Hz, IH), 5.99-5.58 (m, IH), 3.81 (d, J = 2.5 Hz, IH), 3.61 (s, 3H), 2.42 (s, 3H), 2.24 (s, 3H)
N-(3-cyano-4-fluoro-phenyl)-4-[2-[[3-(2cyclopropylethynyl)oxetan-3-yl]amino]-2oxo-acety 1]-1,3,5-trimethyl-pyrrole-2carboxamide	43	Ή NMR (300 MHz. DMSO-î/6) δ 10.54 (s.lH). 9.65 (s.lH), 8.24-8.21 (m.lH), 8.00-7.95 (m.lH). 7.55 (t. J=9,l H), 4.69 (s,4H), 3.60 (s,3H), 2.27 (s,3H), 2.08 (s,3H), 1.42-1.33 (m,lH), 0.84-0.80 (m 2H), 0.62-0.59 (m,2H)
5-chloro-N-(3-cyano-4-flnoro-phenyl)-4-[2((3,3-difluoro-1 -vinyl-cyclobutyl)amino]-2oxo-acety 1 ] -1,3 -d i methy 1 -pyrro le-2carboxamide	44	'H NMR (300 MHz, DMSO-î/0) δ 10.68 (s, IH), 9.37 (s. 114), 8.21 (dd, J - 5.8. 2.6 Hz, IH), 8.04-7.90 (m, IH), 7.57 (t, J = 9.2 Hz, 1 H). 6.12 (dd, J = 17.2, 10.4 Hz. 1 H). 5.34-5.01 (m. 2H), 3.70 (s, 3H), 3.00 (dt, J = 18.0, 13.1 Hz. 4H), 2.31 (s, 3 H)

Compound Name	Compound No.	Ή NMR
3-chloro-N-(3-cyano-4-fluoro-phenyl)-4-[2[(3-ethynyloxetan-3-yl)amino]-2-oxoacetyl]-l,5-dimethyl-pyrrole-2carboxamide	45	Ή NMR (300 MHz, DMSO-î/«) δ 10.77 (s, 1H). 9.80 (s, IH), 8.22 (dd, J = 5.7, 2.7 Hz, IH), 8.05-7.91 (m, IH), 7.56 (t, J = 9.2 Hz, IH), 4.74 (s, 4H), 3.67 (s, 3H), 3.66 (s, IH), 2.48 (s, 3H)
3-chloro-N-(3-cyano-4-fluoro-phenyl)-l,5dimethyl-4-[2-oxo-2-[(3-vinyloxetan-3y I )am i no ] acety I ] py rro l e-2-carboxam ide	46	'H NMR (400 MHz. DMSO-^) δ 10.75 (s, IH), 9.47 (s, IH), 8.21 (dd, J = 5.8, 2.7 Hz, IH), 7.98 (ddd, J = 9.2, 4.8, 2.7 Hz. IH), 7.54 (t, J = 9.1 Hz, IH), 6.29 (dd, J= 17.3, 10.5 Hz, IH), 3.65 (s, 3H), 2.47 (s, 3H)
N-(3-cyano-4-fluoro-phenyl)-1,3,5trimethyl-4-[2-oxo-2-[[3-(3,3,3trifluoroprop-l-ynyl)oxetan-3yl]amino]acety l]pyrrole-2-carboxamide	47	’H NMR (400 MHz, DMSO-A) δ 10.59 (s, IH), 8.22(dd, J = 5,6, 2.8 Hz, IH), 8.00-7,96 (m, IH), 7.56 (t. J =8.8Hz. IH), 6.37-6.31 (m, 1 H), 4.80-4.76 (m, 4H), 3.63 (s. 3H), 2.39 (s. 3H), 2.20 (s, 3H)
N-(3-cyano-4-fluoro-phenyl)-1,3,5triinethy l-4-[2-[[3-(3-methy Ibut-1 ynyl)oxetan-3-yl]amino]-2-oxoacety l]pyrrole-2-carboxam ide	48	Ή NMR (300 MHz. DMSO-î/0) δ 10.55 (s, IH), 9.67 (s, IH), 8.22 (dd. J=5.8, 2.7 Hz, IH), 8.00-7.94 (m, IH), 7.55 (t. J = 9.2Hz, 1 H), 4.70 (s, 4H), 3.61 (s, 3H). 2.69-2,59 (m, IH), 2.28 (s, 3H), 2.08 (s, 3H), 1.13 (d. J=6.9Hz, 6H)
4-[2-[(l-ethynyl-3-hydroxycyclobLityl)amino]-2-oxo-acetyl]-N-[4fluoro-3-(trifluoromethyl)phenyl]-1,3.5trimethyl-pyrroie-2-carboxaniide	49	Ή NMR (300 MHz. DMSO-Jî) δ 10.52 (s, IH), 9.31 (s, IH), 8.22 (dd, J = 6.5, 2.6 Hz, IH), 7.97 (dt, ,1 = 7.9, 3.8 Hz, IH), 7.52 (t, J = 9.8 Hz, IH), 5.34 (s, IH), 4.15 (s, IH), 3.60 (s, 3H), 3.26 (s, IH), 2.78 (ddd. J = 9.5, 6.9, 2.8 Hz, 2H), 2.42 (s, 3H), 2.28 (s, 3H), 2.17 (t, J = 10.0 Hz. 2H)

Compound Name	Compound No.	Ή NMR
N-(3-cyano-4-fluoro-pheny I )-1,3,5trimethyl-4-[2-oxo-2-[(3-prop-1 ynyloxetan-3-yl)amino]acetylJpyrrole-2carboxamide	50	'H NMR (400 MHz, DMSO-î/s) δ 10.54 (s. 111). 9.68 (s, IH). 8.21 (dd. J = 5.6, 2.4 Hz, IH), 7.99-7.95 (m. 1 H), 7.55 (t. J = 9.2 Hz. IH),4.70(s.4H), 3.60(s. 3H). 2.41 (s, 3H), 2.27 (s. 3H). 1.86 (s, 3H)
3-chloro-N-(3-cyano-4-fluoro-phenyl)-4-[2[(3,3-difliioro-l-vinyl-cyclobutyl)amino]-2oxo-acety l]-1,5-dimethy l-pyrrole-2carboxamide	..... 51	Ή NMR (400 MHz. DMSO-tA) δ 10.75 (s, IH), 9.32 (s, IH), 8.20 (dd, J = 5.8, 2.7 Hz. IH), 7.97 (ddd, J = 9.2, 4.9, 2.7 Hz. IH), 7.54 (t. J = 9.1 Hz. IH), 6.09 (dd, J = 17.2, 10.4 Hz. IH), 5.23 (dd. J = 17.1. 0.9 Hz, IH), 5.13 (dd, J = 10.5, 0.9 Hz. IH), 3.64 (s, 3H), 2.97 (dq, J = 46.6, 13.5 Hz, 4H), 2.46 (s. 3H)
3-chloro-N-(3-cyano-4-fluoro-pheny 1)-4-(2[( l-ethynyl-3,3-difluoro- cyclobutyl)amino]-2-oxo-acety!]-1,5- dimethyl-pyrrole-2-carboxamide	52	'11 NMR (300 MHz. DMSCR/ô) δ 10.74 (s, IH), 9.63 (s, IH), 8.21 (dd, J = 5.8, 2.7 Hz. IH). 7.98 (ddd, J = 9.2, 4.9, 2.7 Hz. IH), 7.55 (t. J = 9.1 Hz. IH), 3.66 (s. 3H), 3.50 (s, IH), 3.14 (t. J= 12.1 Hz. 4H). 2.47 (s, 3H)
N-(3-cyano-4-fluoro-phenyl)-4-[2-[(3.3d i fl uoro-1 -v i ny 1 -cy c lobuty l)am ino]-2-oxo- acetyl]-1.3.5-tnmethyl-pyrrole-2- carboxamide	53	Ή NMR (400 MHz. DMSO-</6) δ 10.52 (s, IH), 9.27 (s, IH), 8.20 (dd, J = 5.8. 2.7 Hz. IH), 7.96 (ddd, J = 9.2, 4.9, 2.7 Hz. IH), 7.53 (t. J = 9.1 Hz. IH), 6.09 (dd. J = 17.2, 10.5 Hz, IH). 5.25 (dd, J = 17.2, 0.9 Hz. IH). 5.13 (dd. J = 10.4, 0.9 Hz, IH), 3.59 (s, 3H), 3.10-2.80 (m, 4H), 2.41 (s, 3H), 2.25 (s, 3H)
N-(3-cyano-4-fluoro-phenyl)-4-[2-[(3ethynyloxetan-3-yl)amino]-2-oxo-acetyl]-3fluoro-1,5-dimethy l-pyrrole-2-carboxamide	55	Ή NMR (400 MHz. DMSO-ώ) δ 10.44 (s, IH), 9.82 (s, IH), 8.17 (dd, J = 5.8, 2.7 Hz. IH), 7.97 (ddd. J = 9.3, 4.9, 2.7 Hz. IH), 7.54 (t. J = 9.1 Hz, IH). 4.78 C 4.68 (m, 4H). 3.73 (s. 3H), 3.66 (s, IH), 2.52 (s. 3H)

Compound Name	Compound No.	Ή NMR
N-(3-cyano-4-fluoro-pheny l)-4-[2-[( l ethynyl-3,3-difluoro-cyclobutyl)amino]-2oxo-acetyl]-3-fluoro-l,5-dirnethyl-pyrrole2-carboxamide	56	Ή NMR (400 MHz. DMSO-d6) δ 10.45 (s, IH), 9.67 (s, IH). 8.I7 (dd, J = 5.8, 2.7 Hz, IH), 7.96 (ddd, J = 9.2, 4.9, 2.7 Hz, IH), 7.54 (t, J = 9.I Hz, IH), 3.72 (s, 3H), 3.52 (s, IH), 3.18 C 3.04 (m, 4H). 2.50 (s, 3H)
N-(3-cyano-4-fluoro-phenyl)-1,3,5trimethy l-4-[2-oxo-2-[[ I R)-1 -(oxetan-3yl)prop-2-ynyl]amino]acetyl|pyrrole-2carboxamide	57	Ή NMR (300 MHz, DMSO-40 δ 10.55 (s, IH), 9.27 (d, J = 8.1 Hz, IH), 8.22 (dd, J = 5.8, 2.7 Hz. IH), 7.98 (ddd. J = 9.2, 4.9, 2.7 Hz, IH), 7.55 (t, J = 9.1 Hz, IH), 4.96 (td. J = 8.0, 2.4 Hz, IH), 4.63 (ddd. J = 9.5, 7.8, 6.3 Hz. 2H), 4.47 (t, J = 6.2 Hz. IH), 4.36 (t. J = 6.2 Hz, IH), 3.61 (s. 3 H), 3.37 (d, J = 2.3 Hz. I H), 3.30-3.21 (m, IH), 2.41 (s,3H), 2.25 (s, 3H)
N-(3-cyano-4-fluoro-phenyl)-1.3,5trimethyl-4-[2-oxo-2-[[( l S)-1 -(oxetan-3yl)prop-2-ynyl]amino]acetyl]pyrrole-2carboxamide	58	'H NMR (300 MHz. DMSO-Je) δ 10.54 (s, IH), 9.27 (d, J = 8.1 Hz, IH), 8.21 (dd. J = 5.8, 2.7 Hz, IH), 8.05-7.87 (m, IH), 7.55 (t. J = 9.1 Hz, IH), 5.03-4.88 (m, IH), 4.71-4.55 (m, 2H), 4.47 (t. J = 6.3 Hz. IH). 4.36 (t. J = 6.2 Hz, IH), 3.61 (s, 3H), 3.37 (d, J = 2.3 Hz. IH). 3.30-3.22 (m, IH), 2.41 (s. 3H), 2.25 (s, 3H)
5-chloro-N-(3-cyano-4-lluoro-phenyl)-4-[2[( l -ethynyl-3-hydroxy-cyclobutyl)amino]2-oxo-acetyl]-1,3-dimethyl-pyrrole-2carboxamide	59	Ή NMR (300 MHz. DMSO-A) δ 10.68 (s, IH), 9.37 (s, IH), 8.21 (dd, J = 5.8, 2.7 Hz. IH), 7.98 (ddd, J = 9.2, 4.9, 2.8 Hz. IH), 7.57 (t, J = 9.1 Hz, IH), 5.34 (d, J = 6.8 Hz. IH),4.15 (q. J = 7.3 Hz, IH), 3.70 (s, 3H), 3.26 (s, 1H),2.84 C 2.72 (m. 2H), 2.31 (s, 3H), 2.21 (s. 2H)

Compound Naine	Compound No.	Ή NMR
3-chloro-N-(3-cyano-4-fluoro-phenyl)-4-[2[( I -ethynyl-3-hydroxy-cyclobutyl)ainino]2-oxo-acety I J-1,5-dimethyl-pyrrole-2carboxamide	60	Ή NMR (300 MHz. DMSO-î70) δ 10.75 (s, 1H), 9.34 (s, IH), 8.23 (dd, J = 5.8, 2.7 Hz. 1H), 8.00 (ddd, J = 9.2, 4.9, 2.7 Hz, 1H). 7.56 (t, J = 9.1 Hz, IH), 5.32 (d, J = 6.8 Hz, lH),4.14(q, J = 7.2 Hz, IH), 3.66 (s, 3H), 3.25(s, 1H), 2.83 C 2.73 (m, 2H), 2.47 (s, 3H), 2.21 (s, 2H)
N-(3-cyano-4-fluoro-pheny l)-1,3,5trimethy l-4-[2-oxo-2-[[( 1 R)-1 -(2hydroxyethyl)prop-2- ynyl]amino]acetyl]pytTole-2-carboxamide	61a	Ή NMR (300 MHz. DMSO-î4) δ 10.55 (s, 1H), 9.12 (d, J = 8.2 Hz. 1H), 8.22 (dd, J = 5.8, 2.7 Hz. 1 H), 8.03-7.92 (m. IH), 7.55 (t, J = 9.1 Hz. IH), 4.77 (d, J = 6.1 Hz, IH), 4.63 (t. J = 4.9 Hz, IH), 3.60 (s, 3H), 3.53 (q, J = 5.9 Hz. 211), 3.25 (d, J = 2.3 Hz. IH), 2.42 (s, 311). 2.26 (s. 3H), 1.82 (q, J = 6.6 Hz, 2H)
N-(3-cyano-4-fluoro-pheny 1)-1,3,5trimethy l-4-[2-oxo-2-[[( 1 S)-1 -(2hydroxyethyl)prop-2- ynyl]amino]acetyl]pyrrole-2-carboxamide	61 b	Ή NMR (300 MHz. DMSO-Jî) δ 10.55 (s, IH), 9,12 (d, J = 8.2 Hz. III), 8.22 (dd. J = 5.8, 2.7 Hz, IH), 7.98 (ddd, J = 9.3, 4.9, 2.7 Hz. IH), 7.55 (t, J = 9.1 Hz, IH). 4.77 (d, J = 7.1 Hz. IH), 4.63 (t. J = 4.9 Hz. IH), 3.60 (s, 3H), 3.53 (q, J = 5.8 Hz. 2H), 3.25 (d, J = 2.3 Hz. IH), 2.42 (s, 3H), 2.26 (s, 3H), 1.86-1.78 (m, 2H)
N-(3-cyano-4-fluoro-phenyl)-4-[2-[[3hydroxy-1 -(3,3,3-trifluoroprop-1 y ny 1 )cyc lobuty 1 ]am i no] -2-oxo-acety 1 ]l,3,5-trimethyl-pyrrole-2-carboxamide	62	‘H NMR (300 MHz. MethanolΛ) δ 8.16 (dd, J = 5.7, 2.7 Hz, IH), 7.93 (ddd. J = 9.2, 4.7, 2.8 Hz, IH), 7.39 (t. J = 9.0 Hz. IH), 4.37 (t, J = 7.5 Hz. IH), 3.69 (s, 3H), 3.05 (td. J = 6.9, 3.5 Hz. 2H), 2.49 (s, 3H), 2.37 (s.5H)

Compound Name	Compound No.	Ή NMR
N-(3-cyano-4-fluoro-phenyl)-1,3,5trimethy l-4-[2-oxo-2-[[( l R )-1 -cyc lopropy ll-(hydroxymethyl)prop-2- yny l]am inojacety I ]pyrrole-2-carboxam ide	63a	lH NMR (300 MHz. DMSO-t/6) δ 10.52 (s, IH), 8.53 (s, IH). 8.21 (dd. J = 5.8. 2.7 Hz. IH). 8.03 C 7.91 (m, IH), 7.54 (t, J = 9.1 Hz. IH), 5.17 (t. J = 6.0 Hz, IH), 3.94 (dd, J = 10.5, 6.4 Hz. IH), 3.68 C 3.58 (m, IH), 3.59 (s, 3H), 3.20 (s, IH), 2.43 (s, 3H), 2.28 (s, 3H), 1.41 C 1.31 (m, IH), 0.70-0.60 (m, IH). 0.50 C 0.41 (m, 3H)
N-(3-cyano-4-fluoro-phenyl)-1,3,5trimethy l-4-[2-oxo-2-[[( I S)-1 -cyclopropy Il -(hydroxymethyl)prop-2ynyl]amino]acetyl]pyttole-2-carboxamide	63b	Ή NMR (300 MHz. DMSO-^) δ 10.52 (s, IH), 8.53 (s, IH), 8.21 (dd. J = 5.8, 2.7 Hz, IH), 8.03 C 7.91 (m, IH), 7.54 (t, J = 9.1 Hz, IH), 5.17 (t. J = 6.0 Hz. IH), 3.94 (dd, J = 10.5, 6.4 Hz. IH), 3.68 C 3.58 (m, IH), 3.59 (s. 3H), 3.20 (s, IH), 2.43 (s. 3H), 2.28 (s. 3H). 1.41 C 1.31 (m, 1 H), 0.70-0.60 (m. 1 H), 0.50 C 0.41 (m, 3H)
N-(3-cyano-4-fluoro-phenyl )-1,3.5trimethyl-4-[2-oxo-2-[[( I R)-1 (hydroxymethyl)-l-methyl-prop-2ynyl]amino]acetyl]pyrrole-2-carboxamide	64a	Ή NMR (300 MHz, DMSO-i/fi) ô 10.52 (s, IH), 8.48 (s, IH), 8.21 (dd, J = 5.8, 2.6 Hz. IH), 8.02-7.91 (m, IH), 7.54 (t. J = 9.1 Hz, IH), 5.18 (t, J = 6.1 Hz. IH), 3.69 (dd. J = 10.7, 6.3 Hz. IH), 3.59 (s, 3H), 3.57-3.50 (m. IH), 3.21 (s, IH), 2.42 (s, 3H), 2.27 (s. 3H), 1.50 (s. 3H)
N-(3-cyano-4-fluoro-pheny !)-1,3.5trimethy l-4-[2-oxo-2-[[( 1 S)-1 (hydroxymethy 1 )-1 -methy l-prop-2yny 1 ]am ino]acety 1 ] pyrrol e-2-carboxam ide	64b	Ή NMR (300 MHz. DMSO-ίΛ) δ 10.52 (s, IH), 8.48 (s, IH), 8.21 (dd. J = 5.8, 2.7 Hz, IH), 8.05-7.90 (m, IH), 7.54 (t. .1 = 9.1 Hz. IH), 5.18 (t. J = 6.1 Hz, IH), 3.69 (dd. J = 10.6, 6.3 Hz. 1 H), 3.59 (s, 3H), 3.57-3.52 (m. 1 H), 3.21 (s, IH), 2.42 (s, 3H). 2.27 (s, 3H), 1.50 (s. 3H)

Compound Name	Compound No.	’H NMR
N-[4-fluoro-3-(trifluoromethyl)phenyl]l ,3,5-tniriethyl-4-[2-oxo-2-[[( IR ) -1 cyclopropyl-l-(hydroxymethyl)prop-2ynyl]amino]acetyl]pynO)e-2-carboxamîde	65a	Ή NMR (400 MHz. DMSO-A) δ 10.51 (s, IH), 8.53 (s, IH), 8.23 (dd, J = 6.6. 2.7 Hz. IH), 8.01-7.93 (m. IH), 7.53 (t. J = 9.8 Hz, IH), 5.I8 (t. J = 6.I Hz. IH), 3.95 (dd, J = 10.6, 6.4 Hz, IH), 3.65-3.55 (m. 4H), 3.21 (s, IH), 2.44 (s, 3H), 2.30 (s, 3H), I.37 (ddd, J = 13.6, 8.0. 5.4 Hz, IH), 0.64 (q. J = 4.8 Hz, IH), 0.46 (ddd, J = 9.0, 6.4, 3.2 Hz, 3H)
N-[4-tluoro-3-(trifluoromethyl)phenyl]l ,3.5-trimethyl-4-[2-oxo-2-[[( I S)-1 cyclopropy I-1 -(hydroxymethyl)prop-2ynyl]amino]acetyl]pyiTole-2-carboxamide	65b	Ή NMR (400 MHz. DMSO-ί/ή) δ 10.51 (s, IH), 8.53 (s, IH), 8.23 (dd, J - 6.6, 2.7 Hz, IH), 8.01-7.93 (m. IH). 7.53 (t. J = 9.8 Hz. IH), 5.I8 (t. J = 6.1 Hz, IH). 3.95 (dd, J = 10.6. 6.4 Hz. IH). 3.65-3.55 (m, 4H), 3.21 (s, IH), 2.44 (s, 3H), 2.30 (s. 3H), 1.37 (ddd, J = 13.6, 8.0. 5.4 Hz. IH), 0.64 (q. J = 4.8 Hz. IH). 0.46 (ddd. J = 9.0, 6.4. 3.2 Hz, 3H)
N-(3-bromo-2-fluoro-4-pyridyl)-4-[2-[(3ethynyloxetan-3-yl)amino]-2-oxo-acetyl]l,3.5-trimethyl-pyrrole-2-carboxamide	67	Ή NMR (400 MHz, DMSO-</6) δ 9.97 (s, IH), 9.79 (s, IH), 8.19 (d. J = 5.5 Hz, IH), 7.96 (d. J = 5.5 Hz. IH), 4.79-4.69 (m. 4H). 3.67 (d, J = 2.7 Hz. 4H), 2.43 (d. J = 5.9 Hz. 6H)
N-(3-bromo-2-fluoro-4-pyridyl)-4-[2-[( l ethynyl-3,3-difliioro-cyclobutyl)amino]-2oxo-acetyl]-l,3,5-trimethyl-pyrrole-2carboxamide	68	Ή NMR (400 MHz. DMSO-î/6) δ 9.97 (s, lH), 9.64 (s, IH), 8.19 (dd, J = 5.6, 2.3 Hz. IH). 7.95 (dd, J = 5.5, 2.3 Hz. I H). 3.67 (d. J = 2.3 Hz, 3H), 3.54 (d, J = 2.3 Hz, IH), 3.14 (t, J = I2.3 Hz. 4H), 2.42 (dd. J = 7.3, 2.4 Hz, 6H)

Compound Name	Compound No.	Ή NMR
N-[4-fluoro-3-(trifluoromethyl)phenyl]l ,3,5-trimethy l-4-[2-oxo-2-[[( l R)-1 (hydroxymethy l)-1 -methylallyl]amino]acetyl]pyrrole-2-carboxamide	69a	Ή NMR (300 MHz. DMSO-Æ) δ 10.49 (s, IH), 8.21 (dd, J = 6.6, 2.6 Hz, IH), 8.15 (s, IH), 8.01-7.91 (m, IH), 7.52 (t. J = 9.8 Hz. IH), 6.01 (dd, J = 17.5, 10.8 Hz. IH), 5.22-5.04 (m, 2H), 4.95 (t, J = 5.9 Hz. IH), 3.59 (s, 3H), 3.56-3.51 (m. IH), 3.46 (dd, J = 10.8, 5.9 Hz. IH), 2.41 (s, 3H), 2.26 (s. 3H), 1.39 (s, 3H)
N-[4-fluoro-3-(trifluoromethyl)phenyl]l ,3,5-trimethy l-4-[2-oxo-2-[[( IS)-l(hydroxymethyl)-l-methylallyl]amino]acetyl]pyrrole-2-carboxamide	69b	Ή NMR (300 MHz. DMSO-Æ) δ 10.49 (s, IH), 8.21 (dd, J = 6.6, 2.7 Hz, IH), 8.15 (s, IH), 8.00-7.91 (m, III), 7.52 (t, J = 9.8 Hz, IH). 6.01 (dd, J = 17.6, 10.8 Hz, IH), 5.22-5.03 (m,2H), 4.95 (t, J = 5.9 Hz. IH), 3.59 (s, 3H), 3.55-3.42 (m. 2H), 2.41 (s, 3H), 2.26 (s. 3H), 1.39 (s, 3H)
N-(3-cyano-4-fluoro-phenyl)-1,3,5trimethy l -4- [2-[ [ l -methy I-1 -( I methylpyrazol-4-yl)ethyl]ammo]-2-oxoacetyl]pyrrole-2-carboxamide	70	lH NMR (400MHz. CDC13) δ 8.02 (dd, >2.7, 5.4 Hz. IH), 7.76-7.61 (m, 2H), 7.49 (s, IH), 7.41 (s. IH), 7.20 (t, >8.6 Hz. IH), 7.00-6.92 (m, 1 H), 3.87 (s, 3H). 3.69 (s. 3H). 2.34 (d. >8.3 Hz. 6H), 1.78 (s, 6H), 1.25 (s, IH)
N-(3-cyano-4-fluoro-pheny I)-1,3,5trimethy l-4-[2-oxo-2-[[( 1 R)-1 (hydroxymethyl)-l-(trifluoromethyl)prop2-ynyl]amino]acetyl]pyrrole-2carboxamide	71a	Ή NMR (400 MHz, CDC13) δ 8.02 (dd, J = 5.2, 2.8 Hz. IH), 7.75-7.71 (m„ IH). 7.58 (s. IH), 7.51 (s, IH), 7.24-7.20 (m, IH), 4.39-4.34(m, IH). 4.15-4.12 (m, IH), 3.72 (s, 3H). 3.713.68 (m, IH). 2.72 (s. IH), 2.40 (d. J = 7.2 Hz. 6H).
N-(3-cyano-4-fluoro-pheny 1)-1.3,5trimethyl-4-[2-oxo-2-[[( 1 S)-1 (hydroxymethy l)-l-(tri fluoromethyl)prop2-ynyl]amino]acetyl]pyrrole-2carboxamide	71b	Ή NMR (400 MHz. CDCh) δ 8.02 (dd, J = 5.2, 2.4 Hz. IH), 7.75-7,71 (m, IH), 7.60 (s, IH), 7.51 (s, IH), 7.24-7.20 (m, IH), 4.36 (d, J = 12.4 Hz. IH), 4.16 (d, J = 12.8 Hz. IH), 3.72 (s. 3H), 3.37-3.68(m.lH),2.74 (s, IH). 2.40 (d. J = 7.2 Hz, 6H)

Compound Name	Compound No.	Ή NMR
N-(3-cvano-4-tluoro-phenyl )-1,3,5trimethy l-4-[2-oxo-2-[[( lR)-l(hydroxymethyl)-l-rnethylallyl]amino]acetyl]pyrrole-2-carboxamide	72a	'H NMR (300 MHz, DMSO-dô) δ 10.51 (s, IH), 8.25-8.19 (m, IH), 8.I5 (s, IH). 7.98 (dddd, J = 9.2, 4.8, 2.7, I.5 Hz. IH), 7.55 (t. J =9.l Hz. IH), 6.02 (dd, J = 17.6, 10.8 Hz, IH), 5.22-5.06 (m, 2H), 4.95 (t. J = 5.8 Hz, IH), 3.60 (s, 3H), 3.57-3.43 (m. 2H), 2.42 (s, 3H), 2.27 (s. 3H). 1.39 (s, 3H).
N-(3-cyano-4-fluoro-phenyl)-1,3,5trimethy l-4-[2-oxo-2-[[( lS)-l(hydroxymethy l)-1 -methylallyl]amino]acetyl]pyrrole-2-carboxainide	72b	'H NMR (300 MHz. DMSO-</û) δ 10.51 (s, IH), 8.25-8.Il (m, 2H), 7.98 (ddd, J = 9.2, 4.8, 2.7 Hz, IH), 7.55 (t. J = 9.1 Hz, IH), 6.02 (dd. J = 17.6, 10.8 Hz, IH). 5.23-5.05 (m, 2H), 4.95 (t, J = 5.9 Hz, IH), 3.65-3.41 (m, 5H), 2.42 (s, 3H), 2.27 (s, 3H), l.39(s. 3H)
N-(3-cyano-4-fluoro-pheny l)-1,3,5trimethyl-4-[2-oxo-2-[[( I R)-l(hydroxymethy I)-1 (tnfluoromethyl)allyl]amino]acetyl]pyrrole2-carboxamide	74a	Ή NMR (300 MHz. CDCh) δ 8.04 (dd, J = 5.4, 2.7 Hz, IH), 7.79-7.73 (m, IH), 7.67 (s. IH), 7.35 (s, IH), 7.25 (dd. J = 12.0, 3.6 Hz. IH), 6.03 (dd, J = I7.4, 10.8 Hz. IH), 5.62 C 5.55 (m, 2H), 4.47 (s, IH). 4.23 (d, J = 12.6 Hz, IH), 3.96 (d. J = I3.2 Hz, IH), 3.75 (s. 3H), 2.43 (d, J = 6.6 Hz, 6H)
N-(3-cyano-4-fluoro-phenyl)-l,3,5trimethy l-4-[2-oxo-2-[[( l S)-1 (hydroxymethyl)-l- (trifluoromethyl)allyl]aminojacetyl]pyrrole2-carboxamide	74 b	Ή NMR (400 MHz. CDCh) Ô 8.02 (dd, J = 5.2, 2.8 Hz. IH), 7.76-7.72 (m, IH), 7.65 (s, IH), 7.33 (s, IH). 7.23 (dd. J = I5.6, 7.2 Hz, IH), 6.00 (dd. J = 17.6, 10.8 Hz, IH), 5.59 C 5.53 (m, 2H), 4.46 (t, J = 7.6 Hz. IH), 4.21 (dd, J = 12.8, 8.4 Hz. IH), 3.94 (dd, J = 12.8, 6.4 Hz. IH), 3.73 (s, 3H), 2.41 (d. J = 8.8 Hz, 6H)

Compound Name	Compound No.	Ή NMR
N-[4-fluoro-3-(trifluoromethyl)phen\i]l .3,5-trimethy l-4-[2-o.xo-2-[[( l R )-1 (hydroxymethyl)-1 -(tritluoromethy l)prop2-ynyl]amino]acetyl]pyrrole-2carboxamide	75a	'H NMR (400 MHz. CDCb) δ 7.88 (dd. J = 6.0, 2.4 Hz, 1H), 7.76-7.72 (m, IH). 7.51 (d. J = 6.4 Hz. 2H), 7.24 (t. J = 9.2 Hz, IH), 4.38 (d, J = 12.4 Hz, 1H), 4.15 (d, J = 11.6Hz. JH), 3.73 (s, 3H), 2.71 (s, IH), 2.41 (d. J = 3.6 Hz, 6H)
N-[4-fluoro-3-(trifluoromethyl)phenyl]l ,3,5-trimethyl-4-[2-oxo-2-[[( l S)-1 (hydroxymethyl)-1-(tri fluoromethyl)prop2-ynyl]amino]acety!]pyrrole-2carboxamide	75b	lH NMR (400 MHz. CDCb) δ 7.88 (dd, J = 6.4, 2.8 Hz, IH), 7.76-7.72 (m, IH). 7.50 (d, J 5.2 Hz. 2H), 7.21 (t. J =9.6 Hz, IH). 4.37 (d. J = 12.4 Hz. IH), 4.15 (d. J = 12.4 Hz, IH), 3.73 (s, 3H), 2.71 (s, 1 H), 2.40 (d. J = 4.8 Hz, 6H)
N-(3-cyano-4-fluoro-phenyl)-4-[2-[[3-(3hydroxy prop-1 -y ny I )oxetan-3 -y I ] am i no] -2oxo-acetyl]-1,3,5-trimethyl-pyrrole-2carboxamide	76	Ή NMR (400 MHz, DMSO-î76) δ 10.55 (s, IH), 9.74 (s, IH), 8.22 (dd. J = 5.8, 2.7 Hz, 1 H), 7.98 (ddd, J = 9.2, 4.8, 2.7 Hz. 1 H), 7.55 (t, J = 9.1 Hz, 1 H), 5.26 (t. J = 5.9 Hz, IH), 4.74 (s, 4H), 4.14 (d. J = 5.9 Hz, 2H), 3.61 (s, 3H), 2.43 (s, 3H). 2.28 (s.3H)
N-(3-cyano-4-fluoro-phenyl)-1,3,5trimethy l-4-[2-oxo-2-[[( 1 R)-1 -methyl-1 ( tritluoromethy l)prop-2ynyl]amino]acetyl]pyrrole-2-carboxamide	79a	'H NMR (300 MHz. Methanoldd) δ 8.16 (dd, J = 5.6, 2.7 Hz, IH), 7.94 (ddd. J = 9.2, 4.8. 2.8 Hz. IH), 7.39 (t. J = 9.0 Hz, IH), 3.69 (s, 3H), 3.24 (s, IH), 2.51 (s, 3H), 2.39 (s, 3H), 1.90 (s. 3H)
N-(3-cyano-4-fluoro-phenyl)-1,3,5trimethy l-4-[2-oxo-2-[[( 1 S)-1 -methy 1-1 (tritluoromethy l)prop-2ynyI]amino]acetyl]pyrrole-2-carboxamide -	79b	Ή NMR (300 MHz. Methanold4) δ 8.16 (dd, J = 5.7, 2.7 Hz, IH), 7.94 (ddd, J = 9.2, 4.7, 2.7 Hz. IH), 7.39 (t. J = 9.0 Hz. IH), 3.69 (s, 3H). 3.24 (s, 1 H), 2.51 (s. 3H), 2.39 (s. 3H). 1.90 (s, 3 H)

Compound Name	Compound No.	Ή NMR
N-[4-fluoro-3-(trifluoromethyl)phenyl]l ,3,5-trimethyl-4-[2-oxo-2-[[( 1R)-1(hydroxymethyl)-l- (trifluoromethyl)allyl]amino]acetyl]pyrrole2-carboxamide	80a	Ή NMR (400 MHz. CDCh) δ 7.88 (dd, J = 6.0, 2.4 Hz, IH), 7.76-7.72 (m, IH), 7.34 (s, IH), 7.22 (t. J = 9.2 Hz, IH), 6.01 (dd, J= 17,6, 10.8 Hz, IH), 5.60 C5.54 (m, 2H). 4,23 (d, J = 12.8 Hz. IH), 3.96 (d. J = 12.8 Hz, IH), 3.74 (s, 3H), 2.43 (d, J = 3.6 Hz, 6H)
N-[4-fluoro-3-(trifluoromethyl)phenyl]1,3,5-trimethy l-4-[2-oxo-2-[[( 1S )-1 (hydroxymethyl)-l- (trifiuoromethyl)allyl]amino]acetyl]pyrrole2-carboxamide	80b	Ή NMR (400 MHz. CDCh) δ 7,98 (dd, J = 6.0. 2.8 Hz. IH), 7.76-7.73 (m, IH), 7.51 (s, IH), 7.34 (s, IH), 7.22 (t. J = 9.2 Hz. IH), 6.01 (dd, J = 17.2, 10.8 Hz. IH), 5.60 C 5.54 (m. 2H). 4.23 (d. J = 12.8 Hz. IH), 3.95 (d, J = 13.2 Hz, 1 H), 3.73 (s, 3H), 2.42 (d. J = 4.8 Hz, 6H)
5-chloro-N-[3-(difluoromethyl)-4-fluorophenyl]-4-[2-[( 1 -ethynyl-3,3-difluorocyclobutyl )amino]-2-oxo-acety IJ-1,3dimethyl-pyrrole-2-carboxamide	81	Ή NMR (400 MHz, DMSO-Λ) δ 10.59 (s, IH), 9.69 (s, IH), 8.20-8.01 (m. IH), 7.83 (s, IH), 7.48-7.07 (m, 2H). 3,70 (s, 3H), 3.54 (s, IH), 3,15 (t, J = 11.9 Hz. 4H), 2.31 (s, 3H)
N-[3-(difluoromethyl)-4-fluoro-phenyl]-4[2-[( 1 -ethynyl-3,3-difluorocyclobutyl)amino]-2-oxo-acetyi]-1,3,5trimethyl-pyrrole-2-carboxamide	82	‘H NMR (400 MHz, DMSO-de) δ 10.45 (s, IH), 9.62 (s, IH), 8.08 (dd, J = 6.4, 2.6 Hz, IH), 7.88-7.79 (m. IH). 7.41-7.09 (m. 2H). 3.61 (s, 3H), 3.53 (s, IH), 3.20-3.05 (m, 4H), 2.43 (s, 3H), 2.26 (s, 3H).
N-(2-bromo-3-fluoro-4-pyridyl)-4-[2-[(3ethyny 1 oxetan-3-y 1 )am i no] -2-oxo-acety 1 ] 1,3,5 -tri met hy 1 -py rrole-2-carboxam ide	83	'H NMR (300 MHz. DMSO-<76) δ 10.56 (s, IH), 9.77 (s, IH), 8.19 (d, J = 5.3 Hz. IH), 8.05 (t, J = 5.4 Hz, IH). 4.73 (q. J = 6.6 Hz. 4H). 3.66 (s, IH) , 3.63 (s, 3H), 2.42 (s, 3H). 2.30 (s. 3H)
N-(2-bromo-3-fliioro-4-pyridyl)-4-[2-[( 1 ethynyl-3,3-difluoro-cyclobutyl)amino]-2oxo-acety!]-l,3,5-trimethyl-pyrrole-2carboxamide	84	Ή NMR (300 MHz. DMSO-rA) δ 10.54 (s, IH), 9.62 (s, IH), 8.19 (d, J = 5.3 Hz. IH), 8.05 (t, J = 5.4 Hz, IH), 3.63 (s. 3H), 3.52 (s, IH), 3.12 (t, J = 12.2 Hz. 4H), 2.42 (s. 3H), 2.30 (s. 3H)

Compound Name	Compound No.	Ή NMR
N-(3-cyano-4-fluoro-pheny I)-1,3,5trimethyl-4-[2-[( l -methy I-1 -thiazol-2-ylethyl)amino]-2-oxo-acetyl]pyrrole-2carboxainide	85	Ή NMR (400 MHz. DMSO-i/rt) δ 10.53 (s, IH), 9.21 (s, IH), 8.22 (dd, J = 5.8, 2.7 Hz, IH), 7.98 (ddd, J = 9.2, 4.8, 2.7 Hz, IH), 7.69 (d. J = 3.3 Hz, IH), 7.62 (d, J = 3.3 Hz, IH), 7.55 (t, J = 9.2 Hz, IH), 3.59 (s, 3H), 2.40 (s, 3H), 2.24 (s, 3H), 1.74 (s. 6H)
N-(3-cyano-4-fluoro-phenyl)-1,3.5trimethy 1-4-[ 2-[ [ l -methy 1-1 -(2pyridyl)ethyl]amino]-2-oxo-acetyl]pyrrole2-carboxamide	91	Ή NMR (400MHz. DMSO-^) δ 10.49 (s, IH), 8.98 (s, IH), 8.51 (d, J=4.0 Hz. IH), 8.20 (dd. J=2.7, 5.8 Hz, IH), 7.97 (ddd, J=2.6. 4.9, 9.2 Hz. IH), 7.78 (dt. J=1.8, 7.8 Hz. IH), 7.57-7.48 (m, 2H), 7.25 (dd, J=5.3, 7.0 Hz, IH), 3.58 (s, 3H), 2.39 (s, 3H), 2.25 (s. 3H), 1.71-1.59 (m. 6H)
N-(3-cyano-4-tl uoro-pheny 1)-1,3,5trimethy l-4-[2-[[ 1 -methyl-1 -(3pyridyl)ethyl]amino]-2-oxo-acetyl]pyrrole2-carboxamide	92	lH NMR (400MHz, DMSO-t/e) δ 10.49 (s, IH), 9.00 (s, IH), 8.66 (d, J=2.3 Hz. 111),8.42 (dd, J=1.4, 4.7 Hz. IH), 8.19 (dd. J=2.6, 5.8 Hz, IH), 7.96 (ddd. J=2.8, 4.8, 9.2 Hz, IH), 7.867.71 (m, IH), 7.53 (t, J=9.1 Hz, IH), 7.35 (dd. J=4.8. 8.0 Hz. IH), 3.58 (s, 3H), 2.37 (s, 3H), 2.22 (s, 3H). 1.67 (s. 6H)
N-(3-cyano-4-fluoro-pheny 1 )-1,3,5trimethy 1 -4-[2-[ [ 1 -methy 1-1 -(4pyridyl)ethyl]amino]-2-oxo-acetyl]pyrrole2-carboxamide	93	Ή NMR (400MHz. DMSO-î/î) δ 10.50 (s, IH), 9.03 (s, IH), 8.58-8.42 (m, 2H). 8.20 (dd. J=2.6, 5.8 Hz. IH), 8.02-7.89 (m. IH), 7.53 (t. >9.1 Hz, IH), 7.44-7.30 (m, 2H), 3.58 (s. 3H), 2.39 (s, 2H), 2.24 (s, 3H), 1.63 (s, 6H)
N-(3-cyano-4-fluoro-pheny 1)-1,3,5- trimethyl-4-[2-oxo-2-[[3-[(3R)-3- hydroxybut-1 -yny l]oxetan-3- y 1 ]am ino] acety 1 ] py rro le-2-carboxam ide	94a	'H NMR (400 MHz. MethanolΛ) δ 8.14 (t, J = 2.8 Hz, IH), 7.93-7.89 (m. 1 H), 7.36 (t. >8.8 Hz. 1 H),4.85-4.84 (m. 4H). 4,54 (q. > 6.8 Hz. 1H),3.88 (s, 3H),2.48 (s, 3H), 2.37(s, 3H), 1.40 (d, >6.8 Hz, 3H).

Compound Name	Compound No,	'HNMR
N-(3-cyano-4-fluoro-phenyl)-1,3,5trimethyl-4-[2-oxo-2-[[3-[(3S)-3hydroxybut-1 -ynyl ]oxetan-3yl]amino]acetyl]pyrrole-2-carboxamide	94b	'H NMR (400 MHz. MethanolΛ) δ 8.14 (t, J = 2.8 Hz, 1H), 7.93-7.89 (m. IH), 7.36 (t, J=8.8 Hz. 1 H),4.85-4.84 (m, 4H), 4.54 (q. J= 6.8 Hz, 1 H),3.88 (s. 3H),2.48 (s, 3H), 2.37(s, 3H), 1.40 (d, J=6.8 Hz, 3H).
N-(3-cyano-4-fluoro-pheny I)-1,3,5trimethyl-4-[2-oxo-2-[[( I R)-1 -methyl-1 (trifluoromethyl)allyl]amino]acetyl]pyrrole2-carboxamide	95a	“H NMR (300 MHz, DMSO-Λ) δ 10.54 (s, 1H), 9.03 (s, IH), 8.22 (dd, J = 5.8, 2.7 Hz, IH), 7.98 (ddd, J = 9.2, 4.9, 2.7 Hz. IH), 7.55 (t, J = 9.1 Hz, IH), 6.32 (dd, J = 17.5, 10.9 Hz, IH). 5.80 C 5.28 (m, 2H), 3.61 (s, 3H), 2.43 (s, 3H). 2.26 (s, 3H), 1.70 (s, 3H).
N-(3-cyano-4-fluoro-phenyl)-1,3,5trimethyl-4-[2-oxo-2-[[( I S)-1 -methyl-1 (trifluoromethyl)allyl]amino]acetyl]pyrrole2-carboxamide	95 b	Ή NMR (300 MHz. DMSO-î/6) δ 10.54 (s, IH), 9.03 (s, IH), 8.22 (dd. J = 5.8, 2.7 Hz, IH), 7.98 (ddd. J = 9.2, 4.9, 2.7 Hz. IH), 7.55 (t, J = 9.1 Hz. IH), 6.32 (dd, J = 17.5, 10.9 Hz, 1 H), 5.80 C 5.28 (m, 2H), 3.61 (s, 3H), 2.43 (s, 3H), 2.26 (s, 3H), 1.70 (s, 3H).
N-(3-cyano-4-fIuoro-phenyl )-1,3,5trimethy l -4-[2-[[ I -methyl-1 -( l H-pyrazol-4yl)ethyl]amino]-2-oxo-acetyl]pyrrole-2carboxamide	96	'H NMR (400MHz, DMSO4) δ 12.57 (br s, IH), 10.48 (s, IH), 8.49 (s, IH). 8.20 (dd. J=2.6, 5.8 Hz. IH), 7.96 (ddd. J=2.8, 4.9, 9.1 Hz. IH), 7.53 (br t, J=9.1 Hz. 3H), 3.57 (s, 3H), 2.35-2.32 (m. 2H), 2.32-2.32 (m. 1 H), 2.20 (s, 3H), 1.65 (s, 6H)
N-[4-fluoro-3-(trifluoromethyl)phenyl]l ,3,5-trimethy l-4-[2-[[ I -methy I-1 -( l Hpyrazol-4-yl)ethyl]amino]-2-oxoacetyl]pyrrole-2-carboxamide	97	Ή NMR (400MHz. DMSO-rA) δ 12.57 (br s, IH), 10.46 (s, IH), 8.49 (s, IH), 8.20 (dd. J=2.4, 6.4 Hz. IH), 8.01-7.90 (m, IH), 7.63-7.41 (m, 3H). 3.57 (s, 3H), 2.34 (s. 3H), 2.21 (s, 3H), 1.66 (s, 6H)

Compound Name	Compound No.	Ή NMR
N-[4-t1uoro-3-(trii1uoromethyl)phenyl]1,3,5-tr i methy 1 -4-[2-[ [ 1 -methyl-1 -( 1 methylpyrazol-4-yl)ethyl]amino]-2-oxoacety 1 ]pyrrole-2-carboxam ide	98	’H NMR (400MHz. DMSO-Λ) δ 10.47 (s, IH), 8.51 (s, IH), 8.20 (dd, J=2.6, 6.6 Hz, IH), 7.98-7.92 (m, 1 H), 7.60 (s, IH), 7.51 (t, J=9.8 Hz. IH), 7.38 (d, J=0.6 Hz. IH), 3.78 (s, 3H), 3.57 (s. 3H). 2.36-2.33 (m, 3H), 2.21 (s, 3H), 1.63 (s. 6H)
N-[4-fluoro-3-(trifluoromethyl)phenyl]1,3,5-trimethy l-4-[2-[[ 1 -methyl-1 -(2pyridyl)ethyl]amino]-2-oxo-acetyl]pyrrole2-carboxamide	99	'H NMR (400MHz. DMSO-î/ô) δ 10.48 (s, IH), 8.98 (s, IH), 8.51 (d, J=3.9 Hz, IH). 8.21 (br d. J=3.9 Hz, IH), 7.99-7.92 (m, IH). 7.79 (br d. J=1.6 Hz. IH), 7.52 (d. .1=8.4 Hz. 2H), 7.25 (br d. J=1.9 Hz, IH), 3.59 (s, 3H), 2.39 (s, 3H), 2.25 (s, 3H), 1.67 (s, 6H)
N-[4-fluoro-3-(trifluoromethyl)phenyl]1,3,5-trimethy l-4-[2-[[ 1 -methyl-1 -(3pyridyl)ethyl]amino]-2-oxo-acetyl]pyrrole2-carboxamide	100	‘H NMR (400MHz. DMSO-î/û) δ 10.48 (s, IH), 9.01 (s, IH), 8.66 (d, J=2.4 Hz. 1 H). 8.43 (dd. J=l.4, 4.7 Hz. IH), 8.20 (dd. J=2.6. 6.6 Hz. IH), 7.95 (br dd, J=4.l, 7.6 Hz. IH), 7.80 (td, J=1.9, 8.0 Hz. IH), 7.51 (t, J=9.8 Hz. 1 H), 7.35 (dd, J=4.8, 8.0 Hz. IH), 3.58 (s, 3H), 2.38 (s, 3H), 2.23 (s, 3H), 1.68 (s, 6H)
N-[4-fluoro-3-(trifluoromethyl)phenyl]- 1,3,5-t ri met hy 1 -4-[2 - [ [ 1 -methyl-1 -(4pyridyl)ethyl]amino]-2-oxo-acetyl]pyrrole- 2-carboxamide	101	Ή NMR (400MHz. DMSO-Æ) δ 10.49 (s, IH), 9.04 (s, IH), 8.57-8.45 (m, 2H). 8.21 (dd, J=2.5, 6.6 Hz. IH), 7.96 (td. J=3.7, 8.5 Hz. IH), 7.52 (t, J=9.8 Hz, IH), 7.45-7.34 (m, 2H), 3.59 (s, 3H). 2.40 (s, 3H), 2.25 (s, 3H), 1.64 (s. 6H)
N-(3-cyano-4-fluoro-phenyl)-4-[2-[[3-[2(l-hydroxycyclopropyl)ethynyl|oxetan-3yl]amino]-2-oxo-acetyl]-l,3,5-trimethylpyrrole-2-carboxamide	102	’H NMR (300 MHz. MethanolΛ) δ 8.16 (dd, J = 5.6, 2.7 Hz, IH), 7.94 (ddd, J = 9.2, 4.7, 2.7 Hz. IH), 7.39 (t, J = 9.0 Hz. IH), 4.86 (s. 4H), 3.69 (s. 3H), 2.51 (s, 3H), 2.39 (s, 3H), 1.01 (t. J = 2.8 Hz, 2H), 0.97 (t, J = 2.8 Hz, 2H).

I

Compound Name	Compound No.	Ή NMR
N-[4-t1uoro-3-(tritluoroinethyl)phenylJ- 1,3,5-trimethy l-4-[2-[( 1 -methy 1-1 -th iazol-2yl-ethyl)amino]-2-oxo-acetyl]pyrrole-2carboxamide	103	Ή NMR (400MHz. DMSO-tfc) δ 10.49 (s, IH), 9.17 (s, IH), 8.21 (dd, J=2.2, 6.4 Hz. IH), 8.02-7.89 (m, IH), 7.68 (d, J=3.3 Hz, IH), 7.61 (d. J=3.3 Hz. IH), 7.51 (t. J=9.8 Hz, 1 H), 3.59 (s, 3H), 2.39 (s. 3H), 2.24 (s.3H), 1.74 (s, 6H)
[[2-[5-[(3-cyano-4-fluoro- phenyl)carbamoyl]-1,2,4-trimethyl-pyrrol3 -y 1 ]-2-oxo-acety 1 ] -( 3 -ethyny loxetan-3 yl)amino]methyl-(2S)-2-amino-3-methylbutanoate	105	Ή NMR (400 MHz, DMSO-î/î) δ 10.60 (s, IH), 8.19 (dd, J = 5.7, 2.6 Hz. IH), 7.99 C 7.91 (m, 1 H), 7.54 (t, J = 9.2 Hz. IH). 5.51 C 5.38 (m, 2H), 4.91 (dd. J = 6.9, 5.2 Hz. 2H), 4.64 (dd. J = 6.3, 2.7 Hz, 2H), 3.65 (d, J = 50.3 Hz. 4H), 3.09 (s. IH), 2.42 (s. 3H), 2.25 (s, 3H), 1.80 (dd, J = 12.4, 6.1 Hz. IH), 0.83 (d, J = 6.8 Hz, 3H), 0.74 (d. J = 6.8 Hz, 2H).
N-(3-cyano-4-fluoro-phenyl)-4-[2-[(4ethynyltetrahydropyran-4-yl)amino]-2-oxoacetyl ]-1,3,5-trimethy l-pyrrole-2carboxamide	107	Ή NMR (400MHz. DMSO-Æ) δ 10.54 (s, IH), 8.89 (s, IH), 8.22 (dd, J=2.7, 5.8 Hz, 1 H), 7.98 (ddd, J=2.8, 4.9, 9.1 Hz, IH), 7.55 (t, J=9.l Hz, IH), 3.81-3.71 (m. 2H), 3.64 (br s, IH), 3.60 (s, 4H), 3.43 (s, IH), 2.45 (s, 3H), 2.29 (s. 3H), 2.10 (brd, J=14.4 Hz, 2H), 1.96-1.83 (m, 2H)
N-(3-cyano-4-fluoro-phenyl)-4-[2-[( 1 ethyny lcyclopentyl)amino]-2-oxo-acetyl]l.3,5-trimethyl-pyrrole-2-carboxamide	109	Ή NMR (400MHz, DMSO-r/e) δ 10.54 (s, IH), 8.83 (s, IH), 8.21 (dd, J=2.7, 5.8 Hz. IH), 7.97 (ddd. J=2.8, 4.8, 9.2 Hz, IH). 7.54 (t, J=9.2 Hz. 1 H), 3.59 (s, 3H), 3.20 (s, IH), 2.43 (s, 3H), 2.27 (s, 3H), 2.22-2.12 (m, 2H). 2.06-1.94 (m, 2H), 1.771.63 (m. 4H)

Compound Name	Compound No.	Ή NMR
4-[2-[[3.3-difluoro-l-(l-methyltriazol-4yl)cyclobutyl]amino]-2-oxo-acetyl]-N-[4fluoro-3-(trifluoromethyl)phenyl]-l,3,5trimethyl-pyrrole-2-carboxamide	1 10	Ή NMR (400MHz. DMSO-r/i) δ 10.52 (s, IH), 9.74 (s, IH), 8.21 (dd, J=2.5, 6.5 Hz, 1 H), 8.04-7.86 (m, 2H), 7.53 (t, J=9.8 Hz, IH), 4.04 (s, 3H), 3.59 (s, 3H), 3.30-3.19 (m, 4H). 2.34 (s, 3H), 2.20 (s, 3H)
N-(3-cyano-4-tluoro-pheny I )-4-[2-[[ l -( l Himidazol-2-y l)-l-methy l-ethyl]am ino]-2oxo-acety l]-1,3,5-trimethy l-pyrrole-2carboxamîde	131	Ή NMR (400MHz. OMSO-Æ) δ 10.45 (s, IH), 9.61 (s, IH), 8.22 (d, J=2.4 Hz. IH), 7.727.65 (m, IH), 7.63-7.57 (m, IH), 3.60 (s, 3H), 3.52 (s. 1 H), 3.13 (br t. J=11.9 Hz, 4H), 2.42 (s, 3H), 2.28 -2.22 (m, 3H)
N-[4-fliioro-3-(triflLioroiriethyl)phenyl]-4[2-[[ I -( 1 H-imidazol-2-yl)-l-methylethy 1 ]am i no] -2-oxo-acety 1 ] -1,3,5 -tr i methy 1 pyrrole-2-carboxamide	132	Ή NMR (400 MHz. CDCI3) δ 10.64 - 10.35 (m, IH), 7.88 (dd. J=2.7, 6.1 Hz, IH), 7.76 (td. J=3.5, 8.7 Hz, IH), 7.61 (s, IH), 7.22 (t, J=9.3 Hz. IH), 6.98 (s, 2H), 3.72 (s, 3H), 2.36 (d. J=8.1 Hz. 6H), 1.89 (s, 6H)
N-(3-bromo-4-chloro-phenyl)-4-[2-[( 1 ethyny 1-3,3-di ΠυοΓθ<νοΙοΙπιΙ}Τ)3Γηίηο]-2oxo-acetyl·]-1,3,5-trimethy l-pyrrole-2carboxamide	133	'H NMR (400MHz. DMSO-t/e) δ 10.45 (s, IH), 9.61 (s, IH), 8.22 (d, .1=2.4 Hz, IH), 7.727.65 (m, IH), 7.63-7.57 (m, IH), 3.60 (s, 3H), 3.52 (s, IH), 3.13 (br t, J=l 1.9 Hz, 4H), 2.42 (s, 3H), 2.28-2.22 (m,3H)
N-(4-bromo-3-chloro-phenyl)-4-[2-[( 1 ethynyl-3,3-difluoro-cyclobiityl)amino]-2oxo-acetyl]-l,3,5-trimethyl-pyrrole-2carboxamide	134	Ή NMR (400 MHz. CDCI3) δ 7.87 (d, J=2.5 Hz. IH), 7.58 (d, J—8.6 Hz, IH), 7.43 (s, IH), 7.35 - 7.29 (m, 2H), 3.72 (s, 3H), 3.22 (br t, J=11.4 Hz. 4H), 2.53 (s, 1 H), 2.40 (d, J=11.9 Hz, 6H)
N-(3-cyano-4-fluoro-phenyl)-4-[2-[[ 1 -( 1 cyclopropy lpyrazol-4-y !)-1 -methy 1ethyl]amino]-2-oxo-acetyl]-l,3,5-trimethylpyrrole-2-carboxamide	135	Ή NMR (400MHz. DMSO-i/ÿ) δ 10.49 (s, IH), 8.50 (s, IH). 8.20 (dd, J=2.8, 5.8 Hz, 1 H), 7.97 (ddd, J=2.7, 4.9, 9.2 Hz. IH), 7.69 (s, IH), 7.54 (t. J=9.1 Hz, IH), 7.38 (s, IH), 3.69-3.62 (m. IH), 3.57 (s, 3H), 2.33 (s, 3H), 2.19 (s, 3H), 1.63 (s, 6H), 1.01-0.95 (m,2H), 0.95-0.88 (m, 2H)

I ιοο

Compound Name	Compound No.	Ή NMR
4-[2-[f l -( I -cyclopropy lpyrazol-4-yl)-1 methy l-ethy I ]am i no] -2-oxo-acety I ]-N-[4fluoro-3-(trifluoromethyl)phenyl]-1,3,5trimethyI-pyrrole-2-carboxamide	136	'H NMR (400MHz. DMSO-^) δ 10.47 (s, IH), 8.49 (s, IH), 8.20 (dd, >2.5, 6.5 Hz. IH), 7.99-7.93 (m, IH), 7.69 (s, IH), 7.51 (t, J=9.8 Hz. IH), 7.38 (s, IH). 3.68-3.61 (m, IH), 3.57 (s, 3H). 3.44-3.20 (m, 58H), 2.34 (s, 3H), 2.19 (s, 3H), 1.63 (s, 6H), 1.00-0.95 (m, 2H), 0.940.88 (m, 2H)
N-(3-cyano-4-fluoro-pheny 1)-1,3,5trimethy 1-4-[ 2-[ [ 1 -methy 1-1 -(2methylpyrazol-3-yl)ethyl]amino]-2-oxoacetyl |pyrrole-2-carboxamide	137	Ή NMR (400 MHz, CDCh) δ 8.04 (dd, >2.6, 5.4 Hz, IH), 7.85 (s, IH), 7.71 (ddd, >2.9, 4.3, 9.0 Hz. IH), 7.38 (d, >1.6 Hz. IH), 7.20 (t. >8.7 Hz. IH), 7.14-7.14 (m. IH), 7.12 (s. 1 H), 6.22 (d, >1.8 Hz. IH), 3.91 (s, 3H), 3.69 (s, 3H). 2.39 (s, 3H), 2.30 (s, 3H), 1.82 (s. 6H), 1.59 (s, 10H)
N-[4-fluoro-3-(tnfluoromethyl)phenyl]1,3,5-trimethyl-4-[2-[[ 1 -methyl-1 -(2methylpyrazol-3-yl)ethyl]amino]-2-oxoacetyl]pyrrole-2-carboxamide	138	!H NMR (400 MHz. CDCh) δ 7.88 (dd. >2.6, 6.0 Hz, IH), 7.78 - 7.67 (m, IH), 7.62 (s, IH), 7.38 (d. >1.9 Hz, IH), 7.20 (t, >9.4 Hz, IH). 7.12 (s, IH). 6.23 (d, >1.9 Hz, IH), 3.94 (s, 3H), 3.70 (s, 3H), 2.402.29 (m,6H), 1.83 (s. 6H)
N-(3-cyano-4-fluoro-pheny 1)-1,3,5trimethyl-4-[2-[[ 1 -methyl-1 -( 1,3,4oxadiazol-2-yl)ethyl]amino]-2-oxoacety 1 ] py rro le-2 -c arboxam i d e	139	Ή NMR (400 MHz, CDCh) δ 8.37 (s, IH), 8.05 (dd. >2.8, 5.5 Hz, IH), 7.76-7.70 (m, 2H), 7.40 (s, IH), 7.21 (t. >8.7 Hz, IH), 3.70 (s, 3H), 2.38 (s. 3H), 2.33 (s. 3H), 1.88 (s, 6H)
N-(3-cyano-4-fluoro-phenyl)-1,3,5trimethyl-4-[2-[( 1 -methyl-1 -thiazol-4-yiethyl)amino]-2-oxo-acetyl]pyrrole-2carboxamide	140	Ή NMR (400 MHz, CDCh) δ 10.50 (s, IH), 9.01 (d. >1.9 Hz, IH), 8.79 (s, IH), 8.20 (dd. >2.7, 5.8 Hz, IH), 7.96 (ddd, J=2.8, 4.9, 9.2 Hz, IH), 7.54 (t. >9.1 Hz, IH), 7.47 (d, >1.9 Hz. IH), 3.57 (s, 3H), 2.34 (s, 3H), 2.20 (s, 3H), 2.07 (s, IH), 1.71 (s, 6H)

ΙΟΙ

Compound Name	Compound No.	*H NMR
N-[4-fluoro-3-(trifluoromethyl)phenyl]l ,3,5-trimethy l -4-[2-[ ( l -methy l-1 -thiazol-4yl-ethyl)amino]-2-oxo-acetyl]pyrrole-2carboxamide	141	'H NMR (400MHz. DMSO-ί/ή) δ 10.48 (s, IH), 9.01 (d, >1.9 Hz, 1 H), 8.79 (s. IH), 8.21 (dd. >2.5, 6.5 Hz, IH), 7.95 (td, >3.6, 8.8 Hz, IH), 7.57-7.42 (m, 2H), 3.57 (s, 3H). 2.36-2.33 (m, 3H), 2.21 (s, 3H), 1.71 (s, 6H)__________
4-[2-[[l-(2-cyclopropyltriazol-4-y 1)-3,3difluoro-cyclobutyl]amino]-2-oxo-acetyl]N-[4-fluoro-3-(tritluoromethyl)phenyl]1,3,5 -tr i methy I -py rro l e-2 -carboxam i de	142	‘H NMR (400 MHz. CDC h) δ 7.88 (dd, >2.6, 6.0 Hz. IH), 7.77-7.69 (m, IH), 7.63-7.54 (m, 2H), 7.49 (s, IH), 7.22 (t, >9.3 Hz, IH), 3.97 (tt, >3.8, 7.5 Hz. IH). 3.72 (s, 3H), 3.44-3.23 (m, 4H), 2.38 (d, >8.9 Hz, 6H), 1.38-1.29 (m, 2H), 1.16-1.06 (m, 2H)
N-[4-nuoro-3-(trifiuoromethyl)phenyl]l ,3,5-trimethy l-4-[2-[[ l -methy I-1 -( 1,3,4oxadiazol-2-yl)ethyl]amino]-2-oxoacetyl]pyrrole-2-carboxamide	143	Ή NMR (400 MHz, CDCh) δ 8.29 (s, IH), 7.82 (dd. >2.6, 6.1 Hz. IH), 7.66 (td. >3.5, 8.9 Hz, IH), 7.50 (s, IH), 7.32 (s, IH), 7.13 (t. >9.3 Hz. IH), 3.63 (s, 3H), 2.29 (d, >13.4 Hz, 6H), 1.81 (s, 6H)
N-(3-cyano-4-t1uoro-pheny I)-1,3,5trimethyl-4-[2-[( 1 -methyl-1 -pyrimidin-5-y 1ethyI)amino]-2-oxo-acetyl]pyrrole-2carboxamide	144	Ή NMR (400MHz. DMSO-^) δ 10.53 (s, IH), 9.17 (s, IH), 9.08 (s, IH), 8.85 (s, 2H), 8.21 (dd, >2.8, 5.7 Hz. IH), 7.97 (br dd. >3.4, 8.8 Hz. IH), 7.55 (t, >9.1 Hz, IH), 3.59 (s, 3H),2.38 (s, 3H), 2.22 (s. 3H), 1.71 (s, 6H)
N-(3-cyano-4-fluoro-phenyl)-4-[2-[[l-(5fluoro-2-pyridyl)-l -methy l-ethyl]am ino]-2oxo-acetyl]-l,3,5-trimethyl-pyrrole-2carboxamide	145	'H NMR (400MHz, DMSO-<76) δ 10.51 (br s, IH), 9.01 (s, IH), 8.49 (d, >2.9 Hz, IH). 8.21 (dd, >2.6, 5.8 Hz, IH), 7.97 (ddd, >2.7, 4.9, 9.1 Hz. 111). 7.72 (dt, >3.0, 8.8 Hz. IH). 7.61-7.48 (m, 2H), 3.59 (s. 3H), 2.38 (s, 3H), 2.24 (s, 311), 1.66 (s, 6H)

102

Compound Name	Compound No.	Ή NMR
4-[2-[[ I -( l -cyclopropy ltriazol-4-y 1)-3,3d i fl uoro-cyc lobuty 1 ] am i no]-2-oxo-acety 1 ] N-[4-fluoro-3-(trifluoromethyl)phenyl]1,3,5 -tr i methy 1 -py rro le- 2 -carboxam ide	146	'H NMR (400 MHz. CDCh) δ 7.90 (dd, 1=2.5, 5.9 Hz. IH), 7.80 (br dd. 1=3.6, 9.0 Hz, IH), 7.73-7.62 (ιη, 3H), 7.22 (t. J=9.4 Hz. IH), 3.80 - 3.67 (m, 4H), 3.44-3.21 (m, 4H), 2.36 (d. 1=15.4 Hz. 6H), 1.31-1.12 (m, 4H)
4-[2-[ [ 1 -(5-lluoro-2-pyridy 1)-1 -methy 1ethyl]amino]-2-oxo-acetyl]-N-[4-fluoro-3(trifluoromethyl)phenyl]-1,3,5-trimethylpyrrole-2-carboxamide	147	‘H NMR (400MHz. DMSO-tfc) δ 10.49 (s, IH), 9.01 (s, IH), 8.49 (d, 1=2.9 Hz. 1 H). 8.21 (dd. 1=2.3, 6.4 Hz. IH), 8.02-7.88 (m, IH), 7.72 (dt. 1=3.0, 8.8 Hz, IH). 7.61-7.45 (m, 2H), 3.58 (s. 3H), 2.38 (s, 3H), 2.24 (s, 3H), 2.07(s, IH), 1.65 (s. 6H)
N-[4-fl uoro-3-(tri fl uoromethy 1 )pheny 1 ]1,3,5-trimethy 1-4-[2-[( 1 -methy 1-1 pyrimidin-5-yl-ethyl)amino]-2-oxoacetyl]pyrrole-2-carboxamide	148	'H NMR (400MHz. DMSO-î/î) δ 10.50 (s. IH), 9.16 (s, IH), 9.07 (s, IH), 8.85 (s, 2H), 8.21 (dd, 1=2.4, 6.5 Hz. IH), 8.027.89 (m, IH), 7.52 (t. 1=9.8 Hz, IH), 3.58 (s, 3H), 2.38 (s, 3H), 2.21 (s, 3H), 1.70 (s, 6H)
N-[4-fluoro-3-(trifluoromethyl)phenyl]1,3,5-trimethyl-4-[2-[[ 1 -methy 1-1 -( 1 methy 1 i m idazol -4-y 1 )eth y 1 ]am i no ] -2-o xoacetyl]pyrrole-2-carboxamide	149	'H NMR (400MHz. DMSO-î4>) δ 10.64-10.26 (m, IH), 8.74 (s, IH), 8.21 (br d. 1=3.8 Hz, IH), 7.95 (br d. 1=3.4 Hz. IH), 7.50 (br t. 1=9.6 Hz, IH), 7.30-6.82 (m, IH), 3.88 (br s, 2H), 3.573.46 (m, 3H), 2.35-2.27 (m, 3H), 1.82-1.71 (m, 2H), 1.29-1.13 (m, 5H)
4-[2-[[3,3-difluoro-l-(4- pyridyl)cyclobutyl]amino]-2-oxo-acetyl]N-[4-fluoro-3-(trifluoromethyI)phenyl]1,3,5-trimethyl-pyrrole-2-carboxam ide	150	Ή NMR (400 MHz. CDCh) δ 8.69-8.62 (m, 2H), 7.87 (dd, 1=2.6, 6.1 Hz. IH). 7.75-7.68 (m, IH), 7.53 (s, IH). 7.42 (s. IH), 7.40-7.36 (m, 2H), 7.22 (t, 1=9.4 Hz, 1 H), 3.71 (s. 3H), 3.28 (dd. 1=10.3, 12.8 Hz. 4H), 2.34 (d, 1=12.6 Hz, 6H)

103

Compound Name	Compound No.	Ή NMR
N-(3-cyano-4-fluoro-pheny I)-1,3,5trimethyl-4-[2-oxo-2-[[3-( 1 H-pyrazol-4yl)oxetan-3-yl]amino]acetyl]pyrrole-2carboxamîde	151	Ή NMR (400MHz, DMSO-î/è) δ 12.79 (br s, IH), 10.54 (s, 111), 9.67 (s, IH), 8.21 (dd, >2.6, 5.8 Hz, IH), 7.96 (dt. >2.7, 4.5 Hz, IH), 7.67 (br s, 2H), 7.54 (t. >9.1 Hz, IH), 4.90 (d. >6.5 Hz, 2H), 4.75 (d. >6.5 Hz, 2H), 3.59 (s, 3H), 2.37 (s. 3H), 2.22 (s, 3H)
N-(3-cyano-4-fluoro-phenyl)-1,3,5trirnethyl-4-[2-[(l-rnethyl-l-pyrirnidiri-4-ylethyl)amino]-2-oxo-acetyl]pyrrole-2carboxamide	152	‘H NMR (400MHz. DMSO-Λ) δ 10.53 (s, IH), 9.23-9.08 (m, 2H), 8.77 (d. J=5.4 Hz. IH), 8.21 (dd, >2.6, 5,8 Hz, IH), 7.96 (ddd, >2.7, 4.9, 9.1 Hz, IH), 7.63-7.48 (m, 2H), 3,59 (s, 3H), 2.40 (s, 3H), 2.24 (s. 3H), 1.63 (s, 6H)
N-[4-fluoro-3-(trifluoromethyl)phenyl]1,3,5-trimethy l-4-[2-[( 1 -methy 1-1 pyrimidin-4-yl-ethyl)amino]-2-oxoacetyl]pyrrole-2-carboxamide	153	Ή NMR (400 MHz. CDCh) δ 9.19 (d, >0.9 Hz. IH), 8.74 (d, >5.5 Hz, IH), 8.22 (s. IH), 7.87 (dd, >2.6, 6.1 Hz. IH), 7.72 (td, >3.5, 8.6 Hz, IH), 7.50 (s. IH), 7.44 (dd, >1.2, 5.4 Hz, IH), 7.20 (t. >9.3 Hz. IH), 3.70 (s, 3H), 2.38 (d, >5.9 Hz, 6H), 1.81 (s. 6H)
N-(3-cyano-4-fluoro-phenyl)-4-[2-[[3-( 1 Him idazol-2-yl)oxetan-3 -y l]am ino]-2-oxoacety 1]-1,3,5-trimethy l-pyrrole-2carboxamide	154	Ή NMR (400 MHz. CDCh) δ 8.09-7.96 (m. 2H), 7.81-7.68 (m. IH), 7.54 (d. >12.4 Hz, IH), 7.23 (d. J=8.9 Hz. IH). 7.06 (s, 2H), 5.28 (d, >6.8 Hz. 2H), 5.06 (d, >6.9 Hz. 2H), 3.74 (s, 3H), 2.40 (d. >9.6 Hz. 6H), 1.26 (s, IH)
N-[4-fl uoro-3-(tri fl uoromethy 1 ) pheny 1 ]-4[2-[[3-( 1 H-imidazol-2-yl)oxetan-3yl]amino]-2-oxo-acetyl]-l,3,5-trimethylpyrrole-2-carboxamide	155	Ή NMR (400 MHz. CDCh) δ 7.99 (s, IH), 7.88 (dd. >2.3, 6.1 Hz. IH), 7.76 (br d. >8.5 Hz, IH), 7.55-7.41 (m, IH), 7.257.17 (m, 2H). 7.06 (s. 2H), 5.29 (d. >6.8 Hz, 2H), 5.05 (d, >6.6 Hz. 2H), 3.74 (s. 3H), 2.40 (d. >5.1 Hz, 6H)

104

Compound Name	Compound No.	Ή NMR
N-[4-tluoro-3-( tritluoromethy l)phenyl]-4[2-[[3-( I H-imidazol-4-yl)oxetan-3yl]amino]-2-oxo-acetyl]-l,3,5-trimethylpyrrole-2-carboxamide	I56	'H NMR (400MHz, MethanolîZ/> Ô 8.09 (dd. J=2.6, 6.3 Hz. IH), 7.93-7.84 (m, IH), 7.73 (s, IH). 7.33 (t. J=9.6 Hz. IH). 7.17 (s, IH), 5.H - 5.00 (m, 4H), 3.65 (s, 3H), 2.4I (s. 3H),2.342.21 (m. 3H)
N-(3-cyano-4-fluoro-phenyl)-4-[2-[[3-( l Hi m i d azo l -4-y l )oxetan -3 -y I ] am i no] -2-oxoacetyl]-l,3,5-trimethyl-pyrrole-2carboxamide	I57	'H NMR (300 MHz. MethanolΛ) δ 8.09 (dd, J=2.6, 6.3 Hz, IH). 7.93-7.84 (m, IH), 7.73 (s, IH), 7.33 (t, J=9.6 Hz. IH), 7.I7 (s, IH), 5.I I-5.00 (m, 4H), 3.65 (s, 3H), 2.41 (s, 3H), 2.34-2.21 (m. 3H)
N-[4-fluoro-3-(trifluoromethyl)phenyl]l ,3,5-trimethyl-4-[2-oxo-2-[[3-( I Hpyrazol-4-yl)oxetan-3- yl]amino]acetyl]pyrrole-2-carboxamide	I58	'H NMR (300 MHz. MethanolΛ) δ 8.40 (s, IH), 8.13 (dd, J=2.8, 5.6 Hz, IH), 7.92 (ddd. J=2.8, 4.7, 9.2 Hz. IH). 7.46 (d, J=0.9 Hz, IH), 7.37 (t. J=8.9 Hz, IH), 5.11-4.96 (m, 4H), 3.66 (s, 3H), 2.44 (s, 3H), 2.32 (s,3H)
N-[4-fluoro-3-(trifluoromethyl)phenyl]l .3,5-trimethy l-4-[2-[[ I -methy I-1 -(2-oxoI H-pyridin-3-yl)ethyl]amino]-2-oxoacety l ] py rro le-2 -carbox am i de	159	Ή NMR (400MHz. DMSO-î/6) δ 12.79(brs, IH), 10.50 (s, IH), 9.65 (s, IH), 8.21 (dd..7=2.5, 6.5 Hz. IH), 8.02-7.89 (m, IH), 7.78 (s, IH), 7.63-7.43 (m, 2H), 4.91 (d, .7-6.5 Hz, 2H), 4.75 (d, J=6.5 Hz. 2H), 3.59 (s, 3H), 3.37-3.28 (m, 47H), 2.37 (s, 3H), 2.23 (s, 3H)
4-[2-[[ l -( l H-benzimidazol-5-y I)-1 -methylethyl]amino]-2-oxo-acetyl]-N-(3-cyano-4fl uoro- p heny I )-1,3,5 -t ri m et hy l -py rro I e-2 carboxamide	160	Ή NMR (400MHz. DMSO-r/6) δ 11.55 (br d. J=1.6 Hz. 1 H), 10.49 (s, IH), 8.69 (s. IH), 8.21 (dd. J=2.4, 6.5 Hz. IH), 7.997.91 (m, IH), 7.52 (t. J=9.8 Hz, IH), 7.42 (dd, J=2.0, 7.0 Hz. IH). 7.30 (br d. J=5.0 Hz. IH), 6.19 (t, J=6.8 Hz. IH). 3.58 (s, 3H), 2.40 (s, 3H). 2.25 (s, 3H). 1.71 (s, 6H)

105

Compound Name	Compound No.	Ή NMR
N-(3-cyano-4-fluoro-pheny l)-1.3,5trimethy l-4-[2-[[ l -methy I-1 -(2-oxo-1Hpyridin-3-yl)ethyl]amino]-2-oxoacety I ] py rro le-2-carbo xam i de	I6l	‘H NMR (400MHz. DMSO-ifc) δ 12.57-12.27 (m. IH), 10.52 (br s. IH), 8.89 (s. IH), 8.21 (dd. J=2.4, 5.6 Hz, IH), 8.18 (s, I H). 8.03-7.90 (m, IH), 7.67-7.46 (m, 3H). 7.30 (br d, J=8.8 Hz, IH). 3.61-3.53 (m, 3H), 2.38 (s, 3H), 2.29-2.23 (m, 3H). 1.71 (s, 6H)
4-[2-[[l -( l H-benzimidazol-5-y I)-1 -methylethyl]amino]-2-oxo-acetyl]-N-(4-fluoro-3methy l-pheny I )-1,3,5-trimethy l-pyrrole-2carboxamîde	I62	Ή NMR (400MHz. DMSO-t/e) δ 11.68-11.42 (m. IH), 10.51 (br s, IH), 8.70 (s, IH), 8.21 (dd, 7=2.7, 5.8 Hz, IH), 7.97 (ddd, 7=2.8, 4.8, 9.2 Hz. 1 H), 7.54 (t. 7=9.1 Hz, IH), 7.42 (dd. 7=2.0, 7.0 Hz. IH), 7.30 (dd. 7=1,8, 6.3 Hz. IH), 6.19 (t, 7=6.7 Hz. IH), 3.58 (s, 3H), 2.40 (s, 3H), 2.25 (s, 3H), 1.71 (s, 6H)

EXAMPLE 20 Additional Compounds |0l66| The foregoing synthèses are exemplary and can be used as a starting point 5 to préparé a large number of additional compounds. Examples of compounds of Formula (I) that can be prepared in various ways, including those synthetic schemes shown and described herein, are provided below. Those skilled in the art will be able to recognize modifications of the disclosed synthèses and to devise routes based on the disclosures herein; ail such modifications and altemate routes are within the scope of the daims.

Structure	Name	Compound No.
F F	N-[4-fluoro-3- (trifluoromethyl)phenyl]l,3,5-trimethyl-4-[2-oxo-2(prop-2- ynylamino)acetyl]pyrrole-2carboxamide	1
ο χ-ν	4-[2-(allylamino)-2-oxoacetyl]-N-[4-fluoro-3(trifluoromethy l)pheny 1]- 1,3.5-triinethyl-pyrrole-2carboxamide	2

106

Structure	Naine	Compound No.
o p \ hn—/ N	N-(3-cyano-4-fluorophenyl)-l-methyl-4-[2-oxo2-(prop-2ynylamino)acetyI]pyrrole-2carboxamide	3
\ Br 0	N-(2-bromo-3-fl uoro-4pyridyl)-1,3,5-trimethyl-4[2-oxo-2-(prop-2ynylamino)acetyl]pyrrole-2carboxamide	4
F\ Br 0	4-[2-(allylamino)-2-oxoacety 1 ]-N-( 2-brom o-3fluoro-4-pyridyl)-1,3,5trimethyl-pyrrole-2carboxamide	5
wn V Xpq ° Ίΐι \ // N HN—N	N-(3-cyano-4-fluorophenyl)-4-[2-[[3,3-difluoro- 1 -(1 H-triazol-4yl)cyclobutyl|amino]-2oxo-acety 1]-1,3,5-trimethy 1pyrrole-2-carboxamide	19
V7 o hn—/ V_ i ï Fk/ F H S ' \\ N	N-(3-cyano-4-fluoropheny 1)-1,3,5-trimethy 1-4[2-oxo-2-[[(IS)-lcyc lopropy 1 prop-2 y ny 1 ]am i no jacety 1 ] py rro 1 e2-carboxamide	23b
F\Î \ / fi--Λ /--1 0 VA hn (/ \ Wn ΙΓ i \ \	N-(3-cyano-4-fluoropheny l)-4-[2-[( 1-ethynyl3,3-difluorocyclobutyl)amino]-2-oxoacety 1]-1,3,5-trimethy 1pyrrole-2-carboxamide	24
0 X'A_/N—ξ Υ—F * l K N	N-(3-cyano-4-fluorophenyl)-I,5-dimethyl-4-[2oxo-2-(prop-2ynylamino)acetyl]pyrrole-2carboxamide	27

107

Structure	Name	Compound No.
	ZRN	N-(3-cyano-4-fluoropheny l )-1,3,5-trimethy I-4[2-oxo-2-[[( l R)-1 -tertbutylprop-2ynyl]amino]acetyl]pyrrole2-carboxamide	30a
HO		4-[2-[( l -ethynyl-3-hydroxycyc lobuty I )am i no]-2-oxoacetyl]-N-[4-fluoro-3(trifluoromethyl)phenyl]1,3,5-trimethyl-pyrrole-2carboxamide	49
N	3-chloro-N-(3-cyano-4fluoro-phenyl)-4-[2-[(3,3difluoro-l-vinylcyclobutyl)amino]-2-oxo- acetyl]-l,5-dimethyl- pyrrole-2-carboxam ide	51
r\ F	I N M- '	3-chloro-N-(3-cyano-4fluoro-phenyl)-4-[2-[( 1 ethynyl-3,3-difluorocyclobutyl)amino]-2-oxoacetyl]-l,5-dimethylpyrrole-2-carboxamide	52
	N -( 3 -cy ano-4- fl uorophenyl)-4-[2-[(3,3-difluorol-vinyl-cyclobutynamino]2-oxo-acetyl]-l ,3,5trimethy !-pyrrole-2carboxamide	53
~NH /N-””''''''’ 0 C F	N-(3,4-difliiorophenyl)-4- [2-[(3-ethynyloxetan-3- y 1 )am i no] -2 -oxo-acety 1 ] - 1,3,5-trimethyl-pyrrole-2- carboxamide	86
,<y F	N-(3,4-difluorophenyl)-4[2-[(lethynylcyclohexyl)amino]2-oxo-acetyl]-1,3,5trimethyl-pyrrole-2carboxamide	87

108

Structure	Name	Compound No.
F	N-(3,4-difluorophenyl)-4[2-[( l -ethyl-1 -methyl-prop2-ynyl)amino]-2-oxoacetyl]-l,3,5-trimethylpy rro I e-2-carbo xa m i de	S8
,^/Aâ-K NH n'—\ 0 I F	4-[2-( l, I -d iethy lprop-2y ny I am i no)-2 -oxo-acety I ] N-(3,4-difluorophenyl)l ,3,5-trimethy l-pyrrole-2carboxamide	89
a y—nh n-a. ° F	N-(3,4-difluorophenyl)-4[2-( l, I -dimethy lprop-2ynylamino)-2-oxo-acetyl]l ,3,5-trimethy l-pyrrole-2carboxamide	90
. 0 Ν==\ NC	N-(3-cyano-4-fluorophenyl)-4-[2-[[l-(lHim idazol-4-y I)-1 -methylethy I ] am i no] -2-oxo-acety l ] l.3,5-trimethyl-pyrrole-2carboxamide	I04
0 N===\ f3c	N-[4-fluoro-3(trifluoromethyl)phenyl]-4[2-[[ l -( l H-im idazol-4-y ΟΙ-methy l-ethy l]amino]-2oxo-acety l]-1,3,5-trimethy Ipy rro I e-2 -carbo xam i d e	I06
.-ryV-èÂK Ν/ ' / NC o -Q	N-(3-cyano-4-fluorophenyl)-4-[2-[(4-ethynyll,I-dioxo-thian-4y I )am i no] -2-oxo-acety I ] 1,3,5-trimethyl-pyrrole-2carboxamide	108
ύ>ΠΛΚ NC	N-(3-cyano-4-fluorophenyl)- l,3,5-trimethyl-4- [2-oxo-2-[[(3R)-3- ethynyltetrahydrofuran-3yl]amino]acetyl]pyrrole-2carboxamide	lll

I09

Structure	Name	Compound No.
NC	N -( 3 -cyano-4-fl uoropheny l)-l ,3,5-trimethyl-4[2-oxo-2-[[(3S)-3ethynyltetrahydrofuran-3yl]amino]acetyl]pyrrole-2carboxamide	112
. 0 \ Λ-ΝΗ O \ / A^ / b NC 0	N-(3-cyano-4-fluoropheny I)-1.3,5-trimethyl-4[2-oxo-2- [ [(3 S )-3-ethyny Il,l-dioxo-thiolan-3y I ]am i η o ] acety I ] py rro le-2carboxamide	I I3a
. 0 iAûbC NC O	N-(3-cyano-4-fluorophenyl)-l,3,5-trimethyl-4[2-OXO-2- [ [( 3 R)-3 -ethy ny l l, l -dioxo-thiolan-3yl]amino]acetyl]pyrrole-2carboxamide	I I3b
. 0 r==\ A^A’NH yN^\ ° NC	N-(3-cyano-4-fluorophenyl)-l,3,5-trimethyl-4[2-[[ I -methy H- pyrazol-3-yl)ethyl]amino]2-oxo-acetyl]pyrrole-2carboxamide	114
. o i^X NH N-^X^ 0 f3c	N-[4-fluoro-3- (trifluoromethyl)phenyljl,3,5-trimethyl-4-[2-[[lmethyl-1 -( l H-pyrazol-3yl)ethyl]amino]-2-oxoacety l]pyrrole-2carboxamide	115
I Z Gz \=o o^=\ ——·\. ^,2.. oAi I Z	N-(3-cyano-4-fluorophenyl)-1,3,5-trimethy I-4[2-[[ l -methy l-l-(lmethylpyrazol-3yl)ethyl]amino]-2-oxoacetyl]pyrrole-2carboxamide	116
'NH / ^V· ° f3cz	N-[4-fluoro-3(trifluoromethy I )pheny l]l ,3,5-trimethy l-4-[2-[ [ l methy I-1 -( I -methylpyrazol3 -y I )ethy I ] am i no] -2-oxo-	117

HO

Structure	Naine	Compound No.
	acetyl]pyrrole-2carboxamide
. 0 NC	1 -al ly l-N-( 3 -cyano-4fluoro-phenyl)-3-methyl-4[2-oxo-2-(prop-2- ynylamino)acetyl]pyrrole-2carboxamide	118
Ci o NC	2-chloro-N-(3-cyano-4fluoro-phenyl)-1 -[2-oxo-2(prop-2-ynylamino)acetyl]6.7-dihydro-5H-pyrrolizine3-carboxamide	119
l -η Z l O J. v /-- y=° o=/ ZI	N-(3-cyano-4-fluoropheny l)-2-methy 1-1 -[2-oxo2-(prop-2ynylamino)acetyl]-6,7dihydro-5H-pyrrolizine-3carboxamide	120
	1 -[2-(al ly lam ino)-2-oxoacetyl]-N-(3-cyano-4fluoro-phenyl)-2-methyl6,7-dihydro-5H-pyrrolizine3-carboxamide	121
. 0 ,^WrVr'! \\ /Z--NH N'A 0 CH3 O	N-(3-cyano-4-fluoropheny l)-2-methy 1-1 -[2-oxo2-[[(ÎS)-2,2,2-trifluoro-lmethyl-ethyl]amino]acetyl]6,7-dihydro-5H-pyrrolizine3-carboxamide	122
(including pharmaceutically acceptable salts of any ot t	le foregoing).

EXAMPLE A

HBV-DNA Antiviral Assay using HepG2.2.l5 cells

[0167] The following assay procedure describes the HBV antiviral assay. This assay uses HepG2.2.l5 cells, which hâve been transfected with HBV genorne, and extracellular HBV DNA quantification as endpoint. Cell vîability is assessed in parallel by measuring the intracellular ATP content using the CellTiter-Glo® reagent from Promega.

[0168| On day 0, HepG2.2.l5 cells were seeded in 96-well plates at a density of 6,0 x I0⁴ cells/well (0.1 mL/well). The cells were incubated at 37°C and 5% CO2.

[0169| On day 1, the test articles were diluted and added to cell culture wells (8 concentrations, 4-fold dilution, in duplicate). GLS4, Tenofovir and Sorafenib were used as reference compounds. 100 pL of culture medium containing the compounds was added to the plate, and the final total volume per well was 200 pL. The final concentration of DMSO in the culture medium was 0.5%, The plate map of compound treatment is shown below. The cells were cultured at 37 °C and 5% CO2 for 3 days.

The plate map of compound treatment

	1	2	3	4 5 6 7	8	9	10	11	12
A		igh dose		4-fold dilution, 8 dilution points, duplicate		low dose
c	1			_____
D	compound							0.5*DMSO
E F	2 compound		—	---------------------------------------------			ETV(lpM)	control	Blanfc
G H	3	igh dose		4-fold dilution, 8 dilution points, duplicate		Lowdose

[0170| On day 4, the plates were refreshed with culture media with compounds.

[0171| On day 7, cell viability was assessed using the CelITiter-GIo®, and the cell 15 culture supernatants were collected for détermination of HBV DNA by qPCR.

HBV DNA quantification bv qPCR

[0172] Extracellular DNA was isolated with QIAamp 96 DNA Blood Kit per the manufacturer’s manual. HBV DNA was then quantified by qPCR with HBV spécifie primers and probes as specified in Table l using the FastStart Universal MasterMix from 20 Roche on an ABI-7900HT, The PCR cycle program consisted of 95°C for 10 min, followed by 40 cycles at 95°C for 15 sec and 60°C for 1 min.

Table 1: HBV DNA Primers and Probe

Items	Name	Sequence (5’->3’)
HBV Primer	HBVforward	GTGTCTGCGGCGTTTTATCA
HBVreverse	GACAAACGGGCAACATACCTT

112

HBV Probe

HBV probe

FAM-CCTCTKCATCCTGCTGCTATGCCTCATC- TAMRA

[0173] A DNA standard was prepared by dilution of the pAAV2 HBV1.3 plasmid with concentrations ranging from 10 to 1 x 107 copies/uL and used to generate a standard curve by plotting Ct value vs. the concentration of the HBV plasmid DNA standard. The 5 quantity of HBV DNA in each sample was determined by interpolating from the standard curve.

Cell viability

[0174] After harvest of the supernatants, the cell viability was detected by CelITiter-Glo® according to the manufacturer’s manual. In brief, 50 pL of fresh cell culture 10 medium was added to the culture plates, followed by addition of 50 pL CelITiter-Glo into each well. The plates were incubated at room température for 10 mins. The luminescence signal was collected on a BioTek Synergy 2 plate reader.

Data analysis

[0175] Cell viability was calculated as follows: % Cell viability = (luminescence 15 value of test sample - average luminescence value of blank) / (average luminescence value of 0.5% DMSO control - average luminescence of blank) x 100%. HBV DNA inhibition was calculated as follows; 100-(HBV DNA copy number of test sample - HBV DNA copy number of ETV)/ HBV DNA copy number of 0.5% DMSO control - HBV DNA copy number of ETV) * 100%. The CC50, ECso and ECoo values were determined by dose-response curves fitted by GraphPad Prism using log (agonist) vs. response -- Variable slope .

[0176] Compounds of Formula (I) are active against HBV as shown in Table 2, where ‘A’ indicates an EC50 < 1 nM, ‘B’ indicates an EC50 of >1 nM and < 10 nM, ‘C’ indicates an ECso > 10 nM and < 100 nM, ‘D’ indicates an ECso > 100 nM and < 1000 nM, and Έ’ indicates an EC50 > 1000 nM.

Table 2 - Activity of compounds

No.	ECso
1	B
2	B

No.	ECso
3	E
4	B

No.	ECso
5	C
6	D

No.	ECso
7	D
8	C

ll3

No.	ECso
9	B
10	C
H	A
12	D
13	B
I4	A
15	A
16	C
17a	B
17b	B
18	B
19	A
20	C
21	B
22	B
23a	A
23b	A
24	A
25	D
26	A
27	C
28a	B
28b	B
29	B
30a 30b	A
A
3la	B

No.	ECso
3 lb	B
32	B
33	B
34	A
35	A
36a	A
36b	A
37	A
38a	A
38b	A
39	A
40	A
41	B
49	A
50	A
51	A
52	A
53	B
55	A
56	A
57	A
58	B
6Ia	B
61 b	B
62	D
63a	B
63b	B

No.	ECso
64a	B
64b	B
65a	A
65b	B
66a	A
66b	B
67	C
68	A
69a	B
69b	B
70	B
7la	B
7lb	B
72a	B
72b	B
74a	B
75b	C
76a	B
76b	B
76	C
79a	B
79b	B
80a	B
80b	B
8I	B
82	B
83	B

No.	ECso
84	B
85	B
86	B
87	B
88	B
89	B
90	B
91	B
92	B
93	B
94a	C
94b	B
95a	B
95b	B
96	B
97	A
98	A
99	B
100	A
ΙΟΙ	B
102	B
103	B
104	B
105	B
106	B
107	B
108	B

l 14

No.	ECso
I09	B
I3l	B
132	B
133	B
134	B
135	B
136	B
I37	B

No.	ECso
138	B
I39	B
140	B
I4l	B
142	B
143	B
144	B
I45	B

No.	ECso
146	B
147	B
148	B
149	D
150	A
I5l	B
152	B
153	A

No.	ECso
155	B
156	A
157	B
158	A
I59	B
160	B
I6l	B
162	B

[0l77| Although the foregoing has been described in some detail by way of illustrations and examples for purposes of clarity and understanding, it will be understood by those of skill in the art that numerous and various modifications can be made without departing from the spirit of the présent disclosure. Therefore, it should be clearly understood that the forms disclosed herein are illustrative only and are not intended to limit the scope of the présent disclosure, but rather to aiso cover ail modification and alternatives coming with the true scope and spirit of the invention.

Claims (15)

1. A compound of Formula (I), or a pharmaceutically acceptable sait thereof, having the structure:

wherein:

R¹ is an unsubstituted or a substituted C2 alkenyl or an unsubstituted or a substituted C2 alkynyl, wherein when the C2 alkenyl and the C2 alkynyl are substituted, the C2 alkenyl and the C2 alkynyl are independently substituted with one or more substituents independently selected from 10 the group consîsting of halogen, an unsubstituted Cm alkyl, an unsubstituted Cm haloalkyl, an unsubstituted Cm hydroxyalkyl, an unsubstituted monocyclic C3-6 cycloalkyl and a hydroxysubstituted monocyclic C3-6 cycloalkyl;

R² and R³ are independently selected from the group consîsting of hydrogen, an unsubstituted or a substituted Ci-4 alkyl, an unsubstituted Cm haloalkyl, an unsubstituted or a 15 substituted monocyclic C3-6 cycloalkyl. an unsubstituted or a substituted monocyclic 3-6 membered heterocyclyl, an unsubstituted Cm hydroxyalkyl and an unsubstituted Cm alkoxyalkyl, wherein when the monocyclic C3-6 cycloalkyl and the monocyclic 3-6 heterocyclyl are substituted, the monocyclic C3-6 cycloalkyl and the monocyclic 3-6 heterocyclyl are independently substituted with one or more substituents independently selected from the group consîsting of halogen or 20 hydroxy, and wherein when the Cm alkyl is substituted, the Cm alkyl is substituted with one or more substituents selected from the group consîsting of a phosphate, an O-linked α-amino acid and an O-carboxy, and provided that at least one of R² and R³ is not hydrogen; or

R² and R³ are taken together along w ith the carbon to which R² and R³ are attached to form an unsubstituted or a substituted monocyclic C3-6 cycloalkyl or an unsubstituted or a substituted 25 monocyclic 3-6 membered heterocyclyl, wherein when the C3-6 cycloalkyl and 3-6 membered heterocyclyl are substituted, the C3-6 cycloalkyl and the 3-6 membered heterocyclyl are

116 independently substituted with 1 or 2 substituents independently selected from the group consisting of halogen and hydroxy;

R⁴ and R⁵ are independently hydrogen, halogen, an unsubstituted Cm alkyl, a deuterated Cι-a alkyl or an unsubstituted C2-4 alkenyl;

R⁶ is hydrogen, an unsubstituted Cm alkyl, a deuterated Ci-4 alkyl or an unsubstituted C3-4 alkenyl; and provided that at least one of R⁴, R⁵ and R⁶ is not hydrogen; or

R⁵ is hydrogen, halogen, an unsubstituted Cm alkyl or an unsubstituted C2-4 alkenyl; and R⁴ and R⁶ are taken together to form an unsubstituted or substituted 5-6 membered heterocyclic ring;

X¹ isCR^AorN;

R^7a, R^7b, R^7c and R^7d are independently hydrogen, halogen, an unsubstituted C1.4 haloalkyl, cyano or an unsubstituted Cm alkoxy;

R⁸ is -CH2OC(=O)-(an unsubstituted C1.4 alkyl), -CH2OC(=O)-O(an unsubstituted Cm alkyl), -CH2-(a-amino acid) or-Cl-b-phosphate; and

R^A is hydrogen, halogen, an unsubstituted C1-4 haloalkyl or cyano.

2. A compound of Formula (1), or a pharmaceutically acceptable sait thereof, having the structure:

R² R³ wherein

R¹ is an unsubstituted or a substituted C2 alkenyl or an unsubstituted or a substituted C2 alkynyl, wherein when the C2 alkenyl and the C2 alkynyl are substituted, the C2 alkenyl and the C2 alkynyl are independently substituted with one or more substituents independently selected from the group consisting of halogen, an unsubstituted C1.4 alkyl, an unsubstituted C1-4 haloalkyl, an unsubstituted C1-4 hydroxyalkyl, an unsubstituted monocyclic C3.6 cycloalkyl and a hydroxysubstituted monocyclic C3-6 cycloalkyl;

117

R² and R³ are independently selected from the group consisting of hydrogen, an unsubstituted or a substituted Ci-4 alkyl, an unsubstituted Cm haloalkyl, an unsubstituted or a substituted monocyclic C3-6 cycloalkyl, an unsubstituted or a substituted monocyclic 3-6 membered heterocyclyl, an unsubstituted C1-4 hydroxyalkyl and an unsubstituted Cm alkoxyalkyl, wherein when the monocyclic C3-6 cycloalky l and the monocyclic 3-6 heterocycly l are substituted, the monocyclic C3-6 cycloalkyl and the monocyclic 3-6 heterocyclyl are independently substituted with one or more substituents independently selected from the group consisting of halogen or hydroxy, and wherein when the Cm alkyl is substituted. the Cm alkyl is substituted with one or more substituents selected from the group consisting of a phosphate, an O-linked α-amino acid and an O-carboxy, and provided that at least one of R² and R³ is not hydrogen; or

R² and R³ are taken togetheralong with the carbon to which R² and R³ are attached to form an unsubstituted or a substituted monocyclic C3-6 cycloalkyl or an unsubstituted or a substituted monocyclic 3-6 membered heterocyclyl, wherein when the (m cycloalkyl and 3-6 membered heterocyclyl are substituted, the C3-6 cycloalkyl and the 3-6 membered heterocyclyl are independently substituted with l or 2 substituents independently selected from the group consisting of halogen and hydroxy;

R⁴ and R⁵ are independently hydrogen, halogen, an unsubstituted Cm alkyl, a deuterated Cm alkyl or an unsubstituted C2.4 alkenyl;

R⁶ is hydrogen, an unsubstituted Cm alkyl, a deuterated Cm alkyl or an unsubstituted Cm alkenyl; and provided that at least one of R⁴, R³ and R⁶ is not hydrogen; or

R⁵ is hydrogen. halogen, an unsubstituted Cm alkyl or an unsubstituted C2-4 alkenyl; and R⁴ and R⁶ are taken together to form an unsubstituted or substituted 5-6 membered heterocyclic ring;

X¹ isCR^AorN;

R^7a, R^7c and R^7d are each hydrogen;

R^7b is cyano;

R⁸ is hydrogen; and

R^a is hydrogen, halogen, an unsubstituted Cm haloalkyl or cyano.

3. The compound ofClaim 1 or 2, wherein R² and R³ are independently selected from the group consisting of hydrogen, an unsubstituted Cm alkyl, an unsubstituted Cm haloalkyl, an

118 unsubstituted or a substituted monocyclic C3-6 cycloalkyl, an unsubstituted or a substituted monocyclic 3-6 membered heterocyclyl, an unsubstituted Cm hydroxyalkyl and an unsubstituted Ci-s alkoxyalkyl, wherein when the monocyclic C3-6 cycloalkyl and the monocyclic 3-6 heterocyclyl are substituted, the monocyclic C3-6 cycloalkyl and the monocyclic 3-6 heterocyclyl are independently substituted with one or more substituents selected from the group consistîng of halogen or hydroxy.

4. The compound of Claim l or 2, wherein R² and R³ are taken together along with the carbon to which R² and R³ are attached to form an unsubstituted or a substituted monocyclic C3.6 cycloalkyl or an unsubstituted or a substituted monocyclic 3-6 membered heterocyclyl, wherein when the C3-6 cycloalkyl and 3-6 membered heterocyclyl are substituted, the C3-6 cycloalkyl and the 3-6 membered heterocyclyl are independently substituted with 1 or 2 substituents selected from the group consistîng of halogen and hydroxy.

5 28. A pharmaceutical composition comprising an effective amount of a compound of any one of Claims 1-27, or a pharmaceutically acceptable sait thereof, and excipient.

29. Use of a compound of any one of Claims 1-27, or a pharmaceutically acceptable sait thereof, in the préparation of a médicament for treating hepatitis B.

30. Use of a compound of any one of Claims 1-27, or a pharmaceutically acceptable

5. The compound of Claim 4, wherein the monocyclic 3-6 membered heterocyclyl is selected from the group consistîng of an unsubstituted or substituted oxetane, an unsubstituted or substituted thietane, an unsubstituted or substituted O, an unsubstituted or substituted

O , an unsubstituted or substituted , an unsubstituted or substituted o _s an unsubstituted or substituted

O and an unsubstituted or substituted O O

6. The compound of any one of Claims 1-5, wherein R⁴ is an unsubstituted Cm alkyl; R⁵ is an unsubstituted Cm alkyl; and R⁶ is an unsubstituted Cm alkyl.

7. The compound of any one of Claims 1-6, wherein X¹ is CR^A.

8. The compound of Claim 7, wherein R^A is halogen.

9. The compound of any one of Claims 1 or 3-7, wherein R^7a is hydrogen; and R^7d is hydrogen.

10 sait thereof, in the préparation of a médicament for treating hepatitis D.

31. The use of Claims 29 or 30, further comprising the use of an additional agent selected from the group consisting of an interferon, a nucleoside analog, a nucléotide analog, a sequence spécifie oligonucleotide, a nucleic acid polymer, an entry inhibitor and a small molécule immunomodulator.

10. The compound of any one of Claims 1 or 3-8, wherein R^7b is halogen, an unsubstituted Cm haloalkyl, cyano or an unsubstituted Cm alkoxy.

11. The compound of any one of Claims 1 or 3-9, wherein R^7c is halogen, an unsubstituted Cm haloalkyl, cyano or an unsubstituted Cm alkoxy.

119

12 21. A compound having the structure a pharmaceutically acceptable sait thereof. 22. A compound having the structure pharmaceutically acceptable sait thereof. 5 23. A compound having the structure 24, A compound , o AA ° ^CF CH₃ NH₃ ⁺C|- 25. A compound having the structure a pharmaceutically acceptable sait thereof. 22136 1 οΙ O=P—0 I .0 ^nh —\ ⁰ nc , or \ \ il H II o \_y~NH ⁰ S) / , or a > o AV^F . k A Λ A cf₃ o /VH / ^N\ ^H NaO-p-Q/X 0 / NaO ^CH3 having the structure 3 , or a pharmaceutically acceptable sait thereof. -y(^{0 CH3} ' \ , or

I

122

26.

A compound having the structure

or a pharmaceutically acceptable sait thereof.

12. The compound of any onc of Claims 1-11, wherein R¹ is an unsubstituted C;> alkenyl.

13. The compound of any one of Claims 1-11, wherein R¹ is an unsubstituted C? alkynyl.

14. The compound of any one of Claims 1 or 3-13, wherein R⁸ is -CH2OC(-O)- (an unsubstituted Cm alkyl), -CHzOC(=O)-O(an unsubstituted Cm alkyl) or-CH2-(a-amino acid).

15. The compound of any one of Claims 1 or 3-13, wherein R⁸ is -CHz-phosphate.

16. The compound of Claim 1, wherein:

R¹ is an unsubstituted or a substituted C2 alkynyl, wherein when the C2 alkynyl is substituted, the C2 alkynyl is substituted with one or more substituents independently selected from the group consisting of halogen, an unsubstituted Cm alkyl, an unsubstituted Cm haloalkyl, an unsubstituted Cm hydroxyalkyl, an unsubstituted monocyclic C3-6 cycloalkyl and a hydroxysubstituted monocyclic C3-6 cycloalkyl;

R² is an unsubstituted Cm alkyl;

R³ is selected from the group consisting a substituted Cm alkyl and an unsubstituted Cm hydroxyalkyl, wherein when the C1-4 alkyl is substituted, the Cm alkyl is substituted with one or more substituents selected from the group consisting of a phosphate, an O-linked α-amino acid and an O-carboxy;

R⁴ and R⁵ are each an unsubstituted Cm alkyl;

R⁶ is an unsubstituted Cm alkyl;

X¹ isCR^A;

R^7a, R^7c and R^7d are each hydrogen;

R^7b is halogen, an unsubstituted Cm haloalkyl, cyano or an unsubstituted Cm alkoxy;

R⁸ is -CH2OC(=O)-(an unsubstituted Cm alkyl), -CHiOC(=O)-O(an unsubstituted Cm alkyl), -CH2—(α-amino acid) or -CHz-phosphate; or

R^7a, R^7c and R^7d are each hydrogen;

R^7b is cyano;

R⁸ is hydrogen; and

R^A is halogen.

120

I7. The compound of Claim l, wherein:

R¹ is an unsubstituted or a substituted C2 alkynyl, wherein when the C2 alkynyl is substituted, the C2 alkynyl is substituted with one or more substituents independently selected from the group consisting of halogen, an unsubstituted C1-4 alkyl, an unsubstituted C1-4 haloalkyl, an unsubstituted Cm hydroxyalkyl, an unsubstituted monocyclic C3-6 cycloalkyl and a hydroxysubstituted monocyclic C3-6 cycloalkyl;

R² and R³ are taken togetheralong with the carbon to which R² and R³ are attached to form an unsubstituted or a substituted monocyclic 3-6 membered heterocyclyl. wherein when 3-6 membered heterocyclyl are substituted. the 3-6 membered heterocyclyl is substituted with I or 2 substituents independently selected from the group consisting of halogen and hydroxy;

R⁴ and R⁵ are each an unsubstituted Cm alkyl;

R⁶ is an unsubstituted Cm alkyl;

X¹ isCR^A;

R^7a, R^7t and R^7d are each hydrogen;

R^7b is halogen, an unsubstituted Cm haloalkyl, cyano or an unsubstituted Cm alkoxy;

R⁸ is -CH2OC(=O)-(an unsubstituted Cm alkyl), -CEEOC(=O)-O(an unsubstituted Cm alkyl), -CEE-(ct-amino acid) or-CEE-phosphate; or

R^7a, R^7c and R^7d are each hydrogen;

R^7b is cyano;

R⁸ is hydrogen; and

R^a is halogen.

18. The compound of Claim 16 or 17, wherein R² and R³ are taken together along with the carbon to which R² and R³ are attached to form an unsubstituted or a substituted oxetane.

19. The compound of any one of Claims 16-18, wherein R^7a, R^7c and R^7d are each hydrogen; R^7b is halogen, an unsubstituted C1-4 haloalkyl, cyano or an unsubstituted Cm alkoxy; and R⁸ is -CEE-phosphate.

20. The compound of any one of Claims 16-18, wherein R^7a, R^7c and R^7d are each hydrogen; R^7b is cyano; and R⁸ is hydrogen.

I

15 32. The use of Claim 31, wherein the médicament is for administration with an additional agent selected from the group consisting of an interferon, a nucleoside analog, a nucléotide analog, a sequence spécifie oligonucleotide, a nucleic acid polymer, an entry inhibitor and a small molécule immunomodulator.