OA20659A - Chimeric filovirus vaccines. - Google Patents

Abstract

The present invention relates to polynucleotides comprising a sequence of a live, infectious, attenuated Flavivirus wherein a nucleotide sequence encoding at least a part of a Filovirus glycoprotein is located at the intergenic region between the E and NS1 gene of said Flavivirus, such that a chimeric virus is expressed, characterised in that the encoded sequence C terminally of the E protein of said Flavivirus and N terminally of the signal peptide of the NS1 protein of said Flavivirus comprises in the following order: a further signal peptide of a Flavivirus NS1 protein, a Filovirus glycoprotein wherein the N terminal signal peptide is absent, a TM domain of a Flaviviral E protein.

Description

CHIMERIC FILOVIRUS VACCINES

Field of the invention

The invention relates to chimeric Flavivirus based vaccines. The invention further relates to vaccines against filoviruses such as Ebola.

Background of the invention

Currently, there is no licensed prophylaxis ortreatment available against Ebola disease (EVD). The most advanced vaccine candidate against Ebola virus (EBOV) is a recombinant vesicular stomatitis Indiana virus (VSV) vectored vaccine expressing the Ebola glycoprotein (G protein or GP) from Zaïre ebolavirus called rVSV-ZEBOV. In addition to rVSV-ZEBOV and, other approaches that hâve been used to generate a vaccine involve the use of human or chimpanzee adenovirus or modified vaccinia virus Ankara (MVA) as vector to express the Ebola GP.

Although a wide range of approaches had been developed to generate a Ebola vaccine, until now, yellow fever 17D has never been used as vector to engineer an Ebola vaccine.

Most of the main vaccine candidates mentioned above require multiples doses to achieve a potent immune response and get full protection. In addition, the requirement of a cold chain to preserve them poses a significant obstacle to implement these vaccines in the African countries where are required. The ring vaccination with rVSV-ZEBOV which needs to be stored at -80C, showed that might not be practical in the field. Besides, there are outstanding questions regarding the long-term safety and immunogenicity of the vaccine (McWilliams étal. (2019) Cell reports 26, 1718-1726.

Summary of the invention

The présent invention discloses a live-attenuated yellow fever vaccine strain (YFV-17D) as vector to engineer a transgenic vaccine by inserting the Ebola glycoprotein (GP) from Makona strain between YF-E/NS1 as follows: the Nterminal (Nt) signal peptide (SP) of Ebola-GP was deleted, the first 9 amino acids of NSI (27 nucléotides) were added Nt of Ebola-GP to allow proper release of Ebola-GP protein, the Ebola-GP cytoplasmatic domain was preserved and fused to the WNV transmembrane domain 2. The resulting plasmid launches viable live-attenuated viruses expressing functional Ebola-GP and YFV17D proteins. The plasmid is thermostable and can be used directly as vaccine, or as stable seed for production of a similar live vaccine in tissue culture or comparable substrate following transfection of said construct. The vaccine induced immune response against both Ebola and YFV after one-single shot. In addition, a second construct was generate in the same way but, in this case, the mucin like domain (MLD) of GP1 was deleted. Also constructs carrying the glycoprotein genes from different filoviruses (BDBV, SUDV, TAFV, RESTV, MARV, RAVV and MLAV) are being generated.

The present invention provides vaccine inducing Fiavivirus (e.g. YFV) and filovirus (e.g. Ebola) virus spécifie immunity. The constructs can also be used as stable seed for the production of tissue culture-derived live-attenuated vaccine. Based on the YFV-Ebola constructs vaccines against other filoviruses (e.g. Marburg virus, MARV) can be generated against which no vaccines exist yes.

The invention is summarised in the following statements:

1. A polynucleotide comprising a sequence of a live, infectious, attenuated Fiavivirus wherein a nucléotide sequence encoding at least a part of a Filovirus glycoprotein is located at the intergenic région between the E and NSI gene of said Fiavivirus, such that a chimeric virus is expressed, characterized in that the encoded sequence C terminally of the E protein of said Fiavivirus and N terminally of the signal peptide of the NSI protein of said Fiavivirus comprises in the following order :

- a further signal peptide of a Fiavivirus NSI protein,

- a filovirus glycoprotein wherein the N terminal signal peptide is absent,

- a TM domain of a flaviviral E protein (typically TM2).

2. The polynucleotide according to statement 1, wherein the mucin like domain (MLD) of the filovirus glycoprotein is absent.

3. The polynucleotide according to statement 1 or 2, wherein the Fiavivirus is Yellow Fever virus, typically the YF17D strain.

4. The polynucleotide according to statement 1 or 2, wherein live, infectious, attenuated Fiavivirus is a chimeric virus.

5. The polynucleotide according to any one of statements 1 to 4, wherein the fiiovirus is a mononegavirus.

6. The polynucleotide according to any one of statements 1 to 5, wherein the fiiovirus is selected from the group consisting of BDBV, SUDV, TAFV, RESTV, MARV, RAVV, MLAV.

7. The polynucleotide according to one of statements 1 to 5, wherein the fiiovirus in an Ebola virus.

8. The polynucleotide according to statement 7, wherein the Ebola virus is the Ebola Makona strain.

9. The polynucleotide according to any one of statements 1 to 8, wherein the nucléotide sequence of the glycoprotein is codon optimized for improved expression in mammalian cells.

10. The polynucleotide according to any one of statements 1 to 9, wherein the signal peptide of the NSI protein of the live, infectious, attenuated Flavivirus, comprises or consists of the sequence DQGCAINFG [SEQ ID NO: 9], 11. The polynucleotide according to any one of statements 1 to 10, wherein the TM2 domain of a flaviviral E protein is from West Nile virus.

12. The polynucleotide according to any one of statements 1 to 11, wherein the TM2 domain of a flaviviral E protein has the sequence RSIAMTFLAVGGVLLFLSVNVHA [SEQ ID NO: 10].

13. The polynucleotide according to any one of statements 1 to 12, wherein the Glycoprotein lacks the N terminal signal sequence of SEQ ID NO 6.

14. The polynucleotide according to any one of statements 1 to 13, wherein the Glycoprotein lacks the mucln like domain of SEQ ID NO:7

15. The polynucleotide according to any one of statements 1 to 13, wherein the sequence of the chimeric virus comprises at the junction of Flavivirus E gene NSI signal peptide and the Ebola glycoprotein the sequence of [SEQ ID NO:11],

16. The polynucleotide according to any one of statements 1 to 14, wherein the sequence of the chimeric virus comprises at the junction of the Ebola glycoprotein and the WNV TM2 domain the sequence of SEQ ID NO: 12].

17. The polynucleotide according to any one of statements 1 to, wherein the sequence of the chimeric virus comprises at the junction of the WNV TM2 domain and the NSI protein the sequence of SEQ ID NO: 13],

In preferred embodiments the junctions connecting the flavirus NSI signal sequence, the Filovirus G protein, the TM protein and the second NSI signal sequence provide a fingerprint for the encoded proteins. Thus embodiments of encoded sequences can be defined by sequences having the sequence of SEQ ID NO:2 or SEQ ID NO: 4, comprising the sequences with SEQ ID NO: 11, SEQ ID: NO: 12 and SEQ ID NO: 13; and wherein outside SEQ ID NO: 11, SEQ ID: NO 12 and SEQ ID NO13 , a number of amino acids may differ from SEQ ID NO:2 or SEQ ID N0:4, e.g. differing up to 20, up to 10, or up to 5 compared to SEQ ID NO:2 or SEQ ID NO: 4, or e.g. having a sequence identity of at least 95 %, 96 %, 97 %, 98% or 99 % with SEQ ID NO:2 or SEQ ID NO:4.

18. The polynucleotide according to any one of the statements 1 to 17, which is a bacterial artificial chromosome.

19. A polynucleotide in accordance to any one of statement 1 to 18, for use as a médicament.

20. The polynucleotide for use as a médicament in accordance with statement 19, wherein the médicament is a vaccine.

21. A polynucleotide sequence in accordance to any one of statement 1 to 18, for use in the vaccination against a Filovirus.

22. A chimeric lîve, infectious, attenuated Flavivirus wherein at least a part of a Filovirus glycoprotein is inserted located between the E and NSI protein of said Flavivirus, such that C terminally of the E protein and N terminally of the signal peptide of the NSI protein the virus comprises in the following order :

a) a further signal peptide of a Flavivirus NSI protein,

b) a filovirus glycoprotein protein lacking a functional signal peptide , and c) a TM domain of a flaviviral E protein.

23. A chimeric virus in accordance to statement 22, for use as a médicament. 24. A chimeric virus in accordance to statement 22, for use in the prévention of a filovirus infection.

25. A chimeric virus encoded by a nucléotide in accordance to statement 22, for use in the prévention of a filovirus and in the prévention of the Flavivirus infection.

26. A method of preparing a vaccine against a filovirus infection, comprising the steps of:

- providing a BAC which comprises:

an inducible bacterial ori sequence for amplification of said BAC to more than 10 copies per bacterial cell, and a viral expression cassette comprising a cDNA of a yellow fever filovirus chimeric virus according to any one of statements 1 to 15, and comprising cisregulatory éléments for transcription of said viral cDNA in mammalian cells and for processing ofthe transcribed RNA into infectious RNA virus,

- transfecting mammalian cells with the BAC of step a) and passaging the infected cells,

-validating replicated virus of the transfected cells of step b) for virulence and the capacity of generating antibodies and inducing protection against rabies infection,

- cloning the virus validated in step c into a vector, and

- formulating the vector into a vaccine formulation.

T7. The method according to statement 26, wherein the vector is BAC, which comprises an inducible bacterial ori sequence for amplification of said BAC to more than 10 copies per bacterial cell.

Detailed description

Figure legends

Figure 1: Schematic représentation of 1) PLLAV-YFV17D-Ebola-GP and 2) PLLAV-YFV17D-Ebola-deltaMLD.

Figure 2: A) Plaque phenotype of YFV17D-Ebola-GP compared to YFV17D. B) Virus stability: RT-PCR analysis of the virus samples harvested during serial passaging (in BHK-21J and VeroE6) of the YFV17D-Ebola-GP virus. C+, control positive PLLAV-YFV17D-Ebola-GP; -RT: RT-PCR reaction without reverse transcriptase; RNA: RT-PCR reaction with the virus RNA.

Figure 3: A) Schematic vaccination schedule. Ifnar(-/-) mice (n=5) were intraperitoneal (IP) or subcutaneous (SC) vaccinated with PLLAV-YFV17DEbola-GP (2.5 pg) or YFV17D-Ebola-GP (250 PFU). B) Humoral immune response in Ifnar(-/-) mice 28 days after vaccination with YFV17D-Ebola-GP (LAV) or PLLAV-YFV17D-Ebola-GP. Represented numbers are the amount of animais that show séroconversion according to an indirect immunofluorescence assay (IIFA) against Yellow Fever (Euroimmune) or Ebola (în-house).

Figure 4: Analysis of cellular immunity in vaccinated Ifnar(-/-) mice. A) Représentative IFN-gamma ELISPOT wells after 48 hours of splénocyte stimulation with the indicated antigen. B) Spots per six hundred thousand splénocytes in IFN-gamma ELISPOT after 48 hours stimulation with the indicated antigen. For each mouse, samples were analysed in duplicates and values are normalized by subtracting the number of spots in control wells (ovalbumin stimulated).

Figure 5: A) Schematic vaccination schedule. B) Table showing the Ebola antibody titres in sérum samples harvested at 28 days post-vaccination of ifnar(-/-) mice vaccinated with YFV17D-Ebola-GP. C) Représentative pictures of HEK293T cells transfected with pCMV-Eboia-GP-IRES-GFP construct to express GFP (green) and Ebola GP that was stained in red with a commercial polyclonal antibody against Ebola-GP or with sérum sample from îfnar(-/-) mice vaccinated with YFV17D-Ebola-GP.

Figure 6: Spots per six hundred thousand splénocytes in IFN-gamma ELISPOT after 48 hours of stimulation with the indicated antigen. For each mouse, samples were analysed in duplicates and values are normalized by subtracting the number of spots in control wells (ovalbumin stimulated).

Figure 7: A) Schematic vaccination schedule. B) Analysis of cellular immunity in vaccinated AG 129 mice. Représentative IFN gamma ELISPOT wells after 48 hours of stimulation of splénocytes with the indicated antigen. For each mouse, samples were anaiysed in duplicates and values are normalized by subtracting the number of spots in control wells (ovalbumin stimulated).

The présent invention is exemplified for Yellow Fever virus, but is also applicable using other viral backbones of Flavivirus species such as, but not limited to, Japanese Encephalitis, Dengue, Murray Valley Encephalitis (MVE), St. Louis Encephalitis (SLE), West Nile (WN), Tick-borne Encephalitis (TBE), Russian Spring-Summer Encephalitis (RSSE), Kunjin virus, Powassan virus, Kyasanur Forest Disease virus, Zika virus, Usutu virus, Wesselsbron and Omsk Hémorrhagie Fever virus.

The invention is further applicable to Fiaviviridae, which comprises the genus Flavivirus but also the généra, Pegivirus, Hepacivirus and Pestivirus.

The genus Hepacivirus comprises e.g. Hepacivirus C (hepatitis C virus) and Hepacivirus B (GB virus B)

The genus Pegivirus comprises e.g. Pegivirus A (GB virus A), Pegivirus C (GB virus C), and Pegivirus B (GB virus D).

The genus Pestivirus comprises e.g. Bovine virus diarrhea virus 1 and Classical swine fever virus (previously hog choiera virus).

The Flavivirus which is used as backbone can itself by a chimeric virus composed of parts of different Fiaviviruses.

For example the C and NS1-5 région are from Yellow Fever and the prME région is of Japanese encephalitis or of Zika virus.

The présent invention is exemplified for the G protein of Ebola virus but is also applicable to G proteins of other filoviruses. Filoviruses suitable in the context of the présent invention are Cuevaviruses such as Llovîu cuevavirus (LLOV), Dianloviruses such as Mënglà virus (MLAV), Ebolaviruses such as Bundibugyo Ebolavirus (BDBV), Reston ebolavirus (RESTV), Sudan ebolavirus (SUDV), Taï Forest ebolavirus (TAFV), Zaïre ebolavirus (EBOV), and Marburgviruses such as Marburg virus (MARV) and Ravn virus (RAVV).

The présent invention relates to nucléotide sequence and encoded proteins wherein within the copy DNA (cDNA) or RNA of a Flavivirus a glycoprotein of an fîlovirus is inserted (Also referred to as G protein or GP). The structure and function of Fîlovirus giycoproteins is reviewed for example in Marin étal. (2016) Antiviral Res. 135, 1-14.

The Ebola glycoprotein originates from a GP1,2 RNA transcript which codes for a GPO precursor. mRNAs are then translated into the GPO precursor, which transits through the endoplasmic réticulum and the Golgi apparatus, where it is cleaved by furin-like protease(s) into two proteins, GP1 and GP2. These two proteins together form a trimeric chalice structure made of three GP1 and three GP2 subunits assembled by GP1/GP2 and GP2/GP2 interactions. The bowl of the chalice is shaped by the GP1 subunits, while GP2 organizes and anchors the complex to the membrane. In the trimer, GPl,2s are bound to each other by disulfide bonds

The ectodomain GP1 is constituted of a core protein and a mucin-like domain (MLD), which ts largely glycosylated.

The core of GP1 is subdivided into three domains: the glycan cap, the head, and the base (Lee et al. (2008) Nature 454, 177-182). The glycan cap is the outer part of GP1 forming the chalice. The head supposedly helps structuring the metastable pre-fusion conformation. This part is exposed to the host membrane surface carrying the putative RBS. The base subdomaîn supports the linkage with GP2 and stabilizes the metastable pre-fusion conformation. The trans-membrane GP2 protein anchors the complex to the viral membrane, but also manages virus entry and fusion. Its structure incorporâtes a transmembrane domain, a short cytoplasmic tail, an internai fusion loop defined by a disulfide bound between GP2 Cys511 and Cys556, and two heptad repeat régions (HRR1 and HRR2) surroundîng the fusion peptide. This domain constitutes the unstable pre-fusion conformation of GP2, which rearranges itself at low pH to trigger fusion. To maintain the structure in the pre-fusion State, the GP1 head packs the GP2 hydrophobie fusion peptide and stabilizes GP2.

The constructs of the present invention allow a proper présentation of the encoded insert into the ER and its proteolytic processing.

The invention is now further described for embodiments wherein a Flavivirus is used as backbone and a G protein of Ebola virus as insert.

The high sequence identity between G proteins of different filovlruses présents no problems to the skilled person to identify in related sequences the sequence éléments corresponding to those present in Ebola virus G protein.

Flavivîruses hâve a positive single-strand RNA genome of approximately 11,000 nucléotides in length. The genome contaîns a 5' untranslated région (UTR), a long open-reading frame (ORF), and a 3' UTR. The ORF encodes three structural (capsîd [C], precursor membrane [prM], and envelope [E]) and seven nonstructural (NSI, NS2A, NS2B, NS3, NS4A, ΝΞ4Β, and NS5) proteins. Along with genomlc RNA, the structural proteins form viral particles. The non-structural proteins participate in viral polyproteîn processing, réplication, virion assembly, and évasion of host immune response. The signal peptide at the C terminus of the C protein (C-signal peptide; also called C-anchor domain) régulâtes Flavivirus packaging through coordination of sequential cleavages at the N terminus (by viral NS2B/NS3 protease in the cytoplasm) and C terminus (by host signalase in the endoplasmic reticulum [ER] lumen) of the signal peptide sequence.

The positive-sense singie-stranded genome is translated into a single polyprotein that is co- and post translationally cleaved by viral and host proteins into three structural [Capsid (C), premembrane (prM), envelope (E)], and seven non-structural (NSI, NS2A, NS2B, NS3, NS4A, NS4B, NS5) proteins. The structural proteins are responsible for forming the (spherical) structure of the virion, initiating virion adhesion, internalization and viral RNA release into cells, thereby initiating the virus life cycle. The non-structural proteins on the other hand are responsible for viral réplication, modulation and évasion of immune responses in infected cells, and the transmission of viruses to mosquitoes. The intra- and inter-molecular interactions between the structural and nonstructural proteins play key rôles in the virus infection and pathogenesis.

The E protein comprises at its C terminal end two transmembrane sequences, indicated as TM1 and TM2 in e.g. figure 6.

NSI is translocated into the lumen of the ER via a signal sequence corresponding to the final 24 amino acids of E and is reieased from E at its amino terminus via cleavage by the ER résident host signal peptidase (Nowak étal. (1989) Virology 169, 365-376). The NSI comprises at its C terminal a 89 amino acids signal sequence which contains a récognition site for a protease (Muller & Young (2013) Antiviral Res. 98, 192-208)

The constructs of the présent invention are chimeric viruses wherein an Ebola G protein is inserted at the boundary between the E and NSI protein. However additional sequence éléments are provided N terminally and C terminally of the G protein insert.

The invention relates to polynucleotide comprising a sequence of a live, infectious, attenuated Flavivirus wherein a nucléotide sequence encoding at least a part of a filovirus G protein is inserted at the intergenic région between the E and NSI gene of said Flavivirus, such that a chimeric virus is expressed, characterised in that the encoded sequence C terminally of the E protein of said Flavivirus and N terminal the NSI protein of said Flavivirus comprises in the following order :

a sequence element allowing the proteolytic processing of the G protein from the E protein by a signal peptidase.

- a G protein wherein the signal peptide said G protein is absent, and optionally the mucin like domain of the G protein is absent, and

- a TM transmembrane of a flavirus, typically a TM2 domain, typically a West Nile virus TM 2 domain

To allow proteolytic processing of the Fiiovirus G protein from the Flavivirus E protein at its aminoterminal end and allow proteolytic processing of the fiiovirus G protein from the Flavivirus NSI protein at its C terminal, sequence éléments are provided which are substrates for a signal peptidase. These can vary in length and in sequence, and can be as short as one amîno acid as shown in Jang et al. cited above. A discussion on suitable récognition sites for sîgnailing proteases is found in Nielsen étal. (1997) Protein Eng. 10, 1-6.

Typically, at the C terminus of the G protein, the signal peptide at the N terminus of the NSI protein will be used (or a fragment which allows proteolytic processing).

Typically, at the N terminus of the G protein, the same signal peptide (or fragment) ofthe NSI protein ofthe Flavivirus backbone is introduced.

The invention equally relates to polynucleotides comprising a sequence of a live, infectious, attenuated Flavivirus. Herein a nucléotide sequence encoding at least a part of a fiiovirus G protein is Inserted at the întergenic région between the E and NSI gene of said Flavivirus. Additional sequences are provided such that when the chimeric virus is expressed such that the encoded sequence from the C terminally of the E protein to the N terminus of the signal peptide ofthe NSI protein comprises in the following order:

a further signal peptide (or cleavable fragment thereof) of a Flavivirus NSI gene, C terminal to the E protein and N terminal to the NSI protein.

a fiiovirus G protein comprising a defective functional signal peptide or lacking a functional signal peptide, This G protein is C terminally positioned from a NSI signal peptide. C terminally of the G protein is the sequence of a Flavivirus TM2 transmembrane domain of a Flavivirus. C terminally of this TM2 sequence follows the NSI protein, including its native signal peptide sequence.

Thus, the G protein and the TM2 domain are flanked at N terminus and C terminus by an NSI sequence. In the embodiments disclosed in the examples the protein and DNA sequence of both NSI are identical.

In typical embodiments both NSI signal sequences hâve the sequence DQGCAINFG [SEQ ID NO:9].

The constructs of the présent invention did not show recombination due to the presence of this répétitive sequence. Sequence modifications can be introduced or NSI sequences from different Flavivirus can be used to avoid presence of identical sequences, as long as the encoded peptide remains a target from the protease which processes these NSI N-terminal signal sequences.

In typical embodiments, as disclosed in the examples, the G protein is of Ebola virus, preferably of the Makona strain of Ebola virus.

To facilitate the production of virus in the mammalian hosts, the nucléotide sequence of the G protein is codon optimized.

It is submitted that minor sequence modifications in the G protein and in the C terminal tail can be introduced without loss of function of these sequence éléments.

It has been found that the presence of a functional signal peptide of the G protein results in a sélective pressure whereby a part of the G protein comprising its signal peptide is deleted or mutated. Thus the constructs of the présent invention typically contain a defective G protein signal by partial or complété removal of this sequence or by the introduction of mutations which render the signal protein non-functional .

The TM domain which is located C terminally of the G protein and N terminally of the NSI is generally of a Flavivirus, typically from the E protein, and more typical a TM2 domain of an E protein. In preferred embodiments this TM2 domain of an E protein is from a different Flavivirus than the virus forming the backbone. The examples of présent invention describe the TM2 domain of the E protein of the West Nile virus. This domain has the sequence RSIAMTFLAVGGVLLFLSVNVHA [SEQ ID NO: 10].

In the examples section below and in the schematic représentation ail sequence éléments form a continuous sequence without any intervening sequence éléments. It is submitted that in between these sequence éléments, addîtional amino acids may be présent as long as the localisation of the protein at either the ER lumen or cytosol is not disturbed and proteolytic Processing is maintained.

The above described nucléotide sequence can be that of the virus itself or can refer to a sequence in a vector. A suitable vector for cloning Flavivirus and chimeric version are Bacterial Artificial Chromosomes, as describe in more detail below.

The methods and compounds of the présent invention hâve médicinal application, whereby the virus or a vector encoding the virus can be used to vaccinate against the filovirus which contains the G protein that was cloned in the Flavivirus. In addition, the proteins from the Flavivirus equally provide protection such that the compounds of the présent invention can be used to vaccinate against a Flavivirus and a filovirus using a single virus or DNA vaccine. The use of Bacterial Artificial Chromosomes, and especially the use of inducible BACS as disclosed by the présent inventors in WO2014174078, is particularly suitable for high yield, high quality amplification of cDNA of RNA viruses such as chimeric constructs ofthe présent invention.

A BAC as described in this publication BAC comprises:

- an inducible bacterial ori sequence for amplification of said BAC to more than 10 copies per bacterial cell, and

- a viral expression cassette comprising a cDNA of an the RNA virus genome and comprising cis-regulatory éléments for transcription of said viral cDNA in mammalian cells and for processing of the transcrîbed RNA into infectious RNA virus.

As is the case in the présent invention the RNA virus genome is a chimeric viral cDNA construct of an RNA virus genome and a filovirus G protein .

In these BACS, the viral expression cassette comprises a cDNA of a positivestrand RNA virus genome, and typically a RNA polymerase driven promoter precedîng the 5' end of said cDNA for initiating the transcription of said cDNA, and an element for RNA self-cleaving following the 3' end of said cDNA for cieaving the RNA transcript of said viral cDNA at a set position.

The BAC may further comprise a yeast autonomously replicating sequence for shuttling to and maintaining said bacterial artificial chromosome in yeast. An example of a yeast ori sequence is the 2μ plasmid origin or the ARS1 (autonomously replicating sequence 1) or functionally homologous dérivatives thereof.

The RNA polymerase driven promoter of this first aspect of the invention can be an RNA polymerase II promoter, such as Cytomégalovirus Immédiate Early (CMV-IE) promoter, or the Simian virus 40 promoter or functionally homologous dérivatives thereof.

The RNA polymerase driven promoter can equally be an RNA polymerase I or III promoter.

The BAC may also comprise an element for RNA self-cleaving such as the cDNA of the genomic ribozyme of hepatitis delta virus or functionally homologous RNA éléments.

The formulation of DNA into a vaccine préparation is known in the art and is described in detail in for example chapter 6 to 10 of DNA Vaccines Methods in Molecular Medicine Vol 127, (2006) Springer Saltzman, Shen and Brandsma (Eds.) Humana Press. Totoma, NJ. and in chapter 61 Alternative vaccine delivery methods, P 1200-1231, of Vaccines (6th Edition) (2013) (Plotkin et al. Eds.). Details on acceptable carrier, diluents, excipient and adjuvant suitable in the préparation of DNA vaccines can also be found in WO2005042014, as indicated below.

Acceptable carrier, diluent or excipient refers to an addîtional substance that is acceptable for use in human and/or veterinary medicine, with particular regard to immunotherapy.

By way of example, an acceptable carrier, diluent or excipient may be a solid or liquid filler, diluent or encapsulating substance that may be safely used in systemic or topic administration. Depending upon the particular route of administration, a variety of carriers, well known in the art may be used. These carriers may be selected from a group including sugars, starches, cellulose and its dérivatives, malt, geiatine, talc, calcium sulphate and carbonates, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffered solutions, emulsifiers, isotonie saline and salts such as minerai acid salts including hydrochlorides, bromides and suiphates, organic acids such as acétates, propionates and malonates and pyrogen-free water.

A useful reference describing pharmaceutically acceptable carriers, diluents and excipients is Remington's Pharmaceutîcal Sciences (Mack Publishing Co. N. J. USA, (1991)) which is incorporated herein by reference.

Any safe route of administration may be employed for providing a patient with the DNA vaccine. For example, oral, rectal, parentéral, sublingual, buccal, intravenous, intra-articular, intra-muscular, intra-dermal, subeutaneous, in ha lationa I, intraocular, intraperitoneal, intracerebroventricular, transdermal and the like may be employed. Intra-muscular and subcutaneous injection may be appropriate, for example, for administration of immunotherapeutic compositions, proteinaceous vaccines and nucleic acid vaccines. It is also contemplated that microparticle bombardment or electroporation may be particularly useful for delivery of nucleic acid vaccines.

Dosage forms include tablets, dispersions, suspensions, injections, solutions, syrups, troches, capsules, suppositories, aérosols, transdermal patches and the like. These dosage forms may also include injecting or implanting controlled releasing devices designed specifically for this purpose or other forms of implants modified to act additionally in this fashion. Controlled release of the therapeutic agent may be effected by coating the same, for example, with hydrophobie polymers including acrylic resins, waxes, higher aliphatic alcohols, polylactic and polyglycolic acids and certain cellulose dérivatives such as hydroxypropylmethyl cellulose. In addition, the controlled release may be effected by usîng other polymer matrices, liposomes and/or mlcrospheres.

DNA vaccines suitable for oral or parentéral administration may be presented as discrète units such as capsules, sachets or tablets each containing a predetermined amount of plasmid DNA, as a powder or granules or as a solution or a suspension in an aqueous liquid, a non-aqueous liquid, an oil-in-water émulsion or a water-in-oil liquid émulsion. Such compositions may be prepared by any of the methods of pharmacy but ail methods include the step of bringing into association one or more agents as described above with the carrier which constitutes one or more necessary ingrédients. In general, the compositions are prepared by uniformly and intimateiy admixing the DNA plasmids with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product into the desired présentation.

The above compositions may be administered in a manner compatible with the dosage formulation, and in such amount as is effective. The dose administered to a patient, should be sufficient to effect a bénéficiai response in a patient over an appropriate period of time. The quantity of agent (s) to be administered may dépend on the subject to be treated inclusive of the âge, sex, weight and general health condition thereof, factors that will dépend on the judgement of the practitioner.

Furthermore DNA vaccine may be deiîvered by bacterial transduction as using live-attenuated strain of Salmonella transformed with said DNA plasmids as exemplified by Darji et al. (2000) FEMS Immunol Med Microbiol 27, 341-349 and Cicin-Sain étal. (2003) J Virol 77, 8249-8255 given as reference.

Typically the DNA vaccines are used for prophylactic or therapeutic immunisation of humans, but can for certain viruses also be appiied on vertebrate animais (typically mammals, birds and fish) including domestic animais such as livestock and companion animais. The vaccination is envisaged of animais which are a live réservoir of viruses (zoonosis) such as monkeys, dogs, mice, rats, birds and bats.

In certain embodiments vaccines may include an adjuvant, Le. one or more substances that enhances the immunogenicity and/or efficacy of a vaccine composition However, life vaccines may eventually be harmed by adjuvants that may stimulate innate immune response independent of viral réplication. Non-limiting examples of suitable adjuvants include squalane and squalene (or other oils of animal origin); block copolymers; détergents such as Tween-80; Quill A, minéral oils such as Drakeol or Marcoî, vegetable oils such as peanut oil; Corynebacterium-derived adjuvants such as Corynebacterium parvum; Propionibacterium-derived adjuvants such as Propionibacterium acné; Mycobacterium bovîs (Bacille Calmette and Guérin or BCG); interleukins such as interleukin 2 and interleukin 12; monokines such as interleukin 1; tumour necrosis factor; interférons such as gamma interferon; combinations such as saponin-aluminium hydroxide or Quil-A aluminium hydroxide; liposomes; ISCOMt) and ISCOMATRIX (B) adjuvant; mycobacterial cell wall extract; synthetic glycopeptides such as muramyl dipeptides or other dérivatives; Avridine; Lipid A dérivatives; dextran sulfate; DEAE-Dextran or with aluminium phosphate; carboxypolymethylene such as Carbopol'EMA; acryllc copolymer émulsions such as Neocryl A640; vaccinia or animal poxvirus proteins; sub-viral particle adjuvants such as choiera toxin, or mixtures thereof.

EXAMPLES

Example 1 YFV17D/EBOLA CONSTRUCTS

The Ebola glycoprotein (GP) from Makona strain was inserted between YFE/NS1 to generate two constructs as follows:

1) PLLAV-YFV17D-Ebola-GP: N-terminal (Nt) signal peptide (SP) was deleted, first 9 aminoacids of NSI (27 nucléotides) were added Nt of Ebola-GP to allow proper release of Ebola-GP protein, the Ebola-GP cytoplasmic domain was preserved and fused to the WNV transmembrane domain 2. The resulting PLLAV-YFV17D-Ebola-GP launches viable live-attenuated viruses expressing functional Ebola-GP and YFV17D proteins.

2) PLLAV-YFV17D-Ebola-deltaMLD: This construct is similar to the one described above but, in this case, the mucin like domain (MLD) of GP1 was deleted.

Note: Constructs carrying the glycoprotein genes from different filoviruses (BDBV, SUDV, TAFV, RESTV, MARV, RAVV and MLAV) were generated. In these constructs the corresponding GP gene is inserted in the same way as in PLLAVYFV17D-Ebola-GP described above.

Example 2 CONSTRUCT#1 PLLAV-YFV17D-Eboia-GP

PLLAV-YFV17D-Ebola-GP was transfected into BHK21J cells and typical CPE was observed as well as the virus supernatant harvested from them formed markedly smaller plaques compared to the plaque phenotype of YFV17D (Figure 2A). Therefore, the resulting transgenic virus (YFV17D-Ebola-GP) is further attenuated, and virus yieids were at least 10-fold less compared to YFV17D.

The stability of PLLAV-YFV17D-Ebola-GP was determined by performing RT-PCR to detect the transgene insert in virus samples that were harvested during serial passage of the YFV17D-Ebola-GP (Figure 2B). Sequencing of the RT-PCR products showed that YFV17D-Ebola-GP insert with no mutations can be detected at least until passage 6 in BHK21J cells.

To détermine the immunogenicity of PLLAV-YFV17D-Ebola-GP and the liveattenuated virus (LAV) version Ifnar knockout mice (n=5) were vaccinated with either PLLAV-YFV17D-Ebola-GP or the LAV intraperitoneally or subcutaneously (i.p. and s.c. respectively) (figure 3A). The YFV- and EBOV-specific antîbody responses were quantîfied by indirect immunofluorescence assay (IIFA) and the cell mediated immune response was quantîfied by EliSPOT (Figure 3B and 4). Vaccinated mice were monitored daily for morbidity/mortality and blood was sampled for serological analysis at baseline and with two-week intervals. The results showed that in ail the animais vaccinated (i.p. or s,c.) with the LAV version spécifie binding antibodies were detected against both, YFV and EBOV.

Regarding the mice vaccinated with PLLAV in 3 out of 5 of the mice vaccinated i.p. antibodies were detected against YFV and EBOV (Figure 3B).

The analysis of the T cells immune response (Figure 4) revealed that there was spécifie T cell responses after vaccination with YFV17D-Ebola-GP LAV (i.p. and s.c.) and the PLLAV version when his one was inoculated i.p. These results suggests that this is a bivalent vaccine that can induce dual immunity and protection against YFV and EBOV.

In a second experiment (figure 5A), ifnar mice (n = 10) were vaccinated with YFV17D-Ebola-GP (250 PFU) and the spécifie antibody response against EBOV was determined by an in-house IIFA (Figure 5C) (HEK293T cells were transfected with pCMV-Ebola-GP-IRES-GFP construct). The cellular immune response (IFN-gamma ELISPOT) was also analysed (Figure 6). The results in figure 5A shows that in ail animais vaccinated with YFV17D-Ebola-GP there were binding antibodies against EBOV (titres between 1:540 and 1:1620 dilution at 28 days post-vaccination). Ail the animais were seroconverted for YFV as well (data not shown). Concerning, the cellular immune response (figure 6), T cells responses against both, YFV and EBOV, were detected in the mice vaccinated with YFV17D-Ebola-GP. In ail the control mice, vaccinated with YFV17D, as expected, only T cells responses against YFV were observed.

A third experiment evaluated the immune response in AG129 mice after vaccination with either PLLAV-YFV17D-Ebola-GP or its derived LAV (Figure 7A)). The cell mediated immune response was evaluated at 28 days post infection by ELISpot (figure 7B). In ail the mice vaccinated with LAV there was T cells responses against YFV and EBOV. However only in 1 out of 3 mice vaccinated with the PLLAV version a cellular immune response against YFV was observed but not against EBOV. Likely the plasmid was not deliver efficiently in these mice. Nevertheless induction of immunity by PLLAV-YFV17D-Ebola-GP at least in a fraction of mice, demonstrates in principle that the vaccine has the same antigenicity as the live virus vaccine derived thereof and can induce protection if used in the DNA modality as well.

SEQUENCES DEPICTED IN THE APPLICATION

Construct# 1: PLLAV-YFV17D-EBOLA-GP (signal peptide deleted and cytoplasmic tail fused to WNV-TM2)

- End YF-E (amino acids 1-40)

- first 27 nucleotides/9 amino acids NSI, (amino acids 41-49)

- Ebola-gpl [without signal peptide and sequence ΆΆΑΑΆΆΆ [SEQ ID NO: 14]replaced by aaGaaGaA [SEQ ID NO:15], one extra A added to get the GP transmembrane version of the protein) (amino acids 50-329) - mucin like domain (MLD, 150 aa) / (amino acids 330-479) furin cleavage site between GP1-GP2/EBOLA-GP2/ (amino acids 480693)

- WNV-TM2 (amino acids 694-716)

- Beginning YF-NS1(amino acids 717-768)

SEQ ID NO:1

SEQ ID NO:2

AAGGTCATCATGGGGGCGGTACTTATATGGGTTGGCATCAACACAAGAAACATGACAATG KVIMGAVLIWVGINTRNMTM 20

TCCATGAGCATGATCTTGGTAGGAGTGATCATGATGTTTTTGTCTCTAGGAGTTGGcGCc SMSMILVGVIMMFLSLGVGA 40

GACCAGGGCTGCGCGATAa&TTTCGGTatcccgcttggagttatccacaatagtacatta PQGCAINFGI PLGVIHNSTL· 60 caggttAgtgatgtcgacaaactagtttgtcgtgacaaactgtcatccacaaatcaattg

QVSDVDKLVCRDKLSSTNQL 80 agatcagttggactgaatctcgaggggaatggagtggcaactgacgtgccatctgtgact

RSVGLNLEGNGVATDVPSVT 100 aaaagatggggcttcaggtccggtgtcccaccaaaggtggtcaattatgaagctggtgaa

KRWGFRSGVPPKVVNYEAGE 120 tgggctgaaaactgctacaatcttgaaatcaaaaaacctgacgggagtgagtgtctacca

WAENCYNLEIKKPDGSECLP 140 gcagcgccagacgggattcggggcttcccccggtgccggtatgtgcacaaagtatcagga

AAPDGIRGFPRCRYVHKVSG 160 acgggaccatgtgccggagactttgccttccacaaagagggtgctttcttcctgtatgat

TGPCAGDFAFHKEGAFFLYD 180 cgacttgcttccacagttatctaccgaggaacgactttcgctgaaggtgtcgttgcattt

RLASTVIYRGTTFAEGVVAF 200 ctgatactgccccaagctaagaaggacttcttcagctcacaccccttgagagagccggtc

LILPQAKKDFFSSHPLREPV 220 aatgcaacggaggacccgtcgagtggctattattctaccacaattagatatcaggctacc

NATEDPSSGYYSTTIRYQAT 240 ggttttggaactaatgagacagagtacttgttcgaggttgacaatttgacctacgtccaa

GFGTNETEYLFEVDNLTYVQ 260 cttgaatcaagattcacaccacagtttctgctccagctgaatgagacaatatatgcaagt

LESRFTPQFLLQLNETIYAS 280 gggaagaggagcaacaccacgggaaaactaatttggaaggtcaaccccgaaattgataca

GKRSNTTGKLIWKVNPEIDT 300 acaatcggggagtgggccttctgggaaactaaGaaGaAcctcactagaaaaattcgcagt

TIGEWAFWETKKNLTRKIRS 320 gaagagttgtctttcacagctgtatcaaacggAcccaaaaacatcagtggtcagagtccg

EEL S FTAV Zngpknisgqsp 340 gcgcgaactt.att.ccgacccagagacaaacaaaaaaaatgaagaacacaaaa'tcatggc't artssdpetnttnedhkisia 360 tcagaaaattcatctgcaatggttcaagtgcacagtcaaggaaggaaagatgcagtgtag sens samvqvhsqgrkaavs 380 catctgacaacccttgccacaatctccacgagtcctcaacctaacacaaaaaaaacaggt h 1 t t 1 a t i s t s p g p p t t k t g 400 caggacaacagcacccataatacaccegtgtataaacttgacatctctgaggcaactcaa pdnsthntpvykldiseatq 420 gttggacaacatcaccgtagagcagacaacgacagcacagectccgacactcccccegec 5 vgqhhxradndstasdtppa 440 acgaccgcagccggacccttaaaagcagagaacaccaacacgagtaagagegetgactcc ttaagplkaentntsksads 460 ctggacctcgccaccacgacaâgeccccaaaactacagcgagactgctggcaacaacaac d 1 a t t tspqnyse t a g π π η 480 10 actcatcaccaagataccggagaagagagtgccagcagcgggaagctaggcttaattacc thhqdtgeesassgklglit 500 aatactattgctggagtagcaggactgatcacaggcgggagaaggactcgaagaGAAGTA ntiagvaglitggrRTRREV 520 ATTGTCAATGCTCAACCCAAATGCAACCCCAATTTACATTACTGGACTACTCAGGATGAA 15 IVNAQPKCNPNLHYWTTQDE 540 GGTGCTGCAATCGGATTGGCCTGGATACCATATTTCGGGCCAGCAGCCGAAGGAATTTAC

GAAIGLAWIPYFGPAAEGIY 560 ACAGAGGGGCTAATGCACAACCAAGATGGTTTAA TCTGTGGGTTGAGGCAGCTGGCCAAC

TEGLMHNQDGL ICGLRQLAN 580 20 GAAACGACTCAAGCTCTCCAACTGTTCCTGAGAGCCACAACTGAGCTGCGAACCTTTTCA

ETTQALQLFLRATTELRTFS 600 ATCCTCAACCGTAAGGCAATTGACTTCCTGCTGCAGCGATGGGGTGGCACATGCCACATT

ILNRKAIDFLLQRWGGTCHI 620 TTGGGACCGGACTGCTGTATCGAACCACATGATTGGACCAAGAACATAACAGACAAAATT 25 LGPDCCIEPHDWTKNITDKI 640 GATCAGATTATTCATGATTTTGTTGATAAAACCCTTCCGGACCAGGGGGACAATGACAAT

DQIIHDFVDKTLPDQGDNDN 660 TGGTGGACAGGATGGAGACAA TGGATACCGGCAGGTATTGGAGTTACAGGTGTTATAATT

WWTGWRQWIP A GIGVTGVI I 680 30 GCAGTTATCGCTTTATTCTGTATATGCAAATTTGTCTTTAGGTCAATTGCTATGACGTTT

AVIALFCICKFVF R S I A Μ T F 700 CTTGCGGTTGGAGGAGTTTTGCTCTTCCTTTCGGTCAACGTCCATGCTGATCAAGGATGC

LAVGGVLLFLSVNVHAD Q G C720

GCCATCAACITTGGCAAGAGAGAGCTCAAGTGCGGAGATGGTATCTTCATATTTAGAGAC 35 AINFGKRELKCGDGIFIFRD740

TCTGATGACTGGCTGAACAAGTACTCATACTATCCAGAAGATCCTGTGAAGCTTGCATCA

SDDWLNKYSYYPEDPVKLAS 760 ATAGTGAAAGCCTCTTTTGAAGAA IVKASFEE768

Construct# 2: PLLAV-YFV17D-EBOLA-GP MLD (signal peptide and mucin like domain (MLD, 15 0aa from aa 312 to 4 62 ) deleted, cytoplasmic tail fused to WNV-TM2) End YF-E/ first 27 nucléotides NSI (9 amino acids), (amino acids 45 41-49)

Ebola-gpl: [without signal peptide and sequence ΑΆΆΆΆΆΆ [SEQ ID NO:14] replaced by aaGaaGaA [SEQ ID NO:15], one extra A added to get the GP transmembrane version of the protein): furin cleavage site between GP1-GP2/ (amino acids 50- **) 50 EB0LA-GP2 (amino acids ** - 693) WNV-TM2 : (amino acids 694-716) Beginning YF-NS1 : (amino acids 717-768) SEQ ID NO:3

SEQ ID NO: 4

AAGGTCATCATGGGGGCGGTACTTATATGGGTTGGCATCAACACAAGAAACATGACAATG

KVIMGAVLIWVGINTRNMTM20

TCCATGAGCATGATCTTGGTAGGAGTGATCATGATGTTTTTGTCTCTAGGAGTTGGcGCc

SMSMILVGVIMMFLSLGVGA40

GACCAGGGCTGCGCGATAAATTTCGGTatcccgcttggagttatccacaatagtacatta

DQGCAINFGI PLGVIHNSTL60

Caggttagtgatgtcgacaaactagtttgtcgtgacaaactgtcatccacaaatcaattg

QVSDVDKLVCRDKLSSTNQL80

Agatcagttggactgaatctcgaggggaatggagtggcaactgacgtgccatctgtgact

RSVGLNLEGNGVATDVPSVT 100

Aaaagatggggcttcaggtccggtgtcccaccaaaggtggtcaattatgaagctggtgaa

KRWGFRSGVPPKVVNYEAGE 120

Tgggctgaaaactgctacaatcttgaaatcaaaaaacctgacgggagtgagtgtctacca

WAENCYNLEIKKPDGSECLP 140

Gcagcgccagacgggattcggggcttcccccggtgccggtatgtgcacaaagtatcagga

AAPDGIRGFPRCRYVHKVSG 160

Acgggaccatgtgccggagactttgccttccacaaagagggtgctttcttcctgtatgat

TGPCAGDFAFHKEGAFFLYD 180

Cgacttgcttccacagttatctaccgaggaacgactttcgctgaaggtgtcgttgcattt

RLASTVIYRGTTFAEGVVAF 200

Ctgatactgccccaagctaagaaggacttcttcagctcacaccccttgagagagccggtc

LILPQAKKDFFSSHPLREPV 220

Aatgcaacggaggacccgtcgagtggctattattctaccacaattagatatcaggctacc

NATEDPSSGYYSTTIRYQAT 240

Ggttttggaactaatgagacagagtacttgttcgaggttgacaatttgacctacgtccaa

GFGTNETEYLFEVDNLTYVQ 260

Cttgaatcaagattcacaccacagtttctgctccagctgaatgagacaatatatgcaagt

LESRFTPQFLLQLNETIYAS 280

Gggaagaggagcaacaccacgggaaaactaatttggaaggtcaaccccgaaattgataca

GKRSNTTGKLIWKVNPEIDT 300 acaatcggggagtgggccttctgggaaactaaGaaGaAcctcactagaaaaattcgcagt

TIGEWAFWETKKNLTRKIRS 320 gaagagttgtctttcacagctgtatcaaacactcatcaccaagataccggagaagagagt

EELSFTAVSNTHHQDTGEES 340 gccagcagcgggaagctaggcttaattaccaatactattgctggagtagcaggactgatc

ASSGKLGLITNTIAGVAGLI 360 acaggcgggagaaggactcgaagaGAAGTAATTGTCAATGCTCAACCCAAAÎ’GCAACCCC

TGGRRTRREVIVWAOFKCNF 380

AATTTACATTACTGGACTACTCAGGATGAAGGTGCTGCAATCGGATTGGCCTGGATACCA

NLHYWTTQDEGAAIGLAWI P 400

TATTTCGGGCCAGCAGCCGAAGGAATTTACACAGAGGGGCTAATGCACAACCAAGATGGT

YFGPAAEGI YTEGLMHNQDG 420

TTAATCTGTGGGTTGAGGCAGCTGGCCAACGAAACGACTCAAGCTCTCCAACTGTTCCTG

LICGLRQLA N ETTQALQLFL 440

AGAGCCACAACTGAGCTGCGAACCTTTTCAATCCTCAACCGTAAGGCAATTGACTTCCTG

RA T T E L R TFSILNRKAIDFL 460

CTGCAGCGATGGGGTGGCACATGCCACATTTTGGGACCGGACTGCTGTATCGAACCACAT

LQRNGGTCHILGPDCCIEPH 480

GA TTGGACCAAGAACATAACAGACAAAATTGATCAGATTATTCATGATTTTGTTGATAAA

D W T K N I TDKIDQIIHDFVDK 500

ACCCTTCCGGACCAGGGGGACAATGACAATTGGTGGACAGGATGGAGACAATGGATACCG

TLPDQGDNDNWWTGWRQWIP 520

GCAGGTATTGGAGTTACAGGTGTTATAATTGCAGTTATCGCTTTATTCTGTATATGCAAA

AGIGVTGVIIAVIALFCICK 540 TTTGTCmAGGTCAATTGCTATGACGTTTCTTGCGGTTGGAGGAGTTTTGCTCTTCCTT F V F RS IAMTFLAVGGVLLFL560

TCGGTCAACGTCCATGCTGATCAAGGATGCGCCATCAACTTTGGCAAGAGAGAGCTCAAG S V N V H A D QGCAINFGKRELK580

TGCGGAGATGGTATCTTCATATTTAGAGACTCTGATGACTGGCTGAACAAGTACTCATAC CGDGIFIFRDSDDWLNKYSY 600

TATCCAGAAGATCCTGTGAAGCTTGCATCAATAGTGAAAGCCTCTTTTGAAGAA ÏPEDPVKLASTVKASFEE618

Nucléotide and amino acid sequence of deleted peptide [SEQ ID NO:5 [SEQ ID NO:6]

ATGGGTGTTACAGGAATATTGCAGTTACCTCGTGATCGATTCAAGAGGACATCATTCTTT

MGVTGILQLPRDRFKRTSFF 20 CTTTGGGTAATTATCCTTTTCCAAAGAACATTTTCC

LWVIILFQRTFS 32

Mucin like domain [SEQ ID NO: 7]

NGPKNISGQS PARTSSDPET NTTNEDHKIM ASENSSAMVQ VHSQGRKAAV 50

SHLTTLATIS TSPQPPTTKT GPDNSTHNTP VYKLDISEAT QVGQHHRRAD 100

NDSTASDTPP ATTAAGPLKA ENTNTSKSAD SLDLATTTSP QNYSETAGNN 150

Ebolavirus glycoprotein [SEQ ID NO: 8] mgvtgilqlp rdrfkrtsff Iwviilfqrt fsiplgvihn stlqvsdvdk 50

Ivcrdklsst nqlrsvglnl egngvatdvp svtkrwgfrs gvppkvvnye 100 agewaencyn leikkpdgse clpaapdgir gfprcryvhk vsgtgpcagd 150 fafhkegaff lydrlastvi yrgttfaegv vaflilpqak kdffsshplr 200 epvnatedps sgyysttiry qatgfgtnet eylfevdnlt yvqlesrftp 250 qfllqlneti yasgkrsntt gkliwkvnpe idttigewaf wetkknltrk 300 irseelsfta vsngpknisg qspartssdp etnttnedhk imasenssam 350 vqvhsqgrka avshlttlat istspqpptt ktgpdnsthn tpvykldise 400 atqvgqhhrr adndstasdt ppattaagpl kaentntsks adsldlattt 450 spqnysetag nnnthhqdtg eesassgklg litntiagva glitggrrtr 500 revivnaqpk cnpnlhywtt qdegaaigla wipyfgpaae giyteglmhn 550 qdglicglrq lanettqalq Iflrattelr tfsilnrkai dfllqrwggt 600 chilgpdcci ephdwtknit dridqiihdf vdktlpdqgd ndnwwtgwrq 650 wipagigvtg viiavialfc ickfvf

NSI signal sequence [SEQ ID NO:9] DQGCAINFG

WNV TM2 domain [SEQ ID NO:10] RSIAMT FLAVGGVLL FLSVNVHA junction NSI signal peptide Ebola glycoprotein [SEQ ID NO:11] AINFGIPLGV junction Ebola glycoprotein- WNV TM2 domain [SEQ ID NO:12] CKFVFRSIAM junction TM2 domain - NSI protein [SEQ ID NO:13] VNVHADQGCA

Claims (10)

1. A polynucleotide comprising a sequence of a live, infectious, attenuated Flavivirus wherein a nucléotide sequence encoding at least a part of a Filovirus glycoprotein is located atthe intergenic région between the E and NSI gene of said Flavivirus, such that a chimeric virus is expressed, characterised in that the encoded sequence C terminally of the E protein of said Flavivirus and N terminally of the signal peptide of the NSI protein of said Flavivirus comprises in the following order:

- a further signal peptide of a Flavivirus NSI protein,

- a Filovirus glycoprotein wherein the N terminal signal peptide is absent, - a TM domain of a Flaviviral E protein (typically TM2).

2. The polynucleotide according to claim 1, wherein:

- the mucin like domain (MLD) of the Filovirus glycoprotein is absent; and/or

- the glycoprotein lacks the mucin like domain of SEQ ID NO:7; and/or

- the glycoprotein lacks the N terminal signal sequence of SEQ ID NO 6.

3. The polynucleotide according to claim 1 or 2, wherein:

- the Flavivirus is Yellow Fever virus, typically the YF17D strain; and/or

- the Filovirus is a mononegavirus or an Ebola virus.

4. The polynucleotide according to any one of daims 1 to 3, wherein the signal peptide of the NSI protein of the live, infectious, attenuated Flavivirus, comprises or consists of the sequence DQGCAINFG [SEQ ID NO: 9],

5. The polynucleotide according to any one of claims 1 to 4, wherein the TM2 domain of a Flaviviral E protein is from West Nile virus.

6. The polynucleotide according to any one of claims 1 to 5, wherein the sequence of the chimeric virus comprises at the junction of Flavivirus E gene NSI signal peptide and the Ebola glycoprotein the sequence of SEQ

ID NO: 11, or wherein the sequence ofthe chimeric virus comprises at the junction of the Ebola glycoprotein and the WNV TM2 domain the sequence of SEQ ID NO: 12, or wherein the sequence of the chimeric virus comprises at the junction of the WNV TM2 domain and the NSI protein the sequence of SEQ ID NO: 13.

7. The polynucleotide according to any one of daims 1 to 6, encoding a sequence comprising SEQ ID NO: 11, SEQ ID: NO 12 and SEQ ID NO: 13; and outside SEQ ID NO: 11, SEQ ID: NO 12 and SEQ ID NO: 13, a sequence identity of at least 95 %, 96 %, 97 %, 98% or 99 % with SEQ ID NO:2 or SEQ ID NO:4.

8. The polynucleotide according to any one of daims 1 to 7, wherein the encoded sequence comprises the sequence of SEQ ID NO: 2 or SEQ ID NO: 4.

9. A chimeric live, infectious, attenuated Flavivirus wherein at least a part of a Fiiovirus glycoprotein is inserted located between the E and NSI protein of said Flavivirus, such that C terminally of the E protein and N terminally of the signal peptide of the NSI protein the virus comprises in the following order :

a) a further signal peptide of a Flavivirus NSI protein,

b) a Fiiovirus glycoprotein protein lacking a functional signal peptide, and

c) a TM domain of a Flaviviral E protein.

10. A polynucleotide sequence according to any one of claîm 1 to 8, or a chimeric virus according to daim 9, for use in the prévention of a fiiovirus infection.