OA21336A

OA21336A - Modified short interfering nucleic acid (siNA) molecules and uses thereof.

Info

Publication number: OA21336A
Application number: OA1202200362
Authority: OA
Inventors: Leonid Beigelman; Vivek Kumar Rajwanshi; Jin Hong; Rajendra K. Pandey; Markus Hossbach; Lax man ELTE PU; Saul MARTINEZ MONTERO; N. Tilani S. DE COSTA
Original assignee: Aligos Therapeutics, Inc.
Priority date: 2020-03-06
Filing date: 2021-03-05
Publication date: 2024-05-10

Abstract

Disclosed herein are short interfering nucleic acid (siNA) molecules comprising modified nucleotides and uses therof. The siNA molecules may be double stranded and comprise modified nucleotides selected from 2’-O-methyl nucleotides and 2’-fluoro nucleotides. Further disclosed herein are siNA molecules comprising (a) a phosphorylation blocker, conjugated moiety, or 5’- stabilized end cap; and (b) a short interfering nucleic acid (siNA).

Description

Modifiée! Short Interfering Nucleic Acid (siNA) Molécules and Uses Thereof CROSS-REFERENCE TO RELATED APPLICATIONS

This application daims priority to U.S. Provisional Application No. 62/986,150, filed March 6, 2020, and U.S. Provisional Application No. 63/109,196, filed November 3, 2020, the disclosures of which are hereby incorporated by reference in their entireties.

SEQUENCE LISTING

The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on May 13, 2021, is named 122400-0154_SL.txt and is 178,906 bytes in size. .

FIELD OF THE INVENTION

Described are short interfering nucleic acid (siNA) molécules comprising modified nucléotides, compositions, and uses thereof.

BACKGROUND OF THE INVENTION

RNA interférence (RNAi) is a biological response to double-stranded RNA that médiates résistance to both endogenous parasitic and exogenous pathogenic nucleic acids, and régulâtes the expression of protein-coding genes. The short interfering nucleic acids (siNA), such as siRNA, hâve been developed for RNAi therapy to treat a variety of diseases. For instance, RNAi therapy has been proposed for the treatment of metabolic diseases, neurodegenerative diseases, cancer, and pathogenic infections (See e.g., Rondindone, Biotechniques, 2018, 40(4S), doi.org/10.2144/000112163, Boudreau and Davidson, Curr Top Dev Biol, 2006, 75:73-92, Chalbatani et al., Int JNanomedicine, 2019, 14:3111-3128, Arbuthnot, DrugNews Perspect, 2010, 23(6):341-50, and Chemikov et. al., Front. Pharmacol., 2019, :

doi.org/10.3389/fphar.2019.00444, each of which are incorporated by reference in their entirety). However, major limitations of RNAi therapy are the ability to effectively deliver siRNA to target cells and the dégradation of the siRNA.

The présent disclosure improves the delivery and stability of siNA molécules by providing siNA molécules comprising modified nucléotides. The siNA molécules of the présent disclosure provide optimized combinations and numbers of modified nucléotides, nucléotide lengths, design (e.g., blunt ends or overhangs, intemucleoside linkages, conjugales), and modification patterns for improving the delivery and stability of siNA molécules.

SUMMARY OF THE INVENTION

Disclosed herein is a short interfering nucleic acid (siNA) molécule comprising: (a) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-(9-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and the nucléotide at position 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-(2-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide.

Disclosed herein is a short interfering nucleic acid (siNA) molécule comprising: (a) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-(9-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-(9-methyl nucléotide and the nucléotide at position 2, 5, 6, 8, 10, 14,16, 17, and/or 18 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide.

In some embodiments, the first nucléotide sequence comprises 16, 17, 18, 19, 20, 21, 22, 23, or more modified nucléotides independently selected from a 2’-(2-methyl nucléotide and a 2' fluoro nucléotide. In some embodiments, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the nucléotides in the first nucléotide sequence are modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide. In some embodiments, between 2 to 15 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, between 2 to 10 modified nucléotides of the first nucléotide sequence are 2’fluoro nucléotides. In some embodiments, between 2 to 6 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least 2, 3, 4, 5, or 6 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, less than or equal to 10, 9, 8, 7, 6, 5, 4, 3, or 2 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, between about 2 to 25 modified nucléotides of the first nucléotide sequence are 2’-<9-methyl nucléotides. In some embodiments, between about 2 to 20 modified nucléotides of the first nucléotide sequence are 2’-(9-methyl nucléotides. In some embodiments, between about 5 to 25 modified nucléotides of the first nucléotide sequence are 2’-(9-methyl nucléotides. In some embodiments, between about 10 to 25 modified nucléotides of the first nucléotide sequence are 2’-(9-methyl nucléotides. In some embodiments, between about 12 to 25 modified nucléotides of the first nucléotide sequence are 2’-(9-methyl nucléotides. In some embodiments, at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 modified nucléotides of the first nucléotide sequence are 2’-(9-methyl nucléotides. In some embodiments, less than or equal to 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides.

In some embodiments, the second nucléotide sequence comprises 16, 17, 18, 19, 20, 21, 22, 23, or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2'-fluoro nucléotide. In some embodiments, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the nucléotides in the second nucléotide sequence are modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide. In some embodiments, between 2 to 15 modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, between 2 to 10 modified nucléotides of the second nucléotide sequence are 2’fluoro nucléotides. In some embodiments, between 2 to 6 modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least 2, 3, 4, 5, or 6 modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, less than or equal to 10, 9, 8, 7, 6, 5, 4, 3, or 2 modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, between about 2 to 25 modified nucléotides of the second nucléotide sequence are 2’-(9-methyl nucléotides. In some embodiments, between about 2 to 20 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, between about 5 to 25 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, between about 10 to 25 modified nucléotides of the second nucléotide sequence are 2’-(9-methyl nucléotides. In some embodiments, between about 12 to 25 modified nucléotides of the second nucléotide sequence are 2’-(9-methyl nucléotides. In some embodiments, at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 modified nucléotides of the second nucléotide sequence are 2’-(?-methyl nucléotides. In some embodiments, less than or equal to 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides.

Disclosed herein is a short interfering nucleic acid (siNA) molécule comprising: (a) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence: (i) is 15 to 30 nucléotides in length; (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and (iii) comprises 1 or more phosphorothioate intemucleoside linkage; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence: (i) is 15 to 30 nucléotides in length; (ii) comprises 15 or more modified nucléotides independently selected from a 2’-(9-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-(9-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and (iii) comprises 1 or more phosphorothioate intemucleoside linkage.

Disclosed herein is a short interfering nucleic acid (siNA) molécule comprising: (a) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-<9-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide, wherein the siNA further comprises a phosphorylation blocker, a galactosamine, or 5’-stabilized end cap.

In some embodiments, at least 1, 2, 3, 4, 5, 6, or 7 nucléotides at position 3, 5, 7, 8, 9, 10, 11, 12, and/or 17 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 3 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 5 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 7 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 8 from the 5’ end of the first nucléotide sequence is a 2’fluoro nucléotide. In some embodiments, the nucléotide at position 9 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 12 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 17 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, nucléotide at position 10 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 11 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide.

In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, or 9 nucléotides at position 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 2 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 5 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 6 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 8 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 10 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 14 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotides at position 16 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 17 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 18 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide.

In some embodiments, the nucléotides in the second nucléotide sequence are arranged in an altemating 1:3 modification pattern, and wherein 1 nucléotide is a 2’-fluoro nucléotide and 3 nucléotides are 2’-(9-methyl nucléotides. In some embodiments, the altemating 1:3 modification pattern occurs 2-5 times. In some embodiments, at least two of the altemating 1:3 modification pattern occur consecutively. In some embodiments, at least two of the altemating 1:3 modification pattern occurs nonconsecutively. In some embodiments, at least 1, 2, 3, 4, or 5 altemating 1:3 modification pattern begins at nucléotide position 2, 6, 10, 14, and/or 18 ffom the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 2 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 6 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 10 ffom the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 14 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 18 from the 5’ end of the antisense strand.

In some embodiments, the nucléotides in the second nucléotide sequence are arranged in an altemating 1:2 modification pattern, and wherein 1 nucléotide is a 2’-fluoro nucléotide and 2 nucléotides are 2’-O-methyl nucléotides. In some embodiments, the altemating 1:2 modification pattern occurs 2-5 times. In some embodiments, at least two of the altemating 1:2 modification pattern occurs consecutively. In some embodiments, at least two of the altemating 1:2 modification pattern occurs nonconsecutively. In some embodiments, at least 1, 2, 3, 4, or 5 altemating 1:2 modification pattern begins at nucléotide position 2, 5, 8, 14, and/or 17 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:2 modification pattern begins at nucléotide position 2 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:2 modification pattern begins at nucléotide position 5 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:2 modification pattern begins at nucléotide position 8 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:2 modification pattern begins at nucléotide position 14 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:2 modification pattern begins at nucléotide position 17 from the 5’ end of the antisense strand.

Disclosed herein is a short interfering nucleic acid (siNA) molécule represented by Formula (VIII):

’-An%²An³Bn⁴An⁵Bn⁶An⁷Bn⁸An⁹-3 ’ 3’-Cq¹Aq²Bq³Aq⁴Bq⁵Aq⁶Bq⁷Aq⁸Bq⁹Aq¹⁰Bq¹¹Aq¹²-5’ wherein:

the top strand is a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence comprises 15 to 30 nucléotides;

the bottom strand is an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence comprises 15 to 30 nucléotides;

each A is independently a 2’-O-methyl nucléotide or a nucléotide comprising a 5’-stabilized end cap or a phosphorylation blocker;

B is a 2’-fluoro nucléotide;

C represents overhanging nucléotides and is a 2’-O-methyl nucléotide;

n¹ = 1-4 nucléotides in length;

each n², n⁶, n⁸, q³, q⁵, q⁷, q⁹, q¹¹, and q¹² is independently 0-1 nucléotides in length;

each n³ and n⁴ is independently 1-3 nucléotides in length;

n⁵ is 1-10 nucléotides in length;

n⁷ is 0-4 nucléotides in length;

each n⁹, q¹, and q² is independently 0-2 nucléotides in length;

q⁴ is 0-3 nucléotides in length;

q⁶ is 0-5 nucléotides in length;

q⁸ is 2-7 nucléotides in length; and q¹⁰ is 2-11 nucléotides in length.

Disclosed herein is a short interfering nucleic acid (siNA) molécule represented by

Formula (IX):

5’-A₂-4BiAi-3 B2-3 A₂-ioBo-iAo-4Bo-iAo-₂-3’

3’-C₂Ao-₂Bo-iAo-3Bo-iAo-5Bo-iA₂-7BiA₂-iiBiAi-5’ wherein:

each A is independently a 2’-(9-methyl nucléotide or a nucléotide comprising a 5’-stabilized end cap or a phosphorylation blocker;

B is a 2’-fluoro nucléotide;

C represents overhanging nucléotides and is a 2’-O-methyl nucléotide.

Disclosed herein is a short interfering nucleic acid (siNA) molécule comprising (a) a sense strand comprising a first nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 3,7-9, 12, and 17 from the 5’ end of the first nucléotide sequence, and wherein 2’-O-methyl nucléotides are at positions 1, 2, 4-6, 10, 11, and 13-16 from the 5’ end of the first nucléotide sequence; and (b) an antisense strand comprising a second nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 2 and 14 from the 5’ end of the second nucléotide sequence, and wherein 2’-O-methyl nucléotides are at positions 1, 3-13, and 15-17 from the 5’ end of the second nucléotide sequence. In some embodiments, the first nucléotide sequence consists of 19 nucléotides. In some embodiments, 2’-O-methyl nucléotides are at positions 18 and 19 from the 5’ end of the first nucléotide sequence. In some embodiments, the second nucléotide sequence consists of 21 nucléotides. In some embodiments, 2’-O-methyl nucléotides are at positions 18-21 from the 5’ end of the second nucléotide sequence.

Disclosed herein is a short interfering nucleic acid (siNA) molécule comprising (a) a sense strand comprising a first nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 3, 7, 8, and 17 from the 5’ end of the first nucléotide sequence, and wherein 2’-O-methyl nucléotides are at positions 1, 2, 4-6, and 9-16 from the 5’ end of the first nucléotide sequence; and (b) an antisense strand comprising a second nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 2 and 14 from the 5’ end of the first nucléotide sequence; and wherein 2’-(9-methyl nucléotides are at positions 1,3-13, and 15-17 from the 5’ end of the first nucléotide sequence. In some embodiments, the first nucléotide sequence consists of 19 nucléotides. In some embodiments, 2’O-methyl nucléotides are at positions 18 and 19 from the 5’ end of the first nucléotide sequence. In some embodiments, the second nucléotide sequence consists of 21 nucléotides. In some embodiments, 2’-O-methyl nucléotides are at positions 18-21 from the 5’ end of the second nucléotide sequence.

Disclosed herein is a short interfering nucleic acid (siNA) molécule comprising (a) a sense strand comprising a first nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 3, 7-9, 12 and 17 from the 5’ end of the first nucléotide sequence, and wherein 2’-O-methyl nucléotides are at positions 1, 2, 4-6, 10, 11, and 13-16 from the 5’ end of the first nucléotide sequence; and (b) an antisense strand comprising a second nucléotide sequence consisting of 17 to 23 nucléotides, wherein the nucléotides in the second nucléotide sequence are arranged in an altemating 1:3 modification pattern, and wherein 1 nucléotide is a 2’-fluoro nucléotide and 3 nucléotides are 2’-O-methyl nucléotides. In some embodiments, the first nucléotide sequence consists of 19 nucléotides. In some embodiments, 2’O-methyl nucléotides are at positions 18 and 19 from the 5’ end of the first nucléotide sequence. In some embodiments, the second nucléotide sequence consists of 21 nucléotides. In some embodiments, 2’-O-methyl nucléotides are at positions 19-21 from the 5’ end of the second nucléotide sequence. In some embodiments, the altemating 1:3 modification pattern occurs 2-5 times. In some embodiments, at least two of the altemating 1:3 modification pattern occur consecutively. In some embodiments, at least two of the altemating 1:3 modification pattern occurs nonconsecutively. In some embodiments, at least 1, 2, 3, 4, or 5 altemating 1:3 modification pattern begins at nucléotide position 2, 6, 10, 14, and/or 18 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 2 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 6 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 10 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 14 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 18 from the 5’ end of the antisense strand.

Disclosed herein is a short interfering nucleic acid (siNA) molécule comprising (a) a sense strand comprising a first nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 5 and 7-9 from the 5’ end of the first nucléotide sequence, and wherein 2’-O-methyl nucléotides are at positions 1-4, 6, and 10-17 from the 5’ end of the first nucléotide sequence; and (b) an antisense strand comprising a second nucléotide sequence consisting of 17 to 23 nucléotides, wherein the nucléotides in the second nucléotide sequence are arranged in an altemating 1:3 modification pattern, and wherein 1 nucléotide is a 2’-fluoro nucléotide and 3 nucléotides are 2’-(9-methyl nucléotides. In some embodiments, the first nucléotide sequence consists of 19 nucléotides. In some embodiments, 2’-O-methyl nucléotides are at positions 18 and 19 from the 5’ end of the first nucléotide sequence. In some embodiments, the second nucléotide sequence consists of 21 nucléotides. In some embodiments, 2’-<9-methyl nucléotides are at positions 19-21 from the 5’ end of the second nucléotide sequence. In some embodiments, the altemating 1:3 modification pattern occurs 2-5 times. In some embodiments, at least two of the altemating 1:3 modification pattern occur consecutively. In some embodiments, at least two of the altemating 1:3 modification pattern occurs nonconsecutively. In some embodiments, at least 1, 2, 3, 4, or 5 altemating 1:3 modification pattern begins at nucléotide position 2, 6, 10, 14, and/or 18 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 2 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 6 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 10 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 14 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 18 from the 5’ end of the antisense strand.

Disclosed herein is a short interfering nucleic acid (siNA) molécule comprising (a) a sense strand comprising a first nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 5 and 7-9 from the 5’ end of the first nucléotide sequence, and wherein 2’-O-methyl nucléotides are at positions 1-4, 6, and 10-17 from the 5’ end of the first nucléotide sequence; and (b) an antisense strand comprising a second nucléotide sequence consisting of 17 to 23 nucléotides, wherein the nucléotides in the second nucléotide sequence are arranged in an altemating 1:2 modification pattern, and wherein 1 nucléotide is a 2’-fluoro nucléotide and 2 nucléotides are 2’-O-methyl nucléotides. In some embodiments, the first nucléotide sequence consists of 19 nucléotides. In some embodiments, 2’-(9-methyl nucléotides are at positions 18 and 19 from the 5’ end of the first nucléotide sequence. In some embodiments, the second nucléotide sequence consists of 21 nucléotides. In some embodiments, 2’-O-methyl nucléotides are at positions 18-21 from the 5’ end of the second nucléotide sequence. In some embodiments, the altemating 1:2 modification pattern occurs 2-5 times. In some embodiments, at least two of the altemating 1:2 modification pattern occur consecutively. In some embodiments, at least two of the altemating 1:2 modification pattern occurs nonconsecutively. In some embodiments, at least 1, 2, 3, 4, or 5 altemating 1:2 modification pattern begins at nucléotide position 2, 5, 8, 14, and/or 17 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:2 modification pattern begins at nucléotide position 2 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:2 modification pattern begins at nucléotide position 5 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:2 modification pattern begins at nucléotide position 8 from the 5’ end of the antisense strand. In some embodiments, at least one altemating

1:2 modification pattern begins at nucléotide position 14 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:2 modification pattern begins at nucléotide position 17 from the 5’ end of the antisense strand.

Disclosed herein is a short interfering nucleic acid (siNA) molécule comprising (a) a sense strand comprising a first nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 5 and 7-9 from the 5’ end of the first nucléotide sequence, and wherein 2’-O-methyl nucléotides are at positions 1-4, 6, and 10-17 from the 5’ end of the first nucléotide sequence; and (b) an antisense strand comprising a second nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 2, 6, 14, and 16 from the 5’ end of the second nucléotide sequence, and wherein 2’-O-methyl nucléotides are at positions 1, 3-5, 7-13, 15, and 17 from the 5’ end the second nucléotide sequence. In some embodiments, the first nucléotide sequence consists of 19 nucléotides. In some embodiments, 2’O-methyl nucléotides are at positions 18 and 19 from the 5’ end of the first nucléotide sequence. In some embodiments, the second nucléotide sequence consists of 21 nucléotides. In some embodiments, 2’-(9-methyl nucléotides are at positions 18-21 from the 5’ end of the second nucléotide sequence.

Disclosed herein is a short interfering nucleic acid (siNA) molécule comprising: (a) a sense strand comprising a first nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 5, 9-11, and 14 from the 5’ end of the first nucléotide sequence, and wherein 2’-O-methyl nucléotides are at positions 1-4, 6-8, and 12-17 from the 5’ end of the first nucléotide sequence; and (b) an antisense strand comprising a second nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 2 and 14 from the 5’ end of the second nucléotide sequence, and wherein 2’-O-methyl nucléotides are at positions 1, 3-13, and 15-17 from the 5’ end the second nucléotide sequence. In some embodiments, the first nucléotide sequence consists of 21 nucléotides. In some embodiments, 2’(9-methyl nucléotides are at positions 18-21 from the 5’ end of the first nucléotide sequence. In some embodiments, the second nucléotide sequence consists of 23 nucléotides. In some embodiments, 2’-O-methyl nucléotides are at positions 18-23 from the 5’ end of the second nucléotide sequence.

In some embodiments, any of the sense strands disclosed herein further comprise a TT sequence adjacent to the first nucléotide sequence.

In some embodiments, any of the sense strands disclosed herein further comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more phosphorothioate intemucleoside linkages. In some embodiments, at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 1 and 2 from the 5’ end of the first nucléotide sequence. In some embodiments, at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 2 and 3 from the 5’ end of the first nucléotide sequence.

In some embodiments, any of the antisense strands disclosed herein further comprise TT sequence adjacent to the second nucléotide sequence. In some embodiments, the antisense strand further comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more phosphorothioate intemucleoside linkages. In some embodiments, at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 1 and 2 from the 5’ end of the second nucléotide sequence. In some embodiments, at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 2 and 3 from the 5’ end of the second nucléotide sequence. In some embodiments, at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 1 and 2 from the 3’ end of the second nucléotide sequence. In some embodiments, at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 2 and 3 from the 3 ’ end of the second nucléotide sequence.

In some embodiments, the first nucléotide from the 5’ end of any of the first nucléotide sequences disclosed herein comprises a 5’ stabilizing end cap.

In some embodiments, the first nucléotide from the 5’ end of any of the second nucléotide sequences disclosed herein comprise a 5’ stabilizing end cap.

' In some embodiments, the first nucléotide from the 5’ end of any of the first nucléotide sequences dislosed herein comprises a phosphorylation blocker.

In some embodiments, the first nucléotide from the 5’ end of any of the second nucléotide sequences dislosed herein comprises a phosphorylation blocker.

In some embodiments, any of the first nucléotide sequences or second nucléotide sequences disclosed herein comprise at least one modified nucléotide selected from

O<=O -Æo -oy-N (LNA), (ScpBNA or “cp”); ⁰ (AmNA), where R is H

or alkyl (or AmNA(N-Me)) when R is alkyl);

^h2ⁿ (GuNA); and

GuNA(N-R), R = Me, Et, iPr, tBu, _wherein B is a nucleobase.

Disclosed herein is a short-interfering nucleic acid (siNA) molécule comprising: (a) a ^R4\Î/^R1 phosphorylation blocker of Formula (IV): ~J— , wherein

R¹ is a nucleobase,

R⁴is -O-R³⁰ or-NR³¹R³²,

R³⁰ is Ci-Cs substituted or unsubstituted alkyl; and

R³¹ and R³² together with the nitrogen to which they are attached form a substituted or unsubstituted heterocyclic ring; and (b) a short interfering nucleic acid (siNA). In some embodiments, the siNA is any of the siNAs disclosed herein. In some embodiments, the siNA comprises any of the sense strands, first nucléotide sequences, antisense strands, or second nucléotide sequences disclosed herein. In some embodiments, the siNA comprises any of the the sense strands disclosed herein. In some embodiments, the siNA comprises any of the antisense strand disclosed herein. In some embodiments, the siNA comprises a first nucléotide sequence selected from any one of SEQ ID NOs: 1-56, 103-158, and 205-260. In some embodiments, the siNA comprises a second nucléotide sequence selected from any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the siNA comprises a sense sequence selected from any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the siNA comprises an antisense sequence selected from any one of SEQ ID NOs: 363-409, 445-533, and 536-539. In some embodiments, the siNA comprises a ds-siNA sequence selected from any one of ds-siNA-001 to ds-siNA-0178. In some embodiments, the siNA further comprises any of the 5’ end caps disclosed herein. In some embodiments, the siNA further comprises any of the conjugated moieties disclosed herein. In some embodiments, the siNA further comprises any of the destabilizing nucléotides disclosed herein. In some embodiments, the siNA further comprises any of the modified nucléotides disclosed herein.

Disclosed herein is a short-interfering nucleic acid (siNA) molécule comprising: (a) a 5’ stabilized end cap of Formula (la):

wherein

R¹ is a nucleobase, aryl, heteroaryl, or H,

H

H ,N. / i S // Λ

O O 5 _zOCD₃ o , -CH=CD-Z, -CD=CH-Z, -CD=CD-Z, -(CR^2IR²²)_n-Z, or -(C₂-C₆ alkenylene)-Z and R²⁰ is hydrogen; or

R² and R²⁰ together form a 3- to 7-membered carbocyclic ring substituted with -(CR²¹R²²)_n-Z or

-(C2-C6 alkenylene)-Z;

n is 1, 2, 3, or 4;

Z is -ONR²³R²⁴, -OP(O)OH(CH2)mCO2R²³, -OP(S)OH(CH2)_mCO₂R²³, -P(O)(OH)₂, P(O)(OH)(OCH₃), -P(O)(OH)(OCD₃), -SO₂(CH₂)_mP(O)(OH)₂, -SO₂NR²³R²⁵, -nr²³r²⁴, R²¹ and R²² are independently hydrogen or Ci-Cô alkyl; R²¹ and R²² together form an oxo group; R²³ is hydrogen or Ci-Cô alkyl;

R²⁴ is -SO₂R²⁵ or -C(O)R²⁵; or

R²³ and R²⁴ together with the nitrogen to which they are attached form a substituted or unsubstituted heterocyclic ring;

R²⁵ is Ci-Cô alkyl; and m is 1, 2, 3, or 4; and (b) a short interfering nucleic acid (siNA). In some embodiments, the siNA comprises any of the the sense strands disclosed herein. In some embodiments, the siNA comprises any of the antisense strand disclosed herein. In some embodiments, the siNA comprises a first nucléotide sequence selected from any one of SEQ ID NOs: 1-56, 103-158, and 205-260. In some embodiments, the siNA comprises a second nucléotide sequence selected from any one of SEQ 14

ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the siNA comprises a sense sequence selected from any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the siNA comprises an antisense sequence selected from any one of SEQ ID NOs: 363-409, 445533, and 536-539. In some embodiments, the siNA comprises a ds-siNA sequence selected from any one of ds-siNA-001 to ds-siNA-0178. In some embodiments, the siNA further comprises any of the phosphorylation blockers disclosed herein. In some embodiments, the siNA further comprises any of the conjugated moieties disclosed herein. In some embodiments, the siNA further comprises any of the destabilizing nucléotides disclosed herein. In some embodiments, the siNA further comprises any of the modified nucléotides disclosed herein.

Disclosed herein is a short-interfering nucleic acid (siNA) molécule comprising: (a) a 5’ stabilized end cap of Formula (Ib):

wherein

R¹ is a nucleobase, aryl, heteroaryl, or H,

O

II

P_X-OH OH

HO, _ZS 9 O, OH O, OCH₃

.. p^z J-L p Y

Y O ^ OH Y YH Y YH

O,, _zocd₃

-CH=CD-Z, -CD=CH-Z, -CD=CD-Z, -(CR²¹R²²)_n-Z, or -(C₂-C₆ alkenylene)-Z and R²⁰ is hydrogen; or

-(C2-C6 alkenylene)-Z;

n is 1, 2, 3, or 4;

Z is -ONR²³R²⁴, -OP(O)OH(CH2)mCO2R²³, -OP(S)OH(CH2)_mCO₂R²³, -P(O)(OH)₂, P(O)(OH)(OCH₃), -P(O)(OH)(OCD₃), -SO₂(CH₂)_mP(O)(OH)₂, -SO₂NR²³R²⁵, -nr²³r²⁴,

R²¹ and R²² are independently hydrogen or Ci-Cô alkyl; R²¹ and R²² together form an oxo group;

R²³ is hydrogen or Ci-Cô alkyl;

R²⁴ is -SO₂R²⁵ or -C(O)R²⁵; or

R²⁵ is Ci-Cô alkyl; and m is 1, 2, 3, or 4; and (b) a short interfering nucleic acid (siNA). In some embodiments, the siNA comprises any of the the sense strands disclosed herein. In some embodiments, the siNA comprises any of the antisense strand disclosed herein. In some embodiments, the siNA comprises a first nucléotide sequence selected from any one of SEQ ID NOs: 1-56, 103-158, and 205-260. In some embodiments, the siNA comprises a second nucléotide sequence selected from any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the siNA comprises a sense sequence selected from any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the siNA comprises an antisense sequence selected from any one of SEQ ID NOs: 363-409, 445533, and 536-539. In some embodiments, the siNA comprises a ds-siNA sequence selected from any one of ds-siNA-001 to ds-siNA-0178. In some embodiments, the siNA further comprises any of the phosphorylation blockers disclosed herein. In some embodiments, the siNA further comprises any of the conjugated moieties disclosed herein. In some embodiments, the siNA further comprises any of the destabilizing nucléotides disclosed herein. In some embodiments, the siNA further comprises any of the modified nucléotides disclosed herein.

Disclosed herein is a short-interfering nucleic acid (siNA) molécule comprising: (a) a 5’stabilized end cap selected from the group consisting of Formula (1) to Formula (15), Formula (9X) to Formula (12X), and Formula (9Y) to Formula (12Y):

Formula (8) Formula (9) Formula (9X) Formula (9Y)

Formula (10Y)

Formula (10)

Formula (10X)

Formula (11 Y)

Formula (11) Formula (11X)

Formula (12X) Formula (12Y)

Formula (12)

Formula (13)

Formula (14)

Formula (15) , wherein R¹ is a nucleobase, aryl, heteroaryl, or H; and (b) a short interfering nucleic acid (siNA). In some embodiments, the siNA comprises any of the the sense strands disclosed herein. In some embodiments, the siNA comprises any of the antisense strand disclosed herein. In some embodiments, the siNA comprises a first nucléotide sequence selected from any one of SEQ ID NOs: 1-56, 103-158, and 205-260. In some embodiments, the siNA comprises a second nucléotide sequence selected from any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the siNA comprises a sense sequence selected from any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the siNA comprises an antisense sequence selected from any one of SEQ ID NOs: 363-409, 445-533, and 536-539. In some embodiments, the siNA comprises a ds-siNA sequence selected from any one of ds-siNA-001 to ds-siNA-0178. In some embodiments, the siNA fiirther comprises any of the phosphorylation blockers disclosed herein. In some embodiments, the siNA fiirther comprises any of the conjugated moieties disclosed herein. In some embodiments, the siNA fiirther comprises any of the destabilizing nucléotides disclosed herein. In some embodiments, the siNA fiirther comprises any of the modified nucléotides disclosed herein.

Disclosed herein is a short-interfering nucleic acid (siNA) molécule comprising: (a) a 5’stabilized end cap selected from the group consisting of Formulas (1 A)-(15A), Formulas (9B)(12B), Formulas (9AX)-(12AX), Formulas (9AY)-(12AY), Formulas (9BX)-(12BX), and Formulas (9BY)-(12BY):

Formula (8A)

Formula (9A) Formula (9AX) Formula (9AY)

Formula (9B) Formula (9BX) Formula (9BY)

Formula (10A)

Formula (10AX)

Formula (10B)

Formula (10BX)

Formula (10BY)

Formula (11A)

Formula (11AX)

Formula (11AY)

Formula (11 B)

Formula (11BX)

Formula (11BY)

Formula (12AX)

Formula (12AY)

Formula (12A)

Formula (12BX)

Formula (12BY)

interfering nucleic acid (siNA). In some embodiments, the siNA comprises any of the the sense strands disclosed herein. In some embodiments, the siNA comprises any of the antisense strand disclosed herein. In some embodiments, the siNA comprises a first nucléotide sequence selected from any one of SEQ ID NOs: 1-56, 103-158, and 205-260. In some embodiments, the siNA comprises a second nucléotide sequence selected from any one of SEQ ID NOs: 57-102, 159204, and 261-306. In some embodiments, the siNA comprises a sense sequence selected from any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the siNA comprises an antisense sequence selected from any one of SEQ ID NOs: 363-409, 445-533, and 536-539. In some embodiments, the siNA comprises a ds-siNA sequence selected from any one of ds-siNA001 to ds-siNA-0178. In some embodiments, the siNA further comprises any of the phosphorylation blockers disclosed herein. In some embodiments, the siNA further comprises any of the conjugated moieties disclosed herein. In some embodiments, the siNA further comprises any of the destabilizing nucléotides disclosed herein. In some embodiments, the siNA further comprises any of the modified nucléotides disclosed herein.

Disclosed herein is a short-interfering nucleic acid (siNA) molécule comprising: (a) a 5’ stabilized end cap of Formula (le):

wherein

R¹ is a nucleobase, aryl, heteroaryl, or H,

O II P_X-OH OH _ZOH Ο_χ, _ZOCH_{3 z}OCD₃ ? 5

HO_X z_zS 9

Y^o^p^^A'oh

o , -CH=CD-Z, -CD=CH-Z, -CD=CD-Z, -(CR²¹R²²)_n-Z, or -(C₂-C₆ alkenylene)-Z and R²⁰ is hydrogen; or

-(C2-C6 alkenylene)-Z;

nis 1, 2, 3, or 4;

Z is -ONR²³R²⁴, -OP(O)OH(CH2)mCO2R²³, -OP(S)OH(CH2)_mCO₂R²³, -P(O)(OH)2, P(O)(OH)(OCH3), -P(O)(OH)(OCD3), -SO2(CH2)mP(O)(OH)2, -SO2NR²³R²⁵, -NR²³R²⁴, orNR²³SO2R²⁴;

R²¹ and R²² either are independently hydrogen or Ci-Ce alkyl, or R²¹ and R²² together form an oxo group;

R²³ is hydrogen or Ci-Ce alkyl;

R²⁴ is -SO₂R²⁵ or -C(O)R²⁵; or

R²⁵ is Ci-C₆ alkyl; and m is 1, 2, 3, or 4; and (b) a short interfering nucleic acid (siNA). In some embodiments, the siNA comprises any of the the sense strands disclosed herein. In some embodiments, the siNA comprises any of the antisense strand disclosed herein. In some embodiments, the siNA comprises a first nucléotide sequence selected from any one of SEQ ID NOs: 1-56, 103-158, and 205-260. In some embodiments, the siNA comprises a second nucléotide sequence selected from any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the siNA comprises a sense sequence selected from any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the siNA comprises an antisense sequence selected from any one of SEQ ID NOs: 363-409, 445533, and 536-539. In some embodiments, the siNA comprises a ds-siNA sequence selected from any one of ds-siNA-001 to ds-siNA-0178. In some embodiments, the siNA further comprises any of the phosphorylation blockers disclosed herein. In some embodiments, the siNA further comprises any of the conjugated moieties disclosed herein. In some embodiments, the siNA further comprises any of the destabilizing nucléotides disclosed herein. In some embodiments, the siNA further comprises any of the modified nucléotides disclosed herein.

Disclosed herein is a short-interfering nucleic acid (siNA) molécule comprising: (a) a 5’stabilized end cap selected from the group consisting of Formula (21) to Formula (35):

Formula (25)

Formula (26)

Formula (27)

Formula (31) Formula (32) Formula (33)

Formula (34)

Formula (35) , wherein R¹ is a nucleobase, aryl, heteroaryl, or

H; and (b) a short interfering nucleic acid (siNA). In some embodiments, the siNA comprises any of the the sense strands disclosed herein. In some embodiments, the siNA comprises any of the antisense strand disclosed herein. In some embodiments, the siNA comprises a first nucléotide sequence selected from any one of SEQ ID NOs: 1-56, 103-158, and 205-260. In some embodiments, the siNA comprises a second nucléotide sequence selected from any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the siNA comprises a sense sequence selected from any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the siNA comprises an antisense sequence selected from any one of SEQ ID NOs: 363-409, 445533, and 536-539. In some embodiments, the siNA comprises a ds-siNA sequence selected from any one of ds-siNA-001 to ds-siNA-0178. In some embodiments, the siNA further comprises any of the phosphorylation blockers disclosed herein. In some embodiments, the siNA further comprises any of the conjugated moieties disclosed herein. In some embodiments, the siNA further comprises any of the destabilizing nucléotides disclosed herein. In some embodiments, the siNA further comprises any of the modified nucléotides disclosed herein.

Disclosed herein is a short-interfering nucleic acid (siNA) molécule comprising: (a) a 5’stabilized end cap selected from the group consisting of Formulas (21A)-(35A), Formulas (29B)(32B), Formulas (29AX)-(32AX), Formulas (29AY)-(32AY), Formulas (29BX)-(32BX), and Formulas (29BY)-(32BY):

Formula (28A)

Formula (29B)

Formula (29AY)

Formula (29A)

Formula (29AX)

Formula (29BX)

Formula (29BY)

Formula (31AX)

Formula (31BX)

Disclosed herein is a short interfering nucleic acid (siNA) molécule.comprising: (a) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence comprises a nucléotide sequence of any one SEQ ID NOs: 1-56, 103158, and 205-260; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence comprises a nucléotide sequence of any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the siNA further comprises any of the 5’ end caps disclosed herein. In some embodiments, the siNA fürther comprises any of the phosphorylation blockers disclosed herein. In some emboiments, the siNA further comprises any of the conjugated moieties disclosed herein. In some embodiments, the siNA further comprises any of the destabilizing nucléotides disclosed herein. In some embodiments, the siNA further comprises any of the modified nucléotides disclosed herein.

Disclosed herein is a interfering nucleic acid (siNA) molécule comprising: (a) a sense strand comprising a nucléotide sequence of any one of SEQ ID NOs: 307-362 and 415-444; and (b) an antisense strand comprising a nucléotide sequence of any one of SEQ ID NOs: 363-409, 445-533, and 536-539.

In some embodiments, any of the siNA disclosed herein further comprise a phosphorylation blocker.

In some embodiments, the phosphorylation blocker has the structure of Formula (IV):

, wherein

R¹ is a nucleobase,

R⁴ is -O-R³⁰ or -NR³¹R³², R³⁰ is Ci-Cs substituted or unsubstituted alkyl; and

R³¹ and R³² together with the nitrogen to which they are attached form a substituted or unsubstituted heterocyclic ring.

In some embodiments, R⁴ is -OCH3 or -N(CH2CH2)2O.

In some embodiments, the phosphorylation blocker is attached to the 5’ end of the sense strand.

In some embodiments, the phosphorylation blocker is attached to the 5’ end of the sense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, and phosphorodithioate linker.

In some embodiments, the phosphorylation blocker is attached to the 3 ’ end of the sense strand.

In some embodiments, the phosphorylation blocker is attached to the 3’ end of the sense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, and phosphorodithioate linker.

In some embodiments, the phosphorylation blocker is attached to the 5’ end of the antisense strand. In some embodiments, the phosphorylation blocker is attached to the 5’ end of the antisense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, and phosphorodithioate linker. In some embodiments, the phosphorylation blocker is attached to the 3’ end of the antisense strand. In some embodiments, the phosphorylation blocker is attached to the 3 ’ end of the antisense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, and phosphorodithioate linker.

In some embodiments, any of the siNAs disclosed herein further comprise a conjugated moiety. In some embodiments, the conjugated moiety comprises a galactosamine. In some embodiments, the galactosamine is N-acetylgalactosamine (GalNAc) of Formula (VII):

R = OH or SH wherein each n is independently 1 or 2. In some embodiments, the galactosamine is Nacetylgalactosamine (GalNAc) of Formula (VI):

m is 1, 2, 3, 4, or 5;

each n is independently 1 or 2; p is 0 or 1 ;

each R is independently H;

each Y is independently selected from -O-P(=O)(SH)-, -O-P(=O)(O)-, -O-P(=O)(OH)-, and O-P(S)S-;

Z is H or a second protecting group;

either L is a linker or L and Y in combination are a linker; and

A is H, OH, a third protecting group, an activated group, or an oligonucleotide. In some embodiments, wherein A is an oligonucleotide. In some embodiments, A is 1-2 oligonucleotides. In some embodiments, the oligonucleotide is dTdT. In some embodiments, the galactosamine is attached to the 3’ end of the sense strand. In some embodiments, the galactosamine is attached to the 3 ’ end of the sense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, or phosphorodithioate linker. In some embodiments, the galactosamine is attached to the 5’ end of the sense strand. In some embodiments, the galactosamine is attached to the 5’ end of the sense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, or phosphorodithioate linker. In some embodiments, the galactosamine is attached to the 3 ’ end of the antisense strand. In some embodiments, the galactosamine is attached to the 3 ’ end of the atnisense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, or phosphorodithioate linker. In some embodiments, the galactosamine is attached to the 5’ end of the antisense strand. In some embodiments, the galactosamine is attached to the 5’ end of the atnisense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, or phosphorodithioate linker.

In some embodiments, any of the siNAs disclosed herein further comprise a 5’-stabilized end cap. In some embodiments, the 5’-stabilized end cap is a 5’ vinyl phosphonate or deuterated

5’ vinyl phosphonate. In some embodiments, the 5’-stabilized end cap has the structure of

R²

R²⁰' 0'

Formula (la): — °\^R¹ (DCH₃ , wherein

R¹ is a nucleobase, aryl, heteroaryl, or H,

O, _ZO

R² is H

9'P

H ;s-^No' ^SO

O. O

O, _ZO

H o,_xzp 9

J:s^p_x-oh

OH

HO, _zs 9

O, OH _ZOCH₃

ΌΗ

O_s OCD₃^^PxOH

H ,N. / 1 S // Ά

O O 5

-(C2-C6 alkenylene)-Z;

n is 1, 2, 3, or 4;

R²¹ and R²² either are independently hydrogen or Ci-Cô alkyl, or R²¹ and R²² together form an oxo group;

R²³ is hydrogen or Ci-Cô alkyl;

R²⁴ is -SO2R²⁵ or-C(O)R²⁵; or

R²⁵ is Ci-Cô alkyl; and m is 1, 2, 3, or 4. In some embodiments, the 5’-stabilized end cap has the structure of Formula ^ry°_vr¹ _R2ovy

0' ^zocd₃(Ib): —I— , wherein

R¹ is a nucleobase, aryl, heteroaryl, or H,

Zz° ° HO. _ZS 9 O_x DH O, och₃ O, ocd₃ 's'/R-OH , p' A _u A . A _ A

Oh Y O OH V OH Y OH Y OH

-(C₂-Cô alkenylene)-Z;

n is 1, 2, 3, or 4;

R²³ is hydrogen or Ci-Ce alkyl;

R²⁴ is -SO₂R²⁵ or -C(O)R²⁵; or

R²⁵ is Ci-Cô alkyl; and m is 1, 2, 3, or 4. In some embodiments, the 5’-stabilized end cap has the structure of Formula

0' F (le): —L- , wherein

R¹ is a nucleobase, aryl, heteroaryl, or H,

O_s θ HO. _ZS 9 o_x OH O. och₃ O. ocd₃

Js^r-oh x A A

OH V O OH Y OH Y OH Y OH ? 9 5 5

Ο , -CH=CD-Z, -CD=CH-Z, -CD=CD-Z, -(CR² ‘R²²)_n-Z, or -(C₂-C₆ alkenylene)-Z and R²⁰ is hydrogen; or

-(C2-C6 alkenylene)-Z;

n is 1, 2, 3, or 4;

R²³ is hydrogen or Ci-Cô alkyl;

R²⁴ is -SO2R²⁵ or -C(O)R²⁵; or

R²⁵ is Ci-Cô alkyl; and m is 1, 2, 3, or 4. In some embodiments, R¹ is an aryl. In some embodiments, the aryl is a phenyl. In some embodiments, the 5’-stabilized end cap is selected from the group consisting of Formula (1) to Formula (15), Formula (9X) to Formula (12X), and Formula (9Y) to Formula (12Y):

Formula (5)

Formula (6)

Formula (7)

Formula (11) Formula (11X) Formula (11 Y)

Formula (12) Formula (12X) Formula (12Y)

Formula (13) Formula (14)

Formula (15) , wherein R¹ independently is a nucleobase, aryl, heteroaryl, or H. In some embodiments, the 5’-stabilized end cap is selected from the group consisting of Formulas (1A)-(15A), Formulas (9B)-(12B), Formulas (9AX)-(12AX), Formulas (9AY)-(12AY), Formulas (9BX)-(12BX), and Formulas (9BY)(12BY):

Formula (5A)

Formula (8A)

Formula (9AX) Formula (9AY)

Formula (9B)

Formula (10A)

Formula (9A)

Formula (9BX)

cf Î)CH₃

Formula (9BY)

Formula (10B) Formula (10BX) Formula (10BY)

Formula (11AX)

Formula (11 B)

Formula (11BX)

Formula (11BY)

Formula (12A) Formula (12AX) Formula (12AY)

the 5’-stabilized end cap is selected from the group consisting of Formula (21) to Formula (35):

Formula (25)

Formula (26)

Formula (27)

Formula (28) Formula (29) Formula (30)

Formula (31) Formula (32) Formula (33)

Formula (34) Formula (35) , _wherein R¹ is a nucleobase, aryl, heteroaryl, or

H. In some embodiments, the 5’-stabilized end cap is selected from the group consisting of

Formulas (21A)-(35A), Formulas (29B)-(32B), Formulas (29AX)-(32AX), Formulas (29AY)(32AY), Formulas (29BX)-(32BX), and Formulas (29BY)-(32BY):

Formula (28A)

Formula (29B)

Formula (31A)

Formula (29A) Formula (29AX) Formula (29AY)

Formula (29BX)

Formula (29BY)

Formula (30AX)

Formula (30BY)

Formula (31AX)

Formula (31BY)

Formula (32A) Formula (32AX) Formula (32AY)

Formula (33A) Formula (34A) Formula (35A) . j-q sq^ic embodiments the 5’-stabilized end cap is attached to the 5’ end of the antisense strand. In some embodiments, the 5’-stabilized end cap is attached to the 5’ end of the antisense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, or phosphorodithioate linker. In some embodiments, the 5’-stabilized end cap is attached to the 5’ end of the sense strand. In some embodiments, the 5’-stabilized end cap is attached to the 5’ end of the sense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, or phosphorodithioate linker.

In some embodiments, any of the siNAs, sense strands, first nucléotide sequences, antisense strands, or second nucléotide sequences disclosed herein further comprise at least one thermally destabilizing nucléotides. In some embodiments, any of the antisense strands disclosed herein further comprise at least one thermally destabilizing nucléotide selected from:

. In some embodiments, any of the sense strands disclosed herein comprise at least one thermally destabilizing nucléotide selected from:

herein further comprise at least one thermally destabilizing nucléotide selected from:

0' F . In some embodiments, any of the modified nucléotides disclosed herein is a thermally destabilizing nucléotide.

In some embodiments, any of the siNAs disclosed herein specifically downregulate or reduce expression of a target gene. In some embodiments, the target gene is a viral gene. In some embodiments, the viral gene is from a DNA virus. In some embodiments, the DNA virus is a double-stranded DNA (dsDNA) virus. In some embodiments, the dsDNA virus is a hepadnavirus. In some embodiments, the hepadnavirus is a hepatitis B virus (HBV). In some embodiments, the HBV is selected from HBV génotypes A-J. In some embodiments, the target gene is selected from the S gene or X gene of the HBV.

In some embodiments, the second nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to 15 to 30 nucléotides within positions 200-720 or 1100-1700 of SEQ ID NO: 410. In some embodiments, the second nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to 15 to 30 nucléotides within positions 200-280, 300-445, 460-510, 650-720, 1170-1220, 1250-1300, or 1550-1630 of SEQ ID NO: 410. In some embodiments, the second nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to 15 to 30 nucléotides within positions 200-230, 250-280, 300-330, 370-400, 405-445, 460-500, 670-700, 1180-1210, 1260-1295, 1520-1550, or 1570-1610 of SEQ ID NO: 410. In some embodiments, the second nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to 15 to 30 nucléotides starting at position 203, 206, 254, 305, 375, 409, 412, 415, 416, 419, 462, 466, 467, 674, 676, 1182, 1262, 1263, 1268, 1526, 1577, 1578, 1580, 1581, 1583, or 1584 of SEQ ID NO: 410.

In some embodiments, the first nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to 15 to 30 nucléotides within positions 200-720 or 1100-1700 of SEQ ID NO: 410. In some embodiments, the first nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to 15 to 30 nucléotides within positions 200-280, 300-445, 460-510, 650-720, 1170-1220, 1250-1300, or 1550-1630 of SEQ ID NO: 410. In some embodiments, the first nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to 15 to 30 nucléotides within positions 200-230, 250-280, 300-330, 370-400, 405-445, 460-500, 670-700, 1180-1210, 12601295, 1520-1550, or 1570-1610 of SEQ ID NO: 410. In some embodiments, the first nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to 15 to 30 nucléotides starting at position 203, 206, 254, 305, 375, 409, 412, 415, 416, 419, 462, 466, 467, 674, 676, 1182, 1262, 1263, 1268, 1526, 1577, 1578, 1580, 1581, 1583, or 1584 ofSEQ ID NO: 410.

In some embodiments, the first nucléotide sequence comprises a nucléotide sequence of any one SEQ ID NOs: 1-56, 103-158, and 205-260.

In some embodiments, the second nucléotide sequence comprises a nucléotide sequence of any one ofSEQ ID NOs: 57-102, 159-204, and 261-306.

In some embodiments, the sense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 307-362 and 415-444.

In some embodiments, the antisense strand comprises a nucléotide sequence of any one ofSEQ ID NOs: 363-409, 445-533, and 536-539.

In some embodiments, at least one end of the siNA is a blunt end.

In some embodiments, at least one end of the siNA comprises an overhang, wherein the overhang comprises at least one nucléotide.

In some embodiments, both ends of the siNA comprise an overhang, wherein the overhang comprises at least one nucléotide.

In some embodiments, the siNA is selected from ds-siNA-001 to ds-siNA-0178.

In some embodiments, at least one 2’-fluoro nucléotide or 2’-O-methyl nucléotide is a 2’fluoro or 2-O-methyl nucléotide mimic of Formula (V):

q2 r⁵ , wherein .

R¹ is independently a nucleobase, aryl, heteroaryl, or H, Q¹ and Q² are independently S or O,

R⁵ is independently -OCD3, -F, or -OCH3, and

R⁶ and R⁷ are independently H, D, or CD3.

In some embodiments, the 2’-fluoro or 2’-(9-methyl nucléotide mimic is a nucléotide mimic of Formula (16) - Formula (20):

O R² S R² d R² 0' ôcd₃ d ÔCD₃ % \ \ \ %

Formula (16) Formula (17) Formula (18) Formula (19) Formula (20) wherein R¹ is a nucleobase and R² is independently F or -OCH3.

Further disclosed herein are compositions comprising any of the siNAs disclosed herein. In some embodiments, the siNA targets an S gene of HBV. In some embodiments, the siNA specifically downregulates or reduces expression of the S gene of HBV. In some embodiments, the siNA targets an X gene of HBV. In some embodiments, the siNA specifically downregulates or reduces expression of the X gene of HBV. In some embodiments, the siNA comprises a first nucléotide sequence. In some embodiments, the first nucléotide sequence comprises a nucléotide sequence of any one SEQ ID NOs: 1-56, 103-158, and 205-260. In some embodiments, the siNA comprises a second nucléotide sequence. In some embodiments, the second nucléotide sequence comprises a nucléotide sequence of any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the siNA comprises a sense strand. In some embodiments, the sense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the siNA comprises an antisense strand. In some embodiments, the antisense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 363-409, 445-533, and 536539. In some embodiments, the siNA further comprises any of the 5’ end caps disclosed herein. In some embodiments, the siNA further comprises any of the phosphorylation blockers disclosed herein. In some embodiments, the siNA further comprises any of the conjugated moieties disclosed herein. In some embodiments, the siNA further comprises any of the destabilized nucléotides disclosed herein. In some embodiments, the siNA further comprises any of the modified nucléotides disclosed herein.

Further disclosed herein are compositions comprising 2, 3, 4, 5, 6, 7, 8, 9, 10 or more of any of the siNAs disclosed herein. In some embodiments, at least 1, 2, 3, 4, 5, or more siNAs target an S gene of HBV. In some embodiments, at least 1, 2, 3, 4, 5, or more siNAs specifically downregulate or reduce expression of the S gene of HBV. In some embodiments, at least 1, 2, 3, 4, 5, or more siNAs target an X gene of HBV. In some embodiments, at least 1, 2, 3, 4, 5, or more siNAs specifically downregulate or reduce expression of the X gene of HBV. In some embodiments, the siNA comprises a first nucléotide sequence. In some embodiments, the first nucléotide sequence comprises a nucléotide sequence of any one SEQ ID NOs: 1-56, 103-158, and 205-260. In some embodiments, the siNA comprises a second nucléotide sequence. In some embodiments, the second nucléotide sequence comprises a nucléotide sequence of any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the siNA comprises a sense strand. In some embodiments, the sense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the siNA comprises an antisense strand. In some embodiments, the antisense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 363-409, 445-533, and 536-539. In some embodiments, the siNA further comprises any of the 5 ’ end caps disclosed herein. In some embodiments, the siNA fürther comprises any of the phosphorylation blockers disclosed herein. In some embodiments, the siNA further comprises any of the conjugated moieties disclosed herein. In some embodiments, the siNA further comprises any of the destabilized nucléotides disclosed herein. In some embodiments, the siNA further comprises any of the modified nucléotides disclosed herein.

In some embodiments, any of the compositions disclosed herein further comprise an additional HBV treatment agent. In some embodiments, the additional HBV treatment agent is selected from a nucléotide analog, nucleoside analog, a capsid assembly modulator (CAM), a recombinant interferon, an entry inhibitor, a small molécule immunomodulator and oligonucleotide therapy. In some embodiments, the oligonucleotide therapy is an additional siNA. In some embodiments, the additional siNA is selected from any of ds-sîNA-001 to dssiNA-0178. In some embodiments, the oligonucleotide therapy is an antisense oligonucleotide (ASO), NAPs, or STOPs. In some embodiments, the ASO is ASO 1 or ASO 2. In some embodiments, the ASO specifically targets the S gene of HBV. In some embodiments, the ASO specifically targets the X gene of HBV. In some embodiments, the additional HBV treatment agent is selected from HBV STOPS™ ALG-010133, HBV CAM ALG-000184, ASO 1, recombinant interferon alpha 2b, IFN-a, PEG-IFN-a-2a, lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide, tenofovir disoproxil, NVR3-778, BAY414109, JNJ-632, JNJ-3989 (ARO-HBV), RG6004, GSK3228836, REP-2139, REP-2165, AB-729, VIR-2218, RG6346 (DCR-HBVS), JNJ-6379, GLS4, ABI-HO731, JNJ-440, NZ-4, RG7907, EDP-514, AB-423, AB-506, ABI-H03733 and ABI-H2158.

In some embodiments, any of the compositions disclosed herein further comprise a liver disease treatment agent. In some embodiments, the liver disease treatment agent is selected from a peroxisome proliferator-activator receptor (PPAR) agonist, famesoid X receptor (FXR) agonist, lipid-altering agent, and incretin-based therapy. In some embodiments, the PPAR agonist is selected from a PPARa agonist, dual PPARa/δ agonist, PPARy agonist, and dual PPARa/γ agonist. In some embodiments, the dual PPARa agonist is a fibrate. In some embodiments, the PPARa/δ agonist is elafibranor. In some embodiments, the PPARy agonist is a thiazolidinedione (TZD). In some embodiments, TZD is pioglitazone. In some embodiments, the dual PPARa/γ agonist is saroglitazar. In some embodiments, the FXR agonist is obeticholic acis (OCA). In some embodiments, the lipid-altering agent is aramchol. In some embodiments, the incretin-based therapy is a glucagon-like peptide 1 (GLP-1) receptor agonist or dipeptidyl peptidase 4 (DPP-4) inhibitor. In some embodiments, the GLP-1 receptor agonist is exenatide or liraglutide. In some embodiments, the DPP-4 inhibitor is sitagliptin or vildapliptin.

Further disclosed herein are methods of treating a disease in a subject in need thereof, comprising administering to the subject any of the siNAs disclosed herein. In some embodiments, the siNA comprises a first nucléotide sequence. In some embodiments, the first nucléotide sequence comprises a nucléotide sequence of any one SEQ ID NOs: 1-56, 103-158, and 205-260. In some embodiments, the siNA comprises a second nucléotide sequence. In some embodiments, the second nucléotide sequence comprises a nucléotide sequence of any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the siNA comprises a sense strand. In some embodiments, the sense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the siNA comprises an antisense strand. In some embodiments, the antisense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 363-409, 445-533, and 536-539. In some embodiments, the siNA further comprises any of the 5 ’ end caps disclosed herein. In some embodiments, the siNA further comprises any of the phosphorylation blockers disclosed herein. In some embodiments, the siNA further comprises any of the conjugated moieties disclosed herein. In some embodiments, the siNA further comprises any of the destabilized nucléotides disclosed herein. In some embodiments, the siNA further comprises any of the modified nucléotides disclosed herein.

Further disclosed herein are methods of treating a disease in a subject in need thereof, comprising administering to the subject any of the compositions disclosed herein. In some embodiments, the compositon comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more of any of the siNAs disclosed herein. In some embodiments, the siNA comprises a first nucléotide sequence. In some embodiments, the first nucléotide sequence comprises a nucléotide sequence of any one SEQ ID NOs: 1-56, 103-158, and 205-260. In some embodiments, the siNA comprises a second nucléotide sequence. In some embodiments, the second nucléotide sequence comprises a nucléotide sequence of any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the siNA comprises a sense strand. In some embodiments, the sense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the siNA comprises an antisense strand. In some embodiments, the antisense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 363-409, 445-533, and 536539. In some embodiments, the siNA further comprises any of the 5’ end caps disclosed herein. In some embodiments, the siNA further comprises any of the phosphorylation blockers disclosed herein. In some embodiments, the siNA further comprises any of the conjugated moieties disclosed herein. In some embodiments, the siNA further comprises any of the destabilized nucléotides disclosed herein. In some embodiments, the siNA further comprises any of the modified nucléotides disclosed herein. In some embodiments, the composition further comprises any of the additional HBV treatment agents disclosed herein. In some embodiments, the disease is a viral disease. In some embodiments, the viral disease is caused by a DNA virus. In some embodiments, the DNA virus is a double stranded DNA (dsDNA) virus. In some embodiments, the dsDNA virus is a hepadnavirus. In some embodiments, the hepadnavirus is a hepatitis B virus (HBV). In some embodiments, the HBV is selected from HBV génotypes A-J. In some embodiments, the method further comprises administering an additional HBV treatment agent. In some embodiments, the siNA or the composition and the additional HBV treatment agent are administered concurrently. In some embodiments, the siNA or the composition and the additional HBV treatment agent are administered sequentially. In some embodiments, the siNA or the composition is administered prior to administering the additional HBV treatment agent. In some embodiments, the siNA or the composition is administered after administering the additional HBV treatment agent. In some embodiments, the additional HBV treatment agent is selected from a nucléotide analog, nucleoside analog, a capsid assembly modulator (CAM), a recombinant interferon, an entry inhibitor, a small molécule immunomodulator and oligonucleotide therapy. In some embodiments, the oligonucleotide therapy is an additional siNA. In some embodiments, the additional siNA is selected from any of ds-siNA-001 to dssiNA-0178. In some embodiments, the oligonucleotide therapy is an antisense oligonucleotide (ASO), NAPs, or STOPs. In some embodiments, the ASO is ASO 1 or ASO 2. In some embodiments, the additional HBV treatment agent is selected from HBV STOPS™ ALG010133, HBV CAM ALG-000184, ASO 1, recombinant interferon alpha 2b, IFN-a, PEG-IFN-a2a, lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide, tenofovir disoproxil, NVR3-778, BAY41-4109, JNJ-632, JNJ-3989 (ARO-HBV), RG6004, GSK3228836, REP-2139, REP-2165, AB-729, VIR-2218, RG6346 (DCR-HBVS), JNJ-6379, GLS4, ABI-HO731, JNJ-440, NZ-4, RG7907, EDP-514, AB-423, AB-506, ABI-H03733 and ABI-H2158.

In some embodiments, the disease is a liver disease. In some embodiments, the liver disease is a nonalcoholic fatty liver disease (NAFLD) or hepatocellular carcinoma (HCC). In some embodiments, the NAFLD is nonalcoholic steatohepatitis (NASH). In some embodiments, the method further comprises administering to the subject a liver disease treatment agent. In some embodiments, the liver disease treatment agent is selected from a peroxisome proliferatoractivator receptor (PPAR) agonist, famesoid X receptor (FXR) agonist, lipid-altering agent, and incretin-based therapy. In some embodiments, the PPAR agonist is selected from a PPARa agonist, dual PPARa/δ agonist, PPARy agonist, and dual PPARa/γ agonist. In some embodiments, the dual PPARa agonist is a fibrate. In some embodiments, the PPARa/δ agonist is elafibranor. In some embodiments, the PPARy agonist is a thiazolidinedione (TZD). In some embodiments, TZD is pioglitazone. In some embodiments, the dual PPARa/γ agonist is saroglitazar. In some embodiments, the FXR agonist is obeticholic acis (OCA). In some embodiments, the lipid-altering agent is aramchol. In some embodiments, the incretin-based therapy is a glucagon-like peptide 1 (GLP-1) receptor agonist or dipeptidyl peptidase 4 (DPP-4) inhibitor. In some embodiments, the GLP-1 receptor agonist is exenatide or liraglutide. In some embodiments, the DPP-4 inhibitor is sitagliptin or vildapliptin. In some embodiments, the siNA or composition and the liver disease treatment agent are administered concurrently. In some embodiments, the siNA or composition and the liver disease treatment agent are administered sequentially. In some embodiments, the siNA or composition is administered prior to administering the liver disease treatment agent. In some embodiments, the siNA or composition is administered after administering the liver disease treatment agent.

In some embodiments, the siNA or the composition is administered at a dose of at least 1 mg/kg, 2 mg/kg, 3 mg/kg, 4 mg/kg, 5 mg/kg, 6 mg/kg, 7 mg/kg, 8 mg/kg, 9 mg/kg, 10 mg/kg, 11 mg/kg, 12 mg/kg, 13 mg/kg 14 mg/kg, or 15 mg/kg. In some embodiments, the siNA or the composition is administered at a dose of between 0.5 mg/kg to 50 mg/kg, 0.5 mg/kg to 40 mg/kg 0.5 mg/kg to 30 mg/kg, 1 mg/kg to 50 mg/kg, 1 mg/kg to 40 mg/kg, 1 mg/kg to 30 mg/kg, 1 mg/kg to 20 mg/kg, 3 mg/kg to 50 mg/kg, 3 mg/kg to 40 mg/kg, 3 mg/kg to 30 mg/kg, 3 mg/kg to 20 mg/kg, 3 mg/kg to 15 mg/kg, 3 mg/kg to 10 mg/kg, 4 mg/kg to 50 mg/kg, 4 mg/kg to 40 mg/kg, 4 mg/kg to 30 mg/kg, 4 mg/kg to 20 mg/kg, 4 mg/kg to 15 mg/kg, 4 mg/kg to 10 mg/kg, 5 mg/kg to 50 mg/kg, 5 mg/kg to 40 mg/kg, 5 mg/kg to 30 mg/kg, 5 mg/kg to 20 mg/kg, 5 mg/kg to 15 mg/kg, or 5 mg/kg to 10 mg/kg.

In some embodiments, the siNA or the composition is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times. In some embodiments, the siNA or the composition is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times a day, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times a week, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times a month. In some embodiments, the siNA or the composition are administered at least once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days. In some embodiments, the siNA or the composition is administered for aperiod of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days, or at least 1,2, 3,4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,20, 21,22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 51, 52, 53, 54, or 55 weeks.

In some embodiments, the siNA or the composition is administered at a single dose of 5 mg/kg. In some embodiments, the siNA or the composition is administered at a single dose of 10 mg/kg. In some embodiments, the siNA or the composition is administered at three doses of 10 mg/kg once a week. In some embodiments, the siNA or the composition is administered at three doses of 10 mg/kg once every three days. In some embodiments, the siNA or the composition is administered at five doses of 10 mg/kg once every three days. In some embodiments, the siNA or the composition is administered at six doses of ranging from 1 mg/kg to 15 mg/kg, 1 mg/kg to 10 mg/kg, 2 mg/kg to 15 mg/kg, 2 mg/kg to 10 mg/kg, 3 mg/kg to 15 mg/kg, or 3 mg/kg to 10 mg/kg. In some embodiments, the first dose and second dose are administered at least 3 days apart. In some embodiments, the second dose and third dose are administered at least 4 days apart. In some embodiments, the third dose and fourth dose, fourth dose and fifth dose, or fifth dose and sixth dose are administered at least 7 days apart.

In some embodiments, any of the siNAs or the compositions disclosed herein are formulated as a particle or viral vector. In some embodiments, the siNA or the composition are administered in a particle or viral vector. In some embodiments, the viral vector is a vector of adenovirus, adeno-associated virus (AAV), alphavirus, flavivirus, herpes simplex virus, lentivirus, measles virus, picomavirus, poxvirus, retrovirus, or rhabdovirus. In some embodiments, the viral vector is a recombinant viral vector. In some embodiments, the viral vector is selected from AAVrh.74, AAVrh.10, AAVrh.20, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12 and AAV-13. In some embodiments, the siNA or the composition is administered systemically. In some embodiments, the siNA or the composition is administered locally. In some embodiments, the siNA or the composition is administered intravenously, subcutaneously, or intramuscularly.

In some embodiments, any of the siRNAs or compositions disclosed herein are used in the manufacture of a médicament for treating a disease. In some embodiments, the disease is a viral disease. In some embodiments, the viral disease is caused by a DNA virus. In some embodiments, the DNA virus is a double stranded DNA (dsDNA virus). In some embodiments, the dsDNA virus is a hepadnavirus. In some embodiments, the hepadnavirus is a hepatitis B virus (HBV). In some embodiments, the HBV is selected from HBV génotypes A-J. In some embodiments, an additional HBV treatment agent is fùrther used in the manufacture of the médicament. In some embodiments, the additional HBV treatment agent is selected from a nucléotide analog, nucleoside analog, a capsid assembly modulator (CAM), a recombinant interferon, an entry inhibitor, a small molécule immunomodulator and oligonucleotide therapy. In some embodiments, the oligonucleotide therapy is an additional siNA. In some embodiments, the additional siNA is selected from any of ds-siNA-001 to ds-siNA-0178. In some embodiments, the oligonucleotide therapy is an antisense oligonucleotide (ASO), NAPs, or STOPs. In some embodiments, the ASO is ASO 1 or ASO 2. In some embodiments, the additional HBV treatment agent is selected from HBV STOPS™ ALG-010133, HBV CAM ALG-000184, ASO 1, recombinant interferon alpha 2b, IFN-a, PEG-IFN-a-2a, lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide, tenofovir disoproxil, NVR3-778, BAY41-4109, JNJ-632, JNJ-3989 (ARO-HBV), RG6004, GSK3228836, REP-2139, REP-2165, AB-729, VIR-2218, RG6346 (DCR-HBVS), JNJ-6379, GLS4, ABI-HO731, JNJ440, NZ-4, RG7907, EDP-514, AB-423, AB-506, ABI-H03733 and ABI-H2158.

In some embodiments, any of the siRNAs or compositions disclosed herein are used in the manufacture of a médicament for treating a disease. In some embodiments, the disease is a liver disease. In some embodiments, the liver disease is a nonalcoholic fatty liver disease (NAFLD) or hepatocellular carcinoma (HCC). In some embodiments, the NAFLD is nonalcoholic steatohepatitis (NASH). In some embodiments, the siNA comprises a first nucléotide sequence. In some embodiments, the first nucléotide sequence comprises a nucléotide sequence of any one SEQ ID NOs: 1-56, 103-158, and 205-260. In some embodiments, the siNA comprises a second nucléotide sequence. In some embodiments, the second nucléotide sequence comprises a nucléotide sequence of any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the siNA comprises a sense strand. In some embodiments, the sense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the siNA comprises an antisense strand. In some embodiments, the antisense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 363-409, 445-533, and 536539. In some embodiments, the siNA further comprises any of the 5’ end caps disclosed herein. In some embodiments, the siNA further comprises any of the phosphorylation blockers disclosed herein. In some embodiments, the siNA further comprises any of the conjugated moieties disclosed herein. In some embodiments, the siNA further comprises any of the destabilized nucléotides disclosed herein. In some embodiments, the siNA further comprises any of the modified nucléotides disclosed herein. In some embodiments, a liver disease treatment agent is further used in the manufacture of the médicament. In some embodiments, the liver disease treatment agent is selected from a peroxisome proliferator-activator receptor (PPAR) agonist, famesoid X receptor (FXR) agonist, lipid-altering agent, and incretin-based therapy. In some embodiments, the PPAR agonist is selected from a PPARa agonist, dual PPARa/δ agonist, PPARy agonist, and dual PPARa/γ agonist. In some embodiments, the dual PPARa agonist is a fibrate. In some embodiments, the PPARa/δ agonist is elafibranor. In some embodiments, the PPARy agonist is a thiazolidinedione (TZD). In some embodiments, TZD is pioglitazone. In some embodiments, the dual PPARa/γ agonist is saroglitazar. In some embodiments, the FXR agonist is obeticholic acis (OCA). In some embodiments, the lipid-altering agent is aramchol. In some embodiments, the incretin-based therapy is a glucagon-like peptide 1 (GLP-1) receptor agonist or dipeptidyl peptidase 4 (DPP-4) inhibitor. In some embodiments, the GLP-1 receptor agonist is exenatide or liraglutide. In some embodiments, the DPP-4 inhibitor is sitagliptin or vildapliptin.

In some embodiments, any of the siNAs disclosed herein is used as a médicament. In some embodiments, the siNA comprises a first nucléotide sequence. In some embodiments, the first nucléotide sequence comprises a nucléotide sequence of any one SEQ ID NOs: 1-56, 103158, and 205-260. In some embodiments, the siNA comprises a second nucléotide sequence. In some embodiments, the second nucléotide sequence comprises a nucléotide sequence of any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the siNA comprises a sense strand. In some embodiments, the sense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the siNA comprises an antisense strand. In some embodiments, the antisense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 363-409, 445-533, and 536-539. In some embodiments, the siNA further comprises any of the 5’ end caps disclosed herein. In some embodiments, the siNA further comprises any of the phosphorylation blockers disclosed herein. In some embodiments, the siNA fürther comprises any of the conjugated moieties disclosed herein. In some embodiments, the siNA further comprises any of the destabilized nucléotides disclosed herein. In some embodiments, the siNA further comprises any of the modified nucléotides disclosed herein.

In some embodiments, any of the compositions disclosed herein are used as a médicament. In some embodiments, the composition comprises any of the siNAs disclosed herein. In some embodiments, the siNA comprises a first nucléotide sequence. In some embodiments, the first nucléotide sequence comprises a nucléotide sequence of any one SEQ ID NOs: 1-56, 103-158, and 205-260. In some embodiments, the siNA comprises a second nucléotide sequence. In some embodiments, the second nucléotide sequence comprises a nucléotide sequence of any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the siNA comprises a sense strand. In some embodiments, the sense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the siNA comprises an antisense strand. In some embodiments, the antisense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 363-409, 445-533, and 536539. In some embodiments, the siNA further comprises any of the 5’ end caps disclosed herein. In some embodiments, the siNA further comprises any of the phosphorylation blockers disclosed herein. In some embodiments, the siNA further comprises any of the conjugated moieties disclosed herein. In some embodiments, the siNA further comprises any of the destabilized nucléotides disclosed herein. In some embodiments, the siNA further comprises any of the modified nucléotides disclosed herein.

In some embodiments, any of the siNAs disclosed herein are used in the treatment of a disease. In some embodiments, the siNA comprises a first nucléotide sequence. In some embodiments, the first nucléotide sequence comprises a nucléotide sequence of any one SEQ ID NOs: 1-56, 103-158, and 205-260. In some embodiments, the siNA comprises a second nucléotide sequence. In some embodiments, the second nucléotide sequence comprises a nucléotide sequence of any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the siNA comprises a sense strand. In some embodiments, the sense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the siNA comprises an antisense strand. In some embodiments, the antisense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 363-409, 445-533, and 536539. In some embodiments, the siNA further comprises any of the 5’ end caps disclosed herein. In some embodiments, the siNA further comprises any of the phosphorylation blockers disclosed herein. In some embodiments, the siNA fùrther comprises any of the conjugated moieties disclosed herein. In some embodiments, the siNA further comprises any of the destabilized nucléotides disclosed herein. In some embodiments, the siNA further comprises any of the modified nucléotides disclosed herein. In some embodiments, the disease is a viral disease. In some embodiments, the viral disease is caused by a DNA virus. In some embodiments, the DNA virus is a double stranded DNA (dsDNA virus). In some embodiments, the dsDNA virus is a hepadnavirus. In some embodiments, the hepadnavirus is a hepatitis B virus (HBV). In some embodiments, the HBV is selected from HBV génotypes A-J. In some embodiments, the disease is a liver disease. In some embodiments, the liver disease is a nonalcoholic fatty liver disease (NAFLD) or hepatocellular carcinoma (HCC). In some embodiments, the NAFLD is nonalcoholic steatohepatitis (NASH).

In some embodiments, any of the compositions disclosed herein are used in the treatment of a disease. In some embodiments, the composition comprises any of the siNAs disclosed herein. In some embodiments, the siNA comprises a first nucléotide sequence. In some embodiments, the first nucléotide sequence comprises a nucléotide sequence of any one SEQ ID NOs: 1-56, 103-158, and 205-260. In some embodiments, the siNA comprises a second nucléotide sequence. In some embodiments, the second nucléotide sequence comprises a nucléotide sequence of any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the siNA comprises a sense strand. In some embodiments, the sense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the siNA comprises an antisense strand. In some embodiments, the antisense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 363-409, 445-533, and 536539. In some embodiments, the siNA further comprises any of the 5’ end caps disclosed herein. In some embodiments, the siNA further comprises any of the phosphorylation blockers disclosed herein. In some embodiments, the siNA further comprises any of the conjugated moieties disclosed herein. In some embodiments, the siNA further comprises any of the destabilized nucléotides disclosed herein. In some embodiments, the siNA further comprises any of the modified nucléotides disclosed herein. In some embodiments, the disease is a viral disease. In some embodiments, the viral disease is caused by a DNA virus. In some embodiments, the DNA virus is a double stranded DNA (dsDNA virus). In some embodiments, the dsDNA virus is a hepadnavirus. In some embodiments, the hepadnavirus is a hepatitis B virus (HBV). In some embodiments, the HBV is selected from HBV génotypes A-J. In some embodiments, the disease is a liver disease. In some embodiments, the liver disease is a nonalcoholic fatty liver disease (NAFLD) or hepatocellular carcinoma (HCC). In some embodiments, the NAFLD is nonalcoholic steatohepatitis (NASH).

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 illustrâtes an exemplary siNA molécule.

FIG. 2 illustrâtes an exemplary siNA molécule.

FIGs. 3A-3G illustrate exemplary double-stranded siNA molécules.

FIG. 4 shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with ds-siNA-0160, ds-siNA-0165, ds-siNA-0163, or ds-siNA-0166.

FIG. 5A shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01) or ds-siNA-0160 (G03).

FIG. 5B shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01) or ds-siNA-0160 (G 15).

FIG. 5C shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01) or ds-siNA-0160 (G03).

FIG. 5D shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0160 (G03), or ds-siNA-0109 (G09).

FIGs. 5E-5F show a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01) or ds-siNA-0169 (G 18).

FIG. 5G shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01) or ds-siNA-0169 (G04).

FIG. 5H shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01) or ds-siNA-0169 (G04).

FIG. 51 shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0169 (G04), or ds-siNA-0147 (G08).

FIG. 5J shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0166 (G06), or ds-siNA-0153 (G14).

FIG. 5K shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0163 (G05), or ds-siNA-0119 (G13).

FIG. 6A shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0160 (G15), or ds-siNA-080 (G14).

FIG. 6B shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0169 (G16), or ds-siNA-081 (G13).

FIG. 7A shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0165 (G18), or ds-siNA-0127 (G17).

FIG. 7B shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0168 (G20), or ds-siNA-0150 (G19).

FIG. 8A shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0160 (G06), ASO 1 (G18), or a combination of ds-siNA-0160 and ASO 1 (G20).

FIG. 8B shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0160 (G06), ASO 1 (G18), or a combination of ds-siNA-0160 and ASO 1 (G20).

FIG. 8C shows a graph of a synergy analysis of a combination therapy with unconjugated forms of ds-siNA-0164 and ASO 2 (e.g., ds-siNA-0160 and ASO 1 without GalNac).

FIG. 9 shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0166 (G03), ds-siNA-0155 (G08), or ds-siNA-0157.

FIG. 10 shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0165 (G10), ds-siNA-0160 (G06), or a combination therapy with ds-siNA-0160 and ds-siNA-0165 (G14).

FIG. 11 shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0165 (G05), or ds-siNA-0144 (G11).

FIG. 12 shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0163 (G04), ds-siNA-0122 (G09), or ds-siNA-0123 (G13).

FIG. 13 shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G 15) or ds-siNA-0147 (G 19).

FIG. 14 shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G 15, square), ds-siNA-0109 (G 21, circle), or ds-siNA-0172 (G 27, diamond).

FIG. 15 shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G 01, circle), ds-siNA-0109 (G 07, square), ds-siNA-0119 (G 11, triangle), or dssiNA-0153 (G 13, diamond).

FIG. 16 shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G 01, circle), ASO 1 (G 20, square), ds-siNA-0147 (G 24, diamond), or a combination of ASO 1 and ds-siNA-0147 (G 25, triangle).

FIG. 17 shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G 01, circle), ASO 1 (G 20, square), ds-siNA-0109 (G 26, diamond), or a combination of ASO 1 and ds-siNA-0109 (G 27, triangle).

DETAILED DESCRIPTION OF THE INVENTION

Disclosed herein are short interfering nucleic acid (siNA) molécules comprising modified nucléotides. The siNA molécules described herein may be double-stranded siNA (ds-siNA) molécules. The siNA molécules described herein may comprise modified nucléotides selected from 2’-(9-methyl nucléotides and 2’-fluoro nucléotides. The siNA molécules described herein may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more phosphorothioate intemucleoside linkages. The siNA molécules described herein may comprise a phosphorylation blocker. The siNA molécules described herein may comprise a 5’-stabilized end cap. The siNA molécules described herein may comprise a galactosamine. The siNA molécules described herein may comprise one or more blunt ends. The siNA molécules described herein may comprise one or more overhangs.

Further disclosed herein are short interfering nucleic acid (siNA) molécules comprising (a) a phosphorylation blocker; and (b) a short interfering nucleic acid (siNA). The siNA may comprise at least 5 nucléotides. The nucléotides may be modified nucléotides, non-modified nucléotides, or any combination thereof. The nucléotides may be ribonucleotides, deoxyribonucleotides, or any combination thereof. The siNA may be single-stranded. Altematively, the siNA is double-stranded. The double-stranded siNA may comprise one or more blunt ends. The double-stranded siNA may comprise one or more overhangs. The doublestranded siNA may comprise a blunt end and an overhang.

Further disclosed herein are short interfering nucleic acid (siNA) molécules comprising (a) a conjugated moiety; and (b) a short interfering nucleic acid (siNA). The siNA may comprise at least 5 nucléotides. The nucléotides may be modified nucléotides, non-modified nucléotides, or any combination thereof. The nucléotides may be ribonucleotides, deoxyribonucleotides, or any combination thereof. The siNA may be single-stranded. Altematively, the siNA is doublestranded. The double-stranded siNA may comprise one or more blunt ends. The double-stranded siNA may comprise one or more overhangs. The double-stranded siNA may comprise a blunt end and an overhang.

Further disclosed herein are short interfering nucleic acid (siNA) molécules comprising (a) a 5’-stabilized end cap; and (b) a short interfering nucleic acid (siNA). The siNA may comprise at least 5 nucléotides. The nucléotides may be modified nucléotides, non-modified nucléotides, or any combination thereof. The nucléotides may be ribonucleotides, deoxyribonucleotides, or any combination thereof. The siNA may be single-stranded. Altematively, the siNA is double-stranded. The double-stranded siNA may comprise one or more blunt ends. The double-stranded siNA may comprise one or more overhangs. The doublestranded siNA may comprise a blunt end and an overhang.

Further disclosed herein are short interfering nucleic acid (siNA) molécules comprising (a) at least one phosphorylation blocker, conjugated moiety, or 5’-stabilized end cap; and (b) a short interfering nucleic acid (siNA). The siNA may comprise at least 5 nucléotides. The nucléotides may be modified nucléotides, non-modified nucléotides, or any combination thereof. The nucléotides may be ribonucleotides, deoxyribonucleotides, or any combination thereof. The siNA may be single-stranded. Altematively, the siNA is double-stranded. The double-stranded siNA may comprise one or more blunt ends. The double-stranded siNA may comprise one or more overhangs. The double-stranded siNA may comprise a blunt end and an overhang.

An exemplary siNA molécule of the présent disclosure is shown in FIG. 1. As shown in FIG. 1, an exemplary siNA molécule comprises a sense strand (101) and an antisense strand (102). The sense strand (101) may comprise a first oligonucleotide sequence (103). The first oligonucleotide sequence (103) may comprise one or more phosphorothioate intemucleoside linkages (109). The phosphorothioate intemucleoside linkage (109) may be between the nucléotides at the 5’ or 3’ terminal end of the first oligonucleotide sequence (103). The phosphorothioate intemucleoside linkage (109) may be between the first three nucléotides from the 5’ end of the first oligonucleotide sequence (103). The first oligonucleotide sequence (103) may comprise one or more 2’-fluoro nucléotides (110). The first oligonucleotide sequence (103) may comprise one or more 2’-(9-methyl nucléotides (111). The first oligonucleotide sequence (103) may comprise 15 or more modified nucléotides independently selected from 2’-fluoro nucléotides (110) and 2’-<9-methyl nucléotides (111). The sense strand (101) may further comprise a phosphorylation blocker (105). The sense strand (101) may further comprise a galactosamine (106). The antisense strand (102) may comprise a second oligonucleotide sequence (104). The second oligonucleotide sequence (104) may comprise one or more phophorothioate intemucleoside linkages (109). The phosphorothioate intemucleoside linkage (109) may be between the nucléotides at the 5’ or 3’ terminal end of the second oligonucleotide sequence (104). The phosphorothioate intemucleoside linkage (109) may be between the first three nucléotides from the 5’ end of the second oligonucleotide sequence (104). The phosphorothioate intemucleoside linkage (109) may be between the first three nucléotides from the 3’ end of the second oligonucleotide sequence (104). The second oligonucleotide sequence (104) may comprise one or more 2’-fluoro nucléotides (110). The second oligonucleotide sequence (104) may comprise one or more 2’-O-methyl nucléotides (111). The second oligonucleotide sequence (104) may comprise 15 or more modified nucléotides independently selected from 2’-fluoro nucléotides (110) and 2’-O-methyl nucléotides (111). The antisense strand (102) may further comprise a 5’-stabilized end cap (107). The siNA may further comprise one or more blunt ends. Altematively, or additionally, one end of the siNA may comprise an overhang (108). The overhang (108) may be part of the sense strand (101). The overhang (108) may be part of the antisense strand (102). The overhang (108) may be distinct from the first nucléotide sequence (103). The overhang (108) may be distinct from the second nucléotide sequence (104). The overhang (108) may be part of the first nucléotide sequence (103). The overhang (108) may be part of the second nucléotide sequence (104). The overhang (108) may comprise 1 or more nucléotides. The overhang (108) may comprise 1 or more deoxyribonucleotides. The overhang (108) may comprise 1 or more modified nucléotides. The overhang (108) may comprise 1 or more modified ribonucleotides. The sense strand (101) may be shorter than the antisense strand (102). The sense strand (101) may be the same length as the antisense strand (102). The sense strand (101) may be longer than the antisense strand (102).

An exemplary siNA molécule of the présent disclosure is shown in FIG. 2. As shown in FIG. 2, an exemplary siNA molécule comprises a sense strand (201) and an antisense strand (202). The sense strand (201) may comprise a first oligonucleotide'sequence (203). The first oligonucleotide sequence (203) may comprise one or more phophorothioate intemucleoside linkages (209). The phosphorothioate intemucleoside linkage (209) may be between the nucléotides at the 5’ or 3’ terminal end of the first oligonucleotide sequence (203). The phosphorothioate intemucleoside linkage (209) may be between the first three nucléotides from the 5’ end of the first oligonucleotide sequence (203). The first oligonucleotide sequence (203) may comprise one or more 2’-fluoro nucléotides (210). The first oligonucleotide sequence (203) may comprise one or more 2’-O-methyl nucléotides (211). The first oligonucleotide sequence (203) may comprise 15 or more modified nucléotides independently selected from 2’-fluoro nucléotides (210) and 2’-(9-methyl nucléotides (211). The sense strand (201) may further comprise a phosphorylation blocker (205). The sense strand (201) may further comprise a galactosamine (206). The antisense strand (202) may comprise a second oligonucleotide sequence (204). The second oligonucleotide sequence (204) may comprise one or more phophorothioate intemucleoside linkages (209). The phosphorothioate intemucleoside linkage (209) may be between the nucléotides at the 5’ or 3’ terminal end of the second oligonucleotide sequence (204). The phosphorothioate intemucleoside linkage (209) may be between the first three nucléotides from the 5’ end of the second oligonucleotide sequence (204). The phosphorothioate intemucleoside linkage (209) may be between the first three nucléotides from the 3’ end of the second oligonucleotide sequence (204). The second oligonucleotide sequence (204) may comprise one or more 2’-fluoro nucléotides (210). The second oligonucleotide sequence (204) may comprise one or more 2’-O-methyl nucléotides (211). The second oligonucleotide sequence (204) may comprise 15 or more modified nucléotides independently selected from 2’-fluoro nucléotides (210) and 2’-O-methyl nucléotides (211). The antisense strand (202) may further comprise a 5’-stabilized end cap (207). The siNA may further comprise one or more overhangs (208). The overhang (208) may be part of the sense strand (201). The overhang (208) may be part of the antisense strand. (202). The overhang (208) may be distinct from the first nucléotide sequence (203). The overhang (208) may be distinct from the second nucléotide sequence (204). The overhang (208) may be part of the first nucléotide sequence (203). The overhang (208) may be part of the second nucléotide sequence (204). The overhang (208) may be adjacent to the 3’ end of the first nucléotide sequence (203). The overhang (208) may be adjacent to the 5’ end of the first nucléotide sequence (203). The overhang (208) may be adjacent to the 3’ end of the second nucléotide sequence (204). The overhang (208) may be adjacent to the 5’ end of the second nucléotide sequence (204). The overhang (208) may comprise 1 or more nucléotides. The overhang (208) may comprise 1 or more deoxyribonucleotides. The overhang (208) may comprise a TT sequence. The overhang (208) may comprise 1 or more modified nucléotides. The overhang (208) may comprise 1 or more modified nucléotides disclosed herein (e.g., 2-fluoro nucléotide, 2’-O-methyl nucléotide, 2’ fluoro nucléotide mimic, 2’-(9-methyl nucléotide mimic, or a nucléotide comprising a modified nucleobase). The overhang (208) may comprise 1 or more modified ribonucleotides. The sense strand (201) may be shorter than the antisense strand (202). The sense strand (201) may be the same length as the antisense strand (202). The sense strand (201) may be longer than the antisense strand (202).

FIGs. 3A-3G depict exemplary ds-siNA modification patterns. As shown in FIGs. 3A3 G, an exemplary ds-siNA molécule may hâve the following formula: S’-An’Bn^BnUn^An^An⁹^’

3’-C_q ¹Aq²B_q ³Aq⁴Bq⁵A_q ⁶Bq⁷Aq⁸B_q ⁹Aq^I0Bq¹¹Aq¹²-5’ wherein:

each A is independently a 2’-(9-methyl nucléotide or a nucléotide comprising a 5’ stabilized end cap or phosphorylation blocker;

B is a 2’-fluoro nucléotide;

C represents overhanging nucléotides and is a 2’-O-methyl nucléotide;

n¹ = 1-4 nucléotides in length;

each n³ and n⁴ is independently 1-3 nucléotides in length;

n⁵ is 1-10 nucléotides in length;

n⁷ is 0-4 nucléotides in length;

each n⁹, q¹, and q² is independently 0-2 nucléotides in length;

q⁴ is 0-3 nucléotides in length;

q⁶ is 0-5 nucléotides in length;

q⁸ is 2-7 nucléotides in length; and q¹⁰ is 2-11 nucléotides in length.

The ds-siNA may further comprise a conjugated moiety. The conjugated moiety may comprise any of the galactosamines disclosed herein. The ds-siNA may further comprise (i) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2 and positions 2 and 3 from the 5’ end of the sense strand; and (ii) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5’ end of the antisense strand. The ds-siNA may further comprise a 5’-stabilizing end cap. The 5’-stabilizing end cap may be a vinyl phosphonate. The 5’-stabilizing end cap may be attached to the 5’ end of the antisense strand. In some embodiments, the 2’-Omethyl nucléotide at position 1 from the 5’ end of the sense strand is further modifïed to contain a 5’ stabilizing end cap. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modifïed to contain a 5’ stabilizing end cap. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the sense strand is further modifïed to contain a phosphorylation blocker. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 3 ’ end of the sense strand is further modifïed to contain a phosphorylation blocker. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modifïed to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3’ end of the antisense strand is further modifïed to contain a phosphorylation blocker. An exemplary ds-siNA molécule may hâve the following formula:

5’-A₂-4 BiAi-3 B₂-3 A₂-io B0-1A0-4B0-1 Ao-₂-3’ ’ -C₂ Aq-₂Bo- 1 Ao-₃Bq- 1A0-5B0-1A₂-7 B1A₂.11 B1A1 -5 ’ wherein:

each A is independently a 2’-O-methyl nucléotide or a nucléotide comprising a 5’ stabilized end cap or phosphorylation blocker;

B is a 2’-fluoro nucléotide;

C represents overhanging nucléotides and is a 2’-O-methyl nucléotide.

The ds-siNA may further comprise a conjugated moiety. The conjugated moiety may comprise any of the galactosamines disclosed herein. The ds-siNA may further comprise (i) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2 and positions 2 and 3 from the 5’ end of the sense strand; and (ii) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5’ end of the antisense strand. The ds-siNA may further comprise a 5’-stabilizing end cap. The 5’-stabilizing end cap may be a vinyl phosphonate. The vinyl phosphonate may be a deuterated vinyl phosphonate. The deuterated vinyl phosphonate may be a mono-deuterated vinyl phosphonate. The deuterated vinyl phosphonate may be a mono-dideuterated vinyl phosphonate.The 5’-stabilizing end cap may be attached to the 5’ end of the antisense strand. The 5’-stabilizing end cap may be attached to the 3’ end of the antisense strand. The 5’-stabilizing end cap may be attached to the 5’ end of the sense strand. The 5’-stabilizing end cap may be attached to the 3’ end of the sense strand. In some embodiments, the 2’-Omethyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 3 ’ end of the sense strand is fùrther modified to contain a phosphorylation blocker. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 3’ end of the antisense strand is further modified to contain a phosphorylation blocker.

The exemplary ds-siNA shown in FIGs. 3A-3G comprise (i) a sense strand comprising 19-21 nucléotides; and (ii) an antisense strand comprising 21-23 nucléotides. The ds-siNA may further comprise (iii) a conjugated moiety, wherein the conjugated moiety is attached to the 3’ end of the antisense strand. The ds-siNA may comprise a 2 nucléotide overhang consisting of nucléotides at positions 20 and 21 from the 5’ end of the antisense strand. The ds-siNA may comprise a 2 nucléotide overhang consisting of nucléotides at positions 22 and 23 from the 5’ end of the antisense strand. The ds-siNA may further comprise 1, 2, 3, 4, 5, 6 or more phosphorothioate (ps) intemucleoside linkages. At least one phosphorothioate intemucleoside linkage may be between the nucléotides at positions 1 and 2 or positions 2 and 3 from the 5’ end of the sense strand. At least one phosphorothioate intemucleoside linkage may be between the nucléotides at positions 1 and 2 or positions 2 and 3 from the 5’ end of the antisense strand. At least one phosphorothioate intemucleoside linkage may be between the nucléotides at positions 19 and 20, positions 20 and 21, positions 21 and 22, or positions 22 and 23 from the 5’ end of the antisense strand. As shown in FIGs. 3A-3G, 4-6 nucléotides in the sense strand may be 2’-fluoro nucléotides. As shown in FIGs. 3A-3G, 2-5 nucléotides in the antisense strand may be 2’-fluoro nucléotides. As shown in FIGs. 3A-3G, 13-15 nucléotides in the sense strand may be 2’-(9methyl nucléotides. As shown in FIGs. 3A-3G, 14-19 nucléotides in the antisense strand may be 2’-(9-methyl nucléotides. As shown in FIGs. 3A-3G, the ds-siNA does not contain a base pair between 2’-fluoro nucléotides on the sense and antisense strands. In some embodiments, the 2’(2-methyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3 ’ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-(2-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3’ end of the antisense strand is further modified to contain a phosphorylation blocker.

As shown in FIG. 3 A, a ds-siNA may comprise (a) a sense strand consisting of 19 nucléotides, wherein 2’-fluoro nucléotides are at positions 3, 7-9, 12, and 17 from the 5’ end of the sense strand, and wherein 2’-O-methyl nucléotides are at positions 1, 2, 4-6, 10, 11, 13-16, 18, and 19 from the 5’ end of the sense strand; (b) an antisense strand consisting of 21 nucléotides, wherein nucléotides at positions 2 and 14 from the 5’ end of the antisense strand are 2’-fluoro nucléotides; and wherein nucléotides at positions 1, 3-13, and 15-21 are 2’-O-methyl nucléotides. The ds-siNA may further comprise a conjugated moiety attached to the 3’ end of the sense strand. The ds-siNA may further comprise (i) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2 and positions 2 and 3 from the 5’ end of the sense strand; and (ii) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5’ end of the antisense strand. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3’ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3 ’ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the sense strand is a d2vd3 nucléotide. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the antisense strand is a d2vd3 nucléotide. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 3’ end of the sense strand is a d2vd3 nucléotide. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3’ end of the antisense strand is a d2vd3 nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand or antisense strand is a 2’-fluoro nucléotide mimic.In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand or antisense strand is a f4P, f2P, or IX nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-(9-methyl nucléotide on the sense or antisense strand is a 2’-O-methyl nucléotide mimic.

As shown in FIG. 3B, a ds-siNA may comprise (a) a sense strand consisting of 19 nucléotides, wherein 2’-fluoro nucléotides are at positions 3, 7, 8, and 17 from the 5’ end of the sense strand, and wherein 2’-O-methyl nucléotides are at positions 1, 2, 4-6, 9-16, 18, and 19 from the 5’ end of the sense strand; (b) an antisense strand consisting of 21 nucléotides, wherein nucléotides at positions 2 and 14 from the 5’ end of the antisense strand are 2’-fluoro nucléotides; and wherein nucléotides at positions 1,3-13, and 15-21 are 2’-O-methyl nucléotides. The ds-siNA may further comprise a conjugated moiety attached to the 3’ end of the sense strand. The ds-siNA may further comprise (i) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2 and positions 2 and 3 from the 5’ end of the sense strand; and (ii) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5’ end of the antisense strand. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 3’ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3 ’ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the sense strand is a d2vd3 nucléotide. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 5’ end of the antisense strand is a d2vd3 nucléotide. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3’ end of the sense strand is a d2vd3 nucléotide. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3’ end of the antisense strand is a d2vd3 nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand or antisense strand is a 2’-fluoro nucléotide mimic. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand or antisense strand is a f4P, f2P, or IX nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-(9-methyl nucléotide on the sense or antisense strand is a 2’-O-methyl nucléotide mimic.

As shown in FIG. 3C, a ds-siNA may comprise (a) a sense strand consisting of 19 nucléotides, wherein 2’-fluoro nucléotides are at positions 3, 7-9, 12 and 17 from the 5’ end of the sense strand, and wherein 2’-O-methyl nucléotides are at positions 1, 2, 4-6, 10, 11, 13-16, 18, and 19 from the 5’ end of the sense strand; (b) an antisense strand consisting of 21 nucléotides, wherein the nucléotides in the antisense strand comprise an altemating 1:3 modification pattern, and wherein 1 nucléotide is a 2’-fluoro nucléotide and 3 nucléotides are 2’O-methyl nucléotides. The ds-siNA may further comprise a conjugated moiety attached to the 3’ end of the sense strand. The ds-siNA may further comprise (i) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2 and positions 2 and 3 from the 5’ end of the sense strand; and (ii) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5’ end of the antisense strand. The ds-siNA may comprise 2-5 altemating 1:3 modification patterns on the antisense strand. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3’ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3 ’ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 5’ end of the sense strand is a d2vd3 nucléotide. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the antisense strand is a d2vd3 nucléotide. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3’ end of the sense strand is a d2vd3 nucléotide. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3’ end of the antisense strand is a d2vd3 nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand or antisense strand is a 2’-fluoro nucléotide mimic. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand is a f4P, f2P, or fX nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the antisense strand is a f4P, f2P, or fX nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-(9-methyl nucléotide on the sense or antisense strand is a 2’-O-methyl nucléotide mimic.

As shown in FIG. 3D, a ds-siNA may comprise (a) a sense strand consisting of 19 nucléotides, wherein 2’-fluoro nucléotides are at positions 5 and 7-9 from the 5’ end of the sense strand, and wherein 2’-O-methyl nucléotides are at positions 1-4, 6, and 10-19 from the 5’ end of the sense strand; (b) an antisense strand consisting of 21 nucléotides, wherein the nucléotides in the antisense strand comprise an altemating 1:3 modification pattern, and wherein 1 nucléotide is a 2’-fluoro nucléotide and 3 nucléotides are 2’-O-methyl nucléotides. The ds-siNA may further comprise a conjugated moiety attached to the 3’ end of the sense strand. The ds-siNA may fùrther comprise (i) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2 and positions 2 and 3 from the 5’ end of the sense strand; and (ii) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5’ end of the antisense strand. The ds-siNA may comprise 2-5 altemating 1:3 modification patterns on the antisense strand. The altemating 1:3 modification pattern may start at the nucléotide at any of positions 2, 6, 10, 14, and/or 18 from the 5’ end of the antisense strand. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3 ’ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3’ end of the antisense strand is fùrther modified to contain a phosphorylation blocker. In some embodiments, the 2’-Omethyl nucléotide at position 1 from the 5’ end of the sense strand is a d2vd3 nucléotide. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the antisense strand is a d2vd3 nucléotide. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3’ end of the sense strand is a d2vd3 nucléotide. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3 ’ end of the antisense strand is a d2vd3 nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand or antisense strand is a 2’fluoro nucléotide mimic. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand is a f4P, f2P, or fX nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the antisense strand is a f4P, f2P, or fX nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-O-methyl nucléotide on the sense or antisense strand is a 2’-O-methyl nucléotide mimic.

As shown in FIG. 3E, a ds-siNA may comprise (a) a sense strand consisting of 19 nucléotides, wherein 2’-fluoro nucléotides are at positions 5 and 7-9 from the 5’ end of the sense strand, and wherein 2’-(9-methyl nucléotides are at positions 1-4, 6, and 10-19 from the 5’ end of the sense strand; (b) an antisense strand consisting of 21 nucléotides, wherein the nucléotides in the antisense strand comprise an altemating 1:2 modification pattern, and wherein 1 nucléotide is a 2’-fluoro nucléotide and 2 nucléotides are 2’-O-methyl nucléotides. The ds-siNA may further comprise a conjugated moiety attached to the 3 ’ end of the sense strand. The ds-siNA may further comprise (i) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2 and positions 2 and 3 from the 5’ end of the sense strand; and (ii) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5’ end of the antisense strand. The ds-siNA may comprise 2-5 altemating 1:2 modification patterns on the antisense strand. The altemating 1:2 modification pattern may start at the nucléotide at any of positions 2, 5, 8, 14, and/or 17 from the 5’ end of the antisense strand. In some embodiments, the ds-siNA comprises (a) a sense strand consisting of 19 nucléotides, wherein 2’-fluoro nucléotides are at positions 5 and 7-9 from the 5’ end of the sense strand, and wherein 2’-O-methyl nucléotides are at positions 1-4, 6, and 10-19 from the 5’ end of the sense strand; (b) an antisense strand consisting of 21 nucléotides, wherein 2’-fluoro nucléotides are at positions 2, 5, 8, 14, and 17 from the 5’ end of the antisense strand, and wherein 2’-O-methyl nucléotides are at positions 1,3,4, 6, 7, 9-13, 15, 16, and 18-21 from the 5’ end of the sense strand. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3 ’ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-(2-methyl nucléotide at position 1 from the 3’ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the T-Omethyl nucléotide at position 1 from the 5’ end of the sense strand is a d2vd3 nucléotide. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the antisense strand is a d2vd3 nucléotide. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 3’ end of the sense strand is a d2vd3 nucléotide. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 3 ’ end of the antisense strand is a d2vd3 nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand or antisense strand is a 2’fluoro nucléotide mimic. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand is a f4P, f2P, or fX nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the antisense strand is a f4P, f2P, or fX nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-O-methyl nucléotide on the sense or antisense strand is a 2’-(9-methyl nucléotide mimic.

As shown in FIG. 3 F, a ds-siNA may comprise (a) a sense strand consisting of 19 nucléotides, wherein 2’-fluoro nucléotides are at positions 5 and 7-9 from the 5’ end of the sense strand, and wherein 2’-O-methyl nucléotides are at positions 1-4, 6, and 10-19 from the 5’ end of the sense strand; (b) an antisense strand consisting of 21 nucléotides, wherein 2’-fluoro nucléotides are at positions 2, 6, 14, and 16 from the 5’ end of the antisense strand, and wherein 2’-O-methyl nucléotides are at positions 1, 3-5, 7-13, 15, and 17-21 from the 5’ end of the antisense strand. The ds-siNA may further comprise a conjugated moiety attached to the 3’ end of the sense strand. The ds-siNA may further comprise (i) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2 and positions 2 and 3 from the 5’ end of the sense strand; and (ii) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5’ end of the antisense strand. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand or antisense strand is a f4P, f2P, or fX nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand or antisense strand is a f4P nucléotide. In some embodiments, at least 1, 2, 3, or 4 of the 2’-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5’ end of the antisense strand is a f4P nucléotide. In some embodiments, at least one of the 2’-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5’ end of the antisense strand is a f4P nucléotide. In some embodiments, at least two of the 2’-fluoro63 nucléotides at positions 2, 6, 14, and 16 from the 5’ end of the antisense strand is a f4P nucléotide. In some embodiments, less than or equal to 3 of the 2’-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5’ end of the antisense strand is a f4P nucléotide. In some embodiments, less than or equal to 2 of the 2’-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5’ end of the antisense strand is a f4P nucléotide. In some embodiments, the 2’-fluoronucleotide at position 2 from the 5’ end of the antisense strand is a f4P nucléotide. In some embodiments, the 2’-fluoro-nucleotide at position 6 from the 5’ end of the antisense strand is a f4P nucléotide. In some embodiments, the 2’-fluoro-nucleotide at position 14 from the 5’ end of the antisense strand is a f4P nucléotide. In some embodiments, the 2’-fluoro-nucleotide at position 16 from the 5’ end of the antisense strand is a f4P nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand or antisense strand is a f2P nucléotide. In some embodiments, at least 1, 2, 3, or 4 of the 2’-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5’ end of the antisense strand is a f2P nucléotide. In some embodiments, at least one of the 2’-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5’ end of the antisense strand is a f2P nucléotide. In some embodiments, at least two of the 2’-fluoronucleotides at positions 2, 6, 14, and 16 from the 5’ end of the antisense strand is a f2P nucléotide. In some embodiments, less than or equal to 3 of the 2’-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5’ end of the antisense strand is a f2P nucléotide. In some embodiments, less than or equal to 2 of the 2’-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5’ end of the antisense strand is a I2P nucléotide. In some embodiments, the 2’-fluoronucleotide at position 2 from the 5’ end of the antisense strand is a f2P nucléotide. In some embodiments, the 2’-fluoro-nucleotide at position 6 from the 5’ end of the antisense strand is a f2P nucléotide. In some embodiments, the 2’-fluoro-nucleotide at position 14 from the 5’ end of the antisense strand is a f2P nucléotide. In some embodiments, the 2’-fluoro-nucleotide at position 16 from the 5’ end of the antisense strand is a f2P nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand or antisense strand is a fX nucléotide. In some embodiments, at least 1, 2, 3, or 4 of the 2’-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5’ end of the antisense strand is a fX nucléotide. In some embodiments, at least one of the 2’-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5’ end of the antisense strand is a fX nucléotide. In some embodiments, at least two of the 2’-fluoronucleotides at positions 2, 6, 14, and 16 from the 5’ end of the antisense strand is a fX nucléotide. In some embodiments, less than or equal to 3 of the 2’-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5’ end of the antisense strand is a fX nucléotide. In some embodiments, less than or equal to 2 of the 2’-fluoro-nucleotides at positions 2, 6, 14, and 16 from the 5’ end of the antisense strand is a fX nucléotide. In some embodiments, the 2’-fluoro-nucleotide at position 2 from the 5’ end of the antisense strand is a fX nucléotide. In some embodiments, the 2’-fluoro-nucleotide at position 6 from the 5’ end of the antisense strand is a fX nucléotide. In some embodiments, the 2’-fluoro-nucleotide at position 14 from the 5’ end of the antisense strand is a fX nucléotide. In some embodiments, the 2’-fluoro-nucleotide at position 16 from the 5’ end of the antisense strand is a fX nucléotide. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3 ’ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3’ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-(9methyl nucléotide at position 1 from the 5’ end of the sense strand is a d2vd3 nucléotide. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the antisense strand is a d2vd3 nucléotide. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3’ end of the sense strand is a d2vd3 nucléotide. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3 ’ end of the antisense strand is a d2vd3 nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand or antisense strand is a 2’fluoro nucléotide mimic. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand is a f4P, f2P, or fX nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the antisense strand is a f4P, f2P, or fX nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-(9-methyl nucléotide on the sense or antisense strand is a 2’-O-methyl nucléotide mimic.

As shown in FIG. 3G, a ds-siNA may comprise (a) a sense strand consisting of 21 nucléotides, wherein 2’-fluoro nucléotides are at positions 5, 9-11, 14, and 19 from the 5’ end of the sense strand, and wherein 2’-<9-methyl nucléotides are at positions 1-4, 6-8, 12, 13, 15-18, 20, and 21 from the 5’ end of the sense strand; and (b) an antisense strand consisting of 23 nucléotides, wherein 2’-flouro nucleodies are at positions 2 and 14 from the 5’ end of the antisense strand, and wherein 2’-O-methyl nucléotides are at positions 1, 3-13, and 15-23 from the 5’ end of the antisense strand. The ds-siNA may further comprise a conjugated moiety attached to the 3’ end of the sense strand. The ds-siNA may further comprise (i) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2 and positions 2 and 3 from the 5’ end of the sense strand; and (ii) phosphorothioate intemucleoside linkages between the nucléotides at positions 1 and 2; positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5’ end of the antisense strand. In some embodiments, the 2’-Omethyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a 5’ stabilizing end cap. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 5’ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-(9-methyl nucléotide at position 1 from the 3 ’ end of the sense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3’ end of the antisense strand is further modified to contain a phosphorylation blocker. In some embodiments, the 2’-(9methyl nucléotide at position 1 from the 5’ end of the sense strand is a d2vd3 nucléotide. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 5’ end of the antisense strand is a d2vd3 nucléotide. In some embodiments, the 2’-(2-methyl nucléotide at position 1 from the 3’ end of the sense strand is a d2vd3 nucléotide. In some embodiments, the 2’-O-methyl nucléotide at position 1 from the 3 ’ end of the antisense strand is a d2vd3 nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand or antisense strand is a 2’fluoro nucléotide mimic. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the sense strand is a f4P, f2P, or fX nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-fluoro nucléotides on the antisense strand is a f4P, f2P, or fX nucléotide. In some embodiments, at least 1, 2, 3, 4 or more 2’-O-methyl nucléotide on the sense or antisense strand is a 2’-O-methyl nucléotide mimic.

Any of the siNAs disclosed herein may comprise a sense strand and an antisense strand. The sense strand may comprise a first nucléotide sequence that is 15 to 30 nucléotides in length. The antisense strand may comprise a second nucléotide sequence that is 15 to 30 nucléotides in length.

In some embodiments, the double-stranded short interfering nucleic acid (ds-siNA) molécule comprises: (a) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and the nucléotide at position 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide.

In some embodiments, the double-stranded short interfering nucleic acid (ds-siNA) molécule comprises: (a) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-(9-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and the nucléotide at position 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-(9-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide.

In some embodiments, the double-stranded short interfering nucleic acid (ds-siNA) molécule comprises: (a) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and the nucléotide at position 7 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-(9-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide.

In some embodiments, the double-stranded short interfering nucleic acid (ds-siNA) molécule comprises: (a) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and the nucléotide at position 7, 9, 10, and/or 11 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyI nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide.

In some embodiments, the double-stranded short interfering nucleic acid (ds-siNA) molécule comprises: (a) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-(9-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-(9-methyl nucléotide and a 2’fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and the nucléotide at position 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide.

In some embodiments, the double-stranded short interfering nucleic acid (ds-siNA) molécule comprises: (a) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and the nucléotide at position 2 of the second nucléotide sequence is a 2’-fluoro nucléotide.

In some embodiments, the double-stranded short interfering nucleic acid (ds-siNA) molécule comprises: (a) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence: (i) is 15 to 30 nucléotides in length; (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and (iii) comprises 1 or more phosphorothioate intemucleoside linkage; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence: (i) is 15 to 30 nucléotides in length; (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-(9-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and (iii) comprises 1 or more phosphorothioate intemucleoside linkage.

In some embodiments, the double-stranded short interfering nucleic acid (ds-siNA) molécule comprises: (a) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%,

80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide, wherein the ds-siNA may further comprise a phosphorylation blocker, a galactosamine, or 5’-stabilized end cap.

In some embodiments, the double-stranded short interfering nucleic acid (ds-siNA) molécule comprises: (I) a sense strand comprising (A) a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and (B) a phosphorylation blocker or a galactosamine; and (II) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence: (a) is 15 to 30 nucléotides in length; and (b) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-(2-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide.

In some embodiments, the double-stranded short interfering nucleic acid (ds-siNA) molécule comprises: (I) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence: (a) is 15 to 30 nucléotides in length; and (b) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and (II) an antisense strand comprising (A) a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’fhioro nucléotide, wherein at least one modified nucléotide is a 2’-(9-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and (B) a 5’-stabilized end cap.

In some embodiments, the double-stranded short interfering nucleic acid (ds-siNA) molécule comprises: (I) a sense strand comprising (A) a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and (B) a phosphorylation blocker or a galactosamine; and (II) an antisense strand comprising (A) a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence: (i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and (B) a 5’-stabilized end cap.

In some embodiments, the double-stranded short interfering nucleic acid (ds-siNA) molécule comprises: (a) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence comprises a nucléotide sequence of any one SEQ ID NOs: 1-56, 103-158, and 205-260; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence comprises a nucléotide sequence of any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the double-stranded short interfering nucleic acid (ds-siNA) molécule comprises: (a) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence comprises a nucléotide sequence as shown in Tables 1-3; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence comprises a nucléotide sequence as shown in Tables 1-3.

In some embodiments, the double-stranded short interfering nucleic acid (ds-siNA) molécule comprises: (a) a sense strand comprising a nucléotide sequence of any one of SEQ ID NOs: 307-362 and 415-444; and (b) an antisense strand comprising a nucléotide sequence of any one of SEQ ID NOs: 363-409, 445-533, and 536-539. In some embodiments, the ds-siNA molécule comprises a double-stranded molécule as identified by the duplex ID (e.g., ds-siNA001 to ds-siNA-0178) shown in Tables 6 and 10.

Further disclosed herein are compositions comprising two or more of the siNA molécules described herein.

Further disclosed herein are compositions comprising any of the siNA molécule described and a pharmaceutically acceptable carrier or diluent.

Further disclosed herein are compositions comprising two or more of the siNA molécules described herein for use as a médicament.

Further disclosed herein are compositions comprising any of the siNA molécule described and a pharmaceutically acceptable carrier or diluent for use as a médicament.

Further disclosed herein are methods of treating a disease in a subject in need thereof, the method comprising administering to the subject any of the siNA molécules described herein.

Further disclosed herein are uses of any of the siNA molécules described herein in the manufacture of a médicament for treating a disease.

Short interfering nucleic acid (siNA) molécules

As indicated above, the présent disclosure provides siNA molécules comprising modifïed nucléotides. Any of the siNA molécules described herein may be double-stranded siNA (dssiNA) molécules. The terms “siNA molécules” and “ds-siNA molécules” may be used interchangeably. In some embodiments, the ds-siNA molécules comprise a sense strand and an antisense strand.

Further disclosed herein are siNA molécules comprising (a) at least one phosphorylation blocker, conjugated moiety, or 5’-stabilized end cap; and (b) a short interfering nucleic acid (siNA). In some embodiments, the phosphorylation blocker is a phosphorylation blocker disclosed herein. In some embodiments, the conjugated moiety is a galactosamine disclosed herein. In some embodiments, the 5’-stabilized end cap is a 5’-stabilized end cap disclosed herein. The siNA may comprise any of the first nucléotide, second nucléotide, sense strand, or antisense strand sequences disclosed herein. The siNA may comprise 5 to 100, 5 to 90, 10 to 100, 10 to 90, 10 to 80, 10 to 70, 10 to 60, 10 to 50, 10 to 30, 10 to 25, 15 to 100, 15 to 90, 15 to 80, 15 to 70, 15 to 60, 15 to 50, 15 to 30, or 15 to 25 nucléotides. The siNA may comprise at least 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,21,22, 23,24, 25,26, 27, 28, 29,30,31,32,33, 34, 35, 36, 37, 38, 39, or 40 nucléotides. The siNA may comprise less than or equal to 50, 45, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, or 19 nucléotides. The nucléotides may be modifïed nucléotides. The siNA may be single stranded. The siNA may be double stranded. The siNA may comprise (a) a sense strand comprising 15 to 30, 15 to 25, 15 to

24, 15 to 23, 15 to 22, 15 to 21, 17 to 30, 17 to 25, 17 to 24, 17 to 23, 17 to 22, 17 to 21, 18 to

30, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 19 to 30, 19 to 25, 19 to 24, 19 to 23, 19 to

22, 19 to 21, 20 to 25, 20 to 24, 20 to 23, 21 to 25, 21 to 24, or 21 to 23 nucléotides; and (b) an antisense strand comprising 15 to 30, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 17 to 30, 17 to 25, 17 to 24, 17 to 23, 17 to 22, 17 to 21, 18 to 30, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 19 to 30, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 20 to 25, 20 to 24, 20 to 23, 21 to 25, 21 to 24, or 21 to 23 nucléotides. The siNA may comprise (a) a sense strand comprising about 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucléotides; and (b) an antisense strand comprising about 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucléotides. The siNA may comprise (a) a sense strand comprising about 19 nucléotides; and (b) an antisense strand comprising about 21 nucléotides. The siNA may comprise (a) a sense strand comprising about 21 nucléotides; and (b) an antisense strand comprising about 23 nucléotides.

In some embodiments, any of the siNA molécules disclosed herein further comprise one or more linkers independently selected from a phosphodiester (PO) linker, phosphorothioate (PS) linker, phosphorodithioate linker, and PS-mimic linker. In some embodiments, the PS-mimic linker is a sulfur linker. In some embodiments, the linkers are intemucleoside linkers. Altematively, or additionally, the linkers connect a nucléotide of the siNA molécule to at least one phosphorylation blocker, conjugated moiety, or 5’-stabilized end cap. In some embodiments, the linkers connect a conjugated moiety to a phosphorylation blocker or 5’stabilized end cap. siNA sense strand

Any of the siNA molécules described herein may comprise a sense strand. The sense strand may comprise a first nucléotide sequence. The first nucléotide sequence may be 15 to 30, 15 to 25, 15 to 23, 17 to 23, 19 to 23, or 19 to 21 nucléotides in length. In some embodiments, the first nucléotide sequence is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucléotides in length. In some embodiments, the first nucléotide sequence is at least 19 nucléotides in length. In some embodiments, the first nucléotide sequence is at least 21 nucléotides in length.

In some embodiments, the sense strand is the same length as the first nucléotide sequence. In some embodiments, the sense strand is longer than the first nucléotide sequence. In some embodiments, the sense strand may further comprise 1, 2, 3, 4, or 5 or more nucléotides than the first nucléotide sequence. In some embodiments, the sense strand may further comprise a deoxyribonucleic acid (DNA). In some embodiments, the DNA is thymine (T). In some embodiments, the sense strand may further comprise a TT sequence. In some embodiments, the

I sense strand may further comprise one or more modified nucléotides that are adjacent to the first nucléotide sequence. In some embodiments, the one or more modified nucléotides are independently selected from any of the modified nucléotides disclosed herein (e.g., 2’-fluoro nucléotide, 2’-O-methyl nucléotide, 2’-fluoro nucléotide mimic, 2’-O-methyl nucléotide mimic, or a nucléotide comprising a modified nucleobase).

In some embodiments, the first nucléotide sequence comprises 15, 16, 17, 18, 19, 20, 21, 22, 23, or more modified nucléotides independently selected from a 2’-(9-methyl nucléotide and a 2'-fluoro nucléotide. In some embodiments, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the nucléotides in the first nucléotide sequence are modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide. In some embodiments, 100% of the nucléotides in the first nucléotide sequence are modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide. In some embodiments, the 2’-O-methyl nucléotide is a 2’-(9-methyl nucléotide mimic. In some embodiments, the 2’-fluoro nucléotide is a 2’-fluoro nucléotide mimic.

In some embodiments, between about 15 to 30, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 17 to 30, 17 to 25, 17 to 24, 17 to 23, 17 to 22, 17 to 21, 18 to 30, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 19 to 30, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 20 to 25, 20 to 24, 20 to 23, 21 to 25, 21 to 24, or 21 to 23 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, between about 2 to 20 modified nucléotides of the first nucléotide sequence are 2’-(9-methyl nucléotides. In some embodiments, between about 5 to 25 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, between about 10 to 25 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, between about 12 to 25 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, at least about 12 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, at least about 13 modified nucléotides of the first nucléotide sequence are 2’-Omethyl nucléotides. In some embodiments, at least about 14 modified nucléotides of the first nucléotide sequence are 2’-(9-methyl nucléotides. In some embodiments, at least about 15 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, at least about 16 modified nucléotides of the first nucléotide sequence are T-Omethyl nucléotides. In some embodiments, at least about 17 modified nucléotides of the first nucléotide sequence are 2’-(9-methyl nucléotides. In some embodiments, at least about 18 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, at least about 19 modified nucléotides of the first nucléotide sequence are 2’-(2methyl nucléotides. In some embodiments, less than or equal to 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, less than or equal to 21 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, less than or equal to 20 modified nucléotides of the first nucléotide sequence are 2’-(2-methyl nucléotides. In some embodiments, less than or equal to 19 modified nucléotides of the first nucléotide sequence are 2’-(9-methyl nucléotides. In some embodiments, less than or equal to 18 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, less than or equal to 17 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, less than or equal to 16 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, less than or equal to 15 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, less than or equal to 14 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, less than or equal to 13 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, at least one modified nucléotide of the first nucléotide sequence is a 2’-O-methyl pyrimidine. In some embodiments, at least 5, 6, 7, 8, 9, or 10 modified nucléotides of the first nucléotide sequence are 2’-O-methyl pyrimidines. In some embodiments, at least one modified nucléotide of the first nucléotide sequence is a 2’-O-methyl purine. In some embodiments, at least 5, 6, 7, 8, 9, or 10 modified nucléotides of the first nucléotide sequence are 2’-(9-methyl purines. In some embodiments, the 2’-(9-methyl nucléotide is a 2’-O-methyl nucléotide mimic.

In some embodiments, between 2 to 15 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, between 2 to 10 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, between 2 to 6 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 1 to 6, 1 to 5, 1 to 4, or 1 to 3 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least 1, 2, 3, 4, 5, or 6 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least 1 modified nucléotide of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, at least 2 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least 3 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least 4 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least 5 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least 6 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 10, 9, 8, 7, 6, 5, 4, 3 or fewer modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 10 or fewer modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 7 or fewer modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 6 or fewer modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 5 or fewer modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 4 or fewer modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 3 or fewer modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 2 or fewer modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least one modified nucléotide of the first nucléotide sequence is a 2’-fluoro pyrimidine. In some embodiments, 1, 2, 3, 4, 5, or 6 modified nucléotides of the first nucléotide sequence are 2’fluoro pyrimidines. In some embodiments, at least one modified nucléotide of the first nucléotide sequence is a 2’-fluoro purine. In some embodiments, 1, 2, 3, 4, 5, or 6 modified nucléotides of the first nucléotide sequence are 2’-fluoro purines. In some embodiments, the 2’-fluoro nucléotide is a 2’-fluoro nucléotide mimic.

In some embodiments, the nucléotide at position 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, at least two nucléotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5’ end of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least three nucléotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5’ end of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least four nucléotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5’ end of the first nucléotide sequence are 2’-fhioro nucléotides. In some embodiments, at least five nucléotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5’ end of the first nucléotide sequence are 2’fluoro nucléotides. In some embodiments, the nucléotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5’ end of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, the nucléotide at position 3 from the 5’ end of the first nucléotide sequence is a 2’fluoro nucléotide. In some embodiments, the nucléotide at position 7 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 8 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 9 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 12 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 17 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the 2’-fluoro nucléotide is a 2’-fluoro nucléotide mimic.

In some embodiments, at least 1, 2, 3, 4, 5, 6, or 7 nucléotides at position 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, at least two nucléotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5’ end of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least three nucléotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5’ end of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, the nucléotides at positions 3, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5’ end of the first nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, the nucléotide at position 3 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 5 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 7 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 8 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 9 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 10 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 11 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 12 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 14 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 17 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 19 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 3, 7, 8, 9, 12, and/or 17 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 3, 7, 8, and/or 17 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 3, 7, 8, 9, 12, and/or 17 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 5, 7, 8, and/or 9 from the 5’ end of the first nucléotide sequence is a 2’fluoro nucléotide. In some embodiments, the nucléotide at position 5, 9, 10, 11, 12, and/or 19 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the 2’-fluoro nucléotide is a 2’-fluoro nucléotide mimic.

In some embodiments, the 2’-fluoro nucléotide or 2’-O-methyl nucléotide is a 2’-fluoro or 2’-(9-methyl nucléotide mimic. In some embodiments, the 2’-fluoro or 2’-O-methyl nucléotide

Q2 R⁵ mimic is a nucléotide mimic of Formula (V): , wherein R¹ is independently a nucleobase, aryl, heteroaryl, or H, Q¹ and Q² are independently S or O, R⁵ is independently OCD3, -F, or -OCH3, and R⁶ and R⁷ are independently H, D, or CD3. In some embodiments, the nucleobase is selected from cytosine, guanine, adenine, uracil, aryl, heteroaryl, and an analogue or dérivative thereof.

In some embodiments, the 2’-fluoro or 2’-O-methyl nucléotide mimic is a nucléotide mimic of Formula (16) - Formula (20):

Formula (18) Formula (19) Formula (20) wherein R¹ is independently a nucleobase and R² is F or -OCH3. In some embodiments, the nucleobase is selected from cytosine, guanine, adenine, uracil, aryl, heteroaryl, and an analogue or dérivative thereof.

In some embodiments, the first nucléotide sequence comprises, consists of, or consists essentially of ribonucleic acids (RNAs). In some embodiments, the first nucléotide sequence comprises, consists of, or consists essentially of modified RNAs. In some embodiments, the modified RNAs are selected from a 2’-(9-methyl RNA and 2’-fluoro RNA. In some embodiments, 15, 16, 17, 18, 19, 20, 21, 22, or 23 modified nucléotides of the first nucléotide sequence are independently selected from 2’-(2-methyl RNA and 2’-fluoro RNA.

In some embodiments, the sense strand may further comprise one or more intemucleoside linkages independently selected from a phosphodiester (PO) intemucleoside linkage, phosphorothioate (PS) intemucleoside linkage, phosphorodithioate intemucleoside linkage, and

PS-mimic intemucleoside linkage. In some embodiments, the PS-mimic intemucleoside linkage is a sulfo intemucleoside linkage.

In some embodiments, the sense strand may further comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 or more phosphorothioate intemucleoside linkages. In some embodiments, the sense strand comprises 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 or fewer phosphorothioate intemucleoside linkages. In some embodiments, the sense strand comprises 2 to 10, 2 to 8, 2 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2 phosphorothioate intemucleoside linkages. In some embodiments, the sense strand comprises 1 to 2 phosphorothioate intemucleoside linkages. In some embodiments, the sense strand comprises 2 to 4 phosphorothioate intemucleoside linkages. In some embodiments, at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 1 and 2 from the 5’ end of the first nucléotide sequence. In some embodiments, at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 2 and 3 from the 5’ end of the first nucléotide sequence. In some embodiments, the sense strand comprises two phosphorothioate intemucleoside linkages between the nucléotides at positions 1 to 3 from the 5’ end of the first nucléotide sequence.

In some embodiments, any of the sense strands disclosed herein fiirther comprise a monomer selected from Examples 21-32, 36, 37, 40-42, and 44-46 monomers. In some embodiments, any of the sense strands disclosed herein fiirther comprise a 5’ end cap monomer. In some embodiments, the 5’ end cap monomer is selected from Examples 5-11, 33-35, 38, 39, 43, and 49-53 5’ end cap monomers. .

In some embodiments, any of the first nucléotide sequences disclosed herein fiirther comprise a monomer selected from Examples 21-32, 36, 37, 40-42, and 44-46 monomers. In some embodiments, any of the first nucléotide sequences disclosed herein fiirther comprise a 5’ end cap monomer. In some embodiments, the 5’ end cap monomer is selected from Examples 511, 33-35, 38, 39, 43, and 49-53 5’ end cap monomers. siNA antisense strand

Any of the siNA molécules described herein may comprise an antisense strand. The antisense strand may comprise a second nucléotide sequence. The second nucléotide sequence may be 15 to 30, 15 to 25, 15 to 23, 17 to 23, 19 to 23, or 19 to 21 nucléotides in length. In some embodiments, the second nucléotide sequence is 15, 16, 17, 18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucléotides in length. In some embodiments, the second nucléotide sequence is at least 19 nucléotides in length. In some embodiments, the second nucléotide sequence is at least 21 nucléotides in length.

In some embodiments, the antisense strand is the same length as the second nucléotide sequence. In some embodiments, the antisense strand is longer than the second nucléotide sequence. In some embodiments, the antisense strand may further comprise 1, 2, 3, 4, or 5 or more nucléotides than the second nucléotide sequence. In some embodiments, the antisense strand is the same length as the sense strand. In some embodiments, the antisense strand is longer than the sense strand. In some embodiments, the antisense strand may further comprise 1, 2, 3, 4, or 5 or more nucléotides than the sense strand. In some embodiments, the antisense strand may further comprise a deoxyribonucleic acid (DNA). In some embodiments, the DNA is thymine (T). In some embodiments, the antisense strand may further comprise a TT sequence. In some embodiments, the antisense strand may further comprise one or more modified nucléotides that are adjacent to the second nucléotide sequence. In some embodiments, the one or more modified nucléotides are independently selected from any of the modified nucléotides disclosed herein (e.g., 2’-fluoro nucléotide, 2’-O-methyl nucléotide, 2’-fluoro nucléotide mimic, 2’-O-methyl nucléotide mimic, or a nucléotide comprising a modified nucleobase).

In some embodiments, the second nucléotide sequence comprises 15, 16, 17, 18, 19, 20, 21, 22, 23, or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide. In some embodiments, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the nucléotides in the second nucléotide sequence are modified nucléotides independently selected from a 2’-(9-methyl nucléotide and a 2’-fluoro nucléotide. In some embodiments, 100% of the nucléotides in the second nucléotide sequence are modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide.

In some embodiments, between about 15 to 30, 15 to 25, 15 to 24, 15 to 23, 15 to 22, 15 to 21, 17 to 30, 17 to 25, 17 to 24, 17 to 23, 17 to 22, 17 to 21, 18 to 30, 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 19 to 30, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 20 to 25, 20 to 24, 20 to 23, 21 to 25, 21 to 24, or 21 to 23 modified nucléotides of the second nucléotide sequence are 2’-(9-methyl nucléotides. In some embodiments, between about 2 to 20 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, between about 5 to 25 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, between about 10 to 25 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, between about 12 to 25 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, at least about 12 modified nucléotides of the second nucléotide sequence are 2’-O methyl nucléotides. In some embodiments, at least about 13 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, at least about 14 modified nucléotides of the second nucléotide sequence are 2’-(9-methyl nucléotides. In some embodiments, at least about 15 modified nucléotides of the second nucléotide sequence are 2’-Omethyl nucléotides. In some embodiments, at least about 16 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, at least about 17 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, at least about 18 modified nucléotides of the second nucléotide sequence are 2’-Omethyl nucléotides. In some embodiments, at least about 19 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, less than or equal to 25, 24, 23,22,21,20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8,7, 6, 5, 4, 3, or 2 modified nucléotides of the second nucléotide sequence are 2’-(9-methyl nucléotides. In some embodiments, less than or equal to 21 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, less than or equal to 20 modified nucléotides of the second nucléotide sequence are 2’-(9-methyl nucléotides. In some embodiments, less than or equal to 19 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, less than or equal to 18 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, less than or equal to 17 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, less than or equal to 16 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, less than or equal to 15 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, less than or equal to 14 modified nucléotides of the second nucléotide sequence are 2’-(9-methyl nucléotides. In some embodiments, less than or equal to 13 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides. In some embodiments, at least one modified nucléotide of the second nucléotide sequence is a 2’-(9-methyl pyrimidine. In some embodiments, at least 5, 6, 7, 8, 9, or 10 modified nucléotides of the second nucléotide sequence are 2’-O-methyl pyrimidines. In some embodiments, at least one modified nucléotide of the second nucléotide sequence is a 2’-(2-methyl purine. In some embodiments, at least 5, 6, 7, 8, 9, or 10 modified nucléotides of the second nucléotide sequence are 2’-O-methyl purines. In some embodiments, the 2’-(9-methyl nucléotide is a 2’-(9-methyl nucléotide mimic.

In some embodiments, between 2 to 15 modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, between 2 to 10 modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, between 2 to 6 modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 1 to 6, 1 to 5, 1 to 4, or 1 to 3 modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least 1, 2, 3, 4, 5, or 6 modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least 1 modified nucléotide of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, at least 2 modified nucléotides of the second nucléotide sequence are 2’fluoro nucléotides. In some embodiments, at least 3 modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least 4 modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least 5 modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 10, 9, 8, 7, 6, 5, 4, 3 or fewer modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 10 or fewer modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 7 or fewer modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 6 or fewer modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 5 or fewer modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 4 or fewer modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 3 or fewer modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, 2 or fewer modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least one modified nucléotide of the second nucléotide sequence is a 2’-fluoro pyrimidine. In some embodiments, 1, 2, 3, 4, 5, or 6 modified nucléotides of the second nucléotide sequence are 2’-fluoro pyrimidines. In some embodiments, at least one modified nucléotide of the second nucléotide sequence is a 2’-fluoro purine. In some embodiments, 1, 2, 3, 4, 5, or 6 modified nucléotides of the second nucléotide sequence are 2’fluoro purines. In some embodiments, the 2’-fluoro nucléotide is a 2’-fluoro nucléotide mimic.

In some embodiments, the 2’-fluoro nucléotide or 2’-(9-methyl nucléotide is a 2’-fluoro or 2’-O-methyl nucléotide mimic. In some embodiments, the 2’-fluoro or 2’-O-methyl nucléotide

Q2 R⁵ mimic is a nucléotide mimic of Formula (V): , wherein R¹ is independently a nucleobase, aryl, heteroaryl, or H, Q¹ and Q² are independently S or O, R⁵ is independently

OCÜ3, -F, or -OCH3, and R⁶ and R⁷ are independently H, D, or CD3. In some embodiments, the nucleobase is selected from cytosine, guanine, adenine, uracil, aryl, heteroaryl, and an analogue or dérivative thereof.

O'' R² %	S^C R²	Cf' R²	οζ ôcd₃	O' OCD % '
Formula (16)	Formula (17)	Formula (18)	Formula (19)	Formula (20)

wherein R¹ is a nucleobase and R² is independently F or -OCH3. In some embodiments, the nucleobase is selected from cytosine, guanine, adenine, uracil, aryl, heteroaryl, and an analogue or dérivative thereof.

In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, or 9 nucléotides at position 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, at least two nucléotides at positions 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5’ end of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least three nucléotides at positions 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5’ end of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least four nucléotides at positions 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5’ end of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, at least five nucléotides at positions 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5’ end of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, the nucléotides at positions 2 and/or 14 from the 5’ end of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, the nucléotides at positions 2, 6, and/or 16 from the 5’ end of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, the nucléotides at positions 2, 6, 14, and/or 16 from the 5’ end of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, the nucléotides at positions 2, 6, 10, 14, and/or 18 from the 5’ end of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, the nucléotides at positions 2, 5, 8, 14, and/or 17 from the 5’ end of the second nucléotide sequence are 2’-fluoro nucléotides. In some embodiments, the nucléotide at position 2 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 5 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 6 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 8 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 10 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 14 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 16 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 17 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the nucléotide at position 18 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide. In some embodiments, the 2’-fluoro nucléotide is a 2’-fluoro nucléotide mimic.

In some embodiments, the nucléotides in the second nucléotide sequence are arranged in an altemating 1:3 modification pattern, wherein 1 nucléotide is a 2’-fluoro nucléotide and 3 nucléotides are 2’-(9-methyl nucléotides, and wherein the altemating 1:3 modification pattern occurs at least 2 times. In some embodiments, the altemating 1:3 modification pattern occurs 2-5 times. In some embodiments, at least two of the altemating 1:3 modification pattern occur consecutively. In some embodiments, at least two of the altemating 1:3 modification pattern occurs nonconsecutively. In some embodiments, at least 1, 2, 3, 4, or 5 altemating 1:3 modification pattern begins at nucléotide position 2, 6, 10, 14, and/or 18 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 2 from the 5’ end of the antisense strand. In some embodiments, wherein at least one altemating 1:3 modification pattern begins at nucléotide position 6 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 10 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 14 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:3 modification pattern begins at nucléotide position 18 from the 5’ end of the antisense strand. In some embodiments, the 2’-fluoro nucléotide is a 2’-fluoro nucléotide mimic.

In some embodiments, the nucléotides in the second nucléotide sequence are arranged in an altemating 1:2 modification pattern, wherein 1 nucléotide is a 2’-fluoro nucléotide and 2 nucléotides are 2’-O-methyl nucléotides, and wherein the altemating 1:2 modification pattern occurs at least 2 times. In some embodiments, the altemating 1:2 modification pattern occurs 2-5 times. In some embodiments, at least two of the altemating 1:2 modification pattern occurs consecutively. In some embodiments, at least two of the altemating 1:2 modification pattern occurs nonconsecutively. In some embodiments, at least 1, 2, 3, 4, or 5 altemating 1:2 modification pattern begins at nucléotide position 2, 5, 8, 14, and/or 17 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:2 modification pattern begins at nucléotide position 2 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:2 modification pattern begins at nucléotide position 5 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:2 modification pattern begins at nucléotide position 8 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:2 modification pattern begins at nucléotide position 14 from the 5’ end of the antisense strand. In some embodiments, at least one altemating 1:2 modification pattern begins at nucléotide position 17 from the 5’ end of the antisense strand. In some embodiments, the 2’fluoro nucléotide is a 2’-fluoro nucléotide mimic.

In some embodiments, the second nucléotide sequence comprises, consists of, or consists essentially of ribonucleic acids (RNAs). In some embodiments, the second nucléotide sequence comprises, consists of, or consists essentially of modified RNAs. In some embodiments, the modified RNAs are selected from a 2’-O-methyl RNA and 2’-fhioro RNA. In some embodiments, 15, 16, 17, 18, 19, 20, 21, 22, or 23 modified nucléotides of the second nucléotide sequence are independently selected from 2’-O-methyl RNA and 2’-fluoro RNA. In some embodiments, the 2’-fluoro nucléotide is a 2’-fluoro nucléotide mimic.

In some embodiments, the sense strand may further comprise one or more intemucleoside linkages independently selected from a phosphodiester (PO) intemucleoside linkage, phosphorothioate (PS) intemucleoside linkage, phosphorodithioate intemucleoside linkage, and PS-mimic intemucleoside linkage. In some embodiments, the PS-mimic intemucleoside linkage is a sulfo intemucleoside linkage.

In some embodiments, the antisense strand may further comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 or more phosphorothioate intemucleoside linkages. In some embodiments, the antisense strand comprises 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, or 3 or fewer phosphorothioate intemucleoside linkages. In some embodiments, the antisense strand comprises 2 to 10, 2 to 8, 2 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2 phosphorothioate intemucleoside linkages. In some embodiments, the antisense strand comprises 2 to 10, 2 to 8, 2 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2 phosphorothioate intemucleoside linkages. In some embodiments, the antisense strand comprises 2 to 8 phosphorothioate intemucleoside linkages. In some embodiments, the antisense strand comprises 3 to 8 phosphorothioate intemucleoside linkages. In some embodiments, the antisense strand comprises 4 to 8 phosphorothioate intemucleoside linkages. In some embodiments, at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 1 and 2 from the 5’ end of the second nucléotide sequence. In some embodiments, at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 2 and 3 from the 5’ end of the second nucléotide sequence. In some embodiments, at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 1 and 2 from the 3 ’ end of the second nucléotide sequence. In some embodiments, at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 2 and 3 from the 3 ’ end of the second nucléotide sequence. In some embodiments, the antisense strand comprises two phosphorothioate intemucleoside linkages between the nucléotides at positions 1 to 3 from the 5’ end of the first nucléotide sequence. In some embodiments, the antisense strand comprises two phosphorothioate intemucleoside linkages between the nucléotides at positions 1 to 3 from the 3’ end of the first nucléotide sequence. In some embodiments, the antisense strand comprises (a) two phosphorothioate intemucleoside linkages between the nucléotides at positions 1 to 3 from the 5’ end of the first nucléotide sequence; and (b) two phosphorothioate intemucleoside linkages between the nucléotides at positions 1 to 3 from the 3 ’ end of the first nucléotide sequence.

In some embodiments, at least one end of the ds-siNA is a blunt end. In some embodiments, at least one end of the ds-siNA comprises an overhang, wherein the overhang comprises at least one nucléotide. In some embodiments, both ends of the ds-siNA comprise an overhang, wherein the overhang comprises at least one nucléotide. In some embodiments, the overhang comprises 1 to 5 nucléotides, 1 to 4 nucléotides, 1 to 3 nucléotides, or 1 to 2 nucléotides. In some embodiments, the overhang consists of 1 to 2 nucléotides.

In some embodiments, the first nucléotide sequence comprises a nucléotide sequence of any one SEQ ID NOs: 1-56, 103-158, and 205-260. In some embodiments, the second nucléotide sequence comprises a nucléotide sequence of any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the sense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the antisense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 363-409, 445-533, and 536-539.

In some embodiments, any of the antisense strands disclosed herein further comprise a monomer selected from Examples 21-32, 36, 37, 40-42, and 44-46 monomers. In some embodiments, any of the antisense strands disclosed herein further comprise a 5’ end cap monomer. In some embodiments, the 5’ end cap monomer is selected from Examples 5-11, 3335, 38, 39, 43, and 49-53 5’ end cap monomers.

In some embodiments, any of the secondnucleotide sequences disclosed herein further comprise a monomer selected from Examples 21-32, 36, 37, 40-42, and 44-46 monomers. In some embodiments, any of the second nucléotide sequences disclosed herein further comprise a

5’ end cap monomer. In some embodiments, the 5’ end cap monomer is selected from Examples 5-11, 33-35, 38, 39, 43, and 49-53 5’ end cap monomers.

Modified Nucléotides

Further disclosed herein are siNA molécules comprising one or more modified nucléotides. In some embodiments, any of the siNAs disclosed herein comprise one or more modified nucléotides. In some embodiments, any of the sense strands disclosed herein comprise one or more modified nucléotides. In some embodiments, any of the first nucléotide sequences disclosed herein comprise one or more modified nucléotides. In some embodiments, any of the antisense strands disclosed herein comprise one or more modified nucléotides. In some embodiments, any of the second nucléotide sequences disclosed herein comprise one or more modified nucléotides. In some embodiments, the one or more modified nucléotides is adjacent to the first nucléotide sequence. In some embodiments, at least one modified nucléotide is adjacent to the 5’ end of the first nucléotide sequence. In some embodiments, at least one modified nucléotide is adjacent to the 3’ end of the first nucléotide sequence. In some embodiments, at least one modified nucléotide is adjacent to the 5’ end of the first nucléotide sequence and at least one modified nucléotide is adjacent to the 3’ end of the first nucléotide sequence. In some embodiments, the one or more modified nucléotides is adjacent to the second nucléotide sequence. In some embodiments, at least one modified nucléotide is adjacent to the 5’ end of the second nucléotide sequence. In some embodiments, at least one modified nucléotide is adjacent to the 3 ’ end of the second nucléotide sequence. In some embodiments, at least one modified nucléotide is adjacent to the 5’ end of the second nucléotide sequence and at least one modified nucléotide is adjacent to the 3’ end of the second nucléotide sequence. In some embodiments, a 2’-(9-methyl nucléotide in any of sense strands or first nucléotide sequences disclosed herein is replaced with a modified nucléotide. In some embodiments, a 2’-O-methyl nucléotide in any of antisense strands or second nucléotide sequences disclosed herein is replaced with a modified nucléotide.

In some embodiments, any of the siNA molécules, siNAs, sense strands, first nucléotide sequences, antisense strands, and second nucléotide sequences disclosed herein comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,21,22, 23,24, 25, 26, 27,28,29, or 30 or more modified nucléotides. In some embodiments, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the nucléotides in the siNA molécule, siNA, sense strand, first nucléotide sequence, antisense strand, or second nucléotide sequence are modified nucléotides.

In some embodiments, a modified nucléotide is selected from the group consisting of 2’fluoro nucléotide, 2’-O-methyl nucléotide, 2’-fluoro nucléotide mimic, 2’-(9-methyl nucléotide mimic, a locked nucleic acid, and a nucléotide comprising a modified nucleobase.

In some embodiments, any of the siRNAs disclosed herein comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more 2’-fluoro or 2’-O-methyl nucléotide mimics. In some embodiments, any of the sense strands disclosed herein comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more 2’fluoro or 2’-O-methyl nucléotide mimics. In some embodiments, any of the first nucléotide sequences disclosed herein comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more 2’-fluoro or 2’O-methyl nucléotide mimics. In some embodiments, any of the antisense strand disclosed herein comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more 2’-fluoro or 2’-O-methyl nucléotide mimics. In some embodiments, any of the second nucléotide sequences disclosed herein comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more 2’-fhioro or 2’-O-methyl nucléotide mimics. In some embodiments, the 2’-fluoro or 2’-O-methyl nucléotide mimic is a nucléotide mimic of Formula (16) - Formula (20):

Formula (16)

Formula (17) Formula (18) Formula (19)

Formula (20) wherein R¹ is a nucleobase and R² is independently F or -OCH3. In some embodiments, the nucleobase is selected from cytosine, guanine, adenine, uracil, aryl, heteroaryl, and an analogue or dérivative thereof. In some embodiments, the siNA molécules disclosed herein comprise at least one 2’-fluoro nucléotide, at least one 2’-O-methyl nucléotide, and at least one 2’-fluoro or 2’-O-methyl nucléotide mimic. In some embodiments, the at least one 2’-fluoro or 2’-O-methyl nucléotide mimic is adjacent to the first nucléotide sequence. In some embodiments, the at least one 2’-fluoro or 2’-O-methyl nucléotide mimic is adjacent to the 5’ end of first nucléotide sequence. In some embodiments, the at least one 2’-fluoro or 2’-O-methyl nucléotide mimic is adjacent to the 3’ end of first nucléotide sequence. In some embodiments, the at least one 2’fluoro or 2’-(9-methyl nucléotide mimic is adjacent to the second nucléotide sequence. In some embodiments, the at least one 2’-fluoro or 2’-(9-methyl nucléotide mimic is adjacent to the 5’ end of second nucléotide sequence. In some embodiments, the at least one 2’-fluoro or 2’-Omethyl nucléotide mimic is adjacent to the 3’ end of second nucléotide sequence. In some embodiments, the first nucléotide sequence does not comprise a 2’-fluoro nucléotide mimic. In some embodiments, the first nucléotide sequence does not comprise a 2’-O-methyl nucléotide mimic. In some embodiments, the second nucléotide sequence does not comprise a 2’-fluoro nucléotide mimic. In some embodiments, the second nucléotide sequence does not comprise a

2’-O-methyl nucléotide mimic.

In some embodiments, any of the siRNAs disclosed herein comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more locked nucleic acids. In some embodiments, any of the sense strands disclosed herein comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more locked nucleic acids. In some embodiments, any of the first nucléotide sequences disclosed herein comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more locked nucleic acids. In some embodiments, any of the antisense strand disclosed herein comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more locked nucleic acids. In some embodiments, any of the second nucléotide sequences disclosed herein comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more locked nucleic acids. In some embodiments, the ^B °^\ n /^B

Voy y°y o^o locked nucleic acid is selected from * (LNA), (ScpBNA or “cp”);

(AmNA), where R is H or alkyl (or AmNA(N-Me)) when R is alkyl);

(GuNA); and GuNA(N-R), r - Me, Et, iPr, tBu, wherein B is a nucleobase. In some embodiments, any of the siRNAs, sense strands, first nucléotide sequences, antisense strands, or second nucléotide sequences disclosed herein comprise at least modified

nucléotide that is (LNA). In some embodiments, any of the siRNAs, sense strands, first nucléotide sequences, antisense strands, or second nucléotide sequences disclosed herein comprise at least modified nucléotide that is

(ScpBNA or “cp”). In some embodiments, any of the siRNAs, sense strands, first nucléotide sequences, antisense strands, or second nucléotide sequences disclosed herein comprise at least modified nucléotide that is

B

Voy

-o^-n,_r ⁰ (AmNA), where R is H or alkyl (or AmNA(N-Me)) when R is alkyl). In some embodiments, any of the siRNAs, sense strands, first nucléotide sequences, antisense strands, or second nucléotide sequences disclosed herein comprise at least modified nucléotide that is

^h2ⁿ (GuNA). In some embodiments, any of the siRNAs, sense strands, first nucléotide sequences, antisense strands, or second nucléotide sequences disclosed herein

comprise at least modified nucléotide that is GuNA(N-R), r Me, Et, iPr, tBu, _wherein B is a nucleobase.

Phosphorylation blocker

Further disclosed herein are siNA molécules comprising a phosphorylation blocker. In some embodiments, a 2’-(9-methyl nucléotide in any of sense strands or first nucléotide sequences disclosed herein is replaced with a nucléotide containing a phosphorylation blocker. In some embodiments, a 2’-O-methyl nucléotide in any of antisense strands or second nucléotide sequences disclosed herein is replaced with a nucléotide containing a phosphorylation blocker. In some embodiments, a 2’-(9-methyl nucléotide in any of sense strands or first nucléotide sequences disclosed herein is further modified to contain a phosphorylation blocker. In some embodiments, a 2’-O-methyl nucléotide in any of antisense strands or second nucléotide sequences disclosed herein is further modified to contain a phosphorylation blocker.

In some embodiments, any of the siNA molécules disclosed herein comprise a ^R4yy^R1 phosphorylation blocker of Formula (IV): , wherein R¹ is a nucleobase, R⁴ is -OR³⁰ or -NR³¹R³², R³⁰ is Ci-Cs substituted or unsubstituted alkyl; and R³¹ and R³² together with the nitrogen to which they are attached form a substituted or unsubstituted heterocyclic ring.

In some embodiments, any of the siNA molécules disclosed herein comprise a

phosphorylation blocker of Formula (IV): —L Formula (IV), wherein R¹ is a nucleobase, and R⁴ is -OCH3 or -N(CH2CH2)2O.

In some embodiments, a siNA molécule comprises (a) a phosphorylation blocker of ^R4\°/^R1

Formula (IV): —J— , wherein R¹ is a nucleobase, R⁴ is -O-R³⁰ or-NR³¹R³², R³⁰ is Ci-Cs substituted or unsubstituted alkyl; and R³¹ and R³² together with the nitrogen to which they are attached form a substituted or unsubstituted heterocyclic ring; and (b) a short interfering nucleic acid (siNA), wherein the phosphorylation blocker is conjugated to the siNA.

In some embodiments, a siNA molécule comprises (a) a phosphorylation blocker of ^R4A^°y^R1'^O^'O

Formula (IV): Formula (IV), wherein R¹ is a nucleobase, and R⁴ is -OCH3 or N(CH2CH2)2O; and (b) a short interfering nucleic acid (siNA), wherein the phosphorylation blocker is conjugated to the siNA.

In some embodiments, the phosphorylation blocker is attached to the 3’ end of the sense strand or first nucléotide sequence. In some embodiments, the phosphorylation blocker is attached to the 3’ end of the sense strand or first nucléotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the phosphorylation blocker is attached to the 5’ end of the sense strand or first nucléotide sequence. In some embodiments, the phosphorylation blocker is attached to the 5’ end of the sense strand or first nucléotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the phosphorylation blocker is attached to the 3’ end of the antisense strand or second nucléotide sequence. In some embodiments, the phosphorylation blocker is attached to the 3’ end of the antisense strand or second nucléotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the phosphorylation blocker is attached to the 5’ end of the antisense strand or second nucléotide sequence. In some embodiments, the phosphorylation blocker is attached to the 5’ end of the antisense strand or second nucléotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the one or more linkers are independently selected from the group consisting of a phosphodiester linker, phosphorothioate linker, and phosphorodithioate linker.

Conjugated Moiety

Further disclosed herein are siNA molécules comprising a conjugated moiety. In some embodiments, the conjugated moiety is selected from galactosamine, peptides, proteins, sterols, lipids, phospholipids, biotin, phenoxazines, active diug substance, cholestérols, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. In some embodiments, the conjugated moiety is attached to the 3’ end of the sense strand or first nucléotide sequence. In some embodiments, the conjugated moiety is attached to the 3’ end of the sense strand or first nucléotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the conjugated moiety is attached to the 5’ end of the sense strand or first nucléotide sequence. In some embodiments, the conjugated moiety is attached to the 5’ end of the sense strand or first nucléotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the conjugated moiety is attached to the 3 ’ end of the antisense strand or second nucléotide sequence. In some embodiments, the conjugated moiety is attached to the 3’ end of the antisense strand or second nucléotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the conjugated moiety is attached to the 5’ end of the antisense strand or second nucléotide sequence. In some embodiments, the conjugated moiety is attached to the 5’ end of the antisense strand or second nucléotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the one or more linkers are independently selected from the group consisting of a phosphodiester linker, phosphorothioate linker, and phosphorodithioate linker.

In some embodiments, the conjugated moiety is galactosamine. In some embodiments, any of the siNAs disclosed herein are attached to a conjugated moiety that is galactosamine. In some embodiments, the galactosamine is N-acetylgalactosamine (GalNAc). In some embodiments, any of the siNA molécules disclosed herein comprise GalNAc. In some embodiments, the GalNAc is of Formula (VI):

is independently 1 or 2; p is 0 or 1 ; each R is independently H or a first protecting group; each Y is independently selected from -O-P(=O)(SH) -, -O-P(=O)(O) -, -O-P(=O)(OH) -, -O-P(S)S-, and -O-; Z is H or a second protecting group; either L is a linker or L and Y in combination are a linker; and A is H, OH, a third protecting group, an activated group, or an oligonucleotide. In some embodiments, the first protecting group is acetyl. In some embodiments, the second protecting group is trimethoxytrityl (TMT). In some embodiments, the activated group is a phosphoramidite group. In some embodiments, the phosphoramidite group is a cyanoethoxy V A-diisopropylphosphoramidite group. In some embodiments, the linker is a C6-NH2 group. In some embodiments, A is a short interfering nucleic acid (siNA) or siNA molécule. In some embodiments, m is 3. In some embodiments, R is H, Z is H, and n is 1. In some embodiments, R is H, Z is H, and n is 2.

In some embodiments, the GalNAc is of Formula (VII):

R = OH or SH wherein each n is independently 1 or 2.

In some embodiments, the galactosamine is attached to the 3 ’ end of the sense strand or first nucléotide sequence. In some embodiments, the galactosamine is attached to the 3 ’ end of the sense strand or first nucléotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the galactosamine is attached to the 5’ end of the sense strand or first nucléotide sequence. In some embodiments, the galactosamine is attached to the 5’ end of the sense strand or first nucléotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the galactosamine is attached to the 3 ’ end of the antisense strand or second nucléotide sequence. In some embodiments, the galactosamine is attached to the 3 ’ end of the antisense strand or second nucléotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the galactosamine is attached to the 5’ end of the antisense strand or second nucléotide sequence. In some embodiments, the galactosamine is attached to the 5’ end of the antisense strand or second nucléotide sequence via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the one or more linkers are independently selected from the group consisting of a phosphodiester (p or po) linker, phosphorothioate (ps) linker, phosphoramidite (HEG) linker, triethylene glycol (TEG) linker, and/or phosphorodithioate linker. In some embodiments, the one or more linkers are independently selected from the group consisting of p-(PS)2, (PS)2-p-TEG-p, (PS)2-p-HEG-p, and (PS)2-p-(HEG-p)2.

In some embodiments, the conjugated moiety is a lipid moiety. In some embodiments, any of the siNAs disclosed herein are attached to a conjugated moiety that is a lipid moiety. Examples of lipid moieties include, but are not limited to, a cholestérol moiety, a thioether, e.g., hexyl-S-tritylthiol, a thiocholestérol, an aliphatic chain, e.g., dodecandiol or undecyl residues a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1-di-O-hexadecyl-racglycero-S-H-phosphonate, a polyamine or a polyethylene glycol chain, adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.

In some embodiments, the conjugated moiety is an active drug substance. In some embodiments, any of the siNAs disclosed herein are attached to a conjugated moiety that is an active drug substance. Examples of active drug substances include, but are not limited to, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (5)-(+)- pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

5’-Stabilized End Cap

Further disclosed herein are siNA molécules comprising a 5’-stabilized end cap. As used herein the ternis “5’-stabilized end cap” and “5’ end cap” are used interchangeably. In some embodiments, a 2’-O-methyl nucléotide in any of sense strands or first nucléotide sequences disclosed herein is replaced with a nucléotide containing a 5’-stabilized end cap. In some embodiments, a 2’-O-methyl nucléotide in any of antisense strands or second nucléotide sequences disclosed herein is replaced with a nucléotide containing a 5’-stabilized end cap. In some embodiments, a 2’-(9-methyl nucléotide in any of sense strands or first nucléotide sequences disclosed herein is further modified to contain a 5’-stabilized end cap. In some embodiments, a 2’-(9-methyl nucléotide in any of antisense strands or second nucléotide sequences disclosed herein is further modified to contain a 5’-stabilized end cap.

In some embodiments, the 5’-stabilized end cap is a 5’ phosphate mimic. In some embodiments, the 5’-stabilized end cap is a modified 5’ phosphate mimic. In some embodiments, the modified 5’ phosphate is a chemically modified 5’ phosphate. In some embodiments, the 5’stabilized end cap is a 5’-vinyl phosphonate. In some embodiments, the 5’-vinyl phosphonate is a 5’-(E)-vinyl phosphonate or 5’-(Z)-vinyl phosphonate. In some embodiments, the 5’-vinyl phosphonate is a deuterated vinyl phosphonate. In some embodiments, the deuterated vinyl phosphonate is a mono-deuterated vinyl phosphonate. In some embodiments, the deuterated vinyl phosphonate is a di-deuterated vinyl phosphonate. In some embodiments, the 5’-stabilized end cap is a phosphate mimic. Examples of phosphate mimics are disclosed in Parmar et al.,

2018, J Med Chem, 61(3):734-744, International Publication Nos. WO2018/045317 and

WO2018/044350, and U.S. Patent No. 10,087,210, each of which is incorporated by reference in its entirety.

In some embodiments, any of the siNA molécules, sense strands, first nucléotide sequences, antisense strands, or second nucléotide sequences disclosed herein comprise a 5’-

O (DCH₃ , wherein R¹ is H, a nucleobase, aryl, or stabilized end cap of Formula (la):

_zocd₃

ο , -CH CD-Z, -CD=CH-Z, -CD=CD-Z, (CR²¹R²²)n-Z, or -(C2-C6 alkenylene)-Z and R²⁰ is H; or R² and R²⁰ together form a 3- to 7membered carbocyclic ring substituted with -(CR²¹R²²)n-Z or -(C2-C6 alkenylene)-Z; n is 1, 2, 3, or 4; Z is -ONR²³R²⁴, -OP(O)OH(CH2)mCO2R²³, -OP(S)OH(CH2)mCO₂R²³, -P(O)(OH)₂, P(O)(OH)(OCH₃), -P(O)(OH)(OCD₃), -SO₂(CH₂)mP(O)(OH)2, -so₂nr²³r²⁵, -nr²³r²⁴, NR²³SÛ2R²⁴; either R²¹ and R²² are independently hydrogen or Ci-Cô alkyl, or R²¹ and R²²together form an oxo group; R²³ is hydrogen or Ci-Cô alkyl; R²⁴ is -SO2R²⁵ or -C(O)R²⁵; or R²³ and R²⁴ together with the nitrogen to which they are attached form a substituted or unsubstituted heterocyclic ring; R²⁵ is Ci-Cg alkyl; and m is 1, 2, 3, or 4. In some embodiments, R¹ is an aryl.

In some embodiments, the aryl is a phenyl.

0' (DCD₃ stabilized end cap of Formula (Ib): Ά , wherein R¹ is H, a nucleobase, aryl, or heteroaryl; R² is

O O

Ο

II

Ρ_χ-ΟΗ

OH

HO, ,S 9 O,, _ZOH

Y'YC^P'^X~^/OH Y^^^OH 9

O, OCH

_zOCD ΌΗ

-CH=CD-Z, -CD=CH-Z, -CD=CD-Z, (CR^2IR²²)n-Z, or -(C2-C6 alkenylene)-Z and R²⁰ is H; or R² and R²⁰ together form a 3- to 7membered carbocyclic ring substituted with -(CR²¹R²²)n-Z or -(C₂-Cô alkenylene)-Z; n is 1, 2, 3, or 4; Z is -ONR²³R²⁴, -OP(O)OH(CH2)mCO2R²³, -OP(S)OH(CH2)mCO₂R²³, -P(O)(OH)2, P(O)(OH)(OCH3), -P(O)(OH)(OCD3), -SO2(CH2)mP(O)(OH)2, -SO2NR²³R²⁵, -NR²³R²⁴, NR²³SO2R²⁴; either R²¹ and R²² are independently hydrogen or Ci-Cô alkyl, or R²¹ and R²²together form an oxo group; R²³ is hydrogen or Ci-Cô alkyl; R²⁴ is -SO2R²⁵ or -C(O)R²⁵; or R²³and R²⁴ together with the nitrogen to which they are attached form a substituted or unsubstituted heterocyclic ring; R²⁵ is Ci-Cô alkyl; and m is 1, 2, 3, or 4. In some embodiments, R¹ is an aryl.

In some embodiments, the aryl is a phenyl.

In some embodiments, any of the siNA molécules, sense strands, first nucléotide sequences, antisense strands, or second nucléotide sequences disclosed herein comprise a 5’stabilized end cap of Formula (le):

, wherein R¹ is a nucleobase, aryl, heteroaryl, or H,

O

II

P_X-OH

OH

HO, _Z/S 9 O,, _ZOH

ΥΥο'^^ΌΗ Ύ^^Ρ^ΟΗ

O, och₃ o, ocd₃

Y OH Y OH 5

, -CH=CD-Z, -CD=CH-Z, -CD=CD-Z, -(CR² ‘R²²)_n-Z, or -(C₂-C₆ alkenylene)-Z and R²⁰ is hydrogen; or R² and R²⁰ together form a 3- to 7-membered carbocyclic ring substituted with -(CR²¹R²²)_n-Z or-(C₂-Cô alkenylene)-Z; n is 1, 2, 3, or 4;

Z is -ONR²³R²⁴, -OP(O)OH(CH2)mCO2R²³, -OP(S)OH(CH2)_raCO₂R²³, -P(O)(OH)2, P(O)(OH)(OCH3), -P(O)(OH)(OCD3), -SO2(CH2)mP(O)(OH)2, -SO2NR²³R²⁵, -NR²³R²⁴, orNR²³SO2R²⁴; R²¹ and R²² either are independently hydrogen or Ci-Cô alkyl, or R²¹ and R²²together form an oxo group; R²³ is hydrogen or Ci-Cô alkyl; R²⁴ is -SO₂R²⁵ or -C(O)R²⁵; or

R²³ and R²⁴ together with the nitrogen to which they are attached form a substituted or unsubstituted heterocyclic ring; R²⁵ is Ci-Cô alkyl; and m is 1, 2, 3, or 4. In some embodiments, R¹ is an aryl. In some embodiments, the aryl is a phenyl.

In some embodiments, any of the siNA molécules, sense strands, first nucléotide 5 sequences, antisense strands, or second nucléotide sequences disclosed herein comprise a 5’^Rv°v-R’

O t>CH₃ stabilized end cap of Formula (Ha): , wherein R¹ is a nucleobase, aryl, heteroaryl,

COCH₃, - - is a double or single bond, R¹⁰ = -CH2PO3H or -NHCH3, R¹¹ is -CH2- or -CO-, 10 and R¹² is H and R¹³ is CH3 or R¹² and R¹³ together form -CH₂CH₂CH₂-. In some embodiments, R¹ is an aryl. In some embodiments, the aryl is a phenyl.

0' OCD₃ stabilized end cap of Formula (Ilb): -~L~ , wherein R¹ is a nucleobase, aryl, heteroaryl,

HQ R Æ 'S=O ° N-R¹¹ ⁰ , -CH2SO2NHCH3, or R¹²^, R⁹ is -SO2CH₃ orCOCH3, - - - is a double or single bond, R¹⁰ = -CH2PO3H or -NHCH3, R¹¹ is -CH2- or -CO-, and R¹² is H and R¹³ is CH3 or R¹² and R¹³ together form -CH₂CH₂CH₂- In some embodiments, R¹ is an aryl. In some embodiments, the aryl is a phenyl.

In some embodiments, any of the siNA molécules, sense strands, first nucléotide sequences, antisense strands, or second nucléotide sequences disclosed herein comprise a 5’a^/Lx^°^R¹ θ' 'OCH₃ stabilized end cap of Formula (III): ~-L~ , wherein R¹ is a nucleobase, aryl, heteroaryl, or H, L is -CH₂-, -CH=CH-, -CO-, or -CH2CH2-, and A is -ONHCOCH3, -ONHSO2CH3, PO3H, -OP(SOH)CH₂CO₂H, -SO₂CH₂PO₃H, -SO2NHCH3, -NHSO2CH3, or N(SO₂CH₂CH₂CH₂). In some embodiments, R¹ is an aryl. In some embodiments, the aryl is a phenyl.

In some embodiments, any of the siNA molécules, sense strands, first nucléotide sequences, antisense strands, or second nucléotide sequences disclosed herein comprise a 5’stabilized end cap selected from Examples 5-11, 33-35, 38, 39, 43, and 49-53 5’ end cap monomers.

Further disclosed herein are siNA molécules comprising (a) a 5’-stabilized end cap of

0' 'OCH₃ , wherein R¹ is a nucleobase, aryl, heteroaryl, or H; R² is

Formula (la):

zP 9 HO. _ZS 9 O_x OH O, OCH₃ O, OCD₃ ^JS^P_X-OH A s/<X X 5/^jX l OH Y O OH X OH Y OH V OH

5 5 5

, -CH=CD-Z, -CD=CH-Z, -CD=CD-Z, -(CR²¹R²²)_n-Z, or-(C₂-C₆ alkenylene)-Z and R²⁰ is H; or R² and R²⁰ together form a 3- to 7-membered carbocyclic ring substituted with -(CR²¹R²²)n-Z or - (C2-Cô alkenylene)-Z; n is 1, 2, 3, or 4; Z is -ONR²³R²⁴, OP(O)OH(CH2)_mCO₂R²³, -OP(S)OH(CH2)mCO2R²³, -P(O)(OH)2, -P(O)(OH)(OCH₃), P(O)(OH)(OCD₃), -SO₂(CH2)mP(O)(OH)₂, -SO₂NR²³R²⁵, -NR²³R²⁴, -NR²³SO₂R²⁴; either R²¹and R²² are independently hydrogen or Ci-Ce alkyl, or R²¹ and R²² together form an oxo group; R²³ is hydrogen or Ci-Cô alkyl; R²⁴ is -SO2R²⁵ or -C(O)R²⁵; or R²³ and R²⁴ together with the nitrogen to which they are attached form a substituted or unsubstituted heterocyclic ring; R²⁵ is

Ci-Cô alkyl; and m is 1, 2, 3, or 4; and (b) a short interfering nucleic acid (siNA), wherein the 5’ stabilized end cap is conjugated to the siNA. In some embodiments, R¹ is an aryl. In some embodiments, the aryl is a phenyl.

0' ocd₃

Ύ , wherein R¹ is a nucleobase, aryl, heteroaryl, or H; R² is

Formula (Ib):

O , -CH=CD-Z, -CD=CH-Z, -CD=CD-Z, -(CR²¹R²²)_n-Z, or -(C₂-C₆ alkenylene)-Z and R²⁰ is H; or R² and R²⁰ together form a 3- to 7-membered carbocyclic ring substituted with -(CR²¹R²²)n-Z or - (C2-Cô alkenylene)-Z; n is 1, 2, 3, or 4; Z is -ONR²³R²⁴, OP(O)OH(CH2)_mCO₂R²³, -OP(S)OH(CH2)mCO2R²³, -P(O)(OH)2, -P(O)(OH)(OCH₃), P(O)(OH)(OCD₃), -SO₂(CH₂)_mP(O)(OH)₂, -SO₂NR²³R²⁵, -NR²³R²⁴, -NR²³SO2R²⁴; either R²¹and R²² are independently hydrogen or Ci-Cô alkyl, or R²¹ and R²² together form an oxo group; R²³ is hydrogen or Ci-Cô alkyl; R²⁴ is -SO2R²⁵ or -C(O)R²⁵; or R²³ and R²⁴ together with the nitrogen to which they are attached form a substituted or unsubstituted heterocyclic ring; R²⁵ is

Further disclosed herein are siNA molécules comprising (a) a 5’-stabilized end cap of ^Ry°yR¹

R²⁰' VJ

0' F

Formula (le): ~~L- , wherein R¹ is a nucleobase, aryl, heteroaryl, or H, R² is

H ,Ν./ । S // Ά

O O ο , -CH=CD-Z, -CD=CH-Z, -CD=CD-Z, -(CR²¹R²²)_n-Z, or -(C₂-C₆ alkenylene)-Z and R²⁰ is hydrogen; or R² and R²⁰ together form a 3- to 7-membered carbocyclic ring substituted with -(CR²¹R²²)_n-Z or -(C₂-Cô alkenylene)-Z; n is 1, 2, 3, or 4;

Z is -ONR²³R²⁴, -OP(O)OH(CH2)mCO2R²³, -OP(S)OH(CH2)_mCO₂R²³, -P(O)(OH)2, P(O)(OH)(OCH3), -P(O)(OH)(OCD3), -SO2(CH2)mP(O)(OH)2, -SO2NR²³R²⁵, -NR²³R²⁴, orNR²³SO2R²⁴; R²¹ and R²² either are independently hydrogen or Ci-Cô alkyl, or R²¹ and R²²together form an oxo group; R²³ is hydrogen or Ci-Cô alkyl; R²⁴ is -SO₂R²⁵ or -C(O)R²⁵; or R²³ and R²⁴ together with the nitrogen to which they are attached form a substituted or unsubstituted heterocyclic ring; R²⁵ is Ci-Cô alkyl; and m is 1, 2, 3, or 4; and (b) a short interfering nucleic acid (siNA), wherein the 5’-stabilized end cap is conjugated to the siNA. In some embodiments, R¹ is an aryl. In some embodiments, the aryl is a phenyl.

In some embodiments, a siNA molécule comprises (a) a 5’-stabilized end cap of Formula

R13 P ^R'S>0 'n-r¹¹

CH₂SO₂NHCH₃, or R¹² , R⁹ is -SO₂CH₃ or -COCH₃, wherein is a double or single bond, R¹⁰ = -CH2PO3H or -NHCH3, R¹¹ is -CH2- or -CO-, and R¹² is H and R¹³ is CH3 or R¹²and R¹³ together form -CH2CH₂CH₂-; and (b) a short interfering nucleic acid (siNA), wherein the 5’-stabilized end cap is conjugated to the siNA. In some embodiments, R¹ is an aryl. In some embodiments, the aryl is a phenyl.

0' OCD₃ hn._o (Ilb): —J— , wherein R¹ is a nucleobase, aryl, heteroaryl, or H, R² is

100

R13/9 ^R's=o 'n-r¹¹

CH2SO2NHCH3, or R¹² , R⁹ is -SO2CH3 or -COCH3, wherein is a double or single bond, R¹⁰ = -CH2PO3H or -NHCH3, R¹¹ is -CH₂- or -CO-, and R¹² is H and R¹³ is CH3 or R¹²and R¹³ together form -CH2CH2CH2-; and (b) a short interfering nucleic acid (siNA), wherein the 5’-stabilized end cap is conjugated to the siNA. In some embodiments, R¹ is an aryl. In some 5 embodiments, the aryl is a phenyl.

In some embodiments, a siNA molécule comprises (a) a 5’-stabilized end cap of Formula a^/Lx^°\^R¹ô' OCH₃ (III): , wherein R¹ is a nucleobase, aryl, heteroaryl, or H, L is -CH₂-, -CH=CH-,

-CO-, or -CH2CH2-, and A is -ONHCOCH3, -ONHSO2CH3, -PO3H, -OP(SOH)CH₂CO₂H, SO2CH2PO3H, -SO2NHCH3, -NHSO2CH3, or-N(SO₂CH₂CH2CH2); and (b) a short interfering 10 nucleic acid (siNA), wherein the 5’-stabilized end cap is conjugated to the siNA. In some embodiments, R¹ is an aryl. In some embodiments, the aryl is phenyl.

In some embodiments, any of the siNA molécules disclosed herein comprise a 5’stabilized end cap selected from the group consisting of Formula (1) to Formula (15), Formula (9X) to Formula (12X), and Formula (9Y) to Formula (12Y):

Formula (1) Formula (2) Formula (3) Formula (4)

Formula (5) Formula (6) Formula (7)

Formula (8)

Formula (9)

Formula (9X)

Formula (9Y)

101

Formula (11X) Formula (11Y)

Formula (11)

Formula (12) Formula (12X) Formula (12Y)

Formula (13) Formula (14)

Formula (15) , wherein R¹ is a nucleobase, aryl, heteroaryl, or H. In some embodiments, R¹ is an aryl. In some embodiments, the aryl is a phenyl.

In some embodiments, any of the siNA molécules disclosed herein comprise a 5’stabilized end cap selected from the group consisting of Formulas (1 A)-(15A), Formulas (9B)(12B), Formulas (9AX)-(12AX), Formulas (9AY)-(12AY), Formulas (9BX)-(12BX), and

Formulas (9BY)-(12BY):

102

Formula (9B)

Formula (9AX) Formula (9AY)

Formula (8A) Formula (9A)

Formula (9BX)

Formula (10AX)

Formula (9BY)

Formula (10B)

Formula (10BX)

Formula (10BY)

Formula (11 A)

Formula (11AX)

Formula (11AY)

103

Formula (11 B) Formula (11BX) Formula (11BY)

Formula (12A) Formula (12AX) Formula (12AY)

Formula (12B) Formula (12BX) Formula (12BY)

In some embodiments, any of the siNA molécules disclosed herein comprise a 5’stabilized end cap selected from the group consisting of Formula (21) to Formula (35):

Formula (25)

Formula (26)

Formula (27)

104

Formula (31) Formula (32) Formula (33)

Formula (34)

Formula (35) , wherein R¹ is a nucleobase, aryl, heteroaryl, or

H. In some embodiments, R¹ is an aryl. In some embodiments, the aryl is a phenyl.

In some embodiments, any of the siNA molécules disclosed herein comprise a 5’stabilized end cap selected from the group consisting of Formulas (21A)-(35A), Formulas (29B)(32B), Formulas (29AX)-(32AX), Formulas (29AY)-(32AY), Formulas (29BX)-(32BX), and Formulas (29BY)-(32BY):

105

Formula (28A)

Formula (29A)

Formula (29AX)

Formula (29AY)

Formula (29B)

Formula (29BX)

Formula (29BY)

Formula (30A)

Formula (30AX)

Formula (30AY)

Formula (30B) Formula (30BX) Formula (30BY)

Formula (31A)

Formula (31AX)

Formula (31AY)

Formula (31BY)

106

Formula (32A) Formula (32AX) Formula (32AY)

Formula (32B)

Formula (32BX)

In some embodiments, the 5’-stabilized end cap is attached to the 5’ end of the antisense strand. In some embodiments, the 5’-stabilized end cap is attached to the 5’ end of the antisense strand via 1, 2, 3, 4, or 5 or more linkers. In some embodiments, the one or more linkers are independently selected from the group consisting of a phosphodiester (p or po) linker, phosphorothioate (ps) linker (ps), phosphoramidite (HEG) linker, triethylene glycol (TEG) linker, and/or phosphorodithioate linker. In some embodiments, the one or more linkers are independently selected from the group consisting of p-(PS)2, (PS)2-p-TEG-p, (PS)2-p-HEG-p, and (PS)2-p-(HEG-p)2.

Linker

In some embodiments, any of the siRNAs, sense strands, first nucléotide sequences, antisense strands, and/or second nucléotide sequences disclosed herein comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or more intemucleoside linkers. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more intemucleoside linkers are independently selected from the group consisting of a phosphodiester (p or po) linker, phosphorothioate (ps) linker, or phosphorodithioate linker.

In some embodiments, any of the siRNAs, sense strands, first nucléotide sequences, antisense strands, and/or second nucléotide sequences disclosed herein further comprise 1, 2, 3, 4 or more linkers that attach a conjugated moiety, phosphorylation blocker, and/or 5’ end cap to

107 the siRNA, sense strand, first nucléotide sequence, antisense strand, and/or second nucléotide sequences. In some embodiments, the 1, 2, 3, 4 or more linkers are independently selected from the group consisting of a phosphodiester (p or po) linker, phosphorothioate (ps) linker, phosphoramidite (HEG) linker, triethylene glycol (TEG) linker, and/or phosphorodithioate linker. In some embodiments, the one or more linkers are independently selected from the group consisting of p-(PS)2, (PS)2-p-TEG-p, (PS)2-p-HEG-p, and (PS)2-p-(HEG-p)2.

Target Gene

Without wishing to be bound by theory, upon entry into a cell, any of the ds-siNA molécules disclosed herein may interact with proteins in the cell to form a RNA-Induced Silencing Complex (RISC). Once the ds-siNA is part of the RISC, the ds-siNA may be unwound to form a single-stranded siNA (ss-siNA). The ss-siNA may comprise the antisense strand of the ds-siNA. The antisense strand may bind to a complementary messenger RNA (mRNA), which results in silencing of the gene that encodes the mRNA.

The target gene may be any gene in a cell. In some embodiments, the target gene is a viral gene. In some embodiments, the viral gene is from a DNA virus. In some embodiments, the DNA virus is a double-stranded DNA (dsDNA) virus. In some embodiments, the dsDNA virus is a hepadnavirus. In some embodiments, the hepadnavirus is a hepatitis B virus (HBV). In some embodiments, the HBV is selected from HBV génotypes A-J.

In some embodiments, the target gene is selected from the S gene or X gene of the HBV. In some embodiments, the HBV has a genome sequence shown in the nucléotide sequence of SEQ ID NO: 410, which corresponds to the nucléotide sequence of GenBank Accession No. U95551.1, which is incorporated by reference in its entirety.

An exemplary HBV genome sequence is shown in SEQ ID NO: 596, corresponding to Genbank Accession No. KC315400.1, which is incorporated by reference in its entirety. Nucléotides 2307..3215,1..1623 of SEQ ID NO: 596 correspond to the polymerase/RT gene sequence, which encodes for the polymerase protein. Nucléotides 2848..3215,1..835 of SEQ ID NO: 596 correspond to the PreSl/S2/S gene sequence, which encodes for the large S protein. Nucléotides 3205..3215,1..835 of SEQ ID NO: 596 correspond to the PreS2/S gene sequence, which encodes for the middle S protein. Nucléotides 155..835 of SEQ ID NO: 596 correspond to the S gene sequence, which encodes the small S protein. Nucléotides 1374..1838 of SEQ ID NO: 596 correspond to the X gene sequence, which encodes the X protein. Nucléotides 1814..2452 of SEQ ID NO: 596 correspond to the PreC/C gene sequence, which encodes the precore/core protein. Nucléotides 1901..2452 of SEQ ID NO: 596 correspond to the C gene sequence, which encodes the core protein. The HBV genome further comprises viral regulatory éléments, such as

108 viral promoters (preS2, preSl, Core, and X) and enhancer éléments (ENH1 and ENH2). Nucléotides 1624..1771 ofSEQ ID NO: 596 correspond to ENH2. Nucléotides 1742..1849 of SEQ ID NO: 596 correspond to the Core promoter. Nucléotides 1818...3215,1..1930 ofSEQ ID NO: 596 correspond to the pregenomic RNA (pgRNA), which encodes the core and polymerase pro teins.

In some embodiments, the ASO is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary or hybridizes to a viral target RNA sequence that begins in an X région of HBV or in an S région of HBV. The viral target may, e.g., begin at the 5'-end of targetsite in acc. KC315400.1 (génotype B, “gt B”), or in any one of génotypes A, C, or D. The skilled person would understand the HBV position, e.g., as described in Wing-Kin Sung, et al., Nature Genetics 44:765 (2012). In some embodiments, the S région is defmed as from the beginning of small S protein (in génotype B KC315400.1 isolate, position #155) to before beginning of X protein (in génotype B KC315400.1 isolate, position #1373). In some embodiments, the X région is defined as from the beginning X protein (in génotype B KC315400.1 isolate, position #1374) to end of DR2 site (in génotype B KC315400.1 isolate, position #1603).

In some embodiments, the second nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucléotides within positions 200-720 or 1100-1700 of SEQ ID NO: 410. In some embodiments, the second nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucléotides within positions 200-280, 300-445, 460-510, 650-720, 1170-1220, 1250-1300, or 1550-1630 of SEQ ID NO: 410. In some embodiments, the second nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucléotides within positions 200-230, 250-280, 300-330, 370-400, 405-445, 460-500, 670-700, 1180-1210, 1260-1295, 15201550, or 1570-1610 ofSEQ ID NO: 410. In some embodiments, the second nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucléotides starting at position 203, 206, 254, 305, 375, 409, 412, 415, 416, 419, 462, 466, 467, 674, 676, 1182, 1262, 1263, 1268, 1526, 1577, 1578, 1580, 1581, 1583, or 1584 ofSEQ ID NO: 410.

In some embodiments, the first nucléotide is at least about 60%, 65%, 70%, 75%, 80%, 85%>, 90%, 95%, or 100% identical to a nucléotide région within SEQ ID NO: 410, with the

109 exception that the thymines (Ts) in SEQ ID NO: 410 are replaced with uracil (U). In some embodiments, the first nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucléotides within positions 200-720 or 1100-1700 of SEQ ID NO: 410. In some embodiments, the first nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucléotides within positions 200-280, 300-445, 460-510, 650-720, 1170-1220, 1250-1300, or 1550-1630 of SEQ ID NO: 410. In some embodiments, the first nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucléotides within positions 200-230, 250-280, 300-330, 370400, 405-445,460-500, 670-700, 1180-1210, 1260-1295, 1520-1550, or 1570-1610 of SEQ ID NO: 410. In some embodiments, the first nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to 15 to 30, 15 to 25, 15 to 23, 15 to 22, 15 to 21, 17 to 25, 17 to 23, 17 to 22, 17 to 21, or 19 to 21 nucléotides starting at position 203, 206, 254, 305, 375, 409, 412, 415, 416, 419, 462, 466, 467, 674, 676, 1182, 1262, 1263, 1268, 1526, 1577, 1578, 1580, 1581, 1583, or 1584 ofSEQ IDNO:410.

In some embodiments, the target gene is involved in liver metabolism. In some embodiments, the target gene is an inhibitor of the électron transport chain. In some embodiments, the target gene encodes the MC J protein (MCJ/DnaJC15 or MethylationControlled J protein). In some embodiments, the MC J protein is encoded by the mRNA sequence of SEQ ID NO: 411, which corresponds to the nucléotide sequence of GenBank Accession No. NM 013238.3, which is incorporated by reference in its entirety.

In some embodiments, the target gene is TAZ. In some embodiments, TAZ comprises the nucléotide sequence of SEQ ID NO: 412, which corresponds to the nucléotide sequence of GenBank Accession No. NM 000116.5, which is incorporated by reference in its entirety.

In some embodiments, the target gene is angiopoietin like 3 (ANGPTL3). In some embodiments, ANGPTL3 comprises the nucléotide sequence ofSEQ ID NO: 413, which corresponds to the nucléotide sequence of GenBank Accession No. NM_014495.4, which is incorporated by reference in its entirety.

In some embodiments, the target gene is diacylglycérol acyltransferase 2 (DGAT2). In some embodiments, DGAT2 comprises the nucléotide sequence ofSEQ ID NO: 414, which corresponds to the nucléotide sequence of GenBank Accession No. NM_001253891.1, which is incorporated by reference in its entirety.

110

Compositions

As indicated above, the présent disclosure provides compositions comprising any of the siNA molécules, sense strands, antisense strands, first nucléotide sequences, or second nucléotide sequences described herein. The compositions may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more siNA molécules described herein. The compositions may comprise a first nucléotide sequence comprising a nucléotide sequence of any one SEQ ID NOs: 1-56, 103-158, and 205-260. In some embodiments, the composition comprises a second nucléotide sequence comprising a nucléotide sequence of any one of SEQ ID NOs: 57-102, 159-204, and 261-306. In some embodiments, the composition comprises a sense strand comprising a nucléotide sequence of any one of SEQ ID NOs: 307-362 and 415-444. In some embodiments, the composition comprises an antisense strand comprising a nucléotide sequence of any one of SEQ ID NOs: 363-409, 445-533, and 536-539.

Altematively, the compositions may comprise (a) a phosphorylation blocker; and (b) a short interfering nucleic acid (siNA). In some embodiments, the phosphorylation blocker is any of the phosphorylation blockers disclosed herein. In some embodiments, the siNA is any of the siNAs disclosed herein. In some embodiments, the siNA comprises any of the sense strands, antisense strands, first nucléotide sequences, or second nucléotide sequences described herein. In some embodiments, the siNA comprises any of the sense strands, antisense strands, first nucléotide sequences, or second nucléotide sequences described herein. In some embodiments, the siNA comprises one or more modified nucléotides. In some embodiments, the one or more modified nucléotides are independently selected from a 2’-fluoro nucléotide and a 2’-(9-methyl nucléotide. In some embodiments, the 2’-fluoro nucléotide or the 2’-(9-methyl nucléotide is independently selected from any of the 2’-fluoro or 2’-O-methyl nucléotide mimics disclosed herein. In some embodiments, the siNA comprises a nucléotide sequence comprising any of the modification patterns disclosed herein.

In some embodiments, the composition comprises (a) a conjugated moiety; and (b) a short interfering nucleic acid (siNA). In some embodiments, the conjugated moiety is any of the galactosamines disclosed herein. In some embodiments, the siNA is any of the siNAs disclosed herein. In some embodiments, the siNA comprises any of the sense strands, antisense strands, first nucléotide sequences, or second nucléotide sequences described herein. In some embodiments, the siNA comprises any of the sense strands, antisense strands, first nucléotide sequences, or second nucléotide sequences described herein. In some embodiments, the siNA comprises one or more modified nucléotides. In some embodiments, the one or more modified nucléotides are independently selected from a 2’-fluoro nucléotide and a 2’-O-methyl nucléotide.

111

In some embodiments, the 2’-fluoro nucléotide or the 2’-O-methyl nucléotide is independently selected from any of the 2’-fluoro or 2’-(9-methyl nucléotide mimics disclosed herein. In some embodiments, the siNA comprises a nucléotide sequence comprising any of the modification patterns disclosed herein.

In some embodiments, the composition comprises (a) a 5’-stabilized end cap; and (b) a short interfering nucleic acid (siNA). In some embodiments, the 5’-stabilized end cap is any of the 5-stabilized end caps disclosed herein. In some embodiments, the siNA is any of the siNAs disclosed herein. In some embodiments, the siNA comprises any of the sense strands, antisense strands, first nucléotide sequences, or second nucléotide sequences described herein. In some embodiments, the siNA comprises one or more modified nucléotides. In some embodiments, the one or more modified nucléotides are independently selected from a 2’-fluoro nucléotide and a 2’-O-methyl nucléotide. In some embodiments, the 2’-fluoro nucléotide or the 2’-(9-methyl nucléotide is independently selected from any of the 2’-fluoro or 2’-O-methyl nucléotide mimics disclosed herein. In some embodiments, the siNA comprises a nucléotide sequence comprising any of the modification patterns disclosed herein.

In some embodiments, the composition comprises (a) at least one phosphorylation blocker, conjugated moiety, or 5’-stabilized end cap; and (b) a short interfering nucleic acid (siNA). In some embodiments, the phosphorylation blocker is any of the phosphorylation blockers disclosed herein. In some embodiments, the conjugated moiety is any of the galactosamines disclosed herein. In some embodiments, the 5’-stabilized end cap is any of the 5stabilized end caps disclosed herein. In some embodiments, the siNA is any of the siNAs disclosed herein. In some embodiments, the siNA comprises any of the sense strands, antisense strands, first nucléotide sequences, or second nucléotide sequences described herein. In some embodiments, the siNA comprises one or more modified nucléotides. In some embodiments, the one or more modified nucléotides are independently selected from a 2’-fluoro nucléotide and a 2’-(9-methyl nucléotide. In some embodiments, the 2’-fluoro nucléotide or the 2’-O-methyl nucléotide is independently selected from any of the 2’-fluoro or 2’-(9-methyl nucléotide mimics disclosed herein. In some embodiments, the siNA comprises a nucléotide sequence comprising any of the modification patterns disclosed herein.

The composition may be a pharmaceutical composition. In some embodiments, the pharmaceutical composition comprises an amount of one or more of the siNA molécules described herein formulated with one or more pharmaceutically acceptable carriers (additives) and/or diluents. The pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral

112 administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; (2) parentéral administration, for example, by subcutaneous, intramuscular, intravenous or épidural injection as, for example, a stérile solution or suspension, or sustained-release formulation; (3) topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; (5) sublingually; (6) ocularly; (7) transdermally; or (8) nasally.

The phrase “therapeutically-effective amount” as used herein means that amount of a compound, material, or composition comprising a siNA of the présent disclosure which is effective for producing some desired therapeutic effect in at least a sub-population of cells in an animal at a reasonable benefit/risk ratio applicable to any medical treatment.

The phrase “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animais without excessive toxicity, irritation, allergie response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

Wetting agents, emulsifïers and lubricants, such as sodium lauryl sulfate and magnésium stéarate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be présent in the compositions.

Examples of pharmaceutically-acceptable antioxidants include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) métal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

Formulations of the présent disclosure include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal and/or parentéral administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingrédient which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration. The amount of active ingrédient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound (e.g., siNA molécule) which produces a therapeutic effect. Generally,

113 out of one hundred percent, this amount will range from about 0.1 percent to about ninety-nine percent of active ingrédient, preferably from about 5 percent to about 70 percent, most preferably from about 10 percent to about 30 percent.

In certain embodiments, a formulation of the présent disclosure. comprises an excipient selected from the group consisting of cyclodextrins, celluloses, liposomes, micelle forming agents, e.g., bile acids, and polymeric carriers, e.g., polyesters and polyanhydrides; and a compound (e.g., siNA molécule) of the présent disclosure. In certain embodiments, an aforementioned formulation renders orally bioavailable a compound (e.g., siNA molécule) of the présent disclosure.

Methods of preparing these formulations or compositions include the step of bringing into association a compound (e.g., siNA molécule) of the présent disclosure with the carrier and, optionally, one or more accessory ingrédients. In general, the formulations are prepared by uniformly and intimately bringing into association a compound (e.g., siNA molécule) of the présent disclosure with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.

Formulations of the disclosure suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid émulsion, or as an élixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and/or as mouth washes and the like, each containing a predetermined amount of a compound (e.g, siNA molécule) of the présent disclosure as an active ingrédient. A compound (e.g, siNA molécule) of the présent disclosure may also be administered as a bolus, electuary or paste.

In solid dosage forms of the disclosure for oral administration (capsules, tablets, pills, dragees, powders, granules, tronches and the like), the active ingrédient is mixed with one or more pharmaceutically-acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffm; (6) absorption accelerators, such as quatemary ammonium compounds and surfactants, such as poloxamer and sodium lauryl sulfate; (7) wetting agents, such as, for example, cetyl alcohol, glycerol monostearate, and non-ionic surfactants; (8) absorbents, such as kaolin and bentonite

114 clay; (9) lubricants, such as talc, calcium stéarate, magnésium stéarate, solid polyethylene glycols, sodium lauryl sulfate, zinc stéarate, sodium stéarate, stearic acid, and mixtures thereof; (10) coloring agents; and (11) controlled release agents such as crospovidone or ethyl cellulose.

In the case of capsules, tablets and pills, the pharmaceutical compositions may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-shelled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.

A tablet may be made by compression or molding, optionally with one or more accessory ingrédients. Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.

The tablets, and other solid dosage forms of the pharmaceutical compositions of the présent disclosure, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingrédient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile, other polymer matrices, liposomes and/or microspheres. They may be formulated for rapid release, e.g., fireeze-dried.

They may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of stérile solid compositions which can be dissolved in stérile water, or some other stérile injectable medium immediately before use. These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes. The active ingrédient can also be in micro-encapsulated form, if appropriate, with one or more of the above-described excipients.

Liquid dosage forms for oral administration of the compounds (e.g., siNA molécules) of the disclosure include pharmaceutically acceptable émulsions, microemulsions, solutions, suspensions, syrups and élixirs. In addition to the active ingrédient, the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (I

115 particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.

Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.

Suspensions, in addition to the active compounds (e.g., siNA molécules), may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, micro crystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.

Formulations of the pharmaceutical compositions of the disclosure for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing one or more compounds (e.g., siNA molécules) of the disclosure with one or more suitable nonirritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, and which is solid at room température, but liquid at body température and, therefore, will melt in the rectum or vaginal cavity and release the active compound (e.g., siNA molécule).

Formulations of the présent disclosure which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate.

Dosage forms for the topical or transdermal administration of a compound (e.g., siNA molécule) of this disclosure include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active compound (e.g., siNA molécule) may be mixed under stérile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required.

The ointments, pastes, creams and gels may contain, in addition to an active compound (e.g., siNA molécule) of this disclosure, excipients, such as animal and vegetable fats, oils, waxes, paraffms, starch, tragacanth, cellulose dérivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.

Powders and sprays can contain, in addition to a compound (e.g., siNA molécule) of this disclosure, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.

116

Transdermal patches hâve the added advantage of providing controlled delivery of a compound (e.g., siNA molécule) of the présent disclosure to the body. Such dosage forms can be made by dissolving or dispersing the compound (e.g., siNA molécule) in the proper medium. Absorption enhancers can also be used to increase the flux of the compound (e.g., siNA molécule) across the skin. The rate of such flux can be controlled by either providing a rate controlling membrane or dispersing the compound (e.g., siNA molécule) in a polymer matrix or gel.

Ophthalmic formulations, eye ointments, powders, solutions and the like, are also contemplated as being within the scope of this invention.

Pharmaceutical compositions of this disclosure suitable for parentéral administration comprise one or more compounds (e.g., siNA molécules) of the disclosure in combination with one or more pharmaceutically-acceptable stérile isotonie aqueous or nonaqueous solutions, dispersions, suspensions or émulsions, or stérile powders which may be reconstituted into stérile injectable solutions or dispersions just prior to use, which may contain sugars, alcohols, antioxidants, buffers, bacteriostats, solutés which render the formulation isotonie with the blood of the intended récipient or suspending or thickening agents.

Examples of suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions of the disclosure include water, éthanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prévention of the action of microorganisms upon the subject compounds may be ensured by the inclusion of varions antibacterial and antifungal agents, for example, paraben, chlorobutanol, phénol sorbic acid, and the like. It may also be désirable to include isotonie agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.

In some cases, in order to prolong the effect of a drug, it is désirable to slow the absorption of the drug from subeutaneous or intramuscular injection. This may be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of absorption of the drug then dépends upon its rate of dissolution which, in

117 tum, may dépend upon crystal size and crystalline form. Altematively, delayed absorption of a parenterally-administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle.

Injectable depot forms are made by forming microencapsule matrices of the subject compounds (e.g., siNA molécules) in biodégradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer, and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodégradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissue.

When the compounds (e.g., siNA molécules) of the présent disclosure are administered as pharmaceuticals, to humans and animais, they can be given per se or as a pharmaceutical composition containing, for example, 0.1 to 99% (more preferably, 10 to 30%) of active ingrédient in combination with a pharmaceutically acceptable carrier.

Methods of Treatment and Administration

The siNA molécules of the présent disclosure may be used to treat a disease in a subject in need thereof. In some embodiments, a method of treating a disease in a subject in need thereof comprises administering to the subject any of the siNA molécules disclosed herein. In some embodiments, a method of treating a disease in a subject in need thereof comprises administering to the subject any of the compositions disclosed herein.

The préparations (e.g, siNA molécules or compositions) of the présent disclosure may be given orally, parenterally, topically, or rectally. They are of course given in forms suitable for each administration route. For example, they are administered in tablets or capsule form, administration by injection, infùsion or inhalation; topical by lotion or ointment; and rectal by suppositories. Oral administrations are preferred.

The phrases “parentéral administration” and “administered parenterally” as used herein means modes of administration other than enterai and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrastemal injection and infusion.

The phrases “systemic administration,” “administered systemically,” “peripheral administration” and “administered peripherally” as used herein mean the administration of a compound, drug or other material other than directly into the central nervous System, such that it

118 enters the patient’s System and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration.

These compounds may be administered to humans and other animais for therapy by any suitable route of administration, including orally, nasally, as by, for example, a spray, rectally, intravaginally, parenterally, intracistemally and topically, as by powders, ointments or drops, including buccally and sublingually.

Regardless of the route of administration selected, the compounds (e.g., siNA molécules) of the présent disclosure, which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the présent disclosure, are formulated into pharmaceuticallyacceptable dosage forms by conventional methods known to those of skill in the art.

Actual dosage levels of the active ingrédients in the pharmaceutical compositions of this disclosure may be varied so as to obtain an amount of the active ingrédient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.

The selected dosage level will dépend upon a variety of factors including the activity of the particular compound (e.g., siNA molécule) of the présent disclosure employed, or the ester, sait or amide thereof, the route of administration, the time of administration, the rate of excrétion or metabolism of the particular compound being employed, the rate and extent of absorption, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compound employed, the âge, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.

A physician or veterinarian having ordinary skill in the art can readily détermine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds (e.g., siNA molécules) of the disclosure employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.

In general, a suitable daily dose of a compound (e.g., siNA molécule) of the disclosure is the amount of the compound that is the lowest dose effective to produce a therapeutic effect. Such an effective dose generally dépends upon the factors described above. Preferably, the compounds are administered at about 0.01 mg/kg to about 200 mg/kg, more preferably at about 0.1 mg/kg to about 100 mg/kg, even more preferably at about 0.5 mg/kg to about 50 mg/kg. In some embodiments, the compound is administered at a dose equal to or greater than 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19,

119

0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.35, 0.40, 0.45, 0.50, 0.55, 0.60, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, or 1 mg/kg. In some embodiments, the compound is administered at a dose equal to or less than 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, or 15 mg/kg. In some embodiments, the total daily dose of the compound is equal to or greater than 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, or 100 mg.

When the compounds (e.g., siNA molécules) described herein are co-administered with another, the effective amount may be less than when the compound is used alone.

If desired, the effective daily dose of the active compound (e.g., siNA molécule) may be administered as two, three, four, five, six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms. Preferred dosing is one administration per day. In some embodiments, the compound is administered at least 1, 2, 3, 4, 5,6, 7, 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 times a week. In some embodiments, the compound is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 times a month. In some embodiments, the compound is administered onceevery 1,2, 3,4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days. In some embodiments, the compound is administered once every 1, 2, 3, 4, 5, 6, 7, or 8 weeks.

Diseases

The siNA molécules and compositions described herein may be administered to a subject to treat a disease. Further disclosed herein are uses of any of the siNA molécules or compositions disclosed herein in the manufacture of a médicament for treating a disease.

In some embodiments, the disease is a viral disease. In some embodiments, the viral disease is caused by a DNA virus. In some embodiments, the DNA virus is a double stranded DNA (dsDNA virus). In some embodiments, the dsDNA virus is a hepadnavirus. In some embodiments, the hepadnavirus is a hepatitis B virus (HBV).

In some embodiments, the disease is a liver disease. In some embodiments, the liver disease is nonalcoholic fatty liver disease (NAFLD). In some embodiments, the NAFLD is nonalcoholic steatohepatitis (NASH). In some embodiments, the liver disease is hepatocellular carcinoma (HCC).

Administration of siNA

Administration of any of the siNAs disclosed herein may be conducted by methods known in the art. In some embodiments, the siNA is administered by subcutaneous (SC) or intravenous (IV) delivery. The préparations (e.g., siNAs or compositions) of the présent

120 disclosure may be given orally, parenterally, topically, or rectally. They are of course given in forms suitable for each administration route. For example, they are administered in tablets or capsule form, administration by injection, infusion or inhalation; topical by lotion or ointment; and rectal by suppositories. In some embodiments, subcutaneous administration is preferred.

The phrases “systemic administration,” “administered systemically,” “peripheral administration” and “administered peripherally” as used herein mean the administration of a compound, drug or other material other than directly into the central nervous System, such that it enters the patient’s System and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration.

Regardless of the route of administration selected, the compounds (e.g., siNAs) of the présent disclosure, which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the présent disclosure, are formulated into pharmaceutically-acceptable dosage forms by conventional methods known to those of skill in the art.

The selected dosage level will dépend upon a variety of factors including the activity of the particular compound (e.g., siNA) of the présent disclosure employed, or the ester, sait or amide thereof, the route of administration, the time of administration, the rate of excrétion or metabolism of the particular compound being employed, the rate and extent of absorption, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compound employed, the âge, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.

121

A physician or veterinarian having ordinary skill in the art can readily détermine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds (e.g., siNAs) of the disclosure employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.

In general, a suitable daily dose of a compound (e.g., siNA) of the disclosure is the amount of the compound that is the lowest dose effective to produce a therapeutic effect. Such an effective dose generally dépends upon the factors described above. Preferably, the compounds are administered at about Ô.01 mg/kg to about 200 mg/kg, more preferably at about 0.1 mg/kg to about 100 mg/kg, even more preferably at about 0.5 mg/kg to about 50 mg/kg. In some embodiments, the compound is administered at about 1 mg/kg to about 40 mg/kg, about 1 mg/kg to about 30 mg/kg, about 1 mg/kg to about 20 mg/kg, about 1 mg/kg to about 15 mg/kg, or 1 mg/kg to about 10 mg/kg. In some embodiments, the compound is administered at a dose equal to or greater than 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.35, 0.40, 0.45, 0.50, 0.55, 0.60, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, or 1 mg/kg. In some embodiments, the compound is administered at a dose equal to or greater than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,21,22, 23,24, 25, 26, 27, 28,29, or 30 mg/kg. In some embodiments, the compound is administered at a dose equal to or less than 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, or 15 mg/kg. In some embodiments, the total daily dose of the compound is equal to or greater than 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, or 100 mg.

If desired, the effective daily dose of the active compound (e.g., siNA) may be administered as two, three, four, five, six, seven, eight, nine, ten or more doses or sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms. In some embodiments, the compound is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 times. Preferred dosing is one administration per day. In some embodiments, the compound is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 times a week. In some embodiments, the compound is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 times amonth. In some embodiments, the compound is administered once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days. In some embodiments, the compound is administered

122 every 3 days. In some embodiments, the compound is administered once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks. In some embodiments, the compound is administered every month. In some embodiments, the compound is administered once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 months. In some embodiments, the compound is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, or 53 times overaperiod ofat least 1,2, 3,4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,

48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 days. In some embodiments, the compound is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,

40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, or 53 times over aperiod of at least 1, 2, 3, 4, 5,

6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, or 53 weeks. In some embodiments, the compound is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, or 53 times over aperiod of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, or 53 months. In some embodiments, the compound is administered at least once a week for a period of at least 1, 2, 3, 4,5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,21,22, 23,24, 25,26, 27,28,29,30,31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 weeks. In some embodiments, the compound is administered at least once a week for a period of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,

40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65,

66, 67, 68, 69, or 70 months. In some embodiments, the compound is administered at least twice a week for aperiod of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,

22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,

48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 weeks.

In some embodiments, the compound is administered at least twice a week for a period of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 months. In some embodiments, the

123 compound is administered at least once every two weeks for a period of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,21,22, 23,24, 25, 26, 27,28,29,30,31,32,33,34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 weeks. In some embodiments, the compound is administered at least once every two weeks for a period of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 months. In some embodiments, the compound is administered at least once every four weeks for a period of at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,

45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or weeks. In some embodiments, the compound is administered at least once every four weeks for a period ofatleast4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,21,22, 23,24, 25,

26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51,

52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 months.

In some embodiments, any one of the siNAs or compositions disclosed herein is administered in a particle or viral vector. In some embodiments, the viral vector is a vector of adenovirus, adeno-associated virus (AAV), alphavirus, flavivirus, herpes simplex virus, lentivirus, measles virus, picomavirus, poxvirus, rétro virus, or rhabdo virus. In some embodiments, the viral vector is a recombinant viral vector. In some embodiments, the viral vector is selected from AAVrh.74, AAVrh.10, AAVrh.20, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12 and AAV-13.

The subject of the described methods may be a mammal, and it includes humans and non-human mammals. In some embodiments, the subject is a human, such as an adult human.

Some embodiments include a method for treating an HBV virus in a subject infected with the virus comprising administering a therapeutically effective amount of one or more siNA of the présent disclosure or a composition of the présent disclosure to the subject in need thereof thereby reducing the viral load of the virus in the subject and/or reducing a level of a virus antigen in the subject. The siNA may be complementary or hybridize to a portion of the target RNA in the virus, e.g., an X région and/or an S région of HBV.

Combination Thérapies

Any of the methods disclosed herein may further comprise administering to the subject an additional HBV treatment agent. Any of the compositions disclosed herein may further comprise an additional HBV treatment agent. In some embodiments, the additional HBV

124 treatment agent is selected from a nucléotide analog, nucleoside analog, a capsid assembly modulator (CAM), a recombinant interferon, an entry inhibitor, a small molécule immunomodulator and oligonucleotide therapy. In some embodiments, the additional HBV treatment agent is selected from HBV STOPS™ ALG-010133, HBV CAM ALG-000184, ASO 1, recombinant interferon alpha 2b, IFN-a, PEG-IFN-a-2a, lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide, tenofovir disoproxil, NVR3-778, BAY414109, JNJ-632, JNJ-3989 (ARO-HBV), RG6004, GSK3228836, REP-2139, REP-2165, AB-729, VIR-2218, RG6346 (DCR-HBVS), JNJ-6379, GLS4, ABI-HO731, JNJ-440, NZ-4, RG7907, EDP-514, AB-423, AB-506, ABI-H03733 and ABI-H2158. In some embodiments, the oligonucleotide therapy is selected from Nucleic Acid Polymers or S-Antigen Transportinhibiting Oligonucleotide Polymers (NAPs or STOPS), siRNA, and ASO. In some embodiments, the oligonucleotide therapy is an additional siNA. In some embodiments, the additional siNA is selected from any of ds-siNA-001 to ds-siNA-0178. In some embodiments, the oligonucleotide therapy is an antisense oligonucleotide (ASO). In some embodiments, the ASO is ASO 1. In some embodiments, any of the siNAs disclosed herein are co-administered with STOPS. Exemplary STOPS are described in International Publication No. W02020/097342 and U.S. Publication No. 2020/0147124, both of which are incorporated by reference in their entirety. In some embodiments, the STOPS is ALG-010133. In some embodiments, any of the siNAs disclosed herein are co-administered with tenofovir. In some embodiments, any of the siNAs disclosed herein are co-administered with a CAM. Exemplary CAMs are described in Berke et al., Antimicrob Agents Chemother, 2017, 61(8):e00560-17, Klumpp, et al., Gastroenterology, 2018, 154(3):652-662.e8, International Application Nos.

PCT/US2020/017974, PCT/US2020/026116, and PCT/US2020/028349 and U.S. Application Nos. 16/789,298, 16/837,515, and 16/849,851, each which is incorporated by reference in its entirety. In some embodiments, the CAM is ALG-000184, ALG-001075, ALG-001024, JNJ632, BAY41-4109, or NVR3-778. In some embodiments, the siNA and the HBV treatment agent are administered simultaneously. In some embodiments, the siNA and the HBV treatment agent are administered concurrently. In some embodiments, the siNA and the HBV treatment agent are administered sequentially. In some embodiments, the siNA is administered prior to administering the HBV treatment agent. In some embodiments, the siNA is administered after administering the HBV treatment agent. In some embodiments, the siNA and the HBV treatment agent are in separate containers. In some embodiments, the siNA and the HBV treatment agent are in the same container.

125

Any of the methods disclosed herein may further comprise administering to the subject a liver disease treatment agent. Any of the compositions disclosed herein may further comprise a liver disease treatment agent. In some embodiments, the liver disease treatment agent is selected from a peroxisome proliferator-activator receptor (PPAR) agonist, famesoid X receptor (FXR) agonist, lipid-altering agent, and incretin-based therapy. In some embodiments, the PPAR agonist is selected from a PPARa agonist, dual PPARa/δ agonist, PPARy agonist, and dual PPARa/γ agonist. In some embodiments, the dual PPARa agonist is a fïbrate. In some embodiments, the PPARa/δ agonist is elafibranor. In some embodiments, the PPARy agonist is a thiazolidinedione (TZD). In some embodiments, TZD is pioglitazone. In some embodiments, the dual PPARa/γ agonist is saroglitazar. In some embodiments, the FXR agonist is obeticholic acis (OCA). In some embodiments, the lipid-altering agent is aramchol. In some embodiments, the incretin-based therapy is a glucagon-like peptide 1 (GLP-1) receptor agonist or dipeptidyl peptidase 4 (DPP-4) inhibitor. In some embodiments, the GLP-1 receptor agonist is exenatide or liraglutide. In some embodiments, the DPP-4 inhibitor is sitagliptin or vildapliptin. In some embodiments, the siNA and the liver disease treatment agent are administered concurrently. In some embodiments, the siNA and the liver disease treatment agent are administered sequentially. In some embodiments, the siNA is administered prior to administering the liver disease treatment agent. In some embodiments, the siNA is administered after administering the liver disease treatment agent. In some embodiments, the siNA and the liver disease treatment agent are in separate containers. In some embodiments, the siNA and the liver disease treatment agent are in the same container.

Définitions

Unless defmed otherwise, ail technical and scientific terms used herein hâve the meaning commonly understood by a person skilled in the art to which this disclosure belongs. The following references provide one of skill with a general définition of many of the terms used in this invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al., (eds.), Springer Verlag (1991); and Haie & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms hâve the meanings ascribed to them below, unless specified otherwise. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the disclosure.

The terms “a” and “an” as used herein mean “one or more” and include the plural unless the context is inappropriate.

126

As used herein, the ternis “patient” and “subject” refer to organisms to be treated by the methods of the présent disclosure. Such organisms are preferably mammals (e.g., marines, simians, equines, bovines, porcinis, canines, felines, and the like), and more preferably humans.

As used herein, the terni “effective amount” refers to the amount of a compound (e.g., a siNA of the présent disclosure) sufficient to effect bénéficiai or desired results. An effective amount can be administered in one or more administrations, applications, or dosages and is not intended to be limited to a particular formulation or administration route.

As used herein, the term “treating” includes any effect, e.g., lessening, reducing, modulating, ameliorating or eliminating, that results in the improvement of the condition, disease, disorder, and the like, or ameliorating a symptom thereof.

As used herein, the ternis “alleviate” and “alleviating” refer to reducing the severity of the condition, such as reducing the severity by, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%.

As used herein, the term “pharmaceutical composition” refers to the combination of an active agent with a carrier, inert or active, making the composition especially suitable for diagnostic or therapeutic use in vivo or ex vivo.

As used herein, the term “pharmaceutically acceptable carrier” refers to any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, émulsions (e.g., such as an oil/water or water/oil émulsions), and various types of wetting agents. The compositions also can include stabilizers and preservatives. For examples of carriers, stabilizers and adjuvants, see, for example, Martin, Remington's Pharmaceutical Sciences, 15th Ed., Mack Publ. Co., Easton, PA [1975],

The term “about” as used herein when referring to a measurable value (e.g., weight, time, and dose) is meant to encompass variations, such as ±10%, ±5% , ±1% , or ±0.1% of the specified value.

As used herein, the term “nucleobase” refers to a nitrogen-containing biological compound that forms a nucleoside. Examples of nucleobases include, but are not limited to, thymine, uracil, adenine, cytosine, guanine, aryl, heteroaryl, and an analogue or dérivative thereof.

Throughout the description, where compositions are described as having, including, or comprising spécifie components, or where processes and methods are described as having, including, or comprising spécifie steps, it is contemplated that, additionally, there are compositions of the présent disclosure that consist essentially of, or consist of, the recited

127 components, and that there are processes and methods according to the présent disclosure that consist essentially of, or consist of, the recited processing steps.

As a general matter, compositions specifying a percentage are by weight unless otherwise specified. Further, if a variable is not accompanied by a définition, then the previous définition of the variable Controls.

Ail publications and patents cited in this spécification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the présent invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates that may need to be independently confirmed.

EXAMPLES

Example 1. siNA Synthesis

This example describes an exemplary method for synthesizing ds-siNAs, such as the siNAs disclosed in Table 6 (as identified by the ds-siNA ID).

The 2’-OMe phosphoramidite 5’-O-DMT-deoxy Adenosine (NH-Bz), 3’-O-(2cyanoethyl-N,N-diisopropyl phosphoramidite, 5’-O-DMT-deoxy Guanosine (NH-ibu), 3’-O-(2cyanoethyl-N,N-diisopropyl phosphoramidite, 5’-O-DMT-deoxy Cytosine (NH-Bz), 3’-O-(2cyanoethyl-N,N-diisopropyl phosphoramidite, 5’-O-DMT-Uridine 3’-O-(2-cyanoethyl-N,Ndiisopropyl phosphoramidite and solid supports were purchased from Chemgenes Corp. MA.

NC NC

The 2’-F -5’-O-DMT-(NH-Bz) Adenosine-3’-O-(2-cyanoethyl-N,N-diisopropyl phosphoramidite, 2’-F -5’-O-DMT-(NH-ibu)- Guanosine, 3’-O-(2-cyanoethyl-N,N-diisopropyl

128 phosphoramidite, 5’-0-DMT-(NH-Bz)- Cytosine, 2’-F-3’-O-(2-cyanoethyl-N,N-diisopropyl phosphoramidite, 5’-0-DMT-Uridine, 2’-F-3’-O-(2-cyanoethyl-N,N-diisopropyl phosphoramidite and solid supports were purchased from Thermo Fischer Milwaukee WI, USA.

Ail the monomers were dried in vacuum desiccator with desiccants (P2O5, RT 24h). The solid supports (CPG) attached to the nucleosides and universal supports was obtained from LGC and Chemgenes. The Chemicals and solvents for post synthesis workflow were purchased from commercially available sources like VWR/Sigma and used without any purification or treatment. Solvent (Acetonitrile) and solutions (amidite and activator) were stored over molecular sieves during synthesis.

The oligonucleotides were synthesized on a DNA/RNA Synthesizers (Expedite 8909 or AB1-394) using standard oligonucleotide phosphoramidite chemistry starting from the 3' residue of the oligonucleotide preloaded on CPG support. An extended coupling of 0.1M solution of phosphoramidite in CH3CN in the presence of 5-(ethylthio)-177-tetrazole activator to a solid bound oligonucleotide followed by standard capping, oxidation and deprotection afforded modified oligonucleotides. The 0.1M I2, THF:Pyridine;Water-7:2:l was used as oxidizing agent while DDTT ((dimethylamino-methylidene) amino)-3H-l,2,4-dithiazaoline-3-thione was used as the sulfùr-transfer agent for the synthesis of oligoribonucleotide phosphorothioates. The stepwise coupling effïciency of ail modified phosphoramidites was more than 98%.

Reagents Detailed Description

Deblock Solution 3% Dichloroacetic acid (DCA) in Dichloromethane (DCM)

Amidite Concentration 0.1 M in Anhydrous Acetonitrile

Activator

0.25 M Ethyl-thio-Tetrazole (ETT)

129

Cap-A solution

Cap-B Solution

Oxidizing Solution

Sulfurizing Solution

Acetic anhydride in Pyridine/THF 16% 1-Methylimidazole in THF 0.02M I₂, THF: Pyridine; Water-7:2:1

0.2 M DDTT in Pyridine/Acetonitrile 1:1

Cleavage and Deprotection:

Deprotection and cleavage from the solid support was achieved with mixture of ammonia methylamine (1:1, AMA) for 15 min at 65 °C, when the universal linker was used, the deprotection was left for 90 min at 65 °C or solid supports were heated with aqueous ammonia (28%) solution at 55 °C for 16 h to deprotect the base labile protecting groups.

Quantitation of Crude SiNA or Raw Analysis

Samples were dissolved in deionized water (l.OmL) and quantitated as follows: Blanking was first performed with water alone (2 ul) on Nanodrop then Oligo sample reading obtained at 260 nm. The crude material is dried down and stored at -20°C.

Crude HPLC/LC-MS analysis

The 0.1 OD of the crude samples were analyzed for crude HPLC and LC-MS analysis. After Confirming the crude LC-MS data then purification step was performed.

HPLC Purification

The unconjugated and GalNac modified oligonucleotides were purified by anionexchange HPLC. The buffers were 20 mM sodium phosphate in 10 % CH3CN, pH 8.5 (buffer A) and 20 mM sodium phosphate in 10% CH3CN, 1.0 M NaBr, pH 8.5 (buffer B). Fractions containing fiill-length oligonucleotides were pooled.

Desalting of Purified SiNA

The purified dry siNA was then desalted using Sephadex G-25 M (Amersham Biosciences). The cartridge was conditioned with 10 mL of deionized water thrice. Finally, the purified siNA dissolved thoroughly in 2.5mL RNAse free water was applied to the cartridge with very slow drop wise elution. The sait free siNA was eluted with 3.5 ml deionized water directly into a screw cap vial.

IEX HPLC and Electrospray LC/MS Analysis

Approximately 0.10 OD of siNA is dissolved in water and then pipetted in spécial vials for IEX-HPLC and LC/MS analysis. Analytical HPLC and ES LC-MS established the integrity of the compounds.

Duplex Préparation:

130

Single strand oligonucleotides (Sense and Antisense strands) were annealed (1:1 by molar équivalents, heat 90°C for 3 min followed by room température, 20 min) to give the duplex ds-siNA. The final compounds were analyzed on size exclusion chromatography (SEC).

Example 2. ds-siNA Activity

This example investigates the activity of the ds-siNAs synthesized in Example 1.

Homo sapiens HepG2.2.15 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) (ATCC 30-2002) supplemented to also contain 10% fêtai calf sérum (FCS). Cells were incubated at 37°C in an atmosphère with 5% CO2 in a humidified incubator. For transfection of HepG2.2.15 cells with HBV targeting siRNAs, cells were seeded at a density of 15000 cells/well in 96-well regular tissue culture plates. Transfection of cells was carried out using RNAiMAX (Invitrogen/Life Technologies) according to the manufacturer’s instructions. Dose-response experiments were done with oligo concentrations of 40, 20, 10, 5, 2.5, 1.25, 0.625, 0.3125, 0.15625 and 0.07813nM. For each HBV targeting siRNA treatment (e.g., ds-siRNA, as identified by the ds-siNA ID in Table 6), four wells were transfected in parallel, and individual data points were collected from each well. After 24h of incubation with siRNA, media was removed, and cells were lysed and analyzed with a QuantiGene2.0 branched DNA (bDNA) probe set spécifie for HBV génotype D (also called Hepatitis B virus subtype ayw, complété genome of 3182 basepairs) as présent in cell line HepG2.2.15.

For each well, the HBV on-target mRNA levels were normalized to the GAPDH mRNA level. As shown in Table 6, the activity of the HBV targeting ds-siRNAs was expressed as EC50, 50% réduction of normalized HBV RNA level from no drug control. As shown in Table 6, the cytotoxicity of the HBV targeting ds-siRNAs was expressed by CC50 of 50% réduction of GAPDH mRNA from no drug control.

Example 3. Use of ds-siNAs to treat hepatitis B virus infection

In this example, the ds-siNAs synthesized in Example 1 are used to treat a hepatitis B virus infection in a subject. Generally, a composition comprising a ds-siNA from Table 6 (as identified by the ds-siNA ID) and a pharmaceutically acceptable carrier is administered to the subject suffering from hepatitis B virus. The ds-siNA from Table 6 is conjugated to Nacetylgalactosamine. The ds-siNA is administered at a dose of 0.3 to 5 mg/kg every three weeks by subeutaneous injection or intravenous infusion.

Example 4. ds-siNA Hepatitis B Clinical Trial

In this example, the ds-siNAs from Tables 6A and 6B (as identified by the ds-siNA ID) will be evaluated for safety and efficacy in healthy volunteers and chronic hepatitis B patients.

131 ds-siNAs are being developed for the treatment of chronic hepatitis B (CHB) in adults. The study will be conducted in 3 parts, a single ascending-dose (SAD) phase in healthy volunteers (Group A), a single-dose (SD) phase in patients with CHB (Group B), and a multiple ascending-dose (MAD) phase in patients with CHB (Group C).

Study Design

Study Type :	Interventional (Clinical Trial)
Estimated Enrollment :	50 participants
Allocation:	Randomized
Intervention Model:	Sequential Assignment
Intervention Model Description:	Progression from the SAD phase to the first cohort in the MAD phase is contingent upon the Safety Review Committee (SRC) review of a minimum of 14 days post-dose safety and tolerability data from ail HV in at least the first 2 SAD cohorts. The SRC will select one (or more) well-tolerated dose(s) from the SAD phase for administration in the SD and MAD phases. In ail study phases, dosing will be staggered with the use of sentinel participants to allow time for the assessment of safety before additional subjects are exposed to study drug.
Masking:	Triple (Participant, Care Provider, Investigator)
Masking Description:	This is a double-blind placebo-controlled study in which the study site team, the Sponsor, and the participants will be blinded to treatment assignment. The unblinded pharmacist will cover each syringe, prior to transport to the bedside, to ensure blinding. Participants will be centrally assigned to randomized study intervention using an Interactive Voice/Web Response System (IVRS/IWRS).
Primary Purpose:	Treatment

Arms and Interventions

Arm	Intervention/ treatment
Experimental: Cohort Al ds-siNA	Drug: ds-siNA

132

Arm	Intervention/treatment
Single dose, Subcutaneous injection of O.lmg/kg of ds-siNA (HV)	ds-siNA is a synthetic ribonucleic acid interférence (RNAi) drug that consists of double-stranded oligonucleotides conjugated to an N-acetyl-Dgalactosamine (GalNAc) ligand. ds-siNA, stérile solution of the ds-siNA at a concentration of 185 mg/mL in water for injection (WFI).
Placebo Comparator: Cohort Al Placebo Single dose, Subcutaneous injection of O.lmg/kg of Placebo for ds-siNA (HV)	Drug: Placebo for ds-siNA Stérile 9% saline for injection. Other Name: Placebo
Experimental: Cohort A2 ds-siNA Single dose, Subcutaneous injection of 1.5mg/kg of ds-siNA (HV)	Drug: ds-siNA ds-siNA is a synthetic ribonucleic acid interférence (RNAi) drug that consists of double-stranded oligonucleotides conjugated to an N-acetyl-Dgalactosamine (GalNAc) ligand. ds-siNA, stérile solution of the ds-siNA at a concentration of 185 mg/mL in water for injection (WFI).
Placebo Comparator: Cohort A2 Placebo Single dose, Subcutaneous injection of 1.5mg/kg of Placebo for ds-siNA (HV)	Drug: Placebo for ds-siNA Stérile 9% saline for injection. Other Name: Placebo
Experimental: Cohort A3 ds-siNA Single dose, Subcutaneous injection of 3mg/kg of ds-siNA (HV)	Drug: ds-siNA ds-siNA is a synthetic ribonucleic acid interférence (RNAi) drug that consists of double-stranded oligonucleotides conjugated to an N-acetyl-Dgalactosamine (GalNAc) ligand. ds-siNA, stérile solution of the ds-siNA at a concentration of 185 mg/mL in water for injection (WFI).
Placebo Comparator: Cohort A3 Placebo Single dose, Subcutaneous injection of 3mg/kg of Placebo for ds-siNA (HV)	Drug: Placebo for ds-siNA Stérile 9% saline for injection. Other Name: Placebo

133

Arm	Intervention/treatment
Experimental: Cohort A4 ds-siNA Single dose, Subcutaneous injection of 6mg/kg of ds-siNA (HV)	Drug: ds-siNA ds-siNA is a synthetic ribonucleic acid interférence (RNAi) drug that consists of double-stranded oligonucleotides conjugated to an N-acetyl-Dgalactosamine (GalNAc) ligand. ds-siNA, stérile solution of the ds-siNA at a concentration of 185 mg/mL in water for injection (WFI).
Placebo Comparator: Cohort A4 Placebo Single dose, Subcutaneous injection of 6mg/kg of Placebo for ds-siNA (HV)	Drug: Placebo for ds-siNA Stérile 9% saline for injection. Other Name: Placebo
Experimental: Cohort A5 ds-siNA Single dose, Subcutaneous injection of 12mg/kg of ds-siNA (HV)	Drug: ds-siNA ds-siNA is a synthetic ribonucleic acid interférence (RNAi) drug that consists of double-stranded oligonucleotides conjugated to an N-acetyl-Dgalactosamine (GalNAc) ligand. ds-siNA, stérile solution of the ds-siNA at a concentration of 185 mg/mL in water for injection (WFI).
Placebo Comparator: Cohort A5 Placebo Single dose, Subcutaneous injection of 12mg/kg of Placebo for ds-siNA (HV)	Drug: Placebo for ds-siNA Stérile 9% saline for injection. Other Name: Placebo
Experimental: Cohort B ds-siNA Single dose, Subcutaneous injection of 3mg/kg of for ds-siNA (NUC naïve, CHB)	Drug: ds-siNA ds-siNA is a synthetic ribonucleic acid interférence (RNAi) drug that consists of double-stranded oligonucleotides conjugated to an N-acetyl-Dgalactosamine (GalNAc) ligand. ds-siNA, stérile solution of the ds-siNA at a concentration of 185 mg/mL in water for injection (WFI).
Placebo Comparator: Cohort B Placebo	Drug: Placebo for ds-siNA Stérile 9% saline for injection. Other Name: Placebo

134

Arm	Intervention/treatment

Single dose, Subcutaneous injection of 3mg/kg of Placebo for ds-siNA (NUC naïve, CHB)

Experimental: Cohort Cl ds-siNA 4 doses- Subcutaneous injection of 1.5mg/kg of ds-siNA administered every 28 days (NUC experienced, CHB)	Drug: ds-siNA ds-siNA is a synthetic ribonucleic acid interférence (RNAi) drug that consists of double-stranded oligonucleotides conjugated to an N-acetyl-Dgalactosamine (GalNAc) ligand. ds-siNA, stérile solution of the ds-siNA at a concentration of 185 mg/mL in water for injection (WFI).
Placebo Comparator: Cohort Cl Placebo 4 doses- Subcutaneous injection of 1.5mg/kg of Placebo for ds-siNA administered every 28 days (NUC experienced, CHB)	Drug: Placebo for ds-siNA Stérile 9% saline for injection. Other Name: Placebo
Experimental: Cohort C2 ds-siNA 4 doses- Subcutaneous injection of 3mg/kg of ds-siNA administered every 28 days (NUC experienced, CHB)	Drug: ds-siNA ds-siNA is a synthetic ribonucleic acid interférence (RNAi) drug that consists of double-stranded oligonucleotides conjugated to an N-acetyl-Dgalactosamine (GalNAc) ligand. ds-siNA, stérile solution of the ds-siNA at a concentration of 185 mg/mL in water for injection (WFI).
Placebo Comparator: Cohort C2 Placebo 4 doses- Subcutaneous injection of 3mg/kg of Placebo for ds-siNA administered every 28 days (NUC experienced, CHB)	Drug: Placebo for ds-siNA Stérile 9% saline for injection. Other Name: Placebo
Experimental: Cohort C3 ds-siNA	Drug: ds-siNA ds-siNA is a synthetic ribonucleic acid interférence (RNAi) drug that consists of double-stranded

135

Arm	Intervention/treatment
4 doses- Subcutaneous injection of 6mg/kg of ds-siNA administered every 28 days (NUC experienced, CHB)	oligonucleotides conjugated to an N-acetyl-Dgalactosamine (GalNAc) ligand. ds-siNA, stérile solution of the ds-siNA at a concentration of 185 mg/mL in water for injection (WFI).
Placebo Comparator: Cohort C3 Placebo 4 doses- Subcutaneous injection of 6mg/kg of Placebo for ds-siNA administered every 28 days (NUC experienced, CHB)	Drug: Placebo for ds-siNA Stérile 9% saline for injection. Other Name: Placebo

Outcome Measures

Primary Outcome Measures :

Number of healthy volunteers with Adverse Events as assessed by CTCAE v5.0 [Time rame: 4 weeks]

Number of participants with abnormalities in vital signs, electrocardiogram (ECG), and clinically significant laboratory fmdings

Number participants with non-cirrhotic chronic Hepatitis B with Adverse Events as assessed by CTCAE v5.0 [Time Frame: 16 weeks]

Number of participants with abnormalities in vital signs, electrocardiogram (ECG), and clinically significant laboratory fmdings.

Secondary Outcome Measures :

To characterize the pharmacokinetics of ds-siNA in healthy volunteers by monitoring plasma pharmacokinetics profiles of [Time Frame: 4 weeks] Measure the amount of ds-siNA excreted in urine

To characterize the pharmacokinetics of ds-siNA in healthy volunteers by monitoring through concentrations of [Time Frame: 4 weeks]

Measure the amount of ds-siNA rénal clearance (CLR).

To characterize the pharmacokinetics of ds-siNA in participants with non-cirrhotic CHB by monitoring plasma pharmacokinetics profiles of ds-siNA. [Time Frame: 12 weeks]

Measure the amount of ds-siNA excreted in urine

To characterize the pharmacokinetics of ds-siNA in participants with non-cirrhotic CHB by monitoring through concentrations of ds-siNA. [Time Frame: 12 weeks]

Measure ds-siNA rénal clearance (CLR).

136

Other Outcome Measures:

To evaluate the preliminary antiviral efficacy of ds-siNA in participants with CHB by monitoring changes in sérum HBsAg levels (ail Group B and C participants) during and after single dose and 12 weeks of treatment with DCR HBVS. [Time Frame: 12 weeks]

Proportion of participants achieving at least a 1-log réduction in HBsAg and achieving a HBsAg level <100 lU/mL at last scheduled visit Time to HBsAg loss (Kaplan-Mayer) Time to anti-HBs séroconversion

To evaluate the preliminary antiviral efficacy of ds-siNA in participants with CHB by monitoring HBeAg levels (HBeAg+ participants only) during and after single dose and 12 weeks of treatment with DCR HBVS. [Time Frame: 12 weeks] % of participants with HBeAg loss and anti HBe at last scheduled visit (if HBeAg positive at study entry)

To evaluate the preliminary antiviral efficacy of ds-siNA in participants with CHB by monitoring HBV DNA levels (ail Group B and C participants) during and after single dose and 12 weeks of treatment with DCR HBVS. [Time Frame: 12 weeks]

Proportion of participants achieving HBV DNA < 2000 HJ/mL (if > 2,000 lU/mL at Baseline); and proportion of participants achieving PCR-nondetectable HBV DNA (if HBV DNA was détectable at Baseline).

To characterize the pharmacodynamies (PD) of ds-siNA on plasma levels of HBsAg and HBV inblood. [Time Frame: 12 weeks]

Track post-treatment duration of any observed efficacy effects.

Eligibility Criteria .

Ages Eligible for Study:	18 Years to 65 Years (Adult, Older Adult)
Sexes Eligible for Study:	AU
Accepts Healthy Volunteers:	Yes

Inclusion Criteria:

Healthy at the time of screening as determined by medical évaluation.

Capable of giving informed consent.

12-lead ECG within normal limits or with no clinically significant abnormalities.

Négative screen for alcohol or drugs of abuse.

Non-smokers for at least 3 months with a négative urinary cotinine concentration at screening.

BMI within range 18.0-32.0 kg/m2 (inclusive).

137

Female participants not prégnant, not breastfeeding, and not of childbearing potential or willing to follow contraceptive guidance.

Chronic hepatitis B infection (Group B and C only).

Clinical history compatible with compensated liver disease with no evidence of cirrhosis (Group B and C only).

Continuously on nucléotides (NUC) therapy for at least 12 weeks prior to screening (Group C only).

Exclusion Criteria:

History of any medical condition that may interfère with the absorption, distribution, or élimination of study drug.

Poorly controlled or unstable hypertension.

History of diabètes mellitus treated with insulin or hypoglycémie agents.

History of asthma requiring hospital admission within the preceding 12 months.

Evidence of G-6-PD deficiency.

Currently poorly controlled endocrine conditions, excluding thyroid conditions.

History of multiple drug allergies or history of allergie reaction to an oligonucleotide or GalNAc.

Clinically relevant surgical history.

Use of prescription médications (excluding contraception for women) within 4 weeks prior to the administration of study intervention.

Use of clinically relevant over-the-counter médication or suppléments (excluding routine vitamins) within 7 days of first dosing.

Has received an investigational agent within the 3 months prior to dosing or is in followup of another study.

Antiviral therapy (other than entecavir or tenofovir) within 3 months of screening or treatment with interferon in the last 3 years (Group B and C only).

Use within the last 6 months of anticoagulants or systemically administered corticosteroids, immunomodulators, or immunosuppressants (Group B and C only).

Example 5: Synthesis of 5’ End Cap Monomer

2 3

138

Oxone/MeOH. FLO

Example 5 monomer

Example 5 Monomer Synthesis Scheme

Préparation of (2): To a solution of 1 (15 g, 57.90 mmol) in DMF (150 mL) were added AcSK (11.24 g, 98.43 mmol) and TBAI (1.07 g, 2.89 mmol), and the mixture was stirred at 25 °C for 12 h. Upon completion as monitored by LCMS, the mixture was diluted with H2O (10 mL) and extracted with EA (200 mL * 3). The combined organic layers were washed with brine (200 mL * 3), dried over anhydrous NaiSCL, filtered and concentrated under reduced pressure to give 2 (14.5 g, 96.52% yield, 98% purity) as a colorless oil. ESI-LCMS: 254.28 [M+H]⁺; ‘H NMR (400 MHz, CDCI3) δ = 4.78 - 4.65 (m, 2H), 3.19 (d, .7=14.1 Hz, 2H), 2.38 (s, 3H), 1.32 (t, .7=6.7 Hz, 12H); ³¹P NMR (162 MHz, CDCI3) δ = 20.59.

Préparation of (3): To a solution of 2 (14.5 g, 57.02 mmol) in CH3CN (50 mL) and MeOH (25 mL) was added NaOH (3 M, 28.51 mL), and the mixture was stirred at 25 °C for 12 h under Ar. Upon completion as monitored by TLC, the reaction mixture was concentrated under reduced pressure to remove CH3CN and CH3OH. The residue was diluted with water (50 mL) and adjust pH=7 by 6M HCl, and the mixture was extracted with EA (50 mL * 3). The combined organic layers were washed with brine (50 mL * 3), dried over anhydrous Na2SÛ4, filtered and concentrated under reduced pressure to give 3 (12.1 g, crude) as a colorless oil.

139 .

Préparation of (4): To a solution of 3 (12.1 g, 57.01 mmol) in CH3CN (25 mL) and MeOH (25 mL) was added A (14.77 g, 57.01 mmol) dropwise at 25 °C, and the mixture was stirred at 25 °C under Ar for 12 h. Upon completion as monitored by LCMS, the reaction mixture was concentrated under reduced pressure to give 4 (19.5 g, 78.85% yield) as a colorless oil. Ή NMR (400 MHz, CDCI3) δ = 4.80 - 4.66 (m, 4H), 2.93 (d, J=\ 1.3 Hz, 4H), 1.31 (dd, >3.9, 6.1 Hz, 24H); ³¹P NMR (162 MHz, CDCI3) δ = 22.18.

Préparation of (5): To a solution of 4 (19.5 g, 49.95 mmol) in MeOH (100 mL) and H2O (100 mL) was added Oxone (61.41 g, 99.89 mmol) at 25 °C in portions, and the mixture was stirred at 25 °C for 12 h under Ar. Upon completion as monitored by LCMS, the reaction mixture was filtered, and the filtrate was concentrated under reduced pressure to remove MeOH. The residue was extracted with EA (50 mL *3). The combined organic layers were washed with brine (50 mL * 3), dried over anhydrous Na₂SO4, filtered and concentrated under reduced pressure to give a residue. The crude product was triturated with i-Pr₂O and n-Hexane (1:2, 100 mL) at 25 °C for 30 min to give 5 (15.6 g, 73.94% yield,) as a white solid. *H NMR (400 MHz, CDCI3) δ = 4.92 - 4.76 (m, 4H), 4.09 (d, >16.1 Hz, 4H), 1.37 (dd, >3.5, 6.3 Hz, 24H); ^3IP NMR (162 MHz, CDCI3) δ = 10.17.

Préparation of (7): To a mixture of 5 (6.84 g, 16.20 mmol) in THF (20 mL) was added LiBr (937.67 mg, 10.80 mmol) until dissolved, followed by DIEA (1.40 g, 10.80 mmol, 1.88 mL) under argon at 15 °C. The mixture was stirred at 15 °C for 15 min. 6 (4 g, 10.80 mmol) were added. The mixture was stirred at 15 °C for 3 h. Upon completion as monitored by LCMS, the reaction mixture was quenched by addition of H₂O (40 mL) and extracted with EA (40 mL * 3). The combined organic layers were washed with brine (100 mL), dried over Na₂SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash reverse-phase chromatography (120 g C-18 Column, Eluent of 0-60% ACN/H₂O gradient @ 80 mL/min) to give 7 (5.7 g, 61.95% yield) as a colorless oil. ESI-LCMS: 611.2 [M+H]⁺ _; *H NMR (400 MHz, CDCI3); δ = 9.26 (s, 1H), 7.50 (d, >8.1 Hz, 1H), 7.01 (s, 2H), 5.95 (d, >2.7 Hz, 1H), 5.80 (dd, >2.1, 8.2 Hz, 1H), 4.89 - 4.72 (m, 2H), 4.66 (d, >7.2 Hz, 1H), 4.09 - 4.04 (m, 1H), 3.77 (dd, >2.7, 4.9 Hz, 1H), 3.62 (d, >3.1 Hz, 1H), 3.58 (d, >3.1 Hz, 1H), 3.52 (s, 3H), 1.36 (td, >1.7, 6.1 Hz, 12H), 0.92 (s, 9H), 0.12 (s, 6H); ³¹P NMR (162 MHz, CDCh) δ = 9.02

Préparation of (8): To a mixture of 7 (5.4 g, 8.84 mmol) in THF (80 mL) was added Pd/C (5.4 g, 10% purity) under N₂. The suspension was degassed under vacuum and purged with H₂ several times. The mixture was stirred under H₂ (15 psi) at 20 °C for 1 hr. Upon completion as monitored by LCMS, the reaction mixture was filtered, and the filtrate was concentrated to give 8 (5.12 g, 94.5% yield) as a white solid. ESI-LCMS: 613.3 [M+H]⁺ H NMR (400 MHz,

140

CD₃CN) δ = 9.31 (s, 1H), 7.37 (d, 7=8.0 Hz, 1H), 5.80 - 5.69 (m, 2H), 4.87 - 4.75 (m, 2H), 4.11 4.00 (m, 1H), 3.93 - 3.85 (m, 1H), 3.80 - 3.74 (m, 1H), 3.66 - 3.60 (m, 1H), 3.57 - 3.52 (m, 1H), 3.49 (s, 3H), 3.46 - 3.38 (m, 1H), 2.35 - 2.24 (m, 1H), 2.16 - 2.03 (m, 1H), 1.89 - 1.80 (m, 1H), 1.37 - 1.34 (m, 12H), 0.90 (s, 9H), 0.09 (s, 6H); ^3lP NMR (162 MHz, CD₃CN) δ = 9.41.

Préparation of (9): To a solution of 8 (4.4 g, 7.18 mmol) in THF (7.2 mL) was added TBAF (1 M, 7.18 mL), and the mixture was stirred at 20 °C for 1 hr. Upon completion as monitored by LCMS, the reaction mixture was diluted with H₂O (50 mL) and extracted with EA (50 mL*4). The combined organic layers were washed with brine (50 mL), dried over Na₂SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 40 g SepaFlash® Silica Flash Column, Eluent of 0~5%, MeOH/DCM gradient @ 40 mL/min) to give 9 (3.2 g, 88.50% yield) as a white solid. ESI-LCMS: 499.2 [M+H]⁺ ‘H NMR (400 MHz, CD3CN) δ = 9.21 (s, 1H), 7.36 (d, 7=8.3 Hz, 1H), 5.81 - 5.72 (m, 2H), 4.88 - 4.74 (m, 2H), 3.99 - 3.87 (m, 2H), 3.84 (dd, 7=1.9, 5.4 Hz, 1H), 3.66 - 3.47 (m, 7H), 2.98 (s, 1H), 2.44 - 2.15 (m, 2H), 1.36 (d, 7=6.0 Hz, 12H); ³¹P NMR (162 MHz, CD3CN) δ = 9.48.

Préparation of (Example 5 monomer): To a mixture of 9 (3.4 g, 6.82 mmol, 1 eq) and 4A MS (3.4 g) in MeCN (50 mL) was added PI (2.67 g, 8.87 mmol, 2.82 mL, 1.3 eq) at 0 °C, followed by addition of lH-imidazole-4,5-dicarbonitrile (886.05 mg, 7.50 mmol) at 0 °C. The mixture was stirred at 20 °C for 2 h. Upon completion as monitored by LCMS, the reaction mixture was quenched by addition of saturated aq. NaHCO₃ (50 mL) and diluted with DCM (100 mL). The organic layer was washed with saturated aq. NaHCO₃ (50 mL * 2), dried over Na₂SC>4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC: column: YMC-Triart Prep C18 250*50 mm*10um; mobile phase: [water (10 mM NH4HCO₃)-ACN]; B%: 15% to give a impure product. The impure product was fùrther purified by a flash silica gel column (0% to 5% i-PrOH in DCM with 0.5% TEA) to give Example 5 monomer (2.1 g, 43.18% yield) as a white solid. ESI-LCMS: 721.2 [M+Na]^+;H NMR (400 MHz, CD3CN) δ = 9.29 (s,lH), 7.45 (d, 7=8.1 Hz, 1H), 5.81 (d, 7=4.2 Hz, 1H), 5.65 (d, 7=8.1 Hz, 1H), 4.79 - 4.67 (m, 2H), 4.26 - 4.05 (m, 2H), 4.00 - 3.94 (m, 1H), 3.89 - 3.63 (m, 6H), 3.53 - 3.33 (m, 5H), 2.77 - 2.61 (m, 2H), 2.31 - 2.21 (m, 1H), 2.16 - 2.07 (m, 1H), 1.33 - 1.28 (m, 12H), 1.22- 1.16 (m, 1H), 1.22-1.16 (m, 11H); ³¹P NMR (162 MHz, CD3CN) δ = 149.89, 149.78, 10.07, 10.02.

Example 6. Synthesis of 5’ End Cap Monomer

141

Example 6 Monomer

Example 6 Monomer Synthesis Scheme

Préparation of (2): To a solution of 1 (5 g, 13.42 mmol) in DMF (50 mL) were added PPI13 (4.58 g, 17.45 mmol) and 2-hydroxyisoindoline-l,3-dione (2.85 g, 17.45 mmol), followed by a solution of DIAD (4. 07 g, 20. 13 mmol, 3.91 mL) in DMF (10 mL) dropwise at 15°C. The resulting solution was stirred at 15°C for 18 hr. The reaction mixture was then diluted with DCM (50 mL), washed with H2O (60 mL*3) and brine (30 mL), dried over NazSCU, fïltered and evaporated to give a residue. The residue was then triturated with EtOH (55 mL) for 30 min, and the collected white powder was washed with EtOH (10 mL*2) and dried to give 2 (12.2 g, 85. 16% yield) as a white powder (the reaction was set up in two batches and combined) ESI-LCMS: 518.1 [M+H]⁺.

Préparation of (3): 2 (6 g, 11.59 mmol) was suspended in MeOH (50 mL), and then NH2NH2.H2O (3.48 g, 34. 74 mmol, 3.38 mL, 50% purity) was added dropwise at 20°C. The reaction mixture was stirred at 20°C for 4 hr. Upon completion, the reaction mixture was diluted with EA (20 mL) and washed with NaHCOs (10 mL*2) and brine (10 mL). The combined organic layers were then dried over Na2SO4, fïltered and evaporated to give 3 (8.3 g, 92.5% yield) as a white powder. (The reaction was set up in two batches and combined). ESI-LCMS: 388.0 [M+H]⁺ _; Ή NMR (400MHz, DMSO-d₆) δ =11.39 (br s, 1H), 7.72 (d, .7=8.1 Hz, 1H), 6.24 6.09 (m, 2H), 5.80 (d,.7=4.9 Hz, 1H), 5.67 (d, .7=8.1 Ηζ,ΙΗ), 4.26 (t, .7=4.9 Hz, 1H), 4.03 -3.89 (m, 1H), 3.87 - 3.66 (m, 3H),3.33 (s, 3H), 0.88 (s, 9H), 0.09 (d, J=1.3 Hz, 6H)

Préparation of (4): To a solution of 3 (7 g, 18.06 mmol) and Py (1.43 g, 18.06 mmol, 1.46 mL) in DCM (130 mL) was added a solution of MsCl (2.48 g, 21.68 mmol, 1. 68 mL) in DCM (50 mL) dropwise at -78°C under N2. The reaction mixture was allowed to warm to 15°C in 30 min and stirred at 15°C for 3 h. The réaction mixture was quenched by addition of ice

142 water (70 mL) at 0°C, and then extracted with DCM (50 mL * 3). The combined organic layers were washed with saturated aq. NaHCO₃ (50 mL) and brine (30 mL), dried over Na₂SÜ4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 30 g SepaFlash® Silica Flash Column, Eluent of 0~20% iPrOH/DCM gradient @ 30 mL/min to give 4 (6.9 g, 77.94% yield) as a white solid. ESLLCMS: 466.1 [M+H]⁺ _; 'H NMR (400MHz, DMSO-d₆) δ = 11.41 (br s, 1H), 10. 15 (s, 1H), 7. 69 (d, J=8.1 Hz, 1H), 5.80 (d, J=4.4 Hz, 1H), 5.65 (d, J=8. 1 Hz, 1H), 4.24 (t, J=5.2 Hz, 1H), 4.16 3.98 (m, 3H), 3. 87 (t, J=4.8 Hz, 1H), 3.00 (s, 3H), 2.07 (s, 3H), 0.88 (s, 9H), 0. 10 (d, J=1.5 Hz, 6H)

Préparation of (5): To a solution of 4 (6.9 g, 14.82 mmol) in THF (70 mL) was added TBAF (1 M, 16.30 mL) at 15°C. The reaction mixture was stirred at 15°C for 18 hr, and then evaporated to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 24 g SepaFlash® Silica Flash Column, Eluent of 0~9% MeOH/Ethyl acetate gradient @ 30 mL/min) to give 5 (1.8 g, 50.8% yield) as a white solid. ESI-LCMS: 352.0 [M+H]⁺; Ή NMR (400MHz, DMSO-d₆) δ = 11.40 (s, 1H), 10.13 (s, 1H), 7.66 (d, 7=8.1 Hz, 1H), 5.83 (d, 7=4. 9 Hz, 1H), 5.65 (dd, 7=1. 8, 8. 1 Hz, 1H), 5.36 (d, 7=6. 2 Hz, 1H), 4.13 - 4.00 (m, 4H), 3. 82 (t, 7=5.1 Hz, 1H), 3.36 (s, 3H), 3.00 (s, 3H)

Préparation of (Example 6 monomer): To a mixture of 5 (3 g, 8.54 mmol) and DIEA (2.21 g, 17.08 mmol, 2.97 mL) in ACN (90 mL) was added P2 (3.03 g, 12.81 mmol) dropwise at 15°C. The reaction mixture was stirred at 15°C for 5 h. Upon completion, the reaction mixture was diluted with EA (40 mL) and quenched with 5% NaHCO₃ (20 mL). The organic layer was washed with brine (30 mL), dried over Na₂SO4, filtered and evaporated to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 12 g SepaFlash® Silica Flash Column, Eluent of 0—15% i-PrOH/(DCM with 2% TEA) gradient @ 20 mL/min) to Example 6 monomer (2.1 g, 43.93% yield) as a white solid. ESI-LCMS: 552.3 [M+H]⁺; ‘H NMR (400 MHz, CD3CN) δ = 8.78 (br s, 1H), 7.57 (dd, J=4.6, 8.2 Hz, 1H), 5.97 - 5.80 (m, 1H), 5.67 (d, J=8. 3Hz, 1H), 4.46 - 4.11 (m, 4H), 3.95 -3.58 (m, 5H), 3.44 (d, J=16. 3 Hz, 3H), 3.02 (d, J=7. 5 Hz, 3H), 2. 73 -2.59 (m, 2H), 1.23 - 1.15 (m, 12H); ³¹P NMR (162 MHz, CD3CN) δ = 150.30, 150.10

Example 7: Synthesis of 5’ End Cap Monomer

143

TBAF

Example 7 Monomer

Example 7 Monomer Synthesis Scheme

Préparation of (2): To the solution of 1 (5 g, 12.90 mmol) and TEA (1.57 g, 15.48 mmol, 2.16 mL) in DCM (50 mL) was added P-4 (2.24 g, 15.48 mmol, 1.67 mL) in DCM (10 mL) dropwise at 15°C under N₂. The reaction mixture was stirred at 15°C for 3 h. Upon completion as monitored by LCMS and TLC (PE: EtOAc = 0:1), the reaction mixture was concentrated to dryness, diluted with H₂O (20 mL), and extracted with EA (50 mL*3). The combined organic layers were washed with brine (30 mL*3), dried over anhydrous Na₂SC>4, filtered, and the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 40 g SepaFlash® Silica Flash Column, Eluent of 0-95% Ethyl acetate/Petroleum ether gradient @ 60 mL/min) to give 2 (5.3 g, 71.3% yield) as a white solid. ESI-LCMS: 496.1 [M+H]⁺ _;H NMR (400 MHz, CDC1₃) δ= 0.10 (d, J=4.02 Hz, 6 H) 0.91 (s, 9 H) 3.42 - 3.54 (m, 3 H) 3.65 - 3.70 (m, 1 H) 3.76 - 3.89 (m, 6 H) 4.00 (dd, J=10.92, 2.89 Hz, 1 H) 4.08 - 4.13 (m, 1 H) 4.15 - 4.23 (m, 2 H) 5.73 (dd, J=8.28, 2.01 Hz, 1 H) 5.84 (d, J=2.76 Hz, 1 H) 6.86 (d, 1=15.81 Hz, 1 H) 7.72 (d, J=8.03 Hz, 1 H) 9.10 (s, 1 H); ³¹P NMR (162 MHz, CD3CN) δ = 9.65

Préparation of (3): To a solution of 2 (8.3 g, 16.75 mmol) in THF (50 mL) were added TBAF (1 M, 16.75 mL) and CH3COOH (1.01 g, 16.75 mmol, 957.95 uL). The mixture was stirred at 20 °C for 12 hr. Upon completion as monitored by LCMS, the reaction mixture was concentrated under reduced pressure. The residue was purified by column chromatography (SiO₂, PE: EA = 0-100%; MeOH /EA= 0-10%) to give 3 (5 g, 77.51% yield) as a white solid.

144

ESI-LCMS: 382.1 [M+H]⁺; ^[H NMR (400 MHz, CDC13) δ= 3.35 (s, 3 H) 3.65 (br d, 7=2.76 Hz, 3 H) 3.68 (d, 7=2.76 Hz, 3 H) 3.77 (t, 7=5.08 Hz, 1 H) 3.84 - 4.10 (m, 4 H) 5.33 (br d, 7=5.52 Hz, 1 H) 5.62 (d, 7=7.77 Hz, 1 H) 5.83 (d, 7=4.94 Hz, 1 H) 7.69 (d, 7=7.71 Hz, 1 H) 9.08 (d, 7=16.81 Hz, 1 H) 11.39(brs, 1 H);³‘P NMR (162 MHz, CD3CN) δ = 15.41

Préparation of (Example 7 monomer): To a solution of 3 (2 g, 5.25 mmol) and DIPEA (2.03 g, 15.74 mmol, 2.74 mL, 3 eq) in MeCN (21 mL) and pyridine (7 mL) was added P2 (1.86 g, 7.87 mmol) dropwise at 20 °C, and the mixture was stirred at 20 °C for 3 hr. Upon completion as monitored by LCMS, the reaction mixture was diluted with water (20 mL) and extracted with EA (50 mL). The combined organic layers were washed with brine (30 mL), dried over anhydrous Na₂SO4, filtered, and the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 25 g SepaFlash® Silica Flash Column, Eluent of 0-45% (Ethyl acetate: EtOH=4:l)/Petroleum ether gradient) to give Example 7 monomer (1.2 g, 38.2% yield) as a white solid. ESI-LCMS: 604.1 [M+H]⁺; Ή NMR (400 MHz, CD3CN) δ= 1.12 - 1.24 (m, 12 H) 2.61 - 2.77 (m, 2 H) 3.43 (d, J=17.64 Hz, 3 H) 3.59 - 3.69 (m, 2 H) 3.71 - 3.78 (m, 6 H) 3.79 - 4.14 (m, 5 H) 4.16 - 4.28 (m, 1 H) 4.29 - 4.42 (m, 1 H) 5.59 - 5.72 (m, 1 H) 5.89 (t, J=4.53 Hz, 1 H) 7.48 (br d, J=12.76 Hz, 1 H) 7.62 - 7.74 (m, 1 H) 9.26 (br s, 1 H); ^3IP NMR (162 MHz, CD3CN) δ = 150.57, 149.96, 9.87

Example 8: Synthesis of 5’ End Cap Monomer

I,. PI13P. CHjCN

HO'' 'OCH;

DMTrCl, AgNO₃. trimethylpyridine

Example 8 Monomer

Example 8 Monomer Synthesis Scheme

Préparation of (2): To a solution of 1 (30 g, 101.07 mmol, 87% purity) in CH3CN (1.2 L) and Py (60 mL) were added I₂ (33.35 g, 131.40 mmol, 26.47 mL) and PPI13 (37.11 g, 141.50 mmol) in one portion at 10 °C. The reaction was stirred at 25 °C for 48 h. Upon completion, the mixture was diluted with saturated aq.Na₂S₂O3 (300 mL) and saturated aq.NaHCCh (300 mL), concentrated to remove CH3CN, and extracted with EtOAc (300 mL * 3).

145

The combined organic layers were washed with brine (300 mL), dried over Na₂SÛ4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 330 g SepaFlash® Silica Flash Column, Eluent of 0~60% Methanol/Dichloromethane gradient @100 mL/min) to give 2 (28.2 g, 72 % yield) as abrown solid. ESI-LCMS: 369.1 [M+H]⁺ _;H NMR (400 MHz, DMSO-d₆) δ = 11.43 (s, 1H), 7.68 (d, 7=8.1 Hz, 1H), 5.86 (d, 7=5.5 Hz, 1H), 5.69 (d, 7=8.1 Hz, 1H), 5.46 (d, .7=6.0 Hz, 1H), 4.08 3.96 (m, 2H), 3.90 - 3.81 (m, 1H), 3.60 - 3.51 (m, 1H), 3.40 (dd, 7=6.9, 10.6 Hz, 1H), 3.34 (s, 3H).

Préparation of (3): To the solution of 2 (12 g, 32.6 mmol) in DCM (150 mL) were added AgNCh (11.07 g, 65.20 mmol), 2,4,6-trimethylpyridine (11.85 g, 97.79 mmol, 12.92 mL), and DMTC1 (22.09 g, 65.20 mmol) at 10 °C, and the reaction mixture was stirred at 10 °C for 16 hr. Upon completion, the mixture was filtered and the filtrate was concentrated under reduced pressure. The residue was purified by flash silica gel chromatography (ISCO®; 120 g SepaFlash® Silica Flash Column, Eluent of 0-50% Ethyl acetate/Petroleum ethergradient @ 60 mL/min) to give 3 (17 g, 70.78% yield) as a yellow solid. ESI-LCMS: 693.1 [M+Na]^{+ [}; H NMR (400 MHz, DMSO-dô) δ = 11.46 (s, 1H), 7.60 (d, 7=8.4 Hz, 1H), 7.49 (d, 7=7.2 Hz, 2H), 7.40 7.30 (m, 6H), 7.29 - 7.23 (m, 1H), 6.93 (d, 7=8.8 Hz, 4H), 5.97 (d, 7=6.0 Hz, 1H), 5.69 (d, 7=8.0 Hz, 1H), 4.05 - 4.02 (m, 1H), 3.75 (d, J=1.2 Hz, 6H), 3.57 (t, 7=5.6 Hz, 1H), 3.27 (s, 4H), 3.06 (t, 7=10.4 Hz, 1H), 2.98 - 2.89 (m, 1H).

Préparation of (4): To a solution of 3 (17 g, 25.35 mmol) in DMF (200 mL) was added AcSK (11.58 g, 101.42 mmol) at 25 °C, and the reaction was stirred at 60 °C for 2 hr. The mixture was diluted with H₂O (600 mL) and extracted with EtOAc (300 mL * 4). The combined organic layers were washed with brine (300 mL), dried over Na₂SO4, filtered, and concentrated under reduced pressure to give 4 (15.6 g, crude) as a brown solid, which was used directly without further purification. ESI-LCMS: 641.3 [M+H]⁺.

Préparation of (5): To a solution of 4 (15.6 g, 25.21 mmol) in CH3CN (200 mL) were added DTT (11.67 g, 75.64 mmol, 11.22 mL) and LiOH.H₂O (1.06 g, 25.21 mmol) at 10 °C under Ar. The reaction was stirred at 10 °C for 1 hr. The mixture was concentrated under reduced pressure to remove CH3CN, and the residue was diluted with H₂O (400 mL) and extracted with EtOAc (200 mL * 3). The combined organic layers were washed with brine (300 mL), dried over Na₂SÜ4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 220 g SepaFlash® Silica Flash Column, Eluent of 0-60% Ethyl acetate/Petroleum ether gradient @100 mL/min) to give 5 (8.6 g, 56.78% yield) as a white solid. ESI-LCMS: 599.3 [M+Na]⁺ ; 'H NMR (400 MHz, DMSO-dô)

146 δ = 8.79 (s, 1Η), 7.61 (d, .7=8.0 Hz, 1H), 7.56 - 7.46 (m, 2H), 7.45 - 7.37 (m, 4H), 7.36 - 7.27 (m, 3H), 6.85 (dd, .7=2.8, 8.8 Hz, 4H), 5.85 (d, .7=1.3 Hz, 1H), 5.68 (dd, .7=2.0, 8.2 Hz, 1H), 4.33 4.29 (m, 1H), 3.91 (dd, .7=4.8, 8.2 Hz, 1H), 3.81 (d, .7=1.6 Hz, 6H), 3.33 (s, 3H), 2.85 - 2.80 (m, 1H), 2.67-2.55 (m, 2H), 1.11 (t, .7=8.8 Hz, 1H).

Préparation of (Example 8 monomer): To a solution of 5 (6 g, 10.40 mmol) in DCM (120 mL) were added PI (4.08 g, 13.53 mmol, 4.30 mL) and DCI (1.35 g, 11.45 mmol) in one portion at 10 °C under Ar. The reaction was stirred at 10 °C for 2 hr. The reaction mixture was diluted with saturated aq.NaHCO₃ (50 mL) and extracted with DCM (20 mL * 3). The combined organic layers were washed with brine (30 mL), dried over Na₂SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (column: YMC-Triart Prep C18 250*50 mm*10 um; mobile phase: [water(10mM NH4HCO3)-ACN]; B%: 35%-81%,20min) to give Example 8 monomer (3.54 g, 43.36% yield) as a yellow solid. ESILCMS: 776.4 [M+H]⁺; ^lH NMR (400 MHz, DMSO-d6) δ = 7.65 - 7.38 (m, 7H), 7.37 - 7.22 (m, 3H), 6.90 ( d, .7=8.4 Hz, 4H), 5.92 ( s, 1H), 5.66 ( t, .7=8.2 Hz, 1H), 4.13 ( d, .7=4.0 Hz, 1H), 4.00

- 3.88 (m, 1H), 3.87 - 3.59 (m, 10H), 3.33 ( d, .7=5.8 Hz, 3H), 3.12 - 2.94 (m,lH), 2.78 - 2.60 (m,

3H), 2.55-2.48 (m, 1H), 1.36 - 0.98 (m, 12H); ³¹P NMR (162 MHz, DMSO-d₆) δ = 162.69.

Example 9: Synthesis of 5’ End Cap Monomer

NHBz O j ho IA⁰ A ____Oxidation TBSO 1 NHBz N-A'N (/ J j D ΗΟψϋ I NaBD₄, CDjOD ~ L-M

NHBz NHBz <^z I zj <^z J A ΗΟΌ MeOH, SOCI₂ P TBSO TBSO O^ 2 3 NHBz <^Z J J DMTrCI, _D νΆ_ν^ pyrldine DMTrO^i D I TBAF -----------------► T ,0-. -----------------►

TBSO 4 NHBz N^Z _D 'n-v Ta. DMTrO i D 1 /— r OH 6

TBSO Ά 5 NHBz ^p-i ^Dcl DMTroA_D ? CN NC'^-^X P Ar

147

Example 9 Monomer

Example 9 Monomer Synthesis Scheme

Préparation of (2): To a solution of 1 (22.6 g, 45.23 mmol) in DCM (500 mL) and H2O (125 mL) were added TEMPO (6.40 g, 40.71 mmol) and DIB (29.14 g, 90.47 mmol) at 0 °C. The mixture was stirred at 20 °C for 20 h. Upon completion as monitored by LCMS, saturated aq. NaHCO₃ was added to the mixture to adjust pH >8. The mixture was diluted with H2O (200 mL) and washed with DCM (100 mL * 3). The aqueous layer was collected, adjusted to pH < 5 by HCl (4M), and extracted with DCM (200 mL * 3). The combined organic layers were washed with brine (300 mL), dried over Na2SO4, filtered, and concentrated under reduced pressure to give 2 (17.5 g, 68.55% yield) as a yellow solid. ESI-LCMS: 514.2 [M+H]⁺ _; 'H NMR (400 MHz, DMSO-d₆) δ = 11.27 (s, 1H), 8.86 (s, 1H), 8.78 (s, 1H), 8.06 (d, 7=7.5 Hz, 2H), 7.68 - 7.62 (m, 1H), 7.59 - 7.52 (m, 2H), 6.28 (d, <7=6.8 Hz, 1H), 4.82 - 4.76 (m, 1H), 4.54 (dd, 7=4.1, 6.7 Hz, 1H), 4.48 (d, <7=1.8 Hz, 1H), 3.32 (s, 3H), 0.94 (s, 9H), 0.18 (d, <7=4.8 Hz, 6H).

Préparation of (3): To a solution of 2 (9.3 g, 18.11 mmol) in MeOH (20 mL) was added SOCI2 (3.23 g, 27.16 mmol, 1.97 mL) dropwise at 0 °C. The mixture was stirred at 20 °C for 0.5 hr. Upon completion as monitored by LCMS, the reaction mixture was quenched by addition of saturated aq. NaHCO₃ (80 mL) and concentrated under reduced pressure to remove MeOH. The aqueous layer was extracted with DCM (80 mL * 3). The combined organic layers were washed with brine (200 mL), dried over Na2SÜ4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 120 g SepaFlash® Silica Flash Column, Eluent of 0~5%, MeOH/DCM gradient @ 85 mL/min) to give 3 (5.8 g, 60 % yield) as a yellow solid. ESI-LCMS: 528.3 [M+H]⁺ _; Ή NMR (400 MHz, DMSO-d₆) δ = 11.28 (s, 1H), 8.79 (d, 7=7.3 Hz, 2H), 8.06 (d, <7=7.5 Hz, 2H), 7.68 - 7.62 (m, 1H), 7.60 - 7.53 (m, 2H), 6.28 (d, J=6.6 Hz, 1H), 4.87 (dd, 7=2.4, 4.0 Hz, 1H), 4.61 (dd, 7=4.3, 6.5 Hz, 1H), 4.57 (d, <7=2.2 Hz, 1H), 3.75 (s, 3H), 3.32 (s, 3H), 0.94 (s, 9H), 0.17 (d, <7=2.2 Hz, 6H).

Préparation of (4): To a mixture of 3 (5.7 g, 10.80 mmol) in CD₃OD (120 mL) was added NaBÜ4 (1.63 g, 43.21 mmol) in portions at 0 °C, and the mixture was stirred at 20 °C for 1 hr. Upon completion as monitored by LCMS, the reaction mixture was neutralized by AcOH (~ 10 mL) and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 40 g SepaFlash® Silica Flash Column, Eluent of 0~5%, MeOH/DCM gradient @ 40 mL/min) to give 4 (4.15 g, 7.61 mmol, 70.45% yield) as a yellow solid. ESI-LCMS: 502.2 [M+H]⁺; ‘H NMR (400 MHz, DMSO-d₆) δ = 11.23 (s, 1H), 8.76 (s, 2H), 8.04 (d, 7=7.3 Hz, 2H), 7.69 - 7.62 (m, 1H), 7.60 - 7.52 (m, 2H), 6.14 (d, 7=6.0 Hz, 1H),

148

5.18 (s, 1H), 4.60 - 4.51 (m, 2H), 3.98 (d, 7=3.0 Hz, 1H), 3.32 (s, 3H), 0.92 (s, 9H), 0.13 (d, 7=1.5 Hz, 6H).

Préparation of (5): To a solution of 4 (4.85 g, 9.67 mmol) in pyridine (50 mL) was added DMTrCl (5.90 g, 17.40 mmol) at 25 °C and the mixture was stirred for 2 hr. Upon completion as monitored by LCMS, the reaction mixture was concentrated under reduced pressure to remove pyridine. The residue was diluted with EtOAc (150 mL) and washed with H?O (50 mL * 3), dried over NazSCri, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 80 g SepaFlash® Silica Flash Column, Eluent of 0~70%, EA/PE gradient @ 60 mL/min) to give 5 (6.6 g, 84.06% yield) as a yellow solid. ESI-LCMS: 804.3 [M+H]⁺, Ή NMR (400 MHz, DMSO-d₆) δ = 11.22 (s, 1H), 8.68 (d, 7=11.0 Hz, 2H), 8.03 (d, ./=7.3 Hz, 2H), 7.68 - 7.60 (m, 1H), 7.58 - 7.49 (m, 2H), 7.37 - 7.30 (m, 2H), 7.27 - 7.16 (m, 7H), 6.88 - 6.79 (m, 4H), 6.17 (d, 7=4.2 Hz, 1H), 4.72 (t, 7=5.0 Hz, 1H), 4.60 (t, 7=4.5 Hz, 1H), 4.03 - 3.98 (m, 1H), 3.71 (s, 6H), 0.83 (s, 9H), 0.12 - 0.03 (m, 6H).

Préparation of (6): To a solution of 5 (6.6 g, 8.21 mmol) in THF (16 mL) was added TBAF (1 M, 8.21 mL,), and the mixture was stirred at 20 °C for 2 hr. Upon completion as monitored by LCMS, the reaction mixture was diluted with EA (150 mL) and washed with H2O (50 mL*3). The organic layer was washed with brine (150 mL), dried over NasSCU, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 80 g SepaFlash® Silica Flash Column, Eluent of 10- 100%, EA/PE gradient @30 mL/min) to give 6 (5.4 g, 94.4 % yield) as a yellow solid. ESI-LCMS: 690.3 [M+Hf^HNMR (400 MHz, DMSO-d₆) δ = 11.24 (s, 1H), 8.69 (s, 1H), 8.62 (s, 1H), 8.05 (d, 7=7.3 Hz, 2H), 7.69 - 7.62 (m, 1H), 7.60 - 7.52 (m, 2H), 7.40 - 7.33 (m, 2H), 7.30 - 7.18 (m, 7H), 6.84 (dd, 7=5.9, 8.9 Hz, 4H), 6.19 (d, 7=4.8 Hz, 1H), 5.36 (d, 7=6.0 Hz, 1H), 4.59 - 4.52 (m, 1H), 4.48 (q, 7=5.1 Hz, 1H), 4.11 (d, 7=4.8 Hz, 1 H), 3.72 (d, 7=1.0 Hz, 6H), 3.40 (s, 3H).

Préparation of (Example 9 monomer): To a solution of 6 (8.0 g, 11.60 mmol) in MeCN (150 mL) was added P-l (4.54 g, 15.08 mmol, 4.79 mL) at 0 °C, followed by DCI (1.51 g, 12.76 mmol) in one portion. The mixture was warmed to 20 °C and stirred for 2 h. Upon completion as monitored by LCMS, the reaction mixture was quenched by addition of saturated aq. NaHCCh (50 mL) and diluted with DCM (250 mL). The organic layer was washed with saturated aq.NaHCCh (50 mL * 2), dried over NazSCU, fdtered and concentrated under reduced pressure. The residue was purified by a flash silica gel column (0% to 60% EA in PE contain 0.5% TEA) to give Example 9 monomer (5.75 g, 55.37% yield, 99.4% purity) as a white solid. ESI-LCMS: 890.4 [M+H]⁺ _; Ή NMR (400 MHz, CD3CN) δ = 9.55 (s, 1H), 8.63 - 8.51 (m, 1H),

149

8.34 - 8.24 (m, 1H), 7.98 (br d, ./=7.5 Hz, 2H), 7.65 - 7.55 (m, 1H), 7.53 - 7.46 (m, 2H), 7.44 7.37 (m, 2H), 7.32 - 7.17 (m, 7H), 6.84 - 6.77 (m, 4H), 6.14 (d, J=4.3 Hz, 1H), 4.84 - 4.73 (m, 1H), 4.72 - 4.65 (m, 1H), 4.34 - 4.27 (m, 1 H), 3.91 - 3.61 (m, 9H), 3.50 - 3.43 (m, 3H), 2.72 2.61 (m, 1H), 2.50 (t, J=6.Q Hz, 1H), 1.21 - 1.15 (m, 10H), 1.09 (d, .7=6.8 Hz, 2H); ³¹P NMR (162 MHz, CD₃CN) δ = 150.01, 149.65

Example 10: Synthesis of 5’ End Cap Monomer

Example 10 Monomer

Example 10 Monomer Synthesis Scheme

Préparation of (2): To a solution of 1 (10 g, 27.22 mmol) in CH₃CN (200 mL) and H₂O (50 mL) were added TEMPO (3.85 g, 24.50 mmol) and DIB (17.54 g, 54.44 mmol). The mixture was stirred at 25 °C for 12 h. Upon completion as monitored by LCMS, the reaction mixture was concentrated under reduced pressure to give a residue. The residue was triturated with EtOAc (600 mL) for 30 min. The resulting suspension was filtered and the collected solid was washed with EtOAc (300 mL*2) to give 2 (20.09 g, 91.5% yield) as a white solid. ESILCMS: 382.0 [M+H]⁺.

Préparation of (3): To a solution of 2 (6 g, 15.73 mmol) in MeOH (100 mL) was added SOCI2 (2.81 g, 23.60 mmol, 1.71 mL) dropwise at 0 °C. The mixture was stirred at 25 °C 150 for 12 h. Upon completion as monitored by LCMS, the reaction mixture was quenched by addition of NaHCCh (4 g) and stirred at 25 °C for 30 min. The reaction mixture was filtered and the filtrate was concentrated under reduced pressure to give 3 (18.8 g, 95.6% yield) as a white solid. The crude product was used for the next step without further purification. (The reaction was set up in parallel 3 batches and combined). ESI-LCMS: 396.1 [M+H]⁺;'H NMR (400 MHz, DMSO-d₆) δ= 12.26 - 11.57 (m, 2H), 8.42 - 8.06 (m, 1H), 6.14 - 5.68 (m, 2H), 4.56 (s, 2H), 4.33 (dd, J=4.0, 7.3 Hz, 1H), 3.77 (m, 3H),, 3.30 (s, 3H), 2.81 - 2.69 (m, 1H), 1.11 (s, 6H)

Préparation of (4 & 5): To a mixture of 3 (10.1 g, 25.55 mmol) in CD3OD (120 mL) was added NaBÜ4 (3.29 g, 86.86 mmol, 3.4 eq) in portions at 0 °C. The mixture was stirrèd at 25 °C for 1 h. Upon completion as monitored by LCMS, the reaction mixture was neutralized with AcOH (~ 15 mL) and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 120 g SepaFlash® Silica Flash Column, Eluent of 0~7.4%, MeOH/DCM gradient @ 80 mL/min) to give 4 (2.98 g, 6.88 mmol, 27% yield) as a yellow solid. ESI-LCMS: 370.1 [M+H]⁺ and 5 (10.9 g, crude) as a yellow solid. ESILCMS: 300.1[M+H]⁺; *H NMR (400MHz, CD3OD) δ = 7.85 (s, 1H), 5.87 (d, J=6.0 Hz, 1H), 4.46 - 4.39 (m, 1H), 4.34 (t, J=5.4 Hz, 1H), 4.08 (d, J=3.1 Hz, 1H), 3.49 - 3.38 (m, 4H)

Préparation of 6: To a solution of 4 (1.9 g, 4.58 mmol, 85.7% purity) in pyridine (19 mL) was added DMTrCl (2.02 g, 5.96 mmol). The mixture was stirred at 25 °C for 2 h under N2. Upon completion as monitored by LCMS, the reaction mixture was quenched by MeOH (10 mL) and concentrated under reduce pressure to give a residue. The residue was diluted with H₂O (10 mL*3) and extracted with EA (20 mL*3). The combined organic layers were washed with brine (20 mL), dried over anhydrous NaiSCU, filtered and concentrated under reduce pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 25 g SepaFlash® Silica Flash Column, Eluent of 0-77%, PE: (EA withlO%EtOH): 1%TEA@ 35 mL/min) to give 6 (2.6 g, 81.71% yield, 96.71% purity) as a white foam. ESI-LCMS: 672.2 [M+H]⁺; Ή NMR (400 MHz, CDCI3) δ= 12.02 ( s, 1H), 7.96 ( s, 1H), 7.83 (s, 1H),7.51 (d, J=7.4 Hz, 2H), 7.37(d, J=8.6 Hz, 4H), 7.25 - 7.17 (m, 2H),6.80 (t, J=8.4 Hz, 4H), 5.88 (d, >6.3 Hz, 1H), 4.69 (t, J=5.7 Ηζ,ΙΗ), 4.64 (s, 1H), 4.54 (s, 1H),4.19 (d, J=2.9 Hz, 1H), 3.77 (d, J=4.5 Hz, 6H), 3.60 - 3.38 (m, 3H),2.81 (s, 1H), 1.81 (td, >6.9, 13.7Hz, 1H), 0.97 (d, J=6.8 Hz, 3H),0.80 (d, J=6.9 Hz, 3H)

Préparation of Example 10 monomer: To a solution of 6 (8.4 g, 12.5 mmol) in MeCN (80 mL) was added P-l (4.9 g, 16.26 mmol, 5.16 mL) at 0°C, followed by addition of DCI (1.624 g, 13.76 mmol) in one portion at 0°C under Ar. The mixture was stirred at 25 °C for 2 h. Upon completion as monitored by LCMS, the reaction mixture was quenched with saturated aq.NaHCCh (20 mL) and extracted with DCM (50 mL*2). The combined organic

151 layers were dried over anhydrous NazSCU, fîltered and concentrated under reduce pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 40 g SepaFlash® Silica Flash Column, Eluent of 0-52% PE: EA (10%EtOH): 5%TEA, @ 80 mL/min) to give Example 10 monomer (3.4 g, 72.1% yield,) as a white foam. ESI-LCMS:

872.4 [M+H]⁺; *H NMR (400 MHz, CD3CN) δ= 12.46 - 11.07 (m, 1H), 9.29 (s, 1H), 7.84 (d,

J=14.6 Hz, 1H), 7.42 (t, J=6.9 Hz, 2H), 7.34 - 7.17 (m, 7H), 6.85 - 6.77 (m, 4H), 5.95 - 5.77 (m, 1H), 4.56 - 4.40 (m, 2H), 4.24 (dd, J=4.0, 13.3 Hz, 1H), 3.72 (d, J=2.0 Hz, 7H), 3.66 - 3.53 (m, 3H), 3.42 (d, J=11.8Hz, 3H), 2.69-2.61 (m, 1H), 2.60 - 2.42 (m, 2H), 1.16 - 1.00 (m, 18H); ³¹P NMR (162 MHz, CD3CN) δ = 149.975, 149.9 ίο Example 11: Synthesis of 5’ End Cap Monomer

TBSCI

TBSO' OCHj

TFA/EtjSiH

NHBz

TBSO'' 'OCH;

TFA

P1/DCI

HO'' 'OCHj

Example 11 Monomer

Example 11 Monomer Synthesis Scheme

Préparation of (2): To a solution of 1 (40 g, 58.16 mmol) in DMF (60 mL) were added imidazole (11.88 g, 174.48 mmol), Nal (13.08 g, 87.24 mmol), and TBSCI (17.52 g, 116.32 mmol) at 20°C in one portion. The reaction mixture was stirred at 20°C for 12 h. Upon completion, the mixture was diluted with EA (200 mL). The organic layer was washed with

152 brine/water (80 mL/80 mL *4), dried over Na₂SO4, filtered and evaporated to give 2 (50.8 g, crude) as yellow solid. ESI-LCMS: 802.3 [M+H]⁺

Préparation of (3): To a solution of 2 (8.4 g, 10.47 mmol) in DCM (120 mL) were added EtaSiH (3.06 g, 26.3 mmol, 4.2 mL) and TFA (1.29 g, 0.84 mL) dropwise at 0 °C. The reaction mixture was stirred at 20°C for 2 h. The reaction mixture was washed with saturated aq.NaHCCh (15 mL) and brine (80 mL). The organic layer was dried over Na₂SO4, filtered and evaporated. The residue was purified by flash silica gel chromatography (ISCO®; 80 g SepaFlash® Silica Flash Column, Eluent of 0-83% EA/PE gradient @ 80 mL/min) to give 3 (2.92 g, 55.8% yield,) as a white solid. ESI-LCMS: 500.2 [M+H]⁺; Ή NMR (400 MHz, CDC1₃) δ= 8.79 (s, 1H), 8.14 (s, 1H), 8.02 (d, J=7.6 Hz, 2H), 7.64 - 7.58 (m,lH), 7.56 - 7.49 (m, 2H), 5.98 - 5.93 (m, 1H), 4.63 - 4.56 (m, 2H), 4.23 (s, 1H), 3.98 (dd, J=1.5, 13.1 Hz, 1H), 3.75 (dd, >1.5, 13.1 Hz, 1H), 3.28 (s, 3H), 2.06 - 1.99 (m, 1H), 1.00 - 0.90 (m, 9H), 0.15 (d, J=7.0 Hz, 6H).

Préparation of (4): 3 (6 g, 12.01 mmol) and teri-hwO^N-methylsulfonylcarbamate (3.52 g, 18.01 mmol) were co-evaporated with toluene (50 mL), dissolved in dry THF (100 mL), and cooled to 0°C. PPI13 (9.45 g, 36.03 mmol,) was then added, followed by dropwise addition of DIAD (7.28 g, 36.03 mmol, 7.00 mL) in dry THF (30 mL). The reaction mixture was stirred at 20°C for 18 h. Upon completion, the reaction mixture was then diluted with DCM (100 mL) and washed with water (70 mL) and brine (70 mL), dried over Na₂SC>4, filtered and evaporated to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 80 g SepaFlash® Silica Flash Column, Eluent of 0-100% Ethyl acetate/Petroleum ether gradient @ 60 mL/min) followed by reverse-phase HP LC (0.1% NH3.H₂O condition, eluent at 74%) to give 4 (2.88 g, 25 % yield) as a white solid. ESI-LCMS: 677.1 [M+H]⁺ ; Ή NMR (400MHz, CDCI3) δ= 9.24 (s, 1H), 8.84 (s, IH), 8.36 (s, 1H), 8.05 (br d,J=7.3 Hz, 2H), 7.66 - 7.42 (m, 4H), 6.16 (d,

J=5.0 Hz, 1H), 4.52 (br t, J=4.5 Hz, 1H), 4.25 - 4.10 (m, 1H), 3.97 (br dd, J=8.0, 14.8 Hz, 1H),

3.48 (s, 3H), 3.27 (s, 3H), 1.54 (s, 9H), 0.95 (s, 9H), 0.14 (d, J=0.8 Hz, 6H).

Préparation of (5): To a solution of 4 (2.8 g, 4.14 mmol) in THF (20 mL) was added TB AF (4 M, 1.03 mL) and the mixture was stirred at 20°C for 12 h. The reaction mixture was then evaporated. The residue was purified by flash silica gel chromatography (ISCO®; 12 g

SepaFlash® Silica Flash Column, Eluent of 0-6% MeOH/ethyl acetate gradient @ 20 mL/min) to give 5 (2.1 g, 83.92% yield) as a white solid. ESI-LCMS: 563.1 [M+H]⁺; Ή NMR (400MHz, CDCI3) δ= 8.85 - 8.77 (m, 1H), 8.38 (s, 1H), 8.11 - 7.99 (m, 2H), 7.64 -7.50 (m, 4H), 6.19 (d, J=2.8 Hz, 1H), 4.36 - 4.33 (m, 1H), 4.29 (br d, J=4.3 Hz, 1H), 4.22 - 4.02 (m, 2H), 3.65 - 3.59 (m, 3H), 3.28 (s, 3H), 1.54 (s, 9H).

153

Préparation of (6): To a solution of 5 (2.1 g, 3.73 mmol) in DCM (20 mL) was added TFA (7.70 g, 67.53 mmol, 5 mL) at 0°C. The reaction mixture was stirred at 20°C for 24 h. Upon completion, the reaction was quenched with saturated aq. NaHCCf to reach pH 7. The organic layer was dried over Na2SO4, filtered, and evaporated at low pressure. The residue was purified by flash silica gel chromatography (ISCO®; 12 g SepaFlash® Silica Flash Column, Eluent of 0~7% DCM/MeOH gradient @ 20 mL/min) to give 1.6 g (impure, 75% LCMS purity), followed by prep-HPLC [FA condition, column: Boston Uni Cl8 40*150*5um; mobile phase: [water (0.225%FA)-ACN]; B%: 8%-38%,7.7min.] to give 6 (1.04 g, 63.7 % yield) as a white solid. ESI-LCMS: 485.0 [M+Na]⁺; Ή NMR (400 MHz, DMSO-d₆) δ= 11.27 - 11.21 (m, 1H), 8.77 (s, 1H), 8.74 (s, 1H), 8.05 (d, J=7.3 Hz, 2H), 7.68 -7.62 (m, 1H), 7.59 - 7.53 (m, 2H), 7.39 (t, J=6.3 Hz, 1H), 6.16 (d, J=6.0 Hz, 1H), 5.48 (d, J=5.5 Hz, 1H), 4.55 (t,J=5.5 Hz, 1H), 4.43 4.37 (m, 1H), 4.08 - 4.02 (m, 1H), 3.41 - 3.36 (m, 1H), 3.35 (s, 3H), 3.31 - 3.22 (m, 1H), 2.91(s, 3H).

Préparation of (Example 11 monomer): To a solution of 6 (1 g, 2.16 mmol) in DCM (30 mL) was added PI (977.58 mg, 3.24 mmol, 1.03 mL), followed by DCI (306.43 mg, 2.59 mmol) at 0°C in one portion under Ar atmosphère. The mixture was degassed and purged with Ar for 3 times, warmed to 20°C, and stirred for 2 hr under Ar atmosphère. Upon completion as monitored by LCMS and TLC (PE: EtOAc = 4:1), the reaction mixture was diluted with sat.aq. NaHCCL (30 mL) and extracted with DCM (50 mL*2). The combined organic layers were dried over anhydrous Na2SÛ4, filtered, and the filtrate was concentrated under reduced pressure to give a residue. The crude product was purified by reversed-phase HP LC (40 g Cl 8 column: neutral condition, Eluent of 0-57% of 0.3% NH4HCO3 in H2O/CH3CN ether gradient @35 mL/min) to give Example 11 monomer (0.49 g, 33.7% yield) as a white solid. ESI-LCMS: 663.1[M+H]⁺; ‘H NMR (400 MHz, CD3CN) δ= 1.19 - 1.29 (m, 12 H) 2.71 (q, J=5.77 Hz, 2 H) 2.94 (d, J=6.27 Hz, 3 H) 3.35 (d, J=15.56 Hz, 3 H) 3.40 - 3.52 (m, 2 H) 3.61 - 3.97 (m, 4 H) 4.23 - 4.45 (m, 1 H) 4.55 - 4.74 (m, 2 H) 6.02 (dd, J=10.67, 6.40 Hz, 1 H) 7.25 (br s, 1 H) 7.47 - 7.57 (m, 2 H) 7.59 - 7.68 (m, 1 H) 8.01 (d, J=7.78 Hz, 2 H) 8.28 (s, 1 H) 8.66 (s, 1 H) 9.69 (br s, 1 H); ³¹P NMR (162 MHz, CD3CN) δ = 150.92, 149.78.

Example 12. Synthesis of 5’-stabilized end cap modified oligonucleotides

This example provides an exemplary method for synthesizing the siNAs comprising a 5’stabilized end caps disclosed herein. The 5’-stabilized end cap and/or deuterated phosphoramidites were dissolved in anhydrous acetonitrile and oligonucleotide synthesis was performed on a Expedite 8909 Synthesizer using standard phosphoramidite chemistry. An extended coupling (12 minutes) of 0.12 M solution of phosphoramidite in anhydrous CH3CN in

154 the presence of Benzyl-thio-tetrazole (BTT) activator to a solid bound oligonucleotide followed by standard capping, oxidation and sulfurization produced modified oligonucleotides. The 0.02 M 12, THF: Pyridine; Water 7:2:1 was used as an oxidizing agent, while DDTT (dimethylaminomethylidene) amino)-3H-l,2,4-dithiazaoline-3-thione was used as the sulfur-transfer agent for the synthesis of oligoribonucleotide with a phosphorothioate backbone. The stepwise coupling efficiency of ail modified phosphoramidites was achieved around 98%. After synthesis the solid support was heated with aqueous ammonia (28%) solution at 45°C for 16h or 0.05 M K2CO3 in methanol was used to deprotect the base labile protecting groups. The crude oligonucleotides were precipitated with isopropanol and centrifùged (Eppendorf 581 OR, 3000g, 4°C, 15 min) to obtain a pellet. The crude product was then purified using ion exchange chromatography (TSK gel column, 20 mM NaH2PÜ4, 10% CH3CN, 1 M NaBr, gradient 20-60% B over 20 column volumes) and fractions were analyzed by ion change chromatography on an HPLC. Pure fractions were pooled and desalted by Sephadex G-25 column and evaporated to dryness. The purity and molecular weight were determined by HPLC analysis and ESI-MS analysis. Single strand RNA oligonucleotides (sense and antisense strand) were annealed (1:1 by molar équivalents) at 90°C for 3 min followed by RT 40 min) to produce the duplexes.

Example 13. siNA Activity Assays

This example provides exemplary methods for testing the activity of the siNAs disclosed herein.

In vitro Assay:

155

For each well, the HBV on-target mRNA levels were normalized to the GAPDH mRNA level. As shown in Table 6, the activity of the HBV targeting ds-siRNAs was expressed as EC50, 50% réduction of normalized HBV RNA level from no drug control. As shown in Table 6, the cytotoxicity of the HBV targeting ds-siRNAs was expressed by CC50 of 50% réduction of

GAPDH mRNA from no drug control.

Unconjugated siRNA 1) with or without a phosphorylation blocker; and 2) with or without end caps (e.g., 5’-stabilized end cap) are transfected into in vitro disease models or in vitro toxicity models. Afiter transfection, target réduction and/or cell viability is measured and compared after a period of incubation. For HBV, exemplary disease cell models include, but are 10 not limited to, HepG2.2.15, HepG2.117 or live HBV infected HepG2-NTCP or Primary Human Hépatocytes.

In vivo Assay:

GalNAc conjugated siRNA 1) with or without phosphorylation blocker; and 2) with or without 5’- end caps are dosed subcutaneously or intravenously in animal disease models. The 15 target knockdown magnitude and duration is measured from sérum or liver samples and compared to each other and/or control animais (e.g., non-treated diseased animais). In some instances, the toxicity of the siRNAs is compared through routine Clinpath or Histopath assays. For HBV, exemplary animal efficacy models include, but are not limited to, AAV-HBV mouse model, HBV transgenic mouse model, PXB or FRG mouse models.

Example 14. ds-siNA Testing in AAV-HBV Mouse Model

In this example, the efficacy of ds-siNAs in treating HBV in an adeno-associated virus (AAV)-HBV mouse model was evaluated. AAV-HBV mice were subcutaneously injected with a single dose of (a) 5mL/kg of vehicle; or (b) 5mg/kg a ds-siNA at day 0. The sequences of the dssiNA tested in this example are shown in Table 7.

FIG. 4 shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0160 (G03), ds-siNA-0165 (G04), ds-siNA-0163 (G05), or ds-siNA0166 (G06). These results demonstrate that the ds-siNAs containing varions patterns of 2’-fluoro nucléotides and 2’-O-methyl nucléotides can effectively treated HBV.

Table 7. ds-siNA sequences tested in AAV-HBV mouse model
ds-siNA ID	Sense strand sequence (5’-3 ’)	Antisense strand sequence (5’-3’)
ds-siNA- 0160	mCpsmCpsfGmUmGmUfGfCfAmCmUf UmCmGmCmUfUmCmA-p-(PS)2- GalNAc4 (SEQ ID NO: 600)	mUpsfGpsmAmAmGmCmGmAmAmGm UmGmCfAmCmAmCmGmGpsmUpsmC (SEQ ID NO: 272)

156

ds-siNA- 0165	mGpsmUpsfGmGmUmGfGfAfCmUmU fCmUmCmUmCfAmAmU-p-(PS)2GalNAc4 (SEQ ID NO: 601)	mApsfUpsmUmGmAmGmAmGmAmA mGmUmCfCmAmCmCmAmCpsmGpsm A (SEQ ID NO: 292)
ds-siNA- 0163	mGpsmCpsmUmGmCmUfAmUfGfCfC mUmCmAmUmCmUmUmCmUmU-p(PS)2-GalNAc4 (SEQ ID NO: 602)	mApsfApsmGmAmAfGmAmUmGmAm GmGmCfAmUfAmGmCmAmGmCpsmA psmG (SEQ ID NO: 287)
ds-siNA- 0166	mUpsmGpsfU mGmCm AfCfU mUmCm GmCmUmUmCmAfCmCmU-p-(PS)2GalNAc4 (SEQ ID NO: 603)	mApsfGpsmGmUmGmAmAmGmCmGm AmAmGfUmGmCmAmCmApsmCpsmG (SEQ ID NO: 303)

Example 15. ds-siNA Activity Assay and Testing in AAV-HBV Mouse Model

This example investigates the in vitro and in vivo activity of ds-siNAs. The sequences of the ds-siNAs tested in this example are shown in Table 8. As shown in Table 8, the ds-siNAs comprise a sense and antisense strand comprising a mixture of 2’-fluoro and 2’-O-methyl nucléotides. The total number of 2’-fluoro nucléotides in the ds-siNAs are between 6-8. The 2’fluoro nucléotides may be at spécifie positions, such as nucléotide position 3, 5, 7, 8, 9, 10, 11, 12, and/or 17 from the 5’ end of the sense strand or 2, 5, 6, 8, 10, 14, 16, 17, and/or 18. The 2’fluoro nucléotides and 2’-(9-methyl nucléotides might occur at spécifie patterns on the antisense strand, such as an altemating 1:2 or 1:3 pattern, wherein 1 nucléotide is a 2’-fluoro nucléotide and 2 or 3 nucléotides are 2-O-methyl nucléotides.

In vitro Activity Assay

Homo sapiens HepG2.2.15 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) (ATCC 30-2002) supplemented to also contain 10% fêtai calf sérum (FCS). Cells were incubated at 37°C in an atmosphère with 5% CO2 in a humidified incubator. For transfection of HepG2.2.15 cells with HBV targeting siRNAs, cells were seeded at a density of 15000 cells/well in 96-well regular tissue culture plates. Transfection of cells was carried out using RNAiMAX (Invitrogen/Life Technologies) according to the manufacturer’s instructions. Dose-response experiments were done with oligo concentrations of 40, 20, 10, 5, 2.5, 1.25, 0.625, 0.3125, 0.15625 and 0.07813nM. For each HBV targeting siRNA treatment (e.g., ds-siRNA, as identified by the ds-siNA ID in Table 8), four wells were transfected in parallel, and individual data points were collected from each well. After 24h of incubation with siRNA, media was removed, and cells were lysed and analyzed with a QuantiGene2.0 branched DNA (bDNA) probe set spécifie for HBV génotype D (also called Hepatitis B virus subtype ayw, complété genome of 3182 basepairs) as présent in cell line HepG2.2.15.

157

For each well, the HBV on-target mRNA levels were normalized to the GAPDH mRNA level. Table 8 shows the activity of the HBV targeting ds-siRNAs expressed as EC50, which is 50% réduction of normalized HBV RNA level from no drug control, where A = EC50 < 0.5 nM; B = 0.5 nM < EC50 < 1; and C = EC50 > 1.

In vivo testing in AAV-HBVmouse model:

AAV/HBV is a recombinant AAV carrying repli cable HBV genome. Taking advantage of the highly hepatotropic feature of génotype 8 AAV, the HBV genome can be efficiently delivered to the mouse liver cells. Infection of immune competent mouse with AAV/HBV can resuit in long term HBV viremia, which mimics chronic HBV infection in patients. The AAV/HBV model can be used to evaluate the in vivo activity of varions types of anti-HBV agents. Mice were infected with AAV-HBV on day -28 of the study. The test articles or négative control (PB S) were dosed subcutaneously (unless specifîed otherwise) as single dose on days 0 at 5 mg/kg. Serial blood collections were usually taken every 5 days on day 0, 5, 10 and 15 etc. until the termination of studies. Sérum HBV S antigen (HBsAg) was assayed through ELISA.

GalNAc conjugated ds-siNAs were further tested at a single dose of 5mg/kg at day 0 in the adeno-associated virus (AAV)-HBV mouse model. The resulting nadir logio réduction in sérum HBsAg is presented in Table 8, where X > 1 logio réduction in HBsAg, Y is 0.5 - 1 logio réduction in HBsAg, and Z is < 0.5 logio réduction in HBsAg.

FIG. 5A shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01) or ds-siNA-0160 (G03). AAV-HBV mice were subcutaneously injected with a single dose of 5mL/kg of vehicle or 5mg/kg of ds-siNA-0160 on day 0.

FIG. 5B shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01) or ds-siNA-0160 (G15). AAV-HBV mice were subcutaneously injected with a single dose of 5mL/kg of vehicle or 5mg/kg of ds-siNA-0160 on day 0.

FIG. 5C shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01) or ds-siNA-0160 (G03). AAV-HBV mice were subcutaneously injected with a single dose of 5mL/kg of vehicle or 5mg/kg of each ds-siNA on day 0.

FIG. 5D shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0160 (G03), or ds-siNA-0109 (G09). AAV-HBV mice were subcutaneously injected with a single dose of 5mL/kg of vehicle or 5mg/kg of each ds-siNA on day 0.

158

FIGs. 5E-5F show a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01) or ds-siNA-0169 (G18). AAV-HBV mice were subcutaneously injected with a single dose of 5mL/kg of vehicle or 5mg/kg of ds-siNA-0169 on day 0.

FIG. 5G shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01) or ds-siNA-0169 (G04). AAV-HBV mice were subcutaneously injected with a single dose of 5mL/kg of vehicle or 5mg/kg of ds-siNA-0169 on day 0.

FIG. 5H shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01) or ds-siNA-0169 (G04). AAV-HBV mice were subcutaneously injected with a single dose of 5mL/kg of vehicle or 5mg/kg of each ds-siNA on day 0.

FIG. 51 shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0169 (G04) or ds-siNA-0147 (G08). AAV-HBV mice were subcutaneously injected with a single dose of 5mL/kg of vehicle or 5mg/kg of each ds-siNA on day 0.

FIG. 5J shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with 15 vehicle (G01), ds-siNA-0166 (G06), or ds-siNA-0153 (G14). AAV-HBV mice were subcutaneously injected with a single dose of 5mL/kg of vehicle or 5mg/kg of each ds-siNA on day 0.

FIG. 5K shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0163 (G05), or ds-siNA-0119 (G13). AAV-HBV mice were subcutaneously injected with a single dose of 5mL/kg of vehicle or 5mg/kg of each ds-siNA on day 0.

These results demonstrate that ds-siNAs comprising combination of 2’-fluoro nucléotides and 2’-O-methyl nucléotides can be used to target HBV X and S gene sequences, which resulted in successfùl treatment of HBV.

As exemplified by ds-siNA-0160 and ds-siNA-0165, ds-siNAs comprising (a) a sense strand comprising 19 nucléotides, wherein 6 nucléotides are 2’-fluoro nucléotides and 13 nucléotides are 2’-O-methyl nucléotides; (b) an antisense strand comprising 21 nucléotides, wherein 2 nucléotides are 2’-fluoro nucléotides and 19 nucléotides are 2’-(9-methyl nucléotides; and (c) a conjugated moiety, wherein the conjugated moiety is attached to the 3 ’ end of the sense strand, resulted in successfùl treatment of HBV as evidenced by HBsAg réduction in sérum. See FIGs. 4 and 5A-5D, and Table 8. For ds-siNA-0160 and ds-siNA-0165, the 2’-fluoro nucléotides

159 were located at positions 3, 7-9, 12, and 17 from the 5’ end of the sense strand and at positions 2 and 14 from the 5’ end of the antisense strand.

As exemplified by ds-siNA-0166, ds-siNAs comprising (a) a sense strand comprising 19 nucléotides, wherein 4 nucléotides are 2’-fluoro nucléotides and 15 nucléotides are 2’-O-methyl 5 nucléotides; (b) an antisense strand comprising 21 nucléotides, wherein 2 nucléotides are 2’fluoro nucléotides and 19 nucléotides are 2’-O-methyl nucléotides; and (c) a conjugated moiety, wherein the conjugated moiety is attached to the 3’ end of the sense strand, resulted in successful treatment of HBV as evidenced by HBsAg réduction in sérum. See FIGs. 4 and 5J, and Table 8. For ds-siNA-0166, the 2’-fluoro nucléotides were located at positions 3, 7, 8, and 17 from the 5’ 10 end of the sense strand and at positions 2 and 14 from the 5’ end of the antisense strand.

As exemplified by ds-siNA-0153, ds-siNAs comprising (a) a sense strand comprising 19 nucléotides; (b) an antisense strand comprising 21 nucléotides, wherein the nucléotides in the antisense strand comprise at least two altemating 1:3 modification pattern, and wherein approximate 1 nucléotide is a 2’-fluoro nucléotide and 3 nucléotides are 2’-O-methyl nucléotides in repeat pattern; and (c) a conjugated moiety, wherein the conjugated moiety is attached to the 3’ end of the sense strand, resulted in successful treatment of HBV as evidenced by HBsAg réduction in sérum. See FIG. 5J. For ds-siNA-0153, the sense strand comprises 6 2’fluoro nucléotides at positions 3, 7-9, 12, and 17 from the 5’ end of the sense strand. In addition, the antisense strand comprises 5 repeats of the 1:3 modification pattern starting at position 2 from the 5’ end of the antisense strand.

As exemplified by ds-siNA-0109, ds-siNAs comprising (a) a sense strand comprising 19 nucléotides wherein 4 nucléotides are 2’-fluoro nucléotides and 15 nucléotides are 2’-O-methyl nucléotides; (b) an antisense strand comprising 21 nucléotides, wherein 4 nucléotides are 2’fluoro nucléotides and 17 nucléotides are 2’-O-methyl nucléotides; and (c) a conjugated moiety, 25 wherein the conjugated moiety is attached to the 3 ’ end of the sense strand, resulted in successful treatment of HBV as evidenced by HBsAg réduction in sérum. See FIG. 5D. For ds-siNA-0109 the sense strand comprises 4 2’-fluoro nucléotides at positions 5 and 7-9 from the 5’ end of the sense strand. In addition, the antisense strand comprises 5 repeats of the 1:2 modification pattern starting at positions 2, 5, 8, 14, and 17 from the 5’ end of the antisense strand.

As exemplified by ds-siNA-0147, ds-siNAs comprising (a) a sense strand comprising 19 nucléotides; (b) an antisense strand comprising 21 nucléotides, wherein the nucléotides in the antisense strand comprise at least two altemating 1:2 modification pattern, and wherein approximate 1 nucléotide is a 2’-fluoro nucléotide and 2 nucléotides are 2’-O-methyl

160 nucléotides in repeat pattern; and (c) a conjugated moiety, wherein the conjugated moiety is attached to the 3’ end of the sense strand, resulted in successful treatment of HBV as evidenced by HBsAg réduction in sérum. See FIG. 51. For ds-siNA-0147, the 2’-fluoro nucléotides were located at positions 5 and 7-9 from the 5’ end of the sense strand and at positions 2, 6, 14, and 16 5 from the 5’ end of the antisense strand.

Table 8. ds-siNA tested in AAV-HBV Mouse Model

ds- siNA ID	Sense strand sequence (5’-3 ’)	Antisense strand sequence (5’3’)	EC50 HepG2. 2.15*	HBsAg Nadir (Log)**
dssiNA- 0109	mCpsmCpsmGmUfGmUfGfCf AmCmUmUmCmGmCmUmU mCmA-p-(PS)2-GalNac4 (SEQ ID NO: 604)	mUpsfGpsmAmAfGmCmGfA mAmGmUmGmCfAmCmAfC mGmGpsmUpsmC (SEQ ID NO: 605)
ds- siNA- 0119	mGpsmCpsmUmGfCmUmAm UfGfCfCmUmCfAmUmCmU mUfCmUmU-p-(PS)2-GalNac4 (SEQ ID NO: 606)	mApsfApsmGmAmAmGmA mUmGmAmGmGmCfAmUm AmGmCmAmGmCpsmApsm G (SEQ ID NO: 495)
ds- siNA- 0147	mGpsmUpsmGmGfUmGfGfAf CmUmUmCmUmCmUmCmA mAmU-p-(PS)2-GalNac4 (SEQ ID NO: 607)	mApsfUpsmUmGmAfGmAm GmAmAmGmUmCfCmAfCm CmAmCpsmGpsmA (SEQ ID NO: 608)
ds- siNA- 0153	mUpsmGpsfUmGmCmAfCfUf UmCmGfCmUmUmCmAfCm CmU-p-(PS)2-GalNac4 (SEQ ID NO: 609)	mApsfGpsmGmUmGfAmAm GmCfGmAmAmGfUmGmC mAfCmApsmCpsmG (SEQ ID NO: 610)
dssiNA- 0167	mGpsmCpsfGmGmGmGfUfUf UmUmUfCmUmUmGmUfUm GmA-p-(PS)2-GalNac4 (SEQ ID NO: 611)	mUpsfCpsmAmAmCmAmA mGmAmAmAmAmAfCmCm CmCmGmCpsmCpsmU (SEQ ID NO: 285)	A	X
ds- siNA- 0162	mGpsmCpsfGmGmGmGfU fU mUmUmUmCmUmUmGmUf UmGmA-p-(PS)2-GalNac4 (SEQ ID NO: 612)	mUpsfCpsmAmAmCmAmA mGmAmAmAmAmAfCmCm CmCmGmCpsmCpsmU (SEQ ID NO: 285)	C	X

161

dssiNA- 0165	mGpsmUpsfGmGmUmGfGfAf CmUmUfCmUmCmUmCfAm AmU-p-(PS)2-GalNac4 (SEQ ID NO: 601)	mApsfUpsmUmGmAmGmA mGmAmAmGmUmCfCmAm CmCmAmCpsmGpsmA (SEQ ID NO: 292)	A	X
dssiNA- 0168	mUpsmCpsmGmUmGmGfUm GfGfAfCmUmUmCmUmCmU mCmAmAmU-p-(PS)2GalNac4(SEQ ID NO: 613)	. mApsfUpsmUmGmAfGmAm GmAmAmGmUmCfCmAfCm CmAmCmGmApsmGpsmU (SEQ ID NO: 298)	A	X
dssiNA- 0163	mGpsmCpsmUmGmCmUfAm UfGfCfCmUmCmAmUmCmU mUmCmUmU-p-(PS)2GalNac4 (SEQ ID NO: 602)	mApsfApsmGmAmAfGmAm UmGmAmGmGmCfAmUfA mGmCmAmGmCpsmApsmG (SEQ ID NO: 287)	A	Y
ds- siNA- 0161	mCpsmUpsfGmCmUmAfUfGf CmCmUfCmAmUmCmUfUm CmU-p-(PS)2-GalNac4 (SEQ ID NO: 614)	mApsfGpsmAmAmGmAmU mGmAmGmGmCmAfUmAm GmCmAmGpsmCpsmA (SEQ ID NO: 277)	A
dssiNA- 0160	mCpsmCpsfGmUmGmUfGfCf AmCmUfUmCmGmCmUfUm CmA-p-(PS)2-GalNac4 (SEQ ID NO: 600)	mUpsfGpsmAmAmGmCmG mAmAmGmUmGmCfAmCm AmCmGmGpsmUpsmC (SEQ ID NO: 272)	A	X
dssiNA- 0169	mCpsmCpsfGmUmGmUfGfCf AmCmU fümCmGmCmU fUm CmA-p-(PS)2-GalNac4 (SEQ ID NO: 600)	mUpsfGpsmAmAmGmCmG mAmAmGmUmGmCfAmCm AmCmGmGpsTpsT (SEQ ID NO: 375) '	A	X
dssiNA- 0170	mUpsmGpsfUmGmCmAfCfUf UmCmGfCmUmUmCmAfCm CmU- p-(PS)2-GalNac4 (SEQ ID NO: 609)	mApsfGpsmGmUmGmAmA mGmCniGmAmAmGfU mGm CmAmCmApsmCpsmG (SEQ ID NO: 303)	A	X
dssiNA- 0166	mUpsmGpsfUmGmCmAfCfU mUmCmGmCmUmUmCmAfC mCmU-p-(PS)2-GalNAc4 (SEQIDNO: 615)	mApsfGpsmGmUmGmAmA mGmCmGmAmAmGfUmGm CmAmCmApsmCpsmG (SEQ ID NO: 303)	A	X

162

ds- siNA- 0171	mUpsmGpsfUmGmCmAfCfU mUmCmGmCmUmUmCmAfC mCmU- p-(PS)2-GalNac4 (SEQ IDNO: 615)	mApsfGpsmGmUmGmAmA mGmCmGmAmAmGfUmGm CmAmCmApsTpsT (SEQ ID NO: 407)	A	X
mX = 2’-O-methyl nucléotide; fX = 2’-fluoro nucléotide; ps= phosphorothioate linkage * For EC50, A = EC50 < 0.5 nM; B = 0.5 nM < EC50 < 1; and C = EC50 > 1. **For HBsAg Nadir, X > 1 logio réduction in HBsAg, Y is 0.5 - 1 logio réduction in HBsAg, and Z is < 0.5 logio réduction in HBsAg.

Example 16. Testing of ds-siNAs having a 5’-stabiIized end cap in AAV-HBV Mouse Model

This example investigates the in vivo activity of ds-siNAs having a 5’-stabilized end cap. 5 The sequences of the ds-siNAs tested in this example are shown in Table 9.

FIG. 6A shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0160 (G15) (ds-siNA without a 5’-stabilized end cap, e.g., vinyl phosphonate), or ds-siNA-080 (G14) (ds-siNA with a 5’-stabilized end cap, e.g., vinyl phosphonate). AAV-HBV mice were subcutaneously injected with a single dose of 5mL/kg of 10 vehicle or 5mg/kg of each ds-siNA on day 0. The resulting nadir logio réduction in sérum

HBsAg is presented in Table 9, where X > 1 logio réduction in HBsAg, Y is 0.5 - 1 logio réduction in HBsAg, and Z is < 0.5 logio réduction in HBsAg.

FIG. 6B shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0169 (G16) (ds-siNA without a 5’-stabilized end cap, e.g., vinyl 15 phosphonate), or ds-siNA-081 (G13) (ds-siNA with a 5’-stabilized end cap, e.g., vinyl phosphonate). AAV-HBV mice were subcutaneously injected with a single dose of 5mL/kg of vehicle or 5mg/kg of each ds-siNA on day 0. The resulting nadir logio réduction in sérum HBsAg is presented in Table 9, where X > 1 logio réduction in HBsAg, Y is 0.5 - 1 logio réduction in HBsAg, and Z is < 0.5 logio réduction in HBsAg.

FIG. 7A shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0165 (G18) (ds-siNA without a 5’-stabilized end cap, e.g., vinyl phosphonate), or ds-siNA-0127 (G17) (ds-siNA with a 5’-stabilized end cap, e.g., vinyl phosphonate). AAV-HBV mice were subcutaneously injected with a single dose of 5mL/kg of vehicle or 5mg/kg of each ds-siNA on day 0. The resulting nadir logio réduction in sérum

163

FIG. 7B shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0168 (G20) (ds-siNA without a 5’-stabilized end cap, e.g., vinyl phosphonate), or ds-siNA-0150 (G19) (ds-siNA with a 5’-stabilized end cap, e.g., vinyl phosphonate). AAV-HBV mice were subcutaneously injected with a single dose of 5mL/kg of 5 vehicle or 5mg/kg of each ds-siNA on day 0. The resulting nadir logio réduction in sérum HBsAg is presented in Table 9, where X > 1 logio réduction in HBsAg, Y is 0.5 - 1 logio réduction in HBsAg, and Z is < 0.5 logio réduction in HBsAg.

These results demonstrate that the addition of a 5’-stabilized end cap can improve the efficacy of ds-siNAs without a 5’-stabilized end cap.

Table 9. ds-siNA sequences and HBsAg Nadir

ds-siNA ID	Sense strand sequence (5’-3’)	Antisense strand sequence (5’-3’)	HBsAg Nadir (Log)*
ds-siNA- 0160	mCpsmCpsfGmUmGmUfGfC fAmCmUfUmCmGmCmUfU mCmA-(PS)2-p-GalNAc4 (SEQIDNO: 616)	mUpsfGpsmAmAmGmCmGmAmAm GmUmGmCfAmCmAmCmGmGpsm UpsmC (SEQ ID NO: 272)
ds-siNA- 080	mCpsmCpsfGmUmGmUfGfC fAmCmUfUmCmGmCmUfU mCmA-(PS)2-p-GalNAc4 (SEQ ID NO: 616)	VmUpsfGpsmAmAmGmCmGmAmA mGmUmGmCfAmCmAmCmGmGps mUpsmC (SEQ ID NO: 462)	X
ds-siNA- 0169	mCpsmCpsfGmUmGmUfGfC fAmCmUfUmCmGmCmUfU mCmA-(PS)2-p-GalNAc4 (SEQ ID NO: 616)	mUpsfGpsmAmAmGmCmGmAmAm GmUmGmCfAmCmAmCmGmGpsTp sT (SEQ ID NO: 375)
ds-siNA- 081	mCpsmCpsfGmUmGmUfGfC fAmCmUfUmCmGmCmUfU mCmA-(PS)2-p-GalNAc4 (SEQ ID NO: 616)	VmUpsfGpsmAmAmGmCmGmAmA mGmUmGmCfAmCmAmCmGmGpsT psT (SEQ ID NO: 463)	X
ds-siNA- 0165	mGpsmUpsfGmGmUmGfGfA fCmUmUfCmUmCmUmCfA mAmU-(PS)2-p-GalNAc4 (SEQ IDNO: 617)	mApsfUpsmUmGmAmGmAmGmAm AmGmUmCfCmAmCmCmAmCpsmG psmA (SEQ ID NO: 292)	X

164

ds-siNA- 0127	mGpsmUpsfGmGmUmGfGfA fCmUmUfCmUmCmUmCfA mAmU-(PS)2-p-GalNAc4 (SEQ ID NO: 617)	vmApsfUpsmUmGmAmGmAmGmA mAmGmUmCfCmAmCmCmAmCpsm GpsmA (SEQ ID NO: 503)	X
ds-siNA- 0168	mUpsmCpsmGmUmGmGfUm GfGfAfCmUmUmCmUmCm UmCmAmAmU-(PS)2-pGalNAc4 (SEQ ID NO: 618)	mApsfUpsmUmGmAfGmAmGmAmA mGmUmCfCmAfCmCmAmCmGmAp smGpsmU (SEQ ID NO: 298)
ds-siNA- 0150	mUpsmCpsmGmUmGmGfUm GfGfAfCmUmUmCmUmCm UmCmAmAmU-(PS)2-pGalNAc4 (SEQ ID NO: 618)	vmApsfUpsmUmGmAfGmAmGmAm AmGmUmCfCmAfCmCmAmCmGm ApsmGpsmU (SEQ ID NO: 523)	X
mX = 2’-(2-methyl nucléotide; fX = 2’-fluoro nucléotide; ps= phosphorothioate linkage; VP = vinyl phosphonate *For HBsAg Nadir, X > 1 logio réduction in HBsAg, Y is 0.5 - 1 logio réduction in HBsAg, and Z is < 0.5 logio réduction in HBsAg.

Example 17. Efficacy of a Combination Therapy in AAV-HBV Mouse Model This example investigates the efficacy of a combination therapy comprising an antisense oligonucleotide (ASO 1, 5’ GalNAc4-ps-GalNAc4-ps-GalNAc4-po-mA-po- lnGpslnApslnTpslnApslnApsApsAps(5OH)CpsGps(5m)Cps(5m)CpsGps(5m)CpslnApslnGpsln Apscp(5m)C-3’(SEQ ID NO: 534)) and a ds-siNA-0160 for treating HBV in an AAV-HBV mouse model.

FIG. 8A shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0160 (G06), ASO 1 (G18), or a combination of ds-siNA-0160 and

ASO 1 (G20). AAV-HBV mice were subcutaneously injected with (a) 5mL/kg of vehicle, three times a week, from days 0-42 (G01); (b) a single dose of 3mg/kg of ds-siNA-0160 on day 0 (G06); (c) 3mg/kg of ASO 1 on a weekly basis, from days 0-21 (G18); or (d) a combination of ASO 1 and ds-siNA-0160, wherein ASO 1 was administered at a dose of 3mg/kg on a weekly basis, from days 0-21; and ds-siNA-0160 was administered as a single dose of 3mg/kg at day 0.

FIG. 8B shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G01), ds-siNA-0160 (G06), ASO 1 (G18), or a combination of ds-siNA-0160 and ASO 1 (G20). AAV-HBV mice were subcutaneously injected with (a) 5mL/kg of vehicle, three times a week, from days 0-42 (G01); (b) a single dose of lOmg/kg of ds-siNA-0160 on day 0

165 (G06); (c) lOmg/kg of ASO 1 on a weekly basis, from days 0-21 (G18); or (d) a combination of ASO 1 and ds-siNA-0160, wherein ASO 1 was administered at a dose of lOmg/kg on a weekly basis, from days 0-21; and ds-siNA-0160 was administered as a single dose of 3mg/kg at day 0.

FIG. 8C shows a graph of a synergy analysis of an in vitro combination therapy with the ASO 2 and ds-siNA-0164. For the ds-siNA-0164 combination studies with ASO 2, 35,000 cells per well were reverse transfected in a collagen I-coated 96-well plate (Corning, Biocoat; Catalog 356698). Test articles ds-siNA-0164 and ASO 2 were diluted in Opti-MEM™ I Reduced Sérum Medium (Thermo Fisher Scientific; Catalog 31985088) to 40* the desired final test concentration then serially diluted (1:3) up to 5 or 9 distinct concentrations, respectively. A 3.25-pL aliquot of each diluted compound was combined in a checkerboard fashion. This combination of compounds was mixed with 0.3 pL Lipofectamine® RNAiMAX Transfection Reagent (Thermo Fisher Scientific, Catalog 13778150) and 6.2 pL of Opti-MEM™ I Reduced Sérum Medium. After incubating for 20 minutes, the mixture was added to the cells. Space was also allotted for titrations of each compound alone as reference Controls. Cells were incubated with compounds for 3 days at 37°C in a 5% CO2 atmosphère. After that, HBsAg in the supematant of cell culture was assayed by ELIS A and cell viability was measured with Cell Titer Glow, the same procedures as in HepG2.2.15 in vitro assay section. The HBsAg réduction synergy between two test articles were analyzed using MacSynergy Software.

These results demonstrate that a combination therapy with ASO 1 and ds-siNA-0160 resulted in a greater réduction in sérum HBsAg as compared to treatment with ASO 1 or dssiNA-0160 alone.

Example 18. siNA Activity Assays

This example évaluâtes the activity of the siNAs disclosed in Table 10 (as identified by the ds-siNA ID). siRNAs were synthesized as described in Example 1. A conjugated moiety (e.g., ligand monomer) was further conjugated to the 3’ end of the sense strand (note: for dssiNA-067 and ds-siNA-083, the ligand monomer was conjugated to the 5’ end of the sense strand). A 5’-stabilized end cap was further attached to the 5’ end of the antisense strand of some siRNAs.

In vitro Assay.

Homo sapiens HepG2.2.15 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) (ATCC 30-2002) supplemented to also contain 10% fêtai calf sérum (FCS). Cells were incubated at 37°C in an atmosphère with 5% CO2 in a humidified incubator. For transfection of HepG2.2.15 cells with HBV targeting siRNAs, cells were seeded at a density of 15000 cells/well

166 in 96-well regular tissue culture plates. Transfection of cells was carried out using RNAiMAX (Invitrogen/Life Technologies) according to the manufacturer’s instructions. Dose-response experiments were done with oligo concentrations of 40, 20, 10, 5, 2.5, 1.25, 0.625, 0.3125, 0.15625 and 0.07813nM. For each HBV targeting siRNA treatment (e.g., ds-siRNA, as identified by the ds-siNA ID in Table 6), four wells were transfected in parallel, and individual data points were collected from each well. After 24h of incubation with siRNA, media was removed, and cells were lysed and analyzed with a QuantiGene2.0 branched DNA (bDNA) probe set spécifie for HBV génotype D (also called Hepatitis B virus subtype ayw, complété genome of 3182 basepairs) as présent in cell line HepG2.2.15.

For each well, the HBV on-target mRNA levels were normalized to the GAPDH mRNA level. As shown in Table 10, the activity of the HBV targeting ds-siRNAs was expressed as EC50, 50% réduction of normalized HBV RNA level from no drug control, where A = EC50 < 5 nM; B = 5 nM < EC50 < 10; C = EC50 > 10. As shown in Table 10, the cytotoxicity of the HBV targeting ds-siRNAs was expressed by CC50 of 50% réduction of GAPDH mRNA from no drug control.

In vivo Assay:

GalNAc conjugated siRNA with or without 5’- stabilized end caps were subcutaneously injected at a single dose of 5mg/kg into AAV-HBV mi ce. The target knockdown magnitude was measured from sérum. The resulting max HBsAg knockdown (logio) is presented in Table 10, where X > 1 logio réduction in HBsAg, Y is 0.5 - 1 logio réduction in HBsAg, and Z is < 0.5 logio réduction in HBsAg.

Example 19: Analysis of 5’-stabilized end cap on the effïcacy of siNAs

In this example, the rôle of a 5’-stabilized end cap on the effïcacy of siNAs was investigated. Specifically, the first nucléotide on the 5’ end of the antisense strand was modified to contain a 5’-stabilized end cap. The ds-siNAs investigated in this example are shown in the table below:

ds-siNA	Sense Strand Sequence (5’—>3 ’)	Antisense Strand Sequence (5’—>3 ’)
ID
ds-siNA-	mUpsmGpsfUmGmCmAfCfUmUmCmG	mApsfGpsmGmUmGmAmAmGmCm
0166	mCmUmUmCmAfCmCmU-p-(PS)2-	GmAmAmGfUmGmCmAmCmApsm
	GalNAc4 (SEQ ID NO: 615)	CpsmG (SEQ ID NO: 303)
ds-siNA-	mUpsmGpsfUmGmCmAfCfUmUmCmG	vmApsfGpsmGmUmGmAmAmGmC
0155	mCmUmUmCmAfCmCmU-p-(PS)2-	mGm AmAmGfU mGmCm AmCm Aps
	GalNAc4 (SEQ ID NO: 615)	mCpsmG (SEQ ID NO: 525)

167 ds-siNA- mUpsmGpsfUmGmCmAfCfUmUmCmG d2vmApsfGpsmGmUmGmAmAmG

0157 mCmUmUmCmAfCmCmU-p-(PS)2- mCmGmAmAmGfUmGmCmAmCm

GalNAc4 (SEQ ID NO: 615) ApsmCpsmG (SEQ ID NO: 529) mX = 2’-O-methyl nucléotide; fX = 2’-fluoro nucléotide; vmA = 5’-vinyl phosphonate T-Omethyl adenosine; d2vmA = deuterated 5’ vinyl phosphonate adenosine; ps = phosphorothioate linkage

AAV-HBV mice were subcutaneously injected with vehicle or ds-siNAs. ds-siNA-0166, ds-siNA-0155, or ds-siNA-0157 were subcutaneously injected at a single dose of 5mg/kg into AAV-HBV mice. The target knockdown magnitude is measured from sérum. As shown in FIG.

9, the presence of the 5’ stabilized end cap in the first nucléotide from the 5’ end of the antisense strand in ds-siNA-0155 (triangle) and ds-siNA-0157 (square) improved the efficacy of the siNA (squares and triangles) as compared to the siNA without the 5’ stabilized end cap (ds-siNA-0166, diamond). In addition, the presence of the deuterated 5’ vinyl phosphonate in ds-siNA-0157 resulted in a greater improvement in efficacy of a ds-siNA as compared to the presence of the 5’ io vinylphosphanate in ds-siNA-0155. These results demonstrate that a 5’ stabilized end cap improves the efficacy of siNAs, with the greatest improvement seen in siNAs containing deuterated 5’ vinyl phosphonate.

Example 20: Analysis of HBV siRNA S and X Combination Therapy

In this example, combination therapy using an siNA targeting the S gene of HBV and an 15 siNA targeting the X gene of HBV was examined. AAV-HBV mice were treated with vehicle, a single siNA therapy, or a combination siNA therapy targeting the S gene and X gene of HBV. AAV-HBV mice were subcutaneously injected with a single dose of ds-siNA-0160 or ds-siNA0165 on day 0. For the combination siNA therapy, AAV-HBV mice were subcutaneously injected with a single dose of 1.5 mg/kg of ds-siNA-0165 (S trigger) and 1.5 mg/kg of ds-siNA-

0 1 60 (X trigger) on day 0. As shown in FIG. 10, the combination therapy with a siNA targeting the S gene and a siNA targeting the X gene was more potent than the single therapy with dssiNA-0165 or ds-siNA-0160.

168

Example 21. Synthesis of Monomer

Scheme 1

Préparation of (2a): To a solution of la (10.0 g, 29.5 mmol) in ACN (200.0 mL), KSAc (13.5 g, 118.6 mmol) was added at r.t., the mixture was stirred at r.t. for 15 h, TLC showed la was consumed completely. Mixture was fïltered by silica gel and filter cake was washed with DCM (100.0 mL), the filtrate was concentrated to give crude 2a (11.1 g) as an oil. 'H-NMR (400 MHz, CDCh): δ 7.32-7.24 (m, 5H), 7.16 (d, J= 8.9 Hz, 4H), 6.82 (d, J= 8.9 Hz, 4H), 3.82 (s, 6H), 2.28 (s, 3H).

Préparation of (3a): To a solution of crude 2a (11.1 g, 29.2 mmol) in THF (290.0 mL), L1AIH4 (2.0 g, 52.6 mmol) was added at 0°C and kept for 10 min, reaction was stirred at r.t. for 5 h under N2, TLC showed 2a was consumed completely. Mixture was put into aqueous NaHCCh solution and extracted with EA (500.0 mL*2), organic phase was concentrated to give crude which was purified by column chromatography (S1O2, PE/EA = 30:1 to 10:1) to give 3a (8.1g, 95% purity) as a white solid. ESI-LCMS: m/z 335.3 [M-H]’ ; 'H-NMR (400 MHz, CDCh): δ 7.33-7.24 (m, 5H), 7.19 (d, J= 8.8 Hz, 4H), 6.82 (d, J = 8.8 Hz, 4H), 3.83 (s, 6H), 3.09 (s, 1H).

Préparation of (2): To a solution of 1 (20.0 g, 81.3 mmol) inpyridine (400.0 mL), MsCl (10.23 g, 89.43 mmol) was added dropwise at -10°C, reaction was stirred at -10°C for 1 h, LCMS showed 1 was consumed completely, 100.0 mL aqueous NaHCCh solution was added and extracted with DCM (100.0 mL*2), organic phase was concentrated to give crude which was . purified by column chromatography (S1O2, DCM/MeOH = 30:1 to 10:1) to give 2 (9.5 g, 97% purity) as a white solid. ESI-LCMS: m/z 325.3 [M+H]⁺; 'H-NMR (400 MHz, DMSO-îZô): δ 11.45 (s, 1H), 7.64-7.62 (d, J= 8.0 Hz, 1H), 5.92-5.85 (m, 2H), 5.65-5.63 (d, J= 8.0 Hz, 1H), 5.26-5.11 (m, 1H), 4.53-4.37 (m, 2H), 4.27-4.16 (m, 1H), 4.10-4.04 (m, 1H), 3.23 (s, 3H).

169

Préparation of (3): Intermediate 3 was prepared by prepared according to reaction condition described in reference Helvetica Chimica Acta, 2004, 87. 2812. To a solution of 2 (9.2 g, 28.3 mmol) in dry DMSO (130.0 mL). DMTrSH (14.31 g, 42.5 mmol) was added, followed by tetramethylguanidine (3.6 g, 31.2 mmol) was added under N₂, reaction was stirred at r.t. for 3 h, LCMS showed 2 was consumed completely. 100.0 mL H₂O was added and extracted with EA (100.0 mL*2), organic phase was concentrated to give crude which was purified by column chromatography (SiO₂, PE/EA = 5:1 to 1:1) to give 3 (12.0 g, 97% purity) as a white solid. ESILCMS: m/z 563.2 [Μ-H]’; ‘H-NMR (400 MHz, DMSO-t/₆): δ 11.43-11.42 (d,7 = 4.0 Hz, 1H), 7.57-7.55 (d, J= 8.0 Hz, 1H), 7.33-7.17 (m, 9H), 6.89-6.86 (m, 4H), 5.80-5.74 (m, 1H), 5.6510 5.62 (m, 1H), 5.58-5.57 (d, J= 4.0 Hz, 1H), 5.16-5.01 (m, 1H), 3.98-3.90 (m, 1H), 3.73 (s, 6H),

3.73-3.67 (m, 1H), 2.50-2.37 (m, 2H).

Préparation of Example 21 monomer: To a solution of 3 (10.0 g, 17.7 mmol) in dichloromethane (120.0 mL) with an inert atmosphère of nitrogen was added CEOP[N(iPr)₂]₂(6.4 g, 21.2 mmol) and DCI (1.8 g, 15.9 mmol) in order at room température. The resulting solution was stirred for 1.0 h at room température and diluted with 50 mL dichloromethane and washed with 2 x 50 mL of saturated aqueous sodium bicarbonate and 1 x 50 mL of saturated aqueous sodium chloride respectively. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated till no residual solvent left under reduced pressure. The residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH₃CN/H₂O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 6/1; Detector, UV 254 nm. This resulted in to give Example 21 monomer (12.8 g, 98% purity, 93% yield) as an oil. ESI-LCMS: m/z 765.2 [M+H]⁺; ‘H-NMR (400 MHz, DMSOd₆\. δ 11.44 (s, 1H), 7.70-7.66 (m, 1H), 7.32-7.18 (m, 9H), 6.89-6.85 (m, 4H), 5.80-5.64 (m, 2H),

5.38-5.22 (m, 1H), 4.38-4.15 (m, 1H), 3.81-3.70 (m, 8H), 3.61-3.43 (m, 3H), 2.76-2.73 (m, 1H),

2.66-2.63 (m, 1H), 2.50-2.41 (m, 2H), 1.12-1.05 (m, 9H), 0.97-0.95 (m, 3H); ^3IP-NMR (162 MHz, DMSO-î/ô): δ 149.01, 148.97, 148.74, 148.67; ¹⁹F-NMR (376 MHz, DMSO-î/₆): δ 149.01, 148.97, 148.74, 148.67.

Example 22. Synthesis of Monomer

170

Example 22 monomer

Scheme-2

Préparation of (2): To a stirred solution of 1 (2.0 g, 8.8 mmol) in pyridine (20 mL) were added DMTrCl (3.3 g, 9.7 mmol) at r.t. The reaction mixture was stirred at r.t. for 2.5 hrs. With ice-bath cooling, the reaction was quenched with water and the product was extracted with EA (100 mL). The organic phase was evaporated to dryness under reduced pressure to give a residue which was purified by silica gel column chromatography (eluent, DCM: MeOH=50:l~20:l) to give 2 (3.7 g, 7.2 mmol, 80.1%) as a white solid. ESI-LCMS: m/z 527 [M-H]'.

Préparation of (3): To the solution of 2 (2.8 g, 5.3 mmol) in dry DMF (56 mL) was added (CD₃O)2Mg (2.9 g, 31.8 mmol) at r.t. under N2 atmosphère. The reaction mixture was stirred at 100°C for 15 hrs. With ice-bath cooling, the reaction was quenched with saturated aq. NH4CI and extracted with EA (300 mL). The combined organic layer was washed with water and brine, dried over Na2SO4, and concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH₃CN/H2O (0.5% NH₄HCO₃) = 2/3 increasing to CH₃CN/H₂O (0.5% NH₄HCO₃) = 3/2 within 20 min, the eluted product was collected at CH₃CN/ H2O (0.5% NEUHCCh) = 1/1; Detector, UV 254 nm. This resulted in to give 3 (2.0 g, 3.6 mmol, 67.9%) as a white solid. ESI-LCMS: m/z 562 [M-H]'_;Ή-NMR (400 MHz, DMSO-7₆): δ 11.38 (s, 1H), 7.73 (d, J= 8 Hz, 1H), 7.46-7.19 (m, 9H), 6.91 (d, J= 7.4 Hz, 4H), 5.81-5.76 (AB, J= 20 Hz, 1H), 5.30 (d, J= 8 Hz, 1H), 5.22 (s, 1H), 4.254.15 (m, 1H), 3.99-3.92 (m, 1H), 3.85-3.79 (m, 1H), 3.74 (s, 6H), 3.34-3.18 (m, 31H).

Préparation of Example 22 monomer: To a suspension of 3 (2.0 g, 3.5 mmol) in DCM (20 mL) was added DCI (357 mg, 3.0 mmol) and CEP[N(iPr)2]2 (1.3 g, 4.3 mmol). The mixture was stirred at r.t. for 1 h. LC-MS showed 3 was consumed completely. The solution was washed with water twice and washed with brine and dried over Na2SO4. Then concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH₃CN/H2O (0.5% NH4HCO₃) = 1/1 increasing to CH₃CN/H2O (0.5% NH4HCO₃) = 1/0 within 20 min, the eluted product was collected at CH₃CN/ H2O (0.5% NH4HCO₃) = 1/0; Detector, UV 254 nm. This resulted in to give Example 22 monomer (2.1 g, 2.7 mmol, 77.1%) as a white solid. ESI-LCMS: m/z 764 [M+H]⁺ ; 'H-NMR

171 (400 MHz, ACN-i/3): δ 9.45-8.90 (m, 1H, exchanged with D₂O), 7.88-7.66 (m, 1H), 7.50-7.18 (m, 9H), 6.93-6.80 (m, 4H), 5.85 (d, J= 8.2 Hz, 1H),5.29-5.16 (m, 1H), 4.57-4.37 (m, 1H), 4.184.09 (m, 1H), 3.98-3.90 (m, 1H), 3.90-3.74 (m, 7H), 3.74-3.50 (m, 3H), 3.48-3.31 (m, 2H), 2.702.61 (m, 1H), 2.56-2.46 (m, 1H), 1.24-1.12 (m, 9H), 1.09-0.99 (m, 3H). ³¹P-NMR (162 MHz, 5 ACN-J3): δ= 149.87, 149.55.

Ëxample 23. Synthesis of Monomer

Example 23 monomer

Scheme-3

Préparation of (2): To the solution of 1 (39.2 g, 151.9 mmol) in DMF (390.0 mL) was added imidazole (33.0 g, 485.3 mmol) and TBSC1 (57.2 g, 379.6 mmol) at 0°C. The reaction mixture was stirred at room température for 15 hrs under N2 atmosphère. After addition of water, the resulting mixture was extracted with EA (500.0 mL). The combined organic layer was washed with water and brine, dried over Na₂SO4, concentrated to give the crude 2 (85.6 g) as a white solid which was used directly for next step. ESI-LCMS: m/z 487.7 [M+H]⁺.

Préparation of (3): A solution of crude 2 (85.6 g) in a mixture solvent of TFA/H2O = 1/1 (400.0 mL) and THF (400.0 mL) was stirred at 0°C for 30 min. After completion of reaction, the resulting mixture was added con.NH3*H2O to pH = 7, and then extracted with EA (500.0 mL). The organic layer was washed with brine, dried over sodium sulfate and removed to give the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, 172

Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 3/2 within 20 min, the eluted product was collected at CH3CN/H2O (0.5% NH4HCO3) = 1/1; Detector, UV 254 nm. This resulted in to give 3 (36.6 g, 98.4 mmol, 64.7% over two step) as a white solid. ESI-LCMS: m/z 372.5 [M+H]⁺; ^[H-NMR (400 MHz, DMSO-<7₆): δ 11.36 (d, 1 Hz, 1H), 7.92 (d, J=8Hz, 1H), 5.83 (d, J=5Hz, 1H),

5.67-5.65 (m, 1H), 5.19 (s, 1H), 4.30 (t, J= 5 Hz, 1H), 3.85-3.83 (m, 2H), 3.68-3.52 (m, 2H), 0.88 (s, 9H), 0.09 (s, 6H).

Préparation of (4): To the solution of 3 (36.6 g, 98.4 mmol) in dry DCM (200.0 mL) and DMF (50.0 mL) was added PDC (73.9 g, 196.7 mmol), tert-butyl alcohol (188.0 mL) and AC2O (93.0 mL) at r.t under N2 atmosphère, the reaction mixture was stirred at r.t for 2 hrs. The solvent was removed to give a residue which was purified by silica gel column chromatography (eluent, PE/EA = 4:1 ~ 2:1) to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 4 (24.3 g, 54.9 mmol, 55.8%) as a white solid. ESI-LCMS: m/z 443.2 [M+H]⁺; *H-NMR (400 MHz, DMSO-cZô): δ 11.30 (d, J= 1 Hz, 1H), 7.92 (d, J = 8 Hz, 1H), 5.86 (d, J= 6 Hz, 1H), 5.675.65 (m, 1H), 4.33-4.31 (m, 1H), 4.13 (d, J= 3 Hz, 1H), 3.73-3.70 (m, 1H), 1.34 (s, 9H), 0.77 (s, 9H), 0.08 (s, 6H).

Préparation of (5): To the solution of 4 (18.0 g, 40.7 mmol) in dry THF/MeOD/D2O = 10/2/1 (145.0 mL) was added NaBÜ4 (5.1 g, 122.1 mmol) three times during an hour at 50°C, the reaction mixture was stirred at r.t. for 2 hrs. After completion of reaction, adjusted pH value to 7 with CH3COOD, after addition of water, the resulting mixture was extracted with EA (300.0 mL). The combined organic layer was washed with water and brine, dried over Na2SO4, concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 3/2 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/1; Detector, UV 254 nm. This resulted in to give 5 (10.4 g, 27.8 mmol, 68.3%) as a white solid. ESI-LCMS: m/z 375.2 [M+H]⁺; ’H-NMR (400 MHz, DMSO-t/ô): δ 11.36 (d, J= 1 Hz, 1H), 7.92 (d, J= 8 Hz, 1H), 5.83 (d, J= 5 Hz, 1H), 5.675.65 (m, 1H), 5.19 (s, 1H), 4.30 (t, J= 5 Hz, 1H), 3.85-3.83 (m, 2H), 0.88 (s, 9H), 0.09 (s, 6H).

Préparation of (6): To a stirred solution of 5 (10.4 g, 27.8 mmol) in pyridine (100.0 mL) was added DMTrCl (12.2 g, 36.Immol) at r.t., The reaction mixture was stirred at r.t. for 2.5 hrs, the reaction was quenched with water and extracted with EA (200.0 mL). The organic phase was

173 evaporated to dryness under reduced pressure to give a residue which was purified by FlashPrep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 6 (13.5 g, 19.9 mmol, 71.6%) as a white solid. ESI-LCMS: m/z 677.8 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-7₆): δ 11.39 (d, J= 1 Hz, 1H), 7.86 (d, J= 4 Hz, 1H), 7.35-7.21 (m, 9H), 6.90-6.88 (m, 4H), 5.78 (d, J= 2 Hz, 1H), 5.30-5.27 (m, 1H), 4.33-4.30 (m, 1H ), 3.91 (d, J= 7 Hz, 1H), 3.85-3.83 (m, 1H), 3.73 (s, 6H), 3.38 (s, 3H), 0.77 (s, 9H), 0.03 (s, 3H), 0.01 (s, 3H).

Préparation of (7): To a solution of 6 (13.5 g, 19.9 mmol) in THF (130.0 mL) was added 1 M TBAF solution (19.0 mL). The reaction mixture was stirred at r.t. for 1.5 hrs. LC-MS showed 6 was consumed completely. Water (500.0 mL) was added and extracted with EA (300.0 mL), the organic layer was washed with brine and dried over Na2SÛ4. Then the organic layer was concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 3/2 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 1/1; Detector, UV 254 nm. This resulted in to give 7 (10.9 g, 19.4 mmol, 97.5%) as a white solid. ESI-LCMS: m/z 563.6 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-î/ô): δ 11.39 (s, 1H), 7.23 (d, J= 8 Hz, 1H), 7.73 (d, J= 8 Hz, 1H), 7.36-7.23 (m, 9H), 6.90 (d, J= 8 Hz, 4H), 5.81 (d, J= 3 Hz, 1H), 5.30-5.28 (m, 1H), 5.22 (d, J= 7 Hz, 1H), 4.20 (q, 7=7Hz, 1H), 3.93 (d, 7= 7 Hz, 1H), 3.81 (t,7=5Hz, 1H), 3.74 (s, 6H), 3.41 (s, 3H).

Préparation of Example 23 monomer: To a suspension of 7 (10.9 g, 19.4 mmol) in DCM (100.0 mL) was added DCI (1.8 g, 15.7 mmol) and CEP[N(iPr)2]2 (6.1 g, 20.4 mmol). The mixture was stirred at r.t. for 1 h. LC-MS showed 7 was consumed completely. The mixture was washed with water twice and brine, dried over Na2SO4. Then concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give Example 23 monomer (12.5 g, 14.5 mmol, 74.7%) as a white solid. ESI-LCMS: m/z 863.6 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-76): δ 11.39 (s, 1H), 7.81-7.55 (m, 1H), 7.40-7.22 (m, 9H), 6.92-6.87 (m, 4H), 5.83-5.80 (m, 1H), 5.32-5.25 (m, 1H), 4.46-4.34 (m, 1H), 4.10-3.98 (m, 2H), 3.84-3.73 (m, 7H), 3.60-3.50 (m, 3H), 3.42, 3.40 (s, 3H), 2.78 (t, 7= 6 Hz, 1H), 2.62-2.59 (m, 1H), 2.07 (s, 1H), 1.17-0.96 (m, 12H); ³¹P-NMR (162 MHz, DMSO-76): δ 149.37, 149.06.

174

Example 24. Synthesis of Monomer

HO' F imidazole

TBSC1

DMF__

THF/TFA/H₂O

PDC,tert-Butanol

NaBD₄

THF/MeOH-d/D₂O

DMTrCl

Pyridine

5

TBSO' F

TBAF

THF

HO' F

DC1

CEP[N(iPr)₂]₂DCM

Scheme-4

Préparation of (2): To the solution ofl (13.0 g, 52.8 mmol) in DMF (100 mL) was added imidazole (12.6 g, 184.8 mmol) and TBSC1 (19.8 g, 132.0 mmol) at 0 °C, and the reaction mixture was stirred at room température for 15 h under N2 atmosphère. After addition of water, the resulting product was extracted with EA (500 mL). The combined organic layer was washed with water and brine, dried over Na2SO4, and concentrated to give the crude 2 (30.6 g) as a white solid which was used directly for next step. ESI-LCMS: m/z 475 [M+H]⁺. W02017106710A1

Préparation of (3): A solution of crude 2 (30.6 g) in a mixture solvent of TFA/H2O = 1/1 (100 mL) and THF (100 mL) was stirred at 0 °C for 30 min. After completion of reaction, the resulting mixture was added con.NH3*H2O to pH = 7.5, and then the mixture was extracted with EA (500 mL), the organic layer was washed with brine, dried over Na2SÛ4 and removed to give the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 3/2 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/1; Detector, UV 254 nm. This resulted in to give 3 (12.0 g, 33.3 mmol, 65.8% over two step) as a white solid. ESI-LCMS: m/z 361 [M+H]⁺; 'H-NMR (400 MHz,

175

DMSO-e/ô): δ 11.39 (s, J= 1 Hz, 1H, exchanged with D₂O), 7.88 (d, J= 8 Hz, 1H), 5.91-5.86 (m, 1H), 5.66-5.62 (m, 1H), 5.21 (t, 5.2 Hz, 1H, exchanged with D₂O), 5.18-5.03 (m, 1H), 4.37-

4.29 (m, 1H), 3.87-3.83 (m, 1H), 3.78-3.73 (m, 1H), 3.56-3.51 (m, 1H), 0.87 (s, 9H), 0.09 (s, 6H). W02017106710A1.

Préparation of (4): To the solution of 3 (11.0 g, 30.5 mmol) in dry DCM (60 mL) and DMF (15 mL) was added PDC (21. g, 61.0 mmol), tert-butyl alcohol (45 mL) and Ac₂O (32 mL) at r.t under N₂ atmosphère. And the reaction mixture was stirred at r.t for 2 h. The solvent was removed to give a residue which was purified by silica gel column chromatography (eluent, PE: EA=4:1~2:1) to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 4 (9.5 g, 22.0 mmol, 72.3%) as a white solid. ESI-LCMS: m/z 431 [M+H]⁺ _; ‘H-NMR (400 MHz, DMSO-c/₆): δ 11.45 (s, J= 1 Hz, 1H, exchanged with D₂O), 7.93 (d, J= 8.5 Hz, 1H), 6.02-5.97 (m, 1H), 5.76-5.74 (m, 1H), 5.29-5.14 (m, 1H), 4.59-4.52 (m, 1H), 4.29-4.27 (m, 1H), 1.46 (s, 9H), 0.89 (s, 9H), 0.12 (s, 6H).

Préparation of (5): To the solution of 4 (8.5 g, 19.7 mmol) in dry THF/MeOD/D2O = 10/2/1 (80 mL) was added NaBÜ4 (2.5 g, 59.1 mmol) three times per an hour at 50°C. And the reaction mixture was stirred at r.t for 2 h. After completion of reaction, adjusted pH value to 7 with CH3COOD, after addition of water, the resulting mixture was extracted with EA (300 mL). The combined organic layer was washed with water and brine, dried over Na₂SO4, and concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 3/2 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/1; Detector, UV 254 nm. This resulted in to give 5 (3.5 g, 9.7 mmol, 50.3%) as a white solid. ESI-LCMS: m/z 363 [M+H]⁺; Ή-NMR (400 MHz, DMSO-î/ô): δ 11.41 (s, J= 1 Hz, 1H, exchanged with D₂O), 7.88 (d, J= 8 Hz, 1H), 5.91-5.86 (m, 1H), 5.66-5.62 (m, 1H), 5.19 (t, J= 5.2 Hz, 1H, exchanged with D₂O), 5.18-5.03 (m, 1H), 4.374.29 (m, 1H), 3.87-3.83 (m, 1H), 0.88 (s, 9H), 0.10 (s, 6H).

Préparation of (6): To a stirred solution of 5 (3.4 g, 9.7 mmol) in pyridine (35 mL) were added DMTrCl (3.4 g, 10.Immol) at r.t. And the reaction mixture was stirred at r.t for 2.5 h. With ice-bath cooling, the reaction was quenched with water and the product was extracted with EA (200 mL). The organic phase was evaporated to dryness under reduced pressure to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1):

176

Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 6 (PCT Int. Appl., 2019173602), (5.5 g, 8.3 mmol, 85.3%) as a white solid. ESI-LCMS: m/z 665 [M+H]⁺; ’H-NMR (400 MHz, DMSO-Jô): δ 11.50 (d, J= 1 Hz, 1H, exchanged with D₂O), 7.92 (d, J= 4 Hz, 1H), 7.44-7.27 (m, 9H), 6.96-6.93 (m, 4H), 5.94 (d, J= 20.5 Hz, 1H), 5.39-5.37 (m, 1H), 5.32-5.17 (m, 1H ), 4.60-4.51 (m, 1H ), 4.01 (d, J= 8.8 Hz, 1H), 3.80 (s, 6H), 0.80 (s, 9H), 0.09 (s, 3H), 0.05 (s, 3H).

Préparation of (7): To a solution of 6 (5.5 g, 8.3 mmol) in THF (50 mL) was added 1 M TBAF solution (9 mL). The reaction mixture was stirred at r.t. for 1.5 h. LC-MS showed 6 was consumed completely. Water (500 mL) was added. The product was extracted with EA (300 mL) and the organic layer was washed with brine and dried over Na₂SO4. Then the organic layer was concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH₃CN/H₂O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 3/2 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/1; Detector, UV 254 nm. This resulted in to give 7 (4.1 g, 7.5 mmol, 90.0%) as a white solid. ESI-LCMS: m/z 551 [M+H]⁺; ’H-NMR (400 MHz, DMSO-î/ô): δ 11.42 (s, 1H, exchanged with D₂O), 7.76 (d, J= 8.2 Hz, 1H), 7.39-7.22 (m, 9H), 6.90-6.88 (m, 4H), 5.83 (d, J= 20.5 Hz, 1H), 5.65 (d, J= 7.0 Hz, 1H, exchanged with D₂O), 5.29 (d, J= 7.2 Hz, 1H), 5.18-5.03 (m, 1H), 4.40-4.28 (m, 1H), 4.01 (d, J= 8.8 Hz, 1H), 3.74 (s, 6H).

Préparation of Example 24 monomer: To a suspension of 7 (4.1 g, 7.5 mmol) in DCM (40 mL) was added DCI (0.7 g, 6.4 mmol) and CEP[N(iPr)₂]2 (2.9 g, 9.7 mmol). The mixture was stirred at r.t. for 1 h. LC-MS showed 7 was consumed completely. The solution was washed with water twice and washed with brine and dried over Na₂SO4. Then concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = .1/0; Detector, UV 254 nm. This resulted in to give Example 24 monomer (5.0 g, 6.6 mmol, 90.0%) as a white solid. ESI-LCMS: m/z 751 [M+H]⁺; ’H-NMR (400 MHz, DMSO-Jô): δ 11.43 (s, 1H), 7.85-7.82 (m, 1H), 7.40-7.23 (m, 9H), 6.90-6.85 (m, 4H), 5.94-5.86 (m, 1H), 5.40-5.24 (m, 2H), 4.74-4.49 (m, 1H), 4.12-4.09 (m, 2H), 3.79-3.47 (m, 10H), 2.78-2.59 (m, 2H), 1.14-0.93 (m, 12H). ³¹P-NMR (162 MHz, DMSO-J₆): δ 149.67, 149.61, 149.32, 149.27.

177

Example 25. Synthesis of Monomer

imidazole

TBSC1 DMF

DCA

DCM

DMTrCI

Pyridine

TBSO' 'OCD₃

NaBD₄THF/MeOD/D₂O

Example 25 monomer

Scheme-5

Préparation of (4): To the solution of 3 (14.3 g, 25.4 mmol, Scheme 2) in pyridine (150 mL) was added imidazole (4.5 g, 66.6 mmol) and TBSC1 (6.0 g, 40.0 mmol) at 0 °C, and the reaction mixture was stirred at room température for 15 h under N2 atmosphère. After addition of water, the resulting mixture was extracted with EA (500 mL). The combined organic layer was washed with water and brine, dried over Na2SÜ4, and concentrated to give the crude 4 (18.0 g) as a white solid which was used directly for next step. ESI-LCMS: m/z 676 [M-H]’.

Préparation of (5): To the solution of crude 4 (18.0 g) in the solution of DCA (6%) in DCM (200 mL) was added TES (50 mL) at r.t, and the reaction mixture was stirred at room température for 5-10 min. After completion of reaction, the resulting mixture was added pyridine to pH = 7, and then the solvent was removed and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 3/2 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/1; Detector, UV 254 nm. This resulted in to give 5 (6.5 g, 17.2 mmol, 67.7% for two step) as a white solid. ESI-LCMS: m/z 376 [M+H]⁺ _; ’H-NMR (400 MHz, DMSO-c7₆): δ 7.92 (d, J= 8 Hz, 1H), 5.82 (d, J= 5.2 Hz, 1H), 5.68-5.63 (m, 1H), 5.20-5.15 (m, 1H), 4.32-4.25 (m, 1H), 3.87-3.80 (m, 2H), 3.69-3.61 (m, 1H), 3.57-3.49 (m, 1H), 0.88 (s, 9H), 0.09 (s, 6H).

178

Préparation of (6): To the solution of 5 (6.5 g, 17.2 mmol) in dry DCM (35 mL) and DMF (9 mL) was added PDC (12.9 g, 34.3 mmol), tert-butyl alcohol (34 mL) and Ac₂O (17 mL) at r.t under N2 atmosphère. And the reaction mixture was stirred at r.t for 2 hrs. The solvent was removed to give a residue which was purified by silica gel column chromatography (eluent, PE: EA = 4:1-2:1) to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 6 (5.5 g, 12.3 mmol, 70.1%) as a white solid. ESI-LCMS: m/z 446 [M+H]⁺ _; ‘H-NMR (400 MHz, DMSO-Jé): δ = 11.29 (s, 1H), 7.91 (d, J= 8.4 Hz, 1H), 5.85 (d, J= 6.4 Hz, 1H), 5.71-5.61 (m, 1H), 4.35-4.28 (m, 1H), 4.12 (d, J= 3.2 Hz, 1H), 3.75-3.67 (m, 1H), 1.33 (s, 9H), 0.76 (s, 9H), 0.00 (d, J = 1.6 Hz, 6H).

Préparation of (7): To the solution of 6 (5.4 g, 12.1 mmol) in THF/MeOD/D2O= 10/2/1 (44 mL) was added NaBÜ4 (1.5 g, 36.3 mmol) at r.t. and the reaction mixture was stirred at 50°C for 2 hrs. After completion of reaction, adjusted pH value to 7 with CH3COOD. Water was added, the resulting mixture was extracted with EA (500 mL). The combined organic layer was washed with water and brine, dried over Na2SO4, and concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 3/2 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 1/1; Detector, UV 254 nm. This resulted in to give 7 (2.6 g, 6.8 mmol, 56.1%) as a white solid. ESI-LCMS: m/z 378 [M+H]⁺ _; ‘H-NMR (400 MHz, DMSO-t/₆): δ 11.35 (s, 1H), 7.91 (d, J= 8.0 Hz, 1H), 5.82 (d, J= 5.2 Hz, 1H), 5.69-5.60 (m, 1H), 5.14 (s, 1H), 4.34-4.20 (m, 1H), 3.88-3.76 (m, 2H), 0.87 (s, 9H), 0.08 (s, 6H).

Préparation of (8): To a stirred solution of 7 (2.6 g, 6.8 mmol) in pyridine (30 mL) were added DMTrCl (3.5 g, 10.3 mmol) at r.t. And the reaction mixture was stirred at r.t. for 2.5 hrs. With ice-bath cooling, the reaction was quenched with water and the product was extracted into EA (200 mL). The organic phase was evaporated to dryness under reduced pressure to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 8 (4.3 g, 6.3 mmol, 90.1%) as a white solid. ESI-LCMS: m/z 678 [M-H]'; ‘H-NMR (400 MHz, DMSO-tZ₆): δ 11.39 (s, 1H), 7.86 (d, J= 8.0 Hz, 1H), 7.42-7.17 (m, 9H), 6.96-6.83 (m, 4H), 5.82-5.69 (m, 2H), 5.29

179 (d, 8.4 Hz, 1H), 4.36-4.25 (m, 1H), 3.90 (d, J= 7.2 Hz, 1H), 3.86-3.80 (m, 1H), 3.73 (s, 6H),

0.75 (s, 9H), 0.02 (s, 3H), -0.04 (s, 3H).

Préparation of (9): To a solution of 8 (4.3 g, 6.3 mmol) in THF (45 mL) was added 1 M TBAF solution (6 mL). The reaction mixture was stirred at r.t. for 1.5 hrs. LCMS showed 8 was consumed completely. Water (200 mL) was added. The product was extracted with EA (200 mL) and the organic layer was washed with brine and dried over Na₂SC>4. Then the organic layer was concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 3/2 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 1/1; Detector, UV 254 nm. This resulted in to give 8 (3.5 g, 6.1 mmol, 90.1%) as a white solid. ESI-LCMS: m/z 678 [M-H]'; ‘H-NMR (400 MHz, DMSO-î/ê): δ 11.38 (d, J= 2.0 Hz, 1H), 7.23 (d, J= 8.0 Hz, 1H), 7.41-7.19 (m, 9H), 6.94-6.85 (m, 4H), 5.81 (d, J= 4.0 Hz, 1H), 5.33-5.26 (m, 1H), 5.21 (d, J= 7.2 Hz, 1H), 4.06-3.90 (m, 2H), 3.83-3.77 (m, 1H), 3.74 (s, 6H).

Préparation of Example 25 monomer: To a suspension of 9 (2.1 g, 3.7 mmol) in DCM (20 mL) was added DCI (373 mg, 3.1 mmol) and CEP[N(iPr)₂]₂ (1.3 g, 4.4 mmol). The mixture was stirred at r.t. for 1 h. LC-MS showed 9 was consumed completely. The solution was washed with water twice and washed with brine and dried over Na₂SO4. Then concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H₂O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give Example 25 monomer (2.2 g, 3.5 mmol, 80%) as a white solid. ESI-LCMS: m/z 766 [M+H]⁺; 'H-NMR (400 MHz, ACN-i/3): δ 9.65-8.86 (m, 1H, exchanged with D₂O), 7.93-7. 68 (m, 1H), 7.52-7.19 (m, 9H), 6.94-6.78 (m, 4H), 5.95-5.77 (m, 1H), 5.31-5.17 (m, 1H), 4.61-4.37 (m, 1H), 4.20-4.07 (m, 1H), 4.01-3.51 (m, 10H), 2.74-2.59 (m, 1H), 2.57-2.43 (m, 1H), 1.27-1.10 (m, 9H), 1.09-0.95 (m, 3H). ³¹P-NMR (162 MHz, ACN-J3): δ= 149.88, 149.55.

Example 26. Synthesis of Monomer

180

Example 26 monomer

Scheme-6

Préparation of (7): To a solution of 6 (17 g, 25.1 mmol, Scheme 3) in ACN (170 mL) was added DMAP (6.13 g, 50.3 mmol) and TEA (5.1 g, 50.3 mmol, 7.2 mL), Then added TPSC1 (11.4 g, 37.7 mmol) at 0 °C under N2 atmosphère and the mixture was stirred at r.t. for 3 h under N2 atmosphère. Then con. NH3.H2O (27.3 g, 233.7 mmol) was added at r.t. and the mixture was stirred at r.t. for 16 h. The reaction was quenched with water and the product was extracted with EA (200 mL). The organic phase was concentrated to give the crude 7 (17.0 g) as a white solid which was used directly for next step.

Préparation of (8): To a stirred solution of 7 (17.0 g, 25.1 mmol) in pyridine (170 mL) were added BzCl (4.3 g, 30. Immol) 0 °C under N2 atmosphère. And the reaction mixture was stirred at r.t for 2.5 h. With ice-bath cooling, the reaction was quenched with water and the product was extracted with EA (200 mL). The organic phase was evaporated to dryness under reduced pressure to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 8 (19.0 g, 24.3 mmol, 95.6% over two step) as a white solid. ESI-LCMS: m/z 780 [M+H]⁺.

Préparation of (9): To a solution of 8 (19.0 g, 24.3 mmol) in THF (190 mL) was added 1 M TBAF solution (24 mL). The reaction mixture was stirred at r.t. for 1.0 h. LC-MS showed 8 was consumed completely. Water (500 mL) was added. The product was extracted with EA (300 mL) and the organic layer was washed with brine and dried over Na2SO4. Then the organic layer was concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 3/2 within 20 min, the eluted product was 181 collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/1; Detector, UV 254 nm. This resulted in to give 9 (15.2 g, 23.1 mmol, 95.5%) as a white solid. ESI-LCMS: m/z 666 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-î/₆): δ 11.28 (s, 1H), 8.41 (m, 1H), 8.00-7.99 (m, 2H),7.63-7.15 (m, 13H), 6.936.89 (m, 4H), 5.87(s, 1H), 5.20(d, J= 7.4 Hz, 1H), 4.30 (m, 1H), 4.02 (m, 1H), 3.75 (s, 7H), 3.53 5 (s, 3H).

Préparation of Example 26 monomer: To a suspension of 9 (10.0 g, 15.0 mmol) in DCM (100 mL) was added DCI (1.5 g, 12.7 mmol) and CEP[N(iPr)2]2 (5.4 g, 18.0 mmol). The mixture was stirred at r.t. for 1 h. LC-MS showed 9 was consumed completely. The solution was washed with water twice and washed with brine and dried over Na2SO4. Then concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give Example 26 monomer (11.5 g, 13.5 mmol, 90.7%) as a white solid. ESI-LCMS: m/z 866 [M+H]⁺ _; *H-NMR (400 MHz, DMSO-î/ô): δ = 11.28 (s, 1H), 8.48-8.41 (m, 1H), 8.00-7.99 (m, 2H),7.63-7.11 (m,

13H), 6.93-6.89 (m, 4H), 5.92(m, 1H), 4.55-4.44 (m, 1H), 4.17 (m, 1H), 3.95 (m, 1H), 3.80-3.62 (m, 7H), 3.57-3.46 (m, 5H), 3.32 (s, 1H), 2.78 (m, 1H), 2.62-2.59 (m, 1H), 1.19-0.94 (m, 12H); ³¹P-NMR (162 MHz, DMSO-J₆): δ= 149.52, 148.82.

Example 27. Synthesis of Monomer

I) TPSCl; TEA DMAP; ACN 2) NH4OH

TB AF THF

DMTrO

NHBz

CEP[N(iPr)₂]₂; DCI DCM

HO' ’bCD₃

Example 27 monomer

Scheme-7

Préparation of (5): To the solution of 4 (18.8 g, Scheme 5) in dry ACN (200 mL) was added TPSCl (16.8 g, 65.2 mmol) and TEA (5.6 g, 65.2 mmol) and DMAP (6.8 g, 65.2 mmol), and the reaction mixture was stirred at room température for 3.5 hrs under N2 atmosphère. After 182 addition of water, the resulting mixture was extracted with EA (300 mL). The combined organic layer was washed with water and brine, dried over Na₂SÜ4, and concentrated to give the crude 5 (22.0 g) as a white solid which was used directly for next step. ESI-LCMS: m/z 677 [M-H]⁺.

Préparation of (6): To a solution of 5 (22.0 g) in pyridine (150 mL) was added BzCl (6.8 5 g, 48.9 mmol) under ice bath. The reaction mixture was stirred at r.t. for 2.5 hrs. LCMS showed was consumed. The mixture was diluted with EA and water was added. The product was extracted with EA. The crude was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH₃CN/H2O (0.5% NH₄HCO₃) = 1/1 increasing to CH₃CN/H₂O (0.5% NFLHCCh) = 1/0 within 25 min, the eluted product was •10 collected at CH₃CN/H₂O (0.5% NEUHCCh) = 1/0; Detector, UV 254 nm. This resulted in to give the crude 6 (20.8 g, 26.7 mmol, 82% yield over two steps) as a white solid. ESI-LCMS: m/z 781 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-î/₆): δ 11.30 (s, 1H), 8.55 (d, J= 8.0 Hz, 1H), 8.00-7.98 (m, 2H), 7.74-7.66(m, 1H), 7.60-7.50(m, 2H), 7.47-7.31(m, 4H), 7.30-7.2(m, 5H), 7.20-7.1(m, 1H), 6.91 (d, J= 7.4 Hz, 4H), 5.91-5.86 (AB, J= 20.0 Hz, 1H), 4.30 (d, J= 8.0 Hz, 1H), 3.8715 3.78(s, 1H), 3.78-3.70 (m, 6H), 3.62-3.51 (m, 1H), 3.28-3.2 (m, 1H), 2.15-2.05 (m, 3H), 0.73 (s,

9H), 0.00 (m, 6H).

Préparation of (7): To a solution of 6 (20.8 g, 26.7 mmol) in THF (210 mL) was added 1 M TBAF solution (32 mL). The reaction mixture was stirred at r.t. for 1.5 hrs. LCMS showed 6 was consumed completely. Water (600 mL) was added. The product was extracted with EA (400 20 mL) and the organic layer was washed with brine and dried over Na₂SO4. Then the organic layer was concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH₃CN/H₂O (0.5% NH4HCO₃) = 2/3 increasing to CH₃CN/H₂O (0.5% NH4HCO₃) = 3/2 within 20 min, the eluted product was collected at CH₃CN/ H₂O (0.5% NH4HCO₃) = 1/1; Detector, UV 254 nm. This resulted in to give 25 7 (12.4 g, 18.6 mmol, 70%) as a white solid. ESI-LCMS: m/z 667 [M+H]⁺; ‘H-NMR (400 MHz,

DMSO-îZê): δ 11.03 (m, 1H), 8.51-8.48 (m, 1H), 8.08-7.95 (m, 2H), 7.63-7.54(m, 1H), 7.52-7.19 (m, 9H), 7.16-7.07(m,lH), 6.94-6.89 (m, 3H), 5.95-5.87 (m, 1H), 5.31-5.17 (m, 1H), 4.61-4.37 (m, 1H), 4.20-4.07 (m, 1H), 3.82-3.47 (m, 7H), 2.57-2.42 (m, 2H).

Préparation of Example 27 monomer: To a suspension of 7 (12.4 g, 18.6 mmol) in DCM 30 (120 mL) was added DCI (1.7 g, 15.8 mmol) and CEP[N(iPr)₂]₂ (7.3 g, 24.2 mmol). The mixture was stirred at r.t. for 2 hrs. LC-MS showed 7 was consumed completely. The solution was washed with water twice and washed with brine and dried over Na₂SC>4. Then concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH₃CN/H₂O (0.5% NH4HCO₃) = 1/1

183 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give Example 27 monomer (13.6 g, 15.7 mmol, 84.0%) as a white solid. ESI-LCMS: m/z 867 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-t/6): δ 11.03 (m, 1H), 8.51-8.48 (m, 1H), 8.08-7.95 (m, 2H), 7.63-7.54(m, 1H), 7.52-7.19 (m, 9H), 7.16-7.07(m,lH), 6.94-6.89 (m, 3H), 5.95-5.87 (m, 1H), 5.31-5.17 (m, 1H), 4.61-4.37 (m, 1H), 4.20-4.07 (m, 1H), 3.82-3.47 (m, 10H), 2.74-2.59 (m, 1H), 2.57-2.43 (m, 1H), 1.27-1.10 (m, 9H), 1.09-0.95 (m, 3H). ³¹P-NMR (162 MHz, DMSOd6): δ 149.59, 148.85.

Example 28. Synthesis of Monomer

Example 28 monomer

Scheme-8

Préparation of (4): To a solution of 3 (13.1 g, 35.2 mmol, Scheme 3) in pyridine (130 mL) was added MsCl (4.8 g, 42.2 mmol) under -10~0°C. The reaction mixture was stirred at r.t. for 2.5 h under N₂ atmosphère. TLC (DCM/MeOH =15:1) showed the reaction was consumed. The mixture was diluted with EA and water was added. The product was extracted with EA. The organic layer was washed with brine and dried over Na₂SO4 and concentrated to give the crude. This resulted in to give the product 4 (14.2 g) which was used directly for the next step. ESI-LCMS: m/z 451 [M+H]⁺ _; ‘H-NMR (400 MHz, DMSO-î7₆) δ 11.43(m, 1H), 7.677.65(m, 1H), 5.90-5.80(m, 1H), 5.75-5.64(m, 1H), 4.52-4.21(m, 3H), 4.12-3.90(m, 2H), 3.483.21(m, 6H), 0.95-0.78(s, 9H), 0.13-0.03(s, 6H).

Préparation of (5): To a solution of 4 (14.2 g) in DMSO (200 mL) was added DMTrSH (19.6 g, 63.2 mmol) and tetramethylguanidine (5.1 g, 47.4 mmol) at r.t. The reaction mixture was stirred at r.t. for 3.5 h under N₂ atmosphère. LCMS showed 4 the reaction was consumed. The mixture was diluted with EA and water was added. The product was extracted with EA. The

184 organic layer was washed with brine and dried over Na2SÛ4 and concentrated to give the crude. The crude was purified by silica gel column (S1O2, PE/EA = 10:1 — 1:1) to give 5 (14.2 g, 20.6 mmol, 58.5% yield over two steps) as a white solid. ESI-LCMS: m/z 689 [M+H]'_; *H-NMR (400 MHz, DMSO-îZô) δ U.39(m, 1H), 7.63-7.61(d, J= 8.0 Hz, 1H), 7.45-7.1(m, 9H), 6.91-6.81(m, 4H), 5.80-5.70(m, 2H), 4.01-3.91(m, 1H), 3.85-3.78(m, 1H), 3.78-3.65(m, 6H), 3.60-3.51(m, 1H), 3.43-3.2(m, 3H), 2.50-2.32(m, 2H), 0.95-0.77(s, 9H), -0.00-0.02(s, 6H).

Préparation of (6): To a solution of 5 (14.2 g, 20.6 mmol) in THF (140 mL) was added 1 M TBAF solution (20 mL). The reaction mixture was stirred at r.t. under N₂ atmosphère for 2.5 h. LCMS showed 5 was consumed completely. Water was added. The product was extracted with EA and the organic layer was washed with brine and dried over Na₂SO4. Then the organic layer was concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 3/2 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 1/1; Detector, UV 254 nm. This resulted in to give 6 (10.5 g, 18.2 mmol, 88.5%) as a white solid. ESI-LCMS: m/z 576 [M+H]⁺ _;Ή-NMR (400 MHz, DMSO-7₆) δ 11.38(m, 1H), 7.56-7.54(d, J= 8.0 Hz, 1H), 7.45-7.1(m, 9H), 6.91-6.81(m, 4H), 5.80-5.70(m, 2H), 4.05-4.00(m, 1H), 3.81-3.79(m, 1H), 3.74(m, 2H), 3.783.65(m, 6H), 3.60-3.51(m, 1H), 3.43-3.2(m, 3H), 2.40-2.32(m, 1H).

Préparation of Example 28 monomer: To a suspension of 9 (10.5 g, 18.2 mmol) in DCM (100 mL) was added DCI (1.7 g, 15.5 mmol) and CEP[N(iPr)2]2 (7.2 g, 23.7 mmol). The mixture was stirred at r.t. for 1 h. LC-MS showed 9 was consumed completely. The solution was washed with water twice and washed with brine and dried over Na2SO4. Then concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give Example 28 monomer (12.5 g, 16.1 mmol, 88%) as a white solid. ESI-LCMS: m/z 776 [M+H]⁺; *H-NMR (400 MHz, DMSO-îZô) δ 11.41(m, 1H), 7.64-7.59(m, 1H), 7.40-7.25(m, 4H), 7.25-7.10(m, 5H), 6.89-6.86(m, 4H), 5.72-5.67(m, 2H), 4.02-4.00(m, 2H), 3.76-3.74(m, 8H), 3.74-3.73(m, 3H), 3.51-3.49(d, 7=8 Hz, 1H), 3.33-3.29(m, 1H), 2.77-2.73(m, 1H) , 2.63-2.60 (m, 1H), 2.502.47(m, 1H), 1.12-0.99(m, 12H). ³¹P-NMR (162 MHz, DMSO-76): δ 148.92, 148.84.

Example 29. Synthesis of Monomer .

185

TBSÔ F tpsci/nh₄oh

Example 29 monomer

Scheme-9

Préparation of (7): To a solution of 6 (16 g, 24.1 mmol, Scheme 4) in ACN (160 mL) was added DMAP (5.9 g, 48.2 mmol) and TEA (4.8 g, 48.2 mmol), then added TPSC1 (10.9 g, 36.1 mmol) at 0 °C under N₂ atmosphère and the mixture was stirred at r.t. for 5 hrs under N₂atmosphère. Then con. NH3.H2O (30 mL) was added at r.t. and the mixture was stirred at r.t. for 16 h. The reaction was quenched with water and the product was extracted with EA (200 mL). The organic phase was concentrated to give the crude 7 (16.0 g) as a white solid which was used directly for next step.

Préparation of (8): To a stirred solution of 7 (16.0 g, 24.1 mmol) in pyridine (160 mL) were added BzCl (4.1 g, 28.9 mmol) 0°C under N₂ atmosphère. And the reaction mixture was stirred at r.t. for 2.5 h. With ice-bath cooling, the reaction was quenched with water and the product was extracted with EA (200 mL). The organic phase was evaporated to dryness under reduced pressure to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CFhCN/FhO (0.5% NH4HCO3) = 1/1 increasing to CFLCN/FLO (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 8 (18.0 g, 23.4 mmol, 97.0%) as a white solid. ESI-LCMS: m/z 768 [M+H]⁺ _; *H-NMR (400 MHz, DMSO-Jô): δ 11.31 (s, 1H), 8.47(d, J= 7.2 Hz, 1H), 7.99 (d, J= 7.6 Hz, 2H), 7.65-7.16 (m, 13H), 6.92 (d, J= 8.8 Hz, 4H), 6.01 (d, J= 18.4 Hz, 1H), 5.18-5.04 (dd, 1H), 4.58-4.52 (m, 1H), 4.07 (d, J= 9.6 Hz, 1H), 3.75 (s, 6H), 0.73 (s, 9H), 0.05 (s, 3H), -0.06 (s, 3H).

* Préparation of (9): To a solution of 8 (18.0 g, 23.4 mmol) in THF (180 mL) was added 1 M TB AF solution (23 mL). The reaction mixture was stirred at r.t. for 1.5 h. LC-MS showed 8 was consumed completely. Water (500 mL) was added. The product was extracted with EA (300

186 mL) and the organic layer was washed with brine and dried over NaiSCU. Then the organic layer was concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 3/2 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/1 ; Detector, UV 254 nm. This resulted in to give 7 (13.7 g, 21.1 mmol, 90.5%) as a white solid. ESI-LCMS: m/z 654.2 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-ί/ό): δ 11.31 (s, 1H), 8.35(d, J= 7.4 Hz, 1H), 8.01 (m, 2H), 7.65-7.16 (m, 13H), 6.92 (d, J= 8.8 Hz, 4H), 5.94 (d, J= 18.0 Hz, 1H), 5.71 (d, J= 7.0 Hz, 1H), 5.12-4.98 (dd, 1H), 4.51-4.36 (m, 1H), 4.09 (d, J= 9.6 Hz, 1H), 3.75 (s, 6H).

Préparation of Example 29 monomer: To a suspension of 9 (10.6 g, 16.2 mmol) in DCM (100 mL) was added DCI (1.6 g, 13.7 mmol) and CEP[N(iPr)2]2 (5.8 g, 19.4 mmol). The mixture was stirred at r.t. for 1 h. LC-MS showed 9 was consumed completely. The solution was washed with water twice and washed with brine and dried over Na2SO4. Then concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1):

Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give Example 29 monomer (10.5 g, 14.5 mmol, 75.9%) as a white solid. ESI-LCMS: m/z 854.3 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-î7₆): δ 11.31 (s, 1H), 8.41-8.37(m, 1H), 8.01 (d, J= 7.7 Hz, 2H), 7.65-7.16 (m, 13H), 6.92-6.88 (m, 4H), 6.06-5.98 (m, 1H), 5.33-5.15 (m, 1H), 4.78-4.58 (m, 1H), 4.234.19 (m, 1H), 3.81-3.73 (m, 6H), 3.60-3.50 (m, 3H), 3.32 (s, 1H), 2.76 (t, J= 6.0 Hz, 1H), 2.60 (t, .7=5.8 Hz, 1H), 1.15-0.94 (m, 12H) ; ³¹P-NMR (162 MHz, DMSO-îZ₆): δ 150.23, 150.18, 149.43, 149.38.

Example 30. Synthesis of Monomer

187

TBAF THF

CEP[N(iPr),],; DCI DCM

HO' t)CD₃

Example 30 tnonomer

Scheme-10

Préparation of (9): To a solution of 8 (18.8 g, 26.4 mmol, Scheme 5 ) in ACN (200 mL) was added TPSC1 (16.8 g, 55.3 mmol) and DMAP (5.6 g, 55.3 mmol) and TEA (6.8 g, 55.3 mmol). The reaction mixture was stirred at r.t. for 3.5 hrs. LCMS showed the reaction was consumed. The mixture was diluted with con. NH4OH (28 mL). The mixture was diluted with water and EA. The product was extracted with EA. The organic layer was washed with brine and dried over NajSCU and concentrated to give the crude 9 (18.5 g) wihch was used directly for the next step.

Préparation of (10): To a solution of 9 (18.8 g, 27.69 mmol) in pyridine (200 mL) was added BzCl (5.8 g, 41.5 mmol) under ice bath. The reaction mixture was stirred at r.t. for 2.5 hrs. LCMS showed 9 was consumed. The mixture was diluted with EA and water was added. The product was extracted with EA. The crude was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 25 min, the eluted product was collected at CH3CN/H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 10 (19.8 g, 25.3 mmol, 91% yield) as a white solid. ESI-LCMS: m/z 783 [ΜΗ]’; Ή-NMR (400 MHz, DMSO-ri₆): δ 11.29 (d, J= 2.0 Hz, 1H), 8.42 (d, J= 8.0 Hz, 1H), 8.028.00(m,2H), 7.64-7.62(m,lH), 7.60-7.41 (m,2H),7.47.41-7.19 (m, 9H), 6.94-6.85 (m, 4H), 5.81 (d, 4.0 Hz, 1H), 5.33-5.26 (m, 1H), 5.21 (d, J= 7.2 Hz, 1H), 4.06-3.90 (m, 2H), 3.83-3.77 (m, 1H), 3.74 (s, 6H).

Préparation of (11): To a solution of 10 (18.8 g, 26.4 mmol) in THF (190 mL) was added 1 M TBAF solution (28 mL). The reaction mixture was stirred at r.t. for 1.5 hrs. LCMS showed 10 was consumed completely. Water (200 mL) was added. The product was extracted with EA

188 (200 mL) and the organic layer was washed with brine and dried over Na2SO4. Then the organic layer was concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 3/2 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/1; Detector, UV 254 nm. This resulted in to give 11 (17.1 g, 25.6 mmol, 96%) as a white solid. ESI-LCMS: m/z 669 [M-H]'; ‘H-NMR (400 MHz, DMSO-î/₆): δ 11.29 (d, J= 2.0 Hz, 1H), 8.42 (d, J= 8.0 Hz, 1H), 8.028.00(m,2H), 7.64-7.62(m,lH), 7.60-7.41 (m,2H),7.47.41-7.19 (m, 9H), 6.94-6.85 (m, 4H), 5.81 (d, J= 4.0 Hz, 1H), 5.33-5.26 (m, 1H), 5.21 (d, J= 7.2 Hz, 1H), 4.06-3.90 (m, 2H), 3.83-3.77 (m, 1H), 3.74 (s, 6H).

Préparation of Example 30 monomer: To a suspension of 11 (10.8 g, 16.2 mmol) in DCM (100 mL) was added DCI (1.5 g, 13.7 mmol) and CEP[N(iPr)2]2 (5.8 g, 19.3 mmol). The mixture was stirred at r.t. for 2 hrs. LC-MS showed 11 was consumed completely. The solution was washed with water twice and washed with brine and dried over Na2SC>4. Then concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give Example 30 monomer (11.3 g, 13 mmol, 80%) as a white solid. ESI-LCMS: m/z 868 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-J6): δ 11.03 (m, 1H), 8.51-8.48 (m, 1H), 8.08-7.95 (m, 2H), 7.637.54(m, 1H), 7.52-7.19 (m, 9H), 7.16-7.07(m,lH), 6.94-6.89 (m, 3H), 5.95-5.87 (m, 1H), 5.315.17 (m, 1H), 4.61-4.37 (m, 1H), 4.20-4.07 (m, 1H), 3.82-3.47 (m, 10H), 2.74-2.59 (m, 1H), 2.57-2.43 (m, 1H), 1.27-1.10 (m, 9H), 1.09-0.95 (m, 3H). ³¹P-NMR (162 MHz, DMSO-J6): δ 149.52, 148.81.

Example 31. Synthesis of Monomer

189

CEP[N(iPr)₂],; DCI DCM

Scheme-11

Préparation of (2): To a stirred solution of 1 (100.0 g, 406.5 mmol) in pyridine (1000 mL) were added DMTrCl (151.2 g, 447.Immol) at r.t. And the reaction mixture was stirred at r.t. for 2.5 hrs. With ice-bath cooling, the reaction was quenched with water and the product was extracted with EA (3000 mL). The organic phase was evaporated to dryness under reduced pressure to give a residue which was purified by silica gel column chromatography (S1O2, dichloromethane: methanol = 100:1) to give 2 (210.0 g, 90%) as a white solid. ESI-LCMS: m/z 548.2 [M+H]⁺; 'H-NMR (400 MHz, DMSO-76): δ 11.43 (d, J= 1.8 Hz, 1H), 7.77 (d, 7 = 8.0 Hz, 1H), 7.40-7.21(m, 9H), 6.92-6.88(m, 4H), 5.89 (d, 7= 20.0 Hz, 1H), 5.31-5.29 (m, 1H), 5.195.04 (dd, 1H), 4.38-4.31 (m, 1H), 4.02-3.98 (m, 1H), 3.74(s, 6H), 3.30 (d, J= 3.2 Hz, 2H); ¹⁹FNMR (376 MHz, DMSO-76): δ -199.51.

Préparation of (3): To a stirred solution of 2 (100.0 g, 182.8 mmol) in pyridine (1000 mL) were added MsCl (31.2 g, 274.2 mmol) at 0°C under N2 atmosphère. And the reaction mixture was stirred at r.t for 2.5 h. With ice-bath cooling, the reaction was quenched with water and the product was extracted with EA (200 mL). The organic phase was evaporated to dryness under reduced pressure to give the crude (114.0 g) as a white solid which was used directly for next step. To the solution of the crude (114.0 g, 187.8 mmol) in DMF (2000 mL) was added K2CO3

190 (71.5 g, 548.4 mmol), and the reaction mixture was stirred at 90 °C for 15 h under N₂atmosphère. After addition of water, the resulting mixture was extracted with EA (500 mL). The combined organic layer was washed with water and brine, dried over Na₂SO4, and concentrated to give a residue which was purified by silica gel column chromatography (SiO₂, dichloromethane: methanol = 30:1) to give 3 (100.0 g, 90%) as a white solid. ESI-LCMS: m/z 531.2 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-cZ₆): δ 7.79 (d, J= 8.0 Hz, 1H), 7.40-7.21(m, 9H), 6.89-6.83(m, 4H), 6.14 (d, J= 5.4 Hz, 1H), 6.02-5.90 (dd, 1H), 5.87 (d, J= 20.0 Hz, 1H), 5.45 (m, 1H), 4.61 (m, 1H), 3.73(d, J= 1.9 Hz, 6H), 3.30-3.15 (m, 2H), 1.24-1.16 (m, 1H); ¹⁹F-NMR (376 MHz, DMSO-î/ô): δ -204.23.

ίο Préparation of (4): A solution of 3 (100 g, 187.8 mmol) in THF (1000 mL) was added 6N

NaOH (34 mL, 206.5 mmol). The mixture was stirred at r.t. for 6 h. After completion of reaction, the resulting mixture was added H₂O, and then the mixture was extracted with EA, the organic layer was washed with brine, dried over sodium sulfate and removed to give the residue was purified by silica gel column chromatography (SiO₂, dichloromethane: methanol = 30:1) to give

4 (90.4 g, 90%) as a white solid. ESI-LCMS: m/z 548.2 [M+H]⁺; ¹⁹F-NMR (376 MHz, DMSOde): δ -184.58.

Préparation of (5): To a stirred solution of 4 (90.4 g, 165.2 mmol) in pyridine (1000 mL) were added MsCl (61.5 g, 495.6 mmol) at 0°C under N₂ atmosphère. And the reaction mixture was stirred at r.t for 16 hrs. With ice-bath cooling, the reaction was quenched with water and the 20 product was extracted with EA. the organic layer was washed with brine, dried over sodium sulfate and removed to give the residue was purified by silica gel column chromatography (SiO₂, PE: EA = 1:1) to give 5 (75.0 g, 90%) as a white solid. ESI-LCMS: m/z 626.2 [M+H]⁺ _; ‘H-NMR (400 MHz, DMSO-de): δ 11.51 (d, 7= 1.6 Hz, 1H), 7.43-7.23(m, 10H), 6.92-6.88(m, 4H), 6.08 (d, J= 20.0 Hz, 1H), 5.55-5.39 (m, 2H), 4.59 (m, 1H), 3.74(s, 6H), 3.48-3.28 (m, 2H), 3.17 (s,

3H); ^I9F-NMR (376 MHz, DMSO-7₆): δ -187.72.

Préparation of (6): To the solution of 5 (75.0 g, 120.4 mmol) in DMF (1500 mL) was added KSAc (71.5 g, 548.4 mmol) at 110 °C under N₂ atmosphère, After the reaction mixture was stirred at 110 °C for 3 h were added KSAc (7L5 g, 548.4 mmol) under N₂ atmosphère. And the reaction mixture was stirred at r.t for 16 h. After addition of water, the resulting mixture was 30 extracted with EA. The combined organic layer was washed with water and brine, dried over Na₂SC>4, and concentrated to give a residue which was purified by silica gel column chromatography (SiO₂, PE: EA = 1:1) to give 6 (29.0 g, 90%) as a white solid. ESI-LCMS: m/z 605.2 [M+H]⁺ _; ‘H-NMR (400 MHz, DMSO-7₆): δ 11.45 (d, J= 1.9 Hz, 1H), 7.95(d, J= 8.0 Hz, 1H), 7.38-7.21 (m, 9H), 6.92-6.87 (m, 4H), 5.93 (m, 1H), 5.50-5.36 (dd, 1H), 5.25-5.23 (dd, 1H),

191

4.54-4.42 (m, 1H), 4.17-4.12 (m, 1H), 3.74 (m, 7H), 3.35-3.22 (m, 2H), 2.39 (s,lH); ^I9F-NMR (376 MHz, DMSO-Jô): δ -181.97.

Préparation of (7): A solution of 6 (22 g, 36.3 mmol) in a mixture solvent of THF /MeOH (1:1, 200 mL) was added IN NaOMe (70 mL, 72.6 mmol)was stirred at 20 °C for 4 h. After completion of reaction, the resulting mixture was added H₂O, and then the mixture was extracted with EA, the organic layer was washed with brine, dried over sodium sulfate and removed to give the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CNÆUO (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H₂O (0.5% NH4HCO3) = 3/2 within 25 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) =4/3; Detector, UV 254 nm. This resulted in to give 7 (10.5 g, 14.5 mmol, 75.9%) as a white solid. ESI-LCMS: m/z 565.1 [M+H]⁺ _; *H-NMR (400 MHz, DMSO-cZô): δ 11.45 (s, 1H), 7.83(d, J= 8.0 Hz, 1H), 7.40-7.23 (m, 9H), 6.90 (d, J= 8.8 Hz, 4H), 5.88 (m, 1H), 5.29-5.15 (m, 2H), 3.72 (m, 7H), 3.43 (m, 2H), 2.78 (d, J= 10.6 Hz, 1H).

Préparation of Example 31 monomer: To a suspension of 7 (10.5 g, 18.6 mmol) in DCM (100 mL) was added DCI (1.8 g, 15.7 mmol) and CEP[N(iPr)₂]₂ (6.7 g, 22.3 mmol). The mixture was stirred at r.t. for 1 h. LC-MS showed 8 was consumed completely. The solution was washed with water twice and washed with brine and dried over Na₂SO4. Then concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H₂O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give Example 31 monomer (10.5 g, 14.5 mmol, 75.9%) as a white solid. ESI-LCMS: m/z 765.3 [M+H]⁺; 'H-NMR (400 MHz, DMSO-t/ô): δ 11.40 (d, J= 12.2 Hz, 1H), 7.90-7.86(m, 1H), 7.41-7.24 (m, 9H), 6.916.89 (m, 4H), 5.97 (m, 1H), 5.33-5.10 (m, 2H), 4.18-4.16 (m, 1H), 3.91-3.39 (m, 17H), 2.81 (t, J = 5.6 Hz, 1H), 2.66 (t, J= 6.0 Hz, 1H), 1.33-0.97 (m, 12H) ; ³¹P-NMR (162 MHz, DMSO-7₆): δ 164.57, 160.13.

192

Example 32. Synthesis of Monomer

DMTrCl Pyridine

IJMsCl Pyridine

2) K₂CO₃DMF

Example 32 monomer

Scheme-12

Préparation of (2): To a stirred solution of 1 (100.0 g, 387.5 mmol) in pyridine (1000 mL) was added DMTrCl (151.2 g, 447. Immol) at r.t. And the reaction mixture was stirred at r.t. for 2.5 hrs. With ice-bath cooling, the reaction was quenched with water and the product was extracted with EA (3000 mL). The organic phase was evaporated to dryness under reduced pressure to give a residue which was purified by silica gel column chromatography (SiO₂, dichloromethane: methanol = 100:1) to give 2 (200.0 g, 90%) as a white solid. ESI-LCMS: m/z

561 [M+H]⁺.

Préparation of (3): To a stirred solution of 2 (73.0 g, 130.3 mmol) in pyridine (730 mL) were added MsCl (19.5 g, 169.2 mmol) at 0°C under N₂ atmosphère. And the reaction mixture was stirred at r.t for 2.5 h. With ice-bath cooling, the reaction was quenched with water and the product was extracted with EA (200 mL). The organic phase was evaporated to dryness under reduced pressure to give the crude (80.0 g) as a white solid which was used directly for next step. To the solution of the crude (80.0 g, 130.3 mmol) in DMF (1600 mL) was added K₂CCh (71.5 g, 390.9 mmol), and the reaction mixture was stirred at 90 °C for 15 h under N₂ atmosphère. Aller addition of water, the resulting mixture was extracted with EA (500 mL). The combined organic layer was washed with water and brine, dried over Na₂SÜ4, and concentrated to give a residue

193 which was purified by silica gel column chromatography (S1O2, dichloromethane: methanol = 30:1) to give 3 (55.0 g, 90%) as a white solid. ESI-LCMS: m/z 543. [M+H]⁺; ’H-NMR (400 MHz, DMSO-î/ô): δ 7.68 (d, J=8.0 Hz, 1H), 7.40-7.21(m, 9H), 6.89-6.83(m, 4H), 5.96(s, 1H), 5.83 (d, J= 5.4 Hz, 1H), 5.26 (s, 1H), 4.59 (s, 1H), 4.46 (t, J= 6.0 Hz, 1H), 3.72(s, 6H), 3.44(s, 3H), 3.18-3.12 (m, 2H).

Préparation of (4): A solution of 3 (55 g, 101.8 mmol) in THF (550 mL) was added 6N NaOH (34 mL, 206.5 mmol). The mixture was stirred at 20 °C for 6 hrs. After completion of reaction, the resulting mixture was added H₂O, and then the mixture was extracted with EA, the organic layer was washed with brine, dried over sodium sulfate and removed to give the residue was purified by silica gel column chromatography (S1O2, dichloromethane: methanol = 30:1) to give 4 (57.4 g, 87%) as a white solid. ESI-LCMS: m/z 561 [M+H]⁺.

Préparation of (5): To a stirred solution of 4 (57.4 g, 101.8 mmol) in pyridine (550 mL) were added MsCl (61.5 g, 495.6 mmol) at 0°C under N2 atmosphère. And the reaction mixture was stirred at r.t for 16 h. With ice-bath cooling, the reaction was quenched with water and the product was extracted with EA. the organic layer was washed with brine, dried over sodium sulfate and removed to give the residue was purified by silica gel column chromatography (S1O2, PE: EA = 1:1) to give 5 (57.0 g, 90%) as a white solid. ESI-LCMS: m/z 639 [M+H]⁺

Préparation of (6): To the solution of 5 (57.0 g, 89.2 mmol) in DMF (600 mL) was added KSAc (71.5 g, 448.4 mmol) at 110 °C under N2 atmosphère, After the reaction mixture was stirred at 110 °C for 3 h were added KSAc (71.5 g, 448.4 mmol) under N2 atmosphère. And the reaction mixture was stirred at r.t for 16 h. After addition of water, the resulting mixture was extracted with EA. The combined organic layer was washed with water and brine, dried over Na2SO4, and concentrated to give a residue which was purified by silica gel column chromatography (S1O2, PE: EA = 1:1) to give 6 (29.0 g, 47%) as a white solid. ESI-LCMS: m/z 619.2 [M+H]⁺; ’H-NMR (400 MHz, DMSO-î/₆): δ 11.41 (s, 1H), 8.06 (s, 1H), 7.40-7.23 (m, 9H), 6.90 (d, J= 8.8 Hz, 4H), 5.82 (s, 1H), 5.10-5.08 (dd, 1H), 4.38-4.34 (m, 1H), 4.08-4.02 (m, 3H), 3.74 (s, 6H), 3.45 (s, 3H),3.25 (m, 2H), 2.37 (s, 3H); ESI-LCMS: m/z 619 [M+H]⁺ .

Préparation of (7): A solution of 6 (22 g, 35.3 mmol) in a mixture solvent of THF /MeOH (1:1, 200 mL) was added IN NaOMe (70 mL, 72.6 mmol)was stirred at 20 °C for 4 h. After completion of reaction, the resulting mixture was added H2O, and then the mixture was extracted with EA, the organic layer was washed with brine, dried over sodium sulfate and removed to give the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 3/2 within 25 min, the eluted product was collected at CH3CN/

194

H2O (0.5% NH4HCO3) =4/3; Detector, UV 254 nm. This resulted in to give 7 (14.0 g, 70.9%) as a white solid. ESI-LCMS: m/z 576.1 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-J₆): δ 11.38 (s, 1H), 7.90(d, 7= 8.0 Hz, 1H), 7.40-7.23 (m, 9H), 6.90 (d, 7=8.8 Hz, 4H), 5.80 (s, 1H), 5.15-5.13 (dd, 1H), 3.93 (m, 1H),3.87 (d, 7= 5.0 Hz, 1H), 3.74 (s, 6H), 3.59 (m, 2H), 3.49 (s, 3H),3.39 (d, 7 = 2.2 Hz, 2H), 2.40 (d, 7= 10.2 Hz, 1H).

Préparation of Example 32 monomer: To a suspension of 7 (10.5 g, 18.6 mmol) in DCM (100 mL) was added DCI (1.8 g, 15.7 mmol) and CEP[N(iPr)2]2 (6.7 g, 22.3 mmol). The mixture was stirred at r.t. for 1 h. LC-MS showed 7 was consumed completely. The solution was washed with water twice and washed with brine and dried over Na2SO4. Then concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give Example 32 monomer (10.5 g, 14.5 mmol, 75.9%) as a white solid. ESI-LCMS: m/z 776.3 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-Jô): δ 11.40 (d, 7= 12.2 Hz, 1H), 8.04-7.96(dd, 1H), 7.43-7.24 (m, 9H), 6.926.87 (m, 4H), 5.84 (m, 1H), 4.93 (m, 1H), 4.13 (m, 1H), 3.91-3.39 (m, 17H), 2.82 (t, 7= 5.6 Hz, 1H), 2.68 (t, 7= 6.0 Hz, 1H), 1.22-0.97 (m, 12H) ; ^3IP-NMR (162 MHz, DMSO-76): δ 165.06, 157.59.

Example 33. Synthesis of 5’ End Cap Monomer

Imidazole DMTrO—DCM DMTrO— ^H° /° TBS 1 O MOPO-p' ΜΟΡΟ HCOOH/H₂O TBSO 'b / 5

_H0 EDCI; Pyridine Toluene \ q 6%DCA in DCM TFA; DMSO , ^O=\.O. ________ \/ --x ··— OPOM b b ^TBS° /° TBSO' O MOPO-p=_O / I OPOM 9 ³ 4 K ² q' OPOM % \ O Π 0 / > MOPO-p' CEP[N(iPr)₂]₂; DCI _ù/ /^° Κ-χΟ ΜΟΡΟ ^DCM______ ΙΓ° )__/ ^O . °\ ° HO O \ ,P-0 / /—N \ _c ) CN O Example 33 monomer Scheme-13

195

Préparation of (2): To a solution of 1 (11.2 g, 24.7 mmol) in DCM (120 mL), imidazole (4.2 g, 61.9 mmol) and TBSC1 (5.6 g, 37.1 mmol) were added at r.t., mixture was stirred at r.t. for 15 hrs, LCMS showed 1 was consumed completely. Mixture was added water (500 mL) and extracted with DCM (50 mL*2). The organic phase was dried over NaiSO4 and concentrated to give 2 (16.0 g) as an oil for the next step.

Préparation of (3): To a solution of 2 (16.0 g, 28.4 mmol) was added 6% DCA in DCM (160 mL) and triethylsilane (40 mL) at r.t. The reaction mixture was stirred at r.t. for 2 hrs. TLC showed 2 was consumed completely. Water (300 mL) was added, mixture was extracted with DCM (50 mL*4), organic phase was dried by NazSCfi, concentrated by reduce pressure to give crude which was purified by column chromatography (S1O2, PE/EA = 10:1 to 1:1) to give 3 (4.9 g, 65.9% yield) as an oil. ESI-LCMS: m/z 263 [M+HjjH-NMR (400 MHz, DMSO-7₆) δ 4.84-4.50(m, 1H), 4.3-4.09(m, 1H), 3.90-3.80(m, 1H), 3.75-3.67(m, 1H), 3.65-3.57(m, 2H), 3.50-3.44(m, 1H), 3.37-3.28(m, 4H), 0.95-0.78(s, 9H), O.13-O.O3(s, 6H).

Préparation of (4): To a solution of 3 (3.3 g, 12.6 mmol) in DMSO (33 mL) was added EDCI (7.2 g, 37.7 mmol) .The mixture was added pyridine (1.1 g, 13.8 mmol) and TFA (788.6 mg, 6.9 mmol). The reaction mixture was stirred at r.t. for 3 hrs. TLC (PE/EA = 4:1) showed 3 was consumed. The mixture was diluted with EA and water was added. The product was extracted with EA. The organic layer was washed with brine and dried over Na2SÜ4 and concentrated to give the crude. This resulted in to give 4 (3.23 g) as an oil for the next step.

Préparation of (5): To a solution of 4 (3.3 g, 12.6 mmol) in toluene (30 mL) was added POM ester 4a ( reference for 4a Journal of Médicinal Chemistry, 2018, 61 (3), 734-744) (7.9 g, 12.6 mmol) and KOH (1.3 g, 22.6 mmol) at r.t. The reaction mixture was stirred at 40 °C for 8 hrs. LCMS showed 4 was consumed. The mixture was diluted with water and EA was added. The product was extracted with EA. The organic layer was washed with brine and dried over Na2SÛ4 and concentrated to give the crude. The crude was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/H2O (0.5% NH4HCO3) = 91/9 Detector, UV 254 nm. This resulted in to give 5 (5.4 g, 9.5 mmol, 75.9% yield) as an oil. ESI-LCMS: m/z 567.2 [M+H]⁺; ‘H-NMR (400 MHz, CDCI3) δ 6.89-6.77(m, 1H), 6.07-5.96(m, 1H), 5.86-5.55(m, 4H), 4.85 -4.73(m, 1H), 4.36-4.27(m, 1H), 4.05-3.96(m, 1H), 3.95-3.85(m, 1H), 3.73-3.65(m, 1H), 3.44-3.35 (m, 3H), 1.30-1.25(s, 18H), 0.94-0.84(s, 9H), 0.14-0.05(s, 6H).³¹P-NMR (162 MHz, CDC1₃)ô 18.30, 15.11.

196

Préparation of (6): To a solution of 5 (5.4 g, 9.5 mmol) in HCOOH (30 mL) /H₂O (30 mL) = 1:1 at r.t. The reaction mixture was stirred at r.t. for 15 hrs. LCMS showed the reaction was consumed. The mixture was diluted with con. NH4OH till pH = 7.5. The product was extracted with EA. The organic layer was washed with brine and dried over Na₂SÛ4 and concentrated to give the crude. The crude was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN/FEO (0.5%HCOOH) = 30/70 increasing to CH3CN/H2O (0.5% HCOOH) = 70/30 within 45 min, the eluted product was collected at CH3CN/ H₂O (0.5% HCOOH) = 59/41 Detector, UV 220 nm. This resulted in to give 6 (2.4 g, 5.7 mmol, 59.4% yield) as an oil. ESI-LCMS: m/z 453.2 [M+H]⁺; *H-NMR (400 MHz, DMSO-î/ô) δ 6.84-6.68(m, 1H), 6.07-5.90(m, 1H), 5.64- 5.55(m, 4H), 5.32-5.24(m, 1H), 4.23-4.15(m, 1H), 4.00-3.90(m, 1H), 3.89-3.80(m, 1H), 3.78-3.69(m, 2H), 3.37-3.30(s, 3H), 1.30-1.10(s, 18H). ³¹P-NMR (162 MHz, DMSO-d₆) δ 18.14.

Préparation of Example 33 monomer: To a solution of 6 (2.1 g, 4.5 mmol) in DCM (21 mL) were added DCI (452.5 mg, 3.8 mmol) and CEP[N(iPr)₂]₂ (1.8 g, 5.9 mmol) at r.t. The reaction mixture was stirred at r.t. for 15 hrs under N₂ atmosphère. LCMS showed 6 was consumed. The mixture was diluted with water. The product was extracted with DCM (30 mL). The organic layer was washed with brine and dried over Na₂SO4 and concentrated to give the crude. The crude was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H₂O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H₂O (0.5% NH4HCO3) = 1/0 within 28 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 80/20 Detector, UV 254 nm. This resulted in to give Example 33 monomer (2.8 g, 4.3 mmol, 95.2% yield) as an oil. ESI-LCMS: m/z 653.2 [M+H]⁺; ’H-NMR (400 MHz, DMSO-î/ô) δ 6.89-6.77(m, 1H), 6.11-5.96(m, 1H), 5.65-5.50(m, 4H), 4.39-4.34(d, J= 20 Hz, 1H), 4.18-3.95(m, 2H), 3.94-3.48(s, 6H), 3.40-3.28(m, 4H), 2.84-2.75 (m, 2H), 1.261.98(s, 30H). ^3IP-NMR (162 MHz, DMSO-J₆) δ 149.018, 148.736, 17.775, 17.508.

Example 34. Synthesis of 5’ End Cap Monomer

197

OPOM tbso' b

MOPO-p=o ¹ f ,ΟΡΟΜ q'^P'OPOM ⁵

CEP, DCI.DCM

Example 34 monomer

Scheme-14

Préparation of (2): To a solution of 1 (ref for 1 Tetrahedron , 2013, 69, 600-606) (10.60 g, 47.32 mmol) in DMF (106 mL), imidazole (11.26 g, 165.59 mmol) and TBSC1 (19.88 g, 132.53 mmol) were added. The mixture was stirred at r.t. for 3.5 hrs, LCMS showed 1 was consumed completely. Water was added and extracted with EA, dried over by Na^SCL. The filtrate was evaporated under reduced pressure to give 2 (20.80 g, 45.94 mmol, 97.19% yield) for the next step.

Préparation of (3): To a solution of 2 (20.80 g, 45.94mmol) in THF (248 mL), was added TFA (124 mL) and H₂O (124 mL) at 0°C, reaction mixture was stirred for 30 min. LCMS showed 2 was consumed completely. Then was extracted with EA, washed with sat. NaCl (aq.), dried over by Na₂SO4. The filtrate was evaporated under reduced pressure to give the crude product which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H₂O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H₂O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 3 (10.00 g, 29.59 mmol, 64.31% yield). ‘H-NMR (400 MHz, DMSO-J₆): δ 7.33-7.18(m, 5H), 4.83-4.80(m, 1H), 4.61-4.59(m, 1H), 4.21-4.19(m, 1H), 3.75-3.74(m, 1H), 3.23(m, 3H), 3.13(m, 3H),2.41-2.40(m, 1H), 0.81(m, 9H), 0.00(m, 6H).

Préparation of (4): To a solution of 3(3.70 g, 10.95 mmol) in DMSO (37 mL) was added EDCI (6.30 g, 32.84 mmol). Then pyridine (0.95 g, 12.05 mmol) and TFA (0.69 g, 6.02 mmol) was added in N₂ atmosphère. The mixture was stirred for 3 hrs at r.t. LCMS showed 3 was consumed completely. Water was poured into and extracted with EA, washed with sat. NaCl (aq.), dried over by Na₂SC>4. The filtrate was evaporated under reduced pressure to give the crude product which was directly used for next step.

Préparation of (5): To a solution of 4 in toluene (100.00 mL), was added 4a (6.93 g, 10.97 mmol) and KOH (1.11 g, 19.78 mmol). It was stirred for 3.5 hrs at 40°C in N₂ atmosphère.

198

TLC and LCMS showed 4 was consumed completely. Then was extracted with EA, washed with water and sat. NaCl (aq.), dried over by Na2SÜ4. The fdtrate was evaporated under reduced pressure to give the crude product which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 5 (4.30 g, 6.70 mmol, 61.17% yield). ‘H-NMR (400 MHz, CDCI3): δ 7.27-7,26(m, 4H), 7.17(m, 1H), 6.94-6.82(m, 1H), 6.13-6.02(m, 1H), 5.63-5.56(m, 4H), 4.90-4.89(m, 1H), 4,45-4.41(m, 1H), 3.98-3.95(m, 1H), 3.39-3.29(m, 4H), 1.90(m, 1H), 1.12-0.83(m, 29H), 0.00(m, 7H); ³¹PNMR (162 MHz, CDCI3): δ 18.021, 14.472.

Préparation of (6): To a solution of 5 (4.30 g, 6.70 mmol) in THF (43.00 mL) was added HCOOH (100 mL) and H2O (100 mL). It was stirred ovemight at r.t. LCMS showed 5 was consumed completely. NH4OH was poured into it and was extracted with EA, washed with sat. NaCl (aq.), dried over by Na2SC>4. The filtrate was evaporated under reduced pressure to give the crude product which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 6 (2.10 g, 3.98 mmol, 59.32% yield). ‘H-NMR (400 MHz, CDCI3): δ 7.40-7.28(m, 5H), 7.117.00(m, 1H), 6.19-6.14(m, 1H), 5.71-5.68(m, 4H), 4.95-4.94(m, 1H), 4.48-4.47(m, 1H), 4.054.03(m, 1H), 3.62-3.61(m, 1H), 3.46(m, 3H), 3.00-2.99(m, 1H), 1.22(m, 18H);³¹P-NMR (162 MHz, CDCI3): δ 18.134.

Préparation of Example 34 monomer: To a solution of 6 (2.10 g, 3.98 mmol) in DCM (21 mL) was added DCI (410 mg, 3.47 mmol). CEP (1.40 g, 4.65 mmol) was added in a N2 atmosphère. LCMS showed 6 was consumed completely. DCM and H2O was poured, the organic phase was washed with water and sat. NaCl (aq.), dried over by Na2SO4. The filtrate was evaporated under reduced pressure at 40°C to give the crude product which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give Example 34 monomer (2.10 g, 2.88 mmol). 'HNMR (400 MHz, DMSO-c/₆): δ 7.39-7.32(m, 6H), 6.21-6.1 l(m, 1H), 5.64-5.61(m, 4H), 4.914.85(m, 1H), 4.59(m, 1H), 4.28-4.25(m, 1H), 3.84-3.60(m, 5H), 3.36-3.36(m, 2H), 2.83-2.79(m, 2H), 1.18-1.14(m, 29H); ³¹P-NMR (162. MHz, DMSO-7₆): δ 149.588, 148.920, 17.355, 17.010.

199

Example 35. Synthesis of 5’ End Cap Monomer

Scheme-15

Préparation of (2): To a solution of 1 (5.90 g, 21.50 mmol) in DMF (60.00 mL), imidazole (4.39 g, 64.51 mmol) and TBSO (7.63 g, 49.56 mmol) were added. The mixture was stirred at r.t. for 3.5 hrs, LCMS showed 1 was consumed completely. Water was added and extracted with EA, dried over by Na₂SC>4. The filtrate was evaporated under reduced pressure to give 2 (11.00 g, 21.91 mmol, 98.19% yield) for the next step. ESI-LCMS: m/z 225.1 [M+H]⁺.

Préparation of (3): To a solution of 2 (11.00 g, 21.91mmol) in THF (55.00 mL) was added TFA (110.00 mL) and H₂O (55.00 mL) at 0°C,reaction mixture was stirred for 30 min. LCMS showed 2 was consumed completely. Then was extracted with EA, washed with sat. NaCl (aq.), dried over by Na₂SO4. The filtrate was evaporated under reduced pressure to give the crude product which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H₂O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 3 (6.20 g, 16.32 mmol, 72.94 % yield). ESI-LCMS: m/z 411.2 [M+H]⁺.

Préparation of (4): To a solution of 3 (3.50 g, 9.02 mmol) in DMSO (35.00 mL) was added EDCI (5.19 g, 27.06 mmol). Then pyridine (0.78 g, 9.92 mmol) and TFA (0.57 g, 4.96 mmol) was added in N₂ atmosphère. The mixture was stirred for 3h at r.t. Water was poured into it and was extracted with EA, washed with sat. NaCl (aq.), dried over by Na₂SC>4. The filtrate was

200 evaporated under reduced pressure to give the crude product which was directly used for next step. ESI-LCMS: m/z 406.2 [M+H]⁺.

Préparation of (5): To a solution of 4 in toluene (100.00 mL) was added 4a (5.73 g, 9.07 mmol) and KOH (916.3 g, 16.33 mmol). It was stirred for 3.5h at 40°C in N₂ atmosphère. Then was extracted with EA, washed with water and sat. NaCl (aq.), dried over by Na₂SO4. The filtrate was evaporated under reduced pressure to give the crude product which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH₃CN/H₂O (0.5% NH₄HCO₃) = 1/1 increasing to CH₃CN/H₂O (0.5% NH₄HCO₃) = 1/0 within 20 min, the eluted product was collected at CH₃CN/ H₂O (0.5% NH4HCO₃) = 1/0; Detector, UV 254 nm. This resulted in to give 5 (5.02 g, 7.25 mmol, 80.44% yield). ESI-LCMS: m/z 693.2 [M+H]⁺;^3IP-NMR (162 MHz, DMSO-</₆): δ 17.811

Préparation of (6): To a solution of 5 (4.59 g, 6.63 mmol) in THF (46.00 mL) was added HCOOH (92.00 mL) and H₂O (92.00 mL). It was stirred ovemight at r.t. NH4OH was poured into it and extracted with EA, washed with sat. NaCl (aq.), dried over by Na₂SO4. The filtrate was evaporated under reduced pressure to give the crude product which was purified by FlashPrep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH₃CN/H₂O (0.5% NH₄HCO₃) = 1/1 increasing to CH₃CN/H₂O (0.5% NH₄HCO₃) = 1/0 within 20 min, the eluted product was collected at CH₃CN/ H₂O (0.5% NH4HCO₃) = 1/0; Detector, UV 254 nm. This resulted in to give 6 (2.52 g, 4.36 mmol, 65.80% yield).

Préparation of Example 35 monomer: To a solution of 6 (2.00 g, 3.46 mmol) in DCM (21.00 mL) was added DCI (370.00 mg, 3.11 mmol) and CEP (1.12 g, 4.15 mmol) was added in N₂ atmosphère. DCM and H₂O was poured, the organic phase was washed with water and sat. NaCl (aq.), dried over by Na₂SÜ4. The filtrate was evaporated under reduced pressure at 38°C to give the crude product which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH₃CN/H₂O (0.5% NH₄HCO₃) = 1/1 increasing to CH₃CN/H₂O (0.5% NH4HCO₃) = 1/0 within 20 min, the eluted product was collected at CH₃CN/ H₂O (0.5% NH4HCO₃) = 1/0; Detector, UV 254 nm. This resulted in to give Example 35 monomer (2.10 g, 2.70 mmol, 78.07% yield). ‘H-NMR (400 MHz, DMSO-Jd): δ 7.39-7.32(m, 6H), 6.21-6.1 l(m, 1H), 5.64-5.61(m, 4H), 4.91-4.85(m, 1H), 4.59(m, 1H), 4.284.25(m, 1H), 3.84-3.60(m, 5H), 3.36-3.36(m, 2H), 2.83-2.79(m, 2H), 1.18-1.14(m, 29H). ³¹PNMR (162 MHz, DMSO-î7₆): δ 149.588, 148.920, 17.355, 17.010.

Example 36. Synthesis of Monomer

201

1) iBuCI, Pyridine

2) 0.5 N NaOH in pyr/MeOH/H2O

Example 36 monomer

Scheme-16

Préparation of (2): To a solution of 1 (35.0 g, 53.2 mmol) in DMF (350 mL) was added imidazole (9.0 g, 133.0 mmol) then added TBSC1 (12.0 g, 79.8 mmol) at 0°C. The mixture was stirred at r.t. for 14 hrs. TLC showed 1 was consumed completely. Water was added to the reaction. The product was extracted with EA, The organic layer was washed with NaHCCL and brine. Then the solution was concentrated under reduced pressure the crude 2 (41.6

g) as a white solid which was used directly for next step. ESI-LCMS: m/z 772 [M+H]⁺. Préparation of (3): To a solution of 2 (41.0 g, 53.1 mmol) in 3% DCA (53.1 mmol, 350 mL) and EtsSiH (53.1 mmol, 100 mL) at 0°C. The mixture was stirred at 0°C for 0.5 h.

TLC showed 2 was consumed completely. NaHCCL was added to the reaction. The product was extracted with EA, The organic layer was washed with NaHCCh and brine. Then the solution was concentrated under reduced pressure. The residue silica gel column chromatography (eluent, DCM/MeOH = 100:1-20:1). This resulted in to give 3 (20.0 g, 41.7 mmol, 78.6% over two step) as a white solid. ESI-LCMS: m/z 470 [M+H]⁺ _; 'H-NMR (400 MHz, DMSO-</₆): δ 12.12 (s, 1H), 11.67 (s, 1H), 8.28 (s, 1H), 6.12-6.07 (dd, J=15Hz, 1H), 5.75 (d,J=5Hz, 1 H), 5.48-5.24 (m,

202

2H), 4.55-4.49 (m, 1H), 3.97 (s, 1H), 3.75-3.55 (m, 2H), 2.79-2.76 (m, 1H), 1.12 (d, J = 6 Hz, 6H), 0.88 (s, 9H), 0.1 l(d, J= 6 Hz, 6H).

Préparation of (4): To the solution of 3 (20 g, 42.6 mmol) in dry DCM (100 mL) and DMF (60 mL) was added PDC (20. g, 85.1 mmol), tert-butyl alcohol (63.1 g, 851.8 mmol) and AciO (43.4 g, 425.9 mmol) at r.t. under N2 atmosphère. And the reaction mixture was stirred at r.t. for 2 h. The solvent was removed to give a residue which was purified by silica gel column chromatography (eluent, PE: EA = 4:1-2:1) to give a residue which was purified by Flash-PrepHPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 4 (16.0 g, 29.0 mmol, 68.2% yield) as a white solid. ESI-LCMS: m/z 540 [M+H]⁺ _; ‘H-NMR (400 MHz, DMSO-tZ₆): δ 12.12 (s, 1H), 11.69 (s, 1H), 8.28 (s, 1H), 6.21-6.17 (dd, J= 15 Hz, 1H), 5.63-5.55 (m, 1H), 4.75-4.72 (m, 1H), 4.41 (d, J= 5 Hz, 1H), 2.79-2.76 (m, 1H), 1.46 (s, 9H), 1.13-1.11 (m, 6H), 0.90 (s, 9H), 0.14(d, J= 2 Hz, 6H).

Préparation of (5): To the solution of 4 (16.0 g, 29.6 mmol) in dry THF/MeODÆhO = 10/2/1 (195 mL) was added NaBÜ4 (3.4 g, 88.9 mmol) at r.t. and the reaction mixture was stirred at 50 °C for 2 h. After completion of reaction, adjusted pH value to 7 with CH3COOD, after addition of water, the resulting mixture was extracted with EA (300 mL). The combined organic layer was washed with water and brine, dried over Na₂SO4, Then the solution was concentrated under reduced pressure the crude 5 (11.8 g) as a white solid which was used directly for next step. ESI-LCMS: m/z 402 [M+H]⁺.

Préparation of (6): To a solution of 5 (5.0 g, 12.4 mmol) in pyridine (50 mL) was added iBuCl (2.6 g, 24.9 mmol) at 0°C under N2 atmosphère. The mixture was stirred at r.t. for 14 h. TLC showed 5 was consumed completely. Then the solution diluted with EA. The organic layer was washed with NaHCCh and brine. Then the solution was concentrated under reduced pressure to give the crude. To a solution of the crude in pyridine (50 mL) was added 2N NaOH (MeOH/H2O=4:l, 15 mL) at 0°C. The mixture was stirred at 0°C for 10 min. Then the solution diluted with EA .The organic layer was washed with NH4CI and brine. Then the solution was concentrated under reduced pressure the residue was purified by Flash-Prep-HPLC with the following conditions(IntelFlash-l): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) =1/3 increasing to CH3CN/H2O (0.5% NH4HCO3)=4/1 within 25 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) =3/2; Detector, UV 254 nm. This resulted in to give 6 (6 g, 10.86 mmol, 87.17% yield) as a white solid. ESI-LCMS: m/z 472.2 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-J₆): δ 12.12 (s, 1H), 11.67 (s, 1H), 8.28 (s, 1H), 6.12-6.07

203 (dd, J= 15 Hz, 1H), 5.48-5.24 (m, 2H), 5.22 (s, 1H), 4.55-4.49 (m, 1H), 3.97 (d, J= 5 Hz, 1H), 2.79-2.76 (m, 1H), 1.12 (d, J= 6 Hz, 6H), 0.88 (s, 9H), 0.1 l(d, J= 6 Hz, 6H).

Préparation of (7): To a solution of 6 (3.8 g, 8.1 mmol) in pyridine (40 mL) was added DMTrCl (4.1 g, 12.1 mmol) at 20°C. The mixture was stirred at 20°C for 1 h. TLC showed 7 was consumed completely. Water was added to the reaction. The product was extracted with EA, The organic layer was washed with NaHCCh and brine. Then the solution was concentrated under reduced pressure to give the crude product of 7 (6 g, 7.6 mmol, 94.3% yield) as a yellow solid. ESI-LCMS: m/z 775 [M+H]⁺.

Préparation of (8): To a solution of 7 (6.0 g, 7.75 mmol) in THF (60 mL) was added TBAF (2.4 g, 9.3 mmol). The mixture was stirred at r.t. for 1 h. TLC showed 7 was consumed completely. Water was added to the reaction. The product was extracted with EA, The organic layer was washed with NaHCCL and brine. Then the solution was concentrated under reduced pressure, the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) =1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) =1/0 within 25 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) =4/1; Detector, UV 254 nm. This resulted in to give 8 (4.0 g, 5.9 mmol, 76.6% yield) as a white solid. ESI-LCMS: m/z 660 [M+H]⁺; Ή-NMR (400 MHz, DMSO-d6): δ 12.12 (s, 1H), 11.67 (s, 1H), 8.12 (s, 1H), 7.34-7.17 (m, 9H), 6.83-6.78 (m, 4H), 6.23-6.18 (m, 1H), 5.66 (d, J = 7 Hz, 1H), 5.48-5.35 (m, 1H), 4.654.54 (m, 1H), 3.72 (d, J = 2 Hz, 6H), 2.79-2.73 (m, 1H), 1.19-1.06 (m, 6H).

Préparation of Example 36 monomer: To a solution of 9 (4.0 g, 6.1 mmol) in DCM (40 mL) was added DCI (608 mg, 5.1 mmol) and CEP (2.2 g, 7.3 mmol) under N2 pro. The mixture was stirred at 20°C for 0.5 h. TLC showed 9 was consumed completely. The product was extracted with DCM, The organic layer was washed with H2O and brine. Then the solution was concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) =1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 25 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) =1/0; Detector, UV 254 nm. This resulted in to give Example 36 monomer (5.1 g, 5.81 mmol, 95.8% yield) as a white solid. ESILCMS: m/z 860 [M+H]⁺; *H-NMR (400 MHz, DMSO-tZô): δ 12.12 (s, 1H), 11.67 (s, 1H), 8.12 (s, 1H), 7.34-7.17 (m, 9H), 6.83-6.78 (m, 4H), 6.23-6.18 (m, 1H), 5.67-5.54 (m, 1H), 4.70-4.67 (m, 1H), 4.23-4.20 (m, 1H), 3.72 (m, 6H), 3.60-3.48 (m, 3H), 2.79-2.58 (m, 3H), 1.13-0.94 (m, 18H); ^3IP-NMR (162 MHz, DMSO-î/₆): δ 150.31, 150.26, 140.62, 149.57.

204

[0001] Ëxample 37: Synthesis of Monomer

TEMPO

ACN/H₂O

DAIB

SOC1₂

MeOH

TBSCl Imidazole DMF

NaBD₄

THF/CH₃OD/D₂O

Example 37 monomer

Scheme-17

Préparation of (2): To a solution of 1 (35 g, 130.2 mmol) in DMF (350 mL) was added imidazole (26.5 g, 390.0 mmol) then added TBSCl (48.7 g, 325.8 mmol) at 0°C. The mixture was stirred at r.t. for 14 h. TLC showed 1 was consumed completely. Water was added to the reaction. The product was extracted with EA, The organic layer was washed with NaHCCh and brine. Then the solution was concentrated under reduced pressure the crude 2 (64.6 g) as a white solid which was used directly for next step. ESI-LCMS: m/z 498 [M+H]⁺.

Préparation of (3): To a solution of 2 (64.6 g, 130.2 mmol) in THF (300 mL) and added TFA/H2O (1:1, 300 mL) at 0°C. The mixture was stirred at 0°C for 2 h. TLC showed 2 was consumed completely. NaHCCh was added to the reaction. The product was extracted with EA, The organic layer was washed with NaHCCb and brine. Then the solution was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (eluent, DCM: MEOH = 100:1-20:1). This resulted in to give 3 (31.3 g, 81.7 mmol, 62.6% over two step) as a white solid. ESI-LCMS: m/z 384 [M+H]⁺.

205

Préparation of (4): To a solution of 3 (31.3 g, 81.7 mmol) in ACN/ H₂O (1:1,350 mL) was added DAIB (78.0 g, 244.0 mmol) and Tempo (3.8 g, 24.4 mmol). The mixture was stirred at 40°C for 2 h. TLC showed 3 was consumed completely. Then filtered to give 4 (22.5 g, 55.5 mmol, 70.9%) as a white solid. ESI-LCMS: m/z 398 [M+H]⁺.

Préparation of (5): To a solution of 4 (22.5 g, 55.5 mmol) in MeOH (225 mL) held at 15° C with an ice/MeOH bath was added SOCI2 (7.6 mL, 94.5 mmol), dropwise at such a rate that the reaction temp did not exceed 7° C. After the addition was complété, cooling was removed, the reaction was allowed to stir at room temp. The mixture was stirred at r.t. for 14 h. TLC showed 4 was consumed completely. Then the solution was concentrated under reduced pressure to get crude 5 (23.0 g) as a white solid which was used directly for next step. ESILCMS: m/z 298 [M+H]⁺.

Préparation of (6): To a solution of 5 (23 g, 55.5 mmol) in DMF (220 mL) was added imidazole (11.6 g, 165.0 mmol) then added TBSC1 (12.3 g, 82.3 mmol) at 0°C. The mixture was stirred at 20°C for 14 h. TLC showed 1 was consumed completely. Water was added to the reaction. The product was extracted with EA, The organic layer was washed with NaHCCL and brine. Then the solution was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (eluent, DCM: MEOH = 100:1—20:1). This resulted in to give 6 (21.3 g, 51.1 mmol, 90 % over two step) as a white solid. ESI-LCMS: m/z 412 [M+H]⁺.

Préparation of (7): To the solution of 6 (21.0 g, 51.0 mmol) in dry THF/MeODÆhO = 10/2/1 (260.5 mL) was added NaBÜ4 (6.4 g, 153.1 mmol) at r.t. and the reaction mixture was stirred at 50°C for 2 h. After completion of reaction, the resulting mixture was added CH3COOD to pH = 7, after addition of water, the resulting mixture was extracted with EA (300 mL). The combined organic layer was washed with water and brine, dried over Na2SO4. Then the solution was concentrated under reduced pressure and the residue was used for next step without further purification. ESI-LCMS: m/z 386 [M+H]⁺.

Préparation of (8): To a stirred solution of 7 (14.0 g, 35 mmol) in pyridine (50 mL) were added BzCl (17.2 g, 122.5 mmol) at 0°C under N2 atmosphère. The mixture was stirred at r.t. for 14 h. TLC showed 7 was consumed completely. Then the solution diluted with EA .The organic layer was washed with NaHCCh and brine. Then the solution was concentrated under reduced pressure and the residue was used for next step without further purification. To a solution of the crude in pyridine (300 mL) then added 2M NaOH (MeOH: H2O=4:1, 60 mL) at 0°C. The mixture was stirred at 0°C for 10 min. Then the solution diluted with EA. The organic layer was washed with NH4CI and brine. Then the solution was concentrated under reduced pressure and

206 the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) =1/3 increasing to CH3CN/H2O (0.5% NH4HCO3) =4/1 within 25 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) =3/2; Detector, UV 254 nm. This resulted in to give 8 (14 g, 28.02 mmol, 69.21% yield) as a white solid. ESI-LCMS: m/z 490 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-7₆): δ 11.24 (s, 1H), 8.76 (s, 1H), 8.71 (m, 1H), 8.04 (d, J= 7 Hz, 2H),7.66-7.10 (m, 5H), 6.40-6.35 (dd, 1H), 5.71-5.56 (m, 1H), 5.16 (s, 1H), 4.79-4.72 (m, 1H), 4.01 (m, 1H), 0.91 (s, 9H), 0.14 (m, 6H).

Préparation of (9): To a solution of 8 (5.1 g, 10.4 mmol) in pyridine (50 mL) was added DMTrCl (5.3 g, 15.6 mmol). The mixture was stirred at r.t. for 1 h. TLC showed 8 was consumed completely. Water was added to the reaction. The product was extracted with EA, The organic layer was washed with NaHCCh and brine. Then the solution was concentrated under reduced pressure and the residue was used for next step without further purification. ESILCMS: m/z 792 [M+H]⁺.

Préparation of (10): To a solution of 9 (7.9 g, 10.0 mmol) in THF (80 mL) was added IM TB AF in THF (12 mL). The mixture was stirred at r.t. for 1 h. TLC showed 9 was consumed completely. Water was added to the reaction. The product was extracted with EA, The organic layer was washed with NaHCO3 and brine. Then the solution was concentrated under reduced pressure the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) =1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) =1/0 within 25 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) =4/1; Detector, UV 254 nm. This resulted in to give 10 as a white solid. ESI-LCMS: m/z 678 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-7₆): δ 11.25 (s, 1H), 8.74 (s, 1H), 8.62 (s, 1H), 8.04 (d, J= 7 Hz, 2H),7.66-7.53 (m, 3H), 7.33-7.15 (m, 9H), 6.82-6.78 (m, 4H), 6.43 (d, J= 20 Ηζ,ΙΗ), 5.76-5.60 (m, 1H), 4.88-4.80 (m, 1H), 4.13 (d, J= 8 Hz, 1H), 3.71 (m, 6H).

Préparation of Example 37 monomer: To a solution of 10 (6.2 g, 9.1 mmol) in DCM (60 mL) was added DCI (1.1 g, 9.4 mmol) and CEP (3.3 g, 10.9 mmol) under N2 pro. The mixture was stirred at 20°C for 0.5 h. TLC showed 10 was consumed completely. The product was extracted with DCM, The organic layer was washed with H2O and brine. Then the solution was concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This

207 resulted in to give Example 37 monomer (7.5 g, 8.3 mmol, 90.7%) as a white solid. ESI-LCMS: m/z 878 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-d₆): δ 11.25 (s, 1H), 8.68-8.65 (dd, 2H), 8.04 (m, 2H),7.66-7.53 (m, 3H), 7.33-7.15 (m, 9H), 6.82-6.78 (m, 4H), 6.53-6.43 (m, 1H), 5.96-5.81 (m, 1H), 5.36-5.15 (m, 1H), 4.21 (m, 1H), 3.86-3.52 (m, 10H), 2.79-2.61 (m, 2H), 1.21-0.99 (m,

12H); ³¹P-NMR (162 MHz, DMSO-îZ₆): δ 149.60, 149.56, 149.48.

Example 38. Synthesis of End Cap Monomer

TBSCl Imidazole DMF ,

NaBD₄

THF/MeOD/D,O

TEMPO, DA1B

ACN/H,O= 1/1 _

S

TMSC1 BzCl NH₄OH

OPOM MOPO-p=o

D—1 OPOM n ,^ps ^D q' OPOM

HCOOH

CEP, PCI, DCM

OPOM MOPO~P=o _D_^ pPOM ^D o OPOM

O Me MeO-p=Q f _zOMe P_xq OMe

PivCl, Nal ACN

9a

OPOM MOPO~p=o f pPOM _o ^PxOPOM

9b h₂, thf/d₂o

Scheme-18

Préparation of (2): To a solution of 1 (20.0 g, 71.2 mmol) in dry pyridine (200.0 mL) was 10 added TBSCl (26.8 g, 177.9 mmol) and imidazole (15.6 g, 227.8 mmol). The mixture was stirred at r.t. for 15 h. TLC showed 1 was consumed completely. The reaction mixture was concentrated to give residue. The residue was quenched with DCM (300.0 mL). The DCM layer was washed with H2O (100.0 mL*2) and brine. The DCM layer concentrated to give crude 2 (45.8 g) as a yellow oil. The crude used to next step directly. ESI-LCMS m/z 510.5 [M+H]⁺.

208

Préparation of (3): To a mixture solution of 2 (45.8 g) in THF (300.0 mL) was added mixture of H2O (100.0 mL) and TFA (100.0 mL) at 0°C over 30min. Then the reaction mixture was stirred at 0°C for 4 h. TLC showed the 2 was consumed completely. The reaction mixture pH was adjusted to 7-8 with NH3.H2O (100 mL). Then the mixture was extracted with EA (500.0 mL*2). The combined EA layer was washed with brine and concentrated to give crude which was purified by c.c. (PE:EA = 5:1 - 1:0) to give compound 3 (21.0 g, 53.2 mmol, 74.7% yield over 2 steps) as a white solid. ESI-LCMS m/z 396.2 [M+H]⁺.

Préparation of (4): To a solution of 3 (21.0 g, 53.2 mmol) in ACN (100.0 mL) and water (100.0 mL) were added (diacetoxyiodo)benzene (51.0 g, 159.5 mmol) and TEMPO (2.5 g, 15.9 mmol), The reaction mixture was stirred at 40°C for 1 h. TLC showed the 3 was consumed completely. The reaction mixture was cooled down to r.t. and filtered, the filtrate was concentrated to give crude which was purified by crystallization (ACN) to give 4 (14.5 g, 35.4 mmol, 66.2% yield). ESI-LCMS m/z 410.1[M+H]⁺.

Préparation of (5): To a solution of 4 (14.5 g, 35.4 mmol) in toluene (90.0 mL) and MeOH (60.0 mL) was added trimethylsilyldiazomethane (62.5 mL, 2.0 M, 141.8 mmol) at 0°C, then stirred at r.t. for 2h. TLC showed the 4 was consumed completely. The solvent was removed under reduce pressure, the residue was purified by crystallization (ACN) to give 5 (10.0 g, 23.6 mmol, 66.6% yield). ESI-LCMS m/z 424.2 [M+H]⁺

Préparation of (6): To the solution of 5 (10.0 g, 23.6 mmol) in dry THF/MeODÆhO = 10/2/1 (100.0 mL) was added NaBÜ4 (2.98 g, 70.9 mmol) three times during an hour at 40°C, the reaction mixture was stirred at r.t. for 2.0 h. The resulting mixture was added CH3COOD change pH = 7.5, after addition of water, the resulting mixture was extracted with EA (50.0 mL*3). The combined organic layer was washed with water and brine, dried over Na2SCU, concentrated to give a residue which was purified by c.c. (PE/EA =1:1-1:0). This resulted in to give 6 (6.1 g, 15.4 mmol, 65.3% yield) as a white solid. ESI-LCMS m/z 398.1 [M+H]⁺; 'H-NMR (400 MHz, DMSO-Jô) δ 8.28 (s, 1H), 8.02 (s, 1H), 7.23 (s, 2H), 5.86 (d, J= 6.4 Hz, 1H), 5.26 (s, 1H), 4.424.41(m, 1H), 4.35-4.32 (m,lH), 3.82 (d, J= 2.6 Hz, 1H), 3.14 (s, 3H), 0.78 (s, 9H), 0.00 (d, J= 0.9 Hz, 6H).

Préparation of (7): To a solution of 6 (6.1 g, 15.4 mmol) in pyridine (60.0 mL) was added the benzoyl chloride (6.5 g, 46.2 mmol) drop wise at 5°C. The reaction mixture was stirred at r.t. for 2 h. TLC showed the 6 was consumed completely. The reaction mixture was cooled down to 10°C and quenched with H₂O (20.0 mL), extracted with EA (200.0 mL*2), combined the EA layer. The organic phase was washed with brine and dried over Na2SO4, concentrated to give the crude (12.0 g) which was dissolved in pyridine (60.0 mL), cooled to 0°C, 20.0 mL NaOH (2 M

209 in methanol : H₂O = 4:1) was added and stirred for 10 min. The reaction was quenched by saturated solution of ammonium chloride, the aqueous layer was extracted with EA (200.0 mL*2), combined the EA layer, washed with brine and dried over Na₂SÛ4, concentrated. The residue was purified by c.c. (PE/EA = 10:1 - 1:1)to give 7 (7.0 g, 13.9 mmol, 90.2% yield). ESI-LCMS m/z 502.2 [M+H]⁺; ‘H-NMR (400 MHz,DMSO-î7₆) δ 11.24 (s, 1H, exchanged with D₂O) 8.77 (s, 2H), 8.04-8.06 (m, 2H), 7.64-7.66 (m, 2H), 7.54-7.58 (m, 2H), 6.14-6.16 (d, J = 5.9 Hz, 1H), 5.20-5.23 (m, 1H),4.58-4.60 (m, 1H), 4.52-4.55 (m,lH), 3.99-4.01 (m, 1H), 3.34 (s, 4H), 0.93 (s, 9H), 0.14-0.15 (d, J = 1.44 Hz, 6H).

Préparation of (8): To a stirred solution of 7 (5.5 g, 10.9 mmol) in DMSO (55.0 mL) was added EDCI (6.3 g, 32.9 mmol), pyridine (0.9g, 10.9mmol) and TFA(0.6 g,5.5mmol), the reaction mixture was stirred at r.t. for 15 h. The reaction was quenched with water and extracted with EA (100.0 mL). The organic phase was washed by brine, dried over Na₂SO4, The organic phase was evaporated to dryness under reduced pressure to give a residue 8 (4.8 g) which was used directly to next step. ESI-LCMS: m/z 517.1 [M+H₂O]⁺

Préparation of (9b): A solution of 9a (35.0 g, 150.8 mmol) and Nal (90.5 g, 603.4 mmol) in dry ACN (180.0 mL) was added chloromethyl pivalate (113.6 g, 754.3 mmol) at r.t., the reaction was stirred at 80°C for 4 h. The reaction was cooled to r.t. and quenched by water, then the mixture was extracted with EA (500.0 mL *3), combined the organic layer was washed with saturated solution of ammonium chloride, followed by with brine and dried over Na₂SO4. Then the organic layer was concentrated to give a residue which was purified by c.c., this resulted in to give 9b (38.0 g, 60.1mmol, 39.8% yield) as a white solid. ESI-LCMS m/z 655.2 [M+Na]⁺; ΉNMR (400 MHz, CDC1₃): δ 5.74-5.67 (m, 8H), 2.67 (t, J= 21.6 Hz, 2H), 1.23 (s, 36H).

Préparation of (9): 3.8 g 10% Pd/C was washed with dry THF (30.0 mL) three times.

Then transferred into a round-bottom flask charged with 9b (38.0 g, 60.Immol) and solvent (dry THF:D₂O=5:1, 400.0 mL), the mixture was stirred at 80°C under IL H₂balloon for 15 h. The reaction was cooled to r.t. and extracted with EA (500.0 mL *3), combined the organic layer was washed with brine and dried over Na₂SO4. The residue 9 (3.0 g, 3.7 mmol, 38.8% yield) as a white solid was used directly to next step without further purification. ESI-LCMS m/z 657.2 [M+Na]⁺; ‘H-NMR (400 MHz, CDC1₃): δ 5.74-5.67 (m, 8H), 1.23 (s, 36H).

Préparation of (10): A solution of 8 (4.8 g, 9.6 mmol), 9 (7.3 g, 11.5 mmol) and K2CO3 (4.0 g, 38.8 mmol) in dry THF (60.0 mL) and D₂O (20.0 mL) was stirred at r.t. 18h. LC-MS showed 8 was consumed completely. The product was extracted with EA (300.0 mL) and the organic layer was washed with brine and dried over Na₂SO4. Then the organic layer was concentrated to give a residue which was purified by c.c. (PE/EA = 5:1-1:1) and MP LC. This

210 resulted in to give 10 (3.0 g, 3.7 mmol, 38.8% yield) as a white solid. ESI-LCMS m/z 806.4[M+H]⁺; *H-NMR (400 MHz, DMSO-76): δ 11.25 (s, 1H, exchanged with D2O) 8.75 (s, 2H), 8.07-8.05 (d, J= 8.0 Hz, 2H), 7.67-7.54 (m, 3H), 6.05 (d, J= 5.1 Hz, 1H), 5.65-5.58 (m, 4H), 4.80-4.70 (m, 2H), 4.59-4.57 (m,lH), 3.36 (s, 3H), 1.11 (s, 9H), 1.10 (s, 9H), 0.94 (s, 9H), 0.17-0.16 (m, 6H); ^3IP NMR (162 MHz, DMSO-d6) δ 17.02.

Préparation of (11): To a round-bottom flask was added 10 (3.0 g, 3.7 mmol) in a mixture of H₂O (30.0 mL), HCOOH (30.0 mL). The reaction mixture was stirred at 40°C for 15 hrs. LCMS showed the 10 was consumed completely. The reaction mixture was adjusted the pH = 6-7 with con. NH3.H₂O (100.0 mL). Then the mixture was extracted with DCM (100.0 mL*3). The combined DCM layer was dried over Na₂SO4. Filtered and filtrate was concentrated to give crude which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN/H₂O (0.5% NH4HCO3) = 1/2 increasing to CH3CN/ H₂O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 3/2; Detector, UV 254 nm. To give product 11 (1.8 g, 2.6 mmol, 70.3% yield). ESI-LCMS m/z = 692.2[M+H]⁺; ‘H-NMR (400 MHz, DMSO-J6): δ 11.11 (s, 1H, exchanged with D2O) 8.71-8.75 (d, 7=14.4, 2H), 8.04-8.06 (m, 2H), 7.64-7.65 (m, 1H), 7.54-7.58 (m, 2H), 6.20-6.22 (d, 7=5.4, 2H), 5.74-5.75 (d, 7=5.72, 2H), 5.56-5.64 (m, 4H), 4.644.67 (m, 1H), 4.58-4.59(m, 1H), 4.49-4.52 (m, 1H), 3.37 (s, 3H), 1.09-1.10 (d, 7=1.96, 18H); ³¹P NMR (162 MHz, DMSO-J6) δ 17.46.

Préparation of Example 38 monomer: To a solution of 11 (1.8 g, 2.6 mmol) in DCM (18.0 mL) was added the DCI (276.0 mg, 2.3 mmol), then CEP[N(ipr)₂]₂ (939.5 mg, 3.1 mmol) was added. The mixture was stirred at r.t. for Ih. TLC showed 11 consumed completely. The reaction mixture was washed with H₂O (50.0 mL*2) and brine (50.0 mL*2), dried over Na₂SÛ4 and concentrated to give crude which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CTECNÆbO (0.5% NH4HCO3) = 1/1 increasing to CH3CN/ H₂O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 9/1; Detector, UV 254 nm. The product was concentrated to give Example 38 monomer (2.0 g, 2.2 mmol, 86.2% yield) as a white solid. ESILCMS m/z 892.3[M+H]⁺; 'H-NMR (400 MHz, DMSO-76): δ 11.27 (s, 1H, exchanged with D2O) 8.72-8.75 (m, 2H), 8.04-8.06 (m, 2H), 7.54-7.68 (m, 3H), 6.20-6.26 (m, 1H), 5.57-5.64 (m, 4H), 4.70-4.87 (m, 3H), 3.66-3.88 (m, 4H), 3.37-3.41 (m, 3H),2.82-2.86 (m, 2H) , 1.20-1.21 (m, 12H), 1.08-1.09 (m, 18H); ^3IP-NMR (162 MHz, DMSO-76): δ 150.03, 149.19, 17.05, 16.81.

211

Example 39. Synthesis of 5’ End Cap Monomer

EDCI, Pyridine, TFA DMSO

OPOM

MOPO-p=Q

D-l ,ΟΡΟΜ 7 η ,Ρχ ^D OPOM

K₂CO3,THF.D2O.

HCOOH,H₂O^

CEPCI.DCl DCM

Scheme-19

Préparation of (6): To a stirred solution of 5 (8.0 g, 21.3 mmol, Scheme 3) in DMSO (80.0 mL) were added EDCI(12.2 g, 63.9mmol), pyridine(1.7 g,21.3mmol),TFA(1.2 g,10.6mmol) at r.t. And the reaction mixture was stirred at r.t. for 1.5 h. The reaction was quenched with water and extracted with EA (200.0 mL). The organic phase was washed by brine, dried over Na₂SÛ4, The organic phase was evaporated to dryness under reduced pressure to give a residue 6 which was used directly to next step. ESI-LCMS: m/z 372.3 [M+H]⁺.

Préparation of (8): To a solution of K₂CO3 (5.5 g, 8.3 mmol) in dry THF (60.0 mL) and D₂O (20.0 mL) was added a solution of 6 (8.0 g, 21.5mmol) in dry THF(10.0 mL). The reaction mixture was stirred at r.t. ovemight. LC-MS showed 6 was consumed completely. The product was extracted with EA (300.0 mL) and the organic layer was washed with brine and dried over Na₂SO4. Then the organic layer was concentrated to give a residue which was purified by FlashPrep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH₃CN/H₂O (0.5% NH4HCO3) = 2/3 increasing to CH₃CN/H₂O (0.5% NH4HCO3) = 3/2 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 1/1; Detector, UV 254 nm. This resulted in to give 8 (5.0 g, 7.3 mmol, 40.0%) as a white solid. ESI-LCMS: m/z 679.3 [M+H]⁺; ‘H-NMR (400 MHz, Chloroform-d): δ 9.91 (s, 1H), 7.29 (d, J= 8.1 Hz, 1H), 5.82 (d, J= 2.7 Hz, 1H), 5.72 (d, J= 8.1 Hz, 1H), 5.65 - 5.54 (m, 4H), 4.43 (dd, J= 7.2, 3.2 Hz, 1H), 3.92 (dd, J= 7.2, 5.0 Hz, 1H), 3.65 (dd, J= 5.1, 2.7 Hz, 1H), 3.44 (s, 3H), 1.13 (s, 18H), 0.82 (s, 9H), 0.01 (d, J= 4.8 Hz, 6H); ³¹P NMR (162 MHz, Chloroform-d): δ 16.40.

Préparation of (9): To a solution of HCOOH (50.0 mL) and H₂O (50.0 mL) was added 8 (5.0 g,7.3 mmol). The reaction mixture was stirred at 40°C ovemight. LC-MS showed 8 was 212 consumed completely. A solution of NaHCCh (500.0 mL) was added. The product was extracted with EA (300.0 mL) and the organic layer was washed with brine and dried over Na2SO4. Then the organic layer was concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 3/2 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/1; Detector, UV 254 nm. This resulted in to give 9 (3.0 g, 5.4 mmol, 73.2%) as a white solid. ESI-LCMS: m/z 565.2 [M+H]⁺; 'H-NMR (400 MHz, DMSO-J₆): δ 11.43 (s, 1H), 7.64 (d, J= 8.1 Hz, 1H), 5.83 (d, J = 4.3 Hz, 1H), 5.69 - 5.56 (m, 5H), 5.54 (d, J= 6.7 Hz, 1H), 4.37 (dd, J= 6.1, 2.9 Hz, 1H), 4.12 (q, .7=6.1 Hz, 1H), 3.96 (dd,J=5.4, 4.3 Hz, 1H), 3.39 (s, 3H), 1.16 (s, 18H); ³¹P NMR (162 MHz, DMSO-î/ô): δ 17.16.

Préparation of Example 39 monomer: To a suspension of 9 (2.6 g, 4.6 mmol) in DCM (40.0 mL) was added DCI (0.5 g, 5.6 mmol) and CEP[N(iPr)2]2 (1.7 g, 5.6 mmol). The mixture was stirred at r.t. for 1.0 h. LC-MS showed 9 was consumed completely. The solution was washed with water twice and washed with brine and dried over Na2SO4. Then concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give Example 39 monomer (3.0 g, 3.9 mmol, 85.2%) as a white solid. .ESI-LCMS: m/z 765.3 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-î7₆): δ 11.44 (s, 1H), 7.71 (dd, J= 8.1, 3.8 Hz, 1H), 5.81 (dd, J= 4.4, 2.5 Hz, 1H), 5.74-5.53 (m, 5H), 4.59-4.33 (m, 2H), 4.20-4.14 (m, 1H), 3.88-3.53 (m, 4H), 3.39 (d, J= 16.2 Hz, 3H), 2.80 (td, J= 5.9, 2.9 Hz,2H), 1.16 (d, J= 1.9 Hz, 30H); ³¹PNMR (162 MHz, DMSO-tZô): δ 147.68, 149.16, 16.84, 16.55.

Example 40. Synthesis of Monomer

213

BzCl Pyridine

IM NaOH Pyridine

DMTrCI

Pyridine

TBSC) qCD₃

TBAF THF

DCI; CEP[N(iPr)₂]₂DCM

Example 40 monomer

Scheme-20

Préparation of (2): To a solution of 1 (26.7 g*2, 0.1 mol) in DMF (400 mL) was added sodium hydride (4.8 g, 0.1 mol) for 30 min, then was added CD3I (16 g, O.lmol) at 0°C for 2.5 hr (ref. for sélective 2’-O-alkylation reaction conditions , J. Org. Chem. 1991, 56, 5846-5859). The mixture was stirring at r.t. for another Ih. LCMS showed the reaction was consumed. The mixture was filtered and the clear solution was evaporated to dryness and was evaporated with CH3OH. The crude was purified by slica gel column (SiO₂, DCM/MeOH = 50:1-15:1). This resulted in to give the product 2 (35.5 g, 124.6 mmol, 62% yield) as a solid. ESI-LCMS: m/z 285 [M+H]⁺ .

Préparation of (3): To a solution of 2 (35.5 g, 124.6 mmol) in pyridine (360 mL) was added imidazole (29.7 g, 436.1 mmol) and TBSC1 (46.9 g, 311.5 mmol). The mixture was stirred at r.t. over night. LCMS showed 2 was consumed completely. The reaction was quenched with water (500 mL). The product was extracted into ethyl acetate (1 L). The organic layer was washed with brine and dried over anhydrous Na₂SO4. The crude was purified by slica gel column (SiO₂, PE/EA = 4:1-1:1). This resulted in to give the product 3 (20.3 g, 39.6 mmol, 31.8% yield) as a solid. ESI-LCMS: m/z 513 [M+H]⁺; Ή-NMR (400 MHz, DMSO-î/₆): δ 8.32 (m, 1H), 8.13 (m, 1H), 7.31 (m, 2H), 6.02-6.01(d, J= 4.0 Hz, 1H), 4.60-4.58 (m, 1H), 4.49-4.47(m,lH), 3.96-3.86 (m, 2H), 3.72-3.68 (m, 1H), 0.91-0.85 (m, 18H), 0.13-0.01 (m, 12H).

Préparation of (4): To a solution of 3 (20.3 g, 39.6 mmol) in THF (80 mL) was added TFA (20 mL) and water (20 mL) at 0°C. The reaction mixture was stirred at 0°C for 5 h. LC-MS showed 3 was consumed completely. Con. NH4OH was added to the mixture at 0°C to quench the reaction until the pH = 7.5. The product was extracted into ethyl acetate (200 mL). The organic layer was washed with brine and dried over anhydrous Na2SO4. The solution was then concentrated under reduced pressure and the residue was washed by PE/EA = 5:1. This resulted in to give 4 (10.5 g, 26.4 mmol, 66.6% yield) as a white solid. ESI-LCMS: m/z 399 [M+H]⁺; ’H

214

NMR (400 MHz, DMSO-7₆): δ 8.41 (m, 1H), 8.14 (m, 1H), 7.37 (m, 2H), 5.99-5.97(d, J= 8.0 Hz, 1H), 5.43 (m, 1H), 4.54-4.44 (m,2H), 3.97-3.94 (m, 1H), 3.70-3.53 (m, 2H), 0.91 (m, 9H), 0.13-0.12 (m, 6H).

Préparation of (5): To a solution of 4 (10.5 g, 26.4 mmol) in ACN/H2O = 1:1 (100 mL) was added DAIB (25.4 g, 79.2 mmol) and TEMPO (1.7 g, 7.9 mmol). The reaction mixture was stirred at 40°C for 2 h. LCMS showed 4 was consumed. The mixture was diluted with EA and water was added. The product was extracted with EA. The organic layer was washed with brine and dried over anhydrous Na2SO4. The solution was then concentrated under reduced pressure and the residue was washed by ACN. This resulted in to give 5 (6.3 g, 15.3 mmol, 57.9% yield) as a white solid. ESI-LCMS: m/z 413 [M+H]⁺; Y-NMR (400 MHz, DMSO-î7₆): δ = 8.48 (m, 1H), 8.16 (m, 1H), 7.41 (m, 2H), 6.12-6.10(d, J= 8.0 Hz, 1H), 4.75-4.73 (m, 1H), 4.42-4.36 (m, 2H), 3.17 (m, 6H), 2.07 (m, 2H), 0.93 (m, 9H), 0.17-0.15 (m, 6H).

Préparation of (6): To a solution of 5 (6.3 g, 15.3 mmol) in toluene (36 mL) and methanol (24 mL) was added (trimethylsilyl)diazomethane (7.0 g, 61.2 mmol) till the yellow color not disappear at r.t. for 2 min. LCMS showed the reaction was consumed. The solvent was removed to give the cured 6 (6.0 g) as a solid witch used for the next step. ESI-LCMS: m/z 427 [M+H]⁺ _;‘H-NMR (400 MHz, DMSO-J₆): δ 8.45 (m, 1H), 8.15 (m, 1H), 7.35 (m, 2H), 6.12-6.10(d, J= 8.0 Hz, 1H), 4.83-4.81 (m, 1H), 4.50-4.46 (m, 1H), 3.73 (m, 3H), 3.31 (m, 1H), 0.93 (m, 9H), 0.15-0.14 (m, 6H).

Préparation of (7): To the solution of 6 (6 g) in dry THF/MeODÆbO = 10/2/1 (78 mL) was added NaBÜ4 (2.3 g, 54.8 mmol) at r.t. And the reaction mixture was stirred at r.t for 2.5 hr. After completion of reaction, adjusted pH value to 7 with CH3COOD, after addition of water, the resulting mixture was extracted with EA (100 mL). The combined organic layer was washed with water and brine, dried over Na2SC>4, and concentrated to give 7 (5.7 g) which was used for the next step. ESI-LCMS: m/z 401 [M+H]⁺ .

Préparation of (8): To a solution of 7 (5.7 g) in pyridine (60 mL) was added BzCl (10.0 g, 71.3 mmol) under ice bath. The reaction mixture was stirred at r.t. for 2.5 hrs. LCMS showed 7 was consumed. The mixture was diluted with EA and water was added. The product was extracted with EA. The crude was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH₃CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 25 min, the eluted product was collected at CH3CN/H2O (0.5% NH4HCO3) = 7/3; Detector, UV 254 nm. This resulted in to give the crude 8 (6.2 g, 8.7 mmol, 57% yield, over two steps) as a white solid. ESI-LCMS: m/z 713 [M+H]⁺.

215

Préparation of (9): To a solution of 8 (6.2 g, 8.7 mmol) in pyridine (70 mL) and was added IM NaOH (MeOH/HiO = 4/1) (24 mL). LCMS showed 8 was consumed. The mixture was added saturated NH4CI till pH = 7.5. The mixture was diluted with water and EA. The organic layer was washed with brine and dried over Na?SO4 and concentrated to give the crude. The crude was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 25 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 67/33 Detector, UV 254 nm. This resulted in to give the product 10 (4.3 g, 8.5 mmol, 98% yield) as a white solid. ESI-LCMS: m/z 505 [M+H]⁺; 'H-NMR (400 MHz, DMSO-Jâ): δ 11.23 (m, 1H), 8.77 (m, 2H), 8.06-8.04 (m, 2H), 7.66-7.63 (m, 2H), 7.577.53 (m, 3H), 6.16-6.14 (d, J= 8.0 Hz, 1H), 5.17 (m, 1H), 4.60-4.52 (m, 2H), 3.34 (m, 1H), 0.93 (m, 9H), 0.14 (m, 6H).

Préparation of (10): To a stirred solution of 9 (4.3 g, 8.5 mmol) in pyridine (45 mL) were added DMTrCl (3.3 g, 9.8 mmol) at r.t. And the reaction mixture was stirred at r.t for 2.5 hr. With ice-bath cooling, the reaction was quenched with water and the product was extracted into EA. The organic layer was washed with brine and dried over Na2SO4 and concentrated to give the crude. The crude was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 25 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) =97/3 Detector, UV 254 nm. This resulted in to give the product 10 (6.5 g, 8.1 mmol, 95% yield) as a white solid. ESI-LCMS: m/z 807 [M+H]⁺; ’HNMR (400 MHz, DMSO-J₆): δ 11.23 (m, 1H), 8.70-8.68 (m, 2H), 8.04-8.02 (m, 2H), 7.66-7.62 (m, 1H), 7.56-7.52 (m, 2H), 7.35-7.26 (m, 2H), 7.25-7.17 (m, 7H), 6.85-6.82 (m, 4H), 6.18-6.16 (d, J= 8.0 Hz, 1H), 4.73-4.70 (m, 1H), 4.61-4.58 (m, 1H), 3.71 (m, 6H), 3.32 (m, 1H), 0.83 (m, 9H), 0.09-0.03 (m, 6H).

Préparation of (11): To a solution of 10 (3.5 g, 4.3 mmol) in THF (35 mL) was added 1 M TBAF solution (5 mL). The reaction mixture was stirred at r.t. for 1.5 h. LCMS showed 10 was consumed completely. Water (100 mL) was added. The product was extracted with EA (100 mL) and the organic layer was washed with brine and dried over Na2SO4. Then the organic layer was concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/H2O (0.5% NH4HCO3) = 62/38; Detector, UV 254 nm. This resulted in to give 11 (2.7 g, 3.9 mmol, 90.7%) as a white solid. ESI-LCMS: m/z 693 [M+H]⁺ .

216

Préparation of Example 40 monomer: To a suspension of 11 (2.7 g, 3.9 mmol) in DCM (30 mL) was added DCI (0.39 g, 3.3 mmol) and CEP[N(iPr)2]2 (1.4 g, 4.7 mmol). The mixture was stirred at r.t. for 2 h. LC-MS showed 11 was consumed completely. The solution was washed with water twice and washed with brine and dried over Na2SO4. Then concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 73/27; Detector, UV 254 nm. This resulted in to give Example 40 monomer (3.3 g, 3.7 mmol, 94.9%) as a white solid. ESI-LCMS: m/z 893

[M+H]⁺; ‘H-NMR (400 MHz, DMSO-î/₆): δ = 11.24 (m, 1H), 8.66-8.64 (m, 2H), 8.06-8.03 (m,

2H), 7.65-7.53(m, 3H), 7.42-7.38 (m, 2H), 7.37-7.34 (m, 2H), 7.25-7.19 (m, 7H), 6.86-6.80 (m, 4H), 6.20-6.19 (d, J= 4.0 Hz, 1H), 4.78 (m, 2H), 4.22-4.21 (m, 1H), 3.92-3.83 (m, 1H), 3.72 (m, 6H), 3.62-3.57 (m, 3H), 2.81-2.78 (m, 1H), 2.64-2.61 (m, 1H), 1.17-1.04 (m, 12H); ³¹P-NMR (162 MHz, DMSO-îZô): δ 149.51, 149.30.

Example 41. Synthesis of Monomer

217

BzO' ΟΒζ

ch₃nh.

DPC

NalICOj DMF

AgNO₃collidine

TrtCl Pyridine

DAST Pyridine DCM

TrtÔ

9

Pyridine

BzCl DCM

Scheme-21

Préparation of (3): To the solution of 1 (70 g, 138.9 mmol) in dry acetonitrile (700 mL) was added 2 (27.0 g, 166.7 mmol), BSA (112.8 g, 555.5 mmol). The mixture was stirred at 50°C for 1 h. Then the mixture was cooled to -5°C and TMSOTf (46.2 g, 208.3 mmol) slowly added to the mixture. Then the reaction mixture was stirred at r.t for 48 h. Then the solution was cooled to 0°C and saturated aq. NaHCCh was added and the resulting mixture was extracted with EA. The combined organic layer was washed with water and brine, dried over NaiSCU, and concentrated under reduced pressure to give a residue which was purified by silica gel column chromatography (eluent, PE: EA=3:1~1:1) to give 3 (70 g, 115.3 mmol, 81.6%) as a white solid. ESI-LCMS: m/z 605 [M-H]⁺ .

Préparation of (4): To the solution of 3 (70.0 g, 115.3 mmol) in méthylammonium solution (1 M, 700 mL), and the reaction mixture was stirred at 40 °C for 15 h. After completion of reaction, the resulting mixture was concentrated. The residue was crystallized from EA. Solid was isolated by filtration, washed with PE and dried ovemight at 45°Cin vacuum to give 4 (31.0

218 g, 105.4 mmol, 91.1%) as a white solid. ESI-LCMS: m/z 295 [M+H]⁺; Ή-NMR (400 MHz, DMSO): δ 11.63 (s, 1H) , 8.07-7.99 (m, 1H),7.81 (d, J= 8.4 Hz, 1 H), 7.72-7.63 (m, 1H), 7.347.26 (m, 1H), 6.18 (d, J= 6.4 Hz, 1H), 5.24 (s, 1H), 5.00 (s, 2H), 4.58-4.47 (m, 1H), 4.19^1.10 (m, 1H), 3.85-3.77 (m, 1H), 3.75-3.66 (m, 1H), 3.66-3.57 (m, 1H).

Préparation of (5): To the solution of 4 (20.0 g, 68.0 mmol) in dry DMF (200 mL) was added DPC (18.9 g, 88.0 mmol) and NaHCCh (343 mg, 4 mmol) at r.t, and the reaction mixture was stirred at 150°C for 35 min. After completion of reaction, the resulting mixture was poured into tert-Butyl methyl ether (4 L). Solid was isolated by filtration, washed with PE and dried□ in vacuum to give crude 5 (21.0 g) as a brown solid which was used directly for next step (ref for 5, Journal of Organic Chemistry, 1989, vol. 33, p. 1219 - 1225). ESI-LCMS: m/z 275 [M-H]'.

Préparation of (6): To the solution of 5 (crude, 21.0 g) in Pyridine (200 mL) was added AgNCL (31.0 g, 180.0 mmol) and collidine (88.0 g, 720 mmol) and TrtCl (41.5 g, 181 mmol) at r.t, and the reaction mixture was stirred at r.t for 15 h. After addition of water, the resulting mixture was extracted with EA. The combined organic layer was washed with water and brine, dried over Na2SÜ4, and concentrated to give the crude. The crude was by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 6 (10.0 g, 13.1 mmol, 20% yield over 3 steps) as a white solid. ESILCMS: m/z 761 [M+H]⁺.

Préparation of (7): To the solution of 6 (10.0 g, 13.1 mmol) in THF (100 mL) was added 6 N NaOH (30 mL) at r.t, and the reaction mixture was stirred at r.t for 1 hr. After addition of NH4CI, the resulting mixture was extracted with EA. The combined organic layer was washed with water and brine, dried over Na2SO4, and concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 9/1; Detector, UV 254 nm. This resulted in to give 7 (9.3 g, 11.9 mmol, 90%) as a white solid. ESI-LCMS: m/z 777 [M-H]’_; Ή-NMR (400 MHz, DMSO-J₆): δ 11.57 (s, 1H), 8.02 (d, J= 8.7 Hz, 1H), 7.88-7.81 (m, 1H), 7.39-7.18 (m, 30H), 7.09-6.99 (m, 30H), 6.92-6.84 (m, 30H), 6.44 (d, J= 4.0 Hz, 1H), 4.87 (d, J= 4.0 Hz, 1H), 4.37^1.29 (m, 1H), 4.003.96 (m, 1H), 3.76-3.70 (m, 1H), 3.22-3.13 (m, 1H), 3.13-3.04 (m, 1H).

Préparation of (8): To the solution of 7 (8.3 g, 10.7 mmol) in dry DCM (80 mL) was added Pyridine (5.0 g, 64.2 mmol) and DAST (6.9 g, 42.8 mmol) at 0°C, and the reaction

219 mixture was stirred at r.t for 15 hr. After addition of NH4CI, the resulting mixture was extracted with DCM. The combined organic layer was washed with water and brine, dried over NasSCU, and concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 8 (6.8 g, 8.7 mmol, 81.2%) as a white solid. ESI-LCMS: m/z 779 [ΜΗ]⁴·; ¹⁹F-NMR (376 MHz, DMSO-î/₆): δ -183.05.

Préparation of (9): To the solution of 8 (5.8 g, 7.5 mmol) in dry ACN (60 mL) was added TEA (1.5 g, 15.1 mmol), DMAP (1.84 g, 15.1 mmol) and TPSC1 (4.1 g, 13.6 mmol) at r.t, and the reaction mixture was stirred at room température for 3 h under N2 atmosphère. After completion of reaction, the mixture was added NH3.H2O (12 mL). After addition of water, the resulting mixture was extracted with EA. The combined organic layer was washed with water and brine, dried over Na2SO4, and concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 9 (5.5 g, 7 mmol, 90.2%) as a white solid. ESI-LCMS: m/z 780 [M+H]⁺.

Préparation of (10): To a solution of 9 (5.5 g, 7 mmol) in DCM (50 mL) with an inert atmosphère of nitrogen was added pyridine (5.6 g, 70.0 mmol) and BzCl (1.2 g, 8.5 mmol) in order at 0°C. The reaction solution was stirred for 30 minutes at room température. The solution was diluted with DCM (100 mL) and the combined organic layer was washed with water and brine, dried over Na2SC>4, and concentrated under reduced pressure to give a residue which was purified by silica gel column chromatography (eluent, PE: EA=5:1~2:1) to give 10 (5.4 g, 6.1 mmol, 90.6%) as a white solid. ESI-LCMS: m/z 884 [M+H]⁺; ¹⁹F-NMR (376 MHz, DMSO-7₆): δ-183.64.

Préparation of (11): To the solution of 10 (5.4 g, 6.1 mmol) in the solution of DCA (6%) in DCM (60 mL) was added TES (15 mL) at r.t, and the reaction mixture was stirred at room température for 5-10 min. After completion of reaction, the resulting mixture was added NaHCCE, the resulting mixture was extracted with DCM. The combined organic layer was washed with water and brine, dried over Na2SC>4, and concentrated under reduced pressure and the residue was crystallized from EA. Solid was isolated by filtration, washed with PE and dried

220 ovemight at 45° J in vacuum to give 11 (2.0 g, 5.0 mmol, 83.2%) as a white solid. ESI-LCMS: m/z 400 [M+H]⁺ .

Préparation of (12): To a solution of 11 (2.0 g, 5.0 mmol) in dry Pyridine (20 mL) was added DMTrCl (2.0 g, 6.0 mmol). The reaction mixture was stirred at r.t. for 2.5 h. LCMS showed 11 was consumed and water (200 mL) was added. The product was extracted with EA (200 mL) and the organic layer was washed with brine and dried over Na₂SO4 and concentrated to give the crude. The crude was purified by c.c. (PE: EA = 4:1-1:1) to give crude 12. The crude was further purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give 12 (2.1 g, 3 mmol, 60%) as a white solid. ESI-LCMS: m/z 702 [M+H]⁺; *H-NMR (400 MHz, DMSO-î/6): δ 12.63 (s, 1H), 8.54 (d, J= 7.8 Hz, 1H), 8.25 (d, J= 7.2 Hz, 2H), 7.82 (d, J= 3.6 Hz, 2H), 7.67-7.58 (m, 1H), 7.57-7.49 (m, 2H), 7.49-7.39 (m, 1H), 7.39-7.31 (m, 2H), 7.27-7.09 (m, 7H), 6.82-6.69 (m, 4H), 6.23 (d, J= 26.1 Hz, 1H), 5.59-5.49 (m, 1H), 4.83-4.61 (m, 1H), 4.15-4.01 (m, 1H), 3.743.59 (m, 6H), 3.33-3.28 (m, 1H), 3.16-3.05 (m, 1H). ¹⁹F-NMR (376 MHz, DMSO-76): δ -191.66.

Préparation of Example 41 monomer: To a suspension of 12 (2.1 g, 3.0 mmol) in DCM (20 mL) was added DCI (310 mg, 2.6 mmol) and CEP[N(iPr)2]2 (1.1 g, 3.7 mmol). The mixture was stirred at r.t. for 1 h. LC-MS showed 12 was consumed completely. The solution was washed with water twice and washed with brine and dried over Na₂SO4. Then concentrated to give the crude. The crude was by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H₂O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give Example 41 monomer (2.1 g, 2.3 mmol, 80.0%) as a white solid. ESI-LCMS: m/z 902 [M+H]⁺; *H-NMR (400 MHz, DMSO-Jô): δ 12.64 (s, 1H), 8.54 (d, J= 7.6 Hz, 1H), 8.24 (d, J= 7.7 Hz, 2H), 7.937.88 (m, 2H), 7.67-7.58 (m, 1H), 7.56-7.42 (m, 3H), 7.41-7.29 (m, 2H), 7.27-7.08 (m, 7H), 6.826.64 (m, 4H), 6.37-6.18 (m, 1H), 6.03-5.72 (m, 1H), 5.26-4.83 (m, 1H), 4.28-4.12 (m, 1H), 3.883.72 (m, 1H), 3.71-3.37 (m, 9H), 3.15-3.00 (m, 1H), 2.83-2.75 (m, 1H), 2.66-2.57 (m, 1H), 1.210.88 (m, 12H). ¹⁹F-NMR (376 MHz, DMSO-îZ6): δ -189.71.³¹P-NMR (162 MHz, DMSO-îZô): δ

149.48, 149.50, 148.95, 148.88.

221

Ëxample 42. Synthesis of Monomer

BzO' OBz

H

1a

BSA

TMSOTf

ACN

BzO' OBz ch₃nh₂

TrtCl

DMAP Pyridine

TrtO' OH

TrtCl collidine AgNO₃

DMF

Tf-Cl Et₃N DCM

TrtO' 'OH ho' 'oh

KOAc; DMF

CH₃NH₂

DAST; Pyridine

DCM

TrtO' V

DMTrCl Pyridine

Example 42 monomer

Scheme-22

Préparation of (2): To a solution of 1 (40.0 g, 79.3 mmol), la (7.6 g, 80.1 mmol) in ACN (100 mL). Then added BSA (35.2 g, 174.4 mmol) under N2 atmosphère. The mixture was stirred at 50°C for 1 h until the solution was clear. Then cool down to 0°C and dropped TMSOTf (18.5 g, 83.2 mmol).The mixture was stirred at 75°C for 1 h, TLC showed 1 was consumed completely. Then the solution was diluted.with EA, washed with H2O twice. The solvent was concentrated under reduced pressure and the residue was used for next step. ESILCMS: m/z 540 [M+H]⁺.

Préparation of (3): To a solution of 2 (37.1 g, 68.7 mmol) in 30%CH2NH2/MeOH solution (200 mL). The mixture was stirred at 25°C for 2 h. TLC showed 2 was consumed completely. The solvent was concentrated under reduced pressure and the residue was washed with EA twice to give 3 (12.5 g, 55.2 mmol) ( ref. for intermediate 3 Bioorganic & Médicinal Chemistry Letters, 1996, Vol. 6, No. 4, pp. 373-378,) which was used directly for the next step. ESI-LCMS: m/z 228 [M+H]⁺.

222

Préparation of (4): To a solution of 3 (12.5 g, 55.2 mmol) in pyridine (125 mL) and added DMAP (1.3 g, 11.0 mmol), TrtCl (30.7 g, 110.5 mmol). The mixture was stirred at r.t. for 24 h. TLC showed 3 was consumed completely. H2O was added to the mixture. Then filtered and the solution diluted with EA. The organic layer was washed with NaHCO₃ and brine. The solvent was concentrated under reduced pressure and then added ACN, filtered to give 4a (17.0 g, 35.4 mmol, 64% yield) as a white solid.

To a solution of 4a (17.0 g, 35.4 mmol) in DMF (200 mL), collidine (5.2 g, 43.5 mmol), TrCl (13.1 g, 47.1 mmol) were added after 2h and then again after 3h TrCl (13.1 g, 47.1 mmol), AgNO3 (8.0 g, 47.1 mmol). The mixture was stirred at 25°C for 24 h. TLC showed 4a was consumed completely. Then filtered and the solution diluted with EA. The organic layer was washed with NaHCO₃ and brine. The solvent was concentrated under reduced pressure and then added ACN, filtered to get 4 (14.2 g, 19.5 mmol, 54% yield) as a white solid. ESI-LCMS: m/z 712 [M+H]⁺ _; 'H-NMR (400 MHz, DMSO-7₆): δ 7.83 (d, J= 8 Hz, 2H), 7.42-7.20 (m, 30H), 6.18 (d, J= 7 Hz, 1H), 6.09 (d, 7= 8 Hz, 2H), 5.60 (d, 7= 7 Hz, 1H), 4.22 (m, 1H), 3.90 (d, 7= 5 Hz, 1H), 2.85 (d, 7= 10 Hz, 1H), 2.76 (s, 1H), 2.55-2.50 (dd, 1H).

Préparation of (5): To a solution of 4 (14.2 g, 19.9 mmol) in DCM (150 mL), DMAP (2.4 g, 19.9 mmol), TEA (4.0 g, 39.9 mmol, 5.6 mL) were added. Then cool down to 0°C, TfCl (6.7 g, 39.9 mmol) dissolved in DCM (150 mL) were dropped. The mixture was stirred at 25°C for 1 h. TLC showed 4 was consumed completely. Then filtered and the solution diluted with EA. The organic layer was washed with NaHCO₃ and brine. The solvent was concentrated under reduced pressure to get 5 (16.8 g, 19.9 mmol) as a brown solid. ESI-LCMS: m/z 844 [M+H]⁺.

Préparation of (6): To a solution of 5 (16.8 g, 19.9 mmol) in DMF (200 mL), KOAc (9.7 g, 99.6 mmol) were added, The mixture was stirred at 25°C for 14 h and 50°C for 3 h, TLC showed 5 was consumed completely. Then filtered and the solution diluted with EA. The organic layer was washed with H2O and brine. The solvent was concentrated under reduced pressure to get 6a (15.0 g, 18.9 mmol, 90% yield) as a brown solid. To a solution of 6a (15.0 g, 19.9 mmol) in 30% CH₃NH2/MeOH solution (100 mL) were added. The mixture was stirred at 25°C for 2 h, TLC showed 6a was consumed completely. Then the solvent was concentrated under reduced pressure and the residue was purified by cc (0-5% MeOH in DCM) to give 6 (11.6 g, 16.3 mmol, 82% yield) as a yellow solid. ESI-LCMS: m/z 712 [M+H]⁺; 'H-NMR (400 MHz, DMSO-î/ô): δ 7.59 (d, J= 8 Hz, 2H), 7.37-7.22 (m, 30H), 6.01 (d, 7= 8 Hz, 2H), 5.84 (d, 7= 3 Hz, 1H), 5.42 (d, 7= 4 Hz, 1H), 3.78-3.70 (m, 3H), 3.10 (t, 7= 9 Hz, 1H), 2.53 (d, 7= 4 Hz, 6H), 1.77 (s, 6H).

223

Préparation of (7): To a solution of 6 (11.6 g, 16.32 mmol) in DCM (200 mL), DAST (7.9 g, 48.9 mmol)were added at 0°C, The mixture was stirred at 25°C for 16 h, TLC showed 6 was consumed completely. Then the solution was diluted with EA, washed with NaHCCh twice, The solvent was concentrated under reduced pressure the residue purified by Flash-Prep-HPLC with the following conditions(IntelFlash-l): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) =1/1 increasing to CH3CN/H2O (0.5% NH₄HCO₃)=l/0 within 25 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) =4/1; Detector, UV 254 nm. This resulted in to give 7 (11.6 g, 13.8 mmol, 84 % yield) as a white solid. ESI-LCMS: m/z 714 [M+H]⁺ .

Préparation of (8): To a solution of 7 (11.6 g, 16.2 mmol) in DCM (100 mL) was added TFA (10 mL). The mixture was stirred at 20°C for 1 h. TLC showed 7 was consumed completely. Then the solution was concentrated under reduced pressure the residue was purified by silica gel column (0~20% MeOH in DCM) and Flash-Prep-HPLC with the following conditions(IntelFlash-l): Column, C18 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) =0/1 increasing to CH3CN/H2O (0.5% NH4HCO3)=l/3 within 25 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) =0/1; Detector, UV 254 nm. This resulted in to give 9 (1.7 g, 7.2 mmol, 45% yield) as a white solid. ESI-LCMS: m/z 229.9 [M+H]⁺; 'H-NMR (400 MHz, DMSO-7₆): δ 7.91 (d, J= 8 Hz, 2H), 6.14 (d, J= 8 Hz, 2H), 5.81-5.76 (m, 2H), 5.28 (t, J= 5 Hz, 1H), 5.13-4.97 (t, J= 4 Hz, 1H), 4.23 (m, 1H), 3.97 (m, 1H), 3.74-3.58 (m, 2H); ¹⁹F-NMR (376 MHz, DMSO-c/ô): δ -206.09.

Préparation of (9): To a solution of 8 (1.4 g, 6.1 mmol) in pyridine (14 mL) was added DMTrCl (2.5 g, 7.3 mmol) at 20°C. The mixture was stirred at 20°C for 1 h. TLC showed 8 was consumed completely. Water was added to the reaction. The product was extracted with EA, The organic layer was washed with NaHCCh and brine. Then the solution was concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 4/1 within 25 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/1; Detector, UV 254 nm. This resulted in to give 9 (2.5 g, 4.6 mmol, 76 yield) as a white solid. ESI-LCMS: m/z 532.2 [M+H]⁺; 'H-NMR (400 MHz, DMSO-î/ô): δ 7.87-7.84 (m, 2H), 7.40-7.22 (m, 9H), 6.91-6.87(m, 4H), 5.98-5.95 (m, 2H), 5.88-5.77 (m, 2H), 5.16-5.02 (m, 1H), 4.42 (m, 1H), 4.05 (m, 1H), 3.74 (s, 6H), 3.35 (m, 2H); ¹⁹F-NMR (376 MHz, DMSO-J6): δ -202.32.

Préparation of Example 42 monomer: To a solution of 9 (2.2 g, 4.1 mmol) in DCM (20 mL) was added DCI (415 mg, 3.5 mmol) and CEP (1.5 g, 4.9 mmol) under N2 pro. The mixture

224 was stirred at 20°C for 0.5 h. TLC showed 9 was consumed completely. The product was extracted with DCM, The organic layer was washed with H₂O and brine. Then the solution was concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH₃CN/H₂O (0.5% NH4HCO3) = 1/3 increasing to CH3CN/H₂O (0.5% NH4HCO3) = 1/0 within 25 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give Example 42 monomer (2.6 g, 3.5 mmol, 85% yield) as a white solid. ESILCMS: m/z 732.2 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-J6): δ 7.87-7.84 (m, 2H), 7.40-7.22 (m, 9H), 6.91-6.87(m, 4H), 5.98-5.95 (m, 2H), 5.90-5.88 (m, 1H), 5.30-5.17 (m, 1H), 4.62 (m, 1H), 4.19 (m, 1H), 3.78-3.73 (m, 7H), 3.62-3.35 (m, 5H), 2.78 (t, J= 5 Hz, 1H), 2.63 (t, J= 6 Hz, 1H),1.14-0.96 (m, 12H); ¹⁹F-NMR (376 MHz, DMSO-J6): δ -200.77, 200.80, 201.62, 201.64. ³¹P-NMR (162 MHz, DMSO-îZ₆): δ 150.31, 150.24, 149.66, 149.60.

Example 43. Synthesis of End Cap Monomer

EDCI; TFA Pyridine DMSO

OPOM

MOPO-p=_O ⁹ _Dy ,ΟΡΟΜ ^D Q' OPOM

O

MOPO-p' D ΜΟΡΟ 11

TBSO' bcfè .0.

O

HCOOH

K,CO₃

THF/D₂O

CEP[N(iPr)₂]₂; DCI DCM

Example 43 monomer

Scheme-23

Préparation of (8): To a stirred solution of 7 (13.4 g, 35.5 mmol, Scheme 5) in DMSO (135 mL) were added EDCI (6.3 g, 32.9 mmol) and pyridine (0.9g, 10.9 mmol), TFA (0.6 g, 5.5 mmol) at r.t. And the reaction mixture was stirred at r.t for 2 h. LCMS showed 7 consumed completely. The reaction was quenched with water and the product was extracted with EA (1800 mL). The organic phase was washed by brine, dried over Na₂SO4, The organic phase was evaporated to dryness under reduced pressure to give a residue 8 (13.2 g, 35.3 mmol, 99.3% yield). Which was used directly to next step. ESI-LCMS: m/z =375 [M+H₂O]⁺

Préparation of (10): A solution of 8 (13.2 g, 35.3 mmol), 9 (26.8 g, 42.3 mmol, Scheme 18 ) and K₂CO₃ (19.5 g, 141.0 mmol) in dry THF (160 mL) and D₂O (53 mL) was stirred at 225

r.t. 17 h. LCMS showed most of 8 was consumed. The product was extracted with EA (2500 mL) and the organic layer was washed with brine and dried over Na2SÛ4. Then the organic layer was concentrated to give a residue which was purified by c.c. (PE: EA = 10:1 ~ 1:2) to give product 10 (8.1 g, 11.8mmol, 33.4% yield) as a white solid. ESI-LCMS m/z = 682 [M+H]⁺; ’HNMR (400 MHz, DMSO-dô): δ 11.42 (s, 1H), 7.69-7.71 (d, 7=8.1 Hz, 1H), 5.78-5.79 (d, 7=3.7 Hz, 1H), 5.65-5.67 (m, 1H), 5.59-5.63 (m, 4H), 4.29-4.35 (m, 2H), 3.97-3.99 (m, 1H), 1.15 (s, 18H), 0.87 (s, 9H), 0.07-0.08 (d, 7=5.1 Hz, 6H). ³¹P-NMR (162 MHz, DMS O-76) δ 16.62.

Préparation of (11): To a round-bottom flask was added 10 (7.7 g, 11.1 mmol) in a mixture of HCOOH (80 mL) and H2O (80 mL). The reaction mixture was stirred at 40°C for 3 h. LCMS showed the 10 was consumed completely. The reaction mixture was adjusted the pH = 7.0 with con.NH3.H2O (100 mL). Then the mixture was extracted with DCM (100 mL*3). The combined DCM layer was dried over Na2SÜ4. Fïltered and filtrate was concentrated to give crude which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/2 increasing to CH3CN/ H2O (0.5% NH4HCO3) = 1/1 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. To give product 11 (5.5 g, 9.6 mmol, 86.1% yield) as a white solid. ESI-LCMS m/z = 568 [M+H]⁺; ‘H-NMR (400 MHz,DMSO-d6): δ 11.42 (s, 1H, exchanged with D2O), 7.62-7.64 (d, 7=8.1, 1H), 5.81-5.82 (d, 7=4.3, 1H), 5.58-5.66 (m, 5H), 5.52-5.53 (d, 7=6.6, 1H), 4.34-4.37 (m, 1H), 4.09-4.13 (m, 1H), 3.94-3.96 (t, 7=9.7, 1H), 1.15 (s, 18H), 0 (s, 1H). ³¹P NMR (162 MHz, DMSO-76) δ 17.16.

Préparation of Example 43 monomer: To a solution of 11 (5.3 g, 9.3 mmol) in DCM (40 mL) was added the DCI (1.1 g, 7.9 mmol), then CEP[N(ipr)2]2 (3.4 g, 11.2 mmol) was added. The mixture was stirred at r.t. for 1 h. LCMS showed 11 consumed completely. The reaction mixture was washed with H2O (50 mL*2) and brine (50 mL*l). Dried over Na2SC>4 and concentrated to give crude which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/3 increasing to CH3CN/ H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. The product was concentrated to give Example 43 monomer (6.2 g, 8.0 mmol, 85.6% yield) as a white solid. ESILCMS m/z = 768 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-76): δ 11.43 (s, 1H), 7.68-7.71 (m, 1H), 5.79-5.81 (m, 1H), 5.58-5.67 (m, 5H), 4.34-4.56 (m, 2H), 4.14-4.17 (m, 1H), 3.54-3.85 (m, 4H), 2.78-2.81 (m, 2H), 1.13-1.17 (m, 30H). ³¹P-NMR (162 MHz, DMSO-d6): δ 149.66, 149.16, 16.84, 16.56.

226

Example 44. Synthesis of Monomer

Example 44 monomer

Scheme-24

Préparation of (2): To a solution of 1 (20.0 g, 66.4 mmol) in dry DMF (400 mL) was added sodium hydride (1.9 g, 79.7 mmol) for 30 min, then was added CD3I (9.1 g, 79.7 mmol) in dry DCM (40 mL) at -20°C for 5.5 hr. LCMS showed the reaction was consumed. The mixture was filtered and the clear solution was evaporated to dryness and was evaporated with CH3OH. The crude was purified by silica gel column (SiCh, DCM/MeOH = 50:1-10:1). This resulted in to give the product 2 (7.5 g, 23.5 mmol, 35.5% yield) as a solid. ESI-LCMS: m/z 319 [M+H]⁺ _; ‘H-NMR (400 MHz, DMSO-J3): δ = 8.38 (m, 1H), 6.97 (m, 2H), 5.93-5.81 (m, 1H), 5.27-5.26 (d, J=4Hz, 1H), 5.13-5.11 (m, 1H), 4.39-4.31 (m, 1H), 4.31-4.25 (m, 1 H), 3.96-3.94 (m, 1H), 3.66-3.63 (m, 1H), 3.63-3.56 (m, 1H).

Préparation of (3): To a solution of 2 (7.5 g, 23.5 mmol) in dry DMF (75 mL) was added Imidazole (5.6 g, 82.3 mmol) and TBS.C1 (8.9 g, 58.8 mmol). The mixture was stirred at r.t. over 227 night. LCMS showed 2 was consumed completely. The reaction was quenched with water (300 mL). The product was extracted into ethyl acetate (100 mL). The organic layer was washed with brine and dried over anhydrous Na2SO4. The solvent was removed to give the cured 3 (9.8 g) as a solid witch used for the next step. ESI-LCMS: m/z 547 [M+H]⁺ .

Préparation of (4): To a solution of 3 (9.8 g) in THF (40 mL) was added TFA (10 mL) and water (10 mL) at 0°C. The reaction mixture was stirred at 0°C for 5 h. LC-MS showed 3 was consumed completely. Con. NH4OH was added to the mixture at 0°C to quench the reaction until the pH = 7.5. The product was extracted into ethyl acetate (200 mL). The organic layer was washed with brine and dried over anhydrous Na₂SO4. The solvent was removed to give the cured 4 (8.4 g) as a solid witch used for the next step. ESI-LCMS: m/z 433 [M+H]⁺ .

Préparation of (5): To a solution of 4 (8.4 g) in DCM/H₂O = 2:1 (84 mL) was added DAIB (18.8 g, 58.4 mmol) and TEMPO (0.87 g, 5.8 mmol). The reaction mixture was stirred at 40°C for 2 h. LCMS showed 4 was consumed. The mixture was diluted with DCM and water was added. The product was extracted with DCM. The organic layer was washed with brine and dried over anhydrous Na₂SO4. The solution was then concentrated under reduced pressure. This resulted in to give 5 (14.4 g) as a white solid. ESI-LCMS: m/z 447 [M+H]⁺ .

Préparation of (6): To a solution of 5 (14.4 g) in toluene (90 mL) and methanol (60 mL) was added 2M TMSCHN₂ (8.9 g, 78.1 mmol) till the yellow color not disappear at r.t. for 10 min. LCMS showed 5 was consumed. The crude was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH₃CN/H₂O (0.5% NH4HCO3) =1/1 increasing to CH₃CN/H₂O (0.5% NH4HCO3) = 1/0 within 25 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) =65/35 Detector, UV 254 nm. This resulted in to give the product 6 (3.5 g, 7.6 mmol, 32.3% yield over three steps, 70% purity) as a white solid. ESI-LCMS: m/z 461 [M+H]⁺ .

Préparation of (7): To the solution of 6 (3.5 g, 7.6 mmol) in dry THF/MeOD/D₂O = 10/2/1 (45 mL) was added NaBÜ4 (0.96 g, 22.8 mmol). And the reaction mixture was stirred at r.t for 2.5 hr. Aller completion of reaction, the resulting mixture was added CH3COOD to pH = 7, aller addition of water, the resulting mixture was extracted with EA (100 mL). The combined organic layer was washed with water and brine, dried over Na₂SO4, and concentrated to give 7 (3.3 g) which was used for the next step. ESI-LCMS: m/z 435 [M+H]⁺ .

Préparation of (8): To a solution of 7 (3.3 g) in dry DCM (30 mL) was added pyridine (5.9 g, 74.5 mmol) and iBuCl (2.4 g, 22.4 mmol) in DCM (6 mL) under ice bath. The reaction mixture was stirred at 0°C for 2.5 hr. LCMS showed 7 was consumed. The mixture was diluted with EA and water was added. The product was extracted with EA. The crude was purified by

228

Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH₃CN/H₂O (0.5% NH4HCO3) = 1/1 increasing to CH₃CN/H₂O (0.5% NH4HCO3) = 1/0 within 25 min, the eluted product was collected at CH3CN/H2O (0.5% NH4HCO3) = 87/13; Detector, UV 254 nm. This resulted in to give the crude 8 (1.6 g, 2.8 mmol, 36.8% yield over two steps) as a white solid. ESI-LCMS: m/z 575 [M+H]⁺ .

Préparation of (9): To a solution of 8 (1.6 g, 2.8 mmol,) in H₂O/dioxane =1:1 (30 ml) was added K₂CÜ3 (772.8 mg, 5.6 mmol) and DABCO (739.2 mg, 2.9 mmol). The reaction mixture was stirred at 50°C for 3 hr. LCMS showed 8 was consumed. The mixture was diluted with EA and water was added. The product was extracted with EA. The combined organic layer was washed with water and brine, dried over Na₂SO4, and concentrated to give 9 (1.8 g) which was used for the next step. ESI-LCMS: m/z 557 [M+H]⁺ .

Préparation of (10): To a solution of 9 (1.8 g) in pyridine (20 mL) and was added 2M NaOH (MeOH/H₂O = 4/1) (5 mL) at 0°C for 1 h. LCMS showed 9 was consumed. The mixture was added saturated NH4CI till pH = 7.5. The mixture was diluted with water and EA. The organic layer was washed with brine and dried over Na₂SC>4 and concentrated to give the crude. This resulted in to give the product 10(1.5 g) as a white solid which was used for the next step. ESI-LCMS: m/z 487 [M+H]⁺ .

Préparation of (11): To a stirred solution of 10 (1.5 g) in pyridine (20 mL) were added DMTrCl (1.1 g, 3 mmol) at r.t. And the reaction mixture was stirred at r.t for 2.5 hr. With icebath cooling, the reaction was quenched with water and the product was extracted into EA. The organic layer was washed with brine and dried over Na₂SÜ4 and concentrated to give the crude. The crude was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H₂O (0.5% NH4HCO3) = 1/0 within 25 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 7/3 Detector, UV 254 nm. This resulted in to give the product 11 (1.9 g, 2.4 mmol, 85.7% yield over two steps) as a white solid. ESI-LCMS: m/z 789.3 [M+H]⁺; *HNMR (400 MHz, DMSO-7₆): δ 12.10 (m, 1H), 11.63 (m, 1H), 8.20 (m, 1H), 7.35 -7.33 (m, 2H), 7.29-7.19 (m, 7H), 6.86-6.83 (m, 4H), 5.89-5.88 (d, J= 4 Hz, 1H), 4.40-4.28 (m, 2H), 3.72 (m, 6H), 2.81-2.76 (m, 1H), 1.13-1.11 (m, 6H), 0.80 (m, 9H), 0.05—0.01(m, 7H).

Préparation of (12): To a solution of 11 (1.9 g, 2.4 mmol) in THF (20 mL) was added 1 M TBAF solution (3 mL). The reaction mixture was stirred at r.t. for 1.5 h. LCMS showed 11 was consumed completely. Water (100 mL) was added. The product was extracted with EA (50 mL) and the organic layer was washed with brine and dried over Na₂SO4. Then the organic layer was concentrated to give a residue which was purified by Flash-Prep-HPLC with the following

229 conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 58/42; Detector, UV 254 nm. This resulted in to give 12 (1.5 g, 2.2 mmol, 91.6% yield) as a white solid. ESI-LCMS: m/z 675.3 [M+H]⁺; ’HNMR (400 MHz, DMSO-J₆): δ 12.09 (m, 1H), 11.60 (m, 1H), 8.14 (m, 1H), 7.35 -7.27 (m, 2H), 7.25-7.20 (m, 7H), 6.85-6.80 (m, 4H), 5.96-5.94 (d, J= 8 Hz, 1H), 5.26-5.24 (m, 1H), 4.35-4.28 (m, 2H), 3.72 (m, 6H), 3.32 (m, 1H), 2.79-2.72 (m, 1H), 1.13-1.11 (m, 6H).

Préparation of Example 44 monomer: To a suspension of 11 (1.5 g, 2.2 mmol) in DCM (15 mL) was added DCI (220.8 mg, 1.9 mmol) and CEP[N(iPr)2]2 (795.7 mg, 2.6 mmol) under N₂ pro. The mixture was stirred at r.t. for 2 h. LCMS showed 11 was consumed completely. The solution was washed with water twice and washed with brine and dried over Na2SO4. Then concentrated to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 4/1 ; Detector, UV 254 nm. This resulted in to give Example 44 monomer (1.6 g, 1.8 mmol, 83% yield) as a white solid. ESI-LCMS: m/z 875 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-J6): δ 12.12 (m, 1H), 11.60 (m, 1H), 8.15 (m, 1H), 7.37 7.29 (m, 2H), 7.27-7.20 (m, 7H), 6.86-6.81 (m, 4H), 5.94-5.88 (m, 1H), 4.54-4.51 (m, 2H), 4.214.20 (m, 1H), 3.73-3.54 (m, 10H), 2.80-2.75 (m, 1H), 2.61-2.58 (m, 1 H), 1.19-1.11 (m, 19H). ³¹P-NMR (162 MHz, DMSO-î/6): δ= 149.77, 149.71.

Example 45. Synthesis of Monomer

230

2

TrtCl, AgNO₃collidine, DMF

TfCl, TEA

DMAP, DCM

Scheme-25

6%

DCA7DCM

Example 45 monomer

Préparation of (2): To a solution of 1 (50.0 g, 99.2 mmol) and la (11.3 g, 119.0 mmol) in ACN (500.0 mL). Then added BSA (53.2 g, 218.0 mmol) under N2 Pro. The mixture was stirred at 50°C for 1 h until the solution was clear. Then cool down to 0°C and dropped TMSOTf (26.4 g, 119.0 mmol).The mixture was stirred at 75°C for 1 h, TLC showed 1 was consumed completely. The reaction was quenched by sodium bicarbonate solution at 0°C, then the solution was diluted with EA, washed with H2O twice. The solvent was concentrated under reduced pressure and the crude 2 (60.1 g) was used for next step. ESI-LCMS: m/z 540.2

[M+H]⁺.

Préparation of (3): To a solution of 2 (60.1 g) in CHaNEb/ethanol (500.0 mL). The mixture was stirred at 25°C for 2 h. TLC showed 2 was consumed completely. The solvent was concentrated under reduced pressure and the residue was purified by c.c. (MeOH:DCM = 50:1 ~ 10:1) to give 3 (22.0 g, 96.9 mmol, 97.3% yield over two steps).

ESI-LCMS: m/z 228.0 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-d₆): δ 8.01-7.98 (m, 1H), 7.43-7.38 (m, 1H), 6.37-6.35 (m, 1H), 6.27-6.23 (m, 1H), 6.03 (d, J= 3.5 Hz, 1H), 5.39 (d, J= 4.2 Hz, 1H), 5.11 (t, J=5.1 Hz, 1H), 5.03 (d, .7=5.1 Hz, 1H), 3.98-3.95 (m, 2H), 3.91-3.88 (m, 1H), 3.74-3.57 (m, 2H).

231

Préparation of (4): To a solution of 3 (22.0 g, 96.9 mmol) in pyridine (250.0 mL), TrtCl (30.7 g, 110.5 mmol) was added. The mixture was stirred at 25°C for 24 h. TLC showed 3 was consumed completely, H₂O was added to the mixture. Then filtered and the filtrate diluted with EA, the organic layer was washed with NaHCCh and brine. The solvent was concentrated under reduced pressure and then purified by c.c. (PE/EA = 5:1 ~ 0:1) to give 4 (38.8 g, 82.5 mmol, 85.1% yield) as a white solid. ESI-LCMS: m/z 470.1 [M+H]⁺.

Préparation of (5): To a solution of 4 (38.8 g, 82.5 mmol) in DMF (500.0 mL), collidine (10.0 g, 107.3 mmol), TrtCl (27.6 g, 99.1 mmol) were added followed by AgNCh (18.0 g, 105.1 mmol). The mixture was stirred at 25°C for 4 h. TLC showed 4 was consumed completely. Then filtered and the filtrate diluted with EA. The organic layer was washed with NaHCCh and brine. The solvent was concentrated under reduced pressure and then purified by c.c. (PE/EA = 5:1 ~ 1:1) to give a mixture of 5 (52.3 g, 73.5 mmol, 86.3% yield) as white solid. ESI-LCMS: m/z 711.1 [M+H]⁺.

Préparation of (6): To a solution of 5 (52.3 g, 73.5 mmol) in DCM (500.0 mL), DMAP (8.9 g, 73.5 mmol), TEA (14.9 g, 147.3 mmol, 20.6 mL) were added, cool down to 0°C, TfCl (16.1 g, 95.6 mmol) dissolved in DCM (100.0 mL) were dropped. The mixture was stirred at 25°C for 1 h. TLC showed 5 was consumed completely. Then filtered and the solution diluted with EA. The organic layer was washed with NaHCCh and brine. The solvent was concentrated under reduced pressure to get crude 6 (60.2 g) as a brown solid. ESI-LCMS: m/z 844.2 [M+H]⁺.

Préparation of (7): To a solution of 6 (60.2 g) in DMF (500.0 mL), KOAc (36.1 g, 367.8 mmol) were added, The mixture was stirred at 25°C for 14 h and 50°C for 3 h, TLC showed 6 was consumed completely. Then filtered and the solution diluted with EA. The organic layer was washed with H₂O and brine. The solvent was concentrated under reduced pressure, residue was purified by c.c. (PE/EA = 5:1-1:1) to give 7 (28.0 g, 39.3 mmol, 53.5% yield) as yellow solid. ESI-LCMS: m/z 710.2 [M-H]'_; Ή-NMR (400 MHz, DMSO-î/₆): δ 7.37-7.25 (m, 33H), 6.34-6.31 (m, 2H), 6.13-6.10 (m, 1H), 5.08 (d, J=4.2 Hz, 1H), 3.99 (d, .7=7.6 Hz, 1H), 3.74 (s, 1H), 3.12 (t, J= 9.2 Hz, 1H), 2.72-2.69 (m, 1H).

Préparation of (8): To a solution of 7 (28.0 g, 39.3 mmol) in DCM (300.0 mL), DAST (31.6 g, 196.6 mmol) was added at 0°C, the mixture was stirred at 25°C for 16 h, TLC showed 7 was consumed completely. Then the solution was diluted with EA, washed with NaHCCL twice, the solvent was removed under reduced pressure, residue was purified by c.c. (PE/EA = 5:1 ~ 3:1) to give 8 (5.0 g, 7.0 mmol, 17.8% yield) as a white solid. ESI-LCMS: m/z 748.2 [M+2NH₄]⁺; ‘H-NMR (400 MHz, DMSO-î/₆): δ 7.57-7.18 (m, 35H), 6.30 (d, J= 8.8 Hz, 1H),

232

6.00 (d, J= 19.5 Hz, 1H), 5.92-5.88 (m, 1H), 4.22-4.17 (m, 2H), 3.94 (s, 0.5H), 3.80 (s, 0.5H), 3.35-3.31 (m, 1H), 3.14-3.10 (m, 1H); ¹⁹F-NMR(376 MHz, DMSO-î7₆): δ-193.54.

Préparation of (9): To a solution of 8 (5.0 g, 7.0 mmol) in DCM (60.0 mL) was added DCA (3.6 mL) and TES (15.0 mL). The mixture was stirred at 20°C for 1 h, TLC showed 8 was consumed completely. Then the solution was concentrated under reduced pressure, the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) =0/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/3 within 25 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO₃) =0/1; Detector, UV 254 nm. This resulted in to give 9 (1.6 g, 6.9 mmol, 98.5% yield) as a white solid. ESI-LCMS: m/z 229.9 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-î/6): δ 8.06-8.04 (m, 1H), 7.48-7.43 (m, 1H), 6.39 (d, J= 9.0 Hz, 1H), 6.31-6.27 (m, 1H), 6.16-6.11 (m, 1H), 5.63 (s, 1H), 5.26 (s, 1H), 4.95-4.81 (m, 1H), 4.20-411 (m, 1H), 3.95 (d, J= 8.2 Hz, 1H), 3.84 (d, J =12.4 Hz, 1H), 3.64 (d, .7=12.1 Hz, 1H); ¹⁹F-NMR (376 MHz, DMSO-J6): δ -201.00.

Préparation of (10): To a solution of 9 (1.6 g, 6.9 mmol) in pyridine (20.0 mL) was added DMTrCl (3.5 g, 10.5 mmol) at 20°C and stirred for 1 h. TLC showed 9 was consumed completely. Water was added and extracted with EA, the organic layer was washed with NaHCO3 and brine. Then the solution was concentrated under reduced pressure and the residue was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/3 increasing to CH3CN/H2O (0.5% NH4HCO3) =4/1 within 25 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) =1/1; Detector, UV 254 nm. This resulted in to give 10 (2.2 g, 4.2 mmol, 60.8% yield) as a white solid. ESI-LCMS: m/z 530.1 [M-H]’; 'H-NMR (400 MHz, DMSO-îZ₆): δ 7.937.91 (m, 1H), 7.47-7.23 (m, 10H), 6.91-6.89 (m, 4H), 6.41 (d, .7=8.8 Hz, 1H), 6.13 (d, .7=18.8 Hz, 1H), 6.00-5.96 (m, 1H), 5.68 (d, J= 6.6 Hz, 1H), 5.01 (d, J= 4.2 Hz, 0.5H), 4.88 (d, J= 4.2 Hz, 0.5H), 4.42-4.31 (m, 1H), 4.10-4.08 (m, 1H), 3.74 (s, 6H),3.40-3.34 (m, 2H); ^I9F-NMR (376 MHz, DMSO-de): δ -199.49.

Préparation of Example 45 monomer: To a solution of 10 (2.2 g, 4.2 mmol) in DCM (20.0 mL) was added DCI (415 mg, 3.5 mmol) and CEP (1.5 g, 4.9 mmol) under N2 pro. The mixture was stirred at 20°C for 0.5 h. TLC showed 10 was consumed completely. The product was extracted with DCM, the organic layer was washed with H2O and brine. Then the solution was concentrated under reduced pressure and the residue was purified by cc (PE/EA = 5:1 ~ 1:1) and Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) =1/3 increasing to CH3CN/H2O (0.5% NH4HCO3)=l/0 within 25 min, the eluted product was collected at CH3CN/ H₂O (0.5%

233

NH4HCO3) =1/0; Detector, UV 254 nm. This resulted in to give Example 45 monomer (2.1 g, 3.0 mmol, 73.1% yield) as a white solid. ESI- ESI-LCMS: m/z 732.2 [M+H]⁺; 'H-NMR (400 MHz, DMSO-î/ô): δ 7.98-7.92 (m, 1H), 7.42-7.24 (m, 10H), 6.91-6.85 (m, 4H), 6.43-6.39 (m, 1H), 6.18-6.11 (m, 1H), 6.01-5.97 (m, 1H), 5.22-5.19 (m, 0.5H), 5.09-5.06 (m, 0.5H), 4.73-4.52 (m, 1H), 4.21-4.19 (m, 1H), 3.79-3.62 (m, 7H), 3.57-3.47 (m, 4H), 3.32-3.28 (m, 1H), 2.75-2.58 (m, 1H), 1.13-0.92 (m, 12H); ¹⁹F-NMR (376 MHz, DMSO-76): δ -196.82, -196.84, -197.86, 197.88; ³¹P-NMR (162 MHz, DMSO-76): δ 149.88, 149.83, 149.39, 149.35.

Example 46. Synthesis of Monomer

Example 46 monomer

Scheme-26

Préparation of (2): To the solution of Bromobenzene (2.1 g, 13.6 mmol) in dry THF (15 mL) was added 1.6 M n-BuLi (7 mL, 11.8 mmol) drop wise at -78°C. The mixture was stirred at -78°C for 0.5 h. Then the 1 (3.0 g, 9.1 mmol,Wang, Guangyi et al, Journal of Médicinal Chemistry, 2016,59(10), 4611-4624) was dissolved in THF (15 mL) and added to the mixture drop wise with keeping at -78°C. Then the reaction mixture was stirred at -78°C for 1 hr. LC-MS showed 1 was consumed completely. Then the solution was added to saturated aq. NH4CI and the resulting mixture was extracted with EA. The combined organic layer was washed with water and brine, dried over Na₂SÜ4, and concentrated under reduced pressure to give a residue which was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl8 silica gel; mobile phase, CH3CN/H₂O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 4/1 within 25 min, the eluted product was collected at CH3CN/ H₂O (0.5% NH4HCO3) = 3/2; Detector, UV 254 nm. This resulted in to give 2 (3.0 g, 7.3 mmol, 80.0%) as a white solid. ESI-LCMS: m/z 391 [M-OH]’.

234

Préparation of (3): To the solution of 2 (4.0 g, 9.8 mmol) in DCM (40 mL) was added TES (1.9 g, 11.7 mmol) at -78°C, and the mixture was added BFa.OEt? (2.1 g, 14.7 mmol) drop wise at -78°C. The mixture was stirred at -40°C for 1 hr. LC-MS showed 2 was consumed completely. Then the solution was added to saturated aq. NaHCOs and the resulting mixture was extracted with DCM. The combined organic layer was washed with water and brine, dried over Na2SÛ4, and concentrated under reduced pressure to give a residue which was purified by FlashPrep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 2/3 increasing to CH3CN/H2O (0.5% NH4HCO3) = 4/1 within 25 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 7/3; Detector, UV 254 nm. This resulted in to give 3 (3.1 g, 5.3 mmol, 54.0%) as a water clear oil. ESI-LCMS: m/z 410 [M+H₂O]⁺; ’H-NMR (400 MHz, CDCI3: δ 7.48-7.25 (m, 15H), 5.24-5.13 (m, 1H), 4.93-4.74 (m, 1H), 4.74-4.46 (m, 4H), 4.37-4.25 (m, 1H), 4.19-4.05 (m, 1H), 4.00-3.80 (m, 1H), 3.77-3.63 (m, 1H). ¹⁹F-NMR (376 MHz, CDCI3): δ -196.84.

Préparation of (4): To the solution of 3 (2.1 g, 5.3 mmol) in dry DCM (20 mL) was added 1 M BCI3 (25 mL, 25.5 mmol) drop wise at -78°C, and the reaction mixture was stirred at -78°C for 0.5 hr. LC-MS showed 3 was consumed completely. After completion of reaction, the resulting mixture was poured into water (50 mL). The solution was extracted with DCM and the combined organic layer was concentrated under reduced pressure to give a crude. The crude in MeOH (4 mL) was added 1 M NaOH (15 mL), and the mixture was stirred at r.t for 5—10 min. The mixture was extracted with EA. The combined organic layer was washed with brine, dried over Na2SÜ4, and concentrated under reduced pressure to give a residue which was purified by silica gel column chromatography (eluent, DCM: MeOH = 40:1-15:1) to give 4 (1.0 g, 4.7 mmol, 88.6%) as a water clear oil. ESI-LCMS: m/z 211 [M-H]’_; ‘H-NMR (400 MHz, DMSOd₆): δ 7.58-7.19 (m, 5H), 5.41 (d, J= 6.1 Hz, 1H), 5.09-5.95 (m, 1H), 5.95-4.84 (m, 1H), 4.824.59 (m, 1H), 4.14-3.94 (m, 1H), 3.89-3.80 (m, 1H), 3.78-3.67 (m, 1H), 3.65-3.53 (m, 1H). ¹⁹FNMR (376 MHz, DMSO-îZ₆): δ -196.46.

Préparation of (5): To a solution of 4 (1.0 g, 4.7 mmol) in Pyridine (10 mL) was added DMTrCl (2.0 g, 5.7 mmol). The reaction mixture was stirred at r.t. for 2 hr. LCMS showed 4 was consumed and water (100 mL) was added. The product was extracted with EA (100 mL) and the organic layer was washed with brine and dried over Na2SÛ4 and concentrated to give the crude. The crude was further purified by Flash-Prep-HPLC with the following conditions (IntelFlash1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 9/1; Detector, UV 254 nm. This resulted in to give 5 (2.1 g, 4.1 mmol,

235

87.0%) as a red oil. ESI-LCMS: m/z 513 [M-H]'_; ‘H-NMR (400 MHz, DMSO-î/₆): δ 7.56-7.16 (m, 14H), 6.94-9.80 (m, 4H), 5.45 (d, J= 6.3 Hz, 1H), 5.21-5.09 (m, 1H), 4.89-4.68 (m, 1H), 4.18-4.03 (m, 2H), 3.74 (s, 6H), 3.33-3.29 (m, 1H), 3.26-3.17 (m, 1H). ¹⁹F-NMR (376 MHz, DMSO-î7₆): δ -194.08.

Préparation of Example 46 monomer: To a suspension of 5 (2.1 g, 4.1 mmol) in DCM (20 mL) was added DCI (410 mg, 3.4 mmol) and CEP[N(iPr)2]2 (1.5 g, 4.9 mmol). The mixture was stirred at r.t. for 1 h. LC-MS showed 5 was consumed completely. The solution was washed with water twice and washed with brine and dried over Na2SO4. Then concentrated to give the crude. The crude was purification by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, Cl 8 silica gel; mobile phase, CH3CN/H2O (0.5% NH4HCO3) = 1/1 increasing to CH3CN/H2O (0.5% NH4HCO3) = 1/0 within 20 min, the eluted product was collected at CH3CN/ H2O (0.5% NH4HCO3) = 1/0; Detector, UV 254 nm. This resulted in to give Example 46 monomer (2.1 g, 2.9 mmol, 70.0%) as a white solid. ESI-LCMS: m/z 715 [M+H]⁺; ‘H-NMR (400 MHz, DMSO-îZ6): δ 7.59-7.16 (m, 14H), 6.94-9.80 (m, 4H), 5.26-5.12 (m, 1H), 5.06-4.77 (m, 1H), 4.50-4.20 (m, 1H), 4.20-4.10 (m, 1H), 3.83-3.63 (m, 7H), 3.59-3.37 (m, 4H), 3.25-3.13 (m, 1H), 2.80-2.66 (m, 1H), 2.63-2.53 (m, 1H), 1.18-0.78 (m, 12H). ¹⁹F-NMR (376 MHz, DMSO-c/ό): δ -194.40, -194.42, -194.50, -194.53.³¹P-NMR (162 MHz, DMSO-tZ6): δ 149.38, 149.30, 149.02, 148.98.

Example 47. Deuterated vinyl phosphonate improves potency of siNA

This example investigates whether a deuterated vinyl phosphonate improves potency of siNA in an AAV-HBV mouse. AAV-HBV mice were subcutaneously injected with vehicle, dssiNA-0165 (e.g., siNA without a deuterated vinyl phosphonate), or ds-siNA-0144 (e.g., siNA with a deuterated vinyl phosphonate). For siNA-treated AAV-HBV mice, AAV-HBV mice were subcutaneously injected with a single dose of 5 mg/kg of siNA. As shown in FIG. 11, siNA molécules having 2’-fluoro nucléotides at positions 3, 7-9, 12, and 17 from the 5’ end of the sense strand and 2’-fluoro nucléotides at positions 2 and 14 from the 5’ end of the antisense strand resulted in at least a 0.5-log réduction in HBsAg, with the greatest réduction in HBsAg found in mice treated with the deuterated vinylphopshonate siNA (ds-siNA-0165). Thus, FIG. 11 demonstrates that the presence of a deuterated vinyl phosphonate improves potency of the siNA.

Example 48. Deuterated vinyl phosphonate results in a greater réduction in sérum HBsAg

AAV-HBV mice were subcutaneously injected with vehicle, ds-siNA-0163 (e.g., siNA without a vinyl phosphonate), ds-siNA-0122 (e.g., siNA with a vinyl phosphonate), or ds-siNA0123 (e.g., siNA with a deuterated vinyl phosphonate). For siNA-treated AAV-HBV mice,

236

AAV-HBV mice were subcutaneously injected with a single dose of 5 mg/kg of siNA. As shown in FIG. 12, siNA molécules having 2’-fluoro nucléotides at positions 7, 9-11 from the 5’ end of the sense strand and 2’-fluoro nucléotides at positions 2 and 14 from the 5’ end of the antisense strand resulted in at least a 0.5-log réduction in HBsAg, with the greatest réduction in HBsAg found in mice treated with the deuterated vinylphopshonate siNA (ds-siNA-0165). Thus, FIG. 12 demonstrates that the presence of a deuterated vinyl phosphonate improves potency of the siNA, as compared to the siNA without a vinyl phosphonate and the siNA with the vinyl phosphonate.

Example 49: Synthesis of 5’ End Cap Monomer

Example 49 Monomer Synthesis Scheme

Préparation of (2): 1 (15 g, 58.09 mmol) and fôrt-butyl N-methylsulfonylcarbamate (17.01 g, 87.13 mmol) were dissolved in THF (250 mL), and PPha (30.47 g, 116.18 mmol) was added followed by dropwise addition of DIAD (23.49 g, 116.18 mmol, 22.59 mL) at 0°C. The reaction mixture was stirred at 15°C for 12 h. Upon completion as monitored by TLC (DCM/MeOH=10/l), the reaction mixture was evaporated to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 120 g SepaFlash® Silica Flash Column, Eluent of 0-20% MeOH/DCM gradient @ 60 mL/min) to give 2 (6.9 g, 24.28% yield) as a white solid. ESI-LCMS: m/z 457.9 [M+Na]⁺; Ή NMR (400 MHz, CDCI3) δ = 8.64 (br s, 1H), 7.64 (d, J=8.2 Hz, 1H), 5.88 (d, J=1.9 Hz, 1H), 5.80 (dd, J=2.2, 8.2 Hz, 1H), 4.19 - 4.01 (m, 3H), 3.90 237 (dt, J=5.5, 8.2 Hz, 1H), 3.82 - 3.78 (m, 1H), 3.64 (s, 3H), 3.32 (s, 3H), 2.75 (d, J=8.9 Hz, 1H), 1.56 (s, 9H).

Préparation of (3): 2 (6.9 g, 15.85 mmol) was dissolved in MeOH (40 mL), and a solution of HCl/MeOH (4 M, 7.92 mL) was added dropwise. The reaction mixture was stirred at 15°C for 12 h, and then evaporated to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 40 g SepaFlash® Silica Flash Column, Eluent of 0-10% MeOH/DCM gradient @ 40 mL/min) to give 3 (2.7 g, 50.30% yield) as a white solid. ESI-LCMS: m/z 336.0 [M+H]⁺; ‘H NMR (400 MHz, CD₃CN) δ = 9.20 (br s, 1H), 7.52 (d, J=8.1 Hz, 1H), 5.75 (d, J=3.8 Hz, 1H), 5.64 (dd, J=2.0, 8.1 Hz, 1H), 5.60 - 5.52 (m, 1H), 4.15 - 3.99 (m, 1H), 3.96 - 3.81 (m, 2H), 3.46 (s, 3H), 3.44 - 3.35 (m, 1H), 3.34 - 3.26 (m, 1H), 2.92 (s, 3H).

Préparation of (Example 49 monomer): To a solution of 3 (2.14 g, 6.38 mmol) in DCM (20 mL) was added dropwise 3-bis(diisopropylamino)phosphanyloxypropanenitrile (2.50 g, 8.30 mmol, 2.63 mL) at 0°C, followed by lH-imidazole-4, 5-dicarbonitrile (829 mg, 7.02 mmol), and the mixture was purged under Ar for 3 times. The reaction mixture was stirred at 15 °C for 2 h. Upon completion, the mixture was quenched with 5% NaHCO₃ (20 mL), extracted with DCM (20 mL*2), washed with brine (15 mL), dried over NazSCU, filtered, and evaporated to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 40 g SepaFlash® Silica Flash Column, Eluent of 0-10% (Phase B: i-PrOH/DCM=l/2)/Phase A: DCM with 5% TEA gradient @ 40 mL/min) to give Example 49 monomer (1.73 g, 48.59% yield) as a white solid. ESI-LCMS: m/z 536.3 [M+H]⁺; ‘H NMR (400 MHz, CD3CN) δ = 7.58 7.48 (m, 1H), 5.83 - 5.78 (m, 1H), 5.71 - 5.64 (m, 1H), 4.40 - 4.29 (m, 1H), 4.19 - 4.07 (m, 1H), 3.98 (td, J=5.3, 13.3 Hz, 1H), 3.90 - 3.78 (m, 2H), 3.73 - 3.59 (m, 3H), 3.41 (d, J=14.8 Hz, 4H), 2.92 (br d, J=7.0 Hz, 3H), 2.73 - 2.63 (m, 2H), 1.23 - 1.11 (m, 12H); ³¹P NMR (162 MHz, CD3CN) δ = 149.81, 150.37.

Example 50: Synthesis of 5’ End Cap Monomer

NaNj

Hj/Pd/C

238

Cl

TBSO' OCH₃ TBSO' bCHj HO' t)CHj

6 7

Example 50 Monomer

Example 50 Monomer Synthesis Scheme

Préparation of (2): To a solution of 1 (10 g, 27.16 mmol) in DMF (23 mL) were added imidazole (3.70 g, 54.33 mmol) and TBSC1 (8.19 g, 54.33 mmol) at 25 °C. The mixture was stirred at 25 °C for 2 hr. Upon completion, the reaction mixture was diluted with Η₂Ο (20 mL) and extracted with EA (30 mL * 2). The combined organic layers were washed with brine (20 mL * 2), dried over Na2SO4, filtered and concentrated under reduced pressure to give 2(13 g, 99.2% yield) as a white solid. ESI-LCMS: m/z 482.9 [M+H]⁺. .

Préparation of (3): To a solution of 2 (35.00 g, 72.56 mmol) in DMF (200 mL) was added NaN₃ (14.15 g, 217.67 mmol). The mixture was stirred at 60 °C for 17 h. Upon completion, the reaction mixture was diluted with H2O (200 mL) and extracted with EA (200 mL* 2). The combined organic layers were washed with brine (100 mL * 2), dried over Na₂SO4, filtered and concentrated under reduced pressure to give 3 (31.8 g, crude) as a yellow solid. ESILCMS: m/z 398.1 [M+H]⁺; Ή NMR (400 MHz, DMSO-d6) δ=11.21 (d, J=1.3 Hz, 1H), 7.50 (d, >8.1 Hz, 1H), 5.57 (d, >4.5 Ηζ,ΙΗ), 5.46 (dd, >2.1, 8.0 Hz, 1H), 4.06 (t, >5.2 Hz, 1H), 3.81 - 3.64 (m, 2H), 3.44 - 3.30 (m, 2H), 2.31 -2.25 (m, 3H), 0.65 (s, 9H), -0.13 (s, 6H).

Préparation of (4): To a solution of 3 (7 g, 17.61 mmol) in THF (60 mL) was added Pd/C (2 g) at 25 °C. The reaction mixture was stirred at 25 °C for 3 h under H₂atmosphère (15 PSI). The reaction mixture was filtered, and the filtrate was concentrated to give 4 (5.4 g, 75.11% yield) as a gray solid. ESI-LCMS: m/z 372.1 [M+H]⁺ _; *H NMR (400 MHz, DMSO-d6) δ =7.93 (d, >8.0 Hz, 1H), 5.81 (d, J=5.5 Hz, 1H), 5.65 (d, >8.3 Ηζ,ΙΗ), 4.28 (t,

239 >4.6 Hz, 1H), 3.88 (t, >5.3 Hz, 1H), 3.74 (q, >4.6 Hz, 1 H), 3.31 (s, 3H), 2.83 - 2.66 (m,2H), 0.88 (s, 9H), 0.09 (s, 6H).

Préparation of (5): To a solution of 4 (3 g, 8.08 mmol) in DCM (30 mL) was added TEA (2.45 g, 24.23 mmol, 3.37 mL) followed by dropwise addition of 3-chloropropane-lsulfonyl chloride (1.50 g, 8.48 mmol, 1.03 mL) at 25 °C. The reaction mixture was stirred at 25 °C for 18 h under N? atmosphère. Upon completion, the reaction mixture was diluted with H2O (50 mL) and extracted with DCM (50 mL * 2). The combined organic layers were washed with brine (50 mL* 2), dried over Na₂SO4, filtered and concentrated under reduced pressure. The residue was purified by flash silica gel chromatography (ISCO®; 24 g SepaFlash® Silica Flash Column, Eluent of 0~30% MeOH/DCM @ 50 mL/min) to give 5 (3.6 g, 84.44% yield) as a white solid. ESI-LCMS: m/z 512.1 [M+H]⁺ _; ‘H NMR (400 MHz, DMSO-d6) δ =11.42 (s, 1H), 7.75 (d, >8.1 Ηζ,ΙΗ), 7.49 (t, >6.2 Hz, 1H), 5.83 (d, >5.8 Hz, 1H), 5.70 - 5.61 (m, 1H), 4.33 4.23 (m, 1H), 3.95 (t,>5.5Hz, 1H), 3.90 - 3.78 (m, 1H), 3.73(t, >6.5 Hz, 2H), 3.30 (s, 3H), 3.26- 3.12 (m, 4H), 2.14 - 2.02 (m, 2H), 0.88 (s, 9H), 0.11 (d,>3.3 Hz, 6H).

Préparation of (6): To a solution of 5 (5 g, 9.76 mmol) in DMF (45 mL) was added DBU (7.43 g, 48.82 mmol, 7.36 mL). The mixture was stirred at 25 °C for 16 h. The reaction mixture was concentrated to give a residue, diluted with H2O (50 mL) and extracted with EA (50 mL * 2). The combined organic layers were washed with brine (50 mL * 2), dried over Na₂SO4, filtered and concentrated under reduced pressure. The residue was purified by flash silica gel chromatography (ISCO®; 24 g SepaFlash® Silica Flash Column, Eluent of 0-80% EA/PE @ 40 mL/min) to give 6 (4.4 g, 89.06% yield) as a white solid. ESI-LCMS: m/z 476.1 [M+H]⁺ _; 'H NMR (400 MHz, DMSO-d6) δ =11.43 (d, >1.7 Hz, 1H), 7.72 (d, >8.1 Hz, 1H), 5.82 (d,>4.8 Ηζ,ΙΗ), 5.67 (dd, >2.1, 8.1 Hz, 1H), 4.22 (t, >5.1 Hz, 1H), 3.99 - 3.87 (m, 2H), 3.33 - 3.27 (m, 6H), 3.09 (dd, >6.6, 14.7 Hz, 1H), 2.26 - 2.16 (m, 2H), 0.88 (s, 9H), 0.10 (d, >3.8 Hz, 6H).

Préparation of (7): To a solution of 6 (200 mg, 420.49 umol) in MeOH (2 mL) was added NH4F (311.48 mg, 8.41 mmol, 20 eq), and the mixture was stirred at 80 °C for 2 h. The mixture was filtered and concentrated to give a residue, which was purified by flash silica gel chromatography (ISCO®; 4 g SepaFlash® Silica Flash Column, Eluent of 0-50% MeOH/DCM @ 20 mL/min) to give 7 (120 mg, 76.60% yield) as a white solid. ESI-LCMS: m/z 362.1 [M+H]⁺ _; 'H NMR (400 MHz, DMSO-d6) δ =11.37 (br s, 1H), 7.68 (d, >8.1 Ηζ,ΙΗ), 5.81 (d, >4.6 Hz, 1H), 5.65 (d, >8.0 Hz, 1H), 4.02 (q, >5.6 Ηζ,ΙΗ), 3.95 - 3.83 (m, 2H), 3.34 (s, 9H), 3.09 (dd, >6.9, 14.6 Hz, 1H), 2.26 - 2.14 (m, 2H).

Préparation of (Example 50 monomer): To a solution of 7 (1.5 g, 4.15 mmol) in CH3CN (12 mL) were added 3-bis(diisopropylamino)phosphanyloxypropanenitrile (1.63 g, 5.40

240 mmol, 1.71 mL) and lH-imidazole-4,5-dicarbonitrile (539.22 mg, 4.57 mmol) in one portion at 0 °C. The reaction mixture was gradually warmed to 25 °C. The reaction mixture was stirred at 25 °C for 2 h under N2 atmosphère. Upon completion, the reaction mixture was diluted with NaHCCh (20 mL) and extracted with DCM (20 mL * 2). The combined organic layers were washed with brine (20 mL * 2), dried over Na2SÜ4, filtered and concentrated under reduced pressure to give a residue, which was purified by flash silica gel chromatography (ISCO®; 12 g SepaFlash® Silica Flash Column, Eluent of 0-85% EA /PE with 0.5% TEA @ 30 mL/min to give Example 50 monomer (800 mg, 33.6% yield, ) as a white solid. ESI-LCMS: m/z 562.3 [M+H]⁺; ^[H NMR (400 MHz, CD3CN) δ = 9.28 (br s,lH), 7.55 (br dd, 7=8.3, 12.8 Ηζ,ΙΗ), 5.86 (br d, 7=3.9 Hz, 1H), 5.65(br d, 7=8.0 Hz, 1H), 4.33 - 4.06 (m, 2H), 4.00 - 3.89 (m, 1H), 4.08 3.86(m, 1H), 3.89 - 3.72 (m, 4H), 3.43 (br d, 7=15.1 Hz, 6H), 3.23 - 3.05 (m, 3H), 2.69 (br s, 2H), 2.36 - 2.24 (m, 2H), 1.26 - 1.10 (m, 12H) ; ³¹P NMR (162 MHz, CD3CN) δ = 149.94 , 149.88.

Example 51: Synthesis of 5’ End Cap Monomer

Example 51 Monomer

Example 51 Monomer Synthesis Scheme

Préparation of (2): To a solution of 1 (30 g, 101.07 mmol, 87% purity) in CH3CN (1.2 L) and Py (60 mL) were added I2 (33.35 g, 131.40 mmol, 26.47 mL) and PPI13 (37.11 g, 141.50 mmol) in one portion at 10 °C. The reaction was stirred at 25 °C for another 48 h. The mixture 241 was diluted with aq.Na₂S₂O₃ (300 mL) and aq.NaHCO₃ (300 mL), concentrated to remove CH3CN, and then extracted with EtOAc (300 mL * 3). The combined organic layers were washed with brine (300 mL), dried over Na₂SC>4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 330 g SepaFlash® Silica Flash Column, Eluent of 0~60% Methanol/Dichloromethane gradient @ 100 mL/min) to give 2 (28.2 g, 72.00% yield, 95% purity) as a brown solid. ESILCMS: m/z 369.1 [M+H]⁺ _; ‘H NMR (400 MHz, DMSO-d₆) δ = 11.43 (s, 1H), 7.68 (d, >8.1 Hz, 1H), 5.86 (d, >5.5 Hz, 1H), 5.69 (d, >8.1 Hz, 1H), 5.46 (d, >6.0 Hz, 1H), 4.08 -3.96 (m, 2H), 3.90 - 3.81 (m, 1H), 3.60 - 3.51 (m, 1H), 3.40 (dd, >6.9, 10.6 Hz, 1H), 3.34 (s, 3H).

Préparation of (3): To a solution of 2 in DMF (90 mL) were added imidazole (4.25 g, 62.48 mmol) and TBSC1 (6.96 g, 46.18 mmol) in one portion at 15°C. The mixture was stirred at 15 °C for 6 h. The reaction mixture was quenched by addition of H₂O (300 mL) and extracted with EtOAc (300 mL * 2). The combined organic layers were washed with brine (300 mL), dried over Na₂SO4, filtered and concentrated under reduced pressure to give 3 (13.10 g, crude) as a white solid. ESI-LCMS: m/z 483.0 [M+H]⁺.

Préparation of (4): To a solution of 3 (10 g, 20.73 mmol) in MeOH (20 mL), H₂O (80 mL), and dioxane (20 mL) was added Na₂SO₃ (15.68 g, 124.38 mmol), and the mixture was stirred at 80 °C for 24 h. The reaction mixture was concentrated under reduced pressure to remove MeOH. The aqueous layer was extracted with EtOAc (80 mL * 2) and concentrated under reduced pressure to give a residue. The residue was triturated with MeOH (100*3 mL) to give 4 (9.5 g, 94.48% yield, 90% purity) as a white solid. ESI-LCMS: m/z 437.0 [M+H]⁺.

Préparation of (5): To a solution of 4 (11 g, 21.42 mmol, 85% purity) in DCM (120 mL) was added DMF (469.65 mg, 6.43 mmol, 494.37 uL) at 0 °C, followed by dropwise addition of oxalyl dichloride (13.59 g, 107.10 mmol, 9.37 mL). The mixture was stirred at 20 °C for 2 h. The reaction mixture was quenched by addition of water (60 mL) and the organic layer 5 (0.1125 M, 240 mL DCM) was used directly for next step. (This reaction was set up for two batches and combined) ESI-LCMS: m/z 455.0 [M+H]⁺.

Préparation of (6): 5 (186.4 mL, 0.1125 M in DCM) was diluted with DCM (60 mL) and treated with methylamine (3.26 g, 41.93 mmol, 40% purity). The mixture was stirred at 20 °C for 2 h. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 40 g SepaFlash® Silica Flash Column, Eluent of 0-10%, MeOH/DCM gradient @ 40 mL/min) to give AGS-9-3-008 (1.82 g, 18.53% yield, 96% purity) as a yellow solid. ESI-LCMS: m/z 472.0 [M+Na]⁺ _; ‘H NMR (400 MHz, CDC1₃) δ = 9.08 (s, 1H), 7.31 (d, >8.1 Hz, 1H), 5.78 (d, >8.1 Hz, 1H), 5.57 (d, >3.8

242

Hz, 1H), 4.61 - 4.48 (m, 1H), 4.41 - 4.27 (m, 2H), 4.13 - 4.03 (m, 1H), 3.46 (s, 3H), 3.43 - 3.33 (m, 2H), 2.78 (d, 7=5.2 Hz, 3H), 0.92 (s, 9H), 0.13 (s, 6H).

Préparation of (7): To a solution of 6 (2.3 g, 5.12 mmol) in MeOH (12 mL) was added HCl/MeOH (4 M, 6.39 mL). The mixture was stirred at 20 °C for 2 h. The reaction mixture was concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 24 g SepaFlash® Silica Flash Column, Eluent of 0-15%, MeOH/DCM gradient @ 30 mL/min) to give 7 (1.4 g, 79.98% yield) as a pink solid. ESI-LCMS: m/z 336.1 [M+H]⁺ ; Ή NMR (400 MHz, CDC1₃) δ = 9.12 (s, 1H), 7.39 (d, 7=8.0 Hz, 1H), 5.79 (d, .7=3.3 Hz, 1H), 5.66 (dd, 7=2.1, 8.2 Hz, 1H), 5.13 (s, 1H), 4.13 (t, 7=4.0, 7.4 Hz, 1H), 4.07 - 4.02 (m, 1H), 3.87 (dd, 7=3.3, 5.5 Hz, 1H), 3.47 (s, 3H), 3.43 - 3.37 (m, 2H), 2.65 (d, 7=4.5 Hz, 3H).

Préparation of (Example 51 monomer): To a mixture of 7 (1.7 g, 5.07 mmol) and 4A MS (1.4 g) in MeCN (18 mL) was added 3-bis(diisopropylamino)phosphanyloxypropanenitrile (1.99 g, 6.59 mmol, 2.09 mL) at 0 °C, followed by addition of lH-imidazole-4,5-dicarbonitrile (658.57 mg, 5.58 mmol) in one portion at 0 °C. The mixture was stirred at 20 °C for 2 h. Upon completion, the reaction mixture was quenched by addition of sat. NaHCO₃ solution (20 mL) and diluted with DCM (40 mL). The organic layer was washed with sat. NaHCO₃ (20 mL * 2), dried over Na₂SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by a flash silica gel column (0% to 5% i-PrOH in DCM with 5% TEA) to give Example 51 monomer (1.30 g, 46.68% yield) as a white solid. ESI-LCMS: m/z 536.2 [M+H]⁺ ; Ή NMR (400 MHz, CD3CN) δ = 9.00 (s, 1H), 7.40 (d, 7=8.0 Hz, 1H), 5.85 - 5.76 (m, 1H), 5.64 (d, 7=8.0 Hz, 1H), 5.08 (d, 7=5.0 Hz, 1H), 4.42 - 4.21 (m, 2H), 4.00 (td, 7=4.6, 9.3 Hz, 1H), 3.89 - 3.61 (m, 4H), 3.47-3.40 (m, 4H), 3.37 - 3.22 (m, 1H), 2.71 - 2.60 (m, 5H), 1.21 - 1.16 (m, HH), 1.21 - 1.16 (m, 1H); ³¹P NMR (162 MHz, CD3CN) δ = 150.07, 149.97

Example 52: Synthesis of 5’ End Cap Monomer

243

Example 52 Monomer Synthesis Scheme

Préparation of (2): To a solution of 1 (13.10 g, 27.16 mmol) in THF (100 mL) was added DBU (20.67 g, 135.78 mmol, 20.47 mL). The mixture was stirred at 60 °C for 6 h. Upon completion, the reaction mixture was quenched by addition of sat.NHÆl solution (600 mL) and extracted with EA (600 mL * 2). The combined organic layers were washed with brine (100 ml), dried over Na₂SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 120 g SepaFlash® Silica Flash Column, Eluent of 0-50% (Phase B: ethyl acetate: dichloromethane=l : 1) / Phase A: petroleum ethergradient@ 45 mL/min) to give 2 (5.9 g, 60.1% yield, ) as a white solid. ESI-LCMS: m/z 355.1 [M+H]⁺ ; Ή NMR (400 MHz, DMSO-d₆) δ = 11.61 - 11.30 (m, 1H), 7.76 - 7.51 (m, 1H), 6.04 (d, 7=5.4 Hz, 1H), 5.75 (s, 1H), 5.73 - 5.67 (m, 1H), 4.78 (d, 7=4.9 Hz, 1H), 4.41 (d, 7=1.1 Hz, 1H), 4.30 (t, 7=4.8 Hz, 1H), 4.22 (d, 7=1.4 Hz, 1H), 4.13 (t, 7=5.1 Hz, 1H), 4.06 - 3.97 (m, 1H), 3.94 - 3.89 (m, 1H), 3.82 - 3.75 (m, 1H), 3.33 (s, 3H), 3.30 (s, 2H), 1.17 (t, 7=7.2 Hz, 1H), 0.89 (s, 9H), 0.16 - 0.09 (m, 6H).

Préparation of (3): To a solution of 2 (4 g, 11.28 mmol) in DCM (40 mL) was added Ru(II)-Pheox (214.12 mg, 338.53 umol) in one portion followed by addition of diazo(dimethoxyphosphoryl)methane (2.54 g, 16.93 mmol) dropwise at 0°C under N₂. The reaction was stirred at 20 °C for 16 h. Upon completion, the reaction mixture was filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 80 g SepaFlash® Silica Flash Column, Eluent of 0-4% MeOH/DCM@ 60 mL/min) to give 3 (5 g, 86.47% yield) as a red liquid. ESI-LCMS: m/z 477.1 244

[M+H]⁺ ; *H NMR (400 MHz, DMSO-dô) δ = 11.46 (s, 1H), 7.49 (d, 7=8.0 Hz, 1H), 6.01 -5.87 (m, 1H), 5.75 (dd, 7=2.0, 8.0 Hz, 1H), 4.58 (d, 7=3.8 Hz, 1H), 4.23 (dd, 7=3.8, 7.8 Ηζ,ΙΗ), 3.80 3.68 (m, 6H), 3.30 (s, 3H), 1.65 - 1.46 (m, 2H), 1.28 - 1.16 (m, 1H), 0.91 (s, 9H), 0.10 (d, 7=4.3 Hz, 6H);³'P NMR (162 MHz, DMSO-d₆) δ = 27.5

Préparation of (4): To a mixture of 3 (2.8 g, 5.88 mmol) and Nal (1.76 g, 11.75 mmol) in CH3CN (30 mL) was added chloromethyl 2,2-dimethylpropanoate (2.21 g, 14.69 mmol, 2.13 mL) at 25°C. The mixture was stirred at 80 °C for 40 h under Ar. The reaction mixture was filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 40 g SepaFlash® Silica Flash Column, Eluent of 0~50% Ethylacetate/Petroleum ether gradient @ 40 mL/min) to give 4 (2.1 g, 51.23% yield, 97% purity) as a yellow solid. ESI-LCMS: 677.3 [M+H]⁺.

Préparation of (5): A mixture of 4 (2.09 g, 3.09 mmol) in H2O (1.5 mL) and HCOOH (741.81 mg, 15.44 mmol, 6 mL) was stirred at 15°C for 40 h. Upon completion, the reaction mixture was quenched by saturated aq.NaHCO3 (300 mL) and extracted with EA (300 mL * 2). The combined organic layers were washed with brine (300 mL), dried over Na2SÛ4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 20 g SepaFlash® Silica Flash Column, Eluent of 0~5% Methanol/Dichloromethane@ 45 mL/min) to give 5 (1.51 g, 85.19% yield) as a yellow solid. ESI-LCMS: 585.1 [M+Na]⁺ ; ‘H NMR (400 MHz, DMSO-d6) δ = 11.45 (d, J=1.8 Hz, 1H), 7.44 (d, J=8.2 Hz, 1H), 6.04 (d, J=7.5 Ηζ,ΙΗ), 5.78 -5.51 (m, 6H), 4.39 (t, J=4.4 Hz, 1H), 4.15 (dd, J=4.3, 7.4 Hz, 1H), 4.03 (q, J=7.1 Hz, 1H),1.99 (s, 1H), 1.66 (dd, J=8.6, 10.8 Hz, 1H), 1.55 1.29 (m, 2H), 1.18 (d, J=2.0 Hz, 18H).

Préparation of (Example 52 monomer): To a solution of 5 (2.5 g, 4.44 mmol) in MeCN (30 mL) was added 3-bis(diisopropylamino)phosphanyloxypropanenitrile (1.74 g, 5.78 mmol, 1.84 mL) at 0 °C, followed by lH-imidazole-4,5-dicarbonitrile (577.36 mg, 4.89 mmol) in one portion under Ar. The mixture was gradually warmed to 20 °C and stirred at 20 °C for 1 h. The reaction mixture was quenched by addition of sat.NaHCCh solution (50 mL) and diluted with DCM (250 mL). The organic layer was washed with sat.NaHCCh solution (50 mL * 2), dried over Na2SCU, filtered and concentrated under reduced pressure to give a residue. The residue was purified by a flash silica gel column (0% to 50% EA / PE with 0.5% TEA) to give Example 52 monomer (1.85 g, 54.1% yield) as a white solid. ESI-LCMS: 785.2 [M+Na]⁺ _;'H NMR (400 MHz, CD3CN) δ = 9.18 (s, 1H), 7.31 (d, 7=8.3 Hz, 1H), 6.06 (d, 7=7.8 Hz, 1H), 5.72 - 5.60 (m, 5H), 4.85 - 4.76 (m, 1H), 4.27 (m, 1H), 3.93 - 3.64 (m, 4H), 3.41 (d, 7=16.6 Hz, 3H),

245

2.80 - 2.62 (m, 2H), 1.76 - 1.49 (m, 3H), 1.23 - 1.19 (m, 30H); ³¹P NMR (162 MHz, CD3CN) δ = 150.66 (s), 150.30,24.77,24.66.

Example 53: Synthesis of 5’ End Cap Monomer

Example 53 Monomer

Example 53 Monomer Synthesis Scheme

Préparation of (2): To a solution of 1 (15 g, 137.43 mmol) in DCM (75 mL) were added BOC2O (31.49 g, 144.30 mmol, 33.15 mL) and DMAP (839.47 mg, 6.87 mmol, 0.05 eq) at 0 °C. The mixture was stirred at 20 °C for 16 hr, and concentrated under reduced pressure to give 2 (29.9 g, crude) as a yellow oil. ‘H NMR (400MHz, CDCI3) δ = 3.23 (s, 3H), 3.16 (s, 3H), 1.51 (s, 9H).

Préparation of (3): To a solution of 2 (24.9 g, 118.99 mmol) in THF (250 mL) was added n-BuLi (2.5 M, 47.60 mL) dropwise at -78 °C under Ar and stirred at -78 °C for 1 hr. P-3 (17.19 g, 118.99 mmol, 12.83 mL) was added at 0 °C and stirred for 1 hr. The reaction mixture was quenched by saturated aq. NH4CI (100 mL), and then extracted with EA (100 mL * 2). The combined organic layers were washed with brine (100 mL * 2), dried over Na?SO4, fïltered and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 80 g SepaFlash® Silica Flash Column, Eluent of 0-50% Ethylacetate/Petroleum ethergradient @ 65 mL/min) to give 3 (7.1 g, 18.62% yield) as a yellow oil. ESI-LCMS: 339.9 [M+Na]⁺ _; ‘H NMR (400 MHz, CDCh) δ = 4.12 (s, 1H), 4.08 (s, 1H), 3.83 (s,3H), 3.81 (s, 3H), 3.22 (s, 3H), 1.51 (s, 9H).

246

Préparation of (5): To a mixture of 4 (15 g, 40.27 mmol) and PPTS (10.12 g, 40.27 mmol) in DMSO (75 mL) was added EDCI (23.16 g, 120.81 mmol) at 20 °C. The mixture was stirred at 20 °C for 4 hr. The reaction mixture was diluted with water (150 mL) and extracted with EA (150 mL*2). The combined organic layers were washed with brine (150 mL*2), dried over Na₂SC>4, filtered and concentrated under reduced pressure to give 5 (12 g, crude) as a white solid. ESI-LCMS: 371.2[M+H]⁺; ‘H NMR (400MHz, CDC1₃) δ = 9.77 (s, 1H), 7.62 (d, >8.1 Hz, 1H), 5.83 - 5.76 (m, 2H), 4.53 (d, J=4.3 Hz, 1H), 4.43 (br t, >4.4 Hz, 1H), 3.95 (br t, >4.7 Hz, 1H), 3.47 - 3.35 (m, 5H), 0.92 (s, 9H), 0.13 (d, >5.8 Hz, 6H).

Préparation of (6): To a solution of P4 (8.02 g, 25.27 mmol) in THF (40 mL) was added n-BuLi (2.5 M, 8.42 mL) dropwise under Ar at -78 °C, and the mixture was stirred at -78 °C for 0.5 hr. A solution of 4 (7.8 g, 21.05 mmol) in THF (40 mL) was added dropwise. The mixture was allowed to warm to 0 °C and stirred for another 2 hr. The reaction mixture was quenched by saturated aq. NH4CI solution (80 mL) and extracted with EA (80 mL). The combined organic layers were washed with brine (80 mL * 2), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 80 g SepaFlash® Silica Flash Column, Eluent of 0~38% ethylacetate/petroleum ether gradient @ 60 mL/min) to give 7 (7.7 g, 13.43 mmol, 63.8% yield) as a white solid. ESI-LCMS: 506.2 [M-tBu]⁺; ‘H NMR (400MHz, CDC1₃) δ = 8.97 (s, 1H), 7.25 (d, >8.3 Hz, 1H), 6.95 - 6.88 (m, 1H), 6.87 - 6.81 (m, 1H), 5.83 - 5.77 (m, 2H), 4.58 (dd, >4.4, 6.7 Hz, 1H), 4.05 (dd, >5.0, 7.5 Hz, 1H), 3.82 - 3.77 (m, 1H), 3.53 (s, 3H), 3.20 (s, 3H), 1.50 (s, 9H), 0.91 (s, 9H), 0.11 (d, >2.5 Hz, 6H).

Préparation of (7): To a solution of 6 (7.7 g, 13.71 mmol) in MeOH (10 mL) was added HCl/MeOH (4 M, 51.40 mL) at 20 °C. The mixture was stirred at 20 °C for 16 hr. Upon completion, the reaction mixture was concentrated under reduced pressure to remove MeOH. The residue was purified by flash silica gel chromatography (ISCO®; 80 g SepaFlash® Silica Flash Column, Eluent of 0~4% MeOH/DCM @ 60 mL/min) to give 7 (4.1 g, 86.11% yield) as a white solid. ESI-LCMS: 369.9 [M+Na]⁺; Ή NMR (400MHz, DMSO-d₆) δ = 11.44 (s, 1H), 7.66 (d, >8.3 Hz, 1H), 7.11 (q, >4.9 Hz, 1H), 6.69 (dd, >6.0, 15.1 Hz, 1H), 6.56 - 6.47 (m, 1H), 5.82 (d, >4.0 Hz, 1H), 5.67 (dd, >2.0, 8.0 Hz, 1H), 5.56 (br s, 1H), 4.42 (t, >6.1 Hz, 1H), 4.13 (t, >5.8 Hz, 1H), 3.97 (t, >4.8 Hz, 1H), 3.39 (s, 3H), 2.48 (d, >5.3 Hz, 3H)

Préparation of (8): To a solution of 7 (2.5 g, 7.20 mmol) in THF (25 mL) was added Pd/C (2.5 g, 10% purity) under H2 atmosphère, and the suspension was degassed and purged with H₂ for 3 times. The mixture was stirred under H₂ (15 Psi) at 20 °C for 1 hr. Upon completion, the reaction mixture was filtered and concentrated under reduced pressure to give a

247 residue. The residue was purified by flash silica gel chromatography (ISCO®; 25 g SepaFlash® Silica Flash Column, Eluent of 0-5% Ethylacetate/Petroleum ethergradient @ 50 mL/min) to give 8 (2.2 g, 87.49% yield, ) as a white solid. ESI-LCMS: 372.1 [M+Na]⁺; Ή NMR (400 MHz, DMSO-d6) δ = 11.40 (s, 1H), 7.62 (d, J=8.0 Hz, 1H), 6.93 (q, J=4.9 Hz, 1H), 5.76 (d, J=4.5 Hz, 1H), 5.66 (d, J=8.0 Hz, 1H), 5.26 (d, J=6.3 Hz, 1H), 3.97 (q, J=5.9 Hz, 1H), 3.91 - 3.79 (m, 2H), 3.36 (s, 3H), 3.14 - 3.00 (m, 2H), 2.56 (d, J=5.0 Hz, 3H), 2.07 - 1.87 (m, 2H).

Préparation of (Example 53 monomer): To a solution of 8 (2.2 g, 6.30 mmol, 1 eq) in CH₃CN (25 mL) was added P-l (2.47 g, 8.19 mmol, 2.60 mL, 1.3 eq) at 0 °C, and then 1Himidazole-4,5-dicarbonitrile (818.07 mg, 6.93 mmol, 1.1 eq) was added in one portion at 0°C under Ar. The mixture was stirred at 20 °C for 2 hr. Upon completion, the reaction mixture was quenched by saturated aq. NaHCO₃ (25 mL), and extracted with DCM (25 mL * 2). The combined organic layers were washed with brine (25 mL * 2), dried over NaiSCL, filtered and concentrated under reduced pressure to give a residue. The residue was purified by flash silica gel chromatography (ISCO®; 40 g SepaFlash® Silica Flash Column, Eluent of 40-85% ethylacetate/petroleum ether gradient @ 40 mL/min) to give Example 53 monomer (2.15 g, 61.32% yield) as a white solid. ESI-LCMS: 572.2 [M+Na]⁺ ;‘H NMR (400MHz, CD3CN) δ = 9.32 (br s, 1H), 7.39 (d, J=8.1 Hz, 1H), 5.82 - 5.75 (m, 1H), 5.66 (dd, J=0.7, 8.1 Hz, 1H), 5.14 (qd, J=4.9, 9.4 Hz, 1H), 4.24 - 4.02 (m, 2H), 3.99 - 3.93 (m, 1H), 3.90 - 3.60 (m, 4H), 3.43 (d, J=17.5 Hz, 3H), 3.18 -3.08 (m, 2H), 2.74 - 2.61 (m, 5H), 2.19 - 2.11 (m, 1 H), 2.09 - 1.98 (m, 1H), 1.19 (ddd, J=2.4, 4.0, 6.6 Hz, 12H).³¹P NMR (162 MHz, CD3CN) δ = 149.77 (s), 149.63 (br s).

Example 54. Long-term Efficacy of siNA in an AAV-HBV mouse model

AAV/HBV is a recombinant AAV carrying replicable HBV genome. Taking advantage of the highly hepatotropic feature of génotype 8 AAV, the HBV genome can be efficiently delivered to the mouse liver cells. Infection of immune competent mouse with AAV/HBV can resuit in long terni HBV viremia, which mimics chronic HBV infection in patients. The AAV/HBV model can be used to evaluate the in vivo activity of varions types of anti-HBV agents. Mice were infected with AAV-HBV on day -28 of the study. AAV-HBV mice were subcutaneously injected with a single dose of 5mL/kg of vehicle or 5mg/kg of ds-siNA0147 on day 0. Serial blood collections were usually taken every 5 days on day 0, 5, 10, and 15, etc. until the termination of the study. Sérum HBV S antigen (HBsAg) was assayed through ELIS A. FIG. 13 shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G 15) or ds-siNA-0147 (G 19). As shown in FIG. 13, ds-siNA-0147 was effective in reducing sérum HBsAg levels and the réduction in sérum HBsAg levels was observed for the

248 duration of the study (i.e., 100 days). Thus, FIG. 13 demonstrates that ds-siNA-0147 is effective and durable after a single dose of 5 mg/kg.

ds-siNA ID	Strand	Sequence	SEQ ID NO:
ds-siNA- 0147	Sense	5 ’ -mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmU mCmAmAmU-p-ps2-GalNAc4-3 ’	438
Antisense	3 ’ -mApsmGpsmCm AmCfCmAfCmCmUmGmAm AmG mAfGmAmGmUpsfUpsmA-5 ’	501

Example 55. Deuterated vinyl phosphonate improves potency of siNA

This example investigates whether a deuterated vinyl phosphonate improves potency of siNA in an AAV-HBV mouse. AAV-HBV mice were subcutaneously injected with vehicle, dssiNA-0109 (e.g., siNA without a deuterated vinyl phosphonate), or ds-siNA-0172 (e.g., siNA with a deuterated vinyl phosphonate). AAV-HBV mice were subcutaneously injected with a single dose of 5 mL/kg of vehicle or 5 mg/kg of ds-siNA-0149 or ds-siNA-0172 at day 0. Serial 10 blood collections were usually taken every 5 days on day 0, 5, 10, and 15, etc. until the termination of the study. Sérum HBV S antigen (HBsAg) was assayed through ELISA.

As shown in FIG. 14, siNA molécules having 2’-fluoro nucléotides at positions 5 and 7-9 from the 5’ end of the sense strand and 2’-fluoro nucléotides at positions 2, 5, 8, 14, and 17 from the 5’ end of the antisense strand resulted in greater than a 0.5-log réduction in HBsAg, with the 15 greatest réduction in HBsAg found in mice treated with the deuterated vinylphopshonate siNA (ds-siNA-0172). In addition, the duration of the réduction in sérum HBsAg levels was significantly longer for the deuterated vinylphosphonate siNA (ds-siNA-0172). Thus, FIG. 14 demonstrates that the presence of a deuterated vinyl phosphonate improves potency and durability of the siNA.

ds-siNA ID	Strand	Sequence	SEQID NO:
ds-siNA- 0109	Sense	5’-mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmC mUmUmCmAp-ps2-GalNAc4	424
Antisense	3 ’-mCpsmUpsmGmGfCmAmCfAmCmGmUmGmAfAmG mCfGmAmApsfGpsmU-5 ’	485
ds-siNA- 0172	Sense	5’-mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmC mUmUmCmA-p-ps2-GalNAc4-3 ’	424

249

	Antisense	3’-mCpsmUpsmGmGfCmAmCfAmCmGmUmGmAfAmG mCfGmAmApsfGpsd2vd3U-5’	536
O ^Ho^' D HO Ο ^dZv/ ⁰ 0' OCDî d2vd3U =

Example 56. Comparison of siNAs

AAV/HBV is a recombinant AAV carrying repli cable HBV genome. Taking advantage of the highly hepatotropic feature of génotype 8 AAV, the HBV genome can be efficiently delivered to the mouse liver cells. Infection of immune competent mouse with AAV/HBV can resuit in long term HBV viremia, which mimics chronic HBV infection in patients. The AAV/HBV model can be used to evaluate the in vivo activity of various types of anti-HBV agents. Mice were infected with AAV-HBV on day -28 of the study. AAV-HBV mice were subcutaneously injected with a single dose of 5mL/kg of vehicle or 5mg/kg of ds-siNA-

0109, ds-siNA-0119, or ds-siNA-0153 on day 0. Serial blood collections were usually taken every 5 days on day 0, 5, 10, and 15, etc. until the termination of the study. Sérum HBV S antigen (HBsAg) was assayed through ELIS A. FIG. 15 shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G 01, circle), ds-siNA-0109 (G 07, square), ds-siNA-0119 (G11, triangle), or ds-siNA-0153 (G13, diamond). As shown in FIG. 14, ail three ds-siNAs were effective in reducing sérum HBsAg levels and the réduction in sérum HBsAg levels was observed for the duration of the study (i.e., 100 days), with the best potency and durability observed for ds-siNA-0153. Thus, FIG. 15 demonstrates that ds-siNA-0109, ds-siNA0119, and ds-siNA-0153 were effective and durable after a single dose of 5 mg/kg.

ds-siNA ID	Strand	Sequence	SEQID NO:
ds-siNA- 0109	Sense	5’-mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmC mUmUmCmAp-ps2-GalNAc4	424
Antisense	3 ’ -mCpsmUpsmGmGfCm AmCfAmCmGmUmGm AfAmG mCfGmAmApsfGpsmU-5 ’	485
ds-siNA- 0119	Sense	5’-mGpsmCpsmUmGfCmUmAmUfGfCfCmUmCfAmU mCmUmUfCmUmU-p-ps2-GalNAc4	430

250

	Antisense	3’-mGpsmApsmCmGmAmCmGmAmUfAmCmGmGmA mGmUmAmGmAm AmGpsfApsm A-5 ’	595
ds-siNA- 0153	Sense	5’-mUpsmGpsfUmGmCmAfCfUfUmCmGfCmUmUmC mAfCmCmU-p-ps2-GalNAc4-3 ’	441
Antisense	3’-mGpsmCpsmAfCmAmCmGfUmGmAmAfGmCmGmA fAmGmUmGpsfGpsmA-5	526

Example 57. Efficacy of a Combination Therapy in AAV-HBV Mouse Model

This example investigates the efficacy of a combination therapy comprising an antisense oligonucleotide (ASO 1,5’ GalNAc4-ps-GalNAc4-ps-GalNAc4-po-mA-polnGpslnApslnTpslnApslnApsApsAps(5OH)CpsGps(5m)Cps(5m)CpsGps(5m)CpslnApslnGpsln Apscp(5m)C-3’(SEQ ID NO: 534)) and a ds-siNA-0147 for treating HBV in an AAV-HBV mouse model.

AAV-HBV mice were subcutaneously injected with (a) 5mL/kg of vehicle, three times a week, on days 0, 7, and 14 (G 01); (b) 5 mg/kg of ASO 1 on a weekly basis, on days 0, 7, and 14 (G 20); (c) a single dose of 5 mg/kg of ds-siNA-0147 on day 0 (G 24); or (d) a combination of ASO 1 and ds-siNA-0147, wherein ASO 1 was administered at a dose of 5 mg/kg on a weekly basis, on days 0, 7, and 14; and ds-siNA-0160 was administered as a single dose of 5 mg/kg at day 0 (G25). Serial blood collections were usually taken every 5 days on day 0, 5, 10, and 15, etc. until the termination of the study. Sérum HBV S antigen (HBsAg) was assayed through ELIS A. FIG. 16 shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G 01, circle), ASO 1 (G 20, square), ds-siNA-0147 (G 24, diamond), or a combination of ds-siNA-0147 and ASO 1 (G 25, triangle). As shown in FIG. 16, treatment with ASO 1, ds-siNA-0147, or a combination of ASO 1 and ds-siNA-0147 resulted in a réduction in sérum, with the greatest réduction observed in mice treated with the combination of ASO 1 and ds-siNA-0147.

ds-siNA ID	Strand	Sequence	SEQ ID NO:
ds-siNA- 0147	Sense	5 ’ -mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmU mCmAmAmU-p-ps2-GalNAc4-3 ’	438
Antisense	3 ’ -mApsmGpsmCm AmCfCmAfCmCmUmGmAmAmG mAfGmAmGmUpsfUpsmA-5 ’	501

Example 58. Efficacy of a Combination Therapy in AAV-HBV Mouse Model

251

This example investigates the efficacy of a combination therapy comprising an antisense oligonucleotide (ASO 1,5’ GalNAc4-ps-GalNAc4-ps-GalNAc4-po-mA-polnGpslnApslnTpslnApslnApsApsAps(5OH)CpsGps(5m)Cps(5m)CpsGps(5m)CpslnApslnGpsln Apscp(5m)C-3’(SEQ ID NO: 534)) and a ds-siNA-0109 for treating HBV in an AAV-HBV mouse model.

AAV-HBV mice were subcutaneously injected with (a) 5mL/kg of vehicle, three times a week, on days 0, 7, and 14 (G 01); (b) 5 mg/kg of ASO 1 on a weekly basis, on days 0, 7, and 14 (G 20); (c) a single dose of 5 mg/kg of ds-siNA-0109 on day 0 (G 26); or (d) a combination of ASO 1 and ds-siNA-0109, wherein ASO 1 was administered at a dose of 5 mg/kg on a weekly basis, on days 0, 7, and 14; and ds-siNA-0160 was administered as a single dose of 5 mg/kg at day 0 (G27). Serial blood collections were usually taken every 5 days on day 0, 5, 10, and 15, etc. until the termination of the study. Sérum HBV S antigen (HBsAg) was assayed through ELISA. FIG. 17 shows a graph of the change in sérum HBsAg from AAV-HBV mice treated with vehicle (G 01, circle), ASO 1 (G 20, square), ds-siNA-0109 (G 26, diamond), or a combination of ds-siNA-0109 and ASO 1 (G 27, triangle). As shown in FIG. 17, treatment with ASO 1, ds-siNA-0109, or a combination of ASO 1 and ds-siNA-0109 resulted in a réduction in sérum, with the greatest réduction observed in mice treated with the combination of ASO 1 and ds-siNA-0109.

ds-siNA ID	Strand	Sequence	SEQID NO:
ds-siNA- 0109	Sense	5 ’ -mCpsmCpsmGmUfGmUfGfCfAmCmUmUmCmGmC mUmUmCmAp-ps2-GalNAc4	424
Antisense	3 ’ -mCpsmUpsmGmGfCmAmCfAmCmGmUmGmAfAmG mCfGmAmApsfGpsmU-5 ’	485

Example 59. Rôle of 2’-Fluoro Mimics on siNA Activity

This example investigates the rôle of 2’-fluoro mimics, f4P and f2P monomers, on siNA activity. The f4P monomer was produced as described in Example 42. The f2P monomer was produced as described in Example 45.

The activity of ds-siNA-0173, ds-siNA-0174, and ds-siNA-0175 was assayed using an in vitro HBsAg sécrétion assay with HepG2.2.15 cells. Generally, HepG2.2.15 cells were maintained in DMEM medium with 10% fêtai bovine sérum (FBS) and 1% penicillin/streptomycin, 1% Glutamine, 1% non-essential amino acids, 1% Sodium Pyruvate and 250 ug/ml G418. Cells were maintained at 37°C in a 5% CO² atmosphère. For HBsAg release

252 assay, an assay medium was made that DMEM with 5% FBS, 1% penicillin/streptomycin, 1% Glutamine and 1% DMSO. The day before the assay, HepG2.2.15 cells were trypsinized and washed with Assay Medium once, then spun at 250g x 5min, resuspended with Assay Medium. The resuspenced cells were seeded at 50,000/well in assay medium in collagen coated 96 well plates. On the next day, siRNA was diluted with Opti-MEM, 9-pt, 3-fold dilution and dilute Lipofectamine RNAiMAX (Invitrogen) according manufacturées manual. siRNA dilution and RNAiMAX dilution were mixed and incubated at room température for 5 minutes. 15 μΐ of the siRNA/RNAiMax mixture was added each well of the collagen coated 96 well plate. The plates were placed in a 37°C, 5% CO² incubator for 4 days. After incubation, the supematant was harvested and measured for HBsAg with ELIS A kit (Diasino). The cell viability was measured with CellTiter-Glo (Promega). The EC50, the concentration of the drug required for reducing HBsAg sécrétion by 50% in relation to the untreated cell control, was calculated using the Prism Graphpad. The CC50, the concentration of the drug required for reducing cell viability by 50% in relation to the untreated cell control, was calculated with the same software. The EC50 and

CC50 values are shown in Table 11.

Table 11. siNA Activity
ds-siNA ID	Strand	Sequence	SEQ ID NO:	EC50 (nM)^s	CC50 (nM)
ds-siNA- 0173	Sense	5 ’ -mGpsmUpsmGmGfUmGfGfAfC mUmUmCmUmCmUmCmAmAmU	438	C	>1
Antisense	3 ’-mApsmGpsmCmAmCfCmA fCmCmUmGmAmAmGmAfGmAmG mUpsf4PpsmA-5 ’	537
ds-siNA- 0174	Sense	5 ’ -mGpsmUpsmGmGfUmGfGfAfC mUmUmCmUmCmUmCmAmAmU	438	A	>1
Anti- sense	3 ’-mApsmGpsmCmAmCfCmAf2P mCmUmGmAmAmGmAfGmAmGm UpsfUpsmA-5’	538
ds-siNA0175 (control)	Sense	5 ’ -mGpsmUpsmGmGfUmGfGfAfC mUmUmCmUmCmUmCmAmAmU	438	B	>1
Anti- sense	5 ’ -mApsfUpsmUmGmAfGm AmG mAmAmGmUmCfCmAfCmCmAmC psmGpsmA-3 ’	501
*A = EC50 < 0.2 nM; B = 0.2 nM < EC50 < 0.1 nm; C = EC50 > 0.1 nm

253

Example 60. Rôle of 2’-Fluoro Mimics on siNA Activity

This example investigates the rôle of 2’-fluoro mimics, f4P, f2P, and fx monomers, on siNA activity of GalNAc4 conjugated siNAs. The f4P monomer was produced as described in

Example 42. The f2P monomer was produced as described in Example 45. The fx monomer was produced as described in Example 41.

ds-siNA ID	Strand	Sequence	SEQID NO:
ds-siNA- 0176	Sense	5 ’ -mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmU mCmAmAmU-p-(PS)2-GalNAc4	438
Antisense	3 ’ -m ApsmGpsmCmAmCfCm AfCmCmUmGm Am AmGmA fGmAmGmUpsf4PpsmA-5 ’	537
ds-siNA- 0177	Sense	5 ’ -mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmU mCmAmAmU-p-(PS)2-GalNAc4	438
Antisense	3 ’-mApsmGpsmCmAmCfCmAf2PmCmUmGmAmAmGm AfGmAmGmUpsfUpsmA-5 ’	538
ds-siNA- 0178	Sense	5 ’ -mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmU mCmAmAmU-p-(PS)2-GalNAc4	438
Antisense	3 ’ -mApsmGpsmCmAmCfCmAfXmCmUmGmAmAmG mAfGmAmGmUpsfUpsmA-5 ’	539
ds-siNA- 0147	Sense	5 ’ -mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmU mCmAmAmU-p-ps2-GalNAc4	438
Antisense	3 ’ -m ApsmGpsmCmAmCfCm AfCmCmUmGm Am AmG mAfGmAmGmUpsfUpsmA-5 ’	501
3? U II o vw>O J ►ϋ II / O WV O f -Xk Z £ II O oX Z •‘N Z T ΙΌ

254

The activity of ds-siNA-017, ds-siNA-017, ds-siNA-017, and ds-siNA-0147 can be assayed using in vitro or in vivo methods. An exemplary in vitro assay can be performed as follows:

Homo sapiens HepG2.2.15 cells are cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) (ATCC 30-2002) supplemented to also contain 10% fêtai calf sérum (FCS). Cells were incubated at 37°C in an atmosphère with 5% CO2 in a humidified incubator. For transfection of HepG2.2.15 cells with HBV targeting siRNAs, cells are seeded at a density of 15000 cells/well in 96-well regular tissue culture plates. Transfection of cells is carried out using RNAiMAX (Invitrogen/Life Technologies) according to the manufacturer’s instructions. Dose-response experiments are done with oligo concentrations of 40, 20, 10, 5, 2.5, 1.25, 0.625, 0.3125, 0.15625 and 0.07813nM. For each HBV targeting siRNA treatment (e.g., ds-siNA-0176, dssiNA-0177, ds-siNA-0178, or ds-siNA-0147), four wells are transfected in parallel, and individual data points were collected from each well. After 24h of incubation with siRNA, media is removed, and cells are lysed and analyzed with a QuantiGene2.0 branched DNA (bDNA) probe set spécifie for HBV génotype D (also called Hepatitis B virus subtype ayw, complété genome of 3182 base-pairs) as présent in cell line HepG2.2.15.

For each well, the HBV on-target mRNA levels is normalized to the GAPDH mRNA level. The activity of the HBV targeting ds-siNAs can be expressed as EC50, 50% réduction of normalized HBV RNA level from no drug control. The cytotoxicity of the HBV targeting dssiRNAs can be expressed by CC50 of 50% réduction of GAPDH mRNA from no drug control.

The AAV/HBV model can be used to evaluate the in vivo activity of the siRNA treatment (e.g., ds-siNA-0173, ds-siNA-0174, ds-siNA-0175, and ds-siNA-0147). Mice are infected with AAV-HBV on day -28 of the study. AAV-HBV mice are subcutaneously injected with a single dose of 5mL/kg of vehicle or 5mg/kg of ds-siNA-0173, ds-siNA-0174, ds-siNA0175, or ds-siNA-0147 on day 0. Serial blood collections can be taken every 5 days on day 0, 5, 10, and 15, etc. until the termination of the study. Sérum HBV S antigen (HBsAg) can be assayed through ELISA.

Exemplary Embodiments

Exemplary embodiments are provided below:

1. A short interfering nucleic acid (siNA) molécule comprising:

(a) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence:

(i) is 15 to 30 nucléotides in length; and

255 (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and the nucléotide at positions, 5, 7, 8, 9, 10, 11, 12, 14, 17, and/or 19 from the 5’ end ofthe first nucléotide sequence is a 2’-fluoro nucléotide; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence:

(i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide.

2. A short interfering nucleic acid (siNA) molécule comprising:

(i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-(9-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence:

(i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-(9-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and the nucléotide at position 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide.

256

3. The siNA of embodiment 1 or 2, wherein the first nucléotide sequence comprises 16, 17, 18, 19, 20, 21, 22, 23, or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2'-fluoro nucléotide.

4. The siNA of embodiment 1 or 2, wherein 70%, 75%, 80%, 85%, 90%, 95% or 100% of the nucléotides in the first nucléotide sequence are modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2'-fluoro nucléotide.

5. The siNA of any one of embodiments 1-4, wherein at least 2, 3, 4, 5, or 6 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides.

6. The siNA of any one of embodiments 1-5, wherein no more than 10, 9, 8, 7, 6, 5, 4, 3, or 2 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides.

7. The siNA of any one of embodiments 1-6, wherein at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides.

8. The siNA of any one of embodiments 1-7, wherein no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides.

9. The siRNA of any one of embodiments 1-8, wherein the second nucléotide sequence comprises 16, 17, 18, 19, 20, 21, 22, 23, or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2'-fluoro nucléotide.

10. The siNA of any one of embodiments 1-9, wherein 70%, 75%, 80%, 85%, 90%, 95% or 100% of the nucléotides in the second nucléotide sequence are modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide.

11. The siNA of any one of embodiments 1-10, wherein at least 2, 3, 4, 5, or 6 modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides.

12. The siNA of any one of embodiments 1-11, wherein less than or equal to 10, 9, 8, 7, 6, 5, 4, 3, or 2 modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides.

13. The siNA of any one of embodiments 1-12, wherein at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides.

257

14. The siNA of any one of embodiments 1-12, wherein less than or equal to 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 modified nucléotides ofthe second nucléotide sequence are 2’-O-methyl nucléotides.

15. A short interfering nucleic acid (siNA) molécule comprising:

(i) is 15 to 30 nucléotides in length;

(ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and (iii) comprises 1 or more phosphorothioate intemucleoside linkage; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence:

(i) is 15 to 30 nucléotides in length;

(ii) comprises 15 or more modified nucléotides independently selected from a 2’-(9-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and (iii) comprises 1 or more phosphorothioate intemucleoside linkage.

16. A short interfering nucleic acid (siNA) molécule comprising:

(i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; and

258 (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence:

(i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide, wherein the siNA further comprises a phosphorylation blocker, a galactosamine, or 5’stabilized end cap.

17. The siNA according to any preceding embodiment, wherein at least 1, 2, 3, 4, 5, 6, or 7 nucléotides at position 3, 5, 7, 8, 9, 10, 11, 12, and/or 17 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide.

18. The siNA according to any preceding embodiment, wherein the nucléotide at position 3 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide.

19. The siNA according to any preceding embodiment, wherein the nucléotide at position 5 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide.

20. The siNA according to any preceding embodiment, wherein the nucléotide at position 7 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide.

21. The siNA according to any preceding embodiment, wherein the nucléotide at position 8 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide.

22. The siNA according to any preceding embodiment, wherein the nucléotide at position 9 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide.

23. The siNA according to any preceding embodiment, wherein the nucléotide at position 12 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide.

24. The siNA according to any preceding embodiment, wherein the nucléotide at position 17 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide.

25. The siNA according to any preceding embodiment, wherein the nucléotide at position 10 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide.

259

26. The siNA according to any preceding embodiment, wherein the nucléotide at position 11 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide.

27. The siNA according to any preceding embodiment, wherein at least 1, 2, 3, 4, 5, 6, 7, 8, or 9 nucléotides at position 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5’ end of the second nucléotide sequence is a 2’-fhioro nucléotide. .

28. The siNA according to any preceding embodiment, wherein the nucléotide at position 2 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide.

29. The siNA according to any preceding embodiment, wherein the nucléotide at position 5 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide.

30. The siNA according to any preceding embodiment, wherein the nucléotide at position 6 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide.

31. The siNA according to any preceding embodiment, wherein the nucléotide at position 8 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide.

32. The siNA according to any preceding embodiment, wherein the nucléotide at position 10 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide.

33. The siNA according to any preceding embodiment, wherein the nucléotide at position 14 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide.

34. The siNA according to any preceding embodiment, wherein the nucléotides at position 16 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide.

35. The siNA according to any preceding embodiment, wherein the nucléotide at position 17 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide.

36. The siNA according to any preceding embodiment, wherein the nucléotide at position 18 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide.

37. The siNA according to any preceding embodiment, wherein the nucléotides in the second nucléotide sequence are arranged in an altemating 1:3 modification pattern, and wherein 1 nucléotide is a 2’-fluoro nucléotide and 3 nucléotides are 2’-O-methyl nucléotides.

260

38. The siNA of embodiment 37, wherein the altemating 1:3 modification pattern occurs 2-5 times.

39. The siNA according to embodiment 37 or 38, wherein at least two of the altemating 1:3 modification pattern occur consecutively.

40. The siNA according to any of embodiments 37-39, wherein at least two of the altemating 1:3 modification pattern occurs nonconsecutively.

41. The siNA according to any of clams 37-40, wherein at least 1, 2, 3, 4, or 5 altemating 1:3 modification pattern begins at nucléotide position 2, 6, 10, 14, and/or 18 from the 5’ end of the antisense strand.

42. The siNA according to any of clams 37-41, wherein at least one altemating 1:3 modification pattern begins at nucléotide position 2 from the 5’ end of the antisense strand.

43. The siNA according to any of clams 37-42, wherein at least one altemating 1:3 modification pattern begins at nucléotide position 6 from the 5’ end of the antisense strand.

44. The siNA according to any of clams 37-43, wherein at least one altemating 1:3 modification pattern begins at nucléotide position 10 from the 5’ end of the antisense strand.

45. The siNA according to any of clams 37-44, wherein at least one altemating 1:3 modification pattern begins at nucléotide position 14 from the 5’ end of the antisense strand.

46. The siNA according to any of clams 37-45, wherein at least one altemating 1:3 modification pattern begins at nucléotide position 18 from the 5’ end of the antisense strand.

47. The siNA according to any one of embodiments 1 -37, wherein the nucléotides in the second nucléotide sequence are arranged in an altemating 1:2 modification pattern, and wherein nucléotide is a 2’-fluoro nucléotide and 2 nucléotides are 2’-(9-methyl nucléotides.

48. The siNA of embodiment 47, wherein the altemating 1:2 modification pattern occurs 2-5 times.

49. The siNA according to embodiment 47 or 48, wherein at least two of the altemating 1:2 modification pattern occurs consecutively.

261

50. The siNA according to any of embodiments 47-49, wherein at least two of the altemating 1:2 modification pattern occurs nonconsecutively.

51. The siNA according to any of clams 47-50, wherein at least 1, 2, 3, 4, or 5 altemating 1:2 modification pattern begins at nucléotide position 2, 5, 8, 14, and/or 17 from the 5’ end of the antisense strand.

52. The siNA according to any of clams 47-51, wherein at least one altemating 1:2 modification pattern begins at nucléotide position 2 from the 5’ end of the antisense strand.

53. The siNA according to any of clams 47-52, wherein at least one altemating 1:2 modification pattern begins at nucléotide position 5 from the 5’ end of the antisense strand.

54. The siNA according to any of clams 47-53, wherein at least one altemating 1:2 modification pattern begins at nucléotide position 8 from the 5’ end of the antisense strand.

55. The siNA according to any of clams 47-54, wherein at least one altemating 1:2 modification pattern begins at nucléotide position 14 from the 5’ end of the antisense strand.

56. The siNA according to any of clams 47-55, wherein at least one altemating 1:2 modification pattern begins at nucléotide position 17 from the 5’ end of the antisense strand.

57. A short interfering nucleic acid (siNA) molécule represented by Formula (VIII):

’-An¹Bn²An³Bn⁴An⁵Bn⁶An⁷Bn⁸A_n ⁹-3 ’

3’-Cq^IAq²Bq³Aq⁴Bq⁵Aq⁶Bq⁷Aq⁸Bq⁹Aq¹⁰Bq¹¹Aq¹²-5’ wherein:

the bottom strand is an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%>, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence comprises 15 to 30 nucléotides;

each A is independently a 2’-O-methyl nucléotide or a nucléotide comprising a 5’stabilized end cap or a phosphorylation blocker;

B is a 2’-fluoro nucléotide;

C represents overhanging nucléotides and is a 2’-O-methyl nucléotide;

262 η¹ = 1-4 nucléotides in length;

each n³ and n⁴ is independently 1-3 nucléotides in length;

n⁵ is 1-10 nucléotides in length;

n⁷ is 0-4 nucléotides in length;

each n⁹, q¹, and q² is independently 0-2 nucléotides in length;

q⁴ is 0-3 nucléotides in length;

q⁶ is 0-5 nucléotides in length;

q⁸ is 2-7 nucléotides in length; and q¹⁰ is 2-11 nucléotides in length.

58. A short interfering nucleic acid (siNA) molécule represented by Formula (IX): 5’-A2-4BlAl-3 B₂-3 Α₂-ΐθΒθ-1Αθ-4Βθ-1Αθ-2-3’ ’ -C₂ A0-2B0-1A0-3B0-1A0-5B0-1 Α₂-γΒ i A2-11B i A i -5 ’ wherein:

each A is independently a 2’-(7-methyl nucléotide or a nucléotide comprising a 5’stabilized end cap or a phosphorylation blocker;

B is a 2’-fluoro nucléotide;

C represents overhanging nucléotides and is a 2’-O-methyl nucléotide.

59. A short interfering nucleic acid (siNA) molécule comprising (a) a sense strand comprising a first nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 3, 7-9, 12, and 17 from the 5’ end of the first nucléotide sequence, and wherein 2’-(2-methyl nucléotides are at positions 1, 2, 4-6, 10, 11, and 13-16 from the 5’ end of the first nucléotide sequence; and (b) an antisense strand comprising a second nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 2 and 14 from the 5’

263 end of the second nucléotide sequence, and wherein 2’-(9-methyl nucléotides are at positions 1, 3-13, and 15-17 from the 5’ end of the second nucléotide sequence.

60. The siNA molécule of embodiment 59, wherein the first nucléotide sequence consists of 19 nucléotides.

61. The siNA molécule of embodiment 60, wherein 2’-(9-methyl nucléotides are at positions 18 and 19 from the 5’ end of the first nucléotide sequence.

62. The siNA molécule according to any one of embodiments 59-61, wherein the second nucléotide sequence consists of 21 nucléotides.

63. The siNA molécule of embodiment 62, wherein 2’-O-methyl nucléotides are at positions 18-21 from the 5’ end of the second nucléotide sequence.

64. A short interfering nucleic acid (siNA) molécule comprising (a) a sense strand comprising a first nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 3, 7, 8, and 17 from the 5’ end of the first nucléotide sequence, and wherein 2’-O-methyl nucléotides are at positions 1, 2, 4-6, and 9-16 from the 5’ end of the first nucléotide sequence; and (b) an antisense strand comprising. a second nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 2 and 14 from the 5’ end of the first nucléotide sequence; and wherein 2’-O-methyl nucléotides are at positions 1, 3-13, and 15-17 from the 5’ end of the first nucléotide sequence.

65. The siNA molécule of embodiment 64, wherein the first nucléotide sequence consists of 19 nucléotides.

66. The siNA molécule of embodiment 65, wherein 2’-(9-methyl nucléotides are at positions 18 and 19 from the 5’ end of the first nucléotide sequence.

67. The siNA molécule according to any one of embodiments 64-66, wherein the second nucléotide sequence consists of 21 nucléotides.

68. The siNA molécule of embodiment 67, wherein 2’-O-methyl nucléotides are at positions 18-21 from the 5’ end of the second nucléotide sequence.

69. A short interfering nucleic acid (siNA) molécule comprising

264 (a) a sense strand comprising a first nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 3, 7-9, 12 and 17 from the 5’ end of the first nucléotide sequence, and wherein 2’-O-methyl nucléotides are at positions 1, 2, 4-6, 10, 11, and 13-16 from the 5’ end of the first nucléotide sequence; and (b) an antisense strand comprising a second nucléotide sequence consisting of 17 to 23 nucléotides, wherein the nucléotides in the second nucléotide sequence are arranged in an altemating 1:3 modification pattern, and wherein 1 nucléotide is a 2’-fluoro nucléotide and 3 nucléotides are 2’-O-methyl nucléotides.

70. The siNA molécule of embodiment 69, wherein the first nucléotide sequence consists of 19 nucléotides.

71. The siNA molécule of embodiment 70, wherein 2’-O-methyl nucléotides are at positions 18 and 19 from the 5’ end of the first nucléotide sequence.

72. The siNA molécule according to any one of embodiments 69-71, wherein the second nucléotide sequence consists of 21 nucléotides.

73. The siNA molécule of embodiment 72, wherein 2’-O-methyl nucléotides are at positions 19-21 from the 5’ end of the second nucléotide sequence.

74. The siRNA molécule according to any one of embodiments 69-73, wherein the altemating 1:3 modification pattern occurs 2-5 times.

75. The siRNA molécule according to any one of embodiments 69-74, wherein at least two of the altemating 1:3 modification pattern occur consecutively.

76. The siRNA molécule according to any one of embodiments 69-75, wherein at least two of the altemating 1:3 modification pattern occurs nonconsecutively.

77. The siNA according to any one of embodiments 69-76, wherein at least 1, 2, 3, 4, or 5 altemating 1:3 modification pattern begins at nucléotide position 2, 6, 10, 14, and/or 18 from the 5’ end of the antisense strand.

78. The siNA according to any one of embodiments 69-77, wherein at least one altemating 1:3 modification pattern begins at nucléotide position 2 from the 5’ end of the antisense strand.

265

79. The siNA according to any one of embodiments 69-78, wherein at least one altemating 1:3 modification pattern begins at nucléotide position 6 from the 5’ end of the antisense strand.

80. The siNA according to any one of embodiments 69-79, wherein at least one altemating 1:3 modification pattern begins at nucléotide position 10 from the 5’ end of the antisense strand.

81. The siNA according to any one of embodiments 69-80, wherein at least one altemating 1:3 modification pattern begins at nucléotide position 14 from the 5’ end of the antisense strand.

82. The siNA according to any one of embodiments 69-81, wherein at least one altemating 1:3 modification pattern begins at nucléotide position 18 from the 5’ end of the antisense strand.

83. A short interfering nucleic acid (siNA) molécule comprising (a) a sense strand comprising a first nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 5 and 7-9 from the 5’ end of the first nucléotide sequence, and wherein 2’-O-methyl nucléotides are at positions 1-4, 6, and 10-17 from the 5’ end of the first nucléotide sequence; and (b) an antisense strand comprising a second nucléotide sequence consisting of 17 to 23 nucléotides, wherein the nucléotides in the second nucléotide sequence are arranged in an altemating 1:3 modification pattern, and wherein 1 nucléotide is a 2’-fluoro nucléotide and 3 nucléotides are 2’-O-methyl nucléotides.

84. The siNA molécule of embodiment 83, wherein the first nucléotide sequence consists of 19 nucléotides.

85. The siNA molécule of embodiment 84, wherein 2’-O-methyl nucléotides are at positions 18 and 19 from the 5’ end of the first nucléotide sequence.

86. The siNA molécule according to any one of embodiments 83-85, wherein the second nucléotide sequence consists of 21 nucléotides.

87. The siNA molécule of embodiment 86, wherein 2’-O-methyl nucléotides are at positions 19-21 from the 5’ end of the second nucléotide sequence.

88. The siRNA molécule according to any one of embodiments 83-87, wherein the altemating 1:3 modification pattern occurs 2-5 times.

89. The siRNA molécule according to any one of embodiments 83-88, wherein at least two of the altemating 1:3 modification pattern occur consecutively.

266

90. The siRNA molécule according to any one of embodiments 83-89, wherein at least two of the altemating 1:3 modification pattern occurs nonconsecutively.

91. The siNA according to any one of embodiments 83-90, wherein at least 1, 2, 3, 4, or 5 altemating 1:3 modification pattern begins at nucléotide position 2, 6, 10, 14, and/or 18 from the 5’ end of the antisense strand.

92. The siNA according to any one of embodiments 83-91, wherein at least one altemating 1:3 modification pattern begins at nucléotide position 2 from the 5’ end of the antisense strand.

93. The siNA according to any one of embodiments 83-92, wherein at least one altemating 1:3 modification pattern begins at nucléotide position 6 from the 5’ end of the antisense strand.

94. The siNA according to any one of embodiments 83-93, wherein at least one altemating 1:3 modification pattern begins at nucléotide position 10 from the 5’ end of the antisense strand.

95. The siNA according to any one of embodiments 83-94, wherein at least one altemating 1:3 modification pattern begins at nucléotide position 14 from the 5’ end of the antisense strand.

96. The siNA according to any one of embodiments 83-95, wherein at least one altemating 1:3 modification pattern begins at nucléotide position 18 from the 5’ end of the antisense strand.

97. A short interfering nucleic acid (siNA) molécule comprising (a) a sense strand comprising a first nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 5 and 7-9 from the 5’ end of the first nucléotide sequence, and wherein 2’-O-methyl nucléotides are at positions 1-4, 6, and 10-17 from the 5’ end of the first nucléotide sequence; and (b) an antisense strand comprising a second nucléotide sequence consisting of 17 to 23 nucléotides, wherein the nucléotides in the second nucléotide sequence are arranged in an altemating 1:2 modification pattern, and wherein 1 nucléotide is a 2’-fluoro nucléotide and 2 nucléotides are 2’-(9-methyl nucléotides.

98. The siNA molécule of embodiment 97, wherein the first nucléotide sequence consists of 19 nucléotides.

99. The siNA molécule of embodiment 98, wherein 2’-(9-methyl nucléotides are at positions 18 and 19 from the 5’ end of the first nucléotide sequence.

267

100. The siNA molécule according to any one of embodiments 97-99, wherein the second nucléotide sequence consists of 21 nucléotides.

101. The siNA molécule of embodiment 100, wherein 2’-O-methyl nucléotides are at positions 18-21 from the 5’ end of the second nucléotide sequence.

102. The siRNA molécule according to any one of embodiments 97-101, wherein the altemating 1:2 modification pattern occurs 2-5 times.

103. The siRNA molécule according to any one of embodiments 97-102, wherein at least two of the altemating 1:2 modification pattern occur consecutively.

104. The siRNA molécule according to any one of embodiments 97-103, wherein at least two of the altemating 1:2 modification pattern occurs nonconsecutively.

105. The siNA according to any one of embodiments 97-104, wherein at least 1, 2, 3, 4, or 5 altemating 1:2 modification pattern begins at nucléotide position 2, 5, 8, 14, and/or 17 from the 5’ end of the antisense strand.

106. The siNA according to any one of embodiments 97-105, wherein at least one altemating 1:2 modification pattern begins at nucléotide position 2 from the 5’ end of the antisense strand.

107. The siNA according to any one of embodiments 97-106, wherein at least one altemating 1:2 modification pattern begins at nucléotide position 5 from the 5’ end of the antisense strand.

108. The siNA according to any one of embodiments 97-107, wherein at least one altemating 1:2 modification pattern begins at nucléotide position 8 from the 5’ end of the antisense strand.

109. The siNA according to any one of embodiments 74-85, wherein at least one altemating 1:2 modification pattern begins at nucléotide position 14 from the 5’ end of the antisense strand.

110. The siNA according to any one of embodiments 97-109, wherein at least one altemating 1:2 modification pattern begins at nucléotide position 17 from the 5’ end of the antisense strand.

111. A short interfering nucleic acid (siNA) molécule comprising (a) a sense strand comprising a first nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 5 and 7-9 from the 5’ end of the first nucléotide sequence, and wherein 2’-O-methyl nucléotides are at positions 1-4, 6, and 10-17 from the 5’ end of the first nucléotide sequence; and

268 (b) an antisense strand comprising a second nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 2, 6, 14, and 16 from the 5’ end of the second nucléotide sequence, and wherein 2’-O-methyl nucléotides are at positions 1, 3-5, 7-13, 15, and 17 from the 5’ end the second nucléotide sequence.

112. The siNA molécule of embodiment 111, wherein the first nucléotide sequence consists of 19 nucléotides.

113. The siNA molécule of embodiment 112, wherein 2’-O-methyl nucléotides are at positions 18 and 19 from the 5’ end of the first nucléotide sequence.

114. The siNA molécule according to any one of embodiments 111-113, wherein the second nucléotide sequence consists of 21 nucléotides.

115. The siNA molécule of embodiment 114, wherein 2’-O-methyl nucléotides are at positions 18-21 from the 5’ end of the second nucléotide sequence.

116. A short interfering nucleic acid (siNA) molécule comprising:

(a) a sense strand comprising a first nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 5, 9-11, and 14 from the 5’ end of the first nucléotide sequence, and wherein 2’-O-methyl nucléotides are at positions 1-4, 6-8, and 12-17 from the 5’ end of the first nucléotide sequence; and (b) an antisense strand comprising a second nucléotide sequence consisting of 17 to 23 nucléotides, wherein 2’-fluoro nucléotides are at positions 2 and 14 from the 5’ end of the second nucléotide sequence, and wherein 2’-(9-methyl nucléotides are at positions 1, 3-13, and 15-17 from the 5’ end the second nucléotide sequence.

117. The siNA molécule of embodiment 116, wherein the first nucléotide sequence consists of 21 nucléotides.

118. The siNA molécule of embodiment 117, wherein 2’-(9-methyl nucléotides are at positions 18-21 from the 5’ end of the first nucléotide sequence.

119. The siNA molécule according to any one of embodiments 116-118, wherein the second nucléotide sequence consists of 23 nucléotides.

269

120. The siNA molécule of embodiment 119, wherein 2’-O-methyl nucléotides are at positions 18-23 from the 5’ end of the second nucléotide sequence.

121. The siNA according to any preceding embodiment, wherein the sense strand fùrther comprises TT sequence adjacent to the first nucléotide sequence.

122. The siNA according to any preceding embodiment, wherein the sense strand further comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more phosphorothioate intemucleoside linkages.

123. The siNA of embodiment 122, wherein at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 1 and 2 from the 5’ end of the first nucléotide sequence.

124. The siNA of embodiment 122 or 123, wherein at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 2 and 3 from the 5’ end of the first nucléotide sequence.

125. The siNA according to any preceding embodiment, wherein the antisense strand further comprises TT sequence adjacent to the second hucleotide sequence.

126. The siNA according to any preceding embodiment, wherein the antisense strand further comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more phosphorothioate intemucleoside linkages.

127. The siNA of embodiment 126, wherein at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 1 and 2 from the 5’ end of the second nucléotide sequence.

128. The siNA of embodiment 126 or 127, wherein at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 2 and 3 from the 5’ end of the second nucléotide sequence.

129. The siNA of any one of embodiments 126-128, wherein at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 1 and 2 from the 3 ’ end of the second nucléotide sequence.

270

130. The siNA of any one of embodiments 126-129, wherein at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 2 and 3 from the 3’ end of the second nucléotide sequence.

131. The siNA according to any preceding embodiment, wherein the first nucléotide from the 5 5’ end of the first nucléotide sequence comprises a 5’ stabilizing end cap.

132. The siNA according to any preceding embodiment, wherein the first nucléotide from the 5’ end of the second nucléotide sequence comprises a 5’ stabilizing end cap.

133. The siNA according to any preceding embodiment, wherein the first nucléotide from the 5’ end of the first nucléotide sequence comprises a phosphorylation blocker.

134. The siNA according to any preceding embodiment, wherein the first nucléotide from the

5’ end of the second nucléotide sequence comprises a phosphorylation blocker.

135. The siNA according to any preceding embodiment, wherein the first nucléotide sequence or second nucléotide sequence comprises at least one modified nucléotide selected from

or alkyl (or AmNA(N-Me)) when R is alkyl);

(AmNA), where R is H (GuNA); and

GuNA(N-R), R = Me, Et, iPr, tBu, _wherein B is a nucleobase.

136. A short-interfering nucleic acid (siNA) molécule comprising:

(a) a phosphorylation blocker of Formula (IV):

wherein

271

R¹ is a nucleobase,

R⁴ is-O-R³⁰ or-NR^3IR³²,

R³⁰ is Ci-C₈ substituted or unsubstituted alkyl; and

R³¹ and R³² together with the nitrogen to which they are attached form a substituted or unsubstituted heterocyclic ring; and (b) a short interfering nucleic acid (siNA).

137. A short-interfering nucleic acid (siNA) molécule comprising:

(a) a 5’-stabilized end cap of Formula (la): wherein

R¹ is a nucleobase, aryl, heteroaryl, or H, ^ry°v^r1

R²⁰' VJ

0' t>CH₃

Οχ _zo , Vn-^s'

R² is H fi 0, .0

H o' o /0 ^^SN H

O_xx /0 9 HO .s 9 ^S^P_X-OH X A

OH \ Ο ^OH

O. .OH ^^PxOH o_x och₃

O_{x z}OCD₃

H ,N, / i S

O O ?

O , -CH=CD-Z,-CD=CH-Z,-CD=CD-Z,

-(CR²¹R²²)_n-Z, or -(C₂-Cé alkenylene)-Z and R²⁰ is hydrogen; or

R² and R²⁰ together form a 3- to 7-membered carbocyclic ring substituted with (CR²¹R²²)_n-Z or -(C₂-C₆ alkenylene)-Z;

n is 1, 2, 3, or 4;

Z is -ONR²³R²⁴, -OP(O)OH(CH2)mCO2R²³, -OP(S)OH(CH2)_mCO₂R²³, -P(O)(OH)₂, P(O)(OH)(OCH₃), -P(O)(OH)(OCD₃), -SO₂(CH₂)_mP(O)(OH)₂, -so₂nr²³r²⁵, -nr²³r²⁴, R²¹ and R²² are independently hydrogen or Ci-Cô alkyl; R²¹ and R²² together form an oxo group;

R²³ is hydrogen or Ci-Cô alkyl;

R²⁴ is -SO₂R²⁵ or -C(O)R²⁵; or

R²⁵ is Ci-Cô alkyl; and m is 1, 2, 3, or 4; and

272 (b) a short interfering nucleic acid (siNA).

138. A short-interfering nucleic acid (siNA) molécule comprising:

(a) a 5’-stabilized end cap of Formula (Ib):

wherein

R¹ is a nucleobase, aryl, heteroaryl, or H,

/0 il HO_V .S 9 O_x OH O_s OCH₃

JS^Pç-OH

OH X O OH \ OH OH ? 5 5

-CH=CD-Z, -CD=CH-Z, -CD=CD-Z,

-(CR²¹R²²)_n-Z, or -(C2-C6 alkenylene)-Z and R²⁰ is hydrogen; or

R² and R²⁰ together form a 3- to 7-membered carbocyclic ring substituted with (CR²¹R²²)_n-Z or -(C2-C6 alkenylene)-Z;

n is 1, 2, 3, or 4;

Z is -ONR²³R²⁴, -OP(O)OH(CH2)mCO2R²³, -OP(S)OH(CH2)mCO₂R²³, -P(O)(OH)₂, P(O)(OH)(OCH₃), -P(O)(OH)(OCD₃), -SO2(CH₂)_mP(O)(OH)2, -so₂nr²³r²⁵, -nr²³r²⁴,

R²³ is hydrogen or Ci-Cô alkyl;

R²⁴ is -SO2R²⁵ or -C(O)R²⁵; or

R²⁵ is Ci-Cô alkyl; and m is 1, 2, 3, or 4; and (b) a short interfering nucleic acid (siNA).

139. A short-interfering nucleic acid (siNA) molécule comprising:

273 (a) a 5’-stabilized end cap selected from the group consisting of Formula (1) to Formula (15), Formula (9X) to Formula (12X), and Formula (9Y) to Formula (12Y):

Formula (5) Formula (6) Formula (7)

Formula (8)

Formula (9) Formula (9X) Formula (9Y)

Formula (11 Y)

Formula (11)

Formula (11X)

Formula (12)

Formula (12X)

Formula (12Y)

274

Formula (13) Formula (14) Formula (15) wherein R¹ is a nucleobase, aryl, heteroaryl, or H; and (b) a short interfering nucleic acid (siNA).

140. A short-interfering nucleic acid (siNA) molécule comprising:

(a) a 5’-stabilized end cap selected from the group consisting of Formulas (1A)-(15A),

Formulas (9B)-(12B), Formulas (9AX)-(12AX), Formulas (9AY)-(12AY), Formulas (9BX)-(12BX), and Formulas (9BY)-(12BY):

cf och₃ och₃ och₃

Formula (5A) Formula (6A) Formula (7A)

0 //^ ^nh FJj' ho^hcx<^S H₃co._p<f 0 / \ ' och₃ ο_χ och₃ Formula (8A) Formula (9A) ^H3CCV°/^/°\ ^D3C% HO Λ__/ HO \ / HO ci och₃ ci ôch₃ x y Formula (9B) Formula (9BX)

Q O ^d3^C0>^z-° ho' '^\_j cT och₃ ci och₃ Formula (9AX) Formula (9AY) cT îoch₃ Formula (9BY)

275

Formula (10A)

Formula (10AX)

Formula (10AY)

Formula (10B)

Formula (10BX)

Formula (10BY)

Formula (11 A)

Formula (11AX)

Formula (11AY)

Formula (11 B)

Formula (11 BY)

Formula (11BX)

Formula (12B)

Formula (12BX)

Formula (12BY)

276

Formula (13A) Formula (14A) Formula (15A) _anj (b) a short interfering nucleic acid (siNA).

141. The siNA molécule according to any one of embodiments 136-140, wherein the siNA comprises the sense strand of any one of embodiments 1-135.

142. The siNA molécule according to any one of embodiments 136-141, wherein the siNA comprises the antisense strand of any one of embodiments 1-135.

143. A short interfering nucleic acid (siNA) molécule comprising:

(a) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence comprises a nucléotide sequence of any one SEQ ID NOs: 1-56, 103-158, and 205-260; and (b) an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence comprises a nucléotide sequence of any one of SEQ ID NOs: 57-102, 159-204, and 261-306.

144. A interfering nucleic acid (siNA) molécule comprising:

(a) a sense strand comprising a nucléotide sequence of any one of SEQ ID NOs: 307362 and 415-444; and (b) an antisense strand comprising a nucléotide sequence of any one of SEQ ID NOs: 363-409, 445-533, and 536-539.

145. The siNA according to any one of embodiments 1-132, 135, and 137-144, wherein the siNA further comprises a phosphorylation blocker.

277

146. The siNA according to any one of embodiments 16, 133, 134, and 145, wherein the ^R4A^°y^R1 phosphorylation blocker has the structure of Formula (IV): ~~L~ , wherein

R¹ is a nucleobase,

147. The siNA of embodiment 136 or 146, wherein R⁴ is -OCH3 or -N(CH2CH₂)2O.

148. The siNA according to any one of embodiments 16, 133, 134, 136, and 145-147, wherein the phosphorylation blocker is attached to the 5’ end of the sense strand.

149. The siNA of embodiment 148, wherein the phosphorylation blocker is attached to the 5’ end of the sense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, and phosphorodithioate linker.

150. The siNA according to any one of embodiments 16, 133, 134, 136, and 145-147, wherein the phosphorylation blocker is attached to the 3’ end of the sense strand.

151. The siNA of embodiment 150, wherein the phosphorylation blocker is attached to the 3 ’ end of the sense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, and phosphorodithioate linker.

152. The siNA according to any one of embodiments 16, 133, 134, 136, and 145-147, wherein the phosphorylation blocker is attached to the 5’ end of the antisense strand.

153. The siNA of embodiment 152, wherein the phosphorylation blocker is attached to the 5’ end of the antisense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, and phosphorodithioate linker.

154. The siNA according to any one of embodiments 16, 133, 134, 136, and 144-147, wherein the phosphorylation blocker is attached to the 3 ’ end of the antisense strand.

278

155. The siNA of embodiment 154, wherein the phosphorylation blocker is attached to the 3 ’ end of the antisense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, and phosphorodithioate linker.

156. The siNA according to any preceding embodiment, wherein the siNA further comprises a galactosamine.

157. The siNA of embodiment 16 or 156, wherein the galactosamine is N-acetylgalactosamine (GalNAc) of Formula (VII):

R = OH or SH wherein each n is independently 1 or 2.

158. The siNA of embodiment 16 or 156, wherein the galactosamine is N-acetylgalactosamine (GalNAc) of Formula (VI): wherein

m is 1, 2, 3, 4, or 5;

each n is independently 1 or 2;

p is 0 or 1 ;

each R is independently H;

Z is H or a second protecting group;

either L is a linker or L and Y in combination are a linker; and

A is H, OH, a third protecting group, an activated group, or an oligonucleotide.

279

159. The siNA of embodiment 158, wherein A is an oligonucleotide. ·

160. The siNA of embodiment 158, wherein A is 1-2 oligonucleotides.

161. The siNA of any one of embodiments 158-160, wherein the oligonucleotide is dTdT.

162. The siNA according to any one of embodiments 16 and 156-161, wherein the galactosamine is attached to the 3’ end of the sense strand.

163. The siNA of embodiment 162, wherein the galactosamine is attached to the 3’ end of the sense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, or phosphorodithioate linker.

164. The siNA according to any one of embodiments 16 and 156-161, wherein the galactosamine is attached to the 5’ end of the sense strand.

165. The siNA of embodiment 164, wherein the galactosamine is attached to the 5’ end of the sense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, or phosphorodithioate linker.

166. The siNA according to any one of embodiments 16 and 156-161, wherein the galactosamine is attached to the 3’ end of the antisense strand.

167. The siNA of embodiment 166, wherein the galactosamine is attached to the 3’ end of the atnisense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, or phosphorodithioate linker.

168. The siNA according to any one of embodiments 16 and 156-161, wherein the galactosamine is attached to the 5’ end of the antisense strand.

169. The siNA of embodiment 168, wherein the galactosamine is attached to the 5’ end of the atnisense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, or phosphorodithioate linker.

170. The siNA according to any one of embodiments 1-130, 133-136, and 139-169, wherein the siNA further comprises a 5’-stabilized end cap.

171. The siNA according to any one of embodiments 16, 131, 132, and 170, wherein the 5’stabilized end cap is a 5’ vinyl phosphonate or deuterated 5’ vinyl phosphonate.

280

172. The siNA according to any one of embodiments 16, 131, 132, and 170, wherein the 5’- stabilized end cap has the structure of Formula (la):

wherein

R¹ is a nucleobase, aryl, heteroaryl, or H,

/0 9 HO _ZS 9 O_x OH O_x OCH₃ O_x ocd₃

JsQ^p_coh

OH Y O OH V OH Y OH Y OH

-(C2-C6 alkenylene)-Z;

nis 1, 2, 3, or 4;

Z is -ONR²³R²⁴, -OP(O)OH(CH2)mCO2R²³, -OP(S)OH(CH2)_mCO₂R²³, -P(O)(OH)2, P(O)(OH)(OCH3), -P(O)(OH)(OCD3), -SO2(CH2)mP(O)(OH)2, -SO2NR²³R²⁵, -NR²³R²⁴, or NR²³SO2R²⁴;

R²³ is hydrogen or Ci-Ce alkyl;

R²⁴ is -SO2R²⁵ or -C(O)R²⁵; or

R²⁵ is Ci-Cô alkyl; and m is 1, 2, 3, or 4.

173. The siNA according to any one of embodiments 131, 132, and 170, wherein the 5’- stabilized end cap has the structure of Formula (Ib):

wherein

281

R¹ is a nucleobase, aryl, heteroaryl, or H,

O

II

P_X-OH

OH

HO, _Z/S 9 O,, _ZOH

ΧΑ/Χόη V^%h

O, OCH₃ O, OCD₃

Y OH Y OH 5

, -CH=CD-Z, -CD=CH-Z, -CD=CD-Z, -(CR²¹R²²)_n-Z, or-(C₂-C₆ alkenylene)-Z and R²⁰ is hydrogen; or

-(C₂-Cô alkenylene)-Z;

n is 1, 2, 3, or 4;

Z is -ONR²³R²⁴, -OP(O)OH(CH2)mCO2R²³, -OP(S)OH(CH2)_raCO₂R²³, -P(O)(OH)2, P(O)(OH)(OCH3), -P(O)(OH)(OCD3), -SO2(CH2)mP(O)(OH)2, -SO2NR²³R²⁵, -NR²³R²⁴, orNR²³SO2R²⁴;

R²³ is hydrogen or Ci-Cô alkyl;

R²⁴ is -SO₂R²⁵ or-C(O)R²⁵; or

R²⁵ is Ci-Cô alkyl; and m is 1, 2, 3, or 4.

174. The siNA of embodiment 172 or 173, wherein R¹ is an aryl.

175. The siNA of embodiment 174, wherein the aryl is a phenyl.

176. The siNA according to any one of embodiments 16, 131, 132, and 170, wherein the 5’stabilized end cap is selected from the group consisting of Formula (1) to Formula (15), Formula (9X) to Formula (12X), and Formula (9Y) to Formula (12Y):

282

Formula (10) Formula (10X) Formula (1 ΟΥ)

Formula (11) Formula (11X) Formula (11Y)

Formula (12)

Formula (12X) Formula (12Y)

Formula (13) Formula (14) Formula (15) , wherein R¹ is a nucleobase, aryl, heteroaryl, or H.

283

177. The siNA according to any one of embodiments 16, 131, 132, and 170, wherein the 5’stabilized end cap is selected from the group consisting of Formulas (1A)-(15A), Formulas (9B)(12B), Formulas (9AX)-(12AX), Formulas (9AY)-(12AY), Formulas (9BX)-(12BX), and Formulas (9BY)-(12BY):

Formula (9AX)

Formula (8A)

Formula (9A)

Formula (9AY) ^D ₃COyO n.

HO /

O\ OCH₃

Formula (9BY)

Formula (9BX)

Formula (9B)

Formula (10AX)

284

Formula (10B)

Formula (10BX)

Formula (10BY)

Formula (11 A)

Formula (11AX)

Formula (11AY)

Formula (11 B) Formula (11BX) Formula (11 BY)

Formula (12A) Formula (12AX) Formula (12AY)

Formula (12BY)

Formula (12B) Formula (12BX)

285

178. The siNA according to any one of embodiments 131, 132, and 170, wherein the 5’- stabilized end cap has the structure of Formula (le):

, wherein

R¹ is a nucleobase, aryl, heteroaryl, or H,

<P 9 HO. _ZS 9 O_x OH O_x OCH₃ O_x ocd₃

Js^p_x-oh . ss/XpC ï/XC

OH Y O OH OH Y OH Y OH

5 5 5

o , -CH=CD-Z, -CD=CH-Z, -CD=CD-Z, -(CR²¹ R²²)_n-Z, or -(C₂-C₆ alkenylene)-Z and R²⁰ is hydrogen; or

-(C₂-Cô alkenylene)-Z;

n is 1, 2, 3, or 4;

R²³ is hydrogen or Ci-Cô alkyl;

R²⁴ is -SO₂R²⁵ or -C(O)R²⁵; or

R²⁵ is Ci-Cô alkyl; and m is 1, 2, 3, or 4.

179. The siNA of embodiment 178, wherein R¹ is an aryl.

180. The siNA of embodiment 179, wherein the aryl is a phenyl.

181. The siNA according to any one of embodiments 16, 131, 132, and 170, wherein the 5’stabilized end cap is selected from the group consisting of Formula (21) to Formula (35):

286

Formula (28) Formula (29) Formula (30)

Formula (31) Formula (32) Formula (33)

Formula (34) Formula (35) , wherein R¹ is a nucleobase, aryl, heteroaryl, or

H.

182. The siNA according to any one of embodiments 16, 131, 132, and 170, wherein the 5’stabilized end cap is selected from the group consisting of Formulas (21A)-(35A), Formulas (29B)-(32B), Formulas (29AX)-(32AX), Formulas (29AY)-(32AY), Formulas (29BX)-(32BX), io and Formulas (29BY)-(32BY):

287

Formula (22A)

Formula (23A)

Formula (24A)

Formula (27A)

Formula (28A) Formula (29A)

Formula (29AX) Formula (29AY)

Formula (29B)

Formula (29BX)

Formula (29BY)

Formula (30A)

Formula (30AX)

Formula (30AY)

288

Formula (31A)

Formula (31AY)

Formula (31 B)

Formula (32A)

183. The siNA according to any one of embodiments 1-182, wherein the antisense strand comprises at least one thermally destabilizing nucléotide selected from:

289

184. The siNA according to any one of embodiments 1-182, wherein the sense strand comprises at least one thermally destabilizing nucléotide selected from:

185. The siNA according to any one of embodiments 1-182, wherein the first nucléotide sequence comprises at least one thermally destabilizing nucléotide selected from:

290

186. The siNA according to any one of embodiments 1-182, wherein the second nucléotide sequence comprises at least one thermally destabilizing nucléotide selected from:

187. The siNA according to any one of embodiments 16, 131, 132, and 170-186, wherein the

5’-stabilized end cap is attached to the 5’ end of the antisense strand.

188. The siNA of embodiment 187, wherein the 5’-stabilized end cap is attached to the 5’ end of the antisense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, or phosphorodithioate linker.

189. The siNA according to any one of embodiments 16, 131, 132, and 170-186, wherein the 5’-stabilized end cap is attached to the 5’ end of the sense strand.

190. The siNA of embodiment 189, wherein the 5’-stabilized end cap is attached to the 5’ end of the sense strand via one or more linkers independently selected from a phosphodiester linker, phosphorothioate linker, or phosphorodithioate linker.

191. The siNA according to any preceding embodiment, wherein the target gene is a viral gene.

192. The siNA of embodiment 191, wherein the viral gene is from a DNA virus.

193. The siNA of embodiment 192, wherein the DNA virus is a double-stranded DNA (dsDNA) virus.

194. The siNA of embodiment 193, wherein the dsDNA virus is a hepadnavirus.

195. The siNA of embodiment 194, wherein the hepadnavirus is a hepatitis B virus (HBV).

291

196. The siNA of embodiment 195, wherein the HBV is selected from HBV génotypes A-J.

197. The siNA of embodiment 195 or 196, wherein the target gene is selected from the S gene or X gene of the HBV.

198. The siNA according to any one of embodiments 1-197, wherein the second nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to 15 to 30 nucléotides within positions 200-720 or 1100-1700 of SEQ ID NO: 410.

199. The siNA according to any one of embodiments 1-197, wherein the second nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to 15 to 30 nucléotides within positions 200-280, 300-445, 460-510, 650-720, 1170-1220, 1250-1300, or 1550-1630 of SEQ ID NO: 410.

200. The siNA according to any one of embodiments 1-197, wherein the second nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to 15 to 30 nucléotides within positions 200-230, 250-280, 300-330, 370-400, 405-445, 460-500, 670-700, 1180-1210, 1260-1295, 1520-1550, or 1570-1610 of SEQ ID NO: 410.

201. The siNA according to any one of embodiments 1-197, wherein the second nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to 15 to 30 nucléotides starting at position 203, 206, 254, 305, 375, 409, 412, 415, 416, 419, 462, 466, 467, 674, 676, 1182, 1262, 1263, 1268, 1526, 1577, 1578, 1580, 1581, 1583, or 1584 of SEQ ID NO: 410.

202. The siNA according to any one of embodiments 1-201, wherein the first nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to 15 to 30 nucléotides within positions 200-720 or 1100-1700 of SEQ ID NO: 410.

203. The siNA according to any one of embodiments 1-201, wherein the first nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to 15 to 30 nucléotides within positions 200-280, 300-445, 460-510, 650-720, 1170-1220, 1250-1300, or 1550-1630 of SEQ ID NO: 410.

204. The siNA according to any one of embodiments 1-201, wherein the first nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to 15

292 to 30 nucléotides within positions 200-230, 250-280, 300-330, 370-400, 405-445, 460-500, 670700, 1180-1210, 1260-1295, 1520-1550, or 1570-1610 ofSEQ IDNO:410.

205. The siNA according to any one of embodiments 1-201, wherein the first nucléotide sequence is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to 15 to 30 nucléotides starting at position 203, 206, 254, 305, 375, 409, 412, 415, 416, 419, 462, 466, 467, 674, 676, 1182, 1262, 1263, 1268, 1526, 1577, 1578, 1580, 1581, 1583, or 1584 ofSEQ ID NO: 410.

206. The siNA according to any preceding embodiment, wherein the first nucléotide sequence comprises a nucléotide sequence of any one SEQ ID NOs: 1-56, 103-158, and 205-260.

207. The siNA according to any preceding embodiment, wherein the second nucléotide sequence comprises a nucléotide sequence of any one ofSEQ ID NOs: 57-102, 159-204, and 261-306.

208. The siNA according to any preceding embodiment, wherein the sense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 307-362 and 415-444.

209. The siNA according to any preceding embodiment, wherein the antisense strand comprises a nucléotide sequence of any one of SEQ ID NOs: 363-409, 445-533, and 536-539.

210. The siNA according to any preceding embodiment, wherein at least one end of the siNA is a blunt end.

211. The siNA according to any preceding embodiment, wherein at least one end of the siNA comprises an overhang, wherein the overhang comprises at least one nucléotide.

212. The siNA according to any one of embodiments 1-209, wherein both ends of the siNA comprise an overhang, wherein the overhang comprises at least one nucléotide.

213. The siNA according to any preceding embodiment, wherein the siNA is selected from dssiNA-001 to ds-siNA-0178.

214. The siNA according to any preceding embodiment, wherein at least one 2’-fluoro nucléotide or 2’-O-methyl nucléotide is a 2’-fluoro or 2-O-methyl nucléotide mimic of Formula (V):

293

R¹ is independently a nucleobase, aryl, heteroaryl, or H, Q¹ and Q² are independently S or

O,

R⁵ is independently-OCD3, -F, or-OCH₃, and

R⁶ and R⁷ are independently H, D, or CD3.

215. The siNA of embodiment 214, wherein the 2’-fluoro or 2’-O-methyl nucléotide mimic is a nucléotide mimic of Formula (16) - Formula (20):

Formula (16)

S'' R²

Formula (17)

Formula (18) Formula (19)

Formula (20) wherein R¹ is a nucleobase and R² is independently F or -OCH₃.

216. The siNA according to any preceding embodiment, wherein at least one 2’-fluoro nucléotide is a 2’-fluoro nucléotide mimic.

217. The siNA according to embodiment 216, wherein at least one 2’-fluoro nucléotide on the antisense strand or the second nucléotide sequence is a 2’-fluoro nucléotide mimic.

218. The siNA according to embodiment 216 or 217, wherein the nucléotide at position 2 from the 5’ end of the antisense strand or the second nucléotide sequence is a 2’-fluoro nucléotide mimic.

219. The siNA according to any one of embodiments 216-218, wherein the nucléotide at position 5 from the 5’ end of the antisense strand or the second nucléotide sequence is a 2’-fluoro nucléotide mimic.

220. The siNA according to any one of embodiments 216-219, wherein the nucléotide at position 6 from the 5’ end of the antisense strand or the second nucléotide sequence is a 2’-fluoro nucléotide mimic.

294

221. The siNA according any one of embodiments 216-220, wherein the nucléotide at position from the 5’ end of the antisense strand or the second nucléotide sequence is a 2’-fluoro nucléotide mimic.

222. The siNA according to any one of embodiments 216-221, wherein the nucléotide at position 10 from the 5’ end of the antisense strand or the second nucléotide sequence is a 2’fluoro nucléotide mimic.

223. The siNA according to any one of embodiments 216-222, wherein the nucléotide at position 14 from the 5’ end of the antisense strand or the second nucléotide sequence is a 2’fluoro nucléotide mimic.

224. The siNA according to any one of embodiments 216-223, wherein the nucléotide at position 16 from the 5’ end of the antisense strand or the second nucléotide sequence is a 2’fluoro nucléotide mimic.

225. The siNA according to any one of embodiments 216-224, wherein the nucléotide at position 17 from the 5’ end of the antisense strand or the second nucléotide sequence is a 2’fluoro nucléotide mimic.

226. The siNA according to any one of embodiments 216-225, wherein at least one 2’-fluoro nucléotide on the sense strand or the first nucléotide sequence is a 2’-fluoro nucléotide mimic.

227. The siNA according to any one of embodiments 216-226, wherein the nucléotide at position 3 from the 5’ end of the sense strand or the first nucléotide sequence is a 2’-fluoro nucléotide mimic.

228. The siNA according to any one of embodiments 216-227, wherein the nucléotide at position 5 from the 5’ end of the sense strand or the first nucléotide sequence is a 2’-fluoro nucléotide mimic.

229. The siNA according to any one of embodiments 216-228, wherein the nucléotide at position 7 from the 5’ end of the sense strand or the first nucléotide sequence is a 2’-fluoro nucléotide mimic.

230. The siNA according to any one of embodiments 216-229, wherein the nucléotide at position 8 from the 5’ end of the sense strand or the first nucléotide sequence is a 2’-fluoro nucléotide mimic.

295

231. The siNA according to any one of embodiments 216-230, wherein the nucléotide at position 9 from the 5’ end of the sense strand or the first nucléotide sequence is a 2’-fluoro nucléotide mimic.

232. The siNA according to any one of embodiments 216-231, wherein the nucléotide at position 10 from the 5’ end of the sense strand or the first nucléotide sequence is a 2’-fluoro nucléotide mimic.

233. The siNA according to any one of embodiments 216-232, wherein the nucléotide at position 11 from the 5’ end of the sense strand or the first nucléotide sequence is a 2’-fluoro nucléotide mimic.

234. The siNA according to any one of embodiments 216-233, wherein the nucléotide at position 12 from the 5’ end of the sense strand or the first nucléotide sequence is a 2’-fluoro nucléotide mimic. '

235. The siNA according to any one of embodiments 216-234, wherein the nucléotide at position 14 from the 5’ end of the sense strand or the first nucléotide sequence is a 2’-fluoro nucléotide mimic.

236. The siNA according to any one of embodiments 216-235, wherein the nucléotide at position 17 from the 5’ end of the sense strand or the first nucléotide sequence is a 2’-fluoro nucléotide mimic.

237. The siNA according to any one of embodiments 216-236, wherein at least 1, 2, 3, 4, 5, 6,

or more 2’-fluoro nucléotide mimics is a f4P nucléotide (

238. The siNA according to any one of embodiments 216-237, wherein less than or equal to

10, 9, 8, 7, 6, 5, 4, 3, or 2 2’-fluoro nucléotide mimics is a f4P nucléotide (

296

239. The siNA according to any one of embodiments 216-238, wherein 1, 2, 3, 4, 5, 6, or more

2’-fluoro nucléotide mimics is a f2P nucléotide (

240. The siNA according to any one of embodiments 216-239, wherein less than or equal to

10, 9, 8, 7, 6, 5, 4, 3, or 2 2’-fluoro nucléotide mimics is a f2P nucléotide ( ).

241. The siNA according to any one of embodiments 216-240, wherein 1, 2, 3,. 4, 5, 6, or more nh₂

2’-fluoro nucléotide mimics is a fX nucléotide ( ).

242. The siNA according to any one of embodiments 216-241, wherein less than or equal to

o' F

10, 9, 8, 7, 6, 5, 4, 3, or 2 2’-fluoro nucléotide mimics is a fX nucléotide ( ).

243. The siNA according to any preceding embodiment, wherein the first nucléotide from the 10 5’ end of the sense strand or first nucléotide sequence is a d2vd3 nucléotide (

297

244. The siNA according to any preceding embodiment, wherein the first nucléotide from the

3’ end of the sense strand or first nucléotide sequence is a d2vd3 nucléotide (

245. The siNA according to any preceding embodiment, wherein the first nucléotide from the

5’ end of the antisense strand or second nucléotide sequence is a d2vd3 nucléotide (

246. The siNA according to any preceding embodiment, wherein the first nucléotide from the ’ end of the antisense strand or second nucléotide sequence is a d2vd3 nucléotide (

io 247. A composition comprising the siNA according to any one of embodiments 1-246.

248. A composition comprising 2, 3, 4, 5, 6, 7, 8, 9, 10 or more siNAs according to any one of embodiments 1-246.

249. The composition of embodiment 248, wherein at least 1, 2, 3, 4, 5, or more siNAs target an S gene of HBV.

250. The composition of embodiment 248 or 249, wherein at least 1, 2, 3, 4, 5, or more siNAs target an X gene of HBV.

251. The composition according to any one of embodiments 247-250, further comprising an additional HBV treatment agent.

298

252. The composition of embodiment 251, wherein the additional HBV treatment agent is selected from a nucléotide analog, nucleoside analog, a capsid assembly modulator (CAM), a recombinant interferon, an entry inhibitor, a small molécule immunomodulator and oligonucleotide therapy.

253. The composition of embodiment 252, wherein the oligonucleotide therapy is an additional siNA.

254. The composition of embodiment 253, wherein the additional siNA is selected from any of ds-siNA-001 to ds-siNA-0178.

255. The composition of embodiment 252, wherein the oligonucleotide therapy is an antisense oligonucleotide (ASO), NAPs, or STOPS™

256. The composition of embodiment 255, wherein the ASO is ASO 1 or ASO 2.

257. The composition of embodiment 251 or 252, wherein the additional HBV treatment agent is selected from HBV STOPS™ ALG-010133, HBV CAM ALG-000184, ASO 1, recombinant interferon alpha 2b, IFN-a, PEG-IFN-a-2a, lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide, tenofovir disoproxil, NVR3-778, BAY41-4109, JNJ-632, JNJ-3989 (ARO-HBV), RG6004, GSK3228836, REP-2139, REP-2165, AB-729, VIR2218, RG6346 (DCR-HBVS), JNJ-6379, GLS4, ABI-HO731, JNJ-440, NZ-4, RG7907, EDP514, AB-423, AB-506, ABI-H03733 and ABI-H2158.

258. A method of treating a disease in a subject in need thereof, comprising administering to the subject the siNA according to any one of embodiments 1-246.

259. A method of treating a disease in a subject in need thereof, comprising administering to the subject the composition according to any one of embodiments 247-257.

260. The method of embodiment 258 or 259, wherein the disease is a viral disease.

261. The method of embodiment 260, wherein the viral disease is caused by a DNA virus.

262. The method of embodiment 261, wherein the DNA virus is a double stranded DNA (dsDNA) virus.

263. The method of embodiment 262, wherein the dsDNA virus is a hepadnavirus.

299

264. The method of embodiment 263, wherein the hepadnavirus is a hepatitis B virus (HBV).

265. The method of embodiment 264, wherein the HBV is selected from HBV génotypes A-J.

266. The method of any of embodiments 258-265, further comprising administering an additional HBV treatment agent.

267. The method of embodiment 266, wherein the siNA or the composition and the additional HBV treatment agent are administered concurrently.

268. The method of embodiment 266, wherein the siNA or the composition and the additional HBV treatment agent are administered sequentially.

269. The method of embodiment 266, wherein the siNA or the composition is administered prior to administering the additional HBV treatment agent.

270. The method of embodiment 266, wherein the siNA or the composition is administered after administering the additional HBV treatment agent.

271. The method of any one of embodiments 266-270, wherein the additional HBV treatment agent is selected from a nucléotide analog, nucleoside analog, a capsid assembly modulator (CAM), a recombinant interferon, an entry inhibitor, a small molécule immunomodulator and oligonucleotide therapy.

272. The method of embodiment 271, wherein the oligonucleotide therapy is an additional siNA.

273. The method of embodiment 272, wherein the additional siNA is selected from any of dssiNA-001 to ds-siNA-0178.

274. The method of embodiment 271, wherein the oligonucleotide therapy is an antisense oligonucleotide (ASO), NAPs, or STOPs.

275. The method of embodiment 274, wherein the ASO is ASO 1 or ASO 2.

276. The method of embodiment 270 or 271, wherein the additional HBV treatment agent is selected from HBV STOPS™ ALG-010133, HBV CAM ALG-000184, ASO 1, recombinant interferon alpha 2b, IFN-a, PEG-IFN-a-2a, lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide, tenofovir disoproxil, NVR3-778, BAY41-4109,

300

JNJ-632, JNJ-3989 (ARO-HBV), RG6004, GSK3228836, REP-2139, REP-2165, AB-729, VIR2218, RG6346 (DCR-HBVS), JNJ-6379, GLS4, ABI-HO731, JNJ-440, NZ-4, RG7907, EDP514, AB-423, AB-506, ABI-H03733 and ABI-H2158.

277. The method of embodiment 258 or 259, wherein the disease is a liver disease.

278. The method of embodiment 277, wherein the liver disease is a nonalcoholic fatty liver disease (NAFLD) or hepatocellular carcinoma (HCC).

279. The method of embodiment 278, wherein the NAFLD is nonalcoholic steatohepatitis (NASH).

280. The method of any of embodiments 277-279 further comprising administering to the subject a liver disease treatment agent.

281. The method of embodiment 280, wherein the liver disease treatment agent is selected from a peroxisome proliferator-activator receptor (PPAR) agonist, famesoid X receptor (FXR) agonist, lipid-altering agent, and incretin-based therapy.

282. The method of embodiment 281, wherein the PPAR agonist is selected from a PPARa agonist, dual PPARa/δ agonist, PPARy agonist, and dual PPARa/γ agonist.

283. The method of embodiment 282, wherein the dual PPARa agonist is a fibrate.

284. The method of embodiment 282, wherein the PPARa/δ agonist is elafibranor.

285. The method of embodiment 282, wherein the PPARy agonist is a thiazolidinedione (TZD).

286. The method of embodiment 282, wherein TZD is pioglitazone.

287. The method of embodiment 282, wherein the dual PPARa/γ agonist is saroglitazar.

288. The method of embodiment 281, wherein the FXR agonist is obeticholic acis (OCA).

289. The method of embodiment 281, wherein the lipid-altering agent is aramchol.

290. The method of embodiment 281, wherein the incretin-based therapy is a glucagon-like peptide 1 (GLP-1) receptor agonist or dipeptidyl peptidase 4 (DPP-4) inhibitor.

301

291. The method of embodiment 290, wherein the GLP-1 receptor agonist is exenatide or liraglutide.

292. The method of embodiment 290, wherein the DPP-4 inhibitor is sitagliptin or vildapliptin.

293. The method of any one of embodiments 280-292, wherein the siNA or composition and the liver disease treatment agent are administered concurrently.

294. The method of any one of embodiments 280-292, wherein the siNA or composition and the liver disease treatment agent are administered sequentially.

295. The method of any one of embodiments 280-292, wherein the siNA or composition is administered prior to administering the liver disease treatment agent.

296. The method of any one of embodiments 280-292, wherein the siNA or composition is administered after administering the liver disease treatment agent.

297. The method of any of one embodiments 258-296, wherein the siNA or the composition is administered at a dose of at least 1 mg/kg, 2 mg/kg, 3 mg/kg, 4 mg/kg, 5 mg/kg, 6 mg/kg, 7 mg/kg, 8 mg/kg, 9 mg/kg, 10 mg/kg, 11 mg/kg, 12 mg/kg, 13 mg/kg 14 mg/kg, or 15 mg/kg.

298. The method of any of one embodiments 258-296, wherein the siNA or the composition is administered at a dose of between 0.5 mg/kg to 50 mg/kg, 0.5 mg/kg to 40 mg/kg 0.5 mg/kg to 30 mg/kg, 1 mg/kg to 50 mg/kg, 1 mg/kg to 40 mg/kg, 1 mg/kg to 30 mg/kg, 1 mg/kg to 20 mg/kg, 3 mg/kg to 50 mg/kg, 3 mg/kg to 40 mg/kg, 3 mg/kg to 30 mg/kg, 3 mg/kg to 20 mg/kg, 3 mg/kg to 15 mg/kg, 3 mg/kg to 10 mg/kg, 4 mg/kg to 50 mg/kg, 4 mg/kg to 40 mg/kg, 4 mg/kg to 30 mg/kg, 4 mg/kg to 20 mg/kg, 4 mg/kg to 15 mg/kg, 4 mg/kg to 10 mg/kg, 5 mg/kg to 50 mg/kg, 5 mg/kg to 40 mg/kg, 5 mg/kg to 30 mg/kg, 5 mg/kg to 20 mg/kg, 5 mg/kg to 15 mg/kg, or 5 mg/kg to 10 mg/kg.

299. The method of any of one embodiments 258-298, wherein the siNA or the composition is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times.

300. The method of any of one embodiments 258-298, wherein the siNA or the composition is administered at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times a day, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times a week, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times a month.

302

301. The method of any of one embodiments 258-300, wherein the siNA or the composition are administered at least once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days.

302. The method of any of one embodiments 258-301, wherein the siNA or the composition is administered for aperiod of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days, or at least 1,2, 3,4, 5, 6,7, 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,20, 21,22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, .50, 51, 52, 53, 54, or 55 weeks.

303. The method of any of one embodiments 258-302, wherein the siNA or the composition is administered at a single dose of 5 mg/kg.

304. The method of any of one embodiments 258-302, wherein the siNA or the composition is administered at a single dose of 10 mg/kg.

305. The method of any of one embodiments 258-302, wherein the siNA or the composition is administered at three doses of 10 mg/kg once a week.

306. The method of any of one embodiments 258-302, wherein the siNA or the composition is administered at three doses of 10 mg/kg once every three days.

307. The method of any of one embodiments 258-302, wherein the siNA or the composition is administered at fïve doses of 10 mg/kg once every three days.

308. The method of any of one embodiments 258-302, wherein the siNA or the composition is administered at six doses of ranging from 1 mg/kg to 15 mg/kg, 1 mg/kg to 10 mg/kg, 2 mg/kg to 15 mg/kg, 2 mg/kg to 10 mg/kg, 3 mg/kg to 15 mg/kg, or 3 mg/kg to 10 mg/kg.

309. The method of embodiment 308, wherein the first dose and second dose are administered at least 3 days apart.

310. The method of embodiment 308 or 309, wherein the second dose and third dose are administered at least 4 days apart.

311. The method of any one of embodiments 308-310, wherein the third dose and fourth dose, fourth dose and fifth dose, or fifth dose and sixth dose are administered at least 7 days apart.

312. The method of any one of embodiments 258-311, wherein the siNA or the composition are administered in a particle or viral vector.

303

313. The method of embodiment 312, wherein the viral vector is a vector of adenovirus, adenoassociated virus (AAV), alphavirus, flavivirus, herpes simplex virus, lentivirus, measles virus, picomavirus, poxvirus, rétro virus, or rhabdo virus.

314. The method of embodiment 312, wherein the viral vector is a recombinant viral vector.

315. The method according to any one of embodiments 312-314, wherein the viral vector is selected from AAVrh.74, AAVrh.10, AAVrh.20, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12 and AAV-13.

316. The method according to any one of embodiments 258-315, wherein the siNA or the composition is administered systemically.

317. The method according to any one of embodiments 258-315, wherein the siNA or the composition is administered locally.

318. The method according to any one of embodiments 258-317, wherein the siNA or the composition is administered intravenously, subcutaneously, or intramuscularly.

319. Use of the siNA according to any one of embodiments 1-246 or the composition according to any one of embodiments 247-257 in the manufacture of a médicament for treating a disease.

320. The use of embodiment 319, wherein the disease fs a viral disease.

321. The use of embodiment 320, wherein the viral disease is caused by a DNA virus.

322. The use of embodiment 321, wherein the DNA virus is a double stranded DNA (dsDNA virus).

323. The use of embodiment 321, wherein the dsDNA virus is a hepadnavirus.

324. The use of embodiment 323, wherein the hepadnavirus is a hepatitis B virus (HBV).

325. The use of embodiment 324, wherein the HBV is selected from HBV génotypes A-J.

326. The use of any of one of embodiments 319-325, further comprising an additional HBV treatment agent in the manufacture of the médicament.

304

327. The use of embodiment 326, wherein the additional HBV treatment agent is selected from a nucléotide analog, nucleoside analog, a capsid assembly modulator (CAM), a recombinant interferon, an entry inhibitor, a small molécule immunomodulator and oligonucleotide therapy.

328. The use of embodiment 327, wherein the oligonucleotide therapy is an additional siNA.

329. The use of embodiment 328, wherein the additional siNA is selected from any of ds- siNA-001 to ds-siNA-0178.

330. The use of embodiment 327, wherein the oligonucleotide therapy is an antisense oligonucleotide (ASO), NAPs, or STOPs.

331. The use of embodiment 330, wherein the ASO is ASO 1 or ASO2.

332. The use of embodiment 326 or 327, wherein the additional HBV treatment agent is selected from HBV STOPS™ ALG-010133, HBV CAM ALG-000184, ASO 1, recombinant interferon alpha 2b, IFN-a, PEG-IFN-a-2a, lamivudine, telbivudine, adefovir dipivoxil, clevudine, entecavir, tenofovir alafenamide, tenofovir disoproxil, NVR3-778, BAY41-4109, JNJ-632, JNJ-3989 (ARO-HBV), RG6004, GSK3228836, REP-2139, REP-2165, AB-729, VIR2218, RG6346 (DCR-HBVS), JNJ-6379, GLS4, ABI-HO731, JNJ-440, NZ-4, RG7907, EDP514, AB-423, AB-506, ABI-H03733 and ABI-H2158.

333. The use of embodiment 319, wherein the disease is a liver disease.

334. The use of embodiment 333, wherein the liver disease is a nonalcoholic fatty liver disease (NAFLD) or hepatocellular carcinoma (HCC).

335. The use of embodiment 334, wherein the NAFLD is nonalcoholic steatohepatitis (NASH).

336. The use of any of embodiments 333-335, further comprising a liver disease treatment agent in the manufacture of the médicament.

337. The use of embodiment 336, wherein the liver disease treatment agent is selected from a peroxisome proliferator-activator receptor (PPAR) agonist, famesoid X receptor (FXR) agonist, lipid-altering agent, and incretin-based therapy.

305

338. The use of embodiment 337, wherein the PPAR agonist is selected from a PPARa agonist, dual PPARa/δ agonist, PPARy agonist, and dual PPARa/γ agonist.

339. The use of embodiment 338, wherein the dual PPARa agonist is a fibrate.

340. The use of embodiment 338, wherein the PPARa/δ agonist is elafïbranor.

341. The use of embodiment 338, wherein the PPARy agonist is a thiazolidinedione (TZD).

342. The use of embodiment 341, wherein TZD is pioglitazone.

343. The use of embodiment 338, wherein the dual PPARa/γ agonist is saroglitazar.

344. The use of embodiment 337, wherein the FXR agonist is obeticholic acis (OCA).

345. The use of embodiment 337, wherein the lipid-altering agent is aramchol.

346. The use of embodiment 337, wherein the incretin-based therapy is a glucagon-like peptide 1 (GLP-1) receptor agonist or dipeptidyl peptidase 4 (DPP-4) inhibitor.

347. The use of embodiment 346, wherein the GLP-1 receptor agonist is exenatide or liraglutide.

348. The use of embodiment 346, wherein the DPP-4 inhibitor is sitagliptin or vildapliptin.

349. The siNA according to any one of embodiments 1-246 for use as a médicament.

350. The composition according to any one of embodiments 247-257 for use as a médicament.

351. The siNA according to any one of embodiments 1 -246 for use in the treatment of a disease.

352. The siNA of embodiment 351, wherein the disease is a viral disease.

353. The siNA of embodiment 352, wherein the viral disease is caused by a DNA virus.

354. The siNA of embodiment 353, wherein the DNA virus is a double stranded DNA (dsDNA virus).

355. The siNA of embodiment 354, wherein the dsDNA virus is a hepadnavirus.

356. The siNA of embodiment 355, wherein the hepadnavirus is a hepatitis B virus (HBV).

306

357. The siNA of embodiment 356, wherein the HBV is selected from HBV génotypes A-J.

358. The siNA of embodiment 351, wherein the disease is a liver disease.

359. The siNA of embodiment 358, wherein the liver disease is a nonalcoholic fatty liver disease (NAFLD) or hepatocellular carcinoma (HCC).

360. The siNA of embodiment 359, wherein the NAFLD is nonalcoholic steatohepatitis (NASH).

361. The composition according to any one of embodiments 247-257, for use in the treatment of a disease.

362. The composition of embodiment 361, wherein the disease is a viral disease.

363. The composition of embodiment 362, wherein the viral disease is caused by a DNA virus.

364. The composition of embodiment 363, wherein the DNA virus is a double stranded DNA (dsDNA virus).

365. The composition of embodiment 364, wherein the dsDNA virus is a hepadnavirus.

366. The composition of embodiment 365, wherein the hepadnavirus is a hepatitis B virus (HBV).

367. The composition of embodiment 366, wherein the disease is a liver disease.

368. The composition of embodiment 367, wherein the liver disease is a nonalcoholic fatty liver disease (NAFLD) or hepatocellular carcinoma (HCC).

369. The composition of embodiment 368, wherein the NAFLD is nonalcoholic steatohepatitis (NASH).

Tables

Table 1. Non-modifïed Nucléotide Sequences
SEQ ID NO.	First Nucléotide Sequence (5’-3’)	SEQ ID NO.	Second Nucléotide Sequence(5’-3’
1	ACCGUGUGCACUUCGCUUC	57	GAAGCGAAGUGCACACGGUCC
2	ACCGUGUGCACUUCGCUUC	58	GAAGCGAAGUGCACACGGU

307

Table 1. Non-modifïed Nucléotide Sequences
SEQ ID NO.	First Nucléotide Sequence (5’-3’)	SEQ ID NO.	Second Nucléotide Sequence(5’-3’
3	ACUUCGCUUCACCUCUGCA	59	UGCAGAGGUGAAGCGAAGUGC
4	AGUGUUUGCUGACGCAACC	60	.GGUUGCGUCAGCAAACACUUG
5	CAGGCGGGGUUUUUCUUGU	61	ACAAGAAAAACCCCGCCUGUA
6	CAGGCGGGGUUUUUCUUGU	62	ACAAGAAAAAACCCCGCCUG
7	CAGUUUACUAGUGCCAUUU	63	AAAUGGCACUAGUAAACUGAG
8	CAGUUUACUAGUGCCAUUU	64	AAAUGGCACUAGUAAACUG
9	CAUCCUGCUGCUAUGCCUC	65	GAGGCAUAGCAGCAGGAUGAA
10	CAUCCUGCUGCUAUGCCUCAU	66	AUGAGGCAUAGCAGCAGGAUGAA
11	CAUCCUGCUGCUAUGCCUC	67	GAGGCAUAGCAGCAGGAUG
12	CCGUGUGCACUUCGCUUCA	68	UGAAGCGAAGUGCACACGGUC
13	CCGUGUGCACUUCGCUUCA	69	UGAAGCGAAGUGCACACGG
14	CCUGCUGCUAUGCCUCAUCUU	70	AAGAUGAGGCAUAGCAGCAGGAU
15	CUCAGUUUACUAGUGCCAU	71	AUGGCACUAGUAAACUGAGCC
16	CUCAGUUUACUAGUGCCAU	71	AUGGCACUAGUAAACUGAGCC
17	CUCAGUUUACUAGUGCCAU	71	AUGGCACUAGUAAACUGAGCC
18	CUCAGUUUACUAGUGCCAU	72	AUGGCACUAGUAAACUGAG
19	CUCAGUUUACUAGUGCCAU	72	AUGGCACUAGUAAACUGAG
20	CUGCUAUGCCUCAUCUUCU	73	AGAAGAUGAGGCAUAGCAGCA
21	CUGCUAUGCCUCAUCUUCU	73	AGAAGAUGAGGCAUAGCAGCA
22	CUGCUAUGCCUCAUCUUCU	74	AGAAGAUGAGGCAUAGCAG
23	CUGCUAUGCCUCAUCUUCU	74	AGAAGAUGAGGCAUAGCAG
24	CUGCUGCUAUGCCUCAUCU	75	AGAUGAGGCAUAGCAGCAGGA
25	CUGCUGCUAUGCCUCAUCU	76	AGAUGAGGCAUAGCAGCAG
26	CUGCUGCUAUGCCUCAUCU	76	AGAUGAGGCAUAGCAGCAG
27	CUUCGCUUCACCUCUGCACGU	77	ACGUGCAGAGGUGAAGCGAAGUG
28	GCACUUCGCUUCACCUCUGCA	78	UGCAGAGGUGAAGCGAAGUGCAC
29	GCCGAUCCAUACUGCGGAA	79	UUCCGCAGUAUGGAUCGGCAG
30	GCCGGGUUUUUCUUGUUGA	80	UUCCGCAGUAUGGAUCGGC
31	GCGGGGUUUUUCUUGUUGA	81	UCAACAAGAAAAACCCCGCCU
32	GCGGGGUUUUUCUUGUUGA	81	UCAACAAGAAAAACCCCGCCU
33	GCGGGGUUUUUCUUGUUGA	82	UCAACAAGAAAAACCCCGC
34	GCGGGGUUUUUCUUGUUGA	82	UCAACAAGAAAAACCCCGC
35	GCUGCUAUGCCUCAUCUUCUU	83	AAGAAGAUGAGGCAUAGCAGCAG
36	GGAUGUGUCUGCGGCGUUUUA	84	UAAAACGCCGCAGACACAUCCAG
37	GGCCAAAAUUCGCAGUCCC	85	GGGACUGCGAAUUUUGGCCAA
38	GGCGCACCUCUCUUUACGC	86	GCGUAAAGAGAGGUGCGCCCC
39	GUAUGUUGCCCGUUUGUCC	87	GGACAAACGGGCAACAUACCU
40	GUGGUGGACUUCUCUCAAU	88	AUUGAGAGAAGUCCACCACGA
41	GUGUGCACUUCGCUUCACC	89	GGUGAAGCGAAGUGCACACGG

308

Table 1. Non-modified Nucléotide Sequences
SEQ ID NO.	First Nucléotide Sequence (5’-3’)	SEQ ID NO.	Second Nucléotide Sequence(5’-3’
42	GUUGCCCGUUUGUCCUCUA	90	UAGAGGACAAACGGGCAACAU
43	GUUGCCCGUUUGUCCUCUA	91	UAGAGGACAAACGGGCAAC
44	UCCAUACUGCGGAACUCCU	92	AGGAGUUCCGCAGUAUGGAUC
45	UCCAUACUGCGGAACUCCU	93	AGGAGUUCCGCAGUAUGGA
46	UCGUGGUGGACUUCUCUCAAU	94	AUUGAGAGAAGUCCACCACGAGU
47	UGCACUUCGCUUCACCUCU	95	AGAGGUGAAGCGAAGUGCACA
48	UGCCGAUCCAUACUGCGGA	96	UCCGCAGUAUGGAUCGGCAGA
49	UGCCGAUCCAUACUGCGGA	97	UCCGCAGUAUGGAUCGGCA
50	UGCUAUGCCUCAUCUUCUU	98	AAGAAGAUGAGGCAUAGCAGC
51	UGUGCACUUCGCUUCACCU	99	AGGUGAAGCGAAGUGCACACG
52	UGUGCACUUCGCUUCACCU	99	AGGUGAAGCGAAGUGCACACG
53	UGUGCACUUCGCUUCACCU	100	AGGUGAAGCGAAGUGCACA
54	UGUGCACUUCGCUUCACCU	100	AGGUGAAGCGAAGUGCACA
55	UUGCCCGUUUGUCCUCUAA	101	UUAGAGGACAAACGGGCAACA
56	UUGCCCGUUUGUCCUCUAA	102	UUAGAGGACAAACGGGCAA

Table 2. 2’-OMe and 2’-F Modified Nucléotide Sequences
SEQ ID NO.	First Nucléotide Sequence (5’3’)	SEQID NO.	Second Nucléotide Sequence(5’3’)
103	mAmCfCmGmUmGfUfGfCmA mCfUmUmCmGmCfUmUmC	159	mGfAmAmGmCmGmAmAmGm UmGmCmAfCmAmCmGmGmUm CmC
104	mAmCfCmGmUmGfUfGfCmA mCfUmUmCmGmCfUmUmC	160	mGfAmAmGmCmGmAmAmGm UmGmCmAfCmAmCmGmGmU
105	mAmCfUmUmCmGfCfUfUmC mAfCmCmUmCmUfGmCmA	161	mU fGmCm AmGm AmGmGmUm GmAmAmGfCmGmAmAmGmU mGmC
106	mAmGfUmGmUmUfUfGfCmU mGfAmCmGmCmAfAmCmC	162	mGfGmUmUmGmCmGmUmCmA mGmCmAfAmAmCmAmCmUmU mG
107	mCmAfGmGmCmGfGfGfGmU mU fUmUmUmCmU fU mGmU	163	mAfCmAmAmGmAmAmAmAm AmCmCmCfCmGmCmCmUmGm UmA
108	mCmAfGmGmCmGfGfGfGmU mUfUmUmUmCmU fU mGmU	164	mAfCmAmAmGmAmAmAmAm AmAmCmCmCfCmGmCmCmUm G
109	mCmAfGmUmUmUfAfCfUmA mGfUmGmCmCmAfUmUmU	165	mAfAmAmUmGmGmCmAmCmU mAmGmUfAmAmAmCmUmGm AmG

309

Table 2. 2’-OMe and 2*-F Modified Nucléotide Sequences
SEQ ID NO.	First Nucléotide Sequence (5’3’)	SEQ ID NO.	Second Nucléotide Sequence(5’3’)
110	mCm AfGmUmUmU fAfCfUm A mGfUmGmCmCmAfUmUmU	166	mAfAmAmUmGmGmCmAmCmU m AmGmU fAmAm AmCmUmG
111	mCmAfUmCmCmUfGfCfUmG mCfUmAmUmGmCfCmUmC	167	mGfAmGmGmCmAmUmAmGmC mAmGmCfAmGmGmAmUmGm AmA
112	mCm AmUmCmCm U fGmCfU fG fCmUmAmUmGmCmCmUmCm AmU	168	mAfUmGmAmGfGmCmAmUmA mGmCmAfGmCfAmGmGmAmU mGmAmA
113	mCmAfUmCmCmUfGfCfUmG mCfUmAmUmGmCfCmUmC	169	mGfAmGmGmCmAmUmAmGmC mAmGmCfAmGmGmAmUmG
114	mCmCfGmUmGmUfGfCfAmC mUfUmCmGmCmUfUmCmA	170	mU fGm AmAmGmCmGmAm Am GmUmGmCfAmCmAmCmGmGm UmC
115	mCmCfGmUmGmUfGfCfAmC mUfUmCmGmCmU fUmCm A	171	mUfGm AmAmGmCmGmAmAm GmUmGmCfAmCmAmCmGmG
116	mCmCmUmGmCmUfGmCfUfA fUmGmCmCmUmCmAmUmCm UmU	172	m AfAmGm AmU fGm AmGmGmC mAmUmAfGmCfAmGmCmAmG mGmAmU
117	mCmU fCmAmGmU fU fU fAmC mU fAmGmUmGmCfCm AmU	173	mAfUmGmGmCmAmCmUmAmG mUmAmAfAmCmUmGmAmGmC mC
118	mCmUmCmAmGmUfUmUmAm CmUmAmGmUmGmCmCmAm U	173	mAfU mGmGmCm AmCmUm AmG mUmAmAfAmCmUmGmAmGmC mC
119	mCmU fCmAmGmU fU fUmAmC mUmAmGmUmGmCfCmAmU	173	mAfUmGmGmCmAmCmUmAmG mUmAmAfAmCmUmGmAmGmC mC
120	mCmUfCmAmGmUfUfUfAmC mU fAmGmUmGmCfCmAmU	174	mAfUmGmGmCmAmCmUmAmG mUmAmAfAmCmUmGmAmG
121	mCmU fCmAmGmU fU fU m AmC mUmAmGmUmGmCfCmAmU	174	mAfUmGmGmCmAmCmUmAmG mUmAmAfAmCmUmGmAmG
122	mCmUfGmCmUmAfUfGfCmC mU fCm AmUmCmU fUmCmU	175·	mAfGm Am AmGm AmU mGm Am GmGmCmAfUmAmGmCmAmGm CmA
123	mCmUfGmCmUmAfUfGmCmC mUmCmAmUmCmUfUmCmU	175	mAfGmAmAmGmAmUmGmAm GmGmCm AfU m AmGmCmAmGm CmA
124	mCmUfGmCmUmAfUfGfCmC mUfCmAmUmCmUfUmCmU	176	mAfGmAmAmGmAmUmGmAm GmGmCmAfUmAmGmCmAmG
125	mCmUfGmCmUmAfUfGmCmC mUmCm AmUmCmU fUmCmU	176	mAfGmAmAmGmAmUmGmAm GmGmCmAfUmAmGmCmAmG

310

Table 2. 2’-OMe and 2’-F Modified Nucléotide Sequences
SEQ ID NO.	First Nucléotide Sequence (5’3’)	SEQ ID NO.	Second Nucléotide Sequence(5’3’)
126	mCmUfGmCmUmGfCfUfAmU mGfCmCmUmCmAfUmCmU	177	mAfGmAmUmGmAmGmGmCm AmUmAmGfCmAmGmCmAmGm GmA
127	mCmUfGmCmUmGfCfUfAmU mGfCmCmUmCmAfUmCmU	178	mAfGmAmUmGmAmGmGmCm AmUmAmGfCmAmGmCmAmG
128	mCmUfGmCmUmGfCfUmAmU mGmCmCmUmCmAfUmCmU	178	mAfGmAmUmGmAmGmGmCm AmUmAmGfCmAmGmCmAmG
129	mCmUmUmCmGmCfUmUfCfA fCmCmUmCmUmGmCmAmCm GmU	179	mAfCmGmUmGfCmAmGmAmG mGmUmGfAmAfGmCmGmAmA mGmUmG
130	mGmCmAmCmUmUfCmGfCfU fUmCmAmCmCmUmCmUmGm CmA	180	mU fGmCm AmGfAmGmGmUmG mAmAmGfCmGfAmAmGmUmG mCmAmC
131	mGmCfCmGmAmUfCfCfAmU mAfCmUmGmCmGfGmAmA	181	mUfUmCmCmGmCmAmGmUmA mUmGmGfAmUmCmGmGmCmA mG
132	mGmCfCmGmGmGfUfUfUmU mUfCmUmUmGmUfUmGmA	182	mUfUmCmCmGmCmAmGmUmA mUmGmGfAmUmCmGmGmC
133	mGmCfGmGmGmGfUfUfUmU mUfCmUmUmGmUfUmGmA	183	mU fCm Am AmCmAm AmGmAm A mAmAmAfCmCmCmCmGmCmC mU
134	mGmCfGmGmGmGfUfUmUmU mUmCmUmUmGmUfUmGmA	183	mU fCm Am AmCm AmAmGm AmA mAmAmAfCmCmCmCmGmCmC mU
135	mGmCfGmGmGmGfUfUfUmU mUfCmUmUmGmUfUmGmA	184	mU fCm Am AmCmAm AmGmAm A mAmAmAfCmCmCmCmGmC
136	mGmCfGmGmGmGfUfUmUmU mUmCmUmUmGmU fU mGm A	184	mUfCmAmAmCmAm AmGmAm A mAmAmAfCmCmCmCmGmC
137	mGmCmUmGmCmUfAmUfGfC fCmUmCmAmUmCmUmUmCm UmU	185	mAfAmGmAmAfGmAmUmGmA mGmGmCfAmUfAmGmCmAmG mCmAmG
138	mGmGmAmUmGmUfGmUfCfU fGmCmGmGmCmGmUmUmUm UmA	186	mU fAmAm Am AfCmGmCmCmG mCmAmGfAmCfAmCmAmUmC mCmAmG .
139	mGmGfCmCmAmAfAfAfUmU mCfGmCmAmGmUfCmCmC	187	mGfGmGmAmCmUmGmCmGmA mAmUmUfUmUmGmGmCmCm A mA
140	mGmGfCmGmCmAfCfCfUmCm UfCmUmUmUmAfCmGmC	188	mGfCmGmUmAmAmAmGmAm GmAmGmGfUmGmCmGmCmCm CmC

311

Table 2. 2’-OMe and 2’-F Modified Nucléotide Sequences
SEQ IDNO.	First Nucléotide Sequence (5’3’)	SEQ ID NO.	Second Nucléotide Sequence(5’3’)
141	mGmUfAmUmGmUfUfGfCmC mCfGmUmUmUmGfUmCmC	189	mGfGmAmCmAmAmAmCmGmG mGmCmAfAmCmAmUmAmCmC mU
142	mGmUfGmGmUmGfGfAfCmU mUfCmUmCmUmCfAmAmU	190	mAfUmUmGmAmGmAmGmAm AmGmUmCfCmAmCmCmAmCm GmA
143	mGmUfGmUmGmCfAfCfUmU mCfGmCmUmUmCfAmCmC	191	mGfGmUmGmAmAmGmCmGm AmAmGmU fGmCm AmCmAmCm GmG
144	mGmUfUmGmCmCfCfGfUmU mUfGmUmCmCmUfCmUmA	192	mU fAmGm AmGmGm AmCmAm AmAmCmGfGmGmCmAmAmCm AmU
145	mGmUfUmGmCmCfCfGfUmU mUfGmUmCmCmUfCmUmA	193	mU fAmGm AmGmGm AmCmAm AmAmCmGfGmGmCmAmAmC
146	mUmCfCmAmUmAfCfUfGmC mGfGm Am AmCmU fCmCmU	194	mAfGmGmAmGmUmUmCmCmG mCmAmGfUmAmUmGmGmAm UmC
147	mUmCfCmAmUmAfCfUfGmC mGfGm Am AmCmU fCmCmU	195	mAfGmGmAmGmUmUmCmCmG mCmAmGfUmAmUmGmGmA
148	mUmCmGmUmGmGfUmGfGfA fCmUmUmCmUmCmUmCmAm AmU	196	mAfUmUmGmAfGmAmGmAmA mGmUmCfCmAfCmCmAmCmG mAmGmU
149	mUmGfCmAmCmUfUfCfGmC mUfUmCmAmCmCfUmCmU	197	mAfGmAmGmGmUmGmAmAm GmCmGmAfAmGmUmGmCmAm CmA
150	mUmGfCmCmGmAfUfCfCmA mU fAmCmUmGmCfGmGm A	198	mUfCmCmGmCmAmGmUmAmU mGmGmAfUmCmGmGmCmAmG mA
151	mUmGfCmCmGmAfU fCfCm A mU fAmCmUmGmCfGmGm A	199	mUfCmCmGmCmAmGmUmAmU mGmGmAfUmCmGmGmCmA
152	mUmGfCmUmAmUfGfCfCmU mCfAmUmCmUmUfCmUmU	200	mAfAmGmAmAmGmAmUmGm AmGmGmCfAmUmAmGmCmAm GmC
153	mUmGfUmGmCmAfCfUfUmC mGfCmUmUmCmAfCmCmU	201	mAfGmGmUmGmAmAmGmCm GmAm AmGfU mGmCm AmCmAm CmG
154	mUmGfUmGmCmAfCfUmUmC mGmCmUmUmCm AfCmCmU	201	mAfGmGmUmGmAmAmGmCm GmAmAmGfUmGmCmAmCmAm CmG
155	mUmGfUmGmCmAfCfU fUmC mGfCmUmUmCmAfCmCmU	202	mAfGmGmUmGmAmAmGmCm GmAmAmGfUmGmCmAmCmA

312

Table 2. 2’-OMe and 2’-F Modified Nucléotide Sequences
SEQ IDNO.	First Nucléotide Sequence (5’3’)	SEQ ID NO.	Second Nucléotide Sequence(5’3’)
156	mUmGfUmGmCmAfCfUmUmC mGmCmUmUmCmAfCmCmU	202	mAfGmGmUmGmAmAmGmCm GmAmAmGfUmGmCmAmCmA
157	mUmUfGmCmCmCfGfUmUmU mGmUmCmCmUmCfUmAmA	203	mU fUmAmGm AmGmGm AmCm AmAmAmCfGmGmGmCmAmAm CmA
158	mUmUfGmCmCmCfGfUfUmU mGfUmCmCmUmCfUmAmA	204	mU fUmAmGm AmGmGm AmCm AmAmAmCfGmGmGmCmAmA
mX = 2’-O-methyl nucléotide; fX = 2’-fluoro nucléotide

Table 3. 2’-O-methyl and 2’-fluoro Modified Nucléotide Sequences with Phosphorothioate Linkages
SEQ ID NO.	First Nucléotide Sequence (5’3’)	SEQ ID NO.	Second Nucléotide Sequence (5’-3’
205	mApsmCpsfCmGmUmGfUfGfC mAmCfUmUmCmGmCfUmUmC	261	mGpsfApsmAmGmCmGmAmAmGm UmGmCmAfCmAmCmGmGmUpsmC psmC
206	mApsmCpsfCmGmUmGfUfGfC mAmCfUmUmCmGmCfUmUmC	262	mGpsfApsmAmGmCmGmAmAmGm UmGmCmAfCmAmCmGmGmU
207	mApsmCpsfU mUmCmGfCfU fU mCmAfCmCmUmCmUfGmCmA	263	mUpsfGpsmCmAmGmAmGmGmUm GmAmAmGfCmGmAmAmGmUpsm GpsmC
208	mApsmGpsfUmGmUmU fU fGfC mUmGfAmCmGmCmAfAmCmC	264	mGpsfGpsmUmUmGmCmGmUmCm AmGmCmAfAmAmCmAmCmUpsmU psmG
209	mCpsmApsfGmGmCmGfGfGfG mUmU fU mUmUmCmUfUmGm U	265	mApsfCpsmAmAmGmAmAmAmAm AmCmCmCfCmGmCmCmUmGpsmU psmA
210	mCpsmApsfGmGmCmGfGfGfG mUmUfUmUmUmCmUfUmGm U	266	mApsfCpsmAmAmGmAmAmAmAm AmAmCmCmCfCmGmCmCmUmG
211	mCpsmApsfGmUmUmUfAfCfU mAmGfUmGmCmCmAfUmUm U	267	mApsfApsmAmUmGmGmCmAmCm UmAmGmU fAm Am AmCmUmGpsm ApsmG
212	mCpsmApsfGmUmUmUfAfCfU mAmGfUmGmCmCmAfUmUm U	268	mApsfApsmAmUmGmGmCmAmCm UmAmGmU fAm AmAmCmUmG
213	mCpsmApsfUmCmCmUfGfCfU mGmCfUmAmUmGmCfCmUmC	269	mGpsfApsmGmGmCmAmUmAmGm CmAmGmCfAmGmGmAmUmGpsm ApsmA

313

Table 3. 2’-O-methyl and 2’-fluoro Modified Nucléotide Sequences with Phosphorothioate Linkages
SEQ ID NO.	First Nucléotide Sequence (5’3’)	SEQ ID NO.	Second Nucléotide Sequence (5’-3’
214	mCpsmApsmUmCmCmUfGmCf UfGfCmUmAmUmGmCmCmUm CmAmU	270	mApsfUpsmGmAmGfGmCmAmUmA mGmCmAfGmCfAmGmGmAmUmGp smApsmA
215	mCpsmApsfUmCmCmUfGfCfU mGmCfUmAmUmGmCfCmUmC	271	mGpsfApsmGmGmCmAmUmAmGm CmAmGmCfAmGmGmAmUmG
216	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmUfUmCmA	272	mUpsfGpsmAmAmGmCmGmAmAm GmUmGmCfAmCmAmCmGmGpsmU psmC
217	mCpsmCpsfGmUmGmUfGfCfA mCmU fU mCmGmCmUfUmCm A	273	mUpsfGpsmAmAmGmCmGmAmAm GmUmGmCfAmCmAmCmGmG
218	mCpsmCpsmUmGmCmUfGmCf U fAfU mGmCmCmUmCm AmUm CmUmU	274	mApsfApsmGmAmUfGmAmGmGmC mAmUmAfGmCfAmGmCmAmGmGp smApsmU
219	mCpsmUpsfCmAmGmUfUfUfA mCmUfAmGmUmGmCfCmAmU	275	mApsfUpsmGmGmCmAmCmUmAm GmUmAmAfAmCmUmGmAmGpsm CpsmC
220	mCpsmUpsmCmAmGmUfUmU mAmCmUmAmGmUmGmCmC mAmU	275	mApsfUpsmGmGmCmAmCmUmAm GmUmAmAfAmCmUmGmAmGpsm CpsmC
221	mCpsmUpsfCmAmGmUfUfUmA mCmUmAmGmUmGmCfCmAm U	275	mApsfUpsmGmGmCmAmCmUmAm GmUmAmAfAmCmUmGmAmGpsm CpsmC
222	mCpsmUpsfCmAmGmUfUfUfA mCmU fAmGmUmGmCfCm AmU	276	mApsfUpsmGmGmCmAmCmUmAm GmUmAmAfAmCmUmGmAmG
223	mCpsmUpsfCmAmGmUfUfUmA mCmUmAmGmUmGmCfCmAm U	276	mApsfUpsmGmGmCmAmCmUmAm GmUmAmAfAmCmUmGmAmG
224	mCpsmUpsfGmCmUmAfUfGfC mCmU fCm AmUmCmU fUmCmU	277	mApsfGpsmAmAmGmAmUmGmAm GmGmCmAfUmAmGmCmAmGpsmC psmA
225	mCpsmUpsfGmCmUmAfUfGmC mCmUmCmAmUmCmUfUmCm U	277	mApsfGpsmAmAmGmAmUmGmAm GmGmCmAfUmAmGmCmAmGpsmC psmA
226	mCpsmUpsfGmCmUmAfUfGfC mCmU fCm AmUmCmU fU mCmU	278	mApsfGpsmAmAmGmAmUmGmAm GmGmCmAfUmAmGmCmAmG
227	mCpsmUpsfGmCmUmAfUfGmC mCmUmCm AmUmCm U fU mCm U	278	mApsfGpsmAmAmGmAmUmGmAm GmGmCmAfUmAmGmCmAmG

314

Table 3. 2’-O-methyl and 2’-fluoro Modified Nucléotide Sequences with Phosphorothioate Linkages
SEQ ID NO.	First Nucléotide Sequence (5’3’)	SEQ ID NO.	Second Nucléotide Sequence (5’-3’
228	mCpsmUpsfGmCmUmGfCfUfA mUmGfCmCmUmCmAfUmCmU	279	mApsfGpsmAmUmGmAmGmGmCm AmUmAmGfCmAmGmCmAmGpsm GpsmA
229	mCpsmUpsfGmCmUmGfCfUfA mUmGfCmCmUmCmAfUmCmU	280	mApsfGpsmAmUmGmAmGmGmCm AmUmAmGfCmAmGmCmAmG
230	mCpsmUpsfGmCmUmGfCfUmA mUmGmCmCmUmCmAfUmCm U .	280	mApsfGpsmAmUmGmAmGmGmCm AmUmAmGfCmAmGmCmAmG
231	mCpsmUpsmUmCmGmCfUmUf CfAfCmCmUmCmUmGmCmAm CmGmU	281	mApsfCpsmGmUmGfCmAmGmAmG mGmUmGfAmAfGmCmGmAmAmG psmUpsmG
232	mGpsmCpsmAmCmUmUfCmGf CfUfUmCmAmCmCmUmCmUm GmCmA	282	mUpsfGpsmCmAmGfAmGmGmUmG mAmAmGfCmGfAmAmGmUmGmCp smApsmC
233	mGpsmCpsfCmGmAmUfCfCfA mUmAfCmUmGmCmGfGmAm A	283	mUpsfUpsmCmCmGmCmAmGmUm AmUmGmGfAmUmCmGmGmCpsm ApsmG
234	mGpsmCpsfCmGmGmGfU fU fU mUmUfCmUmUmGmUfUmGm A	284	mUpsfUpsmCmCmGmCmAmGmUm AmUmGmGfAmUmCmGmGmC
235	mGpsmCpsfGmGmGmGfU fU fU mUmU fCmUmUmGmU fUmGm A	285	mUpsfCpsmAmAmCmAmAmGmAm AmAmAmAfCmCmCmCmGmCpsmC psmU
236	mGpsmCpsfGmGmGmGfU fU mU mUmUmCmUmUmGmUfUmGm A	285	mUpsfCpsmAmAmCmAmAmGmAm AmAmAmAfCmCmCmCmGmCpsmC psmU
237	mGpsmCpsfGmGmGmGfUfUfU mUmU fCmUmUmGmU fUmGm A	286	mUpsfCpsmAmAmCmAmAmGmAm AmAmAmAfCmCmCmCmGmC
238	mGpsmCpsfGmGmGmGfUfUmU mUmUmCmUmUmGmU fUmGm A	286	mUpsfCmAmAmCmAmAmGmAmA mAmAmAfCmCmCmCmGmC
239	mGpsmCpsmUmGmCmUfAmUf GfCfCmUmCmAmUmCmUmUm CmUmU	287	mApsfApsmGmAmAfGmAmUmGmA mGmGmCfAmUfAmGmCm AmGmCp smApsmG
240	mGpsmGpsmAmUmGmUfGmUf CfUfGmCmGmGmCmGmUmUm UmUmA	288	mUpsfApsmAmAmAfCmGmCmCmG mCmAmGfAmCfAmCmAmUmCmCp smApsmG

315

Table 3. 2’-O-methyl and 2’-fluoro Modified Nucléotide Sequences with Phosphorothioate Linkages
SEQ ID NO.	First Nucléotide Sequence (5’3’)	SEQ ID NO.	Second Nucléotide Sequence (5’-3⁵
241	mGpsmGpsfCmCmAmAfAfAfU mUmCfGmCmAmGmUfCmCmC	289	mGpsfGpsmGmAmCmUmGmCmGm AmAmUmUfUmUmGmGmCmCpsm ApsmA
242	mGpsmGpsfCmGmCmAfCfCfU mCmUfCmUmUmUmAfCmGmC	290	mGpsfCpsmGmUmAmAmAmGmAm GmAmGmGfUmGmCmGmCmCpsmC psmC
243	mGpsmUpsfAmUmGmUfUfGfC mCmCfGmUmUmUmGfUmCmC	291	mGpsfGpsmAmCmAmAmAmCmGm GmGmCmAfAmCmAmUmAmCpsmC psmU
244	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	292	mApsfUpsmUmGmAmGmAmGmAm AmGmUmCfCmAmCmCmAmCpsmG psmA
245	mGpsmUpsfGmUmGmCfAfCfU mUmCfGmCmUmUmCfAmCmC	293	mGpsfGpsmUmGmAmAmGmCmGm AmAmGmUfGmCmAmCmAmCpsmG psmG
246	mGpsmUpsfUmGmCmCfCfGfU mUmUfGmUmCmCmUfCmUmA	294	mUpsfApsmGmAmGmGmAmCmAm AmAmCmGfGmGmCmAmAmCpsmA psmU
247	mGpsmUpsfUmGmCmCfCfGfU mUmUfGmUmCmCmUfCmUmA	295	mUpsfApsmGmAmGmGmAmCmAm AmAmCmGfGmGmCmAmAmC
248	mUpsmCpsfCmAmUmAfCfUfG mCmGfGmAmAmCmU fCmCmU	296	mApsfGpsmGmAmGmUmUmCmCm GmCmAmGfUmAmUmGmGmApsm UpsmC
249	mUpsmCpsfCmAmUmAfCfUfG mCmGfGmAmAmCmU fCmCmU	297	mApsfGpsmGmAmGmUmUmCmCm GmCmAmGfUmAmUmGmGmA
250	mUpsmCpsmGmUmGmGfUmGf GfAfCmUmUmCmUmCmUmCm AmAmU	298	mApsfUpsmUmGmAfGmAmGmAmA mGmUmCfCmAfCmCmAmCmGmAp smGpsmU
251	mUpsmGpsfCmAmCmUfUfCfG mCmUfUmCmAmCmCfUmCmU	299	mApsfGpsmAmGmGmUmGmAmAm GmCmGmAfAmGmUmGmCmApsmC psmA
252	mUpsmGpsfCmCmGmAfUfCfC mAmU fAmCmUmGmCfGmGm A	300	mUpsfCpsmCmGmCmAmGmUmAm UmGmGmAfUmCmGmGmCmApsm GpsmA
253	mUpsmGpsfCmCmGmAfUfCfC m AmU fAmCmUmGmCfGmGm A	301	mUpsfCpsmCmGmCmAmGmUmAm UmGmGmAfUmCmGmGmCmA

316

Table 3. 2’-O-methyl and 2’-fluoro Modified Nucléotide Sequences with Phosphorothioate Linkages
SEQ ID NO.	First Nucléotide Sequence (5’3’)	SEQ ID NO.	Second Nucléotide Sequence (5’-3’
254	mUpsmGpsfCmUmAmUfGfCfC mUmCfAmUmCmUmUfCmUmU	302	mApsfApsmGmAmAmGmAmUmGm AmGmGmCfAmUmAmGmCmApsm GpsmC
255	mUpsmGpsfUmGmCmAfCfUfU mCmGfCmUmUmCmAfCmCmU	303	mApsfGpsmGmUmGmAmAmGmCm GmAmAmGfUmGmCmAmCmApsmC psmG
256	mUpsmGpsfUmGmCmAfCfUmU mCmGmCmUmUmCmAfCmCm U	303	mApsfGpsmGmUmGmAmAmGmCm Gm AmAmGfU mGmCm AmCmApsmC psmG
257	mUpsmGpsfUmGmCmAfCfUfU mCmGfCmUmUmCmAfCmCmU	304	mApsfGpsmGmUmGmAmAmGmCm Gm Am AmGfU mGmCm AmCrnA
258	mUpsmGpsfUmGmCmAfCfUmU mCmGmCmUmUmCmAfCmCm U	304	mApsfGpsmGmUmGmAmAmGmCm Gm AmAmGfU mGmCm AmCm A
259	mUpsmUpsfGmCmCmCfGfUmU mUmGniUmCmCmUmCfUmAm A	305	mUpsfUpsmAmGmAmGmGmAmCm AmAmAmCfGmGmGmCmAmApsmC psmA
260	mUpsmUpsfGmCmCmCfGfU fU mUmGfUmCmCmUmCfUmAmA	306	mUpsfUpsmAmGmAmGmGmAmCm AmAmAmCfGmGmGmCmAmA
mX = 2’-O-methyl nucléotide; fX = 2’-fluoro nucleotit	e; ps= phosphorothioate linkage

Table 4. siNA Sequences
SEQ ID NO.	Sense Sequence (5'-3*)	SEQ ID NO.	Antisense Sequence (5’-3*)
307	mApsmCpsfCmGmUmGfU fGfC mAmCfUmUmCmGmCfUmUmC	363	mGpsfApsmAmGmCmGmAmAmGmU mGmCmAfCmAmCmGmGmUpsmCps mC
308	mApsmCpsfCmGmUmGfU fGfC mAmCfUmUmCmGmCfUmUmC TT	364	mGpsfApsmAmGmCmGmAmAmGmU mGmCmAfCmAmCmGmGmUpsTpsT
309	mApsmCpsfUmUmCmGfCfU fU mCm AfCmCmUmCmU fGmCmA	365	mUpsfGpsmCmAmGmAmGmGmUmG mAmAmGfCmGmAmAmGmUpsmGps mC
310	mApsmGpsfUmGmUmUfUfGfC mUmGfAmCmGmCmAfAmCmC	366	mGpsfGpsmUmUmGmCmGmUmCmA mGmCmAfAmAmCmAmCmUpsmUps mG

317

Table 4. siNA Sequences
SEQ ID NO.	Sense Sequence (5'-3')	SEQ ID NO.	Antisense Sequence (5’-3*)
311	mCpsmApsfGmGmCmGfGfGfG mUmUfUmUmUmCmUfUmGm U	367	mApsfCpsmAmAmGmAmAmAmAmA mCmCmCfCmGmCmCmUmGpsmUps mA
312	mCpsmApsfGmGmCmGfGfGfG mUmUfUmUmUmCmUfUmGm UTT	368	mApsfCpsmAmAmGmAmAmAmAmA mAmCmCmCfCmGmCmCmUmGpsTp sT
313	mCpsmApsfGmUmUmUfAfCfU mAmGfUmGmCmCmAfUmUm U	369	mApsfApsmAmUmGmGmCmAmCmU mAmGmUfAmAmAmCmUmGpsmAps mG
314	mCpsmApsfGmUmUmUfAfCfU mAmGfUmGmCmCmAfUmUm UTT	370	mApsfApsmAmUmGmGmCmAmCmU mAmGmUfAmAmAmCmUmGpsTpsT
315	mCpsmApsfUmCmCmUfGfCfU mGmCfUmAmUmGmCfCmUmC	371	mGpsfApsmGmGmCmAmUmAmGmC mAmGmCfAmGmGmAmUmGpsmAps mA .
316	mCpsmApsmUmCmCmUfGmCf UfGfCmUmAmUmGmCmCmUm CmAmU	372	mApsfUpsmGmAmGfGmCmAmUmA mGmCmAfGmCfAmGmGmAmUmGps mApsmA
317	mCpsmApsfUmCmCmUfGfCfU mGmCfUmAmUmGmCfCmUmC TT	373	mGpsfApsmGmGmCmAmUmAmGmC mAmGmCfAmGmGmAmUmGpsTpsT
318	mCpsmCpsfGmUmGmUfGfCfA mCmU fUmCmGmCm U fUmCm A	374	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsmUps mC
319	mCpsmCpsfGmUmGmUfGfCfA mCmU fUmCmGmCmUfUmCm A TT	375	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsTpsT
320	mCpsmCpsmUmGmCmUfGmCf U fAfU mGmCmCmUmCm AmUm CmUmU	376	m ApsfApsmGm AmU fGmAmGmGmC mAmUmAfGmCfAmGmCmAmGmGps mApsmU
321	mCpsmUpsfCm AmGmU fUfUfA mCmUfAmGmUmGmCfCmAmU	377	mApsfUpsmGmGmCmAmCmUmAmG mUmAmAfAmCmUmGmAmGpsmCps mC
322	mCpsmUpsmCmAmGmUfUmU mAmCmUmAmGmUmGmCmC mAmU	377	mApsfUpsmGmGmCmAmCmUmAmG mUmAmAfAmCmUmGmAmGpsmCps mC
323	mCpsmUpsfCmAmGmUfUfUmA mCmUmAmGmUmGmCfCmAm U	377	mApsfUpsmGmGmCmAmCmUmAmG mUmAmAfAmCmUmGmAmGpsmCps mC

318

Table 4. siNA Sequences
SEQ ID NO.	Sense Sequence (5'-3’)	SEQ ID NO.	Antisense Sequence (5'-3')
324	mCpsmUpsfCm AmGmUfUfUfA mCmUfAmGmUmGmCfCmAmU TT	378	mApsfUpsmGmGmCmAmCmUmAmG mUmAmAfAmCmUmGmAmGpsTpsT
325	mCpsmUpsfCmAmGmUfUfUmA mCmUmAmGmUmGmCfCmAm UTT	378	mApsfUpsmGmGmCmAmCmUmAmG mUmAmAfAmCmUmGmAmGpsTpsT
326	mCpsmUpsfGmCmUmAfUfGfC mCmU fCm AmUmCmUfUmCmU	379	mApsfGpsmAmAmGmAmUmGmAmG mGmCmAfUmAmGmCmAmGpsmCps mA
327	mCpsmUpsfGmCmUmAfUfGmC mCmUmCmAmUmCmUfUmCm U	379	mApsfGpsmAmAmGmAmUmGmAmG mGmCmAfUmAmGmCmAmGpsmCps mA
. 328	mCpsmUpsfGmCmUmAfUfGfC mCmU fCm AmUmCmU fUmCmU TT	380	mApsfGpsmAmAmGmAmUmGmAmG mGmCmAfUmAmGmCmAmGpsTpsT
329	mCpsmUpsfGmCmUmAfUfGmC mCmUmCmAmUmCmUfUmCm UTT	380	mApsfGpsmAmAmGmAmUmGmAmG mGmCmAfUmAmGmCmAmGpsTpsT
330	mCpsmUpsfGmCmUmGfCfUfA mUmGfCmCmUmCm AfU mCmU	381	mApsfGpsmAmUmGmAmGmGmCmA mUmAmGfCmAmGmCmAmGpsmGps mA
331	mCpsmUpsfGmCmUmGfCfUfA mUmGfCmCmUmCmAfUmCmU TT	382	mApsfGpsmAmUmGmAmGmGmCmA mUmAmGfCmAmGmCmAmGpsTpsT
332	mCpsmUpsfGmCmUmGfCfUmA mUmGmCmCmUmCmAfUmCm UTT	383	mApsfGpsmAmUmGmAmGmGmCmA mUmAmGfCmAmGmCmAmGpsTpsT
333	mCpsmUpsmUmCmGmCfUmUf CfAfCmCmUmCmUmGmCmAm CmGmU	384	mApsfCpsmGmUmGfCmAmGmAmG mGmUmGfAmAfGmCmGmAmAmGp smUpsmG
334	mGpsmCpsmAmCmUmUfCmGf CfUfU mCmAmCmCm UmCmUm GmCmA	385	mUpsfGpsmCmAmGfAmGmGmUmG mAmAmGfCmGfAmAmGmUmGmCps mApsmC
335	mGpsmCpsfCmGmAmUfCfCfA mUmAfCmUmGrnCmGfGmAm A	386	mUpsfUpsmCmCmGmCmAmGmUmA mUmGmGfAmUmCmGmGmCpsmAps mG
336	mGpsmCpsfCmGmGmGfUfUfU mUmUfCmUmUmGmUfUmGm ATT	387	mUpsfUpsmCmCmGmCmAmGmUmA mUmGmGfAmUmCmGmGmCpsTpsT

319

Table 4. siNA Sequences
SEQ ID NO.	Sense Sequence (5'-3')	SEQ ID NO.	Antisense Sequence (5’-3*)
337	mGpsmCpsfGmGmGmGfU fU fU mUmUfCmUmUmGmUfUmGm A	388	mUpsfCpsmAmAmCmAmAmGmAmA mAmAmAfCmCmCmCmGmCpsmCps mU
338	mGpsmCpsfGmGmGmGfU fUmU mUmUmCmUmUmGmUfUmGm A	388	mUpsfCpsmAmAmCmAmAmGmAmA mAmAmAfCmCmCmCmGmCpsmCps mU
339	mGpsmCpsfGmGmGmGfUfUfU mUmUfCmUmUmGmUfUmGm ATT	389	mUpsfCpsmAmAmCmAmAmGmAmA mAmAmAfCmCmCmCmGmCpsTpsT
340	mGpsmCpsfGmGmGmGfU fU mU mUmUmCmUmUmGmUfUmGm ATT	389	mUpsfCmAmAmCmAmAmGmAmAm AmAmAfCmCmCmCmGmCpsTpsT
341	mGpsmCpsmUmGmCmUfAmUf GfCfCmUmCmAmUmCmUmUm CmUmU	390	mApsfApsmGmAmAfGmAmUmGmA mGmGmCfAmUfAmGmCmAmGmCps mApsmG
342	mGpsmGpsm AmUmGmU fGmU f CfU fGmCmGmGmCmGmUmUm UmUmA	391	mUpsfApsmAmAmAfCmGmCmCmG mCmAmGfAmCfAmCmAmUmCmCps mApsmG
343	mGpsmGpsfCmCmAmAfAfAfU mUmCfGmCmAmGmU fCmCmC	392	mGpsfGpsmGmAmCmUmGmCmGmA mAmUmU fU mUmGmGmCmCpsm Aps mA
344	mGpsmGpsfCmGmCmAfCfCfU mCmU fCmUmUmUm AfCmGmC	393	mGpsfCpsmGmUmAmAmAmGmAmG mAmGmGfUmGmCmGmCmCpsmCps mC
345	mGpsmUpsfAmUmGmUfUfGfC mCmCfGmUmUmUmGfUmCmC	394	mGpsfGpsmAmCmAmAmAmCmGmG mGmCmAfAmCmAmUmAmCpsmCps mU
346	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	395	mApsfUpsmUmGmAmGmAmGmAmA mGmUmCfCmAmCmCmAmCpsmGps mA
347	mGpsmUpsfGmUmGmCfAfCfU mUmCfGmCmUmUmCfAmCmC	396	mGpsfGpsmUmGmAmAmGmCmGmA m AmGmU fGmCm AmCm AmCpsmGps mG
348	mGpsmUpsfUmGmCmCfCfGfU mUmU fGmUmCmCmU fCmUm A	397	mUpsfApsmGmAmGmGmAmCmAmA mAmCmGfGmGmCmAmAmCpsmAps mU
349	mGpsmUpsfUmGmCmCfCfGfU mUmUfGmUmCmCmUfCmUmA TT	398	mUpsfApsmGmAmGmGmAmCmAmA m AmCmGfGmGmCm Am AmCpsT psT

320

Table 4. siNA Sequences
SEQ ID NO.	Sense Sequence (5'-3')	SEQ ID NO.	Antisense Sequence (5'-3')
350	mUpsmCpsfCm AmUmAfCfUfG mCmGfGm Am AmCmU fCmCmU	399	mApsfGpsmGmAmGmUmUmCmCmG mCmAmGfUmAmUmGmGmApsmUps mC
351	mUpsmCpsfCmAmUmAfCfUfG mCmGfGm AmAmCmU fCmCmU TT	400	mApsfGpsmGmAmGmUmUmCmCmG mCmAmGfUmAmUmGmGmApsTpsT
352	mUpsmCpsmGmUmGmGfUmGf GfAfCmUmUmCmUmCmUmCm AmAmU	401	mApsfUpsmUmGmAfGmAmGmAmA mGmUmCfCmAfCmCmAmCmGmAps mGpsmU
353	mUpsmGpsfCmAmCmUfUfCfG mCmU fU mCm AmCmCfUmCmU	402	mApsfGpsmAmGmGmUmGmAmAmG mCmGmAfAmGmUmGmCmApsmCps mA
354	mUpsmGpsfCmCmGmAfUfCfC mAmUfAmCmUmGmCfGmGm A	403	mUpsfCpsmCmGmCmAmGmUmAmU mGmGmAfUmCmGmGmCmApsmGps mA
355	mUpsmGpsfCmCmGmAfU fCfC mAmUfAmCmUmGmCfGmGm ATT	404	mUpsfCpsmCmGmCmAmGmUmAmU mGmGmAfUmCmGmGmCmApsTpsT
356	mUpsmGpsfCmUmAmUfGfCfC mUmCfAmUmCmUmUfCmUmU	405	mApsfApsmGmAmAmGmAmUmGmA mGmGmCfAmUmAmGmCmApsmGps mC
357	mUpsmGpsfUmGmCmAfCfUfU mCmGfCmUmUmCmAfCmCmU	406	mApsfGpsmGmUmGmAmAmGmCmG mAmAmGfUmGmCmAmCmApsmCps mG
358	mUpsmGpsfUmGmCmAfCfUmU mCmGmCmUmUmCmAfCmCm U	406	mApsfGpsmGmUmGmAmAmGmCmG mAmAmGfUmGmCmAmCmApsmCps mG
359	mUpsmGpsfUmGmCmAfCfUfU mCmGfCmUmUmCmAfCmCmU TT	407	mApsfGpsmGmUmGmAmAmGmCmG mAmAmGfUmGmCmAmCmApsTpsT
360	mUpsmGpsfUmGmCmAfCfUmU mCmGmCmUmUmCmAfCmCm UTT	407	mApsfGpsmGmUmGmAmAmGmCmG mAmAmGfUmGmCmAmCmApsTpsT
361	mUpsmUpsfGmCmCmCfGfUmU mUmGmUmCmCmUmCfUmAm A	408	mUpsfUpsmAmGmAmGmGmAmCmA mAmAmCfGmGmGmCmAmApsmCps mA
362	mUpsmUpsfGmCmCmCfGfUfU mUmGfUmCmCmUmCfUmAmA TT	409	mUpsfUpsmAmGmAmGmGmAmCmA mAmAmCfGmGmGmCmAmApsTpsT

321

Table 4. siNA Sequences
SEQ ID NO.	Sense Sequence (5'-3')	SEQ ID NO.	Antisense Sequence (5'-3')
415	5dcd3Cps5dcd3CpsfG5dcd3UmG 5dcd3UfG5dfCfA5dcd3C5dcd3U 5dfU5dcd3CmG5dcd3C5dcd3U5d fU5dcd3CmA	445	5 dcd3UpsfGpsmAmAmG5 dcd3 CmGm AmAmG5dcd3UmG5dcd3CfA5dcd3C mA5dcd3CmGmGps5dcd3Ups5dcd3U
415	5dcd3Cps5dcd3CpsfG5dcd3UmG 5dcd3UfG5dfCfA5dcd3C5dcd3U 5dfU5dcd3CmG5dcd3C5dcd3U5d fU5dcd3CmA	446	5dcd3UpsfGpsmAmAmGmCmGmAm AmGmUmGmCfAmCmAmCmGmGps 5dcd3Ups5dcd3U
415	5dcd3Cps5dcd3CpsfG5dcd3UmG 5dcd3UfG5dfCfA5dcd3C5dcd3U 5dfU5dcd3CmG5dcd3C5dcd3U5d fU5dcd3CmA	447	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsmUps mU
416	fCpsmCpsfGmUfGmUfGfCfAmC fUmUfCmGfCmUfUmCfA	448	mUpsfGpsmAfAmGfCmGfAmAfGmU mGmCfAmCfAmCfGmGpsmUpsmC
416	fCpsmCpsfGmUfGmUfGfCfAmC fUmUfCmGfCmUfUmCfA	449	vmUpsfGpsmAfAmGfCmGfAmAfGm UmGmCfAmCfAmCfGmGpsmUpsmC
416	fCpsmCpsfGmU fGmU fGmCfAm CfUmUfCmGfCmUfUmCfA	450	mUpsfGpsmAfAmGfCmGfAmAfGmU f GmCfAmCfAmCfGmGpsmUpsmC
416	fCpsmCpsfGmU fGmU fGmCfAm CfUmUfCmGfCmUfUmCfA	451	VmUpsfGpsmAfAmGfCmGfAmAfGm UfGmCfAmCfAmCfGmGpsmUpsmC
417	fCpsmUpsfGmCfUmAfUmGfCm CfUmCfAmUfCmUfUmCfU	452	mApsfGpsmAfAmGfAmUfGmAfGmGf CmAfUmAfGmCfAmGpsmUpsmU
417	fCpsmUpsfGmCfUmAfUmGfCm CfUmCfAmUfCmUfUmCfU	452	mApsfGpsmAfAmGfAmUfGmAfGmGf CmAfUmAfGmCfAmGpsmUpsmU
417	fCpsmUpsfGmCfUmAfUmGfCm CfUmCfAmUfCmUfUmCfU	452	mApsfGpsmAfAmGfAmUfGmAfGmGf CmAfUmAfGmCfAmGpsmUpsmU
417	fCpsmUpsfGmCfUmAfUmGfCm CfUmCfAmUfCmUfUmCfU	452	mApsfGpsmAfAmGfAmUfGmAfGmGf CmAfUmAfGmCfAmGpsmUpsmU
418	fGpsmUpsfGmGfUmGfGfAfCm UfUmCfUmCfUmCfAmAfU	453	mApsfUpsmUfGmAfGmAfGmAfAmG mUmCfCmAfCmCfAmCpsmGpsmA
418	fGpsmUpsfGmGfUmGfGfAfCm UfUmCfUmCfUmCfAmAfU	454	vmApsfUpsmUfGmAfGmAfGmAfAm GmUmCfCmAfCmCfAmCpsmGpsmA
419	fGpsmUpsfGmGfUmGfGmAfCm UfUmCfUmCfUmCfAmAfU	455	mApsfUpsmUfGmAfGmAfGmAfAmGf UmCfCmAfCmCfAmCpsmGpsmA
419	fGpsmUpsfGmGfUmGfGmAfCm UfUmCfUmCfUmCfAmAfU	456	VmApsfUpsmUfGmAfGmAfGmAfAm GfUmCfCmAfCmCfAmCpsmGpsmA
420	mCpsmCpsfGmUfGmUfGfCfAm CmUmUmCmGmCmUmUmCm A	457	mUpsfGpsmAmAmGfCmGmAmAmG mUmGmCfAmCfAmCmGmGpsmUps mC

322

Table 4. siNA Sequences
SEQ ID NO.	Sense Sequence (5'-3')	SEQ ID NO.	Antisense Sequence (5’-3*)
421	mCpsmCpsfGmUmGmUfGfCfA mAmUfUmCmGmCmUfUmCmA	458	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsmUps mC
422	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmUfUmCmA	459	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsmU3 s mU
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmUfUmCmA	460	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmG5smU5s mU
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmU fUmCm A	461	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsmU 5 s mU
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmUfUmCmA	458	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsmUps mC
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmUfUmCmA	458	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsmUps mC
423	mCpsmCpsfGmUmGmUfGfCfA mCmU fUmCmGmCmUfUmCmA	458	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsmUps mC
423	mCpsmCpsfGmUmGmUfGfCfA mCmU fU mCmGmCm U fUmCm A	462	VmUpsfGpsmAmAmGmCmGmAmAm GmUmGmCfAmCmAmCmGmGpsmU psmC
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmUfUmCmA	463	VmUpsfGpsmAmAmGmCmGmAmAm GmUmGmCfAmCmAmCmGmGpsTps T
423	mCpsmCpsfGmUmGmUfGfCfA mCmU fUmCmGmCmU fUmCm A	447	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsmUps mU
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmUfUmCmA	458	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsmUps mC
423	mCpsmCpsfGmUmGmU fGfCfA mCmU fU mCmGmCmU fUmCm A	457	mUpsfGpsmAmAmGfCmGmAmAmG mUmGmCfAmCfAmCmGmGpsmUps mC
423	mCpsmCpsfGmUmGmUfGfCfA mCmU fUmCmGmCmU fU mCm A	464	mUpsfGpsmAmAmGfCmGmAmAfGm UmGmCfAmCmAmCfGmGpsmUpsmC

323

Table 4. siNA Sequences
SEQ ID NO.	Sense Sequence (5'-3')	SEQ ID NO.	Antisense Sequence (5'-3')
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmUfUmCmA	465	vmBpsfGpsmAmAmGmCmGmAmAm GmUmGmCfAmCmAmCmGmGpsmU psmC
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmUfUmCmA	466	mesnmUpsfGpsmAmAmGmCmGmAm AmGmUmGmCfAmCmAmCmGmGps mUpsmC
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmU fU mCm A	467	cmUpsfGpsmAmAmGmCmGmAmAm GmUmGmCfAmCmAmCmGmGpsmU psmC
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmU fUmCm A	468	mesnomUpsfGpsmAmAmGmCmGmA inAmGmUmGmCfAmCmAmCmGmGp smUpsmC
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmUfUmCmA	469	mUpsfGpsmAmAmGfCmGmAmAmG mUmGmCfAmCmAmCmGmGpsmUps mC
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmUfUmCmA	470	mUpsfGpsmAmAmGmCmGmAmAmG fUmGmCfAmCmAmCmGmGpsmUps mC
423	mCpsmCpsfGmUmGmUfGfCfA mCmU fU mCmGmCmUfUmCm A	471	mUpsfGpsmAmAmGmCmGmAmAmG mUfGmCfAmCmAmCmGmGpsmUps mC
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmU fUmCm A	472	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCfAmCmGmGpsmUps mC
423	mCpsmCpsfGmUmGmUfGfCfA mCmU fUmCmGmCmU fUmCm A	473	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAfCmGmGpsmUps mC
423	mCpsmCpsfGmUmGmUfGfCfA mCmU fUmCmGmCmU fUmCm A	474	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCfGmGpsmUps mC
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmUfUmCmA	475	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGfGpsmUps mC
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmUfUmCmA	476	mUpsfGpsmAfAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsmUps mC
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmUfUmCmA	477	mUpsfGpsmAmAfGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsmUps mC

324

Table 4. siNA Sequences
SEQ ID NO.	Sense Sequence (5'-3')	SEQ ID NO.	Antisense Sequence (5'-3')
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCm GmCm U fU mCm A	478	mUpsfGpsmAmAmGmCfGmAmAmG mUmGmCfAmCmAmCmGmGpsmUps mC
423	mCpsmCpsfGmUmGmUfGfCfA mCmU fUmCmGmCmUfUmCm A	479	mUpsfGpsmAmAmGmCmGfAmAmG mUmGmCfAmCmAmCmGmGpsmUps mC
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmUfUmCmA	480	mUpsfGpsmAmAmGmCmGmAfAmG mUmGmCfAmCmAmCmGmGpsmUps mC
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmU fUmCm A	481	mUpsfGpsmAmAmGmCmGmAmAfG mUmGmCfAmCmAmCmGmGpsmUps mC
423	mCpsmCpsfGmUmGmUfGfCfA mCmUfUmCmGmCmUfUmCmA	482	d2vmUpsfGpsmAmAmGmCmGmAmA mGmUmGmCfAmCmAmCmGmGpsm UpsmC
423	mCpsmCpsfGmUmGmUfGfCfA mCmUmUmCmGmCmUfUmCm A	483	mUpsfGpsmAfAmGfCmGfAmAmGm UmGmCfAmCmAmCmGmGpsmUpsm C
597	mCpsmCpsfGmUmGmUfGfCfC mCmU fU mCmGmCmU fUmCm A	458	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsmUps mC
423	mCpsmCpsfGmUmGmUfGfCmA mCmUmUmCmGmCmUfUmCm A	458	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsmUps mC
424	mCpsmCpsmGmUfGmUfGfCfA mCmUmUmCmGmCmUmUmC mA	457	mUpsfGpsmAmAmGfCmGmAmAmG mUmGmCfAmCfAmCmGmGpsmUps mC
424	mCpsmCpsmGmUfGmUfGfCfA mCmUmUmCmGmCmUmUmC mA	484	mUpsfGpsmAmAmGfCmGfAfAmGm UmGmCfAmCfAmCmGmGpsmUpsmC
424	mCpsmCpsmGmUfGmUfGfCfA mCmUmUmCmGmCmUmUmC mA	485	mUpsfGpsmAmAfGmCmGfAmAmGm UmGmCfAmCmAfCmGmGpsmUpsmC
425	mCpsmUpsmGmCfUmAfUfGfC mCmUmCmAmUmCmUmUmC mU	486	mApsfGpsmAmAmGfAmUmGmAfGm GmCmAfUmAmGmCfAmGpsmCpsm A
425	mCpsmUpsmGmCfUmAfUfGfC mCmUmCmAmUmCmUmUmC mU	487	mApsfGpsmAmAmGfAmUmGmAmG mGmCmAfUmAfGmCmAmGpsmCps mA

325

Table 4. siNA Sequences
SEQ ID NO.	Sense Sequence (5'-3')	SEQ ID NO.	Antisense Sequence (5'-3')
425	mCpsmUpsmGmCfUmAfUfGfC mCmUmCmAmUmCmUmUmC mU	488	mApsfGpsmAmAfGmAmUfGmAmGm GmCmAfUmAmGfCmAmGpsmCpsm A
426	mCpsmUpsmGmCfUmAfUmGfC mCmUfCmAmUmCmUfUmCmU	489	mApsfGpsmAmAmGmAmUmGmAmG inGmCmAfUmAmGmCmAmGpsmCps mA
427	HiGpsmCpsfGmGmGmGfU fU fU mUmU fCmUmUmGmU fU mGm A	490	vmUpsfCpsmAmAmCmAmAmGmAm AmAmAmAfCmCmCmCmGmCpsmCp smU
428	mGpsmCpsfGmGmGmGfUmUm UmUmUmCmUmUmGmUfUmG mA	491	mUpsfCpsmAmAmCmAmAmGmAmA mAmAmAfCmCmCmCmGmCpsmCps mU
429	mGpsmCpsmGmGfGmGfU fU fU mUmUmCmUmUmGmUmUmG mA	492	mUpsfCpsmAmAmCfAmAinGmAfAm AmAmAfCmCmCmCfGmCpsmCpsmU
429	mGpsmCpsmGmGfGmGfUfUfU mUmUmCmUmUmGmUmUmG mA	493	mUpsfCpsmAmAmCfAmAmGmAmA mAmAmAfCmCfCmCmGmCpsmCpsm U
429	mGpsmCpsmGmGfGmGfUfUfU mUmUmCmUmUmGmUmUmG mA	494	mUpsfCpsmAmAfCmAmAfGmAmAm AmAmAfCmCmCfCmGmCpsmCpsmU
430	mGpsmCpsmUmGfCmUmAmUf GfCfCmUmCfAmUmCmUmUfC mUmU	495	mApsfApsmGmAmAmGmAmUmGmA mGmGmCfAmUmAmGmCmAmGmCp smApsmG
430	mGpsmCpsmUmGfCmUmAmU f GfCfCmUmCfAmUmCmUmUfC mUmU	496	mApsfApsmGmAmAfGmAmUmGmA mGmGmCfAmUfAmGmCmAmGmCps mApsmG
431	mGpsmCpsmUmGmCmU fAmU f GfCfCmUmCmAmUfCmUmUfC mUmU	497	m ApsfApsmGm AmAfGm AfU fGm Am GmGmCfAmU fAmGmCm AmGmCpsm ApsmG
432	mGpsmCpsmUmGmCmU fAmU f GfCfCmUmCmAmUmCmUmUm CmUmU	498	vmApsfApsmGmAmAfGmAmUmGmA mGmGmCfAmUfAmGmCmAmGmCps mApsmG
432	mGpsmCpsmUmGmCmUfAmUf GfCfCmUmCmAmUmCmUmUm CmUmU	500	d2vmApsfApsmGmAmAfGmAmUmG mAmGmGmCfAmU fAmGmCmAmGm CpsmApsmG
433	mGpsmUpsfGmGfUmGfGfAfCm UmUmCmUmCmUmCmAmAm U	501	mApsfUpsmUmGmAfGmAmGmAmA mGmUmCfCmAfCmCmAmCpsmGpsm A

326

Table 4. siNA Sequences
SEQ ID NO.	Sense Sequence (5-3)	SEQ ID NO.	Antisense Sequence (5'-3')
434	mGpsmUpsfGmGmUmGfGfAfA mUmUfCmUmCmUmCfAmAmU	502	mApsfUpsmUmGmAmGmAmGmAmA mGmUmCfCmAmCmCmAmCpsmGps mA
598	mGpsmUpsfGmGmUmGfGfAfC mGmUfCmUmCmUmCfAmAmU	502	mApsfUpsmUmGmAmGmAmGmAmA mGmUmCfCmAmCmCmAmCpsmGps mA
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	503	vmApsfUpsmUmGmAmGmAmGmAm AmGmUmCfCmAmCmCmAmCpsmGp smA
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	501	mApsfUpsmUmGmAfGmAmGmAmA mGmUmCfCmAfCmCmAmCpsmGpsm A
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	504	mApsfUpsmUmGmAfGmAmGmAfAm GmUmCfCmAmCmCfAmCpsmGpsmA
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	505	vmNpsfUpsmUmGmAmGmAmGmAm AmGmUmCfCmAmCmCmAmCpsmGp smA
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	506	vmUpsfUpsmUmGmAmGmAmGmAm AmGmUmCfCmAmCmCmAmCpsmGp smA
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	507	cmUpsfUpsmUmGmAmGmAmGmAm AmGmUmCfCmAmCmCmAmCpsmGp smA
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	508	mesnmUpsfUpsmUmGmAmGmAmGm AmAmGmUmCfCmAmCmCmAmCps mGpsmA
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	509	mesnomUpsfUpsmUmGmAmGmAmG mAmAmGmUmCfCmAmCmCmAmCp smGpsmA
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	510	mApsfUpsmUmGmAfGmAmGmAmA mGmUmCfCmAmCmCmAmCpsmGps mA
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	511	m ApsfUpsmU fGm AmGrn AmGmAmA mGmUmCfCmAmCmCmAmCpsmGps mA
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	512	mApsfUpsmUmGfAmGmAmGmAmA mGmUmCfCmAmCmCmAmCpsmGps mA

327

Table 4. siNA Sequences
SEQ ID NO.	Sense Sequence (5'-3')	SEQ ID NO.	Antisense Sequence (5'-3')
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	513	mApsfUpsmUmGmAmGfAmGmAmA mGmUmCfCmAmCmCmAmCpsmGps mA
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	514	mApsfUpsmUmGmAmGmAmGfAmA mGmUmCfCmAmCmCmAmCpsmGps mA
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	515	mApsfUpsmUmGmAmGmAmGmAfA mGmUmCfCmAmCmCmAmCpsmGps mA
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	516	mApsfUpsmUmGmAmGmAmGmAmA mGmUmCfCmAfCmCmAmCpsmGpsm A
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	517	mApsfUpsmUmGmAmGmAmGmAmA mGmUmCfCmAmCmCfAmCpsmGpsm A
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	518	mApsfUpsmUmGmAmGmAmGmAmA mGmUmCfCmAmCmCmAfCpsmGpsm A
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	519	d2vmApsfUpsmUmGmAmGmAmGmA mAmGmUmCfCmAmCmCmAmCpsm GpsmA
436	mGpsmUpsfGmGmUmGfGfAfC mUmUmCmUmCmUmCfUmAm U	520	mApsfUpsmUfGmAfGmAfGmAmAm GmUmCfCmAmCmCmAmCpsmGpsm A
437	mGpsmUpsfGmGmUmGfGfAmC mUmUmCmUmCmUmCfAmAm U	502	mApsfUpsmUmGmAmGmAmGmAmA mGmUmCfCmAmCmCmAmCpsmGps mA
438	mGpsmUpsmGmGfUmGfGfAfC mUmUmCmUmCmUmCmAmA mU	501	mApsfUpsmUmGmAfGmAmGmAmA mGmUmCfCmAfCmCmAmCpsmGpsm A
438	mGpsmUpsmGmGfUmGfGfAfC mUmUmCmUmCmUmCmAmA mU	521	mApsfUpsmUmGmAfGmAfGfAmAm GmUmCfCmAfCmCmAmCpsmGpsmA
438	mGpsmUpsmGmGfUmGfGfAfC mUmUmCmUmCmUmCmAmA mU	522	mApsfUpsmUmGfAmGmAfGmAmAm GmUmCfCmAmCfCmAmCpsmGpsmA
439	mUpsmCpsmGmUmGmGfUmGf GfAfCmUmUmCmUmCmUmCm AmAmU	523	vmApsfUpsmUmGmAfGmAmGmAmA mGmUmCfCmAfCmCmAmCmGmAps mGpsmU

328

Table 4. siNA Set	uences
SEQ ID NO.	Sense Sequence (5'-3')	SEQ ID NO.	Antisense Sequence (5'-3')
440	mUpsmGpsfCmCmGm AfU fCfC mAmUfAmCmUmGmCfGmGm A	524	vmUpsfCpsmCmGmCmAmGmUmAm UmGmGmAfUmCmGmGmCmApsmG psmA
441	mUpsmGpsfUmGmCm AfCfU fU mCmGfCmUmUmCmAfCmCmU	525	VmApsfGpsmGmUmGmAmAmGmCm GmAmAmGfUmGmCmAmCmApsmC psmG
441	mUpsmGpsfUmGmCmAfCfUfU mCmGfCmUmUmCmAfCmCmU	526	mApsfGpsmGmUmGfAmAmGmCfGm AmAmGfUmGmCmAfCmApsmCpsm G
441	mUpsmGpsfUmGmCmAfCfUfU mCmGfCmUmUmCmAfCmCmU	527	mApsfGpsmGmUmGfAmAmGmCmG mAmAmGfUmGfCmAmCmApsmCps mG
442	mUpsmGpsfUmGmCmAfCfUmU mCmGmCmUmUmCmAfCmCm U	525	VmApsfGpsmGmUmGmAmAmGmCm GmAmAmGfUmGmCmAmCmApsmC psmG
442	mUpsmGpsfUmGmCmAfCfUmU mCmGmCmUmUmCmAfCmCm U	528	VmApsfGpsmGmUmGmAmAmGmCm GmAmAmGfUmGmCmAmCmApsTps T
442	mUpsmGpsfUmGmCmAfCfUmU mCmGmCmUmUmCmAfCmCm U	529	d2vmApsfGpsmGmUmGmAmAmGmC mGmAmAmGfUmGmCmAmCmApsm CpsmG
443	unCpsmCpsfGmUmGmU fGfCfA mCmUfUmCmGmCmUfUmCmA	458	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsmUps mC
444	unGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	502	mApsfUpsmUmGmAmGmAmGmAmA mGmUmCfCmAmCmCmAmCpsmGps mA
423	mCpsmCpsfGmUmGmUfGfCfA mCmU fUmCmGmCmU fUmCmA	458	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsmUps mC
224	mCpsmUpsfGmCmUmAfUfGfC mCmU fCmAmUmCmU fU mCmU	489	mApsfGpsmAmAmGmAmUmGmAmG mGmCmAfUmAmGmCmAmGpsmCps mA
236	mGpsmCpsfGmGmGmGfUfUmU mUmUmCmUmUmGmUfUmGm A	491	mUpsfCpsmAmAmCmAmAmGmAmA mAmAmAfCmCmCmCmGmCpsmCps mU
432	mGpsmCpsmUmGmCmUfAmUf GfCfCmUmCmAmUmCmUmUm CmUmU	496	mApsfApsmGmAmAfGmAmUmGmA mGmGmCfAmU fAmGmCm AmGmCps mApsmG

329

Table 4. siNA Sequences
SEQ ID NO.	Sense Sequence (5'-3')	SEQ ID NO.	Antisense Sequence (5'-3')
435	mGpsmUpsfGmGmUmGfGfAfC mUmUfCmUmCmUmCfAmAmU	502	mApsfUpsmUmGmAmGmAmGmAmA mGmUmCfCmAmCmCmAmCpsmGps mA
442	mUpsmGpsfUmGmCmAfCfUmU mCmGmCmUmUmCmAfCmCm U	530	mApsfGpsmGmUmGmAmAmGmCmG mAmAmGfUmGmCmAmCmApsmCps mG
439	mUpsmCpsmGmUmGmGfUmGf GfAfCmUmUmCmUmCmUmCm AmAmU	531	mApsfUpsmUmGmAfGmAmGmAmA mGmUmCfCmAfCmCmAmCmGmAps mGpsmU
423	mCpsmCpsfGmUmGmUfGfCfA mCmU fU mCmGmCmU fUmCm A	532	mUpsfGpsmAmAmGmCmGmAmAmG mUmGmCfAmCmAmCmGmGpsTpsT
441	mUpsmGpsfUmGmCmAfCfUfU mCmGfCmUmUmCmAfCmCmU	530	mApsfGpsmGmUmGmAmAmGmCmG mAmAmGfUmGmCmAmCmApsmCps mG
442	mUpsmGpsfUmGmCmAfCfUmU mCmGmCmUmUmCmAfCmCm U	533	mApsfGpsmGmUmGmAmAmGmCmG mAmAmGfUmGmCmAmCmApsTpsT
424	mCpsmCpsmGmUfGmUfGfCfA mCmUmUmCmGmCmUmUmC mA	536	d2vd3UpsfGpsmAmAfGmCmGfAmAm GmUmGmCfAmCmAfCmGmGpsmUp smC
438	mGpsmUpsmGmGfUmGfGfAfC mUmUmCmUmCmUmCmAmA mU	537	mApsf4PpsmUmGmAfGmAmGmAmA mGmUmCfCmAfCmCmAmCpsmGpsm A
438	mGpsmUpsmGmGfUmGfGfAfC mUmUmCmUmCmUmCmAmA mU	538	mApsfUpsmUmGmAfGmAmGmAmA mGmUmCfZPmAfCmCmAmCpsmGps mA
438	mGpsmUpsmGmGfUmGfGfAfC mUmUmCmUmCmUmCmAmA mU	599	mApsfUpsmUmGmAfGmAmGmAmA mGmUmCfCmAfXmCmAmCpsmGps mA
mX = 2’-O-methyl nucléotide; fX = 2’-fluoro nucléotide; 5dcd3X = nucléotide of Formula 17; 5dfX = nucléotide of Formula 16; vX= 5’ vinyl phosphonate nucléotide; d2vX = deuterated 5’ vinyl phosphonate nucléotide; vmX = 5’ vinyl phosphonate, 2’-O-methyl nucléotide; vmB = 0 ho.£ HO ? HO„° HO X ₀ HO ₀ N—( ^H0 / Y\ \ / Y <· -> A // v—-, <_z ? P V-' 0 OMe î /° 1 ^f 1 . -vU ; vmN = · y_mu =

330

Table 4. siNA Sequences
SEQ ID NO.	Sense Sequence (5'-3')	SEQ ID NO.	Antisense Sequence (5-3)

0' tOMe 0' OC H ₃ cmU = ; mesnmU = zwvw ; mesnomU =

o bcH₃ 9 OMe ; d2vmU = zvwwx · J2vmA =

O

phosphorothioate linkage

Table 5
SEQ ID NO:	Description	Sequence⁺
410	Hepatitis B virus (Genbank Accession No. U95551.1)	aattccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtgg ctccagttcaggagcagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggatt ggggaccctgcgctgaacatggagaacatcacatcaggattcctaggaccccttctcgtgttacagg cggggtttttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctca attttctagggggaactaccgtgtgtcttggccaaaattcgcagtccccaacctccaatcactcacca acctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatc

331

Table 5
SEQ ID NO:	Description	Sequence⁺
		ctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctctaattc caggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctcta tgtatccctcctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctg ggctttcggaaaattcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattt gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggc caagtctgtacagcatcttgagtccctttttaccgctgttaccaattttcttttgtctttgggtatacatttaa accctaacaaaacaaagagatggggttactctctgaattttatgggttatgtcattggaagttatgggtc cttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcctattaacaggcctat tgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccatttacacaatgtggttatc ctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcc tttctgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgttt gctgacgcaacccccactggctggggcttggtcatgggccatcagcgcgtgcgtggaaccttttcg gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaa cattatcgggactgataactctgttgtcctctcccgcaaatatacatcgtatccatggctgctaggctgt gctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatcctgcggacg acccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccacgggg cgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttca cctctgcacgtcgcatggagaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataaga ggactcttggactctctgcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaag actgggaggagttgggggaggagattagattaaaggtctttgtactaggaggctgtaggcataaatt ggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttca agcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataaagaatttggagcta ctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccgcctcag ctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagca attctttgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatct agagacctagtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcac atttcttgtctcacttttggaagagaaaccgttatagagtatttggtgtctttcggagtgtggattcgcact cctccagcttatagaccaccaaatgcccctatcctatcaacacttccggaaactactgttgttagacga cgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcg cagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtggggaactttactg gtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttacacc aagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagattgcaa ttgattatgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttat tatccagaacatctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggta tattatataagagagaaacaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatc tacagcatggggcagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatcc agccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaaggacacctggccag acgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttg gggtggagecetcaggcteagggcatactacaaactttgccagcaaatccgcctcctgcctccacc aatcgccagacaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggcc atgcagtgg

332

Table 5
SEQ ID NO:	Description	Sequence⁺
411	MCJ mRNA (GenBank Accession No. NM_01323 8.3)	agtcactgccgcggcgccttgagtctccgggccgccttgccatggctgcccgtggtgtcatcgctc cagttggcgagagtttgcgctacgctgagtacttgcagccctcggccaaacggccagacgccgac gtcgaccagcagagactggtaagaagtttgatagctgtaggactgggtgttgcagctcttgcatttgc aggtcgctacgcatttcggatctggaaacctctagaacaagttatcacagaaactgcaaagaagattt caactcctagcttttcatcctactataaaggaggatttgaacagaaaatgagtaggcgagaagctggt cttattttaggtgtaagcccatctgctggcaaggctaagattagaacagctcataggagagtcatgatt ttgaatcacccagataaaggtggatctccttacgtagcagccaaaataaatgaagcaaaagacttgct agaaacaaccaccaaacattgatgcttaaggaccacactgaaggaaaaaaaaagaggggacttcg aaaaaaaaaaaagccctgcaaaatattctaaaacatggtcttcttaattttctatatggattgaccacag tcttatcttccaccattaagctgtataacaataaaatgttaatagtcttgctttttattatcttttaaagatctc cttaaattctataactgatcttttttcttattttgtttgtgacattcatacatttttaagatttttgttatgttctgaa ttcccccctacacacacacacacacàcacacacacacacacgtgcaaaaaatatgatcaagaatgc aattgggatttgtgagcaatgagtagacctcttattgtttatatttgtaccctcattgtcaatttttttttagg gaatttgggactctgcctatataaggtgttttaaatgtcttgagaacaagcactggctgatacctcttgg agatatgatctgaaatgtaatggaatttattaaatggtgtttagtaaagtaggggttaaggacttgttaaa gaaccccactatctctgagaccctatagccaaagcatgaggacttggagagctactaaaatgattca ggtttacaaaatgagccctgtgaggaaaggttgagagaagtctgaggagtttgtatttaattatagtctt ccagtactgtatattcattcattactcattctacaaatatttattgaccccttttgatgtgcaaggcactatc gtgcgtcccctgagagttgcaagtatgaagcagtcatggatcatgaaccaaaggaacttatatgtag aggaaggataaatcacaaatagtgaatactgttagatacagatgatatattttaaaagttcaaaggaag aaaagaatgtgttaaacactgcatgagaggaggaataagtggcatagagctaggctttagaaaaga aaaatattccgataccatatgattggtgaggtaagtgttattctgagatgagaattagcagaaatagat atatcaatcggagtgattagagtgcagggtttctggaaagcaaggtttggacagagtggtcatcaaa ggccagccctgtgacttacactgcattaaattaatttcttagaacatagtccctgatcattatcactttact attccaaaggtgagagaacagattcagatagagtgccagcattgtttcccagtattcctttacaaatctt gggttcattccaggtaaactgaactactgcattgtttctatcttaaaatactttttagatatcctagatgcat ctttcaacttctaacattctgtagtttaggagttctcaaccttggcattattgacatgttaggccaaataatt ttttttgtgggaggtctcttgtgcgttttagatgattagcaataatccctgacctgttatctactaaagact agtcgtttctcatcagttgtgacaacaaaaatggttccagatattgccaaatgccctttagaggacagt aatcgcccccagttgagaaccatttcagtaaaactttaattactattttttcttttggtttataaaataatgat cctgaattaaattgatggaaccttgaagtcgataaaatatatttcttgctttaaagtccccatacgtgtcct actaattttctcatgctttagtgttttcacttttctcctgttatccttgtacctaagaatgccatcccaatccc cagatgtccacctgcccaaagtctaggcatagctgaaggccaagctaaaatgtatccctctttttctgg tacatgcagcaaaagtaatatgaattatcagctttctgagagcaggcattgtatctgtcttgtttggtgtt acattggcacccaataaatatttgttgagtgaatgaataaattcccatagcactttattcttcacatggta cataactataggggctatagcttggtaccttgtgaagcaactcttggtgtaacataccttatttctcatac taaaatgcaagaacctttagagcaaggatcttgccattcatctttgtaacctctttactctggagcacttg catttagcaggcatcataaagttttacgtaccaagaaaatgttgctgttttctgaatactatgcatcaaaa aatgttaccactaatttttaaagctctgctaaggaatattggggcaccctcagatgcaccttttaattgat gtcatattttcctaatccatactttattcatgagaatttgagtcaccccagcattagcttggaatttccttatt tcccatttgctttgcaggtgccttggagtcagatctggttttgaatactatcttcctgttatgtgatcttgg

333

Table 5
SEQ ID NO:	Description	Sequence⁺
		gcagttacttaattttctagtcaataacccgtatctataaaatagagaaaataatcctacacaccgggg cctgttgtggggcggggagaggggggagggatcgcatttggagatatactaatgtaaatgacaagt taattggtgcagcacaccaacatggctcatgtctacatatgtaacaaacctgcacgttgtgcacatgtg ccctagaacttaaagtataataaaaagaaattttaaaaaatcctgtcaaataaggttatagtagagaata aggatgtgtaaagcatttagtcacgtaaatgcttaaaaaaatgtaatttttacttctttcactgcctcattta attagttttatctttaataataccttggattcagggtaaagtttcagttatgtcccagtaatcatttattttacc ctcgaatctgcaatttggatagaacatggtggggacagctcgtctctattccttgcagcattaacagg ctggaggcaccacttctctggccagcaagttgggcctggttgttggctgagagcctcagttcctttct gcacaggttcctctttacataggcttctcaacagggctactagagcatcgtcaccatagcagctgtctt ataacagagagtggtcggtctgagagacaaaaaatggaagctgccaaattgttctgggtctggaaa ctgtcagggcatcacttgtgccatattcagttggcctaagaattacagagcctgcctcgattcaaagg gagaggatagagaggactgaaggaatcagtgctcatctttaatatgcagcaggacaggtttgggatt ttttttcccccttgagtctgtgaaggcattacttaagaacaaagtcaggcatgtataattgaactacagtt acttgaaatataagcccagaaagtttcagataataaatacaactatttttctgctgttacccttgtacctaa agatgccatcctaatccccagatctccacaactatacctacatagtagaaggttaaaatgtatccctctt tttctggtgcatccagcaaaagtaatatcatgaattatgagctctctgagagcaaggatcatatcagtct tgtttattgttgcagtgaacaagtacagttgcagatattcaggagtaattatctaaatggcagtaggctt ataaaactgaattttcaccagccacaccctccccccaactccttatctgtaaaaagcttatttgagtggt tacctgtcttcagtaaagattgcgcttgcatatttgctgtcattgcatattctgcttaattaagctctgttga tattgcagtttctgtgcatacttacatcttagatgcaatctgagggcctaggaaggccttttaaaaataa aacaattccgattgcagagaaagtgtaagtcaaggacagttaattcaaggggaacatagaaagctat ttagattttagttgatggtgccagtcttcagcgtaaagtcaaaagtggagggaagtttagtaaggaaa aaatgttgggcttggaatacattgtttagtcttcaaagcactttactttttatgaaatatattttagacattca gcaaatattgaatacttactatatcaggcagtaaagatataaattcattcttaaaatgtgcaacatgttca aactgaaaaaaatacattcttaaacaggaaactttttccttcatactttttaattaacaagacatataaga gttgcattaatgggcgtgcttatgattgatcacccagcagcatcattagaaataatatattttattcatgt gcagaaatcttttggttgtcctggggaaccttgaacacagaaaagagcttttattgataaggtaattga acacacttgacaattagcttaatatggtttaataccatttgtgggagaagatgaatcagccaggctcttt acgtcaagaatatgaagtttctcttgagtcaaccaacttaagatgagctacggagactgcagtgaaaa gttaaatatccaagtacaccagccaatttcacacagtggaaccatgctgtcctcgggcaccctgcac ctcgcccaacagtcatcaactagatggaggctcctggctgcaaggaggatttgatgggaatgagta aatgtgtcagcatagtccgtcccttctaatggaaaagcaacccaaagagcaaatcctattaatggctg gatcagtatcatctacttgtcaaaaacattccatgaattatgagtcaaaattttatttatggtggcattaca cacattaagagatgaggacttctgttagcataatttattagctggaaaagttgagaaggttctctggact catttttataggtggaacctaagtgatctggataattgcccaccagcaaaattgctgggcatggtgga caaagaaaatgttccttctaatgattttttatgagctgagtagctattgttcccagctgagtgctcttttcct ctttttattgttgctgagcaaaagaatttataaaaagctctttcttttgtattaaaaaccctgctcaattgaa atgcaagttcattaagtaatcttcatttctcttcctgccataataaccctttccctctctgttcgattcaaca gtatctagcagcactgctccaaattttaagtctgaacagactatattacatagatgtagagaaatactca atcttcagcattaagagggagcttaatttcacacgggtggaatatgatcactcaggctagatgttggc cataaatttcaaattagtatctcaacttagcaggggggatcaacagtggcaaacttcaattatgacagg

334

Table 5
SEQ ID NO:	Description	Sequence⁺
		ataaaaatcacatagagatattggttcaatatggacatctaaactataatgctaaaagccaataattaga ataagttcattttaagaaaagcattaataatattagctaacgtttagtacctgtgccaaacattctacctat gttaccttgattttcatagccagcctaagaggtactattatgtatccccattttacaggttaagaaacagg ctcagaggagtttaggatcttttccaagattacatagccagtaagtggtggcactaggaaccaaattc agactctgaatcgcatgctgtttatattatattgcactcattctaaatatgtgggaatcagaatgaaggg gcttgtatgacttttggctcattttttgatgcatgtgacctgggattataaatgtgaaattaggtttacgaa aggatccagtgtcattgtgcatcatgggcaaggagtacctaatctctttaattcttccctggaagcttac gatgtccatccaagtgcacatagcaaaagttctgttgtaaagtttagcagagtgactttctttgactcag agtgatgacggaggaagctttgataagattttatctgaaatgttcatggacaagagctttcaaggaga acatccagagcaaggttctgaagacagctcatgaaggtgaagcagcagacctggcacaagaaatg aagagagagctcagtgtattaaagatgaaaacaagaaaaccgaatatattgaaaggagcagagag gcaatgaaaacaagacaactgaaatgaggtaacttgcagcaattgaaagggaatttcagtacttttat agaattcttaaaaattgtttcctgctgtttattttcaattttgaacagggttatttgtccatgccatacttttttt gccaaattccaaaattgtgtatagttctatagttgtctggtggagtcaatggaactttagttaccagtcta agaatgtgtctttgagattgtccagttaattctctatttccagtagctgtaataaatggtgaaaaggtttct gactcctggagaaagtttctaactccttatgactaatattcataacagacttgtgagttccttgaacatgg atacacctatatgcaagagtgtattccaaagctaactcagtgatctttccatttatctattcttggattagt ggtgcctttgctctttccttctgtaaatgtgaatagttaagagttgactgcagaagtgtttacactttggct tccatgcctctggaatgtttgtgctttggtggtgagatgtgagactatatttgtatagtctgcatctctcag gctgccccagaatgttgtacagtgcagtgctgaagaaagcagcaggtacacacagaaatgcagcc tttcctggttaaccctgcttggatctgagttacactttgtttcctgacttcttgggacttaggtaatcagttt gccttctactctatctcattttgtactcgcttacatactacattcttgtttgggctttcgtttcttcttgtaagc agagattttttaaaatccaatatgtgaaaatacggatgcactacaattaaataaataaaatgctgttgtgt ttgttttgctttaaaattgtaaaggataaacaataagatagttttatctatgtggttttcccgatgcagttaa aataaaacctaatctgctaaaattgaa
412	TAZ (GenBank Accession No. NM-00011 6.5)	gctttccggcggttgcaccgggccggggtgccagcgcccgccttcccgtttcctcccgttccgcag cgcgcccacggcctgtgaccccggcgaccgctccccagtgacgagagagcggggccgggcgc tgctccggcctgacctgcgaagggacctcggtccagtcccctgttgcgccgcgcccccgtccgtcc gtgcgcgggccagtcaggggccagtgtctcgagcggtcgaggtcgcagacctagaggcgcccc acaggccggcccggggcgctgggagcgccggccgcgggccgggtggggatgcctctgcacgt gaagtggccgttccccgcggtgccgccgctcacctggaccctggccagcagcgtcgtcatgggct tggtgggcacctacagctgcttctggaccaagtacatgaaccacctgaccgtgcacaacagggag gtgctgtacgagctcatcgagaagcgaggcccggccacgcccctcatcaccgtgtccaatcacca gtcctgcatggacgaccctcatctctgggggatcctgaaactccgccacatctggaacctgaagttg atgcgttggacccctgcagctgcagacatctgcttcaccaaggagctacactcccacttcttcagctt gggcaagtgtgtgcctgtgtgccgaggagcagaatttttccaagcagagaatgaggggaaaggtg ttctagacacaggcaggcacatgccaggtgctggaaaaagaagagagaaaggagatggcgtcta ccagaaggggatggacttcattttggagaagctcaaccatggggactgggtgcatatcttcccagaa gggaaagtgaacatgagttccgaattcctgcgtttcaagtggggaatcgggcgcctgattgctgagt gtcatctcaaccccatcatcctgcccctgtggcatgtcggaatgaatgacgtccttcctaacagtccg ccctacttcccccgctttggacagaaaatcactgtgctgatcgggaagcccttcagtgccctgcctgt

335

Table 5
SEQ ID NO:	Description	Sequence’
		actcgagcggctccgggcggagaacaagtcggctgtggagatgcggaaagccctgacggacttc attcaagaggaattccagcatctgaagactcaggcagagcagctccacaaccacctccagcctgg gagataggccttgcttgctgccttctggattcttggcccgcacagagctggggctgagggatggact gatgcttttagctcaaacgtggcttttagacagatttgttcatagaccctctcaagtgccctctccgagc tggtaggcattccagctcctccgtgcttcctcagttacacaaaggacctcagctgcttctcccacttgg ccaagcagggaggaagaagcttaggcagggctctctttccttcttgccttcagatgttctctcccagg ggctggcttcaggagggagcatagaaggcaggtgagcaaccagttggctaggggagcaggggg cccaccagagctgtggagaggggaccctaagactcctcggcctggctcctacccaccgcccttgc cgaaccaggagctgctcactacctcctcagggatggccgttggccacgtcttccttctgcctgagctt cccccccaccacaggccctttcctcaggcaaggtctggcctcaggtgggccgcaggcgggaaaa gcagcccttggccagaagtcaagcccagccacgtggagcctagagtgagggcctgaggtctggc tgcttgcccccatgctggcgccaacaacttctccatcctttctgcctctcaacatcacttgaatcctagg gcctgggttttcatgtttttgaaacagaaccataaagcatatgtgttggcttgttgtaaaa
413	ANGPTL3 (GenBank Accession No. NM_01449 5.4)	agaagaaaacagttccacgttgcttgaaattgaaaatcaagataaaaatgttcacaattaagctccttc tttttattgttcctctagttatttcctccagaattgatcaagacaattcatcatttgattctctatctccagag ccaaaatcaagatttgctatgttagacgatgtaaaaattttagccaatggcctccttcagttgggacatg gtcttaaagactttgtccataagacgaagggccaaattaatgacatatttcaaaaactcaacatatttga tcagtctttttatgatctatcgctgcaaaccagtgaaatcaaagaagaagaaaaggaactgagaaga actacatataaactacaagtcaaaaatgaagaggtaaagaatatgtcacttgaactcaactcaaaactt gaaagcctcctagaagaaaaaattctacttcaacaaaaagtgaaatatttagaagagcaactaactaa cttaattcaaaatcaacctgaaactccagaacacccagaagtaacttcacttaaaacttttgtagaaaa acaagataatagcatcaaagaccttctccagaccgtggaagaccaatataaacaattaaaccaacag catagtcaaataaaagaaatagaaaatcagctcagaaggactagtattcaagaacccacagaaattt ctctatcttccaagccaagagcaccaagaactactccctttcttcagttgaatgaaataagaaatgtaa aacatgatggcattcctgctgaatgtaccaccatttataacagaggtgaacatacaagtggcatgtat gccatcagacccagcaactctcaagtttttcatgtctactgtgatgttatatcaggtagtccatggacatt aattcaacatcgaatagatggatcacaaaacttcaatgaaacgtgggagaactacaaatatggttttg ggaggcttgatggagaattttggttgggcctagagaagatatactccatagtgaagcaatctaattat gttttacgaattgagttggaagactggaaagacaacaaacattatattgaatattctttttacttgggaaa tcacgaaaccaactatacgctacatctagttgcgattactggcaatgtccccaatgcaatcccggaaa acaaagatttggtgttttctacttgggatcacaaagcaaaaggacacttcaactgtccagagggttatt caggaggctggtggtggcatgatgagtgtggagaaaacaacctaaatggtaaatataacaaaccaa gagcaaaatctaagccagagaggagaagaggattatcttggaagtctcaaaatggaaggttatactc tataaaatcaaccaaaatgttgatccatccaacagattcagaaagctttgaatgaactgaggcaaattt aaaaggcaataatttaaacattaacctcattccaagttaatgtggtctaataatctggtattaaatccttaa gagaaagcttgagaaatagattttttttatcttaaagtcactgtctatttaagattaaacatacaatcacat aaccttaaagaataccgtttacatttctcaatcaaaattcttataatactatttgttttaaattttgtgatgtg ggaatcaattttagatggtcacaatctagattataatcaataggtgaacttattaaataacttttctaaata aaaaatttagagacttttattttaaaaggcatcatatgagctaatatcacaactttcccagtttaaaaaact agtactcttgttaaaactctaaacttgactaaatacagaggactggtaattgtacagttcttaaatgttgt agtattaatttcaaaactaaaaatcgtcagcacagagtatgtgtaaaaatctgtaatacaaatttttaaac

336

Table 5
SEQ ID NO:	Description	Sequence^4-
		tgatgcttcattttgctacaaaataatttggagtaaatgtttgatatgatttatttatgaaacctaatgaagc agaattaaatactgtattaaaataagttcgctgtctttaaacaaatggagatgactactaagtcacattg actttaacatgaggtatcactataccttatttgttaaaatatatactgtatacattttatatattttaacactta atactatgaaaacaaataattgtaaaggaatcttgtcagattacagtaagaatgaacatatttgtggcat cgagttaaagtttatatttcccctaaatatgctgtgattctaatacattcgtgtaggttttcaagtagaaat aaacctcgtaacaagttactgaacgtttaaacagcctgacaagcatgtatatatgtttaaaattcaataa acaaagacccagtccctaaattatagaaatttaaattattcttgcatgtttatcgacatcacaacagatcc ctaaatccctaaatccctaaagattagatacaaattttttaccacagtatcacttgtcagaatttatttttaa atatgattttttaaaactgccagtaagaaattttaaattaaacccatttgttaaaggatatagtgcccaagt tatatggtgacctacctttgtcaatacttagcattatgtatttcaaattatccaatatacatgtcatatatattt ttatatgtcacatatataaaagatatgtatgatctatgtgaatcctaagtaaatattttgttccagaaaagt acaaaataataaaggtaaaaataatctataattttcaggaccacagactaagctgtcgaaattaacgct gatttttttagggccagaataccaaaatggctcctctcttcccccaaaattggacaatttcaaatgcaaa ataattcattatttaatatatgagttgcttcctctatttggtttcc
414	DGAT2 (GenBank Accession No. NM_00125 3891.1)	tgccccgttgtgaggtgataaagtgttgcgctccgggacgccagcgccgcggctgccgcctctgct ggggtctaggctgtttctctcgcgccaccactggccgccggccgcagctccaggtgtcctagccgc ccagcctcgacgccgtcccgggacccctgtgctctgcgcgaagccctggccccgggggccggg gcatgggccaggggcgcggggtgaagcggcttcccgcggggccgtgactgggcgggcttcagc catgaagaccctcatagccgcctactccggggtcctgcgcggcgagcgtcaggccgaggctgac cggagccagcgctctcacggaggacctgcgctgtcgcgcgaggggtctgggagatggggagtg gcctgcagtgccatcctcatgtacatattctgcactgattgctggctcatcgctgtgctctacttcacttg gctggtgtttgactggaacacacccaagaaaggtggcaggaggtcacagtgggtccgaaactggg ctgtgtggcgctactttcgagactactttcccatccagctggtgaagacacacaacctgctgaccacc aggaactatatctttggataccacccccatggtatcatgggcctgggtgccttctgcaacttcagcac agaggccacagaagtgagcaagaagttcccaggcatacggccttacctggctacactggcaggca acttccgaatgcctgtgttgagggagtacctgatgtctggaggtatctgccctgtcagccgggacac catagactatttgctttcaaagaatgggagtggcaatgctatcatcatcgtggtcgggggtgcggctg agtctctgagctccatgcctggcaagaatgcagtcaccctgcggaaccgcaagggctttgtgaaact ggccctgcgtcatggagctgacctggttcccatctactcctttggagagaatgaagtgtacaagcag gtgatcttcgaggagggctcctggggccgatgggtccagaagaagttccagaaatacattggtttcg ccccatgcatcttccatggtcgaggcctcttctcctccgacacctgggggctggtgccctactccaag cccatcaccactgttgtgggagagcccatcaccatccccaagctggagcacccaacccagcaaga catcgacctgtaccacaccatgtacatggaggccctggtgaagctcttcgacaagcacaagaccaa gttcggcctcccggagactgaggtcctggaggtgaactgagccagccttcggggccaattccctg gaggaaccagctgcaaatcacttttttgctctgtaaatttggaagtgtcatgggtgtctgtgggttattta aaagaaattataacaattttgctaaaccattacaatgttaggtcttttttaagaaggaaaaagtcagtattt caagttctttcacttccagcttgccctgttctaggtggtggctaaatctgggcctaatctgggtggctca gctaacctctcttcttcccttcctgaagtgacaaaggaaactcagtcttcttggggaagaaggattgcc attagtgacttggaccagttagatgattcactttttgcccctagggatgagaggcgaaagccacttctc atacaagcccctttattgccactaccccacgctcgtctagtcctgaaactgcaggaccagtttctctgc caaggggaggagttggagagcacagttgccccgttgtgtgagggcagtagtaggcatctggaatg

337

Table 5
SEQ ID NO:	Description	Sequence⁺
		ctccagtttgatctcccttctgccacccctacctcacccctagtcactcatatcggagcctggactggc ctccaggatgaggatgggggtggcaatgacaccctgcaggggaaaggactgccccccatgcacc attgcagggaggatgccgccaccatgagctaggtggagtaactggtttttcttgggtggctgatgac atggatgcagcacagactcagccttggcctggagcacatgcttactggtggcctcagtttaccttccc cagatcctagattctggatgtgaggaagagatccctcttcagaaggggcctggccttctgagcagca gattagttccaaagcaggtggcccccgaacccaagcctcacttttctgtgccttcctgagggggttg ggccggggaggaaacccaaccctctcctgtgtgttctgttatctcttgatgagatcattgcaccatgtc agacttttgtatatgccttgaaaataaatgaaagtgagaatcctctaaaaaaaaaaaa
596	HBV Genbank Accession No. KC315400. 1	ctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc aagttccggaacagtaaaccctgctccgactactgcctctcccatatcgtcaatcttctcgaggactg gggaccctgtaccgaatatggagagcaccacatcaggattcctaggacccctgctcgtgttacagg cggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctca attttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacctccaatcactcacca acctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcc tgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttcc aggaacatcaactaccagcaccggaccatgcaaaacctgcacaactactgctcaagggacctctat gtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgg gctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgt tcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcca agtctgtacaacatcttgagtccctttataccgctgttaccaattttcttttatctttgggtatacatttaaac cctcacaaaacaaaaagatggggatattcccttaacttcatgggatatgtaattgggagttggggcac tttgcctcaggaacatattgtacaaaaaatcaagcaatgttttaggaaacttcctgtaaacaggcctatt gattggaaagtatgtcaacraattgtgggtcttttggggtttgccgcccctttcacgcaatgtggatatc ctgctttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcct ttctgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgct gacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggct cctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaact tatcggcaccgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctaggatgtgct gccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgac ccatctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgcccgaccacggggc gcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacc tctgcacgtcgcatggagaccaccgtgaacgcccacgggaacctgcccaaggtcttgcataagag gactcttggactttcagcaatgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttactga gtgggaggagttgggggaggaggttaggttaaaggtctttgtactaggaggctgtaggcataaattg gtgtgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaag cctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttggagcttct gtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctct gtatcgggaggccttagagtctccggaacattgttcacctcaccatacggcactcaggcaagcaatt ctgtgttggggtgagttaatgaatctagccacctgggtgggaagtaatttggaagatccagcatcca gggaattagtagtcagctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcaca tttcctgtcttacttttgggagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcc

338

Table 5
SEQ ID NO:	Description	Sequence⁺
		tcctgcatatagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacgaag aggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgca gaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaactttacggg gctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcctgacattcatttgcag gaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagacttaa attaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgta ttatccagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcgggg atcttatataaaagagagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagat ctacagcatgggaggttggtcttccaaacctcgaaaaggcatggggacaaatctttctgtccccaatc ccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactcagaaaatccagattgg gacctcaacccacacaaggacaactggccggacgccaacaaggtgggagtgggagcattcggg ccagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcatattcaca acagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttct ctccacctctaagagacactcatcctcaggccatgcagtggaa
534	ASO 1	GalNAc4-ps-GalNAc4-ps-GalNAc4-po-mA-po- lnGpslnApslnTpslnApslnApsApsAps(5OH)CpsGps(5m)Cps(5m)Cps Gps(5m)CpslnApslnGpslnApscp(5m)C
535	ASO 2	mA-po- lnGpslnApslnTpslnApslnApsApsAps(5OH)CpsGps(5m)Cps(5m)Cps Gps(5m)CpslnApslnGpslnApscp(5m)C
0^ B Voy cr—o ⁺ln = Locked nucleic acid (LNA) = ; InA = Locked nucleic acid (LNA) A; ln(5m)C = ln(5m)C =Locked nucleic acid (LNA)-5 methyl C; lnG= Locked nucleic acid (LNA) G; lnT= Locked nucleic acid (LNA) T; (5m)C=5 methyl C; cp = sep = cyclopropyl; cpC = scpC NH₂ho. /L VI JWV . , , \| N 0 CX poU 0 = cyclopropyl C; scp(5m)C = cyclopropyl-5 methyl C; (50H)C ; po = phosphodiester linkage; ps = phosphorothioate linkage

Table 6. siNA Activity
ds-siNA ID	Sense Strand SEQ ID NO.	Antisense Strand SEQ ID NO.	HepG2.2.15 in vitro EC50*	HepG2.2.15 in vitro CC50 (nM)
ds-siNA-001	307	363	A	>40
ds-siNA-002	308	364	A	>40

339

Table 6. siNA Activity
ds-siNA ID	Sense Strand SEQ ID NO.	Antisense Strand SEQ ID NO.	HepG2.2.15 in vitro EC50*	HepG2.2.15 in vitro CC50 (nM)
ds-siNA-003	309	365	B	>40
ds-siNA-004	310	366	B	>40
ds-siNA-005	311	367	B	>40
ds-siNA-006	312	368	C	>40
ds-siNA-007	313	369	Ά	>40
ds-siNA-008	314	370	A	>40
ds-siNA-009	315	371	B	>40
ds-siNA-010	316	372	A	>40
ds-siNA-011	317	373	B _;	>40
ds-siNA-012	318	374	A	>40
ds-siNA-013	319	375	A	>40
ds-siNA-014	320	376	B	>40
ds-siNA-015	321	377	A	>40
ds-siNA-016	322	377	C	>40
ds-siNA-017	323	377	A	>40
ds-siNA-018	324	378	A	>40
ds-siNA-019	325	378	A	>40
ds-siNA-020	326	379	A	>40
ds-siNA-021	327	379	B	>40
ds-siNA-022	328	380	A	>40
ds-siNA-023	329	380	B	>40
ds-siNA-024	330	381	A	>40
ds-siNA-025	331	382	A	>40
ds-siNA-026	332	383	C	>40
ds-siNA-027	333	384	A	>40
ds-siNA-028	334	385	B	>40
ds-siNA-029	335	386	A	>40
ds-siNA-030	336	387	C	>40
ds-siNA-031	337	388	A	>40
ds-siNA-032	338	388	C	>40
ds-siNA-033	339	389	B	>40
ds-siNA-034	340	389	C	>40
ds-siNA-035	341	390	A	>40
ds-siNA-036	342	391	A	>40
ds-siNA-037	343	392	B	>40
ds-siNA-038	344	393	A	>40
ds-siNA-039	345	394	A	>40
ds-siNA-040	346	395	A	>40
ds-siNA-041	347	396	C	>40
ds-siNA-042	348	397	A	>40

340

Table 6. siNA Activity
ds-siNA ID	Sense Strand SEQ ID NO.	Antisense Strand SEQ ID NO.	HepG2.2.15 in vitro EC50*	HepG2.2.15 in vitro CC50 (nM)
ds-siNA-043	349	398	B	>40
ds-siNA-044	350	399	A	>40
ds-siNA-045	351	400	A	>40
ds-siNA-046	352	401	A	>40
ds-siNA-047	353	402	A	>40
ds-siNA-048	354	403	A	>40
ds-siNA-049	355	404	B	>40
ds-siNA-050	356	405	A	>40
ds-siNA-051	357	406	A	>40
ds-siNA-052	358	406	A	>40
ds-siNA-053	359	407	A	>40
ds-siNA-054	360	407	A	>40
ds-siNA-055	361	408	A	>40
ds-siNA-056	362	409	A	>40
ds-siNA-0164	423	482
*A = EC50 < 0.5 nM; B = 0.5 nM	[ < EC50 < 1; C = EC50 > 1 nm

Table 10. siNA Activity
ds-siNA ID	Sense Strand SEQ ID NO	3' Ligand Monomer⁺	Antisense Strand SEQ ID NO	HepG2.2.15 EC50*	HepG2.2.15 CC50 (nM)	Max HBsAg Knock Down (Logio) **
ds-siNA-057	415	p-(PS)2-GalNac4	445	ND	ND	X
ds-siNA-058	415	p-(PS)2-GalNac4	446	ND	ND	X
ds-siNA-059	415	p-(PS)2-GalNac4	447	ND	ND	Y
ds-siNA-060	416	p-(PS)2-GalNac4	448	ND	ND	Y
ds-siNA-061	416	p-(PS)2-GalNac4	449	ND	ND	Y
ds-siNA-062	416	p-(PS)2-GalNac4	450	ND	ND	Y
ds-siNA-063	416	p-(PS)2-GalNac4	451	ND	ND	X
ds-siNA-064	417	5’-GalNAc4(PS)2-p-TEG-p	452	ND	ND	Y
ds-siNA-065	417	5’-GalNAc4(PS)2-p-HEG-p	452	ND	ND	Y
ds-siNA-066	417	5’-GalNAc4(PS)2-p-(HEGP)2	452	ND	ND	Y

341

Table 10. siNA Activity
ds-siNA ID	Sense Strand SEQ ID NO	3' Ligand Monomer⁺	Antisense Strand SEQ ID NO	HepG2.2.15 EC50*	HepG2.2.15 CC50 (nM)	Max HBsAg Knock Down (Logio) **
ds-siNA-067	417	5'-GalNAc4(PS)2-p-(HEGP)2	452	ND	ND	Z
ds-siNA-068	418	p-(PS)2-GalNac4	453	ND	ND	Y
ds-siNA-069	418	p-(PS)2-GalNac4	454	ND	ND	Y
ds-siNA-070	419	p-(PS)2-GalNac4	455	ND	ND	Y
ds-siNA-071	419	p-(PS)2-GalNac4	456	ND	ND	Y
ds-siNA-072	420	p-(PS)2-GalNac4	457	ND	ND	X
ds-siNA-073	421	p-(PS)2-GalNac4	458	ND	ND	X
ds-siNA-074	422	p-(PS)2-GalNac4	459	ND	ND	Y
ds-siNA-075	423	p-(PS)2-GalNac4	460	ND	ND	Y
ds-siNA-076	423	p-(PS)2-GalNac4	461	ND	ND	Y
ds-siNA-077	423	5’-GalNAc4(PS)2-p-TEG-p	458	ND	ND	Y
ds-siNA-078	423	5’-GalNAc4(PS)2-p-HEG-p	458	ND	ND	X
ds-siNA-079	423	5’-GalNAc4(PS)2-p-(HEGP)2	458	ND	ND	Y
ds-siNA-080	423	p-(PS)2-GalNac4	462	ND	ND	X
ds-siNA-081	423	p-(PS)2-GalNac4	463	ND	ND	X
ds-siNA-082	423	p-(PS)2-GalNac4	447	ND	ND	X
ds-siNA-083	423	5'-GalNAc4(PS)2-p-(HEGP)2	458	ND	ND	Z
ds-siNA-084	423	p-(PS)2-GalNac4	457	ND	ND	X
ds-siNA-085	423	p-(PS)2-GalNac4	464	ND	ND	X
ds-siNA-086	423	p-(PS)2-GalNac4	465	ND	ND	X
ds-siNA-087	423	p-(PS)2-GalNac4	466	ND	ND	Y
ds-siNA-088	423	p-(PS)2-GalNac4	467	ND	ND	Z
ds-siNA-089	423	p-(PS)2-GalNac4	468	ND	ND	Z
ds-siNA-090	423	p-(PS)2-GalNac4	469	B	>1000	X
ds-siNA-091	423	p-(PS)2-GalNac4	470	C	>1000	ND
ds-siNA-092	423	p-(PS)2-GalNac4	471	B	>1000	ND
ds-siNA-093	423	p-(PS)2-GalNac4	472	B	>1000	ND
ds-siNA-094	423	p-(PS)2-GalNac4	473	B	>1000	ND

342

Table 10. siNA Activity
ds-siNA ID	Sense Strand SEQ ID NO	3' Ligand Monomer⁺	Antisense Strand SEQ ID NO	HepG2.2.15 EC50*	HepG2.2.15 CC50 (nM)	Max HBsAg Knock Down (Logio) **
ds-siNA-095	423	p-(PS)2-GalNac4	474	C	>1000	ND
ds-siNA-096	423	p-(PS)2-GalNac4	475	B	>1000	ND
ds-siNA-097	423	p-(PS)2-GalNac4	476	B	>1000	ND
ds-siNA-098	423	p-(PS)2-GalNac4	477	A	>1000	ND
ds-siNA-099	423	p-(PS)2-GalNac4	478	B	>1000	ND
ds-siNA0100	423	p-(PS)2-GalNac4	479	B	>1000	ND
ds-siNA0101	423	p-(PS)2-GalNac4	480	B	>1000	ND
ds-siNA0102	423	p-(PS)2-GalNac4	481	A	>1000	ND
ds-siNA0103	423	p-(PS)2-GalNac4	482	ND	ND	ND
ds-siNA0104	423	p-(PS)2-GalNac4	483	ND	ND	ND
ds-siNA0105	423	p-(PS)2-GalNac4	458	ND	ND	Z
ds-siNA0106	423	p-(PS)2-GalNac4	458	ND	ND	Y
ds-siNA0107	424	p-(PS)2-GalNac4	457	ND	ND	X
ds-siNA0108	424	p-(PS)2-GalNac4	484	ND	ND	X
ds-siNA0109	424	p-(PS)2-GalNac4	485	ND	ND	X
ds-siNA0110	425	p-(PS)2-GalNac4	486	ND	ND	ND
ds-siNA0111	425	p-(PS)2-GalNac4	487	ND	ND	ND
ds-siNA0112	425	p-(PS)2-GalNac4	488	ND	ND	ND
ds-siNA0113	426	p-(PS)2-GalNac4	489	ND	ND	ND
ds-siNA0114	427	p-(PS)2-GalNac4	490	ND	ND	X
ds-siNA0115	428	p-(PS)2-GalNac4	491	ND	ND	Y

343

Table 10. siNA Activity
ds-siNA ID	Sense Strand SEQ ID NO	3' Ligand Monomer⁺	Antisense Strand SEQID NO	HepG2.2.15 EC50*	HepG2.2.15 CC50 (nM)	Max HBsAg Knock Down (Logio) **
ds-siNA0116	429	p-(PS)2-GalNac4	492	ND	ND	ND
ds-siNA0117	429	p-(PS)2-GalNac4	493	ND	ND	ND
ds-siNA0118	429	p-(PS)2-GalNac4	494	ND	ND	ND
ds-siNA0119	430	p-(PS)2-GalNac4	495	ND	ND	X
ds-siNA0120	430	p-(PS)2-GalNac4	496	ND	ND	ND
ds-siNA0121	431	p-(PS)2-GalNac4	497	ND	ND	Y
ds-siNA0122	432	p-(PS)2-GalNac4	498	ND	ND	ND
ds-siNA0123	432	p-(PS)2-GalNac4	500	ND	ND	ND
ds-siNA0124	433	p-(PS)2-GalNac4	501	ND	ND	ND
ds-siNA0125	434	p-(PS)2-GalNac4	502	ND	ND	Y
ds-siNA0126	435	p-(PS)2-GalNac4	502	ND	ND	Y
ds-siNA0127	435	p-(PS)2-GalNac4	503	ND	ND	X
ds-siNA0128	435	p-(PS)2-GalNac4	501	ND	ND	X
ds-siNA0129	435	p-(PS)2-GalNac4	504	ND	ND	Y
ds-siNA0130	435	p-(PS)2-GalNac4	505	ND	ND	Z
ds-siNA0131	435	p-(PS)2-GalNac4	506	ND	ND	Y
ds-siNA0132	435	p-(PS)2-GalNac4	507	ND	ND	Z
ds-siNA0133	435	p-(PS)2-GalNac4	508	ND	ND	Z

344

Table 10. siNA Activity
ds-siNA ID	Sense Strand SEQ ID NO	3' Ligand Monomer⁺	Antisense Strand SEQ ID NO	HepG2.2.15 EC50*	HepG2.2.15 CC50 (nM)	Max HBsAg Knock Down (Logio) **
ds-siNA0134	435	p-(PS)2-GalNac4	509	ND	ND	Z
ds-siNA0135	435	p-(PS)2-GalNac4	510	ND	ND	Y
ds-siNA0136	435	p-(PS)2-GalNac4	511	B	>1000	ND
ds-siNA0137	435	p-(PS)2-GalNac4	512	B	>1000	ND
ds-siNA0138	435	p-(PS)2-GalNac4	513	A	>1000	ND
ds-siNA0139	435	p-(PS)2-GalNac4	514	B	>1000	ND
ds-siNA0140	435	p-(PS)2-GalNac4	515	C	>1000	ND
ds-siNA0141	435	p-(PS)2-GalNac4	516	A	>1000	ND
ds-siNA0142	435	p-(PS)2-GalNac4	517	C	>1000	ND
ds-siNA0143	435	p-(PS)2-GalNac4	518	C	>1000	ND
ds-siNA0144	435	p-(PS)2-GalNac4	519	ND	ND	ND
ds-siNA0145	436	p-(PS)2-GalNac4	520	ND	ND	ND
ds-siNA0146	437	p-(PS)2-GalNac4	502	ND	ND	Y
ds-siNA0147	438	p-(PS)2-GalNac4	501	ND	ND	X
ds-siNA0148	438	p-(PS)2-GalNac4	521	ND	ND	X
ds-siNA0149	438	p-(PS)2-GalNac4	522	ND	ND	X
ds-siNA0150	439	p-(PS)2-GalNac4	523	ND	ND	X
ds-siNA0151	440	p-(PS)2-GalNac4	524	ND	ND	Y

345

Table 10. siNA Activity
ds-siNA ID	Sense Strand SEQ ID NO	3' Ligand Monomer⁺	Antisense Strand SEQ ID NO	HepG2.2.15 EC50*	HepG2.2.15 CC50 (nM)	Max HBsAg Knock Down (Logio) **
ds-siNA0152	441	p-(PS)2-GalNac4	525	ND	ND	Y
ds-siNA0153	441	p-(PS)2-GalNac4	526	ND	ND	X
ds-siNA0154	441	p-(PS)2-GalNac4	527	ND	ND	ND
ds-siNA0155	442	p-(PS)2-GalNac4	525	ND	ND	X
ds-siNA0156	442	p-(PS)2-GalNac4	528	ND	ND	Y
ds-siNA0157	442	p-(PS)2-GalNac4	529	ND	ND	ND
ds-siNA0158	443	p-(PS)2-GalNac4	458	ND	ND	Y
ds-siNA0159	444	p-(PS)2-GalNac4	502	ND	ND	Y
ds-siNA0160	423	p-(PS)2-GalNac4	458	ND	ND	ND
ds-siNA0161	533	p-(PS)2-GalNac4	489	ND	ND	ND
ds-siNA0162	534	p-(PS)2-GalNac4	491	ND	ND	ND
ds-siNA0163	432	p-(PS)2-GalNac4	496	ND	ND	ND
ds-siNA0165	435	p-(PS)2-GalNac4	502	ND	ND	ND
ds-siNA0166	442	p-(PS)2-GalNac4	530	ND	ND	ND
ds-siNA0167	427	p-(PS)2-GalNAc4	491	ND	ND	ND
ds-siNA0168	439	p-(PS)2-GalNac4	531	ND	ND	ND
ds-siNA0169	423	p-(PS)2-GalNac4	532	ND	ND	ND
ds-siNA0170	441	p-(PS)2-GalNAc4	530	ND	ND	ND

346

Table 10. siNA Activity
ds-siNA ID	Sense Strand SEQ ID NO	3' Ligand Monomer⁺	Antisense Strand SEQID NO	HepG2.2.15 EC50*	HepG2.2.15 CC50 (nM)	Max HBsAg Knock Down (Logio) **
ds-siNA0171	442	p-(PS)2-GalNAc4	533	ND	ND	ND
ds-siNA0172	424	p-(PS)2-GalNAc4	536	A	>1	ND
ds-siNA0173	438	None	537
ds-siNA0174	438	None	538
ds-siNA0175	438	None	501
ds-siNA0176	438	p-(PS)2-GalNAc4	537
ds-siNA0177	438	p-(PS)2-GalNAc4	538
ds-siNA0178	438	p-(PS)2-GalNAc4	539
⁺Ligand monomers are attached to the 3 ’ end of the sense strand, unless the ligand monomer is annotated with 5’, in which the ligand monomer is attached to the 5’ end of the sense strand. Linkers are represented as p-(PS)2, (PS)2-p-TEG-p, (PS)2-p-HEG-p, or (PS)2-p-(HEG-p)2. For EC50, A = EC50 < 5 nM; B = 5 nM < EC50 < 10; C = EC50 > 10. *For Max HBsAg knock down, X > 1 logio réduction in HBsAg, Y is 0.5 - 1 logio réduction in HBsAg, and Z is < 0.5 logio réduction in HBsAg.

Claims

1. A short interfering nucleic acid (siNA) molécule comprising:

(i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and the nucléotide at position 3, 5, 7, 8, 9, 10,11, 12, 14, 17, and/or 19 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide; and an antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90% 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence:

(iii) is 15 to 30 nucléotides in length; and (iv) comprises 15 or more modified nucléotides independently selected from a 2’-O-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and the nucléotide at position 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide or wherein at least one modified nucléotide is a 2’-(9-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; or (b) a sense strand comprising a first nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to an RNA corresponding to a target gene, wherein the first nucléotide sequence:

(i) is 15 to 30 nucléotides in length; and (ii) comprises 15 or more modified nucléotides independently selected from a 2’-(9-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-û-methyl nucléotide and at least one modified nucléotide is a 2’-fluoro nucléotide; andan antisense strand comprising a second nucléotide sequence that is at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the RNA corresponding to the target gene, wherein the second nucléotide sequence:

348 (iii) is 15 to 30 nucléotides in length; and (iv) comprises 15 or more modified nucléotides independently selected from a 2’-(9-methyl nucléotide and a 2’-fluoro nucléotide, wherein at least one modified nucléotide is a 2’-O-methyl nucléotide and the nucléotide at position 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide.

2. The siNA of claim 1, wherein:

(i) at least 2, 3, 4, 5, or 6 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides;

(ii) no more than 10, 9, 8, 7, 6, 5, 4, 3, or 2 modified nucléotides of the first nucléotide sequence are 2’-fluoro nucléotides;

(iii) at least 10, 11, 12, 13, 14, 15, 16, 17,18, 19, 20, 21, or 22 modified nucléotides of the first nucléotide sequence are 2’-O-methyl nucléotides;

(iv) no more than 25, 24, 23, 22, 21, 20,19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 modified nucléotides of the first nucléotide sequence are 2’O-methyl nucléotides;

(v) at least 2, 3, 4, 5, or 6 modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides;

(vi) less than or equal to 10, 9, 8, 7, 6, 5, 4, 3, or 2 modified nucléotides of the second nucléotide sequence are 2’-fluoro nucléotides;

(vii) at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 modified nucléotides of the second nucléotide sequence are 2’-O-methyl nucléotides; and/or (viii) less than or equal to 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13,12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 modified nucléotides of the second nucléotide sequence are 2’-(9-methyl nucléotides.

3. The siNA according to claim 1 or 2, wherein at least 1, 2, 3, 4, 5, 6, or 7 nucléotides at position 3, 5, 7, 8, 9, 10, 11, 12, and/or 17 from the 5’ end of the first nucléotide sequence is a 2’-fluoro nucléotide, and/or wherein at least 1, 2, 3, 4, 5, 6, 7, 8, or 9 nucléotides at position 2, 5, 6, 8, 10, 14, 16, 17, and/or 18 from the 5’ end of the second nucléotide sequence is a 2’-fluoro nucléotide.

4. The siNA according to any preceding claim, wherein the sense strand, the antisense strand, or both further comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more phosphorothioate intemucleoside linkages.

349

5. The siNA of claim 4, wherein:

(i) at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 1 and 2 from the 5’ end of the first nucléotide sequence;

(ii) at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 2 and 3 from the 5’ end of the first nucléotide sequence;

(iii) at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 1 and 2 from the 5’ end of the second nucléotide sequence;

(iv) at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 2 and 3 from the 5’ end of the second nucléotide sequence;

(v) at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 1 and 2 from the 3’ end of the second nucléotide sequence; and/or (vi) at least one phosphorothioate intemucleoside linkage is between the nucléotides at positions 2 and 3 from the 3’ end of the second nucléotide sequence.

6. The siNA according to any preceding claim, wherein:

(i) the first nucléotide from the 5’ end of the first nucléotide sequence comprises a 5’ stabilizing end cap;

(ii) the first nucléotide from the 5’ end of the second nucléotide sequence comprises a 5’ stabilizing end cap;

(iii) the first nucléotide from the 5’ end of the first nucléotide sequence comprises a phosphorylation blocker; and/or (iv) the first nucléotide from the 5’ end of the second nucléotide sequence comprises a phosphorylation blocker.

7. The siNA according to any preceding claim, wherein the first nucléotide sequence or second nucléotide sequence comprises at least one modified nucléotide selected from i (LNA), i-* (ScpBNA or “cp”); ⁰ (AmNA), where R is

350

H or alkyl (or AmNA(N-Me)) when R is alkyl);

^h2ⁿ (GuNA); and

GuNA(N-R), R = Me, Et, iPr, tBu , _wherein B is a nucleobase.

8. The siNA according to any preceding claim, wherein the siNA further comprises a galactosamine.

5

9. The. siNA of claim 8, wherein the galactosamine is N-acetylgalactosamine (GalNAc) of

Formula (VII):

R = OH or SH wherein each n is independently 1 or 2.

10. The siNA of claim 8, wherein the galactosamine is N-acetylgalactosamine (GalNAc) of

Formula (VI):

wherein m is 1, 2, 3, 4, or 5;

each n is independently 1 or 2;

p is 0 or 1 ;

each R is independently H;

351 each Y is independently selected from -O-P(=O)(SH)-, -O-P(=O)(O)-, -O-P(=O)(OH)-, and O-P(S)S-;

Z is H or a second protecting group;

either L is a linker or L and Y in combination are a linker; and

11. The siNA according to any one of daims 1-10, wherein the antisense strand, sense strand, first nucléotide sequence, and/or second nucléotide sequence comprises at least one thermally

destabilizing nucléotide selected from:

, and

12. The siNA according to any preceding claim, wherein;

(i) the target gene is a viral gene;

(ii) the target gene is a gene is from a DNA virus.

(iii) the target gene is a gene from a double-stranded DNA (dsDNA) virus;.

(iv) the target gene is a gene from a hepadnavirus;

(v) the target gene is a gene from a hepatitis B virus (HBV);

(vi) the target gene is a gene from a HBV of any one of génotypes A-J; or (vii) the target gene is selected from the S gene or X gene of a HBV.

13. Use of the siNA according to any one of daims 1-12 in the manufacture of a médicament for treating a disease.

14. The use of claim 13, wherein:

(i) the disease is a viral disease;

(ii) the disease is caused by a DNA virus;

(iii) the disease is caused by a double stranded DNA (dsDNA virus);

(iv) the disease is caused by a hepadnavirus;

(v) the disease is caused by a hepatitis B virus (HBV); or

352 (vi) the disease is caused by a HBV of any one of HBV génotypes A-J.

15. The use of claim 13, wherein:

(i) the disease is a liver disease;

(ii) the disease is a nonalcoholic fatty liver disease (NAFLD) or hepatocellular carcinoma (HCC); or (iii) the disease is nonalcoholic steatohepatitis (NASH).

16. A double stranded short interfering nucleic acid (siNA) comprising:

(a) a sense strand comprising 19-21 nucléotides in a nucleic acid sequence that is at least 80% identical to SEQ ID NO: 40, wherein 15 or more of the nucléotides are modified nucléotides independently selected from a 2’-(9-methyl nucléotide and a 2’-fluoro nucléotide, and wherein at least 1 lof the modified nucléotides are a 2’-O-methyl nucléotide and at least 4 of the modified nucléotides are a 2’-fluoro nucléotide; and (b) an antisense strand comprising 19-21 nucléotides in a nucleic acid sequence that is at least 80% complementary to SEQ ID NO: 40, wherein 15 or more of the nucléotides are modified nucléotides independently selected from a 2’-(9-methyl nucléotide and a 2’fluoro nucléotide, and wherein at least 11 of the modified nucléotides are a 2’-O-methyl nucléotide and 4 to 6 of the modified nucléotides are a 2’-fluoro nucléotide.

17. The double stranded siNA of claim 16, wherein:

(a) the nucleotide(s) at position 3, 5, 7, 8, 9, 10, 11, 12, 14,17, or 19 from the 5’ end of the sense strand is a 2’-fluoro nucléotide; and (b) the nucleotide(s) at position 2, 5, 6, 8, 10, 14, 16, 17, or 18 from the 5’ end of the antisense strand is a 2’-fluoro nucléotide.

18. The double stranded siNA of claim 16 or 17, wherein the sense strand comprises SEQ ID NO: 438 or SEQ ID NO: 435, and the antisense strand comprises any one of SEQ ID NOs: 501-519, SEQ ID NO: 537, SEQ ID NO: 538, or SEQ ID NO: 539.

19. A double stranded short interfering nucleic acid (siNA) comprising:

(a) a sense strand comprising 19 nucléotides, wherein 2’-fluoro nucléotides are at positions 5 and 7-9 from the 5’ end of the sense strand, and wherein 2’-O-methyl nucléotides are at positions 1-4, 6, and 10-19 from the 5’ end of the sense strand; and (b) an antisense strand comprising 21 nucléotides, wherein 2’-fluoro nucléotides are at positions 2, 6, 14, and 16 from the 5’ end of the antisense strand, and wherein T-O-

353 methyl nucléotides are at positions 1,3-5,7-13, 15, and 17-21 from the 5’ end of the antisense strand.

20. The double stranded siNA of claim 19 further comprising (i) the nucléotides at positions

1 and 2 and positions 2 and 3 from the 5’ end of the sense strand are connected by

5 phosphorothioate intemucleoside linkages; and (ii) the nucléotides at positions 1 and 2;

positions 2 and 3; positions 19 and 20; and positions 20 and 21 from the 5’ end of the antisense strand are connected by phosphorothioate intemucleoside linkages.

21. The double stranded siNA of claim 19 or 21 further comprising a conjugated moiety attached to the sense strand.

10

22. The double stranded siNA of claim 21, wherein the conjugated moiety is N- acetylgalactosamine (GalNAc).

23. The double stranded siNA of claim 19 or 20, wherein the sense strand comprises SEQ ID NO: 438, and the antisense strand comprises any one of SEQ ID NO: 501, SEQ ID NO: 537, SEQ ID NO: 538, or SEQ ID NO: 539.

15

24. The double stranded siNA of claim 23, wherein the sense strand comprises SEQ ID NO:

438 and the antisense comprises SEQ ID NO: 501.

25. The double stranded siNA of claim 24 further comprising a N-acetylgalactosamine (GalNAc) attached to the 3’ of the sense strand, wherein the GalNAc comprises a structure of Formula (VII):

wherein n is 1, and R is OH.

26. The double stranded siNA of claim 23, wherein the sense strand comprises SEQ ID NO:

438 and the antisense strand comprises any one of SEQ ID NO: 537-539.

354

27. The double stranded siNA of claim 19 or 20, wherein the sense strand is at least 80% identical to SEQ ID NO: 40 and the antisense strand is at least 80% complementary to SEQ ID NO: 40.

28. The double stranded siNA of claim 19 or 20, wherein the sense strand or the antisense strand comprises at least one overhang consisting of 1 or 2 nucléotides.

29. A double stranded short interfering nucleic acid (siNA) molécule comprising:

(a) a sense strand comprising a nucleic acid sequence consisting of SEQ ID NO: 438 or SEQ ID NO: 435, and (b) an antisense strand comprising a nucleic acid sequence consisting of any one of SEQ ID NO: 501, SEQ ID NO: 505, SEQ ID NO: 506, SEQ ID NO: 537, SEQ ID NO: 538, and SEQ ID NO: 539.

30. The double stranded siNA molécule of claim 29 further comprising a Nacetylgalactosamine (GalNAc) attached to the 3 ’ of the sense strand.

31. The double stranded siNA molécule of claim 30, wherein the GalNAc comprises a structure of Formula (VII):

wherein n is 1, and R is OH.

32. A double stranded short interfering nucleic acid (siNA) comprising:

(a) a sense strand of 5’- mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU-p-ps2GalNAc-3’ (SEQ ID NO: 438) and an antisense strand of 5’mApsfUpsmUmGmAfGmAmGmAmAmGmUmCfCmAfCmCmAmCpsmGpsm

A-3’ (SEQ ID NO: 501);

355 (b) a sense strand of 5’- mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU-p-ps2GalNAc-3’ (SEQ ID NO: 438) and an antisense strand of 5’mApsfUpsmUmGmAfGmAfGfAmAmGmUmCfCmAfCmCmAmCpsmGpsmA3’ (SEQ ID NO: 521);

(c) a sense strand of 5’- mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU-p-ps2GalNAc-3’ (SEQ ID NO: 438) and an antisense strand of 5’mApsfUpsmUmGfAmGmAfGmAmAmGmUmCfCmAmCfCmAmCpsmGpsmA3’ (SEQ IDNO: 522);

(d) a sense strand of 5’- mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU-p-ps2GalNAc-3’ (SEQ ID NO: 438) and an antisense strand of 5’mApsf4PpsmUmGmAfGmAmGmAmAmGmUmCfCmAfCmCmAmCpsmGpsm

A-3’ (SEQ ID NO: 537);

(e) a sense strand of 5’- mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU-p-ps2GalNAc-3’ (SEQ ID NO: 438) and an antisense strand of 5’mApsfUpsmUmGmAfGmAmGmAniAmGmUmCf2PmAfCmCmAmCpsmGpsm

A-3’ (SEQ ID NO: 538); or (f) a sense strand of 5’- mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU-p-ps2GalNAc-3’ (SEQ ID NO: 438) and an antisense strand of 5’mApsfUpsmUmGmAfGmAmGmAmAmGmUmCfCmAfXmCmAmCpsmGpsm

A-3’ (SEQ ID NO: 539), wherein fX is

wherein GalNAc comprises a structure of Formula (VII):

356

wherein n is 1, and R is OH.

33. The double stranded siNA of claim 32, comprising a sense strand of 5’mGpsmUpsmGmGfUmGfGfAfCmUmUmCmUmCmUmCmAmAmU-p-ps2- GalNAc-3 ’

5 (SEQ ID NO: 438) and an antisense strand of 5’mApsfUpsmUmGmAfGmAmGmAmAmGmUmCfCmAfCmCmAmCpsmGpsmA-3’ (SEQ ID NO: 501).

34. Use of the double stranded siNA according to any one of claims 16-33 in the manufacture of a médicament for treating hepatitis B virus (HBV).