OA21952A - Soybean Transgenic Event GM_CSM63770 And Methods For Detection And Uses Thereof. - Google Patents
Soybean Transgenic Event GM_CSM63770 And Methods For Detection And Uses Thereof.Info
- Publication number
 - OA21952A OA21952A OA1202400468 OA21952A OA 21952 A OA21952 A OA 21952A OA 1202400468 OA1202400468 OA 1202400468 OA 21952 A OA21952 A OA 21952A
 - Authority
 - OA
 - OAPI
 - Prior art keywords
 - seq
 - soybean
 - dna
 - csm63770
 - event
 - Prior art date
 
Links
Abstract
The invention provides a transgenic soybean event GM_ CSM63770, plants, plant cells, seed, plant parts, progeny plants, commodity products comprising event GM_ CSM63770, polynucleotides specific for defining and detecting event GM_ CSM63770 and plants, plant cells, seed, plant parts, progeny plants, and commodity products comprising event GM_ CSM63770; and methods related to detection, characterization, and selection of event GM _ CSM63770.
    Description
SOYBEAN TRANSGENIC EVENT GM_CSM63770 AND METHODS FOR DETECTION AND USES THEREOF
    CROSS REFERENCE TO RELATED APPLICATION
    [00011 This application daims the benefit of United States provisional application No. 63/355,947 filed June 27, 2022, which is herein încorporated by reference in its entirety.
    INCORPORATION OF SEQUENCE LISTING
    [0002| The sequence listing contained in the file named MONS567WO_ST26 is 341,230 bytes 10 (measured in Microsoft Windows®), was created on June 16, 2023, is filed herewith by electronic submission, and is încorporated by reference.
    FIELD OF THE INVENTION
    [0003] The invention relates to recombinant DNA molécules présent in and/or isolated from soybean event GM_CSM63770. The invention also relates to transgenic soybean plants, plant 15 parts, and seed, cells, and agricultural products containing soybean event GM_CSM63770, as well as methods of using the same and detecting the presence of soybean event GM_CSM63770. Transgenic soybean plants, plant parts, seed and cells containing soybean event GM_CSM63770 DNA exhibit résistance to insect infestations in the family Lepidoptera.
    BACKGROUND OF THE INVENTION
    [0004] Soybean (Glycine max) is an important crop and is a primary food source in many areas of the world. The methods of biotechnology hâve been applied to soybean for improvement of the agronomie traits and quality ofthe product. One such agronomie trait is insect résistance, which is accomplished through the expression of heterologous insect toxins, also known as transgenes, inserted into the genome of the soybean plant.
    [0005] There are a number of different transgenic events in soybean that hâve been described in the art that provide various types of insect résistance, particularly to Lepidopteran species, and these include MON8770I, MON8775I, and DAS8I4I9 (Lepidopteran résistant and herbicide tolérant). These transgenic events hâve been in use commercially in a variety of geographies across the globe for an extended period of time, and résistance to the expressed toxins in these events by targeted insect pests has been observed in many géographie régions where these hâve been deployed.
    |0006| Thus, there is a continuing need in the art to provide novel transgenic events in soybean that exhibit résistance to insect infestation, and preferably the novel transgenic events confer résistance to the target insects, including those races that hâve evolved résistance to the exîsting commercially deployed traits, using modes of action that are not overlapping with or similarto the modes of action previously deployed in earlier commercial embodiments. Described herein is an example of such a novel transgenic event that confers résistance to Lepidopteran infestations, including résistance to Lepidopterans that hâve evolved résistance to commercial embodiments that hâve been previously deployed.
    SUMMARY OF THE INVENTION
    [0007] In one embodiment, the invention provides a novel transgenic soybean event GM_CSM63770 - that provides insecticidal control over Lepidopteran pests of soybean. In a further embodiment, the invention also provides transgenic plants, plant cells, seed, plant parts, and commodity products comprising soybean event GM_CSM63770 DNA. The event contains novel DNA that is spécifie and unique to this GM CSM63770 event and comprises the inserted transgenic DNA segment and the novel DNA segments that are adjacent to the inserted DNA segment. These adjacent segments are described herein as the junction sequences which correspond to the DNA sequences extending along the chromosomal DNA adjacent to the chromosomal breakpoint at which the inserted DNA has been introduced. In another embodiment, the invention provides polynucleotides spécifie and unique to, and capable of use for identiiy ing and detecting the presence of soybean event GM_CSM63770 DNA in a bîological sample containing soybean tissue, as well as plant, plant cells, seed, plant parts, progeny plants, and commodity products comprising soybean event GM_CSM63770 DNA. In yet another embodiment. methods related to selecting plant cells, plants and seed comprising the soybean event GM_CSM63770 DNA, and détection of the presence (or absence) of soybean event GM CSM63770 DNA in a sample are provided, such methods providing for the investigator to
    
    confirm that the event DNA is, or is not, présent in a particular sample subjected to the method or to methods reliant upon nucléotide sequences that are the subject of this disclosure.
    [0008] Thus, in one aspect the invention provides a recombinant DNA molécule comprising a nucléotide sequence selected from the group consisting of SEQ ID NO: I, SEQ ID NO:2, SEQ ID 5 NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:lO, and a complété complément thereof.
    |0009] In one embodiment, the recombinant DNA molécule is derived from soybean event GM_CSM63770 in a sample of seed containing the event and which contains the corresponding unique and spécifie DNA segments corresponding to soybean event GM_CSM63770 seed which has been deposited as ATCC Accession No. PTA-126048.
    |0010] Another aspect of the invention provides a DNA molécule comprising a polynucleotide segment ofsufficient length to function as a DNA probe that hybridizes speciftcally understringent hybridization conditions with soybean event GM_CSM63770 DNA in a sample, wherein detecting hybridization of the DNA probe to the DNA in the sample under the stringent hybridization conditions is diagnostic for, or characteristic of, confirming the presence of soybean event GM_CSM63770 DNA in that sample. In certain embodiments, the sample comprises a soybean plant, soybean plant cell, soybean seed, soybean pollen, soybean plant part, soybean progeny plant, process soybean seed, animal feed comprising soybean, soybean oil, soybean meal, soybean flour, soybean flakes, soybean bran, soybean biomass, and fuel products produced using soybean and soybean parts, provided that such soybean and soybean products contain détectable amounts of soybean event GM CSM63770 DNA or détectable amounts of the novel toxin proteins produced by soybean plants, cells and the like, to contain the soybean event GMCSM63770.
    |0011I Yet another aspect of the invention provides a first DNA molécule and a second DNA molécule different from the first DNA molécule, i.e. a pair of DNA molécules that function as
    DNA primers when used together in an amplification reaction containing the appropriate reagents necessary for conducting a DNA amplification procedure with a sample containing soybean event GM_CSM63770 template DNA to produce an amplicon diagnostic for, or characteristic of, the presence of said soybean event GM_CSM63770 DNA in said sample. The amplicon produced will contain at least the nucléotide sequence selected from the group consisting of SEQ ID NO:1,
    SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10, and the complété complément thereof.
    |0012] Another embodiment of the invention is a method of detecting the presence of a DNA segment diagnostic for confirming the presence or absence of soybean event GM_CSM63770 in a sample. In certain embodiments, the method is conducted by contacting the sample with a probe DNA molécule that hybridizes specifically to DNA uniquely associated with soybean event GM_CSM63770, then subjecting the sample and the probe DNA molécule to stringent hybridization conditions to allow the probe to bind to the appropriate complément segment of soybean event GM_CSM63770 spécifie DNA. Detecting hybridization of the probe DNA molécule to the DNA in the sample is conclusive, diagnostic, determinative, that the DNA in the sample contains the soybean event GM_CSM63770 DNA.
    [0013] Yet another embodiment of the invention is a method of detecting the presence of a DNA segment diagnostic for, or characteristic of, soybean event GM_CSM63770 DNA in a sample containing soybean DNA, In one embodiment. the method comprises the steps of contacting a biological sample with a pair of DNA molécules that function as thermal amplification primers spécifie for amplification of a segment of the soybean event GM_CSM63770 DNA; performing an amplification reaction sufficient to produce the DNA amplicon; and detecting the presence of the DNA amplicon in the reaction. Détection of the DNA amplicon is diagnostic for, or characteristic of, the presence of a détectable amount ofthe soybean event GM_CSM63770 DNA in the sample, and the amplicon will contain ail or a portion of the nucléotide sequence targeted for amplification that lies between the primer hybridization positions, such portion of the nucléotide sequence targeted for amplification beîng selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10, and the complété complément thereof. |0014] Another embodiment of the invention is a method of detecting the presence of protein diagnostic for or characteristic of soybean event GM_CSM63770 in a sample, said method comprising: (a) contacting said sample with a first and second monoclonal antibody, wherein the first monoclonal antibody binds specifically to Cry 1 A.2 and the second monoclonal antibody binds specifically to CrylB.2 in an immunoassay; (2) incubating the immunoassay for a sufficient amount of time to allow for binding of the monoclonal antibodies; and (3) detecting the presence
    I
    
    of the CrylA.2 and CrylB.2 proteins in said iinmunoassay, wherein said détection is diagnostic for, or characteristic of, the presence of said soybean event GM_CSM63770 DNA in said sample. The assay can be selected from the group consisting of an Enzyme-linked Immunosorbent Assay (ELISA), a Radioîmmunoassay, and a Latéral flow immunochromatographic assay.
    (0015| Another embodiment of the invention is a soybean plant, soybean plant part, soybean cell, or part thereof comprising a recombinant polynucleotide molécule comprising the nucléotide sequence selected from the group consisting of SEQ ID NO: I, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:IO, and the complété complément thereof. These SEQ ID NOs are each the spécifie and sélective DNA that defmes the soybean event GM_CSM63770. This soybean plant, soybean plant part, soybean cell, or part thereof is insecticidal when provided in the diet of a Lepidopteran insect pest. Lepidopteran insect target pests intended to be controlled include Soybean podworm (Helicoverpa zea), Soybean looper (Chrysodeixis includens), Velvet bean Caterpillar (Anticarsia gemmatalis), Southern armywOrm (Spodoptera eridania), Black armyworm (Spodoptera cosmioides), South American podworm (Helicoverpa gelotopoeon), Sunflower looper (Rachiphtsia nu), Bean shoot moth (Crocidosema aporema), Green cloverworm (Hypena scabra) and Lesser cornstalk borer (Elasmopalpus lignosellus). In addition, the soybean plant can be further defined as progeny of any génération of a soybean plant comprising the soybean event GMCSM63770, provided that the progeny also contains the spécifie and sélective DNA that defmes the soybean event GM_CSM63770.
    [0016] Yet another embodiment of the invention is a method for protecting a soybean plant from insect infestation, wherein said method comprises providing in the diet of a Lepidopteran insect pest an insecticidally effective amount of cells or tissue of the soybean plant comprising soybean event GM_CSM63770. Contemplated Lepidopteran insect pests include Soybean podworm (Helicoverpa zea), Soybean looper (Chrysodeixis includens), Velvet bean Caterpillar (Anticarsia gemmatalis), Southern armywOrm (Spodoptera eridania), Black armyworm (Spodoptera cosmioides), South American podworm (Helicoverpa gelotopoeon), Sunflower looper (Rachiplusia nu), Bean shoot moth (Crocidosema aporema), Green cloverworm (Hypena scabra) and Lesser cornstalk borer (Elasmopalpus lignosellus).
    
    |00171 Another embodiment of the invention is a method of producing an insect résistant soybean plant comprising: a) manually Crossing by conventional breeding, two different soybean plants to produce progeny, wherein at least one of the two different soybean plants contains the soybean event GM_CSM63770 DNA; b) confirming in the seed arising from the breeding activity, and in 5 the progeny plants and tissue grown from such seed, the presence of a DNA segment diagnostic for, or characteristic of, soybean event GM_CSM63770; and c) selecting the progeny comprising the soybean event GM_CSM63770 DNA. Such seed and progeny are Lepidopteran résistant soybean plants.
    [0018] A further embodiment of the invention is a soybean seed, nonliving plant material, or a 10 microorganism comprising a détectable amount of the nucléotide sequence selected from the group consisting of SEQ ID NO: I, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10, or complété compléments thereof.
    |00191 Yet another embodiment is a commodity soybean product comprising a détectable amount 15 of a DNA molécule unique to soybean event GM_CSM63770, wherein the molécule comprises a nucléotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10. Contemplated commodity soybean products include, but are not limited to, whole or processed soybean seed, animal feed comprising soybean, soybean oil, soybean meal, 20 soybean flour, soybean flakes, soybean bran, soybean biomass, and fuel products produced using soybean and soybean parts.
    |0020| Another embodiment of the invention is a soybean plant, soybean plant part, or soybean seed thereof comprising DNA functional as a template when tested in DNA amplification method producing an amplicon diagnostic for, or characteristic of, the presence of soybean event 25 GMCSM63770 DNA.
    [0021] Yet another embodiment of the invention is a method of determining the zygosity of a soybean plant or soybean seed comprising DNA descriptive of the soybean event GM_CSM63770. The zygosity is determined in a sériés of consecutive steps. In the first step, a sample comprising soybean DNA is contacted with a first primer pair that is capable of producing an amplicon 30 diagnostic for, or characteristic of, DNA that is descriptive of and présent exclusively in soybean
    
    event GMCSM63770. Then the sample comprising the soybean DNA is contacted with a second primer pair that is designed to produce an amplicon of an internai standard known to be singlecopy and homozygous in the soybean plant. The method additionally includes contacting the DNA sample with a probe set which contains at least a first probe that specifîcally hybridizes the allele of soybean event GM_CSM63770, and a second probe that specifically hybridizes to the internai standard genomic DNA known to be single-copy and homozygous in the soybean plant. The method also includes a DNA amplification reaction is performed using real-time PCR and determining the cycle thresholds (Ct values) of the amplicon corresponding the allele of soybean event GM_CSM63770 and the single-copy, homozygous internai standard. After the amplification, the différence (ACt) between the Ct value of the single-copy. homozygous internai standard amplicon, and the Ct value ofthe allele for soybean event GM_CSM63770 amplicon may be calculated. In one embodiment, zygosity is determined wherein a ACt of about zéro (0) indicates homozygosity of the inserted T-DNA of soybean event GM_CSM63770 and a ACt of about one ( I ) indicates heterozygosity of the inserted T-DNA of soybean event GM CSM63770.
    In certain embodiments of this method, the primer pairs are selected from the group consisting of SEQ ID NO: 14 combined with SEQ ID NO: 15, and SEQ ID NO: 17 combined with SEQ ID NO: 18; and wherein the probes are SEQ ID NO: 16 and SEQ ID NO: 19. In yet another embodiment of this invention the ACt of about one ( I ) indicating heterozygosity of the inserted T-DNA of corn event MON95275 is in the range of 0.75 to 1.25. In certain embodiments, a ACt of about zéro (0) may be about 0, 0.05, 0.1, 0.15, 0.2, or 0.25, in other embodiments, a ACt of about one ( 1 ) may be about 0.75, 0.8, 0.85, 0.9, 0.95, 1.0, 1.05, 1.1, 1.15, 1.2, or 1.25. In a further embodiment. a ACt of about one (1) may be in the range of0.75 to 1.25, 0.8 to 1.25, 0.85 to 1.25, 0.9 to 1.25, 0.95 to
    1.25, 1.0 to 1.25, 1.05 to 1.25, 1.1 to 1.25, 1.15 to 1.25, 1.2 to 1.25, 0.75 to 1.2, 0.8 to 1.2, 0.85 to
    1.2, 0.9 to 1.2, 0.95 to 1.2, 1.0 to 1.2, 1.05 to 1.2, 1.1 to 1.2, 1.15 to 1.2, 0.75 to 1.15, 0.8 to 1.15,
    0.85 to 1.15, 0.9 to 1.15, 0.95 to 1.15, 1.0 to 1.15, 1.05 to 1.15, 1.1 to 1.15,0.75 to 1.1,0.8 to 1.1,
    0.85 to 1.1,0.9 to 1.1,0.95 to 1.1, 1.0 to 1.1. 1.05 to 1.1, 0.75 to 1.05, 0.8 to 1.05, 0.85 to 1.05,0.9 to 1.05, 0.95 to 1.05, 1.0 to 1.05, 0.75 to 1.0, 0.8 to 1.0, 0.85 to 1.0, 0.9 to 1.0, 0.95 to 1.0, 0.75 to 0.95, 0.8 to 0.95, 0.85 to 0.95, 0.9 to 0.95, 0.75 to 0.9, 0.75 to 0.85, 0.75 to 0.8, 0.8 to 0.9, 0.8 to 0.85, or 0.85 to 0.9.
    
    [002 2] A further embodiment of the invention is a method of determining the zygosity of a soybean plant, soybean seed, soybean pollen, ovum, or cell, in which each such biological component suspected of containing soybean event GM_CSM63770 DNA is subjected to the foliowing method: a) contacting a sample containing DNA obtained from the suspect biological component with at least two different sets of primers, (i) in which a first primer pair eonsisting of a first primer and a second primer different from the first, when used in an amplification reaction together with soybean DNA, are capable of producing a first amplicon diagnostic for, or characteristic of, the presence of soybean event GM_CSM63770 DNA in the sample, and (ii) a second primer pair eonsisting of the first primer and a third primer different from the first primer and from the second primer, when used in an amplification reaction together with soybean DNA, are capable of producing a second amplicon diagnostic for, or characteristic of, native soybean genomic DNA which does not contain or include DNA spécifie for the soybean event GM_CSM63770; b) performing a nucleîc acid amplification reaction with the sample and the two primer pairs; c) detecting in the nucleîc acid amplification reaction the first amplicon diagnostic for, or characteristic of, soybean event GM_CSM63770, or the second amplicon diagnostic for, or characteristic of, native soybean genomic DNA not comprising soybean event GM_CSM63770, wherein the presence of only the first amplicon diagnostic of, or characteristic of, a homozygous soybean event GMCSM63770 DNA in a sample, and the presence of both the first amplicon and the second amplicon is diagnostic of, or characteristic of, a soybean plant heterozygous for soybean event GM_CSM63770 allele; or b) contacting a sample comprising soybean DNA with a probe set which contains at least a first probe that specifically hybridizes to soybean event GM_CSM63770 DNA and at least a second probe that specifically hybridizes to soybean genomic DNA across the segment ofchromosomal DNA that was disrupted by insertion of the heterologous DNA of soybean event GM CSM63770 and which does not hybridize to soybean event
    GM_CSM63770 DNA; i) hybridizing the probe set with a sample under stringent hybridization conditions, wherein detecting hybridization of only the first probe under the hybridization conditions is diagnostic for, or characteristic of, a homozygous allele of soybean event GM_CSM63770 DNA in the sample, and wherein detecting hybridization of both the first probe and the second probe under the hybridization conditions is diagnostic for, or characteristic of, a heterozygous allele of soybean event GM_CSM63770 in said sample. In one embodiment of this method, the set of primer pairs comprises SEQ ID NO: 14 combined with SEQ IDNO: 15, and SEQ ID NO:20 combined with SEQ ID NO:I5. In another embodiment of this method. the probe set comprises SEQ ID NO: 16 and SEQ ID NO:21.
    |OÜ23] Yet another embodiment ofthe invention are soybean plants, plant cells, pollen, plant parts, and seed are provided which comprise a recombinant DNA construct integrated in chromosome 19. The recombinant DNA construct confers résistance to Lepidopteran insect pest species. The recombinant DNA construct is integrated in a position of said chromosome flanked by at least 50 contiguous nucléotides of SEQ ID NOs: 11 or 36 and 50 contiguous nucléotides of SEQ ID NOs: 12 or 37. The at least 50 contiguous nucléotides of SEQ ID NO:l l can comprise one or more nucléotide sequences selected from SEQ ID NOs: 118-!37. The at least 50 contiguous nucléotides of SEQ ID NO:36 can comprise one or more nucléotide sequences selected from SEQ ID NOs:38l 17. The at least 50 contiguous nucléotides of SEQ ID NO: 12 can comprise on or more nucléotide sequences selected from SEQ ID NOs: 138-157. The at least 50 contiguous nucléotides of SEQ ID NO:37 can comprise one or more nucléotide sequences selected from SEQ ID NOs: 158-237.
    [0024] The forgoing and other aspects of the invention will become more apparent from the following detailed description.
    BRIEF DESCRIPTION OF THE DRAWINGS |0025] Figure I is a graphical depiction of the orientation and alignment of the DNA elements/segments that are présent within the nucléotide sequence of SEQ ID NO: 10 represented in the drawing as [10], which is the sequence of the inserted transgenic DNA and adjacent 5' and 3' sequences of the soybean genome présent within the soybean event GM CSM63770. SEQ ID NO:l is represented by [I] and is a fifty (50) nucléotide segment spanning twenty five (25) nucléotides of the inserted DNA and twenty five (25) nucléotides of the arbitrarily assigned 5’ soybean chromosomal DNA segment adjacent to the inserted DNA. SEQ ID NO:2 is represented by [2] and is a fifty (50) nucléotide segment spanning twenty five (25) nucléotides ofthe inserted DNA and twenty five (25) nucléotides of the arbitrarily assigned 3’ soybean chromosomal DNA segment adjacent to the inserted DNA. SEQ ID NO:l is embedded within SEQ ID NO:3 represented by [3], which is a one hundred (100) nucléotide segment spanning fifty' (50) nucléotides of the inserted DNA and fifty (50) nucléotides of the arbitrarily assigned 5’ soybean
    
    chromosomal DNA segment adjacent to the inserted DNA, SEQ ID NO:2 is embedded within SEQ ID NO:4 represented by [4], which is a one hundred ( 100) nucléotide segment spanning fifty (50) nucléotides of the inserted DNA and fifty (50) nucléotides of the arbitrarily assigned 3’ soybean chromosomal DNA segment adjacent to the inserted DNA. SEQ ID NO:5 is represented by [5], which is two hundred (200) nucléotides in length, and contains SEQ ID NO:3, and spans one hundred (100) nucléotides of the inserted DNA and one hundred ( ! 00) nucléotides of the arbitrarily assigned 5’ soybean chromosomal DNA segment adjacent to the inserted DNA. SEQ ID NO:6 is represented by [6], which is two hundred (200) nucléotides in length, contains SEQ ID NO:4, and spans one hundred (100) nucléotides of the inserted DNA and one hundred (I00) nucléotides of the arbitrarily assigned 3’ soybean chromosomal DNA segment adjacent to the inserted DNA. [7] is représentative of SEQ ID NO:7 corresponding to one thousand (1,000) consecutive nucléotides of the soybean genome DNA at the arbitrarily assigned 5’ end of the inserted DNA, and one hundred eighty-one (181) consecutive nucléotides of the adjacent inserted transgenic DNA. [8| is représentative of SEQ ID NO:8 corresponding to one thousand (1,000) consecutive nucléotides of the adjacent soybean genome DNA at the arbitrarily assigned 3’ end of the inserted DNA and one hundred ninety two (192) consecutive nucléotides of the 3’ end of the inserted transgenic DNA. [9] is représentative of SEQ ID NO:9 and is the full length nucléotide segment of the inserted transgenic DNA. The arrows, and the labels below each arrow, represent the orientation of the direction of transcription and translation, as applicable, from the applicable expression éléments that are positioned within the two cassettes within the inserted DNA. RB and LB represent the positions of the right and left borders of the Agrobacterium double border mediated transformation vector, letter P represents the positions of the promoter éléments in the respective constructs, letter L represents the positions of leader sequences (5 ' untranslated régions, 5'UTR) in the respective constructs, letter I represents the position of the intron sequence in the respective construct, the letter T represents the positions of the transcription termination sequences (3' untranslated régions, 3'UTR) in the respective constructs. Eléments from a P to the immediately following T represented in the graphie depiction at [9] and at [10] each represent a construct. The construct at the left side of Figure 1 encodes a pest toxic Cry 1 A.2, and the construct at the right side of Figure 1 encodes a Cry 1 B.2. Cryl A.2 and Cry IB.2 are each a different unique toxins, exhibiting less than 45% amino acid sequence identity to each other, each are toxic to
    
    Lepîdopteran pests, and each toxin exhibits a different mode of action relative to the other. The position within the transgenic inserted DNA of each of the genetic éléments involved in expression ofthese respective toxin proteins are specified in Table I. [Il] represents SEQ ID NO:11 and illustrâtes the position of the soybean genome DNA flanking the 5' end ofthe inserted DNA. [12] 5 represents SEQ ID NO: 12 and illustrâtes the position of the soybean genome DNA flanking the 3' end of the inserted DNA. [14] represents SEQ ID NO: 14 or primer SQ13805. [15] represents SEQ ID NO: 15, or primer SQ51400). These are described for use together, as a primer pair that can be applied to a sample containing event GM_CSM63770 DNA that. when used in a thermal amplification reaction, produces an amplicon of one hundred thirty four (134) nucléotides 10 containing the 3’ end insert/genome junction, the arrows showing the approximate hybridization position within [10] and the direction in which transcription proceeds during the amplification cycles. [16] represents SEQ ID NO: 16 or probe PB4832, which binds (or hybridizes to) an amplicon produced using. for example, primer [14] and [15] together in an amplification reaction with soybean event GM_CSM63770 DNA as template, for detecting the presence of the soybean 15 event GM_CSM63770 DNA in a sample. [20] represents SEQ ID NO:20 or primer
    GM_WT63770F. [20] is a primer that binds to (or hybridizes to) the soybean genome DNA that is adjacent 5' to the inserted DNA, and when combined with [15] (SEQ ID NO: 15, primer SQ5I400) in a thermal amplification reaction together with conventîonal soybean DNA as template lacking or devoid of soy bean event GM_CSM63770 DNA, produces an amplicon of one 20 hundred thirty six (136) nucléotides containing undisrupted soybean genome DNA, and détection of that amplicon is représentative of a sample which does not contain the soybean transgenic event GMCSM63770 DNA at that chromosomal locus. Probe GMWT63770PB (SEQ ID NO:2I) is représentative of a probe that would bind (or hybridize to) the amplicon produced using primers [20] and [15], for detecting an allele lacking, or devoid of, event GM_CSM63770 DNA. Probe 25 GM WT63770PB hybridizes to the 3’ terminal 9 nucléotides of the 5' genomic flanking DNA, the 14 nucléotides of the wild-type allelic DNA that was deleted during insertion of the T-DNA in soybean event GM_CSM63770, and the 5’ 2 nucléotides of the 3' genomic DNA flanking the DNA corresponding to the transgenic inserted DNA described herein as event GM_CSM63770.
    BRIEF DESCRIPTION OF THE SEQUENCES
    [0026| SEQ ID NO:1 is a 50-nucleotide sequence representing the 5'junction région of soybean genomic DNA and the integrated transgenic expression cassette (25 nucléotides soybean genome DNA at the 5' end of SEQ ID NO: I, 25 nucléotides transgenic inserted DNA at the 3 ' end of SEQ ID NO: I ), and can be identified within SEQ ID NO: 10 at nucléotide positions 976-1,025.
    |0027| SEQ ID NO:2 is a 50-nucleotide sequence representing the 3' junction région of the integrated transgenic expression cassette and the soybean genomic DNA (25 nucléotides transgenic inserted DNA at the 5’ end of SEQ ID NO:2, 25 nucléotides soybean genome DNA at 3' end of SEQ ID NO:2), and can be identified within SEQ ID NO: 10 at nucléotide positions 13,216-13.265.
    [0028] SEQ ID NO:3 is a 100-nucleotide sequence representing the 5'junction région of soybean genomic DNA and the integrated transgenic expression cassette (50 nucléotides soybean genome DNA at the 5' end of SEQ ID NO:3, 50 nucléotides transgenic inserted DNA at the 3' end of SEQ ID NO:3), and can be identified within SEQ ID NO: 10 at nucléotide positions 951 -1,050.
    |0029J SEQ ID NO:4 is a 100-nucleotide sequence representing the 3' junction région ofthe integrated transgenic expression cassette and the soybean genomic DNA (50 nucléotides transgenic inserted DNA at the 5' end of SEQ ID NO:4, 50 nucléotides soybean genome DNA at 3' end of SEQ ID NO:4), and can be identified within SEQ ID NO: 10 at nucléotide positions 13,191-13,290.
    [0030] SEQ ID NO:5 is a 200-nucleotide sequence representing the 5' junction région of soybean genomic DNA and the integrated transgenic expression cassette (100 nucléotides soybean genome DNA at the 5' end of SEQ ID NO:5, 100 nucléotides transgenic inserted DNA at the 3' end of SEQ ID NO:5), and can be identified within SEQ ID NO: 10 at nucléotide positions 901-1,100.
    [0031] SEQ ID NO:6 is a 200-nucleotide sequence representing the 3' junction région of the integrated transgenic expression cassette and the soybean genomic DNA (100 nucléotides transgenic inserted DNA at the 5' end of SEQ ID NO:6, 100 nucléotides soybean genome DNA at 3' end of SEQ ID NO:6), and can be identified within SEQ ID NO:10 at nucléotide positions 13,141-13.340.
    [0032] SEQ ID NO:7 is a 1,181-nucléotide sequence representing the 5' junction région of soybean genomic DNA and the integrated transgenic expression cassette (1,000 nucléotides soybean genome DNA at the 5' end of SEQ ID NO:7, 181 nucléotides soybean genome DNA at 3' end of SEQ ID NO:7) and can be identifîed within SEQ ID NO: 10 at nucléotide positions I 1,181.
    [0033] SEQ ID NO:8 is a 1,192-nucleotide sequence representing the 3' junction région of the integrated transgenic expression cassette and the soybean genomic DNA (192 nucléotides transgenic inserted DNA at the 5' end of SEQ ID NO:6, 1000 nucléotides soybean genome DNA at 3' end of SEQ ID NO:6), and can be identifîed within SEQ ID NO: 10 at nucléotide positions 13,049-14.240.
    [0034] SEQ ID NO:9 is a 12,240-nucleotide sequence corresponding to the transgenic inserted TDNA of soybean event GM_CSM63770, and can be identifîed within SEQ IDNO: 10 at nucléotide positions 1,001-13,240.
    [0035] SEQ ID NO: 10 is a 14,240-nucleotide sequence corresponding to the contig nucléotide sequence of the 5' genomic flanking DNA nucléotide sequence, the inserted T-DNA nucléotide sequence in event GM_CSM63770, and the 3’ genomic flanking DNA nucléotide sequence; and includes SEQ ID NO:1 1 (nucléotides 1-1,1000), SEQ ID NO:9 (nucléotides 1,001-13.240), and SEQ ID NO: 12 (nucléotides 13,241-14,240).
    [0036| SEQ ID NO:11 is a 1,000-nucleotide sequence representing the 5' flanking soybean genomic DNA up to the inserted T-DNA, and can be identifîed within SEQ ID NO: 10 at nucléotide positions 1-1,000.
    [0037] SEQ ID NO: 12 is a 1,000-nucleotide sequence representing the 3' flanking soybean genomic DNA after the inserted T-DNA, and can be identifîed within SEQ ID NO: 10 at nucléotide positions 13,241-14,240.
    [0038] SEQ ID NO: 13 is a 12,629-nucleotide sequence representing the transgene cassette comprised within the binary plasmid transformation vector used to transform soybean to produce soybean event GM_CSM63770.
    [0039] SEQ ID NO: 14 is a 26-nucleotide sequence corresponding to a thermal amplification primer referred to as SQ13805 which can be used to identily soybean event GM_CSM63770 DNA in a sample, and is identical to the nucléotide sequence corresponding to positions 13,177-13,202 of SEQID NO: 10.
    [0040] SEQ ID NO: 15 is a 31-nucléotide sequence corresponding to a thermal amplification primer referred to as SQ5 1400 which can be used to identify soybean event GM CSM63770 DNA in a sample, and is identical to the reverse complément ofthe nucléotide sequence corresponding to positions 13,280-13,310 of SEQ IDNO:10.
    (0041] SEQ ID NO: 16 is a 16-nucleotide sequence corresponding to a probe referred to as PB4832 used to identify soybean event GM_CSM63770 DNA in a sample, and is identical to the nucléotide sequence corresponding to positions 13,204-13,219 of SEQ ID NO: 10.
    (0042] SEQ ID NO: 17 is a 20-nucleotide sequence corresponding to a thermal amplification primer referred to as SQ549 used as an internai control for the event and zygosity assay for soybean event GM_CSM63770 and hybridizes to a région ofthe soybean genome.
    [0043| SEQ ID NO: 18 is a 20-nucleotide sequence corresponding to a thermal amplification primer referred to as SQ546 used as an internai control for the event and zygosity assay for soybean event GM_CSM63770 and hybridizes to a région of the soybean genome.
    [0044] SEQ 1D NO: 19 is a 28-nucleotide sequence corresponding to a probe referred to as PB0004 used as an internai control for the event and zygosity assay for soybean event GM_CSM63770 and hybridizes to a région of the soybean genome.
    [0045] SEQ ID NO:20 is a 25-nucleotide sequence corresponding to a thermal amplification primer referred to as GMWT63770F used in the zygosity assay for soybean event GM_CSM63770 and hybridizes to the 5' genomic Banking DNA, and is identical to the nucléotide sequence corresponding to positions 949-971 of SEQ 1D NO: 10.
    [0046| SEQ ID NO:21 is a 25-nucleotide sequence corresponding to a probe referred to as GM_WT63770PB used in the zygosity assay for soybean event GM_CSM63770 and hybridizes to the last 9 nucléotides ofthe 5' genomic flanking DNA, the 14 nucléotides ofthe wild-type allelic DNA that was deleted during insertion of the T-DNA in soybean event GM_CSM63770, and the first 2 nucléotides of the 3' genomic flanking DNA.
    [0047] SEQ ID NO:22 is a 27-nucleotide sequence corresponding to an originator guide RNA récognition site (OgRRS), OgRRS_5-l comprised of a Cas 12a protospacer adjacent motif (PAM) site operably linked to a guide-RNA hybridization site.
    [0048] SEQ ID NO:23 is a 27-nucleotide sequence corresponding to an OgRRS, OgRRS_5-2.
    (0049] SEQ ID NO:24 is a 27-nucleotide sequence corresponding to an OgRRS, OgRRS_5-3.
    [0050] SEQ ID NO:25 is a 27-nucleotide sequence corresponding to an OgRRS, OgRRS_3-l.
    [0051] SEQ ID NO:26 is a 27-nucleotide sequence corresponding to an OgRRS, OgRRS ln-1.
    [0052] SEQ ID NO:27 is a 27 nucléotide sequence corresponding to an OgRRS, OgRRS_In-2.
    |0053| SEQ ID NO:28 is a 51-nucléotide sequence corresponding to a guide-RNA (gRNA), gRNA_OgRRS_5-l.
    |0054J SEQ ID NO:29 is a 51-nucléotide sequence corresponding to a gRNA, gRNA_OgRRS_52.
    [0055] SEQ IDNO:30 îsa 51-nucléotide sequence corresponding to a gRNA, gRNA_OgRRS_53.
    |0056| SEQ ID NO:3 1 is a 51-nucleotide sequence corresponding to a gRNA, gRNA_OgRRS_3I.
    [0057] SEQ ID NO:32 is a 51 -nucléotide sequence corresponding to a gRNA, gRNA_OgRRS_ln1,
    [0058[ SEQ ID NO:33 is a 51 -nucléotide sequence corresponding to a gRNA, gRNA_OgRRS_ln2.
    [0059] SEQ1DNO:34 is a sequence of a synthetic DNA codîng sequence designed for expression in a plant cell encoding a nuclear targeted Casl2a CRISPR-associated protein.
    |0060] SEQ ID NO:35 is an amino acid sequence ofa nuclear targeted Cas 12a CRISPR-associated protein.
    [0061] SEQ ID NO:36 is a 5,000-nucleotide sequence representing soybean genomic DNA that flanks the transgenic insert at the 5 end of the insert. Nucléotides 4,001-5,000 of SEQ ID NO:36 are identical to nucléotides 1-1,000 of SEQ ID NO: I 1.
    |0062] SEQ ID NO:37 is a 5,000-nucleotide sequence representing soybean genomic DNA that flanks the transgenic insert at the 3' end ofthe insert. Nucléotides 1-1,000 of SEQ ID NO:99 are identical to nucléotides 1—1000 of SEQ NO: 12. The remaining nucléotides of SEQ ID NO:99 (nucléotides 1,001—5,000) are based on the genomic sequence of the Williams 82 soybean cultivar.
    
    (0063] SEQ ID NOs:38-117 are additional 50-nucleotide sequence in the 5' flank genomic sequence of event GM CSM63770 based on the genomic sequence of the Williams 82 soybean cultivar.
    (0064] SEQ ID NOs:l 18-137 are 50-nucleotide sequence in the 5' flank genomic sequence of 5 event GM_CSM63770.
    (0065] SEQ ID NOs: 138-157 are 50-nucleotide sequence in the 3' flank genomic sequence of event GM_CSM63770.
    [0066] SEQ ID NOs:158-237 are additional 50-nucleotide sequence in the 3' flank genomic sequence of event GM_CSM63770 based on the genomic sequence of the Williams 82 soybean 10 cultivar.
    DETAILED DESCRIPTION |0067] The présent invention provides a transgenic soybean event GM CSM63770 that achieves insecticidal control over certain Lepidopteran larval pests of soybean by expression of insecticidal toxins CrylA.2 and CrylB.2, which are available in the tissues of the soybean plant containing this event and presented to the larval pests when they consume the plant tissues. Specifically, expression of the CrylA.2 and CryIB.2 insect inhibitory proteins in soybean event GM_CSM63770 provides résistance to the larval forms of Lepidopteran insect pests Soybean podworm (SPW, Helicoverpa zea), Soybean looper {Chrysodeixis includens), Velvet bean Caterpillar (Anticarsiagemmatalis), Southern armyworm {Spodoptera eridania), Black armyworm {Spodoptera cosmioides), South American podworm {Helicoverpa gelotopoeon), Sunflower looper (Rachiplusia nu), Bean shoot moth {Crocidosema aporema), Green cloverworm {Hypena scahra) and Lesser cornstalk borer {Elasmopalpus lignosellus). Event GM_CSM63770 provides an unsolved need in the art for control of these insects in the soybean market, because Lepidopteran species hâve begun to develop résistance to the pest control proteins used in earlier versions of transgenic soybean plants expressing such Lepidopteran control proteins, and Chemical insecticides hâve not provided adéquate control of these insects and at times multiple applications of chemistries are required during the growing season, increasing the input of Chemical pesticides in the environment, increasing the carbon footprint at each application, and adding signîflcant cost to the production ofthe soybean crop.
    
    [0068] The protection against infestation by Lepidopteran species that is provided by event GM_CSM63770 arises in connection with the expression of a DNA segment encoding two different Lepidopteran spécifie insecticidal proteins that are operably and covalently linked within the inserted transgenic DNA that in part defines the soybean event GM_CSM63770. The two insecticidal proteins encoded by the transgenic inserted DNA in the soybean event GM_CSM63770 are (i) Cryl A.2 (United States Patent 10,494,408, the amino acid sequence being referenced therein as SEQ IDNO:4, and the coding sequence as SEQ IDNO:3), and (ii) CrylB.2 (United States Patent 10,669,3017, the amino acid sequence being referenced therein as SEQ ID NO: 10, and the coding sequence as SEQ ID NO:9). These two insecticidal proteins are described herein as being expressed from two different but linked expression cassettes within the inserted transgenic DNA construct as set forth herein in SEQ ID NO:9 and as illustrated in Figure 1.
    |0069] The DNA sequence encoding the Cry 1 A.2 protein in soybean event GM CSM63770 is operably linked to an Arabidopsis thaliana Ubiquitin 10 promoter, leader, and intron. The DNA sequence encoding the CryIB.2 protein in soybean event GM_CSM63770 is operably linked to a
    Cucumis melo chlorophyll a-b binding protein 13 gene promoter and leader (United States Patent 10,443,066, referenced therein as SEQ ID NOs:4-6). Expression (transcription into the mRNA’s coding for the toxin amino acid sequences, and translation of the mRNAs into the toxin proteins) of the toxin proteins Cry 1 A.2 and Cry 1 B.2 from their respective transgene cassettes is oriented in the same direction (head to tail/head to tail). Figure 1 shows the relative positions of each element
    - promoter (P), 5' UTR or leader (L), intron (I), toxin coding sequence or ORF (open reading frame), and 3' UTR (T), the ORF forCry 1 A.2, and ORF for Cry 1 B.2 being comprised within SEQ ID NO:9 and SEQ ID NO: 10 respectively.
    [0070] As described herein, numerous constructs which varied with respect to the use of expression éléments, toxin coding sequences, and orientation of transcription and translation were 25 evaluated. One hundred twenty-five (125) constructs, comprising one or more of twenty-one (21 ) different insect toxin coding sequences, were used to generate events for assay, leading to the sélection of soybean event GM_CSM63770. The construct used to create soybean event GM_CSM63770, presented herein as SEQ ID NO:13, provided superior performance relative to other constructs when evaluated for the correspondîng transgenic soybean plants’ résistance to
    Lepidopteran insect pest infestation. In addition, soybean event GM_CSM63770 is free of the
    
    markers used for sélection of the transformed plant cell as a resuit of method of transformation used ensuring the selectable marker and the intended traits to be integrated are able to be segregated from each other by breeding sélection. Soybean event GMCSM63770 was transformed with a two T-DNA plant transformation binary vector, wherein the sélection cassettes were comprised on a separate T-DNA than the T-DNA which comprised the insect toxin transgene expression cassettes retained in soybean event GM_CSM63770. After self-pollination of the Ro génération transformed soybean plants, Ri progeny were selected for the presence of the T-DNA comprising the insect toxin expression cassettes and absence of the T-DNA used for sélection of the initial transformation event.
    |0071 ] Soybean event GM_CSM63770 was created through plant transformation techniques used to insert heterologous DNA (also known as transgenic DNA) randomly into a chromosome of the genome of a soybean cell to produce a genetically engineered soybean cell, also referred to as a “transgenic” or “recombinant” soybean cell. Using this technique, many individual cells are transformed, each resulting in a unique “transgenic event” or “event” due to the random insertion of the foreign DNA into the genome. A transgenic plant is then regenerated from each individual transgenic cell. This results in every cell of the transgenic plant containing the uniquely inserted transgenic event as a stable part of its genome. This transgenic plant can then be used to produce seed which are then planted and grown into progeny plants, each containing the unique transgenic event.
    [0072] Soybean event GM_CSM63770 was produced by an Jgro/w'zerzzzw-mediated transformation process using the binary transformation plasmid construct GMCSM63770 and dried excised soybean plant expiants. This plasmid construct contains two régions, each bounded by Agrobaclerium border segments (T-DNA segment). The first T-DNA segment contains two linked plant expression cassettes, one expression cassette encoding a selectable marker and one expression cassette encoding a scorable marker. The second T-DNA segment contains two linked plant expression cassettes with the regulatory genetic éléments necessary for expression in soybean plant cells of two different insecticidal proteins, CrylA.2 and CrylB.2. The T-DNA segment containing the selection/scorable marker genes inserted randomly into the soybean genome and at a site separate from the site of intégration of the T-DNA segment containing the CryIA.2 and
    Cry 1 B.2 expression cassettes, thus allowing for ségrégation ofthe two T-DNA segments within the genome of the transformée! plants during a process of selfïng and/or backcrossing, e.g., screening R, and higher génération of transgenic plants. The transformed soybean cells were regenerated into intact soybean plants and individual plants were selected from the population of plants that showed integrity of the second T-DNA segment encoding the CrylA.2 and CrylB.2 proteins. In Ri and subséquent générations, events were selected based on the integrity, stability and intaetnessoftheT-DNA segmentencoding theCrylA.2 andCryl B.2 proteins, on the absence (i.e., ségrégation) of (i) the T-DNA segment encoding the selectable/scorable marker cassettes, and (ii) any plasmid backbone sequence. Further sélection was also made based upon the location of the T-DNA segment encoding the Cryl A.2 and Cryl B.2 proteins within the soybean genome and other characteristics such as efficacy and agronomics. The expression of the CrylA.2 and Cry lB.2 insecticidal toxic proteins in the cells of the soybean event GM_CSM63770 confers résistance to Lepidopteran insect pests when the soybean cells of event GM_CSM63770 are provided in the diet of the ïnsects.
    [0073] The T-DNA segment encoding the CrylA.2 and CrylB.2 proteins in plasmid construct pM63770 is presented as SEQ ID NO: 13. During intégration, two hundred seventeen (217) and one hundred sixty-nine (169) contiguous base pairs (bp) were deleted from the right and left borders, respectively. In addition, fourteen (14) contiguous base pairs (bp) of the wild-type genomic DNA at the point of insertion of the transgenic DNA was deleted during the intégration process.
    [0074| As specifically described herein, soybean event GM_CSM63770 was produced by a complex research and development process in which: (1) over one hundred plasmid vector constructs - which varied with respect to the coding sequences for the insecticidal proteins, the coding sequences for the transcriptional regulatory éléments, and number and orientation of the cassettes within the constructs - were developed and transformed into soybean cells to create thousands of events that were tested and analyzed, resulting in the sélection ofthe construct used to generate event GMCSM63770; (2) thousands of soybean cells were transformed with the construct used to generate event GM CSM63770, creating a population of transgenic plants in which each plant contained a unique transgenic event that was regenerated and tested; (3) the final event GM_CSM63770 was selected after a rigorous multi-year event sélection process involving the testing and analysis of molecular characteristics, efficacy, protein expression, and agronomie
    
    properties in a variety of soybean genetic backgrounds. Soybean event GM_CSM63770 was thus produced and selected as a unïquely superior event useful for broad-scale agronomie purposes.
    |0075| The transgenic DNA inserted into the genome of soybean event GM CSM63770 was characterized by detailed molecular analysis. This analysis included: the insert number (number 5 of intégration sites within the soybean genome), the genomic insert location (the spécifie site in the soybean genome where the insertion occurred), the copy number (the number of copies of the T-DNA within one locus), and the integrity (absence of any rearrangements) of the transgenic inserted DNA. The detailed molecular analysis demonstrated that the integrated T-DNA containing the Cry l A.2 and Cry' l B.2 expression cassettes remained intact after intégration and the 10 T-DNA comprising the selectable/scoreable markers was absent. As used herein, an “expression cassette” or “cassette” is a recombinant DNA molécule comprising a combination of distinct éléments that are to be expressed by a transformed cell. Table I provides a list of the éléments contained in SEQ ID NO: 10, the DNA sequence that corresponds to soybean event GM_CSM63770.
    Table 1. Description of soybean event GM_CSM63770.
    | Elément | Position in SEQ ID ΝΟ:1θ | Description | 
| 5' Flanking DNA | 1-1,000 | DNA sequence flanking the 5' end of the transgenic insert. | 
| Right Border Région | 1,001-1,068 | DNA région from Agrobacterium tumefaciens containing the right border sequence. | 
| P-At.Ubq 10-1:1:1 | 1,182-2,010 | The promoter from a polyubiquitin gene (OBQ10) from Arabidopsis thaliana (thaïe cress). | 
| L-At.Ubql 0-1:1:1 | 2,011-2,077 | The 5' untranslated région from a polyubiquitin gene (UBQ10) from Arabidopsis thaliana (thaïe cress). | 
| l-At.Ubql0:3 | 2,078-2,383 | The intron for a polyubiquitin gene (UBQ10) from Arabidopsis thaliana (thaïe cress). | 
| Cryl A.2 | 2,393-5.962 | Coding sequence of a chimeric insect toxin comprised of domain 1 of Cry 1 Ah, domain 2 of Cry 1 Ac, domain 3 of Cry 1 Ca. and the protoxin domain of Cry 1 Ac. | 
| Elément | Position in SEQ ID NO:10 | Description | 
| T-Mt.Zfp-1:2:1 | 5,971-6,570 | The 3' untranslated région for a putative CCCH-type zinc finger protein from Medicago Iruncatula (barrel medic). | 
| P-CUCme.CipLhcb: 1 | 6,673-8,571 | The promoter for a LHCII type III chlorophyll a/b binding protein from Cucumis melo (melon). | 
| L-CUCme.CipLhcb: 1 | 8,572-8,673 | The 5' untranslated région for a LHCII type III chlorophyll a/b binding protein from Cucumis melo (melon). | 
| CrylB.2 | 8,677-12,240 | Coding sequence of a chimeric insect toxin comprised of domains 1 and 2 of Cry 1 Be, domain 3 of Cry 1 Ka, and a protoxin domain of Cry 1 Ab. | 
| T-Mt.Lox-1 -1:2:1 | 12,241-12,740 | The 3' untranslated région of a lipoxygenase gene from Medicago iruncatula (barrel medic). | 
| Left Border Région | 12,971-13,240 | DNA région from Agrobaclerium tume/aciens containing the left border sequence. | 
| 3' Flanking DNA | 13,241-14,240 | DNA sequence flanking the 3' end of the transgenic insert. | 
[0076] Soybean event GM_CSM63770 is characterized as an insertion of the intended transgenic DNA into a single locus in the soybean genome, resulting in two new loci or junction sequences (e.g., sequences set forth in SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID
    NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8) between the inserted DNA and the soybean genome DNA that are not known to appear naturally in the soybean genome or other transgenic soybean events - they are unique to soybean DNA containing the event GM_CSM63770. These junction sequences are useful in detecting the presence of the event in soybean cells, soybean tissue, soybean seed, soybean pollen and ova, and soybean plants or soybean plant products, such as soybean commodity products. DNA molecular probes and primer pairs are described herein that hâve been developed for use in identifying the presence of these various junction segments in biological samples containing or suspected of containing soybean
    
    cells, soybean seed, soybean plant parts, soybean pollen or ova, or soybean plant tissue that contain the event GM_CSM63770.
    [0077] A sample is intended to refer to a composition that is either substantially pure soybean DNA or protein, or a composition that contains soybean DNA or protein. With respect to a sample containing DNA, the sample is a biological sample, i.e., it contains biological matériels, including but not limited to DNA obtained or derived from, either directly or indirectly, from the genome of soybean event GM_CSM63770. “Directly” refers to the ability of the skilled artisan to directly obtain DNA from the soybean genome by fracturing soybean cells (or by obtaining samples of soybean that contain fractured soybean cells) and exposing the genomic DNA for the purposes of détection. “Indirectly” refers to the ability of the skilled artisan to obtain the target or spécifie reference DNA, i.e., a novel and unique junction segment described herein as being diagnostic for, or characteristic of, the presence of the soybean event GM_CSM63770 in a particular sample, by means other than by direct via fracturing of soybean cells or obtaining a sample of soybean that contains fractured soybean cells. Such indirect means include, but are not limited to, amplification of a DNA segment that contains the DNA sequence targeted by a particular probe designed to bind with specificity to the target sequence, or amplification of a DNA segment that can be measured and characterized, i.e., measured by séparation from other segments of DNA through some efficient matrix such as an agarose or acrylamide gel or the like, or characterized by direct sequence analysis of the amplicons, or cloning of the amplicon into a vector and direct sequencing of the inserted amplicon présent within such vector.
    |0078] A sample of pure soybean protein or a composition that contains soybean protein is a biological sample, i.e., it contains biological materials, including but not limited to protein obtained or derived from the tissues or cells of soybean event GM_CSM63770. The sample is contacted with monoclonal antibodies that bind specifically to CrylA.2 and CrylB.2 in an immunoassay. Détection of the bound proteins is diagnostic of, or characteristic of soybean event GM_CSM63770. The immunoassay method can be, but not limited to, an ELISA (EnzymeLinked Immunosorbent Assay), a Radioimmunoassay, or a Latéral flow immunochromatographic assay. ELISA assays are typically performed in the laboratory using tissueorcell samples obtained from whole plants, or plant parts thereof. Sandwich ELISA assays are frequently used to detect and quantify protein from transgenic crops. To detect the presence of soybean event
    
    GMCSM63770 in a sample using a sandwich ELISA assay, monoclonal antibodies are used, a first monoclonal antibody which binds specifically to Cry I A.2 and a second antibody which binds specifically to Cry l B.2. A known amount of monoclonal antibody is bound to a fîxed surface. Nonspecific sites on the solid surface are blocked by bovine sérum albumin, casein, or any other 5 such neutral solution. The sample containing protein derived from soybean event GM_CSM63770 is applied to the plate and is captured by the antibody. The unbound antigens are washed away by washing solution. A secondary antibody is added which is also conjugated to an enzyme. The unbound antibodies are washed away. A substrate is added, and the enzyme reacts with the substrate and produces a product, typically a pigment or photons, which is proportional to the 10 amount of antigen présent. Separate ELISA assays are performed for each of the two toxin protein in a sample derived from soybean event GM_CSM63770. A positive ELISA reaction is diagnostic for, or characteristîc of, soybean event GM CSM63770.
    |0079| Latéral flow immunochromatographic assays, also known as, immunochromatographic strips (ICS) or dipstick tests, can be used in the field where laboratory facilities are not available 15 for more complex immunoassays. The immunochromatographic test strip is composed of a sample pad, conjugate pad, nitrocellulose membrane, absorbent pad, and a backing card. A first monoclonal antibody which binds specifically to Cry 1 A.2, a second monoclonal antibody which binds specifically to Cry 1 B.2 and IgG antibody which binds to antibodies derived from the organism host cells in which the first and second monoclonal antibodies were derived are 20 transferred onto the nitrocellulose membrane to form test line I (Cryl A.2), test line 2 (Cry 1 B.2), and the control line (anti-host IgG antibody). The conjugate pad is coated with the first and second monoclonal antibodies labeled with colloïdal gold nanoparticles. The blotted membrane, conjugate pad, sample pad, and absorbent pad are assembled sequentially on the plastic backing board. The CrylA.2 and CrylB.2 proteins présent in a sample derived from soybean event 25 GM_CSM63770 will combine with their respective gold-labeled monoclonal antibodies and then bind to capture antibodies coated on the test line I and test line 2. Visual détection of test line I and test line 2 is diagnostic for, or characteristîc of, soybean event GM_CSM63770.
    [0080] Detailed molecular analysis also demonstrated that event GM CSM63770 contains a single T-DNA insertion with one copy of each of the Cryl A.2 and Cryl B.2 expression cassettes.
    No additional éléments from the transformation construct other than portions of the Agrobacterium
    
    tumefaciens left and right border régions used for transgenic DNA transfer from the plant transformation plasmid to the soybean genome were identified in event GM_CSM63770. Further, thermal amplification producing spécifie amplicons diagnostic for, or characteristic of, the presence of event GM_CSM63770 in a sample and DNA sequence analyses were performed to 5 détermine the arbitrarily assigned 5' and 3' insert-to-plant genome junctions, confirm the organization of the éléments within the insert, and déterminé the complété DNA sequence of the inserted transgenic DNA (SEQ ID NO:9). SEQ ID NO:11 is a sequence representing the one thousand (1,000) base-pair (bp) adjacent to the arbitrarily assigned 5' end of the inserted DNA in soybean variety A3555 genomic DNA sequence flanking the inserted T-DNA sequence. SEQ ID 10 NO: 12 is a sequence representing the one thousand (1,000) bp adjacent to the arbitrarily assigned
    3' end of the inserted DNA in soybean variety A3555 genomic DNA sequence flanking the inserted T-DNA sequence. SEQ ID NO:7 is SEQ ID NO: 11 plus one hundred eighty-one (181) bp of the 5’ end of the inserted T-DNA sequence added to the 3’ end of SEQ ID NO:11. SEQ ID NO:8 is SEQ IDNO: 12 plus one hundred ninety-two (192) bpof the 3’ end ofthe inserted T-DNA 15 sequence added to the 5’ end of SEQ ID NO: 12. SEQ ID NO: 10 corresponds to the DNA sequence that defines the soybean event GM_CSM63770 and contains a contiguous sequence (contig) comprising the 5' A3555 flanking sequence, the transgene insert of GM_CSM63770, and the 3' A3555 flanking sequence, and thus contains both of the insert-to-plant genome junction sequences specified as SEQ ID NO:1, 3, 5 and 7 (5’ end), and as SEQ ID NO:2, 4, 6, and 8 (3’ end).
    [0081] Unless otherwise noted herein, tenus are to be understood according to conventional usage by those of ordinary skill in the relevant art. Définitions of common tenus in molecular biology may be found in Rieger et al., Glossary of Genetics: Classical and Molecular, 5th édition, SpringerVerlag: New York, 1991; and Lewin, Genes V, Oxford University Press: New York, 1994, along with other sources known to those of ordinary skill in the art. As used herein, the tenu “soybean” means species belong to the genus Glycine, preferably Glycine max and includes ail plant varieties that can be bred with soybean plants containing event GM_CSM63770, including wild soybean species as well as those plants belonging to the genus Glycine that permit breeding between species.
    |0082] Event GM_CSM63770 was transformed with a DNA construct that contains expression 30 cassettes expressing toxic amounts of the insecticidal proteins CrylA.2 and CrylB.2. What is
    
    meant by toxic amount is an efficacious amount, an insecticidal amount, an insecticidally-effective amount, a target insect suppressive amount, an efficacious pesticidal amount, an amount in the diet of insects in the order of Lepidoptera that is insecticidal, and other similar terms to be understood according to conventional usage by those of ordinary skill in the relevant art. Soybean plants 5 transformed according to the methods and with the DNA construct disclosed herein are résistant to Lepidopteran insect pests.
    |0083] A transgenic “plant” is produced by transformation of a plant cell with heterologous DNA, Le., a polynucleic acid construct that includes a number of efficacious features of interest, régénération of a plant resulting from the insertion of the transgene into the genome of the plant 10 cell, and sélection of a particular plant characterized by insertion into a particular genome location and the number of efficacious features of the regenerated transgenic plant. The term “event” refers to DNA from the original transformant comprising the inserted DNA and flanking genomic sequences immediately adjacent to the inserted DNA. Such DNA is unique and would be expected to be transferred to a progeny that receives the inserted DNA, including the transgene of interest, 15 as the resuit of a sexual cross of parental line that includes the inserted DNA (e.g., the original transformant and progeny resulting from selfrng) and a parental line that does not contain the inserted DNA. The présent invention also provides the original transformant plant and progeny of the transfonnant that include the heterologous DNA. Such progeny may be produced by a sexual outcross between plants comprising the event and another plant wherein the progeny includes the 20 heterologous DNA. Even after repeated back-crossing to a récurrent parent, the event is présent in the progeny of the cross at the same chromosomal location. The transgenic event DNA, and the genome into which the transgenic event DNA is détectable within the plant cell, the plant, the seed, and other parts of the plant, are not pre-existent in nature.
    [0084| As used herein, the term “recombinant” refers to a non-natural DNA, protein, or organism 25 that would not normally be found in nature and was created by human intervention. A “recombinant DNA molécule” is a DNA molécule comprising a combination of DNA molécules that would not naturally occur together and is the resuit of human intervention. For example, a DNA molécule that is comprised of a combination of at least two DNA molécules heterologous to each other, such as a DNA molécule that comprises a transgene and the plant genomic DNA 30 adjacent to the transgene, is a recombinant DNA molécule.
    I
    
    [0085] The tenns “DNA” and “DNA molécule” referred to herein refer to a deoxyrîbonucleic acid (DNA) molécule. A DNA molécule may be of genomic or synthetic origin, and is by convention from the 5' (upstream) end to the 3' (downstream) end. As used herein, the term “DNA sequence” refers to the nucléotide sequence of the DNA molécule. By convention, the DNA sequences of 5 the invention and fragments thereof are disclosed with reference to only one strand of the twostrand complementary DNA sequence strands. By implication and intent, the complementary sequences of the sequences provided here (the sequences of the complementary strand), also referred to in the art as the reverse complementary sequences, are within the scope of the invention and are expressly intended to be within the scope of the subject matter claimed.
    [0086] As used herein, the term “fragment” refers to a smaller piece of the whole. For example, fragments of SEQ ID NO: 10 would include sequences that are at least about 12 consecutive nucléotides, at least about 13 consecutive nucléotides, at least about 14 consecutive nucléotides, at least about 15 consecutive nucléotides, at least about 16 consecutive nucléotides, at least about 17 consecutive nucléotides, at least about 18 consecutive nucléotides, at least about 19 consecutive 15 nucléotides, at least about 20 consecutive nucléotides, at least about 25 consecutive nucléotides, at least about 30 consecutive nucléotides, at least about 35 consecutive nucléotides, at least about 40 consecutive nucléotides, at least about 45 consecutive nucléotides, at least about 50 consecutive nucléotides, at least about 60 consecutive nucléotides, at least about 70 consecutive nucléotides, at least about 80 consecutive nucléotides, at least about 90 consecutive nucléotides, or at least about 100 consecutive nucléotides of the complété sequence of SEQ ID NO: 10.
    [0087] Similarly, a fragment of the 5' flank (SEQ ID NO: I I or SEQ ID NO:36) or 3' flank (SEQ ID NO: 12 or SEQ ID NO:37) of soybean event GMCSM6377O can comprise at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, 25 at least about 22, at least about 23, at least about 24, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, at least about 400, or at least about 500 consecutive nucléotides of SEQ ID NO: 11 or SEQ ID NO:36; or SEQ ID NO: 12 or SEQ ID NO:37. In addition, the présent 30 disclosure encompasses nucléotide sequences that are at least 90%, at least 91%, at least 92%, at
    I
    
    least 93%. at least 94%, at least 95%, at least 96%. at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%. at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% identical to SEQ ID NO: 11 or 12, or SEQ ID NO:36 or 37, or any fragment of either thereof.
    [0088| Reference in this disclosure to an “isolated DNA molécule” or an équivalent term or phrase is intended to mean that the DNA molécule is one that is présent alone or in combination with other compositions, but not within its natural environment. For example, nucleic acid éléments such as a coding sequence, intron sequence, untranslated leader sequence, promoter sequence, transcriptional termination sequence, and the Iike, that are naturally found within the DNA ofthe 10 genome of an organism are not considered to be “isolated” so long as the element is within the genome of the organism and at the location within the genome in which it is naturally found. However, each of these éléments, and subparts of these éléments, would be “isolated” within the scope of this disclosure so long as the element is not within the genome of the organism and at the location within the genome in which it is naturally found. Similarly, a nucléotide sequence 15 encoding an insecticidal protein or any naturally occurring insecticidal variant of that protein would be an isolated nucléotide sequence so long as the nucléotide sequence was not within the DNA of the bacterium from which the sequence encoding the protein is naturally found. A synthetic nucléotide sequence encoding the amino acid sequence of the naturally occurring insecticidal protein would be considered to be isolated for the purposes of this disclosure. For the purposes of this disclosure, any transgenic nucléotide sequence, Le., the nucléotide sequence of the DNA inserted into the genome of the cells of a plant or bacterium, or présent in an extrachromosomal vector, would be considered to be an isolated nucléotide sequence w-hether it îs présent within the plasmid or similar structure used to transform the cells, within the genome of the plant or bacterium, or présent in détectable amounts in tissues, progeny, biological samples or commodity products derived from the plant or bacterium. In any circumstance, the isolated DNA molécule is a Chemical molécule, regardless of whether it is referred to as a nucleic acid, a nucleic acid sequence, a polynucleotide sequence, and the like. It is a novel. inventive molécule that exhibits industrial applicability both when présent in a plant cell or in a plant genome, and when présent outside of a plant cell, and therefore, exhibits and îs intended to exhibit such utility regardless of where the molécule is located.
    
    [0089] Référencé in this disclosure to an “isolated protein molécule” or an équivalent term or phrase is intended to mean that the protein molécule is one that is présent alone or in combination with other compositions but not within its natural environment. For example, the insecticidal protein molécules expressed by soybean event GM_CSM63770 are not naturally found in native 5 soybean plant samples. The CrylA.2 and CrylB.2 insecticidal proteins of soybean event
    GMCSM63770 are isolated protein molécules so long as the insecticidal proteins or variants thereof was not within the protein of the bacterium from which the protein is naturally found.
    |0090] The DNA sequence of the région spanning the connection by phosphodiester bond linkage of one end of the transgenic insert to the flanking soybean genomic DNA is referred to as a 10 “junction.” A junction is the connection point of the transgenic insert and flanking DNA as one contiguous molécule. One junction is found at the 5' end of the transgenic insert and the other is found at the 3' end of the transgenic insert, referred to herein as the 5' and 3'junction, respectively. A “junction sequence” refers to a DNA sequence of any length that spans the 5' or 3' junction of an event. Junction sequences of soybean event GM_CSM63770 are apparent to one of skill in the 15 art using SEQ ID NO: 10. Examples of junction sequences of GM_CSM63770 are provided as
    SEQ IDNOs:l -8. Figure 1 illustrâtes the physical arrangement of the junction sequences, arranged from 5' to 3', relative to SEQ ID NO: 10. The junction sequences of GM_CSM63770 may be présent as part of the genome of a plant, seed, or cell containing GM_CSM63770. The identification of any one or more of the junction sequences in a sample from a plant, plant part, 20 seed. or cell indicates that the DNA was obtained from soybean containing GM_CSM63770 and is diagnostic for, or characteristic of, the presence of soybean event GM_CSM63770.
    [0091] The junction sequences for soybean event GM_CSM63770 may be represented by a sequence from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:10. For 25 example, the junction sequences may be arbitrarily represented by the nucleotîde sequences provided as SEQ ID NO:I (5' junction sequence) and SEQ ID NO:2 (3' junction sequence). Alternatively, the junction sequences may be arbitrarily represented by the nucleotîde sequences provided as SEQ ID NO:3 (5' junction sequence) and SEQ ID NO:4 (3' junction sequence). Alternatively, the junction sequences may be arbitrarily represented by the nucleotîde sequences 30 provided as SEQ ID NO:5 (5' junction sequence) and SEQ ID NO:6 (3' junction sequence).
    I
    I
    AIternatively, the junction sequences may be arbitrarily represented by the nucléotide sequences provided as SEQ ID NO:7 (5'junction sequence) and SEQ ID NO:8 (3'junction sequence). These nucléotide sequences are connected by phosphodiester linkage, and in soybean event GMCSM63770 are présent as part ofthe recombinant plant cell genome.
    [0092] These junction sequences are diagnostic for, or characteristic of, the presence of soybean event GM CSM63770, or the construct comprised therein. Thus, the identification of one or more of SEQ ID NO:1, SEQ ID NO:2. SEQ JD NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO: 10 in a sample derived from a soybean plant, soybean seed, or soybean plant part is diagnostic that the DNA was obtained from soybean event
    GMCSM63770. The invention thus provides a DNA molécule that contains at least one of the nucléotide sequences provided as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10.
    Any segment of DNA derived from transgenic soybean event GM_CSM63770 that is sufficient to include at least one of the sequences provided as SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3,
    SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10 is within the scope of the invention. In addition, any polynucleotide comprising a sequence complementary to any of the sequences described within this paragraph is within the scope of the invention.
    |0093] The invention provides exemplary DNA molécules that can be used either as primers or probes for detecting the presence of DNA derived from a soybean plant comprising event GM CSM63770 DNA in a sample. Such primers or probes are spécifie for a target nucleic acid sequence and, as such, are useful for the identification of soybean event GM_CSM63770 nucleic acid sequence by the methods of the invention described herein.
    10094] It is intended by use of the word “derived” that a particular DNA molécule is in the soybean plant genome or is capable of being detected in soybean plant DNA. “Capable of being detected” refers to the ability of a particular DNA segment to be amplified and its size or sequence characterized or elucidated by DNA sequence analysis, i.e., the target DNA segment, and the subséquent ability to detect the binding of the probe to the target. The particular DNA segment or target DNA segment of the présent invention is présent within soybean that contains the insertion soybean event GM_CSM63770.
    
    [0095] A “probe” is a nucleic acid molécule that is complementary to a strand of target nucleic acid and is useful in hybridization methods. A probe may be attached a conventional détectable label or reporter molécule, e.g., a radioactive isotope, ligand, chemiluminescent agent, or enzyme. Such a probe is complementary to a strand of a target nucleic acid and, in the case of the présent 5 invention, to a strand of DNA from GM_CSM63770 whether from a GM_CSM63770 containing plant or from a sample that includes GM_CSM63770 DNA. Thus, the probes for use herein may comprise DNA molécules or polynucleotide segments of sufficient length to function under stringent hybridization conditions as defined herein to bind to a particular unique segment of DNA présent within and diagnostic for, or characteristic of, event GM_CSM63770 in a sample. Such a 10 probe can be designed to bind only to a single junction or other novel sequence présent only in the soybean event GM_CSM63770, or two or more such single junction segments. Probes according to the présent invention include not only deoxyribonucleic or ribonucleic acids, but also polyamides and other probe materials that bind specifically to a target DNA sequence and can be used to detect the presence of that target DNA sequence. An exemplary DNA sequence useful as 15 a probe for detecting soybean event GM_CSM63770 is provided as SEQ ID NO: 16 (PB4832).
    [0096] A “primer” is typically a DNA molécule that is designed for use in spécifie annealing or hybridization methods that involve thermal amplification. Primers may comprise pairs ofdifferent oligonucleotides or polynucleotide segments for use in a thermal amplification reaction which amplifies a particular DNA target segment. Each primer in the pair is designed to bind to a rather 20 spécifie segment of DNA within or near a segment DNA of interest for amplification. The primers bind in such a way that these then act as localized régions of nucleic acid sequence polymerization resulting in the production of one or more amplicons (amplified target segments of DNA). The amplicon produced from such reaction would hâve a DNA sequence corresponding to sequence of the template DNA located between the two sites where the primers hybridized to the template. In 25 certain embodiments, use of primers designed to bind to unique segments of soybean event
    GMCSM63770 and that amplify particular amplicons containing one or more of the junction sequences described herein. and the détection and/or characterization of such amplicons upon completion or termination of polymerase reaction, is diagnostic for, or characteristic of, the presence of soybean event GMCSM63770 in a particular sample. The skilled artisan is well
    
    familiar with this amplification method and no recitation of the spécifies of amplification is necessary here.
    |0097] A primer is typically designed to hybridize to a complementary target DNA strand to form a hybrid between the primer and target DNA strand, and the presence of the primer is a point of 5 récognition by a polymerase to begin extension of the primer (i.e., polymerization of additional nucléotides into a lengthening nucléotide molécule) using as a template the target DNA strand. Primer pairs refer to use of two primers binding opposite strands of a double stranded nucléotide segment for the purpose of amplifying Iinearly the polynucieotide segment between the positions targeted for binding by the individual members of the primer pair, typically in a thermal amplification reaction or other conventional nucleic-acid amplification methods. Exemplary DNA molécules useful as primers are provided as SEQ ID NO: 14, SEQ IDNO:15, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO:20.
    [0098] The primer pair SEQ ID NO: 14 and SEQ ID NO: 15 are useful as a first DNA molécule and a second DNA molécule that is different from the first DNA molécule, and both are each of sufficient length of contîguous nucléotides of SEQ ID NO: 10 to function as DNA primers that, when used together in a thermal amplification reaction with template DNA derived from soybean event GM_CSM63770, to produce an amplicon diagnostic for, or characteristic of, soybean event GM_CSM63770 DNA in a sample. The primer pair SEQ ID NO: 17 and SEQ ID NO: 18 are useful as a first DNA molécule and a second DNA molécule that is different from lhe first DNA molécule, and both are each of sufficient length of contîguous nucléotides of a locus within the soybean genome to function as DNA primers that, when used together in a thermal amplification reaction with template DNA derived from soybean event GM_CSM63770, to produce an amplicon that serves as an internai control for both the diagnosis of soybean event GM_CSM63770, as well as the zygosity of soybean event GM_CSM63770 DNA in a sample. The primer pair SEQ ID NO:20 and SEQ ID NO: 15 are useful as a first DNA molécule and a second DNA molécule that is different from the first DNA molécule, and both are each of sufficient length of contîguous nucléotides of a locus within the soybean genome to function as DNA primers that, when used together in a thermal amplification reaction with template DNA derived from soybean event GM_CSM63770, to produce an amplicon diagnostic for, or characteristic of, non-inserted wild-type soybean genomic DNA not comprising event GMCSM63770. It is within the skill of the art to détermine
    
    for any particular desired amplification parameters, which probes and primers would be optimum for inclusion in the thermal amplification reaction to detect the presence or absence of the transgenic event DNA of the présent invention based on the DNA sequences provided in the inserted DNA (SEQ ID NO:9) and the full segment of DNA set forth herein as SEQ ID NO:lO which defmes the transgenic soybean event of this invention, GM CSM63370.
    [0099] DNA probes and DNA primers are generaily eleven (l l) polynucleotides or more in length, often eighteen (18) polynucleotides or more, twenty-four (24) polynucleotides or more, or thirty (30) polynucleotides or more. Such probes and primers are selected to be of sufficient length to hybridize specifïcally to a target sequence under high stringency hybridization conditions.
    Preferably, probes and primers according to the présent invention hâve complété sequence similarity with the target sequence, although probes differing from the target sequence that retain the ability to hybridize to target sequences may be designed by conventional methods.
    |00100] The nucleic acid probes and primers of the présent invention hybridize under stringent conditions to a target DNA molécule. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA from a transgenic plant in a sample. Polynucleic acid molécules also referred to as nucleic acid segments or fragments thereof are capable of specifïcally hybridizing to other nucleic acid molécules under certain circumstances. [0100] As used herein, two polynucleic acid molécules are said to be capable of specifïcally hybridizing to one another if the two molécules are capable of forming an anti-parai lel. double- stranded nucleic acid structure. A nucleic acid molécule is said to be the “complément” of another nucleic acid molécule if they exhibit complété complementarity. As used herein, molécules are said to exhibit “complété complementarity” when every nucléotide of one of the molécules is complementary to a nucléotide of the other. Two molécules are said to be “minimally complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional low-stringency conditions. Similarly, the molécules are said to be “complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional high-stringency conditions. Conventional stringency conditions are described by Sambrook et al., 1989, and by Haymes et al., In: Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington. DC (1985). Departures from complété complementarity are therefore permissible, as long as such departures do not completely prechide the capacity of the molécules to form a double-stranded structure. In order for a nucleic acid molécule to serve as a primer or probe it need only be sufficiently complementary in sequence to be able to form a stable double-stranded structure under the particular solvent and sait concentrations employed.
    [01011 As used herein. a substantially homologous sequence is a nucleic acid sequence that will specifically hybridize to the complément of the nucleic acid sequence to which it is being compared under high stringency conditions. Appropriate stringency conditions that promote DNA hybridization, for example, 6.0 x sodium chloride/sodium citrate (SSC) at about 45°C, followed by a wash of 2.0 x SSC at 50°C, are known to those skilied in the art or can be found in Current Protocols in Molecular Blology, John Wiley & Sons. N.Y. ( 1989), 6.3.1-6.3.6. For example, the sait concentration in the wash step can be selected from a low stringency of about 2.0 x SSC at 50°C to a high stringency of about 0.2 x SSC at 50°C. In addition, the température in the wash step can be increased from low stringency conditions at room température, about 22°C, to high stringency conditions at about 65°C. Both température and sait may be varied, or either the température or the sait concentration may be held constant while the other variable is changed. In a preferred embodiment. a polynucleic acid of the présent invention will specifically hybridize to one or more of the nucleic acid molécules set forth in SEQ ID NO: I, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:IO, or compléments thereof or fragments of either under moderately stringent conditions, for example at about 2.0 x SSC and about 65°C. In a particularly preferred embodiment. a nucleic acid of the présent invention w ill specifically hybridize to one or more of the nucleic acid molécules set forth in SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ 1DNO:9, or SEQ IDNO:IO, or compléments or fragments of either under high stringency conditions. In one aspect of the présent invention, a preferred marker nucleic acid molécule ofthe présent invention has the nucleic acid sequence set forth in SEQ ID NO: l, or SEQ ID NO:2, or SEQ ID NO:3, or SEQ ID NO:4, or SEQ ID NO:5, or SEQ ID NO:6, or SEQ ID NO:7, or SEQ ID NO:8, or SEQ ID NO:9, or SEQ ID NO: 10, or compléments thereof, or fragments of either. The hybridization of the probe to the target DNA molécule can be detected by any number of methods known to those skilled in the art, these
    I
    
    can include, but are not limited to, fluorescent tags, radioactive tags, antibody-based tags, and chemiluminescent tags.
    |0102| Regarding the amplification of a target nucleic acid sequence (e.g., by PCR) using a particular amplification primer pair, stringent conditions are conditions that permit the primer 5 pair to hybridize only to the target nucleic acid sequence to which a primer having the correspondîng wild-type sequence (or its complément) would bind and preferably to produce a unique amplification product. the amplicon, in a DNA thermal amplification reaction.
    (0103] The term spécifie for (a target sequence) indicates that a probe or primer hybridizes under stringent hybridization conditions only to the target sequence in a sample comprising the target 10 sequence.
    [0104] As used herein, “amplified DNA” or “amplicon” refers to the product of polynucleic acid amplification method directed to a target polynucleic acid molécule that is part of a polynucleic acid template. For example, to détermine whether a soybean plant resulting from a sexual cross contains transgenic plant genomic DNA from a soybean plant comprising event GM_CSM63770 15 of the présent invention, DNA that is extracted from a soybean plant tissue sample may be subjected to a polynucleic acid amplification method using a primer pair that includes a first primer derived from a genomic DNA sequence in the région flanking the heterologous inserted DNA of event GM_CSM63770 and is elongated by polymerase 5' to 3' in the direction of the inserted DNA. The second primer is derived from the heterologous inserted DNA molécule is elongated 20 by the polymerase 5' to 3' in the direction of the flanking genomic DNA from which the first primer is derived. The amplicon may range in length from the combined length of the primer pair plus one nucléotide base pair, or plus about fifty nucléotide base pairs, or plus about two hundredflfty nucléotide base pairs, or plus about four hundred-fifty nucléotide base pairs or more. Altematively, a primer pair can be derived from genomic sequence on both sides of the inserted 25 heterologous DNA so as to produce an amplicon that includes the entire insert polynucleotide sequence (e.g., a forward primer isolated from the genomic portion on the 5 ' end of SEQ ID NO: 10 and a reverse primer isolated from the genomic portion on the 3' end of SEQ ID NO: 10 that amplifies a DNA molécule comprising the inserted DNA sequence (SEQ ID NO:9) identified herein in the event GM_CSM63770 genome). A member of a primer pair derived from the plant 30 genomic sequence adjacent to the inserted transgenic DNA is located a distance from the inserted
    
    DNA sequence, this distance can range from one nucléotide base pair up to about twenty thousand nucléotide base pairs. The use of the term “amplicon” specifically excludes primer dimers that may be formed in the DNA thermal amplification reaction.
    |0105| For practical purposes, one should design primers which produce amplicons of a limited 5 size range, for example, between 100 to I000 bases. Smaller (shorter polynucleotide length) sized amplicons in general are more reliably produced in thermal amplification reactions, allow for shorter cycle times, and can be easily separated and visualized on agarose gels or adapted for use in endpoint TAQMANR-|jke assays. Smaller amplicons can be produced and detected by methods known in the art of DNA amplicon détection. In addition, amplicons produced using the primer 10 pairs can be cloned into vectors, propagated, isolated, and sequenced or can be sequenced directly with methods well established in the art. Any primer pair derived from the combination of SEQ ID NO: 11 and SEQ ID NO:9 or the combination of SEQ ID NO: 12 and SEQ ID NO:9 that are useful in a DNA amplification method to produce an amplicon diagnostic for, or characteristic of, soybean event GMCSM63770 or progeny thereof is an aspect of the invention. Any single 15 isolated DNA polynucleotide primer molécule comprising at least 15 contiguous nucléotides of
    SEQ ID NO:11, or its complément that is useful in a DNA amplification method to produce an amplicon diagnostic for, or characteristic of, soybean event GM_CSM63770 or progeny thereof is an aspect of the invention. Any single isolated DNA polynucleotide primer molécule comprising at least 15 contiguous nucléotides of SEQ ID NO: 12, or its complément that is useful in a DNA 20 amplification method to produce an ampl icon diagnostic for, or characteristic of, plants comprising soybean event GM_CSM63770 or progeny thereof is an aspect of the invention. Any single isolated DNA polynucleotide primer molécule comprising at least 15 contiguous nucléotides of SEQ ID NO:9, or its complément that is useful in a DNA amplification method to produce an amplicon diagnostic for, or characteristic of, soybean event GM_CSM63770 or progeny thereof is 25 an aspect of the invention.
    [0106] Polynucleic acid amplification can be accomplished by any of the various polynucleic acid amplification methods known in the art, including the polymerase chain reaction (PCR). Amplification methods are known in the art and are described, inter alia, in U.S. Patent Nos. 4,683,195 and 4,683,202 and in PCR Protocols: A Guide to Methods and Applications, ed. Innis 30 et al., Academie Press, San Diego, 1990. PCR amplification methods hâve been developed to
    
    amplify up to 22 kb (kilobase) of genomic DNA and up to 42 kb of bactériophage DNA (Cheng et al., Proc. Natl. Acad. Sci. USA 91:5695-5699, 1994). These methods as well as other methods known in the art of DNA amplification may be used in the practice of the présent invention. The sequence of the heterologous DNA insert or flanking genomic DNA sequence from soybean event 5 GMCSM63770 can be verifïed (and corrected if necessary) by amplifying such DNA molécules from soybean seed containing event GMCSM63770 DNA or soybean plants grown from the soybean seed containing event GMCSM63770 DNA deposited with the ATCC having accession No. PTA-126048, using primers derived from the sequences provided herein, followed by standard DNA sequencing of the PCR amplicon orcloned DNA fragments thereof.
    [0107] The diagnostic amplicon produced by these methods may be detected by a plurality of techniques. One such method is Genetic Bit Analysis (Nikiforov, étal. Nucleic Acid Res. 22:41674175, 1994) where a DNA oligonucleotide is designed that overlaps both the adjacent flanking genomic DNA sequence and the inserted DNA sequence. The oligonucleotide is immobilized in wells of a microtiter plate. Following PCR of the région of interest (using one primer in the inserted sequence and one in the adjacent flanking genomic sequence), a single-stranded PCR product can be hybridized to the immobilized oligonucleotide and serve as a template for a single base extension reaction using a DNA polymerase and labeled dideoxynucleotîde triphosphates (ddNTPs) spécifie for the expected next base. Readout may be fluorescent or ELISA-based. A signal indicates presence of the transgene/genomic sequence due to successful amplification.
    hybridization, and single base extension.
    |0108] Another method is the Pyrosequencing technique as described by Winge (Innov. Pharma. Tech. 00:18-24, 2000). In this method, an oligonucleotide is designed that overlaps the adjacent genomic DNA and insert DNA junction. The oligonucleotide is hybridized to single-stranded PCR product from the région of interest (one primer in the inserted sequence and one in the flanking 25 genomic sequence) and incubated in the presence of a DNA polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine 5' phosphosulfate and luciferin. dNTPs are added individually and the enzymatic reaction of luciferase with these reagents and substrates results in is the release of photons (a signal of light) which are then measured or observed. A light signal indicates the presence of the transgene/genomic sequence due to successful amplification, hybridization, and 30 single or multi-base extension.
    
    |0109] Fluorescence Polarization as described by Chen. et al., (Genome Res. 9:492-498, 1999) is a method that can be used to detect the amplicon of the présent invention. Using this method an oligonucleotide is designed that overlaps the genomic flanking and inserted DNA junction. The oligonucleotide is hybridized to single-stranded PCR product from the région of interest (one 5 primer in the inserted DNA and one in the flanking genomic DNA sequence) and incubated in the presence of a DNA polymerase and a fluorescent-labeled ddNTP. Single base extension results in incorporation of the ddNTP. Incorporation can be measured as a change in polarization using a fluorometer. A change in polarization indicates the presence of the transgene/genomic sequence due to successful amplification, hybridization, and single base extension.
    [0U0| Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the
    PCR as it occurs (i.e., in real time). Data is collected throughout the PCR process, rather than at the end of the PCR. In real-time PCR, reactions are characterized by the point in time durîng cycling when amplification of a target is first detected rather than the amount of target accumulated after a ftxed number of cycles. In a real-time PCR assay, a positive réaction is detected by 15 accumulation of a fluorescent signal. The higher the starting copy number of the nucleic acid target, the sooner a significant increase in fluorescence is observed. The cycle threshold (Ct value) is defined as the number of cycles required for the fluorescent signal to cross the threshold (i.e., exceeds background level). Ct levels are inversely proportional to the amount of target nucleic acid in the sample (i.e., the lower the Ct value, the greater the amount of target nucleic acid in the 20 sample).
    |0111] Taqman® (PE Applied Biosystems, Foster City, CA) is described as a method of detecting and quantitying the presence of a DNA sequence using real-time PCR and is fuily understood in the instructions provided by the manufacturer. Briefly, a FRET oligonucleotide probe is designed that overlaps the genomic flanking and insert DNA junction. The FRET probe and PCR primers 25 (one primer in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. I lybrîdization of the FRET probe results in cleavage and release of the fluorescent moiety away from the quenching moiety on the FRET probe. A fluorescent signal indicates the presence of the transgene/genomic sequence due to successful amplification and hybridization.
    
    [0112| Molecular Beacons hâve been described for use in sequence détection as described in Tyangi, et al. (Nature Biotech. 14:303-308, 1996). Briefly, a FRET oligonucleotide probe is designed that overlaps the flanking genomic and insert DNA junction. The unique structure of the FRET probe results in it containing secondary structure that keeps the fluorescent and quenching moieties in close proximity. The FRET probe and PCR prîmers (one primer in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermalstable polymerase and dNTPs. Following successful PCR amplification, hybridization ofthe FRET probe to the target sequence results in the removal ofthe probe secondary structure and spatial séparation of the fluorescent and quenching moieties. A fluorescent signal results. A fluorescent signal 10 indicates the presence of the flanking/transgene insert sequence due to successful amplification and hybridization.
    {0113] DNA détection kits that are based on DNA amplification methods contain DNA primer molécules that hybridize specifically to a target DNA and amplify a diagnostic amplicon under the appropriate reaction conditions. The kit may provide an agarose gel-based détection method or 15 any number of methods of detecting the diagnostic amplicon that are known in the art. DNA détection kits can be developed using the compositions disclosed herein and are useful for identification of soybean event GM_CSM63770 DNA in a sample and can be applîed to methods for breeding soybean plants containing soybean event GM CSM63770 DNA. A kit that contains DNA primers that are homologous or complementary to any portion of the soybean genomic région as set forth in SEQ ID NO: 10 and to any portion of the inserted transgenîc DNA as set forth in SEQ ID NO: 10 is an object of the invention. The DNA molécules can be used in DNA amplification methods (PCR) or as probes in polynucleic acid hybridization methods, Le., Southern analysis, northern analysis.
    [0114] Probes and primers according to the invention may hâve complété sequence identity with 25 the target sequence, although primers and probes differing from the target sequence that retain the ability to hybridize preferentially to target sequences may be designed by conventional methods. In order for a nucleic acid molécule to serve as a primer or probe it need only be sufficiently complementary in sequence to be able to form a stable double-stranded structure under the particular solvent and sait concentrations employed. Any conventional nucleic acid hybridization 30 or amplification method can be used to identify the presence of transgenîc DNA from soybean event GM_CSM63770 in a sample. Probes and primers are generally at least about I I nucléotides, at least about I8 nucléotides, at least about 24 nucléotides, orat least about 30 nucléotides or more in length. Such probes and primers hybridize specifically to a target DNA sequence under stringent hybridization conditions. Conventional stringency conditions are described by Sambrook et cil., I989, and by Haymes et cil., In: Nucleîc Acid Hybridization, A Practical Approach, IRL Press, Washington, DC (1985).
    [0115| Any number of methods well known to those skilled in the art can be used to isolate and manipulate a DNA molécule, or fragment thereof, disclosed in the invention, including thermal amplification methods. DNA molécules, or fragments thereof, can also be obtained by other techniques such as by directly synthesizing the fragment by Chemical means, as is commonly practiced by using an automated oligonucleotide synthesizer.
    [0116| The DNA molécules and corresponding nucléotide sequences provided herein are therefore useful for, among other things, identifying soybean event GM CSM63770, detecting the presence of DNA derived from the transgenic soybean event GMCSM63770 in a sample, and monitoring samples for the presence and/or absence of soybean event GM_CSM63770 or plant parts derived from soybean plants comprising soybean event GMCSM63770.
    |0117] By reference to soybean it is intended that soybean plants, soybean plant cells, soybean seed, soybean pollen and ova, soybean plant parts, soybean progeny plants, and soybean commodity products are within the scope of the invention, so long as each embodiment contains a détectable amount of DNA corresponding to any one, two, or more of the segments described herein as being diagnostic for, or characteristic of, the presence of soybean event GM_CSM63770 (e.g., such as a polynucleotide having at least one of the sequences provided as SEQ ID NO:I, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10). Soybean plants, plant cells, seed, pollen and or ova, plant parts, and progeny plants of the invention may also contain one or more additional transgenes. Such additional transgene(s) may be any nucléotide sequence encoding a protein or RNA molécule conferring a désirable trait including but not limited to increased insect résistance, increased water use efficiency, increased yield performance, increased drought résistance, increased seed quality, and/or increased herbicide tolérance.
    
    |01l8| The invention provides soybean plants, soybean plant cells, soybean seed, soybean plant parts (such as pollen, ovule, silk, spike, anther, cob, root tissue, stalk tissue, leaf tissue), soybean progeny plants derived from a transgenic soybean plant containing GM_CSM63770 DNA. A représentative sample of soybean seed containing soybean event GM_CSM63770 DNA has been 5 deposited according to the Budapest Treaty with the American Type Culture Collection (ATCC®).
    The ATCC repository has assigned the Patent Deposit Désignation PTA-126048 to the seed containing soybean event GMCSM63770 DNA.
    [0119] The invention provides soybean plants, plant cells, plant parts and plant seed comprising a recombinant DNA construct integrated in chromosome 19, wherein the recombinant DNA 10 construct confers résistance against Lepidopteran insect pest species. The recombinant DNA construct is integrated in a position of said chromosome flanked by at least 50 contiguous nucléotides of SEQ ID NO: 11 or 36 and 50 contiguous nucléotides of SEQ ID NO: 12 or 37. The at least 50 contiguous nucléotides of SEQ ID NO:11 or 36 can comprise one or more nucléotide sequences selected from SEQ ID NOs:38-137. The at least nucléotides of SEQ ID NO: 12 or 37 15 can comprise one or more nucléotide sequences selected from SEQ ID NOs: 138-237.
    [0120] The invention provides a microorganism comprising a DNA molécule having at least one sequence selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ IDNO:8, SEQ ID NO:9, and SEQ ID NO: 10 présent in its genome. An example of such a microorganism is a transgenic plant cell.
    [0121] Microorganisms, such as a plant cell of the invention, are useful in many industrial applications, including but not limited to: (i) use as research tool for scientific inquiry or industrial research; (ii) use in culture for producing endogenous or recombinant carbohydrate, lipid, nucleic acid, or protein products or small molécules that may be used for subséquent scientific research or as industrial products; and (iii) use with modem plant tissue culture techniques to produce 25 transgenic plants or plant tissue cultures that may then be used for agricultural research or production. The production and use of microorganisms such as transgenic plant cells utilizes modem microbiological techniques and human intervention to produce a man-made, unique microorganism. In this process, recombinant DNA is inserted into a plant cell’s genome to create a transgenic plant cell that is separate and unique from naturally occurring plant cells. This 30 transgenic plant cell can then be cultured much like bacteria and yeast cells using modem
    
    microbiology techniques and may exist in an undifferentiated, unicellular state. The transgenic plant cell’s new genetic composition and phenotype is a technical effect created by the intégration of the heterologous DNA into the genome of the cell. Another aspect of the invention is a method of using a microorganîsm ofthe invention. Methods of using microorganisms of the invention, 5 such as transgenic plant cells, include (i) methods of producing transgenic cells by integrating recombinant DNA into the genome of the cell and then using this cell to dérivé additional cells possessing the same heterologous DNA; (ii) methods of culturing cells that contain recombinant DNA using modem microbiology techniques; (iii) methods of producing and puriiying endogenous or recombinant carbohydrate, lipid, nucleic acid, or protein products from cultured 10 cells; and (iv) methods of using modem plant tissue culture techniques with transgenic plant cells to produce transgenic plants or transgenic plant tissue cultures.
    |0122] Plants ofthe invention may pass along the soybean event GM_CSM63770 DNA, including transgene inserted in soybean event GM CSM63770, to progeny, typically through conventional breeding and sélection. As used herein, “progeny” includes any plant, plant cell, seed, and/or 15 regenerable plant part containing the event GM_CSM63770 DNA derived from an ancestor plant and/or comprising a DNA molécule having at least one sequence selected from SEQ ID NO:I, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ IDNO:10. Plants, progeny, and seed may be homozygous or heterozygous for the transgene of event GM CSM63770. Progeny may be grown from seed 20 produced by a soybean event GM CSM63770 containing plant and/or from seed produced by a plant fertilized with pollen from a soybean event GM CSM63770 containing plant.
    [0123] Progeny plants may be self-pollinated (also known as “selfing”) to generate a true breeding line of plants, i.e., plants homozygous for the transgene. Selfing of appropriate progeny can produce plants that are homozygous for both added exogenous genes.
    [0124] Alternatively, progeny plants may be out-crossed, e.g., bred with another unrelated plant, to produce a varietal or a hybrid seed or plant. The other unrelated plant may be transgenic or nontransgenic. A varietal or hybrid seed or plant of the invention may thus be derived by sexually Crossing a first parent that lacks the spécifie and unique DNA of the soybean event GM_CSM63770 with a second parent comprising soybean event GM_CSM6377O, resulting in a hybrid comprising the spécifie and unique DNA of the soybean event GM_CSM63770. Each
    
    parent can be a hybrid or an inbred/varietal, so long as the cross or breeding results in a plant or seed of the invention, i.e., a seed having at least one allele containing the DNA of soybean event GMCSM63770 and/or a DNA molécule having at least one sequence selected from SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, 5 SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:lO. Two different transgenic plants may thus be crossed to produce hybrid offspring that contain two independently segregating, added, exogenous genes. For example, soybean event GM_CSM63770 containing Cry l A.2 and Cry I B.2 conferring insect résistance to soybean can be crossed with other transgenic soybean plants to produce a plant having the characteristics of both transgenic parents. One example of this would be a cross of soybean event GM_CSM63770 containing CrylA.2 and CrylB.2, conferring Lepidopteran résistance to soybean with a plant having one or more additional traits such as herbicide tolérance, insect résistance, or drought tolérance, resulting in a progeny plant or seed that has résistance to Lepidopteran insect pests and has at least one or more additional traits. Back-crossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated, as is végétative propagation. Descriptions of other breeding methods that are commonly used for different traits and crops can be found in one of several references, e.g., Fehr, in Breeding Methods for Cultivar Development, Wilcox J. ed., American Society of Agronomy, Madison WI (1987).
    [0125] Plants, progeny, seed, pollen and ova, cells and plant parts of the invention may also contain one or more additional soybean trait(s) or transgenic events, particularly those introduced 20 by Crossing a soybean plant containing soybean event GM_CSM63770 with another soybean plant containing the additional trait(s) or transgenic events. Such trait(s) or transgenic events include, but are not limited to, increased insect résistance, herbicide tolérance, increased water use efficiency, increased yield performance, increased drought résistance, increased seed quality, improved nutritional quality, hybrid seed production, or disease or fungal résistance. Soybean 25 transgenic events are known to those of skill in the art. For example, a list of such traits is provided by the United States Department of Agriculture’® (USDA) Animal and Plant Health Inspection Service (APHIS) and can be found on their website www.aphis.usda.gov on the worldwide web. Two or more transgenic events may thus be combined in a progeny seed or plant by Crossing two parent plants each comprising one or more transgenic events, collecting the progeny seed, and 30 selecting for progeny seed or plants that contain the two or more transgenic events. These steps may be repeated until the desired combination of transgemc events in a progeny is achieved. Backcrossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated and is végétative propagation.
    [0126] A plant part that is derived from soybean plants comprising soybean event GMCSM63770 is also provided. As used herein, a “plant part” refers to any part of a plant which is comprised of material derived from a soybean plant comprising event GM_CSM63770. Plant parts include but are not limited to pollen, ovule, pod, flower, root or stem tissue, fibers, and leaves. Plant parts may be viable, nonviable, regenerable, and/or nonregenerable.
    [0127] Further provided is a commodity product that is derived from soybean plants comprising soybean event GM_CSM63770 and that contains a détectable amount of a nucleic acid spécifie for soybean event GM_CSM63770. As used herein, a “commodity product” refers to any composition or product which is comprised of material derived from a soybean plant, whole or processed soybean seed, or one or more plant cells and/or plant parts containing the soybean event GM_CSM63770 DNA. Nonviable commodity products include but are not limited to nonviable seed, whole or processed seed, seed parts, and plant parts; animal feed comprising soybean, soybean oil, soybean protein, soybean meal, soybean flour, soybean flakes, soybean bran, soybean milk. soybean cheese, soybean wine, paper comprising soybean, cream comprising soybean, soybean biomass, and fuel products produced using soybean plants and soybean parts. Viable commodity products include but are not limited to seed, plants, and plant cells. The soybean plants comprising soybean event GM_CSM63770 can thus be used to manufacture any commodity product typically acquired from soybean. Any such commodity product that is derived from soybean plants comprising soybean event GM_CSM63770 may contain at least a détectable amount of the spécifie and unique DNA corresponding to soybean event GM_CSM63770, and specifically may contain a détectable amount of a polynucleotide comprising a DNA molécule having at least one sequence selected from SEQ ID NO: I, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10. Any standard method of détection for nucléotide molécules may be used, including methods of détection disclosed herein. A commodity product is with the scope of the invention if there is any détectable amount ofa DNA molécule having at least one sequence selected from SEQ
    
    [D NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID N0:5, SEQ ID NO:6, SEQ ID NO:7, SEQ IDNO:8, SEQ IDNO:9, and SEQ ID NO: 10 in the commodity product.
    [0128] The soybean plants, soybean plant cells, soybean seed, soybean plant parts (such as pollen, ovule, silk, spike, anther, cob, root tissue, stalk tissue, leaf tissue), soybean progeny plants, and 5 commodity products of the invention are therefore, useful for, among other things, growing plants for the purpose of producing seed and/or plant parts comprising soybean event GM_CSM63770 for agricultural purposes, producing progeny comprising soybean event GM_CSM63770 for plant breeding and research purposes, use with microbiological techniques for industrial and research applications, and sale to consumers.
    [0129] Methods for producing an insect résistant soybean plant comprising the DNA sequences spécifie and unique to event GM_CSM63770 of the invention are provided. Transgenic plants used in these methods may be homozygous or heterozygous for the transgene. Progeny plants produced by these methods may be varietal or hybrid plants; may be grown from seed produced by soybean event GMCSM63770 containing plant and/or from seed produced by a plant fertilized with pollen from a soybean event GM_CSM63770 containing plant; and may be homozygous or heterozygous for the transgene. Progeny plants may be subsequently self-poilinated to generate a true breeding line of plants, i.e., plants homozygous for the transgene, or altematively may be outcrossed, e.g., bred with another unrelated plant, to produce a varietal or a hybrid seed or plant.
    [0130] Methods of detecting the presence of DNA derived from a soybean cell, soybean tissue, 20 soybean seed, or soybean plant comprising soybean event GM_CSM63770 in a sample are provided. One method comprises (i) extracting a DNA sample from at least one soybean cell, soybean tissue, soybean seed, or soybean plant; (ii) contacting the DNA sample with at least one primer that is capable of producing DNA sequence spécifie to event GM_CSM63770 DNA under conditions appropriate for DNA sequencing; (iii) performing a DNA sequencing reaction; and then 25 (iv) confirming that the nucléotide sequence comprises a nucléotide sequence spécifie for event
    GM_CSM63770, of the construct comprised therein, such as one selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10. Another method comprises (i) extracting a DNA sample from at least one soybean cell, soybean tissue, soybean seed, or soybean plant; (ii) contacting the DNA sample with a primer pair that is capable of
    
    producing an amplicon from event GMCSM63770 DNA under conditions appropriate for DNA amplification; (iii) performing a DNA amplification reaction; and then (iv) detecting the amplicon molécule and/or confirming that the nucléotide sequence of the amplicon comprises a nucléotide sequence spécifie for event GMCSM63770, such as one selected from the group consisting of 5 SEQ IDNO:1, SEQ IDNO:2, SEQ ID NO:3, SEQ IDNO:4, SEQ IDN0:5, and SEQ IDN0:6.
    The amplicon should be one that is spécifie for event GM_CSM63770, such as an amplicon that comprises SEQ ID NO: 1, or SEQ ID NO:2, or SEQ ID NO:3, or SEQ ID NO:4, or SEQ ID NO:5, or SEQ ID NO:6. The détection of a nucléotide sequence spécifie for soybean event GM_CSM63770 in the amplicon is determinative and/or diagnostic for, or characteristîc of, the 10 presence of the soybean event GM CSM63770 spécifie DNA in the sample. An example of a primer pair that is capable of producing an amplicon from event GM_CSM63770 DNA under conditions appropriate for DNA amplification is provided as SEQ ID NO:14 and SEQ ID NO:15. Other primer pairs may be readily designed by one of ski II in the art and would produce an amplicon comprising SEQ ID NO: 1, or SEQ ID NO:2, or SEQ ID NO:3, or SEQ ID NO:4, or SEQ 15 ID NO:5, or SEQ ID NO:6, wherein such a primer pair comprises at least on primer within the genomic région flanking the insert and a second primer within the insert. Another method of detecting the presence of DNA derived from a soybean cell, soybean tissue, soybean seed, or soybean plant comprising soybean event GM_CSM63770 in a sample comprises (i) extracting a DNA sample from at least one soybean cell, soybean tissue, soybean seed, or soybean plant; (ii) 20 contacting the DNA sample with a DNA probe spécifie for event GM_CSM63770 DNA; (iii) allowing the probe and the DNA sample to hybridize under stringent hybridization conditions; and then (iv) detecting hybridization between the probe and the target DNA sample. An example of the sequence of a DNA probe that is spécifie for event GMCSM63770 is provided as SEQ ID NO: 16. Other probes may be readily designed by one of skill in the art and would comprise at 25 least one fragment of genomic DNA flanking the insert and at least one fragment of insert DNA such as sequence provided in, SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO: 10. Détection of probe hybridization to the DNA sample is diagnostic for, or characteristîc of, the presence of soybean event GM_CSM63770 spécifie DNA in the sample. Absence of hybridization is alternatively diagnostic for, or characteristic of, the absence of soybean event GM_CSM63770 spécifie DNA in the sample.
    [0131 ] DNA détection kits are provided thaï are useful for the identification of soybean event GMCSM63770 DNA in a sample and can also be applied to methods for breeding soybean plants containing the appropriate event DNA. Such kits contain DNA primers and/or probes comprising fragments of SEQ IDNO:I, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10. One example of such a kit comprises at least one DNA molécule of sufficient length of continuous nucléotides of SEQ ID NO: 10 to function as a DNA probe useful for detecting the presence and/or absence of DNA derived from transgenic soybean plants comprising event GMCSM63770 in a sample. The DNA derived from transgenic soybean plants comprising event GM_CSM63770 would comprise a DNA molécule having at least one sequence selected from SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ IDNO:10. A DNA molécule sufficient for use as a DNA probe is provided that is useful for determining, detecting, or diagnosing the presence and/or absence of soybean event GM_CSM63770 DNA in a sample is provided as SEQ ID NO: 16. Other probes may be readily designed by one of skill in the art and should comprise at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, or at least 40 contiguous nucléotides of SEQ ID NO: 10 and be sufficiently unique to soybean event GM CSM63770 DNA in order to identify DNA derived from the event.
    [0132] Another type of kit comprises a primer pair useful for producing an amplicon useful for detecting the presence and/or absence of DNA derived from transgenic soybean event GM_CSM63770 in a sample. Such a kit would employ a method comprising contacting a target DNA sample with a primer pair as described herein, then performing a nucleic acid amplification reaction sufficient to produce an amplicon comprising a DNA molécule having at least one sequence selected from SEQ ID NO:I, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10 and then detecting the presence and/or absence of the amplicon. Such a method may also include sequencing the amplicon or a fragment thereof, which would be determinative of, Le., diagnostic for, or characteristic of, the presence of the soybean event GM_CSM63770 spécifie DNA in the target DNA sample. Other primer pairs may be readily designed by one of skill in the art and should comprise at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, 5 at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 contiguous nucléotides of sequences provided in, but not limited to SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10, and be sufficiently unique to soybean event GMCSM63770 DNA in order to identify DNA derived from the event.
    [0133] The kits and détection methods of the invention are useful for, among other things, identifÿing soybean event GM_CSM63770, selecting plant varieties or hybrids comprising soybean event GM_CSM63770, detecting the presence of DNA derived from the transgenic soybean plant comprising event GM_CSM63770 in a sample, and monitoring samples for the presence and/or absence of soybean plants comprising event GM_CSM63770, or plant parts derived from soybean plants comprising event GM_CSM63770.
    [0134] The sequences of the heterologous DNA insert. junction sequences, or flanking sequence from soybean event GM_CSM63770 can be verified (and corrected if necessary) by amplifÿing such sequences from the event using primers derived from the sequences provided herein followed by standard DNA sequencing of the amplicon or of the cloned DNA.
    |0135| Methods of detecting the zygosity of the transgene allele of DNA derived from a soybean cell, soybean tissue, soybean seed, or soybean plant comprising soybean event GM_CSM63770 in a sample are provided. One method comprises (i) extracting a DNA sample from at least one soybean cell, soybean tissue, soybean seed, or soybean plant; (ii) contactîng the DNA sample with a primer pair that is capable of producing a first amplicon diagnostic for, or characteristic of, soybean event GM CSM63770; (iii) contactîng the DNA sample with a primer pair that is capable of producing a second amplicon diagnostic for, or characteristic of, native soybean genomic DNA not comprising soybean event GM_CSM63770; (iv) performing a DNA amplification reaction; and then (v) detecting the amplicons, wherein the presence of only the first amplicon is diagnostic of a homozygous soybean event GM_CSM63770 DNA in the sample, and the presence of both the first amplicon and the second amplicon is diagnostic of a soybean plant heterozygous for i
    
    soybean event GMCSM63770 allele. An exemplary set of primers pairs are presented as SEQ ID NO:l4 and SEQ ID NO:l5 which produce an amplicon diagnostic for, or characteristic of, event GM CSM63770; and SEQ ID NO:20 and SEQ ID NO:l5 which produces an amplicon diagnostic for, or characteristic of, the wild-type soybean genomic DNA not comprising soybean 5 event GM CSM63770. A set of probes can also be incorporated into such an amplification method to be used in a real-time PCR format using the primer pair sets described above. An exemplary set of probes are presented as SEQ ID NO: 16 (diagnostic for, or characteristic of, the amplicon for the soybean event GM CSM63770) and SEQ ID NO:2I (diagnostic for, or characteristic of, the amplicon for wild-type soybean genomic DNA not comprising soybean event GM_CSM63770).
    [0136| Another method for determining zygosity comprises (i) extracting a DNA sample from at least one soybean cell, soybean tissue, soybean seed, or soybean plant; (ii) contacting the DNA sample with a probe set which contains at least a first probe that specifically hybridizes to event GM_CSM63770 DNA and at least a second probe that specifically hybridizes to soybean genomic DNA that was disrupted by insertion ofthe heterologous DNA of soybean event GM_CSM63770 15 and does not hybridîze to soybean event GM_CSM63770 DNA; (iii) hybridizing the probe set with the sample under stringent hybridization conditions, wherein detecting hybridization of only the first probe under the hybridization conditions is diagnostic for, or characteristic of, a homozygous allele of soybean event GM_CSM63770 DNA in the sample; and wherein detecting hybridization of both the first probe and the second probe under the hybridization conditions is diagnostic for, or characteristic of, a heterozygous allele of soybean event GM CSM63770 in a DNA sample.
    |0137] Yet another method for determining zygosity comprises (i) extracting a DNA sample from at least one soybean cell, soybean tissue, soybean seed, or soybean plant; (ii) contacting the DNA sample with a primer pair that is capable of producing an amplicon diagnostic for, or characteristic 25 of, the allele of soybean vent GM_CSM63770; (iii) contacting the DNA sample with a primer pair that is capable of producing an amplicon of an internai standard known to be single-copy and homozygous in the soybean plant; (iv) contacting the DNA sample with a probe set which contains at least a first probe that specifically hybridizes to the allele of event GM_CSM63770, and at least a second probe that specifically hybridizes to the internai standard genomic DNA known to be 30 single-copy and homozygous in the soybean plant; (v) performing a DNA amplification reaction
    
    using real-time PCR and determining the cycle thresholds (Ct values) of the amplicon corresponding to the toxin coding sequence and the single-copy, homozygous internai standard; (vi) calculating the différence (ACt) between the Ct value of the single-copy, homozygous internai standard amplicon and the Ct value ofthe toxin coding sequence amplicon; and (vii) determining 5 zygosity, wherein a ACt of around zéro (0) indicates homozygosity of the inserted T-DNA and a ACt of around one (!) indicates heterozygosity of the inserted T-DNA. Heterozygous and homozygous events are differentiated by a ACt value unit of approximately one (I). Given the normal variability observed in real-time PCR due to multiple factors such as amplification efficiency and idéal annealîng températures, the range of “about one (1)” is defined as a ACt of 10 0.75 to 1.25. Primer pairs and probes for the above method for determining zygosity can amplifÿ and detect amplicons from the allele of event GM_CSM63770 and internai standard. Exemplary primer pairs for the détection of the amplicons corresponding to the allele of event GMCSM63770 and internai standard are presented as SEQ ID NO: 14 combined with SEQ ID NO:15 (allele of event GM_CSM63770) and SEQ ID NO:17 combined with SEQ ID NO:18 15 (internai standard). The accompanying exemplary probes are presented as SEQ ID NO: 16 (allele of event GM_CSM63770) and SEQ ID NO: 19 (internai standard).
    DEPOSIT INFORMATION |0138] A deposit of a représentative sample of soybean seed containing event GMCSM63770 20 was made on August 21,2019, according to the Budapest Treaty with the American Type Culture Collection (ATCC) having an address at 10801 University Boulevard. Manassas, Virginia USA, Zip Code 20110, and assigned ATCC Accession No. PTA-126048. Access to the deposits will be available during the pendency of the application to the Commissioner of Patents and Trademarks and persons determined by the Commissioner to be entitled thereto upon request. Upon issuance 25 of the patent, ail restrictions upon availability to the public will be irrevocably removed. The deposit will be maintained in the depository for a period of thirty (30) years, or five (5) years after the last request, or for the effective life of the patent, whichever is longer, and will be replaced as necessary during that period.
    EXAMPLES
    [0139] The following Examples are included to more fully describe the invention. Summarized are the construction and testing of 125 constructs, the production of 3,343 events, and the analysis of hundreds of thousands individual plants over 6 years through the rigorous molecular, agronomie, and field testing required for the création and sélection of soybean event GM_CSM63770.
    [0140] Those of skill in the art should, in light of the présent disclosure, appreciate that many changes can be made in the spécifie embodiments that are disclosed and still obtain a like orsimilar resuit without departing from the spirit and scope of the invention.
    EXAMPLE 1
    Expression Cassette Testing, Construct Design, Construct Sélection, Molecular Characterization, Effîcacy Testing, Field Trials, and Event Sélection
    [0141| It is often necessary to create and screen a large number of gene expression constructs and transformation events in order to identify a construct. and then an event, which demonstrates optimal expression of the introduced genes of interest, while also not producing agronomie or phenotypic off-types.
    [0142| For these reasons, the development of a transgenic soybean plant comprising insecticidal proteins that were active against Lepidopterans without any négative effects on agronomics, yield, or stacking viability required extensive research, development, and analysis. Specifically, 6 year period, approximately 3,343 proof of concept and commercial transgenic events derived from 125 different plasmid vector constructs were developed, tested, and analyzed.
    [0143] This Example describes the design and testing in soybean plants of 125 different constructs, to identify the preferred construct for event création. Each construct varied with respect to the coding sequences for the insecticidal proteins and the transcriptional regulatory éléments, and these were tested to select the preferred construct for use in expressing the insecticidal proteins in plants. Each construct had a unique configuration, varying by expression cassette composition (both insecticidal proteins and expression éléments), orientation, and whether or not proteins were targeted for insertion into the chloroplast.
    [0144| In an initial proofof concept and developmental stage, 121 constructs comprising different combinations of29 distinct promoters, I enhancer, 16 distinct introns, and 21 distinct insect toxin coding sequences, and 10 distinct 3' UTRs were used to generale approximately 992 transformed events. These events were evaluated for phenoty pic or agronomie off-types, the level of expression of the insect toxin proteins, and efficacy against selected Lepidopteran insect pest species. The resulting efficacy and protein expression data, along with any information regarding phenotypic and agronomie off-types was used to eliminate ineffïcacious proteins, expression éléments and combinations, and was used to design a smaller number of binary commercial transformation plasmid constructs to be used in the next phase of development.
    [0145] In the next phase of development. 4 new commercial constructs were created. These constructs comprised combinations of 2 to 3 insect toxin transgene expression cassettes in different orientations (convergent or divergent). One of the constructs was eliminated prier to transformation based upon studies of the mode of action of one of the insect toxin proteins expressed in the construct. The remaining 3, pM63770, Construct-2, and Construct-3 were used to generate transformed events (also referred to as “transformants”). Table 2 below shows the event sélection and élimination process for ali three of the commercial construct transformed events.
    Table 2. Event sélection and élimination of stably transformed soybean events, leading to sélection of GM CSM63770.
    | Construct pM63770 | Construct-2 | Construct-3 | ||||
| Stage Analysis | Eliminated | Total Left | Eliminated | Total Left | Eliminated | Total Left | 
| Events Plugged | 3780 | 6911 | 3696 | |||
| Transplanted to soil | 2760 | 1020 | 6509 | 402 | 2767 | 929 | 
| Discarded. didn’t survive | 860 | 160 | 220 | 182 | 797 | 132 | 
| Ru molecular and efficacy | 115 | 45 | 118 | 64 | 94 | 38 | 
| Ri molecular | 13 | 32 | 19 | 45 | 12 | 26 | 
| Ri zygosity | 9 | 23 | 16 | 29 | 7 | 19 | 
| Construct pM63770 | Construct-2 | Construct-3 | ||||
| Stage Analysis | Eliminated | Total Left | Eliminated | Total Left | Eliminated | Total Left | 
| R, Pre-GSS Molecular, performance, maturity | 13 | 10 | 8 | 21 | 19 | 0 | 
| R? GSS molecular, lesser performer | 1 | 9 | 7 | 14 | ||
| Yield | 1 | 8 | 1 | 13 | ||
| Fai led cross | 1 | 7 | 0 | 13 | ||
| Fïeld trial, molecular, yield | 5 | 2 | 12 | 1 | ||
| Molecular eSouthem and flanking sequence | 1 | 1 | ||||
| Selected Event | GM_CSM63770 | 
[0146] After shoot formation in culture, a subset of the transformed events was selected based upon visual characteristics and early molecular analysis. After transformation. 12,036 transformants were transferred to culture plates containing sélective media (also referred to as “plugged”). After initial molecular characterization 9,685 were eliminated. Of the remaîning 2,351 events 1,877 were eliminated based upon observations of plant health and survival. The remaîning 474 Ru events were transplanted to pots and grown in the greenhouse (GH) for further assay. The 474 events were evaluated for molecular characteristics and efficacy, and based upon these studies, 327 events were eliminated.
    [0147] The remaîning 147 Ro events were allowed to self-pollinate, producing Ri seed. The R, events were further characterized molecularly, assessed for zygosity, performance and maturity. From this analysis, 116 events were eliminated. At this point of sélection, it was also observed that the events derived from Construct-3 did not meet the criteria for advancement. and this construct and its associated events were eliminated from further testing and analysis. The remaining 9 events derived from construct pM63770 and 14 events from Construct-2 were selected for further molecular characterization and évaluation in field studies.
    |(H48| During the R2 génération, the events were further evaluated with respect to molecular characteristics and performance. During the Argentina growing season of 2017 to 2018, 23 events (9 events derived from construct pM63770 and 14 events from Construct-2) were evaluated for efficacy in screen house and field trials, and agronomics in field trials. 1 event derived from the construct pM63770 was eliminated and 7 events derived from Construct-2 were also eliminated based upon the R2 criteria (molecular characteristics and efficacy). 1 event derived from each of the two constructs was eliminated based upon yield measurements. Another event derived from construct pM63770 was eliminated after failing to crossbreed with elite germplasm material.
    |0149| The remaining 20 events, 7 derived from construct pM63770 and 13 derived from Construct-2 were assessed for efficacy in screen house and field trials and field agronomie trials. In addition, further molecular studies were performed which included identification of the locus of insertion of the T-DNA for each event. neîghboring genes, and répétitive sequences near the locus of insertion. After reviewing the efficacy and agronomie data, as well as the finer molecular characterization, 5 events derived from construct pM63770 and 12 events derived from Construct2 were eliminated, leaving only 2 events derived from construct pM63770 and 1 event derived from Construct-2. 1 event derived from construct pM63770 was eliminated after review of the flanking sequence details provide by electronic Southern (eSouthern) data. Event GM_CSM63770 derived from construct pM63770 was selected as the commercial product based upon a final comparison of yield, efficacy and molecular characteristics between each single remaining event derived from construct pM63770 and Construct-2.
    [0150] Thus, numerous rounds of testing and comparison of various constructs revealed that the transgene cassette provided as SEQ ID NO: 13, Construct pM63770, when compared to events 25 produced with ail other constructs evaluated, produced events which exhibited superior efficacy against the Lepidopteran pest species Soybean podworm (SPW, Helicoverpa zea), Soybean looper (Chrysodeixis includens), Velvet bean Caterpillar (AMicarsia gemmatalis), Southern armyworm (Spodoptera eridania), Black armyworm (Spodoptera cosmioides), South American podworm (Helicoverpa gelotopoeon), Sunflower looper (Rachiphmia nu), Bean shoot moth (Crocidosema aporetna), Green cloverworm (Hypena scabra) and Lesser comstalk borer (Elasmopalpus lignoselius). Soybean event GM_CSM63770 was selected from the large group of events generated using this pM63770 construct. based upon its superior characteristics with respect to efficacy and agronomie performance in comparisons to other events generated using this construct.
    EXAMPLE 2
    Soybean event GM_CSM63770 Demonstrates Résistance to the Lepidopteran Insect Pests Soybean podworm, Soybean looper, Velvet bean Caterpillar, Southern armyworm, Black armyworm, South American podworm, Sunflower looper, Bean shoot moth, Green cloverworm, and Lesser cornstalk borer.
    |015l| This Example describes the activity of the soybean event GM_CSM63770 against several different Lepidopteran insect pests of soybean. The insect toxin proteins CrylA.2 and CrylB.2, when expressed together in soybean event GMCSM63770, provide résistance to Soybean podworm (SPW, Helicoverpa zea), Soybean looper (SBL, Chrysodeixis inchtdens), Velvet bean Caterpillar (VBC, Anticarsia gemmalalis). Southern armyworm (SAW, Spodoptera eridania), Black armyworm (BLAW, Spodoptera cosmioides), South American podworm (SAPW, Helicoverpa gelotopoeon), Sunflower looper (SFL, Rachiplusia nu), Bean shoot moth (BSM, Crocidosema aporema), Green cloverworm (GCW, Hypena scabra), and Lesser cornstalk borer (LCSB, Elasmopalpus lignosellus).
    |0152] Screenhouse trials were conducted in three locations to assess résistance to Southern armyworm (SAW, Spodoptera eridania) at Velvet bean Caterpillar (VBC, Anticarsiagemmalalis). and Soybean podworm (SPW, Helicoverpa zea). Soybean event GM_CSM63770 along with events derived from transformations from constructs, pM63770, Construct-2, and Construct-3 were evaluated using a randomized complété block design. Each event plot was planted in a 6foot row with approximately 8 seed per foot. Each event had 3 reps; hence each event was represented in the screenhouse by 3 separate plots, randomly located within the screenhouse. A non-transformed event served as a négative control whose plots were also randomly assigned to locations within the screenhouse.
    [0153] Infestation of SPW and VBC was accomplished using adult moths. The insects were reared to pupae in insectary adult emergence cages, maintained in climate-controlled incubators. The
    
    insects were released in the screenhouse. Approximately 1,200 to 2,000 adults were used for each release in the screenhouses. For SPW, adults were released in the screenhouse each week from the RI to R2 stage of soybean development. With respect to VBC, adults were released in the screenhouse bi-weekly between the developmental stages of V4 to R3. Approximately 1.200 to
    2,000 adults were released each time in the screenhouses. Adult moths required continuous access to a I0 percent sucrose solution for normal longevity and fecundity. Plastic food containers were flIled with absorbent cotton and then the sugar solution was poured into the container to completely saturate the cotton. The sugar solution was replenished daily until adult activity subsided which was usually around 2 weeks after the final release of adults.
    [0154| Direct egg infestation was used SAW since this insect does not oviposit preferentially or uniformly on soybean. Approximately 250,000 to 320,000 eggs were used for each infestation applied bi-weekly from RI to R3 stage ofdevelopment. Pièces ofpapercontaining equal numbers of SAW eggs were attached to plants by folding the paper over a sturdy leaf petiole in the upper canopy and stapling the paper together securely. 1 paper was placed on a plant within 1 foot of the front end of the plot, a second paper was placed on a plant in the middle ofthe plot, and a third paper was placed on a plant within 1 foot of the back end of the plot.
    [0155| Défoliation for ail three insects was evaluated twice after each infestation: once about 2 weeks after infestation and again at approximately four weeks after infestation. The stage of plant growth and percent défoliation were recorded after each évaluation. To détermine percent 20 défoliation, the canopy of each plot was divided into 5 zones. A trifoliate leaf was selected from each zone that exhibited damage représentative of the zone from which it was selected. The percent défoliation was determined using a damage chart figure provided to each evaluator. The average percent défoliation was calculated from the average of a single, selected trifoliate leaf from each ofthe 5 zones. Pod production and damage for SPW was determined at maturity ofthe soybean plant. Five plants were randomly selected from each plot and the total number of pods and number of damaged pods on each plant were recorded. The mean number of pods and the mean percent damaged pods was determined from the sampling of the 5 plants. Table 3 below shows the mean percent défoliation assessed for soybean event GM CSM63770 and the négative control for ail three insects, SAW, VBC, and SPW. Table 4 below show the mean number of pods and the mean percent damaged pods caused by SPW.
    Table 3. Meau percent défoliation for soybean event GMCSM63770 and négative control infested with SAW, VBC, and SPW in 2017 US screenhouse trials.
    | Mean % Défoliation | |||||||||
| Event | RI | R2 | R3 | R4 | Early R5 | Late R5 | Max | o/ /o Réduction | |
| SAW | Négative | - | 2% | 30% | 45% | 63% | 58% | 63% | - | 
| GMCSM63770 | - | 0% | 1% | 0% | 0% | 1% | 1% | 98% | |
| VBC | Négative | - | 30% | 34% | - | - | - | 34% | - | 
| GM_CSM63770 | - | 0% | 0% | - | - | - | 0% | 100% | |
| SPW | Négative | 7% | 13% | - | 26% | 27% | 27% | - | |
| GM_CSM63770 | 1% | 3% | - | 11% | 10% | - | 11% | 60% | 
Table 4. Mean nom ber of pods and mean percent damaged pods for soybean event GM CSM63770 and négative control infested with SPW in 2017 US screenhouse trials.
    | Event | Mean Number Pods | Averaged % Damaged | % Réduction Pod Damage | 
| Négative | 25 | 8% | - | 
| GM_CSM63770 | 47 | 5% | 36% | 
[0156] As can be seen in Table 3 above, soybean event GM CSM63770 provided superior résistance to SAW, VBC, and SPW when compared to the négative control. In addition, as can be seen in Table 4, soybean event GMCSM63770 demonstrated a reduced percentage of damaged pods relative to the négative control.
    [0157] Screenhouse and fteld efficacy trials were performed. Each plot in the screenhouse comprîsed a row of 42 seed in a 2-meter row. Each event was represented by 3 reps randomly located within the screenhouse. Screenhouse trials were conducted against the lepidopteran insect pests, Velvet bean Caterpillar (VBC, Anticarsia gemmatalis), Black armyworm (BLAW,
    Spodoptera cosnùoîdes), South American podworm (SAPW, Helicoverpa gelotopoeon), and Sunflower looper (SFL, Rachiplusia nu). Approximately 500 adult moths were released into the screenhouse for each infestation. Two infestations were performed, the first at V3 stage of development and the second at R2 stage of development. Adult moths were maintained as described above using a 10 percent sugar solution to saturate absorbent cotton in a container. The percent défoliation was determined as described above. Table 5 below shows the mean percent défoliation determined for soybean event GM CSM63770 and the négative control.
    Table 5. Mean percent défoliation for soybean event GMCSM63770 and négative control infested with BLAW, SAPW, SBL, and SFL.
    | Mean % Défoliation | ||||||||
| Event | V3 | V4 | V5 | R3 | R5 | Max | o/ /0 Réduction | |
| BLAW | Négative | 9% | 28% | - | 33% | 39% | 39% | - | 
| GM_CSM63770 | 0% | 0% | - | 0% | 0% | 0% | 100% | |
| SAPW | Négative | - | 16% | 29% | 38% | 48% | 48% | - | 
| GM_CSM63770 | - | 1% | 1% | 3% | 2% | 3% | 94% | |
| SBL | Négative | 9% | 13% | - | - | - | 13% | - | 
| GM_CSM63770 | 0% | 0% | • | - | - | 0% | 100% | |
| SFL | Négative | - | 10% | 17% | 21% | 37% | 37% | - | 
| GM_CSM63770 | * | 0% | 0% | 0% | 0% | 0% | 100% | 
[0158] As can be seen in Table 5 above, soybean event GM_CSM63770 demonstrated very good résistance against BLAW, SAPW, SBL, and SFL when compared to the négative control.
    [0159J Field efficacy trials were also conducted in six different locations (A-F). Each plot was comprised of 4, 10 meter rows with 25 seed per meter separated by approximately 1 meter. Each event had 3 replicate plots randomly located within the field. Sampling in the fields was performed to détermine the types of Lepidopteran species and their respective percentage in each field. The Lepidopteran species noted in the field were Velvet bean Caterpillar (VBC, Anticarsia gemmatalis), the looper species (SBL/SFL) Soybean looper (SBL, Chrysodeixis includens) and Sunflower looper (SFL, Rachiplusia nu), Spodoptera spp. (SPO), and South American podworm (SAPW, Helicoverpa gelotopoeon). Insect monitoring began at the beginning of V3 stage in the non-transgenic border rows with at least 10 samples evenly distributed around the border.
    Sampling was performed in the border rows every 7 to 10 days. Monitoring was continued until R6 stage where pod filI is complété. Défoliation was determined in a similar manner as that in the screenhouse trials. Pod damage was also performed in a similar manner as that for the screenhouse experiments. In addition, the number of larvae per meter of a planting row was also recorded. Less Lepidopteran larvae présent on the transformed events when compared to the négative control 10 plants is an indication of résistance, since résistant plants will kill the young larvae, leaving few to remain on the plant. Table 6 below shows the maximum défoliation, cumulative larvae per meter row, and the mean percent pods damaged. In addition, the percent of each Lepidopteran species is also provided for each location.
    (0160] As can be seen in Table 6 below, soybean event GM_CSM63770 demonstrated 15 Lepidopteran résistance in the field under natural infestations when compared to the négative control. The major Lepidopteran pest species in most of the fields were VBC and SBL/SFL. One location had a large percentage of SAPW and little to no VBC. From the results below, GM CSM63770 was efficacious against VBC, SBL/SFL, and SAPW as demonstrated by the percent réduction in défoliation, lower amounts of cumulative larvae per meter row, and a 20 réduction in pod damage.
    Table 6. Maximum défoliation, cumulative larvae, and mean percent pod damage for soybean event GM_CSM63770 and négative control under natural fîeld infestations.
    | Location | Insects | Event | Max % Défoliation | % Réduction Défoliation | Cumulative Larvae/m Row | % Réduction Larvae | Mean # Pods/Plant | Mean % Pods Damaged | % Réduction Pod Damage | 
| A | VBC-64% SBL/SFL20% SPO-13% SAPW-3% | Négative | 13 | - | 9.3 | - | 31.3 | 3.2% | - | 
| GM_CSM63770 | 2 | 85% | 1.2 | 30.3 | 0.0% | 100% | |||
| B | SBL/SFL60% SAPW-40% | Négative | 3 | - | 6.7 | - | 37.2 | 4.2% | - | 
| GM_CSM63770 | 0 | 100% | 0.0 | 100% | 32.6 | 0.0% | 100% | ||
| C | VBC-67% SBL/SFL23% SPO-9% | Négative | 16 | - | 19.4 | - | 24.0 | 0.0% | - | 
| GM_CSM63770 | 3 | 81% | 3.8 | 80% | 23.3 | 0.0% | - | ||
| D | SBL/SFL67% SAPW-22% SPO-10% VBC-l% | Négative | 8 | - | 9.9 | - | 25.3 | 4.2% | - | 
| GM_CSM63770 | 5 | 37% | 0.0 | 100% | 30.7 | 1.1% | 74% | ||
| E | VBC-86% SBL/SFL11% SPO-3% | Négative | 15 | - | 8.4 | - | 18.8 | 4.4% | - | 
| GM_CSM63770 | 7 | 53% | 0.5 | 94% | 25.2 | 0.0% | 100% | ||
| F | SBL/SFL62% VBC-23% SPO-8% SAPW-7% | Négative | 15 | - | 6.2 | - | 23.6 | 2.3% | - | 
| GM_CSM63770 | 1 | 93% | 0.3 | 95% | 18.2 | 0.0% | 100% | 
)0161 j The plants in two of the locations were also examined for damage by Bean shoot moth (BSM, Crocidosema aporema). Ten plants were randomly selected from each of the three plots for each event. The average percent damage for the Controls in location I and location 2 was 6 percent and 4.7 percent, respectively. Soybean event GMCSM63770 demonstrated no damage 5 at location I and only 0.3 percent damage at location 2.
    |01621 Screenhouse effîcacy trials were conducted in multiple locations against the Lepidopteran insect pest species Southern armyworm (SAW, Spodoptera eridania) Soybean looper (SBL, Chrysodeixis includens) Soybean podworm (SPW, Helicoverpa zea), and Velvet bean Caterpillar (VBC, Anticarsia gemmatalis). SBL, SPW, and VBC infestations were performed using adult 10 moths as previously described. SAW infestations were performed by egg infestation as previously described. Défoliation was determined as previously described. Plot sizes and répétitions were also as described above. Table 7 below shows the infestation frequency, the stages in which infestation occurred, the percent maximum défoliation, and the percent réduction in défoliation corresponding to event GMCSM63770 in comparison to the négative control.
    Table 7. Infestation frequency and stages, and percent maximum défoliation and réduction for soybean event GM_CSM63770 and négative control infested with SAW, SBL, SPW, and VBC.
    | Insect | Location | Event | Infestation Frequency | Infestation Growth Stages | % Max Défoliation | o/ /0 Réduction | 
| SAW | G | Négative | Biweekly | RI-R3 | 80% | - | 
| GM_CSM63770 | Biweekly | RI-R3 | 0% | 100% | ||
| SBL | H | Négative | Biweekly | V5-R2 | 23% | - | 
| GM_CSM63770 | Biweekly | V5-R2 | 0% | 100% | ||
| Négative | Biweekly | R3-R5 | 41% | - | ||
| GM_CSM63770 | Biweekly | R3-R5 | 0% | 100% | ||
| G | Négative | Biweekly | V5-R2 | 75% | - | |
| GM_CSM63770 | Biweekly | V5-R2 | 1% | 99% | 
| Insect | Location | Event | Infestation Frequency | Infestation G row t h Stages | % Max Défoliation | % Réduction | 
| SPW | I | Négative | Weekly | RLR2 | 16% | - | 
| GM_CSM63770 | Weekly | R1-R2 | 2% | 91% | ||
| VBC | 1 | Négative | 2x Biweekly | V5-R2 | 20% | - | 
| GMCSM63770 | 2x Biweekly | V5-R2 | 0% | 100% | 
[0163| As can be seen in Table 7 above, soybean event GM_CSM63770 was efficacious against SAW, SBL, SPW, and VBC as demonstrated in the lower percent maximum défoliation and percent réduction in défoliation relative to the négative control. In these studies, soybean event GM_CSM63770 provided résistance to Southern armyworm (SAW, Spodoptera eridania), Soybean looper (SBL, Chrysodeixis includens), Soybean podworm (SPW, Helicoverpa zea), and Velvet bean Caterpillar (VBC, Anticarsia gemniatalis).
    [0164j Field efficacy trials were conducted against natural Lepidopteran pressure at five different locations (J-N). Each plot was comprised of approximately 4, 25 foot rows with approximately 8 seed per foot. Each event was represented by 4 plots randomly located within the field. Measurements of défoliation were performed in a similar manner as described above and conducted approximately every 10 days from RI to R6 stages of development. Pod damage was assessed after the occurrence of maximum damage to the négative Controls. 5 plants were randomly selected for each event to assess pod damage. Lepidopteran species population assessments were conducted during the RI to R6 developmental stages. One or more fields were found to be infested by Velvet bean Caterpillar (VBC, Anticarsia gemniatalis), Soybean looper (SBL, Chrysodeixis includens), Soybean podworm (SPW, Helicoverpa zea), Green cloverworm (GCW, Hypena scabra), Yellowstriped armyworm (YAW, Spodoptera ornithogalli), and Beet armyworm (BAW, Spodoptera exigua). The number of cumulative larvae per meter of row was also determined for each event. Table 8 below shows the percent lepidopteran species for each
    
    site along with the percent maximum and réduction in défoliation, and the cumulative number of larvae per meter row and the percent réduction of larvae.
    Table 8. Lepidopteran species, percent maximum and réduction défoliation, cumulative 5 number, and percent réduction of larvae for soybean event GMCSM63770 and négative control in fïelds under natural infestation.
    | Location | Insects | Event | % Max Défoliation | % Réduction Défoliation | Cumulative Larvae/m Row | % Réduction Larvae | 
| J | VBC-45% SBL-30% GCW23% YAW-2% | Négative | 31% | - | 29.8 | - | 
| GM CSM63770 | 0 | 100% | 0.4 | 99% | ||
| K | SBL-85% VBC-1% GCW-2% SPW-8% BAW-2% YAW-1% | Négative | 13% | - | 25.9 | - | 
| GM CSM63770 | 0% | 100% | 0.2 | 99% | ||
| L | SBL-62% VBC-33% GCW-5% | Négative | 50% | - | 183.5 | - | 
| GM CSM63770 | 1% | 99% | 0.3 | 100% | ||
| NI | GCW65% SBL-29% VBC-4% SPW-1% BAW-1% | Négative | 5% | - | 21.4 | - | 
| GM CSM63770 | 0% | 100% | 0.0 | 100% | ||
| N | SBL-93% SPW-5% SMC-1% GCW-1% | Négative | 34% | - | 26.7 | - | 
| GM CSM63770 | 0% | 100% | 0.0 | 100% | 
[0165] As can be seen in Table 8 above, based upon the percentage of the more prominent 10 Lepidopteran species in each field, soybean event GMCSM63770 was efficacious against Velvet bean Caterpillar (VBC, Anticarsia gemmatalis), Soybean looper (SBL, Chrysodeixis includens), and Green cloverworm (GCW, Hypena scabra) as demonstrated in the percent réduction in défoliation and percent réduction of larvae for soybean event GM_CSM63770 when compared to the négative control. For example, in location D, the most prédominant insect pest species were
    
    GCW and SBL and represented ninety-four percent (94%) ofthe total species observed in that field. The lack of larvae observed for GM_CSM63770 support that this event was highly résistant to these two species, since no living larvae could be found on the event entries, while over 2I larvae were observed per meter of row for the négative control.
    |0166| Pod damage was assessed in location M, where the prédominant pest species was SBL.
    Table 9 shows the mean percent pods damaged and the percent réduction of pod damage for soybean event GM_CSM63770.
    Table 9. Mean percent and réduction of pod damage for soybean event GM_CSM63770 and 10 négative control.
    | Location | Insects | Event | Mean # Pods/Plant | Mean % Pods Damaged | 0/ /0 Réduction Pod Damage | 
| M | SBL-85% VBC-1% GCW-2% SPW-8% BAW-2% YAW-1% | Négative | 45.1 | 2.60% | - | 
| GM CSM63770 | 40.8 | 0.50% | 80% | 
[0167] As can be seen in Table 9 above, while both soybean event GM_CSM63770 and the négative control had a similar number of pods per plant, event GM_CSM63770 demonstrated an 15 80 percent réduction in pod damage in a field wherein most of the Lepidopteran insects were SBL.
    Soybean event GM CSM63770 demonstrated résistance to SBL.
    [0168] Based upon measurements of défoliation, number of larvae, and pod damage in naturally infested fields, soybean event GMCSM63770 was efficacious against the Lepidopteran insect pests Velvet bean Caterpillar (VBC, Anticarsia gemmatalis), Soybean looper (SBL, Chrysodeixis 20 includens), and Green cloverworm (GCW, Hypena scabra).
    [0169] Screenhouse and Field efficacy studies were conducted in two locations (O-P). Screenhouse trials were planted in Acevedo and Fontezuela in the Province of Buenos Aires and were conducted against the lepidopteran insect pests, Velvet bean Caterpillar (VBC, Anticarsia gemmatalis), Black armyworm (BLAW, Spodoptera cosmioides), South American podwonn
    
    (SAPW, Helicoverpa gelotopoeon), Soybean looper (SBL, Chrysodeixis includens), and Sunflower looper (SFL, Rachiplusia nu). Three plots similar to those described above for the 2017-20I8 Argentina screenhouse trials were randomly located within the screenhouse. Each event was represented by three plots. Each screenhouse was infested with adult moths and maintained on a sugar diet as previously described. Measurements of défoliation were performed as previously described. Table I0 below shows the plant growth stages in which infestation occurred, the maximum percent and percent réduction in défoliation for each ofthe insect species from the twO locations.
    Table 10. Maximum percent défoliation and percent réduction of défoliation for soybean event GMCSM63770 and négative control.
    | Insect | Location | Infest-1 Infest-2 | Event | Max Défoliation | O/ /d Défoliation Réduction | 
| BLAW | O | LV R2 | Négative | 23% | - | 
| GM_CSM63770 | 0% | 100% | |||
| SAPW | RI R2 | Négative | 33% | - | |
| GM_CSM63770 | 2% | 94% | |||
| SFL | LV R2 | Négative | 25% | - | |
| GM_CSM63770 | 0% | 100% | |||
| VBC | LV R2 | Négative | 23% | - | |
| GM_CSM63770 | 0% | 100% | |||
| BLAW | P | LV R2 | Négative | 27% | - | 
| GM_CSM63770 | 1% | 96% | |||
| SAPW | RI R2 | Négative | 53% | - | |
| GM_CSM63770 | 2% | 96% | |||
| SFL | LV R2 | Négative | 28% | - | |
| GM_CSM63770 | 0% | 100% | |||
| SBL | Négative | 47% | - | 
| Insect | Location | Infest-1 lnfest-2 | Event | Max Défoliation | o/ /0 Défoliation Réduction | 
| R3 R5 | GM_CSM63770 | 0% | 100% | 
[0170] As can be seen in Table 10 above, soybean event GMCSM63770 was efficacious against
    Velvet bean Caterpillar (VBC, Anticarsia genimalalis), Black armyworm (BLAW, Spodoptera cosmioides), South American podworm (SAPW, Helicoverpa geloiopoeon), Soybean looper 5 (SBL, Chrysodeixis includens), and Sunflower looper (SFL, Rachiplusia nu).
    [0171] Field trials in five locations (Q-U). Sampling in the fields was performed to détermine the types of Lepidopteran species and their respective percentage in each field. The Lepidopteran species noted in the field were Velvet bean Caterpillar (VBC, Anticarsia gemmatalis), the looper species (SBL/SFL) Soybean looper (SBL, Chrysodeixis includens) and Sunflower looper (SFL, 10 Rachiplusia nu), Spodoptera spp. (SPO), and South American podworm (SAPW, Helicoverpa geloiopoeon). Each plot was comprised of 4, 8 meter rows w ith 25 seed per row. Each event w'as represented by 3 replica plots randomly located within the field. Measures of défoliation, cumulative larvae, and pod damage were as previously described. Table I I shows the percent maximum défoliation and percent réduction in défoliation; the cumulative larvae per meter row 15 and percent réduction in larvae; the mean percentage of pods damaged and the percent réduction in pod damage for GM_CSM63770 and négative control.
    Table 11. Maximum défoliation, cumulative larvae, and mean percent pod damage for soybean event GM_CSM63770 and négative control under natural fîeld infestations in Argentina during the 2017-2018 growing season.
    | Location | Insects | Event | % Max défoliation | % Réduction Défoliation | Cumulative larvae/m row | % Réduction Larvae | Mean # pods/plant | Mean % pods damaged | % Réduction Pod Damage | 
| Q | SBL/SFL47% VBC-30% SPO-11% SAPW13% | Négative | 14% | - | 6.4 | - | 33.2 | 0.2% | - | 
| GM_CSM63770 | 1% | 91% | 0.1 | 99% | 33.5 | 0.0% | 100% | ||
| R | VBC-49% SBL/SFL30% SPO-19% SAPW-3% | Négative | 9% | - | 12.4 | - | 39.4 | 0.1% | - | 
| GM_CSM63770 | 2% | 78% | 0.3 | 98% | 33.6 | 0.2% | 0% | ||
| S | VBC-81% SBL/SFL12% SPO-1% SAPW-6% | Négative | 7% | - | 40.6 | - | 33.3 | 1.4% | |
| GM_CSM63770 | 0% | 97% | 0 | 100% | 36.1 | 0.0% | 100% | ||
| T | VBC-92% SBL/SFL1% SPO-7% SAPW-0% | Négative | 6% | « | 18.9 | - | - | - | |
| GM_CSM63770 | 2% | 64% | 1.6 | 92% | 26.1 | 0.0% | 100% | ||
| U | Négative | 12% | - | 6.7 | - | 33.7 | 1.8% | - | 
| Location | Insects | Event | % Max défoliation | % Réduction Défoliation | Cumulative larvae/m row | % Réduction Larvae | Mean # pods/plant | Mean % pods damaged | % Réduction Pod Damage | 
| VBC-48% SBL/SFL41% SPO-8% SAPW-3% | GM_CSM63770 | l% | 89% | O.l | 99% | 35.6 | 0.3% | 81% | 
[0172] As can be seen in Table 11 above, the largest percentage of Lepidopteran insect pests in the fields of location Q and U were VBC and SBL/SFL, whereas VBC was the prédominant insect pest in the fields of location S. From the results above, soybean event GMCSM63770 was efficacious against VBC and SBL/SFL as demonstrated by the percent réduction in défoliation, 5 lower amounts of cumulative larvae per meter row, and a réduction in pod damage.
    [0173] Soybean event GM_CSM63770 was assayed against Lesser cornstalk borer (LCSB, Elasmopalpus lignosellus) using a leaf dise assay. Eight (8) plants from soybean event GM_CSM63770 and a négative control were grown in the greenhouse. Sixteen leaf dises were harvested from each plant and used in assay with first instar neonates. Measures of mortality as 10 well as the number of first instar neonates (mortality+Ll) were taken. Table 12 below shows the average percent Mortality+Ll for GM CSM63770 and the négative control.
    Table 12. Average percent Mortality+Ll for soybean event GMCSM63770 infested with
    LSCB.
    | Event | Mortality’ + L1 | 
| Négative | 12.5% | 
| GM_CSM63770 | 100.0% | 
J0174] As can be seen in Table 12 above, soybean event GM_CSM63770 is very effîcacious against Lesser cornstalk borer (Elasmopalpus lignosellus).
    [0175] From the data presented above, soybean event GMCSM63770 provides résistance against the Lepidopteran insect pest species Soybean podworm (Helicoverpa zea), Soybean looper (Chrysodeixis includens), Velvet bean Caterpillar (Anticarsia gemmatalis), Southern armyworm (Spodoptera eridania), Black armyworm (Spodoptera cosmioides), South American podworm (Helicoverpa gelotopoeon), Sunflower looper (Rachiplusia nu), Bean shoot moth (Crocidosema aporema), Green cloverworm (Hypena scabra) and Lesser cornstalk borer (Elasmopalpus lignosellus).
    EXAMPLE 3
    Soybean event GMCSM63770 Provides Consistent Yield and Agronomics Similar to Untransformed A3555 Soybean Plants |01761 This Example demonstrates that transgenic soybean event GM_CSM63770 provides consistent yields and agronomics similar in the field as untransformed A3555 soybean plants.
    [0l77| Field trials were conducted in four separate growing seasons to evaluate agronomie traits and yield of soybean event GM_CSM63770 in comparison to the parental transformation background under field conditions. Agronomie data such as emergence, date of first flower, plant height. days to maturity, and yield (moisture corrected yield per acre) were assessed for each plot. |0178| When compared to its transformation background A3555, soybean event GM_CSM63770 dîd not show any significant différences for other agronomie traits; emergence, date to flowering, and maturity, with the exception of plant height. wherein soybean event GM_CSM63770 was approximately l inch taller than the wildtype A3555 control, which was not considered biologically significant. Expression of the insecticidal proteins, Cry I A.2 and Cry l B.2 in soybean event GM_CSM63770 did not negatively affect the agronomie and yield performance characteristics of soybean event GM CSM63770 when compared to the non-transgenic control.
    EXAMPLE 4
    Soybean event GMCSM63770 Event-Specific Endpoint TAQMAN® assays
    [0179] The following Example describes methods useful in identifying the presence of GM_CSM63770 in a soybean sample. A pair of PCR primers and a probe were designed for the purpose of identifying the unique junction formed between the soybean genomic DNA and the inserted DNA of GM_CSM63770 in an event-specific endpoint TAQMAN® PCR. Examples of conditions utilized for identiiying the presence of GM_CSM63770 in a soybean sample in an event-specific endpoint TAQMAN® PCR are described in Table 13 and Table 14.
    [0180| The sequence ofthe oligonucleotide forward primer SQ13805 (SEQ ID NO: 14) is identical to the nucléotide sequence corresponding to positions 13,177-13,202 of SEQ ID NO: 10. The sequence of the oligonucleotide reverse primer SQ5I400 (SEQ ID NO: 15) is identical to the reverse complément of the nucléotide sequence corresponding to positions 13,280-13,310 of SEQ ID NO: 10. The sequence of the oligonucleotide probe PB4832 (SEQ ID NO: 16) is identical to the nucléotide sequence corresponding to positions 13,204-13,219 of SEQ ID NO:IO. The primers SQ13805 (SEQ ID NO: 14) and SQ51400 (SEQ ID NO: 15) with probe PB4832 (SEQ ID NO: 16), which may be fluorescently labeled (e.g., a 6-FAM™ fluorescent label), can be used in an end point TAQMAN® PCR assay to identify the presence of DNA derived from GM_CSM63770 in a sample.
    [0181] In addition to SQ13805 (SEQ 1DNO:14), SQ51400(SEQ ID NO: 15), and PB4832 (SEQ ID NO: 16), it should be apparent to persons skilled in the art that other primers and/or probes can be designed to either amplify or hybridize to sequences within SEQ ID NO: 10 which are unique to, and useful for, detecting the presence of DNA derived from GM_CSM63770 in a sample.
    [0182| Following standard molecular biology laboratory practices, PCR assays for event identification were developed for détection of GM_CSM63770 in a sample. Parameters of either a standard PCR assay or a TAQMAN® PCR assay were optimized with each set of primer pairs and probes (e.g., probes labeled with a fluorescent tag such as 6-FAM™ ) used to detect the presence of DNA derived from GM CSM63770 in a sample. A control for the PCR reaction includes internai control primers and an internai control probe (e.g., VlC®-labeled) spécifie to a région within the soybean genome that is used as an internai control, and are primers SQ549 (SEQ IDNO.17), SQ546 (SEQ IDNO:18), and VIC® labeled probe PB0004 (SEQ 1DNO:19).
    [0183] Generally, the parameters which were optimized for détection of GM_CSM63770 in a sample included primer and probe concentration, amount of templated DNA, and PCR amplification cycling parameters. The Controls for this analysis include a positive control from soybean containing GM_CSM63770, a négative control from non-transgenic soybean, and a négative control that contains no template DNA.
    
    Table 13. GMCSM63770 event-specific endpoint TAQMAN® PCR reaction components.
    | Step | Reagent | Stock Concentration (μΜ) | Volume (μΙ) | Final Concentration (μΜ) | Comments | 
| Reaction volume | 5 | ||||
| 1 | Master Mix | 2.28 | 1X final concentration | ||
| 2 | Event Spécifie Primer SQ13805 | 100 | 0.05 | 0.9 | |
| 3 | Event Spécifie Primer SQ5I400 | 100 | 0.05 | 0.9 | |
| 4 | Event Spécifie 6FAM™ probe PB4832 | 100 | 0.01 | 0.2 | Probe is light sensitive | 
| 5 | Internai Control Primer SQ549 | 100 | 0.05 | 0.9 | |
| 6 | Internai Control Primer SQ546 | 100 | 0.05 | 0.9 | |
| 7 | Internai Control VIC® probe PB0004 | 100 | 0.01 | 0.2 | Probe is light sensitive | 
| 8 | Extracted DNA (template): • Leaf Samples to be analyzed • Négative control (non-transgenic DNA) • Négative water control (No template control) • Positive Qualitative control(s) GM_CSM63770 DNA | 2.5 | Separate reactions are made for each template. | 
Table 14. Endpoint TAQMAN® thermocycler conditions.
    | Step No. | Number of Cycles | Settings | 
| 1 | 1 | 95°C 20 seconds | 
| 2 | 35 | 95°C 3 seconds | 
| 60°C 20 seconds | ||
| 3 | 1 | 10°C | 
EXAMPLE 5
    Assays for Determining Zygosity for Soybean event GMCSM63770 Using TAQMAN®
    [0184] The following Example descrîbes methods useful in îdentiiying the zygosity of event GM_CSM63770. Pairs of PCR primers and a probe are designed for the purpose of identifying 10 spécifie properties of alleles positive for the T-DNA insertion that gave rise to event GM_CSM63770 and pairs of PCR primers and a probe are designed as an internai control probe spécifie to a région within the soybean genome that is used as an internai control which is represented in the soybean genome as homozygous.
    |0185] The pairs of PCR primers and probe spécifie to the GMCSM63770 transgenic allele, 15 described in Example 4, PCR primers SQ13805 (SEQ ID NO: 14), SQ51400 (SEQ ID NO: 15), and 6-FAM™ labeled probe PB4832 (SEQ ID NO: 16) and the pairs of PCR primers and probe spécifie to the internai control, primers SQ549 (SEQ ID NO: 17), SQ546 (SEQ ID NO: 18), and VIC® labeled probe PB0004 (SEQ ID NO: 19) are used in a real-time PCR reaction such as that described in Example 6 above.
    |0186] After amplification, the cycle thresholds (Ct values) are determined for the amplicon corresponding to the GM_CSM63770 inserted allele and the single-copy, homozygous internai standard. The différence (ACt) between the Ct value of the single-copy, homozygous internai standard amplicon, and the Ct value of the GMCSM63770 inserted allele amplicon are determined. With respect to zygosity, a ACt of around zéro (0) indicates homozygosîty of the 25 inserted GM_CSM63770 T-DNA and ACt of around one (1) indicated heterozygosity of the inserted GM_CSM63770 T-DNA. Lack of an amplicon corresponding to the GM_CSM63770 inserted allele indicates the sample is null for the inserted GMCSM63770 T-DNA. The Ct values in the TAQMAN® thermal amplification method will hâve some variability due to multiple factors such as amplification efficiency and idéal annealing températures. Therefore, the range of “about one (1)” is defined as a ACt of 0.75 to 1.25.
    EXAMPLE 6
    Assays for Determining Zygosity for Soybean event GM CSM63770 Using TAQMAN® |0187| The following Example describes a method useful in identifying the zygosity of event GM_CSM63770 in a soybean sample.
    [0188| Pairs of PCR primers and a probe are designed for the purpose of identifying spécifie properties of alleles positive and négative for the T-DNA insertion that gave rise to event GM_CSM63770. Examples of conditions that may be used in an event-specific zygosity TAQMAN® PCR are provided in Tables 15 and 16. For this assay, four primers and two probes are mixed together with the sample. The DNA primer pairs used in the zygosity assay are primers SQ13805 (SEQ ID NO: 14) and SQ51400 (SEQ ID NO: 15); and GM_WTA3555F (SEQ ID NO:20) and SQ5I400 (SEQ ID NO: 15). The probes used in the zygosity assay are 6FAM™labeled probe PB4832 (SEQ ID NO: 16) and VIC®-labeled probe GM_WTA3555PB (SEQ ID NO:21). SQ13805 (SEQ ID NO:14) and SQ51400 (SEQ ID NO:15) and the 6FAM™-labeled probe PB4832 (SEQ ID NO: 16) are diagnostic for, or characteristic of, soybean event GM_CSM63770 DNA. The primers GM_WTA3555F (SEQ ID NO:20) and SQ5 1400 (SEQ ID NO: 15) and the VIC®-labeled probe GM_WTA3555PB (SEQ ID NO:21) are diagnostic when there is no copy of soybean event GM_CSM63770; i.e., they are diagnostic for, or characteristic of, the wild type allele.
    |0189| When the three primers and two probes are mixed together in a PCR reaction with DNA extracted from a plant heterozygous for soybean event GM_CSM63770, there is a fluorescent signal from both the 6FAM™-labeled probe PB4832 (SEQ ID NO: 16) and the VIC®-labeled probe GM_WTA3555PB (SEQ ID NO:2I) which is indicative of and diagnostic for, or
    
    characteristic of, a plant heterozygous for soybean event GM_CSM63770. When the three primers and two probes are mixed together in a PCR reaction with DNA extracted from a plant homozygous for GMCSM63770, there is a fluorescent signal from only the 6FAM™-labeled probe PB4832 (SEQ ID NO:l6) and not the VIC®-labeled probe GMWTA3555PB (SEQ ID 5 NO:2l). When the three primers and the two probes are mixed together in a PCR reaction with
    DNA extracted from a plant which is null for soybean event GM_CSM63770 (i.e., the wild-type), there is a fluorescent signal from only the VlC®-labeled probe GM WTA3555PB (SEQ ID NO:2I). The template DNA samples and Controls for this analysis are a positive control from soybean containing GM_CSM63770 DNA (from both a known homozygous and a known 10 heterozygous sample), a négative control from non-transgenic soybean and a négative control that contains no template DNA.
    Table 15. GM CSM63770 zygosity TAQMAN® PCR.
    | Step | Reagent | Stock Concentration (μΜ) | Volume (μΐ) | Final Concentration (μΜ) | Comments | 
| Reaction volume | 5 | ||||
| 1 | Master Mix | 2.28 | IX final concentration | ||
| 2 | Event Spécifie Primer SQ13805 | 100 | 0.05 | 0.9 | |
| 3 | Event Spécifie Primer SQ51400 | 100 | 0.10 | 1.8 | |
| 4 | Event Spécifie 6FAM™ probe PB4832 | 100 | 0.01 | 0.2 | Probe is light sensitive | 
| 5 | Wildtype Allele Primer GM WTA3555F | 100 | 0.05 | 0.9 | |
| 6 | Wildtype Allele VIC® probe GM_WTA3555PB | 100 | 0.01 | 0.2 | Probe is light sensitive | 
| Step | Reagent | Stock Concentration (μΜ) | Volume (μΐ) | Final Concentration (μΜ) | Comments | 
| 7 | Extracted DNA (template): • Leaf Samples to be analyzed • Négative control (non-transgenic DNA) • Négative water control (No template control) • Positive Qualitative control(s) GM_CSM63770 DNA | 2.5 | Separate reactions are made for each template. | 
Table 16. Zygosity TAQMAN® thermocycler conditions.
    | Step No. | Number of Cycles | Settings | 
| 1 | 1 | 95°C 20 seconds | 
| 2 | 40 | 95°C 3 seconds | 
| 60uC 20 seconds | ||
| 3 | ! | 10°C | 
EXAMPLE 7
    Identification of Soybean event GMCSM63770 in any GM CSM63770 Breeding Event
    [0190] The following Example describes how one may identify the soybean event 10 GM_CSM63770 within progeny of any breeding activity using soybean event GM_CSM63770.
    For example, the soybean event GM_CSM63770 could be stacked by breeding or by site directed introgression with other events known in the art to control Lepidopteran pests such as any of the following soybean events including but not limited to MON87701, MON87751, DAS81419 (Lepidopteran résistant and herbicide tolérant). The soybean event GM_CSM63770 could also be stacked by breeding or by site directed introgression with other transgenic soybean events known in the art to provide résistance to herbicides including but not limited to A2704-I2 (U.S. Patent Application Publication No. US20080320616), A5547-I27 (U.S. Patent Application Publication No. US2008196127), CVI27 (International Patent Application Publication No.WO2010080829), DS40278-9 (International Patent Application Publication No. WO2011022469, WO2011022470, WO2011022471), DAS44406-6 (U.S. Patent Application Publication No. US2014041083 ), DAS684I6-4 (U.S. Patent Application Publication No. US20130296170), DAS81419-2 (U.S. Patent Application Publication No. US2013338006), DP356043-5 (U.S. Patent Application Publication No. US20100184079), FG72 (U.S. Patent Application Publication No. US2011162098), GMB151 (U.S. Patent Application Publication No. US2019345512), GTS 40-32, MON87708 (U.S. Patent Application Publication US, MON87751 (U.S. Patent Application No. US20140373191 ), MON89788, SYHT0H2 (U.S. Patent Application Publication No. US20140201860), and SYHT04R (U.S. Patent Application Publication No. US201403 10835). The soybean event GM_CSM63770 could also be stacked by breeding or by site directed introgression with other transgenic soybean events known in the art to provide résistance to herbicides and modified oils, or enhanced photosynthesis, or drought tolérance including but not limited to DP305423-I (U.S. Patent Application Publication No. US20080312082), MON87705 (U.S. Patent Application Publication No. US2014373191 ), MON87712 (U.S. Patent Application Publication No. US2014373191 ), MON87769 (U.S. Patent Application Publication No. US2011067141), and HB4 (U.S. Patent Application Publication No. US20220901 14).
    |0191] DNA primer pairs are used to produce an amplicon diagnostic for, or characteristic of, soybean event GM_CSM63770. An amplicon diagnostic for, or characteristic of, soybean event GM_CSM63770 comprises at least one junction sequence. The junction sequences for soybean event GM CSM63770 are SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 ([1], [2], [3], [4], [5], and [6], respectively in Figure 1 ). SEQ ID NO: 1 is a 50 nucléotide sequence representing the 5' junction régions of soybean genomic DNA and the integrated transgenic expression cassette. SEQ ID NO:1 is positioned in SEQ ID NO: 10 at nucléotide position 976-1,025. SEQ ID NO:2 is a 50 nucléotide sequence representing the 3' junction régions of soybean genomic DNA and the integrated transgenic expression cassette. SEQ
    ID NO:2 is positioned in SEQ ID NO: 10 at nucléotide position 13,216-13,265. SEQ ID NO:3 is a 100 nucléotide sequence representing the 5'junction régions of soybean genomic DNA and the integrated transgenic expression cassette. SEQ ID NO:3 is positioned in SEQ ID NO: 10 at nucléotide position 951-1,050. SEQ ID NO:4 is a 100 nucléotide sequence representing the 3' junction régions of soybean genomic DNA and the integrated transgenic expression cassette. SEQ ID NO:4 is positioned in SEQ ID NO:IO at nucléotide position 13,191-13,290. SEQ ID NO:5 is a 200 nucléotide sequence representing the 5' junction régions of soybean genomic DNA and the integrated transgenic expression cassette. SEQ ID NO:5 is positioned in SEQ ID NO: 10 at nucléotide position 901-1,100. SEQ ID NO:6 is a 200 nucléotide sequence representing the 3' junction régions of soybean genomic DNA and the integrated transgenic expression cassette. SEQ ID NO:6 is positioned in SEQ ID NO: 10 at nucléotide position 13,141-13,340.
    |0192| Primer pairs that will produce an amplicon diagnostic for, or characteristic of, event GMCSM63770 include primer pairs based upon the flanking sequences (SEQ ID NO: 11 and SEQ ID NO:12) and the inserted T-DNA (SEQ ID NO:9). To acquire a diagnostic amplicon in which SEQ ID NO:1, or SEQ ID NO:3, or SEQ ID NO:5 is found, one would design a forward primer molécule based upon the 5' flanking soybean genomic DNA (SEQ ID NO: I I ) from bases 1-1,000 and a reverse primer molécule based upon the inserted T-DNA (SEQ ID NO:9) from positions 1,001-13,240 in which the primer molécules are of sufficient length of contiguous nucléotides to specifically hybridize to SEQ ID NO: 11 and SEQ ID NO:9. To acquire a diagnostic amplicon in which SEQ ID NO:2, or SEQ ID NO:4, or SEQ ID NO:6 is found, one would design a forward primer molécule based upon the inserted T-DNA (SEQ ID NO:9) from positions 1,001-13.240 and a reverse primer molécule based upon the 3' flanking soybean genomic DNA (SEQ ID NO: 12) from positions 13,241-14,240 in w hich the primer molécules are of sufficient length of contiguous nucléotides to specifically hybridize to SEQ IDNO:9and SEQ IDNO:I2.
    [0193] For practical purposes, one should design primers which produce amplicons of a limited size range, preferably between 200 to 1000 bases. Smaller sized amplicons in general are more reliably produced in PCR reactions, allow for shorter cycle tîntes, and can be easily separated and visualized on agarose gels or adapted for use in endpoint TAQMAN®-like assays. In addition, amplicons produced using said primer pairs can be cloned into vectors, propagated, isolated and sequenced, or can be sequenced directly with methods well established in the art. Any primer pair derived from the combinations of SEQ ID NO:I 1 and SEQ ID NO:9 or SEQ ID NO: 12 and SEQ ID NO:9 that are useful in a DNA amplification method to produce an amplicon diagnostic for, or characteristic of, soybean event GMCSM63770 or progeny thereof is an aspect of the présent invention. Any single isolated DNA polynucleotide primer molécule comprising at least eleven (11) contiguous nucléotides of SEQ ID NO:II, SEQ ID NO:9 or SEQ ID NO:12 or their compléments that is useful in a DNA amplification method to produce an amplicon diagnostic for, or characteristic of, soybean event GM_CSM63770 or progeny thereof is an aspect of the présent invention.
    [0194] An example of the amplification conditions for this analysis is illustrated in Tables 14 and
    15. Any modification ofthese methods or the use of DNA primers hoinologous or complementary to SEQ ID NO: 11 or SEQ ID NO: 12, or DNA sequences of the genetic éléments contained in the transgene insert (SEQ ID NO:9) of GM CSM63770, that produce an amplicon diagnostic for, or characteristic of, soybean event GM_CSM63770 is within the art. A diagnostic amplicon comprises a DNA molécule homologous or complementary to at least one transgene/genomic junction DNA or a substantial portion thereof.
    [0195] An analysis for a soybean event GM CSM63770 plant tissue sample should include a positive tissue control from a plant that contains GM_CSM63770, a négative control from a soybean plant that does not contain GM CSM63770 (e.g., A3555), and a négative control that contains no soybean genomic DNA. A primer pair will amplify an endogenous soybean DNA molécule and will serve as an internai control for the DNA amplification conditions. Additional primer sequences can be selected from SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 9 by those skilled in the art of DNA amplification methods. Conditions selected for the production of an amplicon by the methods shown in Table 13 and Table 14 may differ but resuit in an amplicon diagnostic for, or characteristic of, soybean event GM_CSM63770 DNA. The use of DNA primer sequences within or with modifications to the methods of Table 13 and Table 14 are within the scope of the invention. An amplicon produced by at least one DNA primer sequence derived from SEQ ID NO:11, SEQ ID NO: 12, or SEQ ID NO:9 that is diagnostic for, or characteristic of, soybean event GM_CSM63770 is an aspect of the invention.
    [0196] DNA détection kits that contain at least one DNA primer of sufficient length of contiguous nucléotides derived from SEQ ID NO:11, SEQ ID NO: 12, or SEQ 1DNO:9 that, when used in a
    DNA amplification method, produces a diagnostic amplicon for GM_CSM63770 or its progeny is an aspect of the invention. A soybean plant or seed, wherein its genome will produce an amplicon diagnostic for, or characteristic of, soybean event GM_CSM63770, when tested in a DNA amplification method is an aspect of the invention. The assay for the soybean event GM_CSM63770 amplicon can be performed by using an Applied Biosystems GeneAmp™ PCR System 9700, Stratagene Robocycler®, Eppendorf® Mastercycler® Gradient thermocycler or any other amplification System that can be used to produce an amplicon diagnostic of, or characteristic of, soybean event GM_CSM63770 as shown in Table I5.
    EXAMPLE 8
    Insertion of Sequences into Soybean Event GMCSM63770 to Facilitate Removal of the Transgene Insertion using a Single Guide RNA
    [0197] The following Example describes how one may excise the transgene insertion présent in soybean event GM_CSM6377Û using genomic editing techniques. Sequences useful in excision of the soybean event GM_CSM63770 transgene insertion or expression cassettes within SEQ ID NO: 10 can be introduced through genomic editing using a variety of methods, particularly through the use ofClustered Regularly Interspersed Short Palindromie Repeats (CR1SPR) editing Systems. The CRISPR-associated protein can be selected from a Type 1 CRISPR-associated protein, a Type II CRISPR-associated protein, a Type III CRISPR-associated protein, a Type IV CRISPRassociated protein, Type V CRISPR-associated protein, or a Type VI CRISPR-associated protein, such as but not limited to, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Casl2a (also known as Cpfl), Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csf1, Csf2, Csf3, Csf4, CasX, CasY, and Mad7. The CRISPR-associated protein and one or more guide RNAs (gRNA) can be introduced into a plant cell corresponding to soybean event GM_CSM63770 to target a spécifie sequence within the transgene insertion locus via a double strand break repair pathway, which may include, for example, non-homologous end-joining (NHEJ), microhomologymediated end joining (MMEJ), homologous recombination, synthesis-dependent strand annealing
    
    (SDSA), single-strand annealing (SSA), or a combination thereof. at the genomic target site. One or more sequences can be inserted within the soybean event GMCSM63770 transgene insertion locus which can allow for the excision of the transgene insertion from soybean event GM_CSM63770 or spécifie expression cassettes within SEQ ID NO: 10.
    [0198] Sequences corresponding to the 5' and 3' genomic flanking sequences of soybean event
    GM_CSM63770 (presented as SEQ IDNOsil 1 and 12), the 5' and 3'junction régions (presented as SEQ ID NOs:l-6), the inserted T-DNA are scanned for potential originator guide RNA récognition sites (OgRRS) which comprises a protospacer adjacent motif (PAM) site operably linked to a guide RNA hybridization site. The OgRRS can be located within the flanking 5' or 3' genomic sequence, or within the 5' or 3' junction régions, or within the inserted T-DNA. The OgRRS will be determined based upon the spécifie CRISPR editing system chosen. For exampie, Cas9 recognizes a G-rich protospacer-adjacent motif (PAM) that is 3' to its guide RNA binding site whereas Cas 12a Systems recognize a T-rich protospacer-adjacent motif (PAM) that is 5' to its guide RNA binding site.
    [0199] The OgRRS sequence is then used to define a cognate guide RNA récognition site (CgRRS) which is inserted into the transgene insertion locus of event GM_CSM63770 using a CRISPR editing system. The CgRRS comprises the same gRNA target sequence as the selected OgRRS. The CgRRS is inserted in a région within the transgene insertion locus of event GM_CSM63770 that is on the opposite side of the transgene insertion, relative to the OgRRS in a manner that will permit the excision of a fragment of DNA corresponding to either the entire transgene insertion of soybean event GM_CSM63770, or a fragment within the transgene insertion of soybean event GM_CSM63770 such as an expression cassette or genetic element within the transgene cassette, using a single gRNA. For example, to the extent that the OgRRS is located within the 3' genomic flanking sequence or the 3'junction région, then the CgRRS will be inserted within the 5' genomic flanking sequence, or the 5' junction région, or within the transgene insert such as between expression cassettes or genetic éléments within an expression cassette. Insertion of the CgRRS on the opposite side of the transgene insertion or within the région between expression cassettes, relative to the OgRRS allows for excision of the transgene insertion or spécifie expression cassettes to be excised using a single gRNA. An OgRRS located between the expression cassettes of soybean event GM_CSM63770 can be used to design a CgRRS that can be
    
    inserted in either the 5' or 3' genomic flanking sequence to permit excision of one or the other expression cassette using a single gRNA.
    [0200] Table 17 below shows exemplary OgRRS sequences located within the 5' and 3' genomic flanking sequences and between the two expression cassettes of soybean event GM_CSM63770 that can be used in a CRISPR editing System employing Cas 12a, a Type V CRISPR-assocîated protein (coding sequence presented as SEQ ID NO:34; protein sequence presented as SEQ ID NO:35).
    Table 17. Exemplary OgRRS sequences within soybean event GMCSM63770.
    | OgRRS | Sequence | SEQ ID NO: | Target Site | 
| OgRRS_5-l | TTTAGAGTTTGGAGAATAAAGT ACACA | 22 | 5' Flanking Genomic DNA | 
| OgRRS_5-2 | TTTGGCATTGGTCGGAGTCTAT GTTTC | 23 | 5' Flanking Genomic DNA | 
| OgRRS_5-3 | TTTGGAGGGGAGAGATAACTA CACTAA | 24 | 5' Flanking Genomic DNA | 
| OgRRS_3-l | TTTGGAGAGATTCTTGGATAAA TGTAT | 25 | 3' Flanking Genomic DNA | 
| OgRRSIn-l | TTTAGGGATAATAGCTGTTTGC CAATC | 26 | Between Expression Cassettes | 
| OgRRS_In-2 | TTTCGCAACAGGCACAGCGCTG AGGTA | 27 | Between Expression Cassettes | 
[0201] Table 18 below shows gRNAs which include a poly-T transcript termination région that can be used to target the Casl2a nuclease to eut within both the OgRRS and CgRRS sequences.
    Table 18. gRNAs useful in targeting Casl2a nuclease.
    | gRNA | SEQ ID NO: | Sequence | 
| gRNA_OgRRS_5-l | 28 | GAATTTCTACTAAGTGTAGATGAGTTTGGAGAAT AAAGTACACATTTTTTT | 
| gRNA_OgRRS_5-2 | 29 | GAATTTCTACTAAGTGTAGATGCATTGGTCGGAG TCTATGTTTCTTTTTTT | 
| gRNA_OgRRS_5-3 | 30 | GAATTTCTACTAAGTGTAGATGAGGGGAGAGAT AACTACACTAATTTTTTT | 
| gRNA_OgRRS_3-l | 31 | GAATTTCTACTAAGTGTAGATGAGAGATTCTTGG ATAAATGTATTTTTTTT | 
| gRNA_OgRRS_In-l | 32 | GAATTTCTACTAAGTGTAGATGGGATAATAGCTG TTTGCCAATCTTTTTTT | 
| gRNA_OgRRS_In-2 | 33 | GAATTTCTACTAAGTGTAGATGCAACAGGCACA GCGCTGAGGTATTTTTTT | 
|02U2| Any of the OgRRS sequences presented in Table 17 above can be used alternatively as a 5 site to insert a CgRRS that was designed using a different OgRRS. For example, a CgRRS can be inserted into a flanking sequence to allow for the excision of the entire transgene insertion of event GM_CSM63770. To illustrate this approach, OgRRS_3-l is selected as the OgRRS that will be used to design a corresponding CgRRS comprising DNA fragment, and OgRRS_5-3 is selected as the target site in which the CgRRS comprising DNA fragment is inserted. Using a Casl2a editing 10 system, the OgRRS_5-3 site is targeted using the gRNA, gRNA_OgRRS_5-3 presented in Table to eut within the OgRRS_5-3 site. The CgRRS comprising DNA fragment that comprises the OgRRS_3-l target site is then inserted within the eut site that was introduced into the OgRRS_53 sequence. After sélection of a transgenic event comprising the introduced CgRRS site, the event can be bred into another germplasm. When desired, the transgene insert of soybean event 15 GM_CSM63770 can be excised from the plant using a Cas 12a editing system and the gRNA, gRNA_OgRRS_3-I as presented in Table 18.
    
    [0203] Any of the OgRRS sequence presented in Table I7 that are within the 5' and 3' genomic flanking sequences of soybean event GM_CSM63770 can be used as a site to insert a CgRRS comprising DNA fragment, comprising an OgRRS sequence that is between expression cassettes, to permit the excision of a spécifie expression cassette using a single gRNA. To illustrate this approach, OgRRS_ln-l is selected as the OgRRS that will be used to design a corresponding CgRRS comprising DNA fragment, and OgRRS_5-2 is selected as the target site in which the CgRRS comprising DNA fragment is inserted. Using a Cas12a editing System, the OgRRS_5-2 site is targeted using the gRNA, gRNA_OgRRS_5-2 presented in Table 18 to eut within the OgRRS_5-2 site. The CgRRS comprising DNA fragment that comprises the OgRRS ln-l target site is then inserted within the eut site that was introduced into the OgRRS_5-2 sequence. After sélection of a transgenic event comprising the introduced CgRRS site, the event can be bred into another germplasm. When desired, the first expression cassette which expresses the Cry I A.2 toxin protein can be excised from the plant using a Cas 12a editing system and the gRNA, gRNA_OgRRS_ln-l as presented in Table 18.
    [0204] The CgRRS can be introduced into the transgene insertion locus through multiple methods using a CR1SPR system. For example, a CRISPR system can be utilized for targeting 5 ' insertion of a blunt-end double-stranded DNA fragment into a genomic target site of interest such as an OgRRS that is not the OgRRS that has been selected for the design of the CgRRS. The CRISPRmediated endonuclease activity can introduce a double stand break (DSB) in the selected genomic target site and DNA repair, such as microhomology-driven nonhomologous end-joining DNA repair, results in insertion of the blunt-end double-stranded DNA fragment into the DSB. Bluntend double-stranded DNA fragments can be designed with 1 -10 bp of microhomology, on both the 5' and 3' ends of the DNA fragment, that correspond to the 5' and 3' flanking sequence at the eut site of the protospacer in the genomic target site.
    |0205] The CRISPR system can be introduced into event GM_CSM63770 by several methods.
    One or more expression cassettes encoding the gRNA and/or CRISPR associated protein components of a Type I, Type II, Type III, Type IV, Type V, or Type VI CRISPR-Cas system is transiently introduced into a cell. The introduced one or more expression cassettes encoding the gRNA and/or CRISPR associated protein, along with a DNA fragment comprising the CgRRS is provided in sufficient quantity to modify the cell but does not persist after a contemplated period
    
    of time has passed or after one or more cell divisions. In such embodiments, no further steps are needed to remove or segregate the one or more expression cassettes encoding the gRNA and/or CRISPR associated protein from the modified cell.
    [0206| Alternatively, an expression construct comprising one or more expression cassette for the 5 expression of a gRNA, and an expression construct encoding a Type I, Type II, Type III, Type IV,
    Type V, or Type VI CRISPR associated protein is stably transformed into event GM_CSM63770 to introduce the CgRRS within the desired target locus. The gRNA will direct the nuclease to eut within the target locus which can be an OgRRS different from the selected OgRRS. The expression construct would also comprise a CgRRS DNA fragment which is flanked 5' and 3' 10 with the PAM/gRNA sequence of the desired locus (i.e., an OgRRS different from the selected
    OgRRS) which will permit the excision of the CgRRS DNA fragment that can then be introduced into the target locus via a double strand break repair pathway.
    [0207] Other Casl2a PAM/gRNA sites can be found within SEQ ID NO: 10 that can be used as potential OgRRS sequences, depending upon the desired outcome after genomic editing. Table 15 19 below shows the coordinates of each of 418 potential OgRRS sequences within SEQ ID NO: 10 and the element in which they can be found. Those indicated in bold were previously presented in Table 17.
    Table 19. Potential OgRRS sequences within SEQ ID NO: 10 and Eléments.
    | PAM/gRNA | PAM | Strand | Coordinates within SEQ ID NO:10 | Element within SEQ ID NO: 10 | 
| ] | TTTA | + | 28..54 | 5' Flanking DNA | 
| 2 | TTTA | + | 79..105 | 5' Flanking DNA | 
| 3 | TTTG | + | 84.. 110 | 5' Flanking DNA | 
| 4 | TTTA | + | 111..137 | 5' Flanking DNA | 
| 5 | TTTA | + | 121..147 | 5' Flanking DNA | 
| 6 | TTTG | + | 129..155 | 5' Flanking DNA | 
| 7 | TTTA | + | 170..196 | 5' Flanking DNA | 
| 8 | TTTG | - | 182..156 | 5' Flanking DNA | 
| 9 | TTTA | - | 189..163 | 5' Flanking DNA | 
| 10 | TTTA | - | 203..177 | 5' Flanking DNA | 
| 11 | TTTA | - | 207.. 181 | 5' Flanking DNA | 
| 12 | TTTA | + | 237..263 | 5' Flanking DNA | 
| PAM/gRNA | PAM | Strand | Coordinates w ithin SEQ ID NO:10 | Elément within SEQ ID NO: 10 | 
| I3 | TTTG | - | 282..256 | 5' Flanking DNA | 
| 14 | TTTC | + | 369..395 | 5' Flanking DNA | 
| 15 | TTTC | + | 379..405 | 5' Flanking DNA | 
| I6 | TTTC | + | 385..411 | 5' Flanking DNA | 
| 17 | TTTG | + | 389..415 | 5' Flanking DNA | 
| 18 | TTTC | - | 403..377 | 5' Flanking DNA | 
| 19 | TTTG | - | 426..400 | 5' Flanking DNA | 
| 20 | TTTG | + | 430..456 | 5' Flanking DNA | 
| 21 | TTTC | - | 494..468 | 5' Flanking DNA | 
| 22 | TTTA | - | 503..477 | 5' Flanking DNA | 
| 23 | TTTC | - | 507..481 | 5' Flanking DNA | 
| 24 | TTTG | + | 546..572 | 5' Flanking DNA | 
| 25 | TTTG | - | 606..580 | 5' Flanking DNA | 
| 26 | TTTA | + | 632..658 | 5' Flanking DNA | 
| 27 | TTTA | - | 659..633 | 5' Flanking DNA | 
| 28 | TTTA | + | 689..7I5 | 5' Flanking DNA | 
| 29 | TTTA | + | 695..721 | 5' Flanking DNA | 
| 30 | TTTC | + | 765..791 | 5' Flanking DNA | 
| 31 | TTTA | + | 769..795 | 5' Flanking DNA | 
| 32 | TTTC | - | 794..768 | 5' Flanking DNA | 
| 33 | TTTA | - | 874..848 | 5' Flanking DNA | 
| 34 | TTTA | + | 890..916 | 5' Flanking DNA | 
| 35 | TTTG | - | 904..878 | 5' Flanking DNA | 
| 36 | TTTA | - | 923..897 | 5' Flanking DNA | 
| 37 | TTTC | + | 966..992 | 5' Flanking DNA | 
| 38 | TTTA | - | 990..964 | 5' Flanking DNA | 
| 39 | TTTG | - | 1021..995 | 5' Flanking DNA/Right Border Région | 
| 40 | TTTC | - | 1044..1018 | Right Border Région | 
| 41 | TTTG | 1038..1064 | Right Border Région | |
| 42 | TTTC | - | 1051..1025 | Right Border Région | 
| 43 | TTTG | + | 1155..1181 | Between Right Border Région and P-At.Ubq 10-1:1:1 | 
| 44 | TTTG | 4“ | 1184.4210 | P- At.Ubql 0-14:1 | 
| 45 | TTTC | - | 1220..1194 | P-At.Ubq 10-14 : J | 
| 46 | TTTA | - | 1258..1232 | P-At.Ubq 10-1:1:1 | 
| 47 | TTTG | - | 1276..1250 | P-At.Ubq 10-14:1 | 
| 48 | TTTA | - | 1302..1276 | P-At.Ubq 10-1:1:1 | 
| 49 | TTTG | - | 1328.4302 | P-At.Ubq 10-1 4:1 | 
| 50 | TTTA | + | 1341..1367 | P-At.Ubq 10-14 4 | 
| PAM/gRNA | P AM | Strand | Coordinates within SEQ ID NO:10 | Elément within SEQ ID NO: 10 | 
| 5I | TTTG | - | 1373..1347 | P-At.Ubq 10-1:1:1 | 
| 52 | TTTG | - | 1392..1366 | P-At.Ubq 10-1:1:1 | 
| 53 | TTTG | - | I408..1382 | P-At.Ubq 10-1:1:1 | 
| 54 | TTTC | + | 1448..1474 | P-At.Ubq 10-1:1:1 | 
| 55 | TTTA | - | 147L.1445 | P-At.Ubq 10-1:1:1 | 
| 56 | TTTC | + | 1481.. 1507 | P-At.Ubq 10-1:1:1 | 
| 57 | TTTC | - | I49l.. 1465 | P-At.Ubq 10-1:1:1 | 
| 58 | TTTA | + | 1501.. 1527 | P-At.Ubq 10-1:1:1 | 
| 59 | TTTA | - | 1527.. 1501 | P-At.Ubq 10-1:1:1 | 
| 60 | TTTG | - | 1534.. 1508 | P-At.Ubq 10-1:1:1 | 
| 6I | TTTC | - | 1579..1553 | P-At.Ubq 10-1:1:1 | 
| 62 | TTTC | - | 1587.. 1561 | P-At.Ubq 10-1:1:1 | 
| 63 | TTTA | - | 1654.. 1628 | P-At.Ubq 10-1:1:1 | 
| 64 | TTTA | » | 1702.. 1676 | P-At.Ubq 10-1:1:1 | 
| 65 | TTTC | - | 1737..1711 | P-At.Ubq 10-1 : l : 1 | 
| 66 | TTTA | - | 1765.. 1739 | P-At.Ubq 10-1:1:1 | 
| 67 | TTTG | - | 1775.. 1749 | P-At.Ubq 10-1:1:1 | 
| 68 | TTTA | + | 1805.. 1831 | P-At.Ubq 10-1:1:1 | 
| 69 | TTTG | - | 1818.. 1792 | P-At.Ubq 10-1:1:1 | 
| 70 | TTTG | - | I825..1799 | P-At.Ubq 10-1:1:1 | 
| 71 | TTTA | - | 1844.. 1818 | P-At.Ubq 10-1:1:1 | 
| 72 | TTTG | + | 1870.. 1896 | P-At.Ubq 10-1:1:1 | 
| 73 | TTTA | + | 1904.. 1930 | P-At.Ubq 10-1:1:1 | 
| 74 | TTTC | + | 1936..1962 | P-At.Ubq 10-1:1:1 | 
| 75 | TTTG | - | 1996.. 1970 | P-At.Ubq 10-1:1:1 | 
| 76 | TTTG | - | 2036..2010 | L-At.Ubq 10-1:1:1 | 
| 77 | TTTA | - | 2044..2018 | L-At.Ubq 10-1:1:1 | 
| 78 | TTTC | + | 2048..2074 | L-At.Ubq 10-1:1:1 | 
| 79 | TTTA | - | 2082..2056 | L-At.Ubq 10-1:1:1 | 
| 80 | TTTC | + | 2083..2109 | Between L-At.Ubq 10-1:1:1 and 1At.Ubql0:3 | 
| 81 | TTTG | - | 2107..2081 | I-At.Ubq 10:3 | 
| 82 | TTTG | + | 2117..2143 | l-At.Ubql0:3 | 
| 83 | TTTC | + | 2122,.2148 | 1-At.Ubq 10:3 | 
| 84 | TTTC | + | 2138..2164 | I-At.UbqlO:3 | 
| 85 | TTTG | + | 2152..2178 | I-At.Ubql0:3 | 
| 86 | TTTA | + | 2157..2183 | 1-At.Ubq 10:3 | 
| 87 | TTTC | + | 2190..2216 | I-At.UbqlO:3 | 
| 88 | TTTG | + | 2198..2224 | I-At.UbqlO:3 | 
| 89 | TTTC | + | 2235..2261 | 1-At.Ubq 10:3 | 
| PAM/gRNA | PAM | Strand | Coordinates within SEQ ID NO:10 | Element within SEQ ID NO: 10 | 
| 90 | TTTG | + | 2254..2280 | I-At.Ubql0:3 | 
| 91 | TTTG | - | 2263..2237 | I-At.Ubq 10:3 | 
| 92 | TTTG | + | 2267..2293 | l-At.Ubq 10:3 | 
| 93 | TTTG | + | 2274..2300 | l-At.Ubq!0:3 | 
| 94 | TTTG | + | 2297..2323 | I-At.UbqlO:3 | 
| 95 | TTTC | + | 2304..2330 | l-At.Ubq!0:3 | 
| 96 | TTTC | 2327..2353 | l-At.UbqlO:3 | |
| 97 | TTTG | + | 2334..2360 | I-At.UbqlO:3 | 
| 98 | TTTC | + | 2368..2394 | Between 1-At.Ubq 10:3 andCrylA.2 | 
| 99 | TTTC | + | 2478..2504 | Cryl A.2 | 
| 100 | TTTG | + | 2509..2535 | CrylA.2 | 
| 101 | TTTG | + | 2515..2541 | CrylA.2 | 
| 102 | TTTC | + | 2557..2583 | Cryl A.2 | 
| 103 | TTTG | + | 2569..2595 | CrylA.2 | 
| 104 | TTTG | + | 2578..2604 | CrylA.2 | 
| 105 | TTTG | + | 2583..2609 | CrylA.2 | 
| 106 | TTTC | + | 2590..2616 | CrylA.2 | 
| 107 | TTTC | + | 2617..2643 | CrylA.2 | 
| 108 | TTTA | + | 2709..2735 | CrylA.2 | 
| 109 | TTTC | + | 2731..2757 | Cryl A.2 | 
| 110 | TTTG | + | 2779..2805 | Cry IA.2 | 
| 111 | TTTG | - | 2846..2820 | CrylA.2 | 
| 112 | TTTC | -1- | 2848..2874 | Cry 1 A.2 | 
| 113 | TTTC | + | 2865..2891 | CrylA.2 | 
| 114 | TTTG | - | 2889..2863 | Cry 1 A.2 | 
| 115 | TTTG | + | 2902..2928 | Cryl A.2 | 
| 116 | TTTG | + | 2924..2950 | CrylA.2 | 
| 117 | TTTG | - | 2933..2907 | Cryl A.2 | 
| 118 | TTTC | + | 2941..2967 | CrylA.2 | 
| 119 | TTTG | + | 2977..3003 | CrylA.2 | 
| 120 | TTTC | + | 2991..3017 | Cry1A.2 | 
| 121 | TTTG | + | 3034..3060 | CrylA.2 | 
| 122 | TTTG | + | 3045..3071 | CrylA.2 | 
| 123 | TTTG | + | 3103..3129 | Cryl A.2 | 
| 124 | TTTC | + | 3171..3197 | Cry 1 A.2 | 
| 125 | TTTC | - | 3191..3165 | CrylA.2 | 
| 126 | TTTC | + | 3229..3255 | Cryl A.2 | 
| 127 | TTTG | - | 3353..3327 | CrylA.2 | 
| 128 | TTTC | + | 3373..3399 | CrylA.2 | 
| 129 | TTTC | + | 3394..3420 | CrylA.2 | 
| PAM/gRNA | P AM | Strand | Coordinates within SEQ ID NO: 10 | Elément within SEQ ID NO: 10 | 
| 130 | TTTA | + | 3402..3428 | CrylA.2 | 
| I3l | TTTA | + | 3465..3491 | CrylA.2 | 
| 132 | TTTC | + | 3477..3503 | CrylA.2 | 
| I33 | TTTA | + | 3489..3515 | CrylA.2 | 
| 134 | TTTC | + | 3502..3528 | CrylA.2 | 
| I35 | TTTC | + | 3531-3557 | Cry 1 A.2 | 
| 136 | TTTG | 3576..3550 | CrylA.2 | |
| 137 | TTTA | + | 3591..3617 | CrylA.2 | 
| 138 | TTTC | + | 3681..3707 | Cry 1 A.2 | 
| I39 | TTTC | + | 3690-3716 | CrylA.2 | 
| 140 | TTTC | + | 3726..3752 | CrylA.2 | 
| I4l | TTTG | + | 3837-3863 | CrylA.2 | 
| 142 | TTTC | + | 3913-3939 | CrylA.2 | 
| 143 | TTTC | + | 3918..3944 | CrylA.2 | 
| 144 | TTTC | + | 4109-4135 | CryIA.2 | 
| 145 | TTTC | 4123..4I49 | Cryl A.2 | |
| 146 | TTTC | + | 4142-4168 | CrylA.2 | 
| 147 | TTTG | - | 4I52..4126 | Cry 1 A.2 | 
| 148 | TTTG | + | 4187..42I3 | Cryl A.2 | 
| 149 | TTTA | + | 4218.4244 | CrylA.2 | 
| 150 | TTTA | + | 4310-4336 | Cry 1 A.2 | 
| I5l | TTTC | - | 4420-4394 | CrylA.2 | 
| 152 | TTTG | - | 4452..4426 | CrylA.2 | 
| I53 | TTTC | + | 4492-4518 | CrylA.2 | 
| 154 | TTTA | 4- | 4571..4597 | CrylA.2 | 
| 155 | TTTC | - | 4715-4689 | CrylA.2 | 
| I56 | TTTG | - | 4740-4714 | CrylA.2 | 
| 157 | TTTG | - | 4824-4798 | CrylA.2 | 
| 158 | TTTA | + | 4910..4936 | CrylA.2 | 
| 159 | TTTA | + | 4973..4999 | CrylA.2 | 
| 160 | TTTC | -F | 5021..5047 | CrylA.2 | 
| I6l | TTTC | - | 5083-5057 | CrylA.2 | 
| 162 | TTTG | - | 5095-5069 | CrylA.2 | 
| 163 | TTTC | - | 5104..5078 | CrylA.2 | 
| 164 | - | 5117-5091 | Cryl A.2 | |
| 165 | TTTG | - | 5I21..5095 | CrylA.2 | 
| 166 | TTTG | - | 5134..51Ο8 | Cry 1 A.2 | 
| 167 | TTTG | - | 5I43..5I17 | Cry 1 A.2 | 
| 168 | TTTG | + | 5162..5188 | CrylA.2 | 
| 169 | TTTG | - | 5202..5I76 | CrylA.2 | 
| PAM/gRNA | PAM | Strand | Coordinates within SEQ ID NO:10 | Elément within SEQ ID NO: 10 | 
| I70 | TTTG | + | 5300..5326 | CrylA.2 | 
| I7l | TTTA | + | 5333..5359 | CrylA.2 | 
| I72 | TTTC | - | 5355..5329 | CrylA.2 | 
| 173 | TTTA | + | 5375..5401 | CrylA.2 | 
| 174 | TTTG | - | 5407..5381 | CrylA.2 | 
| I75 | TTTC | - | 5627..5601 | CrylA.2 | 
| 176 | TTTC | - | 5706..5680 | CrylA.2 | 
| 177 | TTTG | - | 5856..5830 | CrylA.2 | 
| 178 | TTTC | - | 5879..5853 | Cry 1 A.2 | 
| 179 | TTTG | - | 5887..5861 | CrylA.2 | 
| 180 | TTTC | - | 5900..5874 | Cry 1 A.2 | 
| I8l | TTTC | - | 5909..5883 | CrylA.2 | 
| 182 | TTTG | + | 5979..6005 | Between Cry 1 A.2 and T-Mt.Zfp1:2:1 | 
| 183 | TTTG | + | 5988..6014 | T-Mt.Zfp-1:2:1 | 
| I84 | TTTA | + | 6015..6041 | T-Mt.Zfp-1:2:1 | 
| 185 | TTTA | + | 6020..6046 | T-Mt.Zfp-1:2:1 | 
| 186 | TTTC | + | 6025..6051 | T-Mt.Zfp-1:2:1 | 
| 187 | TTTG | - | 6093..6067 | T-Mt.Zfp-1:2:1 | 
| I88 | TTTC | + | 6147..6173 | T-Mt.Zfp-1:2:1 | 
| 189 | TTTA | + | 6155..6181 | T-Mt.Zfp-1:2:1 | 
| 190 | TTTA | - | 6164..6138 | T-Mt.Zfp-1:2:1 | 
| I9l | TTTA | - | 6184.6158 | T-Mt.Zfp-1:2:l | 
| 192 | TTTC | + | 6191..6217 | T-Mt.Zfp-1:2:1 | 
| 193 | TTTC | - | 6225..6199 | T-Mt.Zfp-1:2:1 | 
| 194 | TTTG | - | 6260..6234 | T-Mt.Zfp-1:2:1 | 
| 195 | TTTA | + | 6283..6309 | T-Mt.Zfp-1:2:1 | 
| 196 | TTTC | + | 6296..6322 | T-Mt.Zfp-1:2:1 | 
| I97 | TTTC | + | 6309..6335 | T-Mt.Zfp-1:2:1 | 
| I98 | TTTA | + | 6341..6367 | T-Mt.Zfp-1:2:1 | 
| 199 | TTTC | + | 6373..6399 | T-Mt.Zfp-1:2:1 | 
| 200 | TTTA | + | 6388..6414 | T-Mt.Zfp-1:2:1 | 
| 201 | TTTA | + | 6406..6432 | T-Mt.Zfp-1:2:1 | 
| 202 | TTTA | + | 6423..6449 | T-Mt.Zfp-1:2:1 | 
| 203 | TTTA | + | 6462..6488 | T-Mt.Zfp-1:2:1 | 
| 204 | TTTA | - | 6504..6478 | T-Mt.Zfp-1:2:1 | 
| 205 | TTTG | - | 6521..6495 | T-Mt.Zfp-1:2:1 | 
| 206 | TTTC | + | 6515..654I | T-Mt.Zfp-1:2:1 | 
| 207 | TTTA | + | 6534..6560 | T-Mt.Zfp-1:2:1 | 
| 208 | TTTG | — | 6544..6518 | T-Mt.Zfp-1:2:1 | 
| PAM/gRNA | PAM | Strand | Coordinates within SEQ ID NO:10 | Elément within SEQ ID NO: 10 | 
| 209 | TTTG | - | 6550..6524 | T-Mt.Zfp-1:2:1 | 
| 210 | TTTA | + | 6569..6595 | Between Cassettes | 
| 211 | TTTG | + | 6586..6612 | Between Cassettes | 
| 212 | TTTC | - | 6674..6648 | Between Cassettes | 
| 213 | TTTC | + | 6703..6729 | P-CUCme.CipLhcb: 1 | 
| 214 | TTTC | + | 6804..6830 | P-CUCme.CipLhcb: I | 
| 215 | TTTG | + | 6837..6863 | P-CUCme.CipLhcb: 1 | 
| 216 | TTTC | + | 6882..6908 | P-CUCme.CipLhcb: 1 | 
| 217 | TTTC | + | 6886..6912 | P-CUCme.CipLhcb: 1 | 
| 218 | TTTG | - | 6911..6885 | P-CUCme.CipLhcb: 1 | 
| 219 | TTTA | - | 6917..6891 | P-CUCme.CipLhcb: 1 | 
| 220 | TTTG | + | 6968-6994 | P-CUCme.CipLhcb: 1 | 
| 221 | TTTA | - | 6980..6954 | P-CUCme.CipLhcb: 1 | 
| 222 | TTTC | + | 6973..6999 | P-CUCme.CipLhcb: 1 | 
| 223 | TTTA | - | 7001..6975 | P-CUCme.CipLhcb: 1 | 
| 224 | TTTA | + | 7003..7029 | P-CUCme.CipLhcb: 1 | 
| 225 | TTTC | - | 7014..6988 | P-CUCme.CipLhcb: 1 | 
| 226 | TTTA | - | 7019..6993 | P-CUCme.CipLhcb: 1 | 
| 227 | TTTA | - | 7030..7004 | P-CUCme.CipLhcb: 1 | 
| 228 | TTTA | - | 7035..7009 | P-CUCme.CipLhcb: 1 | 
| 229 | TTTC | + | 7047..7073 | P-CUCme.CipLhcb: 1 | 
| 230 | TTTA | + | 7057..7083 | P-CUCme.CipLhcb: 1 | 
| 231 | TTTG | + | 7073..7099 | P-CUCme.CipLhcb: 1 | 
| 232 | TTTG | + | 7088..7I14 | P-CUCme.CipLhcb: 1 | 
| 233 | TTTG | - | 7I28..7102 | P-CUCme.CipLhcb: 1 | 
| 234 | TTTG | - | 7146..7I20 | P-CUCme.CipLhcb: 1 | 
| 235 | TTTC | + | 7183-7209 | P-CUCme.CipLhcb: 1 | 
| 236 | TTTG | + | 7188..7214 | P-CUCme.CipLhcb: 1 | 
| 237 | TTTA | + | 7208..7234 | P-CUCme.CipLhcb:! | 
| 238 | TTTC | 7234..7260 | P-CUCme.CipLhcb: 1 | |
| 239 | TTTG | + | 7245..7271 | P-CUCme.CipLhcb: 1 | 
| 240 | TTTC | 7268..7242 | P-CUCme.CipLhcb: 1 | |
| 241 | TTTG | + | 7278..7304 | P-CUCme.CipLhcb: 1 | 
| 242 | TTTC | + | 7298..7324 | P-CUCtne.CipLhcb: 1 | 
| 243 | TTTA | + | 7307-7333 | P-CUCme.CipLhcb: 1 | 
| 244 | TTTC | - | 7329..7303 | P-CUCme.CipLhcb: 1 | 
| 245 | TTTC | - | 7335..7309 | P-CUCme.CipLhcb: 1 | 
| 246 | TTTA | - | 7357..7331 | P-COCme.CipLhcb: 1 | 
| 247 | TTTA | + | 7385..741 1 | P-CUCme.CipLhcb: 1 | 
| 248 | TTTA | + | 7393..7419 | P-CUCme.CipLhcb: 1 | 
| PAM/gRNA | PAM | Strand | Coordinates within SEQ ID NO:10 | Elément within SEQ ID NO: 10 | 
| 249 | TTTA | - | 7402..7376 | P-CUCme.CipLhcb: 1 | 
| 250 | TTTG | - | 7420..7394 | P-CUCme.CipLhcb: 1 | 
| 251 | TTTG | + | 7447..7473 | P-CUCme.CipLhcb: 1 | 
| 252 | TTTC | + | 7475..7501 | P-CUCine.CipLhcb: 1 | 
| 253 | TTTG | - | 7487..7461 | P-CUCine.CipLhcb: 1 | 
| 254 | TTTA | + | 7504..7530 | P-CUCme.CipLhcb: 1 | 
| 255 | TTTA | 7554..7580 | P-CUCme.CipLhcb: 1 | |
| 256 | TTTA | - | 7582..7556 | P-CUCme.CipLhcb: 1 | 
| 257 | TTTA | + | 7584..7610 | P-CUCme.CipLhcb: 1 | 
| 258 | TTTG | + | 7588..7614 | P-CUCme.CipLhcb: 1 | 
| 259 | TTTA | + | 7616..7642 | P-CUCme.CipLhcb: 1 | 
| 260 | TTTG | + | 7629..7655 | P-CUCme.CipLhcb: 1 | 
| 261 | TTTA | · | 7659..7633 | P-CUCine.CipLhcb: 1 | 
| 262 | TTTA | + | 7708..7734 | P-CUCme.CipLhcb: 1 | 
| 263 | TTTA | + | 7724..7750 | P-CUCme.CipLhcb: 1 | 
| 264 | TTTG | - | 7744..7718 | P-CUCme.CipLhcb: 1 | 
| 265 | TTTC | - | 7770..7744 | P-CUCme.CipLhcb: 1 | 
| 266 | TTTC | - | 7789..7763 | P-CUCme.CipLhcb: 1 | 
| 267 | TTTC | + | 7813-7839 | P-CUCme.CipLhcb: 1 | 
| 268 | TTTA | + | 7867..7893 | P-CUCme.CipLhcb: 1 | 
| 269 | TTTC | + | 7875..7901 | P-CUCme.CipLhcb: 1 | 
| 270 | TTTG | 7880..7906 | P-CUCme.CipLhcb: 1 | |
| 271 | TTTA | 7949..7975 | P-CUCme.CipLhcb: 1 | |
| 272 | TTTA | 7959..7985 | P-CUCme.CipLhcb: 1 | |
| 273 | TTTG | + | 7963-7989 | P-CUCme.CipLhcb: 1 | 
| 274 | TTTA | - | 7983..7957 | P-CUCme.CipLhcb: 1 | 
| 275 | TTTA | + | 7976..8002 | P-CUCme.CipLhcb: 1 | 
| 276 | TTTG | + | 7985-8011 | P-CUCme.CipLhcb: 1 | 
| 277 | TTTC | - | 8012..7986 | P-CUCme.CipLhcb: 1 | 
| 278 | TTTC | + | 8035-8061 | P-CUCme.CipLhcb: 1 | 
| 279 | TTTA | - | 8083..8057 | P-CUCme.CipLhcb: 1 | 
| 280 | TTTA | - | 8095..8069 | P-CUCme.CipLhcb: 1 | 
| 281 | TTTA | - | 8145..8119 | P-CUCme.CipLhcb: 1 | 
| 282 | TTTG | + | 8147..8173 | P-CUCme.CipLhcb: 1 | 
| 283 | TTTA | + | 8157..8183 | P-CUCme.CipLhcb: 1 | 
| 284 | TTTG | - | 8198..8172 | P-CUCme.CipLhcb: 1 | 
| 285 | TTTA | + | 8227..8253 | P-CUCme.CipLhcb: 1 | 
| 286 | TTTA | - | 8246-8220 | P-CUCme.CipLhcb: 1 | 
| 287 | TTTA | + | 8241..8267 | P-CUCme.CipLhcb: 1 | 
| 288 | TTTA | + | 8249..8275 | P-CUCme.CipLhcb: 1 | 
| PAM/gRNA | PAM | Strand | Coordinates within SEQ IDNO:10 | Elément within SEQ ID NO: 10 | 
| 289 | TTTG | + | 8254..8280 | P-CUCme.CipLhcb: 1 | 
| 290 | TTTG | - | 828!..8255 | P-CUCme.CipLhcb: 1 | 
| 291 | TTTA | + | 8273..8299 | P-CUCme.CipLhcb: 1 | 
| 292 | TTTG | - | 8286..8260 | P-CUCme.CipLhcb: 1 | 
| 293 | TTTG | + | 8287..8313 | P-CUCme.CipLhcb: 1 | 
| 294 | TTTG | - | 8312..8286 | P-CUCme.CipLhcb: 1 | 
| 295 | TTTA | - | 8328..8302 | P-CUCme.CipLhcb: 1 | 
| 296 | TTTA | + | 8330..8356 | P-CUCme.CipLhcb: 1 | 
| 297 | TTTC | - | 8400..8374 | P-CUCme.CipLhcb: 1 | 
| 298 | TTTA | - | 8409..8383 | P-CUCme.CipLhcb: 1 | 
| 299 | TTTA | - | 8436..8410 | P-CUCme.CipLhcb: 1 | 
| 300 | TTTC | - | 8449..8423 | P-CUCme.CipLhcb: 1 | 
| 301 | TTTG | - | 8470..8444 | P-CUCme.CipLhcb: 1 | 
| 302 | TTTA | + | 8477..8503 | P-CUCme.CipLhcb: 1 | 
| 303 | TTTG | - | 8525..8499 | P-CUCme.CipLhcb: 1 | 
| 304 | TTTC | + | 8527..8553 | P-CUCme.CipLhcb: 1 | 
| 305 | TTTC | + | 8538..8564 | P-CUCme.CipLhcb: 1 | 
| 306 | TTTC | + | 8637-8663 | L-CUCme.CipLhcb: 1 | 
| 307 | TTTC | - | 8693-8667 | Between L-CUCme.CipLhcb: 1 and CrylB.2 | 
| 308 | TTTG | - | 874 I ..8715 | CrylB.2 | 
| 309 | TTTG | - | 8908-8882 | CrylB.2 | 
| 310 | TTTC | + | 8916..8942 | CrylB.2 | 
| 311 | TTTC | - | 8971..8945 | CrylB.2 | 
| 312 | TTTG | - | 94I3..9387 | CrylB.2 | 
| 313 | TTTC | + | 9627..9653 | CrylB.2 | 
| 314 | TTTC | + | 9675-9701 | CrylB.2 | 
| 315 | TTTA | + | 9841..9867 | CrylB.2 | 
| 316 | TTTA | + | 9857-9883 | CrylB.2 | 
| 317 | TTTC | + | 10100..10126 | CrylB.2 | 
| 318 | TTTG | + | 10326..10352 | CrylB.2 | 
| 319 | TTTC | + | 10501.. 10527 | CrylB.2 | 
| 320 | TTTC | + | 10575..1060I | CrylB.2 | 
| 321 | TTTG | - | 10788..10762 | CrylB.2 | 
| 322 | TTTG | 10948.. 10974 | CrylB.2 | |
| 323 | TTTC | - | 10998-10972 | CrylB.2 | 
| 324 | TTTA | - | 11085..11059 | CrylB.2 | 
| 325 | TTTC | - | 1 1301..11275 | CrylB.2 | 
| 326 | TTTC | - | 11413-11387 | CrylB.2 | 
| 327 | TTTA | - | 11555..11529 | CrylB.2 | 
| PAM/gRNA | PAM | Strand | Coordinates within SEQ ID NO: 10 | Elément within SEQ ID NO: 10 | 
| 328 | TTTC | + | 11640..1 1666 | CrylB.2 | 
| 329 | TTTG | - | 12134..12108 | CrylB.2 | 
| 330 | TTTC | + | 12147.,12173 | CrylB.2 | 
| 331 | TTTC | - | 12178..12152 | CrylB.2 | 
| 332 | TTTC | - | 12244..12218 | CrylB.2 | 
| 333 | TTTA | + | 12253..12279 | T-Mt.Lox-1-1:2:1 | 
| 334 | TTTA | + | 12257.. i 2283 | T-Mt.Lox-1-1:2:1 | 
| 335 | TTTC | + | 12278..12304 | T-Mt.Lox-1 -1:2:1 | 
| 336 | TTTA | - | 12287..12261 | T-Mt.Lox-1-1:2:1 | 
| 337 | TTTG | - | 12308..12282 | T-Mt.Lox-1-1:2:1 | 
| 338 | TTTC | + | 12370..12396 | T-Mt.Lox-1-1:2:1 | 
| 339 | TTTA | + | 12381..12407 | T-Mt.Lox-1-1:2:1 | 
| 340 | TTTG | + | 12385..12411 | T-Mt.Lox-1-1:2:1 | 
| 341 | TTTA | - | 12407..12381 | T-Mt.Lox-1-1:2:1 | 
| 342 | TTTA | + | 12402..12428 | T-Mt.Lox-1-1:2:1 | 
| 343 | TTTG | 4- | 12410.12436 | T-Mt.Lox-1-1:2:1 | 
| 344 | TTTG | + | 12417..12443 | T-Mt.Lox-1-1:2:1 | 
| 345 | TTTG | - | 12430.. 12404 | T-Mt.Lox-1-1:2:1 | 
| 346 | TTTG | - | 12448..12422 | T-Mt.Lox-1-1:2:1 | 
| 347 | TTTG | + | 12467.. 12493 | T-Mt.Lox-l-l:2:l | 
| 348 | TTTA | + | 12475.. 12501 | T-Mt.Lox-1-1:2:1 | 
| 349 | TTTA | + | 12523.. 12549 | T-Mt.Lox-1-1:2:1 | 
| 350 | TTTG | + | 12527.. 12553 | T-Mt.Lox-1-1:2:1 | 
| 351 | TTTA | - | 12537..12511 | T-Mt.Lox-1-1:2:1 | 
| 352 | TTTA | + | 12554..12580 | T-Mt.Lox-1 -1:2:1 | 
| 353 | TTTG | + | 12604.. 12630 | T-Mt.Lox-1 -1:2:1 | 
| 354 | TTTC | - | 12647..12621 | T-Mt.Lox-1-1:2:1 | 
| 355 | TTTG | - | 12703..12677 | T-Mt.Lox-1 -1:2:1 | 
| 356 | TTTC | + | 12695.. 12721 | T-Mt.Lox-1 -1:2:1 | 
| 357 | TTTC | + | 12714..12740 | T-Mt.Lox-1-1:2:1 | 
| 358 | TTTC | + | 12718.. 12744 | T-Mt.Lox-1 -1:2:1 | 
| 359 | TTTA | - | 12818..12792 | T-Mt.Lox-1-1:2:1 | 
| 360 | TTTA | + | 12813..12839 | T-Mt.Lox-1-1:2:1 | 
| 361 | TTTG | - | 12854..12828 | T-Mt.Lox-1-1:2:1 | 
| 362 | TTTA | - | 12873..12847 | Between T-Mt.Lox-1-1:2:1 and Left Border Région | 
| 363 | TTTA | + | 12868..12894 | Between T-Mt.Lox-1-1:2:1 and Left Border Région | 
| 364 | TTTG | + | 12888.. 12914 | Between T-Mt.Lox-Ι -1:2:1 and Left Border Région | 
| PAM/gRNA | PAM | Strand | Coordinates within SEQ ID NO:10 | Element within SEQ ID NO: 10 | 
| 365 | TTTG | - | 12906.. 12880 | Between T-Mt.Lox-l-l:2:1 and Left Border Région | 
| 366 | TTTG | + | 12987.. 13013 | Between T-Mt.Lox-1-1:2:1 and Left Border Région | 
| 367 | TTTC | - | 13014..12988 | Between T-Mt.Lox-1 -1:2:1 and Left Border Région | 
| 368 | TTTA | - | 13018..12992 | Between T-Mt.Lox-1-1:2:1 and Left Border Région | 
| 369 | TTTC | + | 13021..13047 | Left Border Région | 
| 370 | TTTG | h | 13038..13064 | Left Border Région | 
| 371 | TTTA | + | 13042.. 13068 | Left Border Région | 
| 372 | TTTC | + | 13050..13076 | Left Border Région | 
| 373 | TTTA | - | 13062.. 13036 | Left Border Région | 
| 374 | TTTG | + | I3078..13104 | Left Border Région | 
| 375 | TTTG | - | 13094.. 13068 | Left Border Région | 
| 376 | TTTA | + | 13086..13112 | Left Border Région | 
| 377 | TTTC | + | 13101..13127 | Left Border Région | 
| 378 | TTTA | + | 13107..13133 | Left Border Région | 
| 379 | TTTC | 4- | 13172..13198 | Left Border Région | 
| 380 | TTTC | + | 13215..13241 | Left Border Région | 
| 381 | TTTA | + | 13234..13260 | Left Border Region/3' Flanking DNA | 
| 382 | TTTG | 13266..13240 | 3' Flanking DNA | |
| 383 | TTTA | + | 13279.. 13305 | 3' Flanking DNA | 
| 384 | TTTC | - | 13298..13272 | 3' Flanking DNA | 
| 385 | TTTC | 13325..13351 | 3' Flanking DNA | |
| 386 | TTTA | + | 13335..13361 | 3' Flanking DNA | 
| 387 | TTTG | + | 13339..13365 | 3' Flanking DNA | 
| 388 | TTTC | + | 13343..13369 | 3' Flanking DNA | 
| 389 | TTTA | -1- | 13375..13401 | 3' Flanking DNA | 
| 390 | TTTA | - | 13513..13487 | 3' Flanking DNA | 
| 391 | TTTG | + | 13590..13616 | 3' Flanking DNA | 
| 392 | TTTG | + | 13636.. 13662 | 3' Flanking DNA | 
| 393 | TTTC | + | 13662..13688 | 3' Flanking DNA | 
| 394 | TTTG | - | 13715.. 13689 | 3' Flanking DNA | 
| 395 | TTTG | + | 13746..13720 | 3' Flanking DNA | 
| 396 | TTTG | - | 13733..13707 | 3' Flanking DNA | 
| 397 | TTTG | + | 13741.. 13767 | 3' Flanking DNA | 
| 398 | TTTA | + | 13796..13822 | 3' Flanking DNA | 
| 399 | TTTG | + | 13802..13828 | 3' Flanking DNA | 
| PAM/gRNA | PAM | Strand | Coordinates within SEQ ID NO:10 | Elément within SEQ ID NO: 10 | 
| 400 | TTTG | - | 13823..13797 | 3' Flanking DNA | 
| 401 | TTTC | + | 13854..13880 | 3' Flanking DNA | 
| 402 | TTTA | - | 13865..13839 | 3' Flanking DNA | 
| 403 | TTTA | + | 13860..13886 | 3' Flanking DNA | 
| 404 | TTTA | - | 13885..13859 | 3' Flanking DNA | 
| 405 | TTTA | - | 13921..13895 | 3' Flanking DNA | 
| 406 | TTTC | - | 13933..13907 | 3' Flanking DNA | 
| 407 | TTTG | + | 13991.. 14017 | 3' Flanking DNA | 
| 408 | TTTC | + | 14005..14031 | 3' Flanking DNA | 
| 409 | TTTG | - | 14026-14000 | 3' Flanking DNA | 
| 410 | TTTG | + | 14027-14053 | 3' Flanking DNA | 
| 411 | TTTG | + | 14039..14065 | 3' Flanking DNA | 
| 412 | TTTA | - | 14060-14034 | 3' Flanking DNA | 
| 413 | TTTC | + | 14072-14098 | 3' Flanking DNA | 
| 414 | TTTG | + | I4097..14123 | 3' Flanking DNA | 
| 415 | TTTA | - | 14112..14086 | 3' Flanking DNA | 
| 416 | TTTG | + | I4122..14148 | 3' Flanking DNA | 
| 417 | TTTA | + | 14I30..14156 | 3' Flanking DNA | 
| 418 | TTTG | + | 14184-14210 | 3' Flanking DNA | 
EXAMPLE 9
    Modification of Soybean Event GM_CSM63770 to Facilitate with Genomic Editing 5 Techniques using a Two Guide RNAs |0208| This example describes the excision of ail or any portion of the transgenîc inserted DNA or an expression cassette within the transgenîc inserted DNA defining and présent in soybean event GMCSM63770, using CRISPR editing Systems comprising two guide RNAs by genomic editing methods. Excision of the event GM_CSM63770 transgenîc insertion or expression cassettes 10 within SEQ ID NO:9 or SEQ ID NO: 10 can be performed through genomic editing using a variety of methods. In one embodiment. Clustered Regularly Interspersed Short Palindromie Repeats (CR1SPR) editing Systems comprising a CRISPR associated protein and two cognate guide RNAs may be used for targeted excision. The CRISPR-associated protein is an RNA guided nuclease and can be selected from a Type I CRISPR-associated protein, a Type II CRISPR-associated 15 protein, a Type III CRISPR-associated protein. a Type IV CRISPR-associated protein, Type V
    CRISPR-associated protein, or a Type VI CRISPR-assocïated protein, such as but not limited to, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Cas I2a (also known as Cpfl), Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csx 14, Csx 10, Csx 16, CsaX, Csx3, Csx I, Csx 15, Csf l, Csf2, CsB, Csf4, CasX, Cas Y, and Mad7. The CRISPR-associated protein and two guide RNAs (gRNA) may be introduced into a plant cell comprising the soybean event GM_CSM63770 to target a spécifie sequence within the transgene insertion locus. In one embodiment, the CRISPR nuclease System cleaves at two distinct guide RNA hybridization sites thereby permitting the excision of the intervening sequence. Following DNA cleavage, the genomic sequence may be repaired via a double strand break repair pathway, which may include, for example, non-homologous end-joining (NHEJ), microhomology-mediated end joining (MMEJ), homologous recombination, synthesis-dependent strand annealing (SDSA), single-strand annealing (SSA), or a combination thereof, at the genomic target site.
    [0209] The guide RNAs presented in Table I8 from Example 8 are used to excise the entire transgene cassette, or alternatîvely, are used to remove one of the two expression cassettes in soybean event GMCSM63770. For example, a gRNA selected from the group consisting of SEQ ID NOs:28-30 and the gRNA as presented as SEQ IDNO:3I are used to guide a Casl2a nuclease to eut within régions ofthe 5' and 3' genomic flanking sequence of soybean event GM_CSM63770 causing the excision of the entire transgene insert. Alternatîvely, to excise the Cryl A.2 expression cassette from soybean event GM CSM63770 a gRNA is selected from the group consisting of SEQ ID NOs:28-30 and a gRNA is selected from the group consisting of SEQ ID NOs:32 and 33 is used to guide a Casl2a nuclease to eut within the région ofthe 5' genomic flanking sequence and a région between the two transgene cassettes causing the excision of the Cryl A.2 expression cassette. Likewise, to excise the Cry l B.2 expression cassette from soybean event GM_CSM63770 a gRNA is selected from the group consisting of SEQ ID NOs:32 and 33 and the gRNA as presented as SEQ ID NO:3I is used to guide a Casl2a nuclease to eut within the région between the two transgene cassettes and with the région of the 3' flanking genomic sequence causing excision ofthe CrylB.2 expression cassette.
    [0210] Ail publications and published patent documents cited in this spécification, and which are material to the invention, are incorporated herein by reference to the same extent as if each
    
    individual publication or patent application was specifically and individually indicated to be incorporated by reference.
    |021 IJ Having illustrated and described the principles of the présent invention, it should be apparent to persons skilled in the art that the invention can be modified in arrangement and detail without departing from such principles. We claim ail modifications that are within the spirit and scope of the appended claims.
  Claims (35)
-  I. A recombinant DNA molécule comprising a nucléotide sequence selected from the group consisting of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:lO; and a 5 complété complément thereof of any of the foregoîng.
 -  2. The recombinant DNA molécule of claim l, wherein said molécule is derived from soybean event GM_CSM63770, a représentative sample of seed comprising said event having been deposited as ATCC Accession No. PTA-126048.
 -  3. A DNA molécule comprising a polynucleotide segment of sufficient length to function as 10 a DNA probe that hybridizes specifically under stringent hybridization conditions with soybean event GM_CSM63770 DNA in a sample, wherein detecting hybridization of said DNA molécule under said stringent hybridization conditions is diagnostic for the presence of soybean event GM_CSM63770 DNA in said sample.
 -  4. The DNA moiecule of claim 3, wherein said sample comprises a soybean plant, soybean 15 plant cell, soybean seed, soybean plant part, soybean progeny plant, processed soybean seed, animal feed comprising soybean, soybean oil, soybean meal, soybean flour, soybean flakes, soybean bran, soybean biomass, and fuel products produced using soybean and soybean parts.
 -  5. A pair of DNA molécules, comprising a first DNA moiecule and a second DNA moiecule 20 different from the first DNA moiecule, that function as DNA primers when used together in an amplification reaction with a sample containing soybean event GM_CSM63770 template DNA to produce an amplicon diagnostic for the presence of said soybean event GM_CSM63770 DNA in said sample, wherein said amplicon comprises the nucléotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2. SEQ ID 25 NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQIDNO:9, and SEQ IDNO: 10.
 -  6. A method of detecting the presence of a DNA segment diagnostic for soybean event GM_CSM63770 DNA in a sample, said method comprising:a. contacting said sample with the DNA moiecule of claim 3;b. subjecting said sample and said DNA molécule to stnngent hybridization conditions; andc. detecting hybridization ofsaid DNA molécule to said DNA in said sample, wherein said détection is diagnostic for the presence of said soybean event GM_CSM63770 DNA in said sample.
 -  7. A method of detecting the presence of a DNA segment diagnostic for soybean event GM_CSM63770 DNA in a sample, said method comprising:a. contacting said sample with the pair of DNA molécules of claim 5;b. performing an amplification reaction sufficient to produce a DNA amplîcon; andc. detecting the presence ofsaid DNA amplicon in said reaction, wherein said DNA amplicon comprises the nucléotide sequence selected from the group consisting of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:lO.
 -  8. A method of detecting the presence of protein diagnostic for soybean event GMCSM63770 in a sample, said method comprising:a. contacting said sample with a first and second monoclonal antibody, wherein the first monoclonal antibody binds specîfically to Cry I A.2 and the second monoclonal antibody binds specîfically to Cry l B.2;b. incubating the protein binding assay for a sufficient amount of time to allow for binding of the monoclonal antibodies; andc. detecting the presence ofthe CrylA.2 and CrylB.2 proteins in said assay, wherein said détection is diagnostic for the presence of said soybean event GMCSM63770 DNA in said sample.
 -  9. The method of claim 8, wherein the assay is performed as an Enzyme-linked Immunosorbent Assay (ELISA), a Radioimmunoassay, or a Latéral flow immunochromatographic assay.
 -  10. A soybean plant, soybean plant part, soybean cell, or part thereof comprising soybean event GM_CSM63770 DNA characterized by the détectable presence of a recombinant polynucleotide molécule comprising the nucléotide sequence selected from the group consisting of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5,100SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10; wherein said soybean plant, plant part, cell, or part thereof exhibits insecticidal activity when provided in the diet of a Lepidopteran insect pest.I 1. The soybean plant, soybean plant part, soybean cell, or part thereof of claim 10, wherein the Lepidopteran insect pest is selected from the group consistîng of Soybean podworm (Helicoverpa zea), Soybean looper (Chrysodeixis includens), Velvet bean Caterpillar (Anticarsia gemmatalis), Southern armyworm (Spodoptera eridania), Black armyworm (Spodoptera cosmioides), South American podworm (Helicoverpa gelotopoeon), Sunflower looper (Rachiplusia nu), Bean shoot moth (Crocidosema aporema), Green cloverworm (Hypena scabra), and Lesser cornstalk borer (Elasmopalpus lignoseilus).
 -  12. The soybean plant, soybean plant part, soybean cell, or part thereof of claim 10, wherein the soybean plant is further defined as progeny of any génération of a soybean plant comprising the soybean event GM_CSM63770.
 -  13. A method for protecting a soybean plant from insect infestation, wherein said method comprises providing in the diet of a Lepidopteran insect pest an insecticidally effective amount of cells or tissue of the soybean plant comprising soybean event GM_CSM63770.
 -  14. The method of claim 13, wherein said Lepidopteran insect pest is selected from the group consistîng of Soybean podworm (Helicoverpa zea), Soybean looper (Chrysodeixis includens), Velvet bean Caterpillar (Anticarsia gemmatalis), Southern armyworm (Spodoptera eridania), Black armyworm (Spodoptera cosmioides), South American podworm (Helicoverpa gelotopoeon), Sunflower looper (Rachiplusia nu), Bean shoot moth (Crocidosema aporema), Green cloverworm (Hypena scabra) and Lesser cornstalk borer (Elasmopalpus lignoseilus).
 -  15. A method of producing a Lepidopteran résistant soybean plant comprising:a. breading two different soybean plants with at least one of the two different soybean plants comprising soybean event GM_CSM63770 DNA to produce progeny;b. confirming in said progeny the presence of a DNA segment diagnostic for soybean event GMCSM63770 DNA; andc. selecting said progeny comprising soybean event GM_CSM63770 DNA; wherein said progeny of step (c) are Lepidopteran résistant.101
 -  16. A soybean seed comprising a détectable amount of the nucleotîde sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO: 10, or complété compléments thereof.5
 -  17. A nonliving soybean plant material comprising a détectable amount of the DNA molécule of claim 1.
 -  18. A microorganism comprising a détectable amount of the DNA molécule of claim 1.
 -  19. The microorganism of claim 18, wherein the microorganism is selected from the group consisting of a bacterial cell and a plant cell.10
 -  20. A commodity product comprising a détectable amount of a DNA molécule unique to soybean event GMCSM63770, wherein the molécule comprises the DNA molécule of claim 1.
 -  21. The commodity product of claim 20, further selected from the group consisting of whole or processed soybean seed, animal feed comprising soybean. soybean oil, soybean meal, 15 soybean flour, soybean flakes, soybean bran, soybean biomass, and fuel products produced using soybean and soybean parts.
 -  22. A soybean plant, soybean plant part, or soybean seed thereof comprising DNA functional as a template in a DNA amplification method producing an amplicon diagnostic for soybean event GM_CSM63770 DNA.20
 -  23. A method of determining the zygosity of a soybean plant or soybean seed comprising soybean event GM_CSM63770 comprising:a. contactîng a sample comprising soybean DNA with a primer pair that is capable of producing an amplicon diagnostic for the allele corresponding to soybean event GMCSM63770 DNA;25 b. contactîng said sample with a second primer pair that is capable of producing, using a thermal amplification reaction, an amplicon of an internai standard soybean genomic DNA known to be single-copy and homozygous in the soybean plant;c. contactîng said sample with a probe set which contains at least a first probe that specifically hybridizes to (or with) the allele DNA of soybean event 30 GMCSM63770, and a second probe that specifically hybridizes to the internai102 standard soybean genomic DNA known to be single-copy and homozygous in the soybean plant;d. performing a DNA amplification reaction using real-time PCR and determining the cycle thresholds (Ct values) of the amplicon corresponding to the allele DNA of 5 soybean event GM_CSM63770 and the single-copy, homozygous internai standard;e. calculating the différence (ACt) between the Ct value of the single-copy, homozygous internai standard amplicon and the Ct value of the amplicon corresponding to the allele DNA of soybean event GM_CSM63770 sequence 10 amplicon; andf. determining zygosity, wherein a ACt of about zéro (0) indicates homozygosity of the inserted T-DNA of event GM_CSM63770 and a ACt of about one ( 1 ) indicates heterozygosity of the inserted T-DNA of soybean event GM_CSM63770.
 -  24. The method of claim 23, wherein the primer pairs are selected from the group consisting 15 of SEQ ID NO: 14 combined with SEQ ID NO: 15, and SEQ ID NO: 17 combined with SEQID NO: 18; and wherein the probes are SEQ ID NO: 16 and SEQ ID NO: 19.
 -  25. The method of claim 23, wherein the ACt of about one (1) indicating heterozygosity of the inserted T-DNA of GM CSM63770 is in the range of 0.75 to 1.25.
 -  26. A method of determining the zygosity of a soybean plant or soybean seed comprising 20 soybean event GM_CSM63770 comprising:a. contacting a sample comprising soybean DNA with a set of primer pairs comprising at least two different primer pairs capable of producing a first amplicon diagnostic for soybean event GMCSM63770 and a second amplicon diagnostic for native soybean genomic DNA devoid of soybean event GM_CSM63770;25 b. performing a nucleic acid amplification reaction with the sample and the set of primer pairs; andc. detecting in the nucleic acid amplification réaction the first amplicon diagnostic for soybean event GM_CSM63770 DNA, or the second amplicon diagnostic for native soybean genomic DNA devoid soybean event GM_CSM63770, wherein the103 presence of only the first amplicon is diagnostic of a soybean plant or soybean seed homozygous for soybean event GM CSM63770 DNA, and the presence of both the first amplicon and the second amplicon is diagnostic of a soybean plant or soybean seed heterozygous for soybean event GM_CSM63770 DNA; ord. contacting a sample comprising soybean DNA with a probe set which contains at least a first probe that specifically hybridizes to soybean event GM_CSM63770 DNA and at least a second probe that specifically hybridizes to soybean genomic DNA that was disrupted by insertion of the heterologous DNA of soybean event GM_CSM63770 and does not hybridize to event GMCSM63770 DNA;e. hybridizing the probe set with the sample under stringent hybridization conditions, wherein detecting hybridization of only the first probe under the hybridization conditions is diagnostic for a homozygous allele of soybean event GM_CSM63770 DNA, and wherein detecting hybridization of both the first probe and the second probe under the hybridization conditions is diagnostic for a soybean plant or soybean seed heterozygous for soybean event GM CSM63770 in said sample.
 -  27. The method of claim 26, wherein the set of primer pairs comprises SEQ ID NO: 14 combined with SEQ ID NO: 15, and SEQ ID NO:20 combined with SEQ ID NO: 15.
 -  28. The method of daim 27, wherein the probe set comprises SEQ ID NO: 16 and SEQ ID NO:21.
 -  29. A DNA construct comprising a polynucleotide having a sequence that is at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the full length of SEQ ID NO: 9; and wherein the DNA construct comprises at the 5' or 3' end of said construct (i) at least 50 contiguous nucléotides of SEQ ID NO: 11 or SEQ ID NO:36; or (ii) at least 50 contiguous nucléotides of SEQ ID NO: 12 or SEQ ID NO:37.
 -  30. The DNA construct of claim 29, wherein the DNA construct comprises at least 50 contiguous nucléotides of SEQ ID NO: 11 or SEQ ID NO:36 at the 5 ' end of the construct and at least 50 contiguous nucléotides of SEQ ID NO: 12 or SEQ ID NO:37 at the 3' end of the construct104
 -  31. The DNA construct of any of daims 29-30, wherein the construct comprises at the 5' end of said construct one or more nucléotide sequences selected from SEQ ID NOs:38-137.
 -  32. The DNA construct of any of daims 29-31, wherein the construct comprises at the 3' end of said construct one or more nudeotide sequences selected from SEQ ID NOs: 138-237.5
 -  33. A soybean plant, plant cell, plant part, or plant seed comprising the DNA construct of daim30.
 -  34. A soybean plant, plant cell, plant part, or plant seed comprising a recombinant DNA construct integrated in chromosome 19, wherein the recombinant DNA construct confers résistance to Lepidopteran insect pest species, and wherein the recombinant DNA construct10 is integrated in a position of said chromosome flanked by at least 50 contiguous nucléotides of SEQ ID NO: 11 or SEQ ID NO:36 and 50 contiguous nucléotides of SEQ ID NO: 12 or SEQIDNO:37.
 -  35. The soybean plant, plant cell, plant part, or plant seed of daim 34, wherein the at least 50 contiguous nucléotides in SEQ ID NO: U or SEQ ID NO:36 comprise one or more15 nudeotide sequences selected from SEQ ID NOs:38-137.
 -  36. The soybean plant, plant cell, plant part, or plant seed of any of daims 35, wherein the at least 50 contiguous nudeotide of SEQ ID NO: 12 or SEQ ID NO:37 comprise one or more nudeotide sequences selected from SEQ ID NOs: 138-237.
 
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title | 
|---|---|---|---|
| US63/355,947 | 2022-06-27 | 
Publications (1)
| Publication Number | Publication Date | 
|---|---|
| OA21952A true OA21952A (en) | 2025-07-14 | 
Family
ID=
Similar Documents
| Publication | Publication Date | Title | 
|---|---|---|
| US11767568B2 (en) | Soybean transgenic event MON87751 and methods for detection and use thereof | |
| US11845949B2 (en) | Corn transgenic event MON 95379 and methods for detection and uses thereof | |
| US12188034B2 (en) | Transgenic corn event MON95275 and methods for detection and uses thereof | |
| US20240035100A1 (en) | Soybean transgenic event gm_csm63770 and methods for detection and uses thereof | |
| OA21952A (en) | Soybean Transgenic Event GM_CSM63770 And Methods For Detection And Uses Thereof. | |
| EA046896B1 (en) | TRANSGENIC CORN OBJECT MON 95379 AND METHODS OF ITS DETECTION AND APPLICATION |