OA20789A - Novel CRISPR-Associated Protein And Use Thereof - Google Patents

Abstract

The present invention relates to a novel CRISPRassociated protein and a use thereof. A protein represented by an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3, according to the present invention, exhibits the activity of endonucleases, which recognize and cleave an intracellular nucleic acid sequence linked to a guide RNA. Therefore, a novel CRISPRassociated protein of the invention can be used as a different nuclease for genome editing, in a CRISPR-Cas system.

Description

Genome editing is a technique by which the genetic information of a living organism is 10 freely edited. Advances in the field of life sciences and development in genome sequencing technology hâve made it possible to understand a wide range of genetic information. For example, understanding of genes for reproduction of animais and plants, diseases and growth, genetic mutations that cause varions human genetic diseases, and production of biofuels has already been achieved; however, further technological advances must be made to directly utilize 15 this understanding for the purpose of improving living organisms and treating human diseases.

Genome editing techniques can be used to change the genetic information of animais, including humans, plants, and microorganisms, and thus their application range can be dramatically expanded. Genetic scissors, which are molecular tools designed and made to precisely eut desired genetic information, play a key rôle in genome editing techniques, Similar 20 to the next-generation sequencing techniques that took the field of gene sequencing to the next level, use of the gene scissors îs becoming a key technique in increasing the speed and range of utîlîzation of genetic information and creating new industrial fields.

The genetic scissors having been developed so far may be divided into three générations accordîng to the order of their appearance. The first génération of genetic scissors is zinc finger 25 nuclease (ZFN); the second génération of genetic scissors is transcription activator-lîke effector nuclease (TALEN); and the most recently studied, clustered regularly interspaced short palindromie repeat (CRISPR)/CRISPR-assocîated protein 9 (Cas9) is the third génération of genetic scissors.

The CRISPRs are loci containing multiple short direct repeats that are found in the 30 genomes of approximately 40% of sequenced bacteria and 90% of sequenced archaea. The Cas9 protein fonns an active endonuclease when complexed with two RNAs termed CRISPR

RNA (crRNA) and trans-activating crRNA (tracrRNA), thereby slîcing foreign genetic éléments in invading phages or plasmids to protect the host cells. The crRNA is transcribed from the CRISPR element of the host genome that has previously been occupied by foreign invaders.

RNA-guided nucleases derived from this CRISPR-Cas System provide a tool capable of genome edîting. In particular, studies hâve been actively conducted which are related to techniques capable of edîting genomes of cells and organs using a single-guide RNA (sgRNA) and a Cas protein. Recently, Cpfl protein (derived from Prevotella and Francisella 1) was reported as another nuclease protein in the CRISPR-Cas System (B. Zetsche, et al., 2015), which results in a wider range of options in genome editing.

Disclosure of Invention Technîcal Problem

As a resuit of making continuous efforts to develop a protein that is more effective in genome editing than the known nucleases, the présent inventors hâve found a novel CRISPRassociated protein that recognizes and cleaves a target nucleic acid sequence, and thus hâve completed the présent invention.

Accordingly, an object of the présent invention is to provide a novel CRISPR-associated protein that recognizes and cleaves a target nucleic acid sequence.

Solution to Problem

To achîeve the above-mentioned object, the présent invention provides a CasI2a protein having the amîno acid sequence of SEQ ID NO: 1.

In addition, the présent invention provides a Casl2a protein having the amino acid sequence of SEQ ID NO: 1, of which lysine (Lys) at position 925 is substituted with another amino acid.

In addition, the présent invention provides a Casl2a protein having the amino acid sequence of SEQ ID NO: 3.

In addition, the présent invention provides a Cas 12a protein having the amino acid sequence of SEQ ID NO: 3, of which lysine (Lys) at position 930 is substituted with another amino acid.

In addition, the présent invention provides a Cas 12a protein having the amino acid sequence of SEQ ID NO: 1, of which aspartic acid (Asp) at position 877 is substîtuted with another amino acid.

In addition, the présent invention provides a Casl2a protein having the amino acid sequence of SEQ ID NO: 3, of which aspartic acid (Asp) at position 873 is substîtuted with another amino acid.

In addition, the présent invention provides a pharmaceutical composition for treating cancer, comprising as active ingrédients: mgCas!2a; and crRNA that targets a nucleic acid sequence specifically présent in cancer cells.

Advantageous Effects of Invention

The protein represented by the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 3, according to the présent invention, has endonuclease activity that recognîzes and cleaves an intracellular nucleic acid sequence bound to a guide RNA. Therefore, the novel CRISPRassociated protein of the présent invention can be used as another nuclease, which performs genome editing, in the CRISPR-Cas System.

Brief Description of Drawings

FIG. 1 illustrâtes a schematic diagram of a process of discovering Casl2a from metagenome.

FIG. 2A illustrâtes a phylogenetic tree of the discovered Cas 12a.

FIG. 2B illustrâtes structures of novel Casl2a's and AsCasl2a.

FIGS. 3 to 8 illustrate amino acid sequences of existing Casl2a's and the mgCas!2a's of the présent invention, which hâve been aligned using the ESPript program.

FIGS. 9A and 9B illustrate tables obtained by comparing and summarizing the sequence information of the Casl2a’s and the mgCasl2a's of the présent invention.

FIGS. 10 to 12 illustrate results obtained by identifying activity, depending on pH, of the mgCasl2a's according to the présent invention. On the other hand, crRNA #1 in FIG. 10 has the nucléotide sequence of SEQ ID NO: 25, and crRNA #2 in FIG. 11 has the nucléotide sequence of SEQ ID NO: 26.

FIG. 13 illustrâtes a diagram in which a target nucleîc acid sequence and positions where crRNAs bind are indicated.

FIG. 14 illustrâtes results obtained by identifying gene editing efficiency achieved by respective proteins (mock, mgCasl2a-l, and mgCas!2a-2) in a case where crRNA for each of the genes CCR5 and DNMTlîs used.

FIG. 15 illustrâtes results obtained by identifying gene editing efficiency achieved by respective proteins (FnCpfl, mgCas!2a-l, and mgCasl2a-2) în a case where two crRNAs for the respective genes FucT14-l and FucT14-2 are used.

FIGS. 16A and 16B illustrâtes results obtained by identifying DNA cleavage activity of FnCasl2a, WT mgCas!2a-l, or WT mgCas!2a-2 protein.

FIG. 17 illustrâtes results obtained by identifying non-specific DNase functions of existing Cas 12a (AsCasl2a, FnCasl2a, or LbCasl2a) and novel Cas 12a (WT mgCasl2a-l, d_mgCasl2a-l, WTmgCasl2a-2, or d_mgCas!2a-2).

FIGS. ISA and 18B illustrate results obaîned by identifying whether the FnCasl2a, WT mgCasl2a-l, or WT mgCasl2a-2 protein has a non-specific DNase function without crRNA.

FIG. 19 illustrâtes results obtained by identifying whether the mgCasl2a can perform DNA cleavage using 5’ handle of existing Cas 12a.

FIGS. 20A and 20B illustrate DNA cleavage activity of the FnCasl2a, mgCasl2a-l, or mgCasl2a-2 protein in divalent ions.

Best Mode for Carrying out the Invention

In an aspect of the présent invention, there is provided a novel Casl2a protein obtained from metagenome.

As used herein, the term “Casl2a” is a CRISPR-related protein and may also be referred to as Cpfl. In addition, Cpfl is an effector protein found in type V CRISPR Systems. Casl2a, which is a single effector protein, is similar to Cas9, which is an effector protein found în type II CRISPR Systems, in that it combines with crRNA to cleave a target gene. However, the two differ in how they work. The Casl2a protein Works with a single crRNA. Therefore, for the CasI2a protein, there is no need to simultaneously use crRNA and trans-activating crRNA (tracrRNA) or to create a single-guide RNA (sgRNA) by synthetic combination of tracrRNA and crRNA, as in Cas9.

In addition, unlike Cas9, the Casl2a System recognizes a PAM présent at the 5' position of a target sequence. In addition, in the Cas 12a System, a guide RNA that détermines a target also has a shorter length than Cas9. In addition, Casl2a is advantageous in that it générâtes a 5’ overhang (sticky end), rather than a blunt end, at a cleavage site in a target DNA, and thus enables more accurate and diverse gene editing.

Conventionally, the Cas 12a proteins may be derived from the Candidatus genus, the Lachnospira genus, the Butyrivibrio genus, the Peregrinibacteria genus, the Acidominococcus genus, the Porphyromonas genus, the Prevotella genus, the Francisella genus, the Candidatus Methanoplasma genus, or the Eubacterium genus. Specifically, PbCasI2a is a protein derived from Parcubacteria bacterium GWC2011_GWC2_44_17; PeCasl2a is a protein derived from Peregrinibacteria Bacterium GW2011_GWA_33_10; AsCasl2a is a protein derived from Acidaminococcus sp. BVBLG; PmCasl2a is a protein derived from Porphyromonas macacae; LbCasl2a is a protein derived from Lachnospiraceae bacterium ND2006; PcCasl2a is a protein derived from Porphyromonas crevioricanis; PdCasl2a is a protein derived from Prevotella disiens; and FnCasl2a is a protein derived from Francisella novîcida U1I2. However, each Cas 12a protein may hâve different activity depending on the microorganism from which h is derived.

In the présent invention, novel Casl2a's hâve been identified by analyzing genes in metagenomes. Hereinafter, metagenome-derived Casl2a may be referred to as mgCasl2a. Like AsCasl2a, the mgCasl2a of the présent invention includes WED, REC, PI, RuvC, BH, and NUC domains (FIG. 2). In addition, it was identified that similar to previously known Cas 12a proteins, the mgCasl2a protein of the présent invention can perform gene cleavage with a gRNA including crRNA and 5'-handle. It was identified that the mgCas!2a uses 5'-handle RNA having the same sequence as FnCasl2a. Specifïcally, the 5’-handle RNA may hâve a sequence of AAUUUCUACUGUUGUAGAU (SEQ ID NO: 12). However, it was identified that the mgCasl2a works even with a 5'-handle RNA in AsCasl2a and LbCasI2a (FIG. 19).

The mgCasl2a may additionally include a tag for séparation and purification. The tag may be bound to the N-terminus or C-terminus of the mgCasl2a. In addition, the tag may be bound simultaneously to the N-terminus and C-terminus of the mgCas!2a. One spécifie example of the tag may be a 6XHis tag.

As one spécifie example of the mgCasl2a, there is provided a protein having the amino acid sequence of SEQ ID NO; 1. In addition, as long as activity of the mgCasl2a is not changed, délétion or substitution of part of the amino acids may be made therein. Specifïcally, the mgCasl2a may be a protein having the amino acid sequence of SEQ ID NO: 1, of which lysine (Lys) at position 925 is substituted with another amino acid. Here, the other amino acid may be any one selected from the group consisting of arginine (Arg), histîdine (Hîs), aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine (Asn), glutamine (Gin), tyrosine (Tyr), alanine (Ala), isoleucine (Ile), leucine (Leu), valine (Val), phenylalanine (Phe), methionîne (Met), tryptophan (Trp), glycine (Gly), proline (Pro), and cysteine (Cys). Specifically, the protein may hâve the amino acid sequence of SEQ ID NO: 1, of which lysine at position 925 is substituted with glutamine. That is, the protein may hâve the amino acid sequence of SEQ ID NO: 5.

In addition, the gene that encodes the protein having the amino acid sequence of SEQ ID NO: 1 may be a polynucleotide having the nucléotide sequence of SEQ ID NO; 2. In addition, the mgCasl2a having the amino acid sequence of SEQ ID NO: 1, according to the présent invention, may hâve optimal activity at pH 7.0 to pH 7.9.

As another spécifie example of the mgCpfl, there is provided a protein having the amino acid sequence of SEQ ID NO: 3. In addition, as long as activity of the mgCpfl is not changed, délétion or substitution of part of the amino acids may be made therein. Specifically, the mgCpfl may be a protein having the amino acid sequence of SEQ ID NO: 3, of which lysine (Lys) at position 930 is substituted with another amino acid. Here, the other amino acid may be any one selected from the group consisting of arginine (Arg), histidine (Hîs), aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine (Asn), glutamine (Gin), tyrosine (Tyr), alanine (Ala), isoleucine (Ile), leucine (Leu), valine (Val), phenylalanine (Phe), méthionine (Met), tryptophan (Trp), glycine (Gly), praline (Pro), and cysteine (Cys). Specifically, the protein may hâve the amino acid sequence of SEQ ID NO: 3, of which lysine at position 930 is substituted with glutamine. That is, the protein may hâve the amino acid sequence of SEQ ID NO: 6.

The gene that encodes the protein having the amino acid sequence of SEQ ID NO: 3 may be a polynucleotide having the nucléotide sequence of SEQ ID NO: 4.

In addition, the mgCasl2a having the amino acid sequence of SEQ ID NO: 3, according to the présent invention, may hâve optimal activity at pH 7.0 to pH 7.9.

In another aspect of the présent invention, there is provided an mgCasl2a protein with decreased endonuclease activity. One spécifie example thereof may be mgCasl2a having the amino acid sequence of SEQ ID NO: 1, of which aspartic acid (Asp) at position 877 is substituted with another amino acid. Here, the other amino acid may be any one selected from the group consisting of arginine (Arg), histidine (His), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine (Asn), glutamine (Gin), tyrosine (Tyr), alanine (Ala), lysine (Lys), isoleucine (Ile), leucine (Leu), valine (Val), phenylalanine (Phe), méthionine (Met), tryptophan (Trp), glycine (Gly), proline (Pro), and cysteine (Cys). Specifically, the protein may be a 5 protein obtained by substitution of the aspartic acid (Asp) with alanine (Ala).

Another spécifie example of the mgCasl2a protein may be mgCasl2a having the amino acid sequence of SEQ ID NO: 3, of which aspartic acid (Asp) at position 873 is substituted with another amino acid. Here, the other amino acid may be any one selected from the group consisting of arginine (Arg), histidine (His), glutamic acid (Glu), serine (Ser), threonine (Thr), 10 asparagine (Asn), glutamine (Gin), tyrosine (Tyr), alanine (Ala), lysine (Lys), isoleucine (Ile), leucine (Leu), valine (Val), phenylalanine (Phe), méthionine (Met), tryptophan (Trp), glycine (Gly), proline (Pro), and cysteine (Cys). Specifically, the protein may be a protein obtained by substitution of the aspartic acid (Asp) with alanine (Ala). Here, the mgCas!2a with decreased endonuclease activity may be referred to as dead mgCasl2a or d_mgCasl2a. The d_mgCasl2a 15 may hâve the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 14.

In addition, in yet another aspect of the présent invention, there is provided a pharmaceutical composition for treating cancer, comprising as active ingrédients: mgCasl2a; and crRNA that targets a nucleic acid sequence specifically présent in cancer cells. Here, the mgCasl2a may hâve any one amino acid sequence selected from the group consisting of SEQ ID 20 NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 6. As used herein, the term nucleic acid sequence specifically présent in cancer cells refers to a nucleic acid sequence that is not présent in normal cells and is présent only in cancer cells. That is, this term refers to a sequence different from that in normal cells, and the two sequences may differ by at least one nucleic acid. In addition, such a différence may be caused by substitution or délétion of part of 25 the gene. As one spécifie example, the nucleic acid sequence specifically présent in cancer cells may be an SNP présent in cancer cells. A target DNA having the above-mentioned sequence, which is présent in cancer cells, and a guide RNA having a sequence complementary to the target DNA specifically bind to each other.

In partîcular, regard!ng the nucleic acid sequence specifically présent in cancer cells, 30 crRNAs can be created by finding spécifie SNPs, which exist only in cancer cells, through genome sequencing of varions cancer tissues and using the same. This is do ne in a way of exhibitîng cancer cell-specific toxicity, and thus makes it possible to develop patient-specific anti-cancer therapeutic drugs. In addition, the nucleic acid sequence specifically présent in cancer cells may be a gene having high copy number variation (CNV) in cancer cells, unlike normal cells.

One spécifie example of the cancer may be any one selected from the group consisting of bladder cancer, bone cancer, blood cancer, breast cancer, melanoma, thyroid cancer, parathyroid cancer, bone marrow cancer, rectal cancer, throat cancer, laryngeal cancer, lung cancer, esophageal cancer, pancreatic cancer, gastric cancer, tongue cancer, skin cancer, brain tumor, uterine cancer, head or neck cancer, gallbladder cancer, oral cancer, colon cancer, perianal cancer, central nervous System tumor, liver cancer, and colorectal cancer. In particular, the cancer may be gastric cancer, colorectal cancer, liver cancer, lung cancer, and breast cancer, which are known as the five major cancers in Korea.

Here, crRNA that targets the nucleic acid sequence specifically présent in cancer cells may include one or more gRNA sequences. For example, the crRNA may use a gRNA capable of simultaneousiy targeting exons 10 and H of BRCA1 présent in ovarian cancer or breast cancer. In addition, the crRNA may use two or more gRNAs targeting exon II of BRCA1. As such, combination of gRNAs may be appropriately selected depending on purposes of cancer treatment and types of cancer. That is, different gRNAs may be selected and used.

Mode for the Invention

Hereinafter, the présent invention will be described in more detail by way of the following examples. However, the following examples are for illustrative purposes only, and the scope of the présent invention is not limited thereto.

Example 1. Discovery of metagenome-derived Casl2a protein

Metagenome nucléotide sequences were downloaded from the NCBI Genbank BLAST database and built into a local BLASTp database. In addition, 16 Casl2a's and varions CRISPR-related protein (Casl) amino acid sequences were downloaded from the Uniprot database. The MetaCRT program was used to find CRISPR repeats and spacer sequences in the metagenome. Then, only the metagenome sequences having the CRISPR sequence were extracted and their genes were predîcted using the Prodigal program.

Among the predicted genes, those within a range that is 10 kb upstream or downstream of the CRISPR sequence were extracted, and the amino acid sequence of Cas 12a was used to predict a Casl2a homolog among the genes in question. The Casl gene was used to predict whether there was a Cas! homolog upstream or downstream of the Casl2a homolog; and Casl2a genes ranging from 800 aa to 1,500 aa, which had Casl around, were selected. For each of these genes, BLASTp was used in the NCBI Genbank non-redundant database to détermine whether the gene was a gene that had already been reported or whether the gene was a gene having no association with CRISPR at ail.

After removing fragmented Casl2a's that do not start with méthionine (Met), these genes were aligned using a multiple alignment using fast fourier transform (MAFFT) program. Then, a phylogenetic tree was drawn with Neighbor-joining (lOOx bootstrap) using MEGA7. The gene that forms a monophyletic taxon with the previously known Cas 12a gene was selected, and a phylogenetic tree thereof was drawn, together with the amino acid sequence of the existing Casl2a, using MEGA7, maximum-likelihood, and lOOOx bootstrap, to examine their evolutionary relationship. Here, the process of discovering Cas 12a from the metagenome is schematically illustrated in FIG. 1. In addition, the phylogenetic tree of the Casl2a is illustrated in FIG. 2A. Here, a novel protein having the amino acid sequence of SEQ ID NO; I was named WT mgCasl2a-l. In addition, a novel protein having the amino acid sequence of SEQ ID NO: 3 was named WT mgCasl2a-2. In addition, the structures of AsCasl2a, mgCasl2a-l, and mgCasl2a-2 are illustrated in FIG. 2B.

Exampk 2. Production of variants of mgCasl2a

Casl2a candidates were aligned based on the structures of AsCasl2a and LbCasl2a using the ESPript program. For the WT mgCasl2a-l and WT mgCasl2a-2, substitution of part of the amino acids was made to increase their endonuclease activity. The WT mgCas!2a-l, in which the 925^lh amino acid Lys(K) was substituted with GIu(Q), was named mgCas!2a-l. In addition, the WT mgCasl2a-2, in which the 930^th amino acid Lys(K) was substituted with Glu(Q), was named mgCasl2a-2. The resulting variants were subjccted to codon optimization in considération of codon usages of humans, Arabidopsîs, and E. coli, and then a request for gene synthesis thereof was made to Bionics. Here, the nucléotide sequences of the human codonoptimized mgCas!2a-l and mgCasl2a-2 are shown in SEQ ID NO: 7 and SEQ ID NO; 8, respectively. In addition, the amino acid sequences of the existing Casl2a's (AsCasl2a (SEQ ID NO: 9), LbCasl2a (SEQ ID NO: 10), and FnCasl2a (SEQ ID NO: 11)) and the Casl2a candidates (mgCasl2a-l and mgCasl2a-2), which were aligned using the ESPript program, are illustrated in FIGS. 3 to 8; and the results obtained by comparing and summarizing their sequence information are illustrated in FIGS. 9A and 9B.

Then, each of the WT mgCasl2a-l, WT mgCasl2a-2, mgCasl2a-l, and mgCasl2a-2 genes, which had been cloned into pUC57 vector, was again inserted into pET28a-KanR-6xHisBPNLS vector, and then cloning was performed. The cloned vector was transform ed into the E.

coli strains DH 5 a and Rosetta, respectively. A 5'-handle sequence of crRNA was extracted from the metagenome CRISPR repeat sequence. The extracted RNA was synthesized into a DNA oligo. Transcription of the DNA oligomer was performed using the MEGAshortscript T7 RNA transcriptase kit, and a concentration of the transcribed 5-handle was checked by FLUOstar Oméga.

Example 3, Protein expression and purification ml of the E. coli Rosetta (DE3), which was cultured ovemight, was inoculated into 500 ml of liquid TB medium supplemented with 100 mg/ml of kanamycin antîbiotic. The medium was cultured in an incubator at 37°C until the OD600 reached 0.6. For protein expression, treatment with 0.4 uM of isopropyl β-D-l-thiogaiactopyranoside (IPTG) was performed, and then further culture was performed at 22°C for 16 to 18 hours. After centrifugation, the obtained cells were mixed with 10 ml of lysîs buffer (20 mM HEPES pH 7.5, 100 mM KC1, 20 mM imidazole, 10% glycerol, and EDTA-free protease inhibitor cocktail), and then subjected to ultrasoni cation for cell disruption. The disruptîon was centrifuged three times at 6,000 rpm for 20 minutes each, and then filtered through a 0.22 micron filter.

Thereafter, washing and elution were performed using a nickel column (HisTrap FF, 5 ml) and 300 mM imidazole buffer, and the proteins were purified by affinity chromatography. The protein sizes were checked by SDS-PAGE electrophoresis, and dialysis was performed overnight agaînst dialysis buffer (20 mM HEPES pH 7.5, 100 mM KC1, 1 mM DTT, 10% glycerol). Then, the proteins were sélective!y subjected to filtration and concentration (Amicon Ultra Centrifugal Filter 100,000 MWCO) depending on their size. For the proteins, Bradford quantitative method was used to measure their concentration. Then, the proteins were stored at -80°C and used.

Example 4. Identification of pH range suitable for mgCasl2a through cleavage analysis

Xylosyltransferase of lettuce (Lactuca sativa) was amplîfied by PCR to predict a protospacer adjacent motif (PAM), and a guide RNA (gRNA) therefor was designed. For rîbonucleoprotein (RNP) complexes for mgCasl2a-I and mgCasl2a-2, each mgCas!2a protein was mixed with the gRNA at a molecular ratio of 1:1.25 at room température for 20 minutes, to produce each RNP complex. The purified xylosyltransferase PCR product was subjected to treatment with the RNPs at varions concentrations. Then, concentration adjustment was conducted with NEBuffer 1.1 (IX Buffer Components, 10 mM Bis-Tris-Propane-HCl, 10 mM MgCl₂ and 100 pg/ml BSA), NEBuffer 2.1 (IX Buffer Components, 50 mM NaCl, 10 mM Tris

HCl, 10 mM MgCh and 100 pg/ml BSA), and NEBuffer 3.1 (IX Buffer Components, 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCh and 100 pg/ml BSA), and an in vitro cleavage analysis was performed at 37°C. Here, the NEBuffer 1.1, the NEBuffer 2.1, and the NEBuffer 3.1 had pH 7.0, pH 7.9, and pH 7.9 values, respectively, at 25°C. After each reaction was completed, the reaction was stopped by incubation at 65°C for 10 minutes, and the completed reaction was checked by 1.5% agarose gel electrophoresis. The results are illustrated in FTGS. 10 to 12. In FIGS. 10 to 12, the mgCasl2a-l and the mgCasl2a-2 are desîgnated by hemgCasl2a-l and hemgCasl2a-2, respectively. In addition, the target nucleic acid sequence, which is in the xylosyltransferase, and the positions where the crRNAs bind were indicated in a diagram, and this diagram is illustrated in FIG. 13.

As illustrated in FIGS. 10 to 12, in a case where the mgCas!2a-l and crRNA complex was treated with the NEBuffer 1.1, the target dsDNA was cleaved. In addition, in a case where the mgCasl2a-2 and crRNA complex was treated with the NEBuffer l. 1, the target dsDNA was cleaved, From these results, it was found that the mgCasl2a-l and mgCasl2a-2 were active at pH 7.0.

Example 5. Analysis of gene editing efficiency of mgCas!2a in animal cells

Example 5.L Production of RNP including mgCas!2a-l or mgCasl2a-2 for gene editing of CCR5 and DNMT1

HEK 293T cells were cultured in a 5% CO? incubator at 37°C in DMEM medium supplemented with 10% fêtai bovine sérum (FBS) and penicillin-streptomycin (P/S). Each 100 pmole of the mgCasl2a-l protein and the mgCasl2a-2 protein, and 200 pmole of each of CCR5targeting crRNA and DNMT1-targeting crRNA were incubated at room température for 20 minutes, to préparé each RNP, Here, the crRNA sequences for CCR5 and DNMT1 were synthesized by Integrated DNA Technologies (IDT), and are shown in Table 1 below.

[Table 1]

Genes	crRNA sequence (5'-3')
CCR5	CACCGAAUUUCUACUGUUGUAGAUGGAGUGAAGGGAGAGUUUGUCAAUU UUUUG (SEQ ID NO: 12)
DNMT 1	GGUCAAUUUCUACUGUUGUAGAUGCUCAGCAGGCACCUGCCUCUUUU (SEQIDNO: 13)

The cultured HEK293T cells at 2 χ 10⁵ were mixed with 20 μΐ of nucleofection reagent, and then mixed with 10 μΐ of RNP complex. Subsequently, 4D-Nucleofector device (Lonza) was used for transfection. 48 and 72 hours after transfection, genomic DNA was extracted from the cells using PureLink™ Genomic DNA Mini Kit (Invitrogen).

Example 5.2. Sequencing analysis for target site

The genomic DNA extracted in Example 5.1 was amplified using adapter primers for CCR5 or DNMT1 shown in Table 2 below.

[Table 2]

Genes	Adapter primer sequence (5’-3')
CCR5	TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGTATTTCTGTTCAGATCAC (SEQ IDNO: 15)
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCCCATCAATTATAGAAA GCC (SEQ IDNO: 16)
DNMT 1	TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCTGCACACAGCAGGCCTTT G (SEQ IDNO: 17)
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCCAATAAGTGGCAGAGT GC (SEQ IDNO: IS)

Subsequently, purification and sequencing library préparation were performed according to the protocol of Illumina, and then a deep-sequencing analysis was performed on the target site using MinîSeq equipment. The gene editing efficiency achieved by the mgCasl2a-l and mgCasl2a-2 proteins is illustrated in FIG. 14, and the sequencing analysis results for the target 10 site are shown in Table 3 below. As illustrated in FIG. 14, the mgCasl2a-l and mgCasl2a-2 proteins exhibited higher gene editing efficiency than that of the mock protein.

[Table 3]

Samples	Genes	Time	Na me	Total $ν(μκ'ην<.'κ	With both indicatm· seqnences	More (han miniinum ΙΊ'Ι’ψΚΈΚΎ	Insertions	Deletîims	1 miel fréquence	Indel frequent y 1%)
1	CCR5	48h	Mock	137952	137475	137196	0	1X7	1X7 (().!%}	0.1
-)	mgCas 12 a-1	1196X4	119250	l1X952	36	4IX	454(1).4%)	0.4
3	myCas l2a-2	Π23Χ7	112077	1l1X26	S	150	158 (0.1 %)	0.1
4	72 h	Mock	1 39323	13X942	13X647	s	179	1X7(04%)	0 1
Λ	mgCas 12a- !	156705	156159	155X57	39	73 X	777(0.52.4	0.5
6	mgCas!2a-2	15X717	15X392	15X04X	5	237	242(0,2“»)	0.2
7	DNMTl	4Xh	Mock	1411x2	136X56	136469	19	316	335 (0.2%)	0.2
s	mgCas 12a-1	I2236X	I2OS7I	120476	70	424	494(0.4%)	0.4
y	mgCas 12a-2	121928	120592	1202IX	46	509	555 (0.5’!»)	o.5
H)	72 h	Mock		964X0	961 70	0	192	[92 (0.2%l	0.2
II	mgCas 12a -1	126317	123792	123370	T	511	513(0.4%)	0.4
12	mgCas 12a-2	47398	47000	4673X	12	199	211 (0.5%)	0.5

Example 6. Analysis of gene editing efficiency of mgCasl2a in plant cells Example 6.1. Plant protoplast isolation

Tobacco seeds were sterilized by treatment with 50% Clorox for 1 minute. The sterilized seeds were placed on a medium for seed germination and cultured for a week. Then, the seeds were transferred to a magenta box used for culture, and grown for 3 weeks. The light culture condition used was 16 hours of light and 8 hours of darkness, and the seeds were grown at a température of 25°C to 28°C. For the plant, leaves grown for 4 to 6 weeks were used. The leaf was placed on a glass plate, and the leaf apex and petiole were eut therefrom so that only an inner part of the leaf was used. Here, the leaf was eut into pièces of 0.5 mm or smaller. The eut leaf pièces were placed in 10 mL of Enzyme solution and incubated on an orbital shaker (50 rpm) at room température for 3 to 4 hours in the dark.

After incubation, 10 mL of W5 solution was added and carefully mixed. A cell strainer (70 pm) was used to filter the protoplasts présent in the Enzyme solution. The filtered protoplasts were centrifuged at 100 xg for 6 minutes. The supematant was discarded, and the protoplast pellet was carefully suspended by addition of MMG solution. Then, the suspension was placed on ice for 10 to 30 minutes. For a part of the suspension, the number of protoplasts was counted using a Hem cytometer, which îs a counter plate, and a microscope. Subsequently, MMG solution was further added for dilution so that the protoplast concentration reached 2MO⁶ cells/mL. The composition for each of the enzyme solution, MMG solution, and PEG solution is shown in Table 4 below.

[Table 4]

Enzyme solution	20 mL
1.0% Cellulase RIO	200 mg
0.5% Macerozyme RIO	100 mg
0.4 M Mannitol	10 mL (0.8 M mannitol stock solution)
20 mM MES, pH 5.7	4 mL(100 mM MES stock solution, pH 5.7)
20 mM KC1	200 pL (2 M KC1 stock solution)
Combination of the above-mentioned reagents is performed, incubation is performed for 10 minutes at 60°C, and then combination with the following reagents is performed.
lOmM CaCl2-2H2O	200 pL (I M CaCl22H2O stock solution)
0. i % BSA	200 pL (10% BSA stock solution)
MMG solution	10 mL
0.4 M Mannitol	5 mL (0.8 M mannitol stock solution)
4 mM MES, pH 5.7	400 pL(0.1 M MES stock solution, pH5.7)
15mM MgCl2	150 pL (1 M MgCi2 stock solution)
Nuclease-free water	4.45 mL

PEG solution	5 mL
0.2 M Mannitol	1.25 mL (0.8 M mannitol stock solution)
40%W/V PEG-4000	2 g (polyethylene glycol 4000)
100 mM CaCl2-2H2O	500 pL (1 M CaCl2-2H2O stock solution)
Nuclease-free water	1.5 mL
W5 solution	50 mL
154 mM NaCl	3.85 mL (2 M NaCl stock solution)
125 mM CaCl2-2H2O	6.25 mL(l M CaCl2-2H2O stock solution)
5 mM KCI	125 pL (2 M KCI stock solution)
2 mM MES, pH 5.7	500 pL (0.1 M MES stock solution)
Nuclease-free water	39.275 mL

Example 6.2. Sequencing analysis for target site and identification of editing efficiency therefor crRNA, mgCasî2a protein, and NEB buffer 1.1 were added to a 2 mL e-tube to a final volume of 20 pL, and then reaction was allowed to proceed at room température for 10 minutes.

200 pL (5 x 10⁵ cells) of the protoplast obtained in Example 6.1, and the reacted crRNA and mgCasl2 protein (volume 20 pL) were added to an e-tube (2 mL), mixed well, and then cultured for 10 minutes in a clean bench. Subsequently, 220 pL of PEG solution, which was the same volume as the incubated volume, was added thereto and carefully mixed. The mixture was cultured at room température for 15 minutes. Then, 840 pL of W5 solution was added thereto 10 and mixed well. After centrifugation at 100 xg for 2 minutes, the supernatant was discarded.

Then, culture was performed in W5 solution for two days. Then, the cells were harvested and DNA was extracted therefrom.

Using the extracted DNA, the target portion was subjected to PCR, and then the target gene editing efficiency was îdentified by next-generation sequencing (NGS). The results are 15 shown in Table 5 below. As shown in Table 5, the gene editing efficiency achieved by the mgCasl2a-l protein was 1.8-fold higher than that of FnCpfl.

[Table 5]

Target gene	crRNA	Nuclease	Total Sequences	With both indicator sequences	More than minimum frequency	Insertions	Délétions	Indel frequency
FucTM-l	2	none	161551	161421	160896	4	180	184 (0.1%)
mgCas 12 a1	124361	124255	123844	3	168	171 (0.1%)
mgCas 12 a2	99154	99053	98734	0	131	131 (0.1%)
FnCpfl	50060	50022	49808	0	63	63 (0.1%)
4	none	161551	161411	160899	4	178	182 (0.1%)
mgCas 12a- 1	106782	106706	106330	0	1877	1877 (1.8%)
mgCas 12a2	126665	126544	126057	79	885	964 (0.8%)
FnCpfl	64554	64501	64272	15	470	485 (0.8%)
FucT14-2	2	none	49459	49422	49192	2	49	51 (0.1%)
mgCas 12a1	81191	81101	80738	0	90	90 (0.1%)
mgCas 12a2	83694	83614	83286	0	99	99 (0.1%)
FnCpfl	108803	108682	108260	0	112	112(0.1%)
4	none	49459	49427	49199	2	49	51 (0.1%)
mgCas 12a1	54918	54854	54532	6	689	695 (1.3%)
mgCas 12a2	127825	127691	127213	2	143	145 (0.1%)
FnCpfl	64265	64168	63882	0	162	162 (0.3%)

In addition, the gene editing efficiency achieved by using two crRNAs for the tobacco FucT14 genes was identified for each protein. The results are illustrated in FIG. 15. As illustrated in FIG. 15, the gene editing efficiency achieved by the mgCasl2a-l protein was 2-fold hîgher than that of FnCpfl. Here, the crRNAs and primer sequences for the target genes NbFucT14_l and NbFucT14_2 are shown in Tables 6 and 7 below.

[Table 6]

Target Gene	crRNA (primer naine)	crRNA sequence (PAM site)
NbFucT14_l	NbFTal4_l/2-2	TTTGGATAATTTGTACTCTTGTCGATGT (SEQ ID NO: 19)
NbFucT14_2	NbFTa 14_ 1/2-4	TTTAGTCCACAAACAGCTAAGCCCACAT (SEQ ID NO: 20)

[Table 7]

Target gene	Primer name	Sequence	Size (bp)
NbFucT14_l	NGS NbFTal4_l_F	TGAGCTGAAGATGGATTATG (SEQ ID NO: 21)	216
NGS NbFTal4_l_R	TCATGCTTAAGATAAAAGAG (SEQ ID NO: 22)
NbFucT14_2	NGS NbFTal4_2_F	TCATGAGCTTAAGATGGATC (SEQ ID NO: 23)	217
NGS NbFTal4_2_R	GTTTAAGCTAAAAGAACTAC (SEQ ID NO: 24)

Example 7. Comparison of gene editing efficiency between FnCasl2a and mgCasl2a

To form each ribonucleoproteîn (RNP) complex consisting of FnCasl2a, WT mgCasl2a-l or WT mgCasl2a-2 protein, and crRNA, 6 pmol of FnCasl2a, WT mgCas!2a-l, or WT mgCasl2a-2 protein, and 7.5 pmol of crRNA were mixed with NEB1.1 buffer and IX distilled water at room température for 30 minutes. To identify dsDNA cleavage activity using the crRNA-dependent Cas 12a (FnCasl2a, WT mgCasl2a-l, or WT mgCasl2a-2), 0.3 pmol of target dsDNA (linear or circular) was added thereto, and then reaction was allowed to proceed at 37°C for 2 hours. Here, HsCCR5, HsDNMTl, and HsEMXl were used as DNA. In addition, the linear DNAs (SEQ ID NO: 27 to SEQ ID NO: 29) used in the experiment were PCR purified products, and the circular DNAs (SEQ ID NO: 30 to SEQ ID NO: 32) were purified plasmids. SDS and EDTA (gel loading dye, NEB) were added thereto, and then the mixture was stored at 20°C for 10 minutes to stop the réaction. Each DNA was loaded on a 1% agarose gel, and then subjected to electrophoresîs to check the DNA cleavage activity caused by the FnCasl2a, WT mgCasl2a-l, or WT mgCasl2a-2. The results are illustrated in FIGS. 16A (linear DNA) and 16B (circular DNA). In FIGS. 16A and 16B, S dénotés a substrate, and each number indicated at the bottom of the gel dénotés how dark the substrate DN A band is.

Example 8. Identification of non-specific DNase activity of mgCaslla

To identify random DNase functions of the Casl2a (AsCasl2a, FnCasl2a, or LbCasl2a) and the mgCas 12a (WT mgCasl2a-l, d_mgCasl2a-l, WTmgCasl2a-2, or d_mgCasl2a-2), an experîment was performed in the same manner as in Example 7. Here, the d-mgCasl2a-l and the d_mgCasl2a-2 refer to proteins obtained from the WT mgCas!2a-l and the WT mgCasI2a-2, respectively, by substitution of Asp (at position 877 for the WT mgCasl2a-l or at position 873 for the WT mgCas 12a-2) with Ala.

Specifically, to form each ribonucleoprotein (RNP) complex consisting of each of the 7 types of Cas 12a and crRNA, 6 pmol of each Cas 12a protein and 7.5 pmol of crRNA were allowed to react at room température for 30 minutes in the presence of NEB1.1 buffer and IX distilled water. Subsequently, 0.3 pmol of target dsDNA was added thereto, and then reaction was allowed to proceed at 37°C for 12 hours or 24 hours. Here, HsCCR5, HsDNMTl, and HsEMXl were used as DNA. SDS and EDTA (gel loading dye, NEB) were added thereto, and then the mixture was stored at -20°C for 10 minutes to stop the reaction. Each DNA was loaded on a 1% agarose gel, and then subjected to electrophoresis to check the DNA cleavage activîty caused by the 7 types of Cas 12a. Tire results are illustrated in FIG. 17. In FIG. 17, S dénotés a substrate, and each number indicaîed at the bottom of the gel dénotés how dark the substrate DNA band is.

As illustrated in FIG. 17, each ribonucleoprotein complex consisting of the WT mgCas 12a-1, d_mgCasl2a-l, WTmgCasl2a-2, or d_mgCasl2a-2, which is novel Cas 12a, and crRNA exhibited a weaker non-specîfic DNase function than the ribonucleoprotein complex consisting of the AsCasl2a, FnCasl2a, or LbCasl2a, which is existing Cas 12a, and crRNA. In addition, overall, it could be presumed that reaction of the Casl2a RNP with DNA results in a non-specific DNase function.

Example 9, Identification of non-specific DNase function of Casl2a under crRNAfree condition

To identify whether Cas 12a has a random DNase function even without crRNA, for the FnCasI2a, WT mgCas 12a-1, or WT mgCasl2a-2 protein, an experîment was performed in the same manner as in Example 7 with varying times, except that a crRNA-free condition was used. The results are illustrated in FIGS. 18A and 18B. As illustrated in FIGS. 18A and 18B, the FnCasl2a, WT mgCasl2a-l, or WT mgCasl2a-2 protein had a random DNase function even without crRNA, in which the random DNase function of the FnCasl2a protein appeared first.

Example 10. Identification of DNA cleavage function of mgCasl2a using handle of existing Casl2a

To identify whether the new Casl2a (d_mgCas!2a or WT mgCas!2a) can perform DNA cleavage using a handle located at the 5' end of the existing Cas 12a (AsCasl2a, FnCasl2a, or LbCasl2a) sequence, an experiment was performed in the same manner as in Example 7 with varying reaction times, except that the handle of each of the AsCasl2a, FnCasl2a, or LbCasl2a was used. The results are illustrated in FIG. 19.

As illustrated in FIG. 19, in a case where DNA cleavage was performed with the d_mgCasl2a or WT mgCasl2a protein using the handle of the AsCasl2a, FnCasl2a or LbCasl2a, ail d_mgCasl2a or WT mgCas!2a proteins using the three types of handles had a DNA cleavage function, although the DNA cleavage efficiency was slightly different depending on the respective handles. From these results, it was found that for DNA cleavage, the 10 mgCasl2a can use the handle of the AsCasl2a, FnCasl2a, or LbCasl2a.

Example 11, Identification of activity of FnCasl2a or mgCaslla in divalent ions

In addition, to identify DNA cleavage activity of the FnCasl2a, mgCasl2a-l, or mgCasl2a-2 protein in divalent ions (CaCl₂, CoCl₂, CuSO₄, FeCl₂, MnSO₄, NiSO₄, or ZnSO₄), an experiment was performed in the same manner as in Example 4, except that a predetermined 15 amount of divalent ions was used in place of the NEBuffer 1.1. The results are illustrated în FIGS. 20A and 20B. As illustrated in FIGS. 20A and 20B, the FnCasl2a, mgCasl2a-l, or mgCasl2a-2 protein exhibited similar DNA cleavage activity in the same divalent ions.

Claims (1)

1. Claims

   [Claîm 1]

   A Cas 12a protein, comprising the amino acid sequence of SEQ ID NO: 1.

   [Claîm 2]

   The Casl2a protein of daim 1, wherein the Casl2a protein comprising the amino acid sequence of SEQ ID NO: 1 is encoded by the nucléotide sequence of SEQ ID NO: 2.

   10 [Claîm 3]

   The Cas 12a protein of claîm 1, wherein the protein has endonuclease activity.

   [Claîm 4]

   The Cas 12a protein of daim 1, wherein the Cas 12a protein comprising the amino acid 15 sequence of SEQ ID NO: 1 has optimal activity at pH 7.0 to pH 7.9.

   [Claîm 5]

   A Cas 12a protein, comprising the amino acid sequence of SEQ ID NO: 1, of which lysine (Lys) at position 925 is substituted with another amino acid.

   20 .A

   [Claîm 6]

   The Cas 12a protein of daim 5, wherein the other amino acid is any one selected from the group consisting of arginine (Arg), histidîne (His), aspartîc acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine (Asn), glutamine (Gin), tyrosine (Tyr), alanine (Ala), ’5 isoleucine (Ile), leucine (Leu), valine (Val), phenylalanine (Phe), méthionine (Met), tryptophan (Trp), glycine (Gly), proline (Pro), and cysteine (Cys).

   [Claim 7]

   A Cas 12a protein, comprising the amino acid sequence of SEQ ID NO: 3.

   [Claim 8]

   The Cas 12a protein of claim 7, wherein the Cas 12a protein comprising the amino acid sequence of SEQ ID NO: 3 is encoded by the nucléotide sequence of SEQ ID NO: 4.

   [Claim 9]

   The Casl2a protein of claim 7, wherein the protein has endonuclease activity.

   [Claim 10]

   The Casl2a protein of daim 7, wherein the Casl2a protein comprising the amino acid sequence of SEQ ID NO: 3 has optimal activity at pH 7.0 to pH 7.9.

   [Claim 11]

   A Casl2a protein, comprising tire amino acid sequence of SEQ ID NO: 3, of which lysine (Lys) at position 930 is substituted with another amino acid.

   [Claim 12]

   The Cas 12a protein of claim 11, wherein the other amino acid is any one selected from the group consisting of arginine (Arg), histidine (His), aspartic acid (Asp), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine (Asn), glutamine (Gin), tyrosine (Tyr), alanine (Ala), isoleucine (Ile), leucine (Leu), valine (Val), phenylalanine (Phe), méthionine (Met), tryptophan (Trp), glycine (Gly), proline (Pro), and cysteine (Cys).

   [Claim 13]

   A Casl2a protein, comprising tire amino acid sequence of SEQ ID NO: I, of which aspartic acid (Asp) at position 877 is substituted with another amino acid.

   [Claim 14]

   The Cas 12a protein of claim 13, wherein the other amino acid is any one selected from the group consisting of arginine (Arg), histidine (His), glutamic acid (Glu), serine (Ser), threonine/Thr), asparagine (Asn), glutamine (Gin), tyrosine (Tyr), alanine (Ala), lysine (Lys), isoleucine (Ile), Icucine (Leu), valine (Val), phenylalanine (Phe), méthionine (Met), tryptophan (Trp), glycine (Gly), proline (Pro), and cysteine (Cys).

   [Claim 15]

   The Cas 12a protein of claim 13, wherein the protein has decreased endonuclease activity.

   [Claim 16]

   A Cas 12a protein, comprising the amino acid sequence of SEQ ID NO: 3, of which aspartic acid (Asp) at position 873 is substituted with another amino acid.

   [Claim 17]

   The Cas 12a protein of claim 16, wherein the other amino acid is any one selected from the group consîstmg of arginine (Arg), histidine (His), glutamic acid (Glu), serine (Ser), threonine (Thr), asparagine (Asn), glutamine (Gin), tyrosine (Tyr), alanine (Ala), lysine (Lys), isoleucine (Ile), leucine (Leu), valine (Val), phenylalanine (Phe), méthionine (Met), tryptophan (Trp), glycine (Gly), proline (Pro), and cysteine (Cys).

   [Claim 18]

   The Cas 12a protein of claim 16, wherein the protein has decreased endonuclease activity.

   [Claim 19]

   A pharmaceutical composition for treating cancer, comprising as active ingrédients:

   mgCasI2a; and crRNA that targets a nucleic acid sequence specifically présent in cancer cells.

   [Claim 20]

   The pharmaceutical composition of claim 19, wherein the mgCasl2a lias any one amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 6.