OA20553A

OA20553A - Compositions and methods for treating hepatitis B virus (HBV) infection.

Info

Publication number: OA20553A
Application number: OA1202100506
Authority: OA
Inventors: Phillip S. Pang; Anna BAKARDJIEV; Lynn E. CONNOLLY
Original assignee: Vir Biotechnology, Inc.
Priority date: 2019-05-13
Filing date: 2020-05-12
Publication date: 2022-10-27

Abstract

The present disclosure provides methods for treating HBV infection using an siRNA that targets an HBV gene. In some embodiments, the method for treating HBV involves co-administration of siRNA with PEG-INFa.

Description

COMPOSITIONS AND METHODS FOR TREATING HEPATITIS B VIRUS (HBV) INFECTION

STATEMENT REGARDING SEQUENCE LISTING

The Sequence Listing associated with this application is provided in text format in lieu of a paper copy, and is hereby încorporated by reference into the spécification. The name of the text file containing the Sequence Listing is 930485_405WO_SEQUENCE_LISTING.txt. The text file is 6.5 KB, was created on May 6, 2020, and is beîng submitted electronically via EFS-Web.

BACKGROUND

Chrome hepatitis B virus (HBV) infection remains an important global public health problem with sîgnîficant morbidity and mortalîty (Trepo C., A brief history of hepatitis milestones, Liver International 2014, 34(1):29-37). According to the World Health Organizatîon (WHO) an estimated 257 million people are living with chronic HBV infection worldwide (WHO, 2017; Schweitzer A, et al., Estimations of worldwide prevalence of chronic hepatitis B virus infection: a systematîc revîew of data published between 1965 and 2013, The Lancet 2015, 387(10003):1546-1555). Over time, chronic HBV infection leads to serious sequelae including cirrhosis, liver faîlure, hepatocellular carcinoma (HCC), and death. Almost 800,000 people are estimated to die annually due to sequelae associated with chronic HBV infection (Stanaway JD, et al., The global burden of viral hepatitis from 1990 to 2013: ftndings from the Global Burden of Disease Study 2013, The Lancet 2016, 388(10049):1081-1088).

HBV prevalence varies geographically, with a range of less than 2% în low to greater than 8% în high prevalence countries (Schweitzer et al., 2015). In high prevalence countries, such as those in sub-Saharan Africa and East Asia, transmission occurs predominantly in infants and chîldren by périnatal and horizontal routes. In more industrialized countries, new infections are highest among young adults and transmission occurs predominantly via injection drug use and high-risk sexual behaviors. The risk of developing chronic HBV infection dépends on the âge at the time of infection. While only approximately 10% of people infected as adults develop chronic HBV infection, 90% of infants infected perinatally or during the first 6 months of life, and 20-60% of children infected between 6 months and 5 years of âge, remain chronically infected. Twenty-five percent of people who acquire HBV during infancy and childhood will develop primary liver cancer or cirrhosîs during adulthood.

HBV is a DNA virus that infects, replicates, and persists in human hépatocytes (Protzer U, et al., Living in the liver: hepatîc infections, Nature Reviews Immunology 201, 12: 201-213). The small viral genome (3.2 kb), consists of partially doublestranded, relaxed-circular DNA (rcDNA) and has 4 open reading frames encoding 7 proteins: HBcAg (HBV core antigen, viral capsid protein), HBeAg (hepatîtis B eantigen), HBV Pol/RT (polymerase, reverse transcriptase), PreSl/PreS2/HBsAg (large, medium, and small surface envelope gtycoproteins), and HBx (HBV ^x antigen, regulator of transcription required for the initiation of infection) (Seeger C, et al., Molecular biology of hepatitis B virus infection, Virology, 2015, 479-480:672-686; Tong S, et al., OverView of viral réplication and genetic variability, Journal of Hepatology, 2016, 64(1):S4-S16).

In hépatocytes, rcDNA, the form of HBV nucleic acid that is întroduced by the infection virion, is converted into a covalently closed circular DNA (cccDNA), which persists in the host cell's nucléus as an episomal chromatînized structure (Allweiss L, et al., The Rôle of cccDNA in HBV Maintenance, Viruses 2017, 9: 156). The cccDNA serves as a transcription template for ail viral transcrîpts (Lucifora J, et al., Attackîng hepatitis B virus cccDNA—The holy grail to hepatitis B cure, Journal of Hepatology 2016, 64(1): S41-S48). Pregenomic RNA (pgRNA) transcrîpts are reverse transcribed into new rcDNA for new virions, which are secreted without causing cytotoxicity. In addition to infectious virions, infected hépatocytes secrete large amounts of genomefree subviral particles that may exceed the number of secreted virions by 10,000-fold (Seeger et al., 2015). Random intégration of the virus into the host genome can occur as well, a mechanism that contributes to hépatocyte transformation (Levrero M, et al., Mechanisms of HBV-induced hepatocellular carcinoma, Journal of Hepatology 2016,

64(1): S84 - SI01). HBV persists in hépatocytes in the form ofcccDNA and integrated DNA (intDNA).

Hepatîtis B infection is characterîzed by sérologie viral markers and antîbodies (Figure 1). In acute resolving infections, the virus is cleared by effective înnate and adaptive immune responses that include cytotoxîc T cells ieading to death of infected hépatocytes, and induction of B cells producîng neutralizing antîbodies that prevent the spread of the virus (Bertoletti A, 2016, Adaptive immunity in HBV infection, Journal of Hepatology 2016, 64(1): S71 - S83; Maîni MK, et al., The rôle of înnate immunity in the immunopathology and treatment of HBV infection, Journal of Hepatology 2016, 64(1): S60-S70; Li Y, et al., Genome-wide association study identifies 8p21.3 associated with persistent hepatîtis B virus infection among Chinese, Nature Communications 2016, 7:11664). In contrast, chronic infection is associated with T and B cell dysfunction, medîated by multiple regulatory mechanisms including présentation of viral epitopes on hépatocytes and sécrétion of subviral particles (Bertoletti et al., 2016; Maîni et al., 2016; Burton AR, et al., Dysfunctional surface antigen spécifie memory B cells accumulate in chronic hepatîtis B infection, EASL International Liver Congress, Paris, France 2018). Thus, the continued expression and sécrétion of viral proteins due to cccDNA persistence in hépatocytes is considered a key step in the inability of the host to clear the infection.

Chronic HBV infection is a dynamic process reflecting the interaction between HBV réplication and host immune responses. The laboratory hallmark of chronic HBV infection is persistence of HBsAg in the blood for greater than six months, and a lack of détectable anti-HBs. Chronic infection is divîded into four stages based on HBV markers in blood (HBsAg, HBeAg/anti-HBe, HBV DNA), and liver disease based on biochemical parameters (alanine amînotransferase, “ALT”), as well as fibrosis markers (noninvasive or based on liver bîopsy) (EASL, 2017). Overall, across the various phases of chronic HBV infection, only a minority of patients (less than 1% per year) clear the disease as measured by HBsAg seroclearance.

A sterilizing cure for HBV would involve complété éradication of HBV DNA or permanent transcriptîonal silencing of HBV DNA, without a risk of récurrence.

Potential thérapies that could eliminate or permanently silence the cccDNA/intDNA carry the risk of damagîng or altering the transcription of the human chromosomal DNA.

In contrast, a functional cure is defined as life-long control of the virus. Patients with a history of acute hepatîtis B who seem to be cured hâve -40% risk for HBV récurrence if undergoing immunosuppression. In this way, functional cure is part of the natural history of HBV infection. Potential thérapies that provide a functional cure may require immunomodulation. This is because chronic HBV infection leads to B and T cell exhaustion, potentially due to expression of HBV antigens (tolerogens), which could prevent efficacy of immune modulators.

Currently, there are two main treatment options for patients with chronic HBV infection: treatment with nucleoside/nucleotide reverse transcriptase inhibitors (NRTIs) and pegylated interferon-alpha (PEG-IFNa) (Liang TJ, et al., Présent and Future Thérapies of Hepatîtis B: From Discovery to Cure, Hepatology 2015, 62(6):1893-

1908). NRTIs înhibit the production of infectious virions, and often reduce sérum HBV

DNA to undetectable. However, NRTIs do not directly eliminate cccDNA, and therefore, transcription and translation of viral proteins continues. Consequently, expression of viral epitopes on hépatocytes, sécrétion of subvirai partîcles, and immune dysfunction remain largely unaffected by NRTI therapy. As a conséquence, this nécessitâtes prolonged, often lifelong therapy (however, less than half of patients remain on therapy after 5 years). NRTI therapy leads to a loss of sérum HBsAg at a rate of -0-3% per year. Furthermore, whîle NRTI therapy reverses fibrosis and reduces the incidence of HCC, it does not eliminate the increased risk of HCC that HBV infection confers.

In contrast, PEG-IFN can induce long-term immunologie al control, but only in a small percentage of patients (< 10%) (Konerman MA, et al., Interferon Treatment for Hepatîtis B, Clinics in Liver Disease 2016, 20(4): 645-665). PEG-IFN typically requires 48 weeks of therapy and the duration-dependent side effects are significant. In studies evaluating PEG-IFNa for the treatment of chronic hepatîtis C infection, 12- or 24-week regimens were associated with lower rates of serions adverse events, grade 3 adverse

events, and treatment discontinuations than those observed in trials evaluating 48-week regimens (Lawitz E, et al., Sofosbuvir for previously untreated chronic hepatitis C infection, N Engl J Med. 2013, 368(20): 1878-1887); Hadziyannis SJ, et al., Peginterferon-alpha2a and ribavirin combination therapy in chronic hepatitis C: a randomized study of treatment duration and ribavirin dose, Ann Intem Med. 2004, 140(5): 346-355; Fried MW, et al., Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection, N Engl J Med. 2002, 347(13): 975-982). The high variability of response, in combination with an unfavorable safety and side effect profile, make a significant number of patients inéligible or unwîlling to undergo PEG-IFNa treatment.

I o The failure of NRTI therapy to eradicate the virus, and the limitations of PEGIFNa therapy, highlight the clinical need for new HBV thérapies that are effective, well tolerated, and do not require lifelong administration.

SUMMARY

In some aspects, the présent disclosure relates to compositions and methods of 15 treating HBV with siRNA, in particular HBV02. For example, in accordance with some embodiments, a method of treating an HBV infection in a subject by administering an siRNA is provided, wherein the siRNA has a sense strand that comprises SEQ ID NO: 5 and an antisense strand that comprises SEQ ID NO: 6. In some embodiments, the method of treating further comprises administering to the subject a pegylated interferon-alpha (PEG-INFa). In some embodiments the PEG-INFa îs administered before, concurrently, or after the siRNA HBV02 is adminîstered. In some embodiments, the HBV infection is chronic. In some further embodiments, the subject is administered a nucleosîde/nucleotîde reverse transcriptase inhibitor (NRTI). In some embodiments the NRTI is adminîstered before, concurrently, or after the HBV02 is administered. In some embodiments the NRTI is administered for 2 to 6 months prior to the HBV02.

In some aspects, the présent disclosure also provides a siRNA for use in the treatment of an HBV infection in a subject, wherein the siRNA is HBV02 and has a sense strand that comprises SEQ ID NO: 5 and an antisense strand that comprises SEQ ID NO: 6. In some additional embodiments, the siRNA HBV02 is administered to a subject that is also administered a PEG-INFa. Tn some embodiments, the PEG-INFa is administered before, concurrently, or after the siRNA HBV02 is administered. In some embodiments, the HBV infection is chronic. In some further embodiments, the subject îs administered a NRTI. In some embodiments the NRTI is administered before, concurrently, or after the HBV02 is administered. In some embodiments the NRTI is administered for 2 to 6 months prior to the HBV02.

In some further aspects, the présent disclosure provide for the use of an siRNA in the manufacture of a médicament for the treatment of an HBV infection, wherein the siRNA îs HBV02 and has a sense strand that comprises SEQ 1D NO: 5 and an antisense strand that comprises SEQ ID NO: 6. In some embodiments, the use of the siRNA HBV02 is for use with PEG-IFNa. In some embodiments, the siRNA HBV02 is for use with PEG-IFNa and an NRTI.

In some of the aforementioned embodiments, the dose ofthe siRNA HBV02 is 0.8 mg/kg, 1.7 mg/kg, 3.3 mg/kg, 6.7 mg/kg, 10 mg/kg, or 15 mg/kg. In some ofthe aforementioned embodiments, the dose ofthe siRNA HBV02 is from 20 mg to 900 mg. In some of the aforementioned embodiments, the dose of the siRNA HBV02 is 20 mg, 50 mg, 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 400 mg, or 450 mg. In some ofthe aforementioned embodiments, the HBV02 is administered weekly. In some of the aforementioned embodiments, more than one dose of the siRNA is administered. In some ofthe aforementioned embodiments, two, three, four, five, six, or more doses of the siRNA are administered with each dose separated by 1,2, 3, or 4 weeks. In some of the aforementioned embodiments, six 200-mg doses of the siRNA are administered. In some of the aforementioned embodiments, two 400-mg doses of the siRNA are administered. In some of the aforementioned embodiments, the siRNA îs administered via subcutaneous injection; for example, in some embodiments, admimstering the siRNA HBVÛ2 includes administering 1, 2, or 3 subcutaneous injections per dose.

In some ofthe aforementioned embodiments, the dose ofPEG-IFNa îs 50 pg, 100 pg, 150 pg, or 200 pg. In some of the aforementioned embodiments, the PEG-IFNa îs administered weekly. In some of the aforementioned embodiments, the PEG-IFNa is administered via subcutaneous injection.

In some of the aforementioned embodiments, the NRTI is tenofovir, tenofovir disoproxil fumarate (TDF), tenofovir alafenamide (TAF), lamivudine, adefovir, adefovir dipîvoxil, entecavir (ETV), telbîvudine, AGX-1009, emtricitabine (FTC), clevudine, ritonavir, dipîvoxil, lobucavir, famvir, N-Acetyl-Cysteine (NAC), PC 1323, theradigm-HBV, thymosin-alpha, ganciclovir, besifovîr (ANA-380/LB-80380), or tenofvir-exaliades (TLX/CMX157).

In some of the aforementioned embodiments, the subject is HBeAg négative. In some embodiments, the subject is HBeAg positive.

In some aspects of the disclosure, a kit îs provided comprising: a pharmaceutical composition comprising an siRNA according to any of the preceding embodiments, and a pharmaceutically acceptable excipient; and a pharmaceutical composition comprising PEG-lFNa, and a pharmaceutically acceptable excipient. The kit may also contain a NRTI, and a pharmaceutically acceptable excipient.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 depîcts characteristics of acute and chronic Hepatitîs B infections.

Figure 2 depîcts characteristics of chronic Hepatitîs B infection. The disease is divided into 4 phases based on HBeAg status and laboratory or radiographie evidence ofliver disease. Heterogeneity of disease could be due to différences in virus (e.g., HBV génotypes, mutations), host (e.g., immune responses, âge at inflection, number of infected hépatocytes), and other factors (e.g., co-infections (HDV, HCV, HIV), intercurrent infections, co-morbidities).

Figure 3 depîcts the single ascending dose design for Part A of Example 2. ^aSubject discharge occurs after all assessments are completed on day 2.

Figure 4 depîcts the multiple ascending dose design for Parts B and C of Example 2. ^Additional HBsAg monitoring is required for subjects with HBsAg levels wîth a >10% decrease from the Day 1 predose level at the Week 16 visit. Visits occur every 4 weeks starting at Week 20 up to Week 48 or until the HBsAg level returns to >90% of the Day 1 perdose level.

Figure 5A to Figure 5B depict the cohort dosing schedule for Parts A, B, and C of Example 2, including optional cohorts and floater subjects. *Up to 8 subjects for Part A and up to 16 subjects total for Parts B/C may be added as part of an expansion of an existing cohort or cohorts if further data are required (the allocation of the floater subjects in Parts B/C is not required to be distributed evenly; the total combined n for Parts B/C does not exceed 48 subjects). **The doses designated in Parts B/C schedule are indicative of a single dose of HBV02 or placebo; subjects receive up to 2 doses total.

Figure 6A to Figure 6D depict the cohort dosing schedule for Part D of Example 2. Figure 6A shows the design for cohort 1 d; Figure 6B shows the design for cohort 2d; Figure 6C shows the design for cohort 3d; and Figure 6D shows the design for cohort 4d.

Figure 7A to 7B depict the cohort dosing schedule for Parts A, B, C, and D of Example 2 including optional cohorts and floater subjects (dashed lines on Figure 7A).

Figure 8 depicts the cohort dosing schedule for Parts A, B, and C of the study in Example 3.

Figure 9A to 9C depict studies generating preliminary data in Example 3. Figure 9A illustrâtes the study design at the time dosing was completed for Part A cohorts 1 through 5 (50 mg, 100 mg, 200 mg, 400 mg, 600 mg) and for Part B cohorts 1 through 2 (50 mg, 100 mg). Figure 9B illustrâtes the Part A completed dosing for cohorts 1 through 5, and the withdrawal of subjects in the different cohorts. Figure 9C depicts the Part B completed dosing for cohorts 1 through 2, and the withdrawal of subjects in the different cohorts.

Figure 10A to Figure 10B depict ALT levels for subjects in cohorts 1 through 4 of Part A of Example 3. Figure 10A shows ALT levels for subjects that received 50 mg (cohort la) or 100 mg (cohort 2a) of HBV002. Figure 10B shows ALT levels for subjects that received 200 mg (cohort 3a) or 400 mg (cohort 4a) of HBV002. One subject in the 200-mg cohort had an ALT at ULN on Day 29 associated with strenuous exercise and high créatinine kinase (CK: 5811 U/L). Two subjects in the 400-mg cohort had ALT values above ULN on Day 1 prior to dosing; one of these subjects admîtted to strenuous exercise, had high CK (20,001 U/L), and wîthdrew on Day 2 unrelated to adverse events, and the ALT of the other subject resolved by Day 8 wîthout intervention.

Figure 11 depicts ALT levels for subjects in Part B of Example 3 that received 50 mg (cohort 1b) or 100 mg (cohort 2b) of HBV002. One female subject in the 100mg cohort exhibîted a grade 1 ALT élévation at Week 8.

Figure 12A to I2C depict antiviral activity in Part B cohorts 1b (50 mg) and 2b (100 mg) of Example 3 as measured by change in HBsAg levels. Figure 12A shows change în HBsAg levels among active and placebo subjects. Figure 12B shows change in HBsAg levels among only active subjects. Figure 12C shows change in HBsAg levels (mean change from Day 1 in HBsAg following administration of HBV02) among subjects in the 50 mg (cohort 1b) and 100 mg (cohort 2b) cohorts.

Figure 13A to Figure 13E show ALT levels în chronic HBV patients in Example 3 through Week 16 (n=32). Figure 13A shows ALT levels for ail patients, and these results are shown separately for different HBV02 dose levels in Figures 13B (20 mg), 13C (50 mg), l3D(100 mg), and 13E(200 mg).

Figure 14 shows treatment-emergent post-baseline ALT élévations in healthy volunteers with normal ALT at baseline, corresponding to Example 3. The highest treatment-emergent post-base line ALT élévation, expressed relative to upper Iimit of normal (ULN), îs shown n the y-axis. Dose of HBV01 or HBV02 is shown on the xaxis. *Approximate mg/kg dose based on an average adult weight of 60 kg; fixed doses of HBV02 ranged from 50-900 mg.

Figure 15A to Figure 15B show plasma concentration vs time profiles for HBV02 (A) and AS(N-1 )3' HBV02 (B) after a single subcutaneous dose in healthy volunteers, corresponding to Example 3.

Figure 16 shows plasma AUC0-12 for HBV02 following a single subcutaneous dose in healthy volunteers, corresponding to Example 3. Dose proportionality was observed from 50 mg to 900 mg.

Figure 17 shows plasma Cmax for HBV02 foliowing a single subcutaneous dose in healthy volunteers, correspondîng to Example 3. Dose proportionalïty was observed from 50 mg to 900 mg.

Figurel8 shows plasma PK parameters for HBV02 and AS(N-1)3' HBV02 after 5 a single SC dose in healthy volunteers in Example 3. Time parameters are expressed as médian (quartile [Q] i, Q3); ail other data are presented as mean (% coefficient of variation [CV]). Due to short HBV02 half-lîfe (ti/2) and PK sampling schedule limitations, terminal phase was not adequately characterized; therefore, apparent clearance and tw were not reported. ^Excludes 1 volunteer who received partial dose;

^includes PK from replacement volunteer; ^measurable in 3/6 volunteers; AUC, area under curve; AUC0-12, AUC from time 0 to 12 hr; AUCiast, AUC from time of dosing to last measurable time point; BLQ, below lîmit of quantitation; Cmax, maximum concentration; CV, coefficient of variance; MR, metabolite-to-parent ratio; NC, not calculable; T_ma_X=time of Cmax; Tt_ast, last measurable time.

Figure 19A to 19B show urine concentration vs time profiles for HBV02 (A) and AS(N-1)3' HBV02 (B) after a single subcutaneous dose in healthy volunteers, correspondîng to Example 3.

Figure 20 shows plasma PK parameters for HBV02 and AS(N-1)3' HBV02 in healthy volunteers in Example 3. Ail PK parameters are expressed as mean (CV%).

^aExcludes 1 volunteer who received partial dose; ⁶Încludes PK from replacement volunteer; ^AUCo-m is extrapolated; AUC0-24, AUC from time 0 to 24 hr; CLR, total rénal clearance; feo-24, fraction excreted from time 0 to 24 hr; NC, not calculable.

Figure 21A to 21B depict antiviral activity in Parts B and C of Example 3, measured by change in HBsAg levels. Figure 21A shows change in HBsAg levels in 25 log scale.

Figure 22 depicts HBsAg change from baseline by dose of FIBV02, or for placebo, for Example 3. Follow-up data available for ail placebo patients through Week 16, compared to 24 weeks for treatment groups.

Figure 23 depicts individual maximum HBsAg change from baseline for 30 Example 3. Error bars represent médian (interquartile range).

Figure 24 shows individual HBsAg change from baseline at Week 24 for Example 3. Error bars represent médian (înterquartile range).

DETAILED DESCRIPTION

The instant disclosure provides methods, compositions, and kits for use in 5 treating hepatitis B virus (HBV) infection, wherein a small interfering RNA (siRNA) molécule that targets HBV is administered. In some embodiments, the siRNA molécule is administered with a pegylated interferon-2a (PEG-IFNa) therapy or is administered to a subject that has received or will receive a PEG-IFN-α therapy. In some embodiments, the methods, compositions, and kits disclosed herein are used to treat chronic HBV infection.

I. Glossary

Prior to setting forth this disclosure in more detail, it may be helpful to an understanding thereof to provide définitions of certain terms to be used herein. Additional définitions are set forth throughout this disclosure.

In the présent description, the term “about” means + 20% of the indîcated range, value, or structure, unless otherwise indîcated.

The term “comprise” means the presence of the stated features, integers, steps, or components as referred to in the claims, but that it does not preclude the presence or addition of one or more other features, integers, steps, components, or groups thereof.

The term “consisting essentîally of ’ lîmits the scope of a claim to the specified materials or steps and those that do not material ly affect the basic and novel characteristics ofthe claimed invention.

It should be understood that the ternis “a” and “an” as used herein refer to “one or more” of the enumerated components. The use of the alternative (e.g., “or”) should 25 be understood to mean either one, both, or any combination thereof of the alternatives, and may be used synonymously with “and/or”. As used herein, the terms “include” and “hâve” are used synonymously, which terms and variants thereof are intended to be construed as non-limiting.

The word “substantially” does not exclude “completely”; e.g, a composition which is “substantially free” from Y may be completely free from Y. Where necessary, the word “substantially” may be omitted from définitions provided herein.

The term “disease” as used herein is întended to be generally synonymous, and is used interchangeably with, the terms “disorder” and “condition” (as in medical condition), in that ail reflect an abnormal condition of the human or animal body or of one of îts parts that impairs normal functionîng. A “disease” îs typically manifested by distinguîshing signs and symptoms, and causes the human or animal to hâve a reduced duration or quality of life.

As used herein, the terms “peptide,” “polypeptide,” and “protein” and variations of these terms refer to a molécule, in particular a peptide, oligopeptide, polypeptide, or protein including fusion protein, respectively, comprising at least two amino acids joîned to each other by a normal peptide bond, or by a modified peptide bond, such as for example in the cases of isosteric peptides. For example, a peptide, polypeptide, or protein may be composed of amino acids selected from the 20 amino acids defined by the genetic code, linked to each other by a normal peptide bond (“classical” polypeptide). A peptide, polypeptide, or protein can be composed of L-amino acids and/or D-amîno acids. In particular, the terms “peptide,” “polypeptide,” and “protein” also include “peptidomimetics,” which are defined as peptide analogs containing nonpeptidic structural éléments, which are capable of mimicking or antagonizing the biologîcal action(s) of a natural parent peptide. A peptidomimetic lacks classical peptide characteristics such as enzymatically scîssile peptide bonds. In particular, a peptide, polypeptide, or protein may comprise amino acids other than the 20 amino acids defined by the genetic code in addition to these amino acids, or it can be composed of amino acids other than the 20 amino acids defined by the genetic code. In particular, a peptide, polypeptide, or protein in the context of the présent disclosure can equally be composed of amino acids modified by natural processes, such as posttranslational maturation processes or by Chemical processes, which are well known to a person skîlled in the art. Such modifications are fully detailed in the literature. These modifications can appear anywhere in the polypeptide: in the peptide skeleton, in the amino acid chain, or even at the carboxy- or amino-terminal ends. In particular, a peptide or polypeptide can be branched following an ubiquitinatîon or be cyclic with or without branching. This type of modification can be the resuit of natural or synthetic post-transiational processes that are well known to a person skîlled in the art. The terms “peptide,” “polypeptide,” or “proteîn” in the context of the présent disclosure in particular also include modîfied peptides, polypeptides, and proteins. For example, peptide, polypeptide, or protein modifications can include acétylation, acylation, ADPribosylation, amidation, covalent fixation of a nucléotide or of a nucléotide dérivative, covalent fixation of a lipid or of a lipidic dérivative, the covalent fixation of a phosphatidylinositol, covalent or non-covalent cross- linking, cyclîzation, disulfide bond formation, déméthylation, glycosylation including pegylation, hydroxylation, iodizatîon, méthylation, myristoylation, oxidation, proteolytic processes, phosphorylation, prénylation, racemization, seneloylatîon, sulfatation, amino acid addition such as arginylation, or ubiquitinatîon. These modifications are fully detailed in the literature (Proteins Structure and Moiecular Propertîes, 2nd Ed., T.E. Creighton, New York (1993); Post-translational Covalent Modifications of Proteins, B.C. Johnson, Ed., Academie Press, New York (1983); Seifter, et al., Analysis for protein modifications and nonprotein cofactors, Meth. Enzymol. 182:626-46 (1990); and Rattan, et al., Protein Synthesis: Post-translational Modifications and Aging, Ann NY Acad Sci 663:48-62 (1992)). Accordîngly, the ternis “peptide,” “polypeptide,” and “protein” include for example lipopeptides, lipoproteins, glycopeptides, glycoproteins, and the like.

As used herein a “(poly)peptide” comprises a single chain of amino acid monomers linked by peptide bonds as explained above. A “protein,” as used herein, comprises one or more, e.g., 1,2, 3, 4, 5, 6, 7, 8, 9 or 10 (poly)peptides, i.e., one or more chains of amino acid monomers linked by peptide bonds as explained above. In particular embodiments, a protein according to the présent disclosure comprises 1, 2, 3, or 4 polypeptides.

The term “recombinant,” as used herein (e.g., a recombinant protein, a recombinant nucleic acid, etc.), refers to any molécule (protein, nucleic acid, siRNA, etc.) that is prepared, expressed, created, or isolated by recombinant means, and which is not naturally occurring.

As used herein, the terms “nucleîc acid,” “nucleic acid molécule,” and “polynucleotide” are used înterchangeably and are intended to include DNA molécules and RNA molécules. A nucleic acid molécule may be single-stranded or doublestranded. In particular embodiments, the nucleic acid molécule is double-stranded RNA molécule.

As used herein, the terms “cell,” “cell line,” and “cell culture” are used înterchangeably and ail such désignations include progeny. Thus, the words “transformants” and “transformed cells” include the primary subject cell and cultures derived therefrom without regard for the number of transfers. It is also understood that ail progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Variant progeny that hâve the same function or biological activity as screened for in the originally transformed cell are included.

As used herein, the tenu “sequence variant” refers to any sequence having one or more alterations in comparison to a reference sequence, whereby a reference sequence is any of the sequences listed in the sequence listing, i.e., SEQ ID NO:1 to SEQ ID NO:6. Thus, the term “sequence variant” includes nucléotide sequence variants and amino acid sequence variants. For a sequence variant in the context of a nucléotide sequence, the reference sequence is also a nucléotide sequence, whereas for a sequence variant in the context of an amino acid sequence, the reference sequence is also an amino acid sequence. A “sequence variant” as used herein is at least 80%, at least 85 %, at least 90%, at least 95%, at least 98%, or at least 99% identical to the reference sequence. Sequence identity is usually calculated with regard to the full length ofthe reference sequence (i.e., the sequence recîted in the application), unless otherwise specîfied. Percentage identity, as referred to herein, can be determined, for example, using BLAST using the default parameters specified by the NCBI (the National Center for Biotechnology Information; http://www.ncbi.nlm.nih.gov/) [Blosum 62 matrix; gap open penalty=I 1 and gap extension penalty=l].

A “sequence variant” in the context of a nucleic acid (nucléotide) sequence has an altered sequence in which one or more of the nucléotides in the référencé sequence is deleted, or substituted, or one or more nucléotides are inserted into the sequence of the reference nucléotide sequence. Nucléotides are referred to herein by the standard one- letter désignation (A, C, G, or T). Due to the degeneracy ofthe genetîc code, a “sequence variant” of a nucléotide sequence can either resuit in a change in the respective reference amino acid sequence, i.e., în an amino acid “sequence variant” or not. In certain embodiments, the nucléotide sequence variants are variants that do not resuit în amino acid sequence variants (i.e., silent mutations). However, nucléotide sequence variants leading to “non-silent” mutations are also within the scope, in particular such nucléotide sequence variants, which resuit in an amino acid sequence, which is at least 80%, at least 85 %, at least 90%, at least 95%, at least 98%, or at least 99% identical to the reference amino acid sequence. A “sequence variant” în the context of an amino acid sequence has an altered sequence in which one or more of the amino acids is deleted, substituted or inserted in comparison to the reference amino acid sequence. As a resuit of the alterations, such a sequence variant has an amino acid sequence which is at least 80%, at least 85 %, at least 90%, at least 95%, at least 98%, or at least 99% identical to the reference amino acid sequence. For example, per 100 amino acids of the reference sequence a variant sequence having no more than 10 alterations, i.e., any combination of délétions, insertions, or substitutions, is “at least 90% identical” to the reference sequence.

While ît is possible to hâve non-conservative amino acid substitutions, in certain embodiments, the substitutions are conservative amino acid substitutions, in which the substituted amino acid has similar structural or Chemical properties with the corresponding amino acid in the reference sequence. By way of example, conservative amino acid substitutions involve substitution of one aliphatic or hydrophobie amino acids, e.g., alanine, valine, leucine, and isoleucine, with another; substitution of one hydoxyl-contaînîng amino acid, e.g., serine and threonine, with another; substitution of one acidic residue, e.g., glutamic acid or aspartic acid, with another; replacement of one amide-containing residue, e.g., asparagine and glutamine, with another; replacement of one aromatic residue, e.g., phenylalanîne and tyrosine, with another; replacement of one basic residue, e.g., lysine, arginine, and histidine, with another; and replacement of one small amino acid, e.g., alanine, serine, threonine, méthionine, and glycine, with another.

Amino acid sequence insertions include amino- and/or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Examples of terminal insertions include the fusion to the N - or C-terminus of an amino acid sequence to a reporter molécule or an enzyme.

Unless otherwïse stated, alterations in the sequence variants do not necessarily abolish the functionality ofthe respective reference sequence, for example, in the present case, the functionality of an sîRNA to reduce HBV protein expression. Guidance in determining which nucléotides and amino acid residues, respectively, may be substituted, inserted, or deleted without abolishing such functionality can be found by using computer programs known in the art.

As used herein, a nucleic acid sequence or an amino acid sequence “derived from” a designated nucleic acid, peptide, polypeptide, or protein refers to the origin of the nucleic acid, peptide, polypeptide, or protein. In some embodiments, the nucleic acid sequence or amino acid sequence which is derived from a particular sequence has an amino acid sequence that is essentîally identical to that sequence or a portion thereof, from which it is derived, whereby “essentîally identical” includes sequence variants as defined above. In certain embodiments, the nucleic acid sequence or amino acid sequence which is derived from a particular peptide or protein is derived from the corresponding domain in the particular peptide or protein. Thereby, “corresponding” refers in particular to the same functionality. For example, an “extracellular domain” corresponds to another “extracellular domain” (of another protein), or a “transmembrane domain” corresponds to another “transmembrane domain” (of another protein). “Corresponding” parts of peptides, proteins, and nucleic acids are thus identifiable to one of ordinary skill in the art. Likewïse, sequences “derived from” another sequence are usually identifiable to one of ordinary skill în the art as having its origin in the sequence.

In some embodiments, a nucleîc acid sequence or an amino acid sequence derived from another nucleic acid, peptide, polypeptide, or protein may be identical to the starting nucleic acid, peptide, polypeptide, or protein (from which it is derived). However, a nucleic acid sequence or an amino acid sequence derived from another nucleic acid, peptide, polypeptide, or protein may also hâve one or more mutations relative to the starting nucleic acid, peptide, polypeptide, or protein (from which it îs derived), in particular a nucleic acid sequence or an amino acid sequence derived from another nucleic acid, peptide, polypeptide, or protein may be a functional sequence variant as described above of the starting nucleic acid, peptide, polypeptide, or protein (from which it îs derived). For example, in a peptide/protein one or more amino acid residues may be substituted with other amino acid residues or one or more amino acid residue insertions or délétions may occur.

As used herein, the term “mutation” relates to a change in the nucleic acid sequence and/or in the amino acid sequence in comparison to a reference sequence, e.g., a corresponding genomîc sequence. A mutation, e.g., in comparison to a genomic sequence, may be, for example, a (naturally occurring) somatic mutation, a spontaneous mutation, an induced mutation, e.g., induced by enzymes, Chemicals, or radiation, or a mutation obtained by site-directed mutagenesis (molecular bioîogy methods for making spécifie and intentîonal changes in the nucleic acid sequence and/or in the amino acid sequence). Thus, the ternis “mutation” or “mutating” shall be understood to also include physîcally making a mutation, e.g., in a nucleic acid sequence or in an amino acid sequence. A mutation includes substitution, délétion, and insertion of one or more nucléotides or amino acids as well as inversion of several successive nucléotides or amino acids. To achieve a mutation in an amino acid sequence, a mutation may be întroduced into the nucléotide sequence encoding said amîno acid sequence in order to express a (recombinant) mutated polypeptide. A mutation may be achieved, e.g., by altering, e.g., by sîte-directed mutagenesis, a codon of a nucleic acid molecuie encoding one amino acid to resuit in a codon encoding a different amino acid, or by synthesîzing a sequence variant, e.g., by knowing the nucléotide sequence of a nucleic acid molecuie encoding a polypeptide and by designing the synthesis of a nucleic acid molecuie

comprising a nucieotide sequence encoding a variant of the polypeptide without the need for mutating one or more nucléotides of a nucleic acid molécule.

As used herein, the term “coding sequence” is intended to refer to a polynucleotide molécule, which encodes the amino acid sequence of a protein product.

The boundaries of the coding sequence are généra lly determined by an open reading frame, which usualiy begins with an ATG start codon.

The term “expression” as used herein refers to any step involved in the production of the polypeptide, including transcription, post-transcriptïonal modification, translation, post-translational modification, sécrétion, or the lîke.

Doses are often expressed in relation to bodyweîght. Thus, a dose which is expressed as [g, mg, or other unît]/kg (or g, mg, etc.) usualiy refers to [g, mg, or other unit] “per kg (or g, mg, etc.) bodyweîght,” even if the term “bodyweîght” is not explicitly mentioned.

As used herein, “Hepatitis B virus,” used interchangeably with the term “HBV” 15 refers to the well-known non-cytopathic, lîver-tropic DNA virus belonging to the Hepadnavirîdae family. The HBV genome is partially double-stranded, circulât DNA with four overlapping reading frames (that may be referred to herein as “genes,” “open reading frames,” or “transcripts”): C, X, P, and S. The core protein is coded for by gene C (HBcAg). Hepatitis B e antigen (HBeAg) is produced by proteolytic processing of the 20 pre-core (pre-C) protein. The DNA polymerase is encoded by gene P. Gene S is the gene that codes for the surface anti gens (HBsAg). The HBsAg gene is one long open reading frame which contains three in frame “start” (ATG) codons resulting in polypeptides of three different sizes called large, middle, and small S antigens, pre-Sl + pre-S2 + S, pre-S2 + S, or S. Surface antigens in addition to decorating the envelope of 25 HBV, are also part of subviral particles, which are produced at large excess as compared to virion particles, and play a rôle in immune tolérance and in sequestering anti-HBsAg antibodies, thereby allowing for infections particles to escape immune détection. The fonction of the non-structural protein coded for by gene X is not fully understood, but it plays a rôle in transcriptional transactivation and réplication and is 30 associated with the development of liver cancer.

Nine génotypes of HBV, designated A to I, hâve been determined, and an additional génotype J has been proposed, each having a distinct geographical distribution (Velkov S, et al., The Global Hepatitis B Virus Génotype Distribution Approximated from Available Genotypîng Data, Genes 2018, 9(10):495). The term “HBV” includes any of the génotypes of HBV (A to J). The complété coding sequence of the reference sequence of the HBV genome may be found in for example, GenBank Accession Nos. GI:21326584 and GI:3582357. Amino acid sequences for the C, X, P, and S proteins can be found at, for example, NCB1 Accession numbers YP_009173857.1 (C protein); YP_009173867.1 and BAA32912.1 (X protein); YP_009173866.1 and BAA32913.1 (P protein); and YP_009173869.1, YP 009173870.1, YP_009173871.1, and BAA32914.1 (S protein). Additional examples of HBV messenger RNA (mRNA) sequences are available using publicly available databases, e.g., GenBank, UniProt, and OMIM. The International Repository for Hepatitis B Virus Strain Data can be accessed at http://www.hpabioinformatics.org.uk/HepSEQ/main.php. The term “HBV,” as used herein, also refers to naturally occurring DNA sequence variations of the HBV genome, i.e., génotypes AJ and variants thereof.

siRNA médiates the targeted cleavage of an RNA transcript via an RNAinduced silencing complex (RISC) pathway, thereby effecting inhibition of gene expression. This process is frequently termed “RNA interférence” (RNAi). Without wîshing to be bound to a particular theory, long double-stranded RNA (dsRNA) întroduced into plants and invertebrate cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp, et al., Genes Dev. 15:485 (2001)). Dîcer, a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair siRNAs with characteristîc two base 3' overhangs (Bernstein, et al., Nature 2001,409:363). The siRNAs are then incorporated into RISC where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target récognition (Nykanen, et ai., 2001, Cell 107:309). Upon binding to the approprîate target mRNA, one or more endonucleases within RISC cleaves the target to induce silencing (Elbashîr, et al., Genes Dev. 2001, 15:188).

The terms “silence,” “inhibit the expression of,” “down-regulate the expression of,” “suppress the expression of,” and the like, in so far as they refer to an HBV gene, herein refer to the at least partial réduction of the expression of an HBV gene, as manifested by a réduction ofthe amount of HBV mRNA which can be isolated from or 5 detected in a first cell or group of cells in which an HBV gene is transcribed and which has or hâve been treated with an inhibîtor of HBV gene expression, such that the expression ofthe HBV gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or hâve not been so treated (control cells). The degree of inhibition can be measured, by example, as the 10 différence between the degree of mRNA expression in a control cell minus the degree of mRNA expression in a treated cell. Alternatively, the degree of inhibition can be gîven in terms of a réduction of a parameter that is functionally linked to HBV gene expression, e.g., the amount of protein encoded by an HBV gene, or the number of cells displaying a certain phenotype, e.g., an HBV infection phenotype. In princîple, HBV 15 gene silencîng can be determined in any cell expressing the HBV gene, e.g., an HBVinfected cell or a cell engineered to express the HBV gene, and by any appropriate assay.

The level of HBV RNA that is expressed by a cell or group of cells, or the level of circulating HBV RNA, may be determined using any method known in the art for 20 assessing mRNA expression, such as the rtPCR method provided in Example 2 of International Application Publication No. WO 2016/077321 Al and U.S. Patent Application No. US2017/0349900A1, which methods are incorporated herein by reference. In some embodiments, the level of expression of an HBV gene (e.g., total HBV RNA, an HBV transcript, e.g., HBV 3.5 kb transcript) in a sample is determined 25 by detectîng a transcribed polynucléotide, or portion thereof, e.g., RNA of the HBV gene. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy RNA préparation kits (Qiagen®), or PAXgene (PreAnalytix, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include 30 nuclear run-on assays, RT-PCR, RNase protection assays (Melton DA, et al., Efficient

in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bactériophage SP6 promoter, Nue. Acids Res. 1984, 12:7035-56), northern blotting, in situ hybridization, and microarray analysis. Circulating HBV mRNA may be detected using methods the described in International Application

Publication No. WO 2012/177906A1 and U.S. Patent Application No. US2014/0275211 Al, which methods are incorporated herein by reference.

As used herein, “target sequence” refers to a contiguous portion of the nucléotide sequence of an mRNA molécule formed during the transcription of an HBV gene, including mRNA that is a product of RNA processing of a primary transcription product. The target portion of the sequence wi 11 be at least long enough to serve as a substrate for RNAi-dîrected cleavage at or near that portion. For example, the target sequence will generally be from 9-36 nucléotides in length, e.g., 15-30 nucléotides in length, including ail sub-ranges there between. As non-limiting examples, a target sequence can be from 15-30 nucléotides, 15-26 nucléotides, 15-23 nucléotides, 15-22 nucléotides, 15-21 nucléotides, 15-20 nucléotides, 15-19 nucléotides, 15-18 nucléotides, 15-17 nucléotides, 18-30 nucléotides, 18-26 nucléotides, 18-23 nucléotides, 18-22 nucléotides, 18-21 nucléotides, 18-20 nucléotides, 19-30 nucléotides, 19-26 nucléotides, 19-23 nucléotides, 19-22 nucléotides, 19- 21 nucléotides, 19-20 nucléotides, 20-30 nucléotides, 20-26 nucléotides, 20-25 nucléotides, 20- 24 nucleotides,20-23 nucléotides, 20-22 nucléotides, 20-21 nucléotides, 21-30 nucléotides, 21-26 nucléotides, 21-25 nucléotides, 21-24 nucléotides, 21-23 nucléotides, or21- 22 nucléotides.

As used herein, the terni “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucléotides that is described by the sequence 25 referred to using the standard nucléotide nomenclature.

As used herein, and unless otherwise îndicated, the terni “complementary,” when used to describe a first nucléotide sequence in relation to a second nucléotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucléotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucléotide

sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by washing. Other conditions, such as physiologically relevant conditions as can be 5 encountered inside an organîsm, can apply. The skilled person will be able to déterminé the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridïzed nucléotides.

Complementary sequences within an siRNA as described herein include basepairing of the oligonucleotide or polynucléotide comprising a first nucléotide sequence 10 to an oligonucleotide or polynucleotide comprising a second nucléotide sequence over the entire length of one or both nucléotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one 15 or more, but generally not more than 5, 4, 3, or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the abîlity to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall 20 not be regarded as mismatches with regard to the détermination of complementarity.

For example, an sîRNA comprising one oligonucleotide 21 nucléotides in length, and another oligonucleotide 23 nucléotides în length, wherein the longer oligonucleotide comprises a sequence of 21 nucléotides that is fully complementary to the shorter oligonucleotide, can y et be referred to as “fully complementary” for the purposes 25 described herein.

“Complementary” sequences, as used herein, can also include, or be formed entirely from non-Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucléotides, in so far as the above requirements with respect to their abîlity to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not 30 limited to, G:U Wobble or Hoogstein base pairing.

The terms “complementary ” “fully complementary,” and “substantialiy complementary” herein can be used with respect to the base matching between the sense strand and the antisense strand of an siRNA, or between the antîsense strand of an siRNA agent and a target sequence, as will be understood from the context of their use.

As used herein, a polynucleotîde that is “substantialiy complementary” to at least part of a mRNA refers to a polynucleotîde that is substantialiy complementary to a contîguous portion of the mRNA of Interest (e.g., an mRNA encoding an HBV protein). For example, a polynucleotîde is complementary to at least a part of an HBV mRNA if the sequence is substantialiy complementary to a non-înterrupted portion of the HBV mRNA.

The term “siRNA,” as used herein, refers to an RNA interférence moiecule that includes an RNA moiecule or complex of molécules having a hybridized duplex région that comprises two anti-parallel and substantialiy complementary nucleic acid strands, which will be referred to as having “sense” and “antisense” orientations with respect to a target RNA. The duplex région can be of any length that permîts spécifie dégradation of a desired target RNA through a RISC pathway, but will typically range from 9 to 36 base pairs in length, e.g, 15-30 base pairs ïn length. Considering a duplex between 9 and 36 base pairs, the duplex can be any length in this range, for example, 9, 10, 11, 12, 13, 14, 15, 16, 17, IS, 19, 20,21 ,22, 23,24,25,26,27,28,29,30,31 ,32,33,34,35, or 36 and any sub-range there between, including, but not limited to 15-30 base pairs, 15-26 base pairs, 15-23 base pairs, 15-22 base pairs, 15-21 base pairs, 15-20 base pairs, 15-19 base pairs, 15-18 base pairs, 15-17 base pairs, 18-30 base pairs, 18-26 base pairs, 18-23 base pairs, 18-22 base pairs, 18-21 base pairs, 18-20 base pairs, 19-30 base pairs, 19-26 base pairs, 19-23 base pairs, 19-22 base pairs, 19-21 base pairs, 19-20 base pairs, 20-30 base pairs, 20-26 base pairs, 20-25 base pairs, 20-24 base pairs, 20-23 base pairs, 20-22 base pairs, 20-21 base pairs, 21-30 base pairs, 21-26 base pairs, 21-25 base pairs, 21-24 base pairs, 21-23 base pairs, and 21-22 base pairs. siRNAs generated in the cell by processing with Dicer and sîmilar enzymes are generally in the range of 19-22 base pairs in length.

One strand of the duplex région of an siRNA comprises a sequence that is substantîally complementary to a région of a target RNA. The two strands forming the duplex structure can be from a single RNA molecuie having at least one selfcomplementary région, or can be formed from two or more separate RNA molécules.

Where the duplex région is formed from two strands of a single molecuie, the molecuie can hâve a duplex région separated by a single stranded chain of nucléotides (herein referred to as a “hairpin loop”) between the 3'-end of one strand and the 5'-end of the respective other strand forming the duplex structure. The hairpin loop can comprise at least one unpaîred nucléotide; in some embodiments the hairpin loop can comprise at 10 least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaîred nucléotides. Where the two substantîally complementary strands of an siRNA are comprised by separate RNA molécules, those molécules need not, but can be covalently connected. Where the two strands are connected covalently by means other than a hairpin loop, the connecting structure is 15 referred to as a “linker.”

An siRNA as described herein can be synthesized by standard methods known in the art, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Bîosystems, Inc.

The term “antisense strand” or “guide strand” refers to the strand of an siRNA, 20 which incîudes a région that is substantîally complementary to a target sequence. As used herein, the term “région of complementarity” refers to the région on the anti sense strand that is substantîally complementary to a sequence, for example a target sequence, as defined herein. Where the région of complementarity is not fuily complementary to the target sequence, the mismatches can be in the internai or terminal régions of the 25 molecuie. Generalîy, the most tolerated mismatches are in the terminal régions, e.g., within 5, 4, 3, or 2 nucléotides of the 5’ and/or 3' terminus.

The tenu “sense strand” or “passenger strand” as used herein, refers to the strand of an siRNA that incîudes a région that is substantîally complementary to a région of the anti sense strand as that term is defined herein.

The term “RNA molécule” or “ribonucleic acid molécule’ encompasses not only RNA molécules as expressed or found in nature, but also analogs and dérivatives of RNA comprising one or more ribonucleotide/ribonucleosîde analogs or dérivatives as described herein or as known in the art. Strîctly speaking, a “ribonucleoside” includes a nucleoside base and a ribose sugar, and a “rîbonucleotide” is a ribonucleoside with one, two or three phosphate moieties. However, the terms “ribonucleoside” and “rîbonucleotide” can be considered to be équivalent as used herein. The RNA can be modified in the nucleobase structure or in the ribose-phosphate backbone structure, e.g., as described in greater detail below. However, siRNA molécules comprising ribonucleoside analogs or dérivatives retain the ability to form a duplex. As nonlimiting examples, an RNA molécule can also include at least one modified ribonucleoside including but not limited to a 2'-O-methyl modified nucleoside, a nucleoside comprising a 5' phosphorothioate group, a terminal nucleoside linked to a cholesteryl dérivative or dodecanoic acid bîsdecylamide group, a locked nucleoside, an abasic nucleoside, a 2'-deoxy-2'-fluoro modified nucleoside, a 2'-amino-modified nucleoside, 2'-alkyl-modified nucleoside, morpholino nucleoside, a phosphoramîdate, or a non-natural base comprising nucleoside, or any combination thereof. In another example, an RNA molécule can comprise at least two modified ribonucleosides, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, or more, up to the entire length of the siRNA molécule. The modifications need not be the same for each of such a plurality of modified ribonucleosides in an RNA molécule. In some embodiments, a modified ribonucleoside includes a deoxyribonucleoside. For example, an siRNA can comprise one or more deoxynucleosides, including, for example, a deoxynucleoside overhang(s), or one or more deoxynucleosides wîthîn the double-stranded portion of an siRNA. However, the term “siRNA” as used herein does not include a fully DNA molécule.

As used herein, the term “nucléotide overhang” refers to at least one unpaired nucléotide that protrudes from the duplex structure of an siRNA. For example, when a 3'-end of one strand of an siRNA extends beyond the 5'-end of the other strand, or vice versa, there is a nucléotide overhang. An siRNA can comprise an overhang of at least one nucléotide; alternat!vely the overhang can comprise at least two nucléotides, at least three nucléotides, at least four nucléotides, at least five nucléotides, or more. A nucleotîde overhang can comprise or consîst of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) can be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be présent on the 5' end, 3' end, or both ends of either an antisense or sense strand of an siRNA.

The terms “blunt” or “blunt ended” as used herein in référencé to an siRNA mean that there are no unpaired nucléotides or nucleotîde analogs at a given terminal end of an siRNA, i.e., no nucleotîde overhang. One or both ends of an siRNA can be blunt. Where both ends of an siRNA are blunt, the siRNA is said to be blunt ended.” A “blunt ended” siRNA is an siRNA that is blunt at both ends, i.e., has no nucleotîde overhang at either end of the molécule. Most often such a molécule will be doublestranded over its entire length.

II . siRNA targeting HBV

The présent disclosure provides methods of treatment involving administering an siRNA that targets HBV, and related compositions and kits. In some embodiments, the siRNA that targets HBV is HBV02. HBV02 is a synthetic, Chemically modified siRNA targeting HBV RNA with a covalently attached triantennary N-acetylgalactosamine (GalNAc) ligand that allows for spécifie uptake by hépatocytes. HBV02 targets a région of the HBV genome that is common to ail HBV viral transcripts and is pharmacologically active against HBV génotypes A through J. In preclinical models, HBV02 has been shown to inhibit viral réplication, translation, and sécrétion of HBsAg, and may provide a functional cure of chronic HBV infections. One siRNA can hâve multiple antiviral effects, including dégradation of the pgRNA, thus inhibiting viral réplication, and dégradation of ail viral mRNA transcripts, thereby preventing expression of viral proteins. This may resuit in the retum of a functional immune response directed against HBV, either alone or in combination with other thérapies.

HBV02's ability to reduce HBsAg-containing nonintectious subviral particles also distinguîshes it from currently available treatments.

HBV02 targets and înhibits expression of an mRNA encoded by an HBV genome according to NCBI Reference Sequence NC_003977.2 (GenBank Accession No. GI:21326584) (SEQ ID NO:l). More specifically, HBV02 targets an mRNA encoded by a portion of the HBV genome comprising the sequence GTGTGCACTTCGCTTCAC (SEQ IDNO:2), which corresponds to nucléotides 15791597 of SEQ ID NO:1. Because transcription of the HBV genome results in polycistronic, overlapping RNAs, HBV02 results in significant inhibition of expression of most or ail HBV transcripts.

HBV02 has a sense strand comprising 5'- GUGUGCACUUCGCUUCACA -3' (SEQ ID NO:3) and an antisense strand comprising 5’UGUGAAGCGAAGUGCACACUU -3’ (SEQ ID NO:4) wherein the nucléotides include 2'-fluoro (2'F) and 2'-O-methoxy (2’OMe) rïbose sugar modifications, phosphorothîoate backbone modifications, a glycol nucleic acid (GNA) modification, and conjugation to a triantennary N-acetyl-galactosamine (GalNAc) ligand at the 3' end ofthe sense strand, to facilitate delivery to hépatocytes through the asialoglycoproteîn receptor (ASGPR). Including modifications, the sense strand of HBV02 comprises 5'gsusguGfcAfCfUfucgcuucacaL96 -3' (SEQ ÏD NO:5) and an antisense strand comprising 5 - usGfsuga(Agn)gCfGfaaguGfcAfcacsusu -3’ (SEQ ID NO:6), wherein the modifications are abbreviated as shown in Table 1.

Table 1. Abbreviations of nucléotide monomers used in modified nucleic acid sequence représentation. It will be understood that, unless otherwise indicated, these monomers, when present in an oligonucleotide, are mutually linked bv S'-S'-phosphodiester bonds.

Abbreviation	Nucleotide(s)
A	adenosine-3'-phosphate
Af	2'-fluoroadenosine-3'-phosphate
Afs	2^,-fluoroadenosine-3'-phosphorothioate
As	adenosîne-3'-phosphorothioate

Abbreviation	„--------—---------------'-------¹ Nucleotide(s) __
C	cytidine-3'-phosphate _____
Cf	2'-fluorocytidine-3'-phosphate __
Cfs	2'-fluorocytidine-3’-phosphorothioate __
Cs	cytidine-3'-phosphorothioate ______
G	guanosine-3'-phosphate __________
Gf	2'-fluoroguanosine-3'-phosphate ____
Gfs	2'-tluoro£uanosine-3'-phosphorothioate ___
Gs	guanosine-3'-phosphorothioate_________________________
T	5'-methyluridine-3'-phosphate
Tf	2'-fluoro-5-methyluridîne-3'-phosphate __________
Tfs	2^,-fluoro-5-methyluridine-3'-phosphorothioate__________
Ts	5-methvluridine-3'-phosphorothioate
U	uridine-3'-phosphate ___
Uf	2'-fluorouridîne-3 '-phosphate __
Ufs	2'-fluorouridine -3'-phosphorothioate___________________
Us	uridine -3'-phosphorothioate
a	2'-O-methyladenosine-3'-phosphate ______
as	2'-O-methyladenosine-3'- phosphorothioate__
c	2'-O-methylcytidîne-3'-phosphate___________________
cs	2'-O-methylcytîdine-3'- phosphorothioate______________
g	2'-O-methylguanosine-3'-phosphate _
gs_______________	2'-O-methylguanosine-3'- phosphorothioate___________
t	2'-O-methy 1-5-methyl uridine-3'-phosphate
ts	2'-O-methyi-5-methyluridine-3'-phosphorothioate _____
U	2'-O-methyluridine-3^,-phosphate
us	2'-O-methyl uridine-3'-phosphorothioate_______________
s	phosphorothioate linkage

Abbrevîatîon	Nucleotide(s)
L96	N-[tris(GalNAc-afkyl)-amîdodecanoyl)]-4-hydroxyprolinol (Hyp-(GalNAc-alkyl)3)
(Agn)	adenosine-glycol nucleic acid (GNA)
dA	2'-deoxyadenosine-3'-phosphate
dAs	2'-deoxvadenosine-3'-phosphorothioate _______
dC	2'-deoxycytidine-3'-phosphate
dCs	2'-deoxycytidine-3'-phosphorothioate
dG	2'-deoxyguanosine-3'-phosphate
dGs	2’-deoxyguanosîne-3'-phosphorothioate
dT	2'-deoxythymidîne-3 -phosphate ______
dTs	2'-deoxythymidine-3'-phosphorothioate
dU	2'-deoxyuridine
dUs	2'-deoxyuridine-3'-phosphorothioate_____________________________

In some embodiments, the siRNA used in the methods, compositions, or kits described herein is HBV02.

In some embodiments, the siRNA used in the methods, compositions, or kits 5 described herein comprises a sequence variant of HBV02. In particular embodiments, the portion of the HBV transcript(s) targeted by the sequence variant of HBV02 overlaps with the portion of the HBV transcript(s) targeted by HBV02.

In some embodiments, the siRNA comprises a sense strand and an antisense strand, wherein (I) the sense strand comprises SEQ ID NO:3 or SEQ ID N0:5, or a 10 sequence that differs by not more than 4, not more than 3, not more than 2, or not more than 1 nucléotide from SEQ ID N0:3 or SEQ ID N0:5, respectively; or (2) the antisense strand comprises SEQ ID NO:4 or SEQ ID NO:6, or a sequence that differs by not more than 4, not more than 3, not more than 2, or not more than 1 nucléotide from SEQ ID NO:4 or SEQ ID NO:6, respectively.

In some embodiments, shorter duplexes having one of the sequences oi SEQ ID NO:5 or SEQ ID NO:6 minus only a few nucléotides on one or both ends are used. Hence, siRNAs having a partial sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucléotides from one or both of SEQ ID NO:5 and SEQ ID NO:6, and differing in their ability to inhibit the expression of an HBV gene by not more than 5, 10, 15, 20, 25, or 30 % inhibition from an siRNA comprising the full sequence, are contemplated herein. In some embodiments, an siRNA having a blunt end at one or both ends, formed by removing nucléotides from one or both ends of HBV02, is provided.

In some embodiments, an siRNA as described herein can contain one or more mismatches to the target sequence. In some embodiments, an siRNA as described herein contains no more than 3 mismatches. In some embodiments, if the antisense strand of the siRNA contains mismatches to a target sequence, the area of mismatch is not located in the center of the région of complementarity. In particular embodiments, if 15 the antisense strand contains mismatches to the target sequence, the mismatch is restricted to within the last 5 nucléotides from either the 5' or 3' end of the région of complementarity. For example, for a 23 nucléotide siRNA strand that is complementary to a région of an HBV gene, the RNA strand may not contain any mismatch within the central 13 nucléotides. The methods described herein or methods known in the art can be used to déterminé whether an siRNA containing a mismatch to a target sequence is effective in inhibiting the expression of an HBV gene.

In some embodiments, the siRNA used in the methods, compositions, and kits described herein include two oligonucleotides, where one oligonucleotide is described as the sense strand, and the second oligonucleotide is described as the corresponding antisense strand of the sense strand. As described elsewhere herein and as known in the art, the complementary sequences of an siRNA can also be contained as selfcomplementary régions of a single nucleic acid molécule, as opposed to being on separate oligonucleotides.

In some embodiments, a single-stranded antisense RNA molécule comprising 30 the antisense strand of HBV02 or sequence variant thereof is used in the methods, compositions, and kits described herein. The antisense RNA molécule can hâve 15-30 nucléotides complementary to the target. For example, the antisense RNA molécule may hâve a sequence ofat least 15, 16, 17, 18, 19, 20, 21, or more contiguous nucîeotîdes from SEQ ID NO: 6.

In some embodiments, the siRNA comprises a sense strand and an antisense strand, wherein the sense strand comprises SEQ ID NO:5 and the antisense strand comprises SEQ ID NO:6, and further comprises additional nucléotides, modifications, or conjugates as described herein. For example, in some embodiments, the siRNA can include further modifications in addition to those indicated in SEQ ID NOs: 5 and 6. Such modifications can be generated using methods established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage SL, et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which methods are încorporated herein by reference. Examples of such modifications are described in more detail below.

a. Modified siRNAs

Modifications disclosed herein include, for example, (a) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar; (b) backbone modifications, inciuding modification or replacement of the phosphodiester linkages; (c) base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded répertoire of partners, removal of bases (abasîc nucléotides), or conjugated bases; and (d) end modifications, e.g., 5' end modifications (phosphorylation, conjugatîon, inverted linkages, etc.), 3' end modifications (conjugation, DNA nucléotides, inverted linkages, etc.). Some spécifie examples of modifications that can be încorporated into siRNAs of the present application are shown in Table 1.

Modifications include substituted sugar moieties. The siRNAs featured herein can include one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- orN-alkynyl; or O-alkyl-O-alkyl; wherein the alkyl, alkenyl, and alkynyl can be substituted or unsubstituted Ci to Cio alkyl or C₂ to Cio alkenyl and alkynyl. Exemplary suitable modifications include O[(CH₂)_nO] mCFL, O(CH₂).nOCH3,

O(CH2)nNH₂, O(CH₂) nCHî, O(CH₂)nONH₂, and O(CH₂)nON[(CH₂)nCH₃)]2, where n and m are from 1 to about 10. In some other embodiments, siRNAs include one of the following at the 2' position: Ci to Cio lower alkyl, substîtuted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH₃, OCN, CI, Br, CN, CF₃, OCF₃, SOCH₃, 5 SO₂CH₃, ONO₂, NO₂, N₃, NH₂, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substîtuted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetîc properties of an siRNA, or a group for improving the pharmacodynamie properties of an siRNA, and other substituents having similar properties. In some embodiments, the modification includes 10 a 2'-methoxyethoxy (2- O-CH2CH₂OCH₃, also known as 2'- O-(2-methoxyethyl) or 2'MOE) (Martin, et al., Helv. Chîm. Acta 1995, 78:486-504), i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'- dimethylaminooxyethoxy, i.e., a O(CH₂)₂ON(CH₃)₂group, also known as 2-DMAOE, and 2’dimethylaminoethoxyethoxy (also known în the art as 2*-O-dîmethylaminoethoxyethyl 15 or 2*-DMAEOE), i.e., 2*-O-CH2-O-CH₂-N(CH₂)₂. Other exemplary modifications include 2’-methoxy (2'-OCH₃), 2'-aminopropoxy (2 - OCH₂CH₂CH₂NH2), and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of an siRNA, particularly the 3' position of the sugar on the 3' terminal nucléotide or in 2-5' linked siRNAs and the 5' position of the 5' terminal nucléotide. Modifications can also 20 include sugar mimetîcs, such as cyclobutyl moieties, in place of the pentofuranosyl sugar.

Représentative U.S. patents that teach the préparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800;

5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134;

5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920; each of which is incorporated herein by reference for teachings relevant to methods of preparing such modifications.

Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothîoates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, 30 methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphînates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkyl phosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3-5’ linkages, 2’-5' linked analogs of these, and those) having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3’-5’ to 5'-3’ or 2'-5' to 5’-2’. Various salts, mixed salts, and free acid forms are also included.

Représentative U.S. patents that teach the préparation of the above phosphoruscontainîng linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6, 239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and US Pat RE39464; each of which is herein incorporated herein by reference for teachings relevant to methods of preparing such modifications.

RNAs having modified backbones include, among others, those that do not hâve a phosphorus atom in the backbone. For the purposes of this spécification, and as sometimes referenced in the art, modified RNAs that do not hâve a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. Modified RNA backbones that do not include a phosphorus atom therein hâve backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); sîloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneîmino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S, and CH2 component parts.

Représentative U.S. patents that teach the préparation of the above oligonucleosides include, but are not lîmited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439; each of which is herein incorporated by reference for teachings relevant to methods of preparing such modifications.

In some embodiments, both the sugar and the intemucleoside linkage, i.e., the backbone, of the nucléotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such olîgomeric compound, an RNA mimetic that has been shown to hâve excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound dîrectly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Représentative U.S. patents that teach the préparation of PNA compounds include, but are not limîted to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262; each of which is incorporated herein by reference. Further teaching of PNA compounds can be found, for example, in Nielsen, et al. (Science, 254:1497- 1500 (1991)).

Some embodiments featured in the technology described herein include RNAs with phosphorothîoate backbones and oligonucleosides with heteroatom backbones, and in particular -CH₂-NH-CH₂-_S -CH₂-N(CH₃)-O-CH₂-[known as a methylene (methylimino) or MMI backbone], -CH₂-O-N(CH₃)-CH₂-, -CH₂-N(CH3)-N(CH₃)-CH₂-, and -N(CH3)-CH₂-CH₂- [wherein the native phosphodiester backbone is represented as -O-P-O-CH₂-] of U.S. Pat. No. 5,489,677, and the amide backbones of U.S. Pat. No. 5,602,240. In some embodiments, the RNAs featured herein hâve morpholîno backbone structures of U.S. Pat. No. 5,034,506.

Modifications of siRNAs disclosed herein can also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “naturel” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosïne (C), and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5methylcytosine (5-me-C), 5-hydroxy methyl cytosïne, xanthine, hypoxanthine, 2aminoadenine, 6-methyl and other alkyl dérivatives of adenine and guanine, 2-propyl and other alkyl dérivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2thiocytosine, 5-halouracil and cytosïne, 5-propynyl uracil and cytosïne, 6-azo uracil, cytosïne and thymine, 5 -uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyi, and other 5-substituted uracils and cytosines, 7methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine, and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine (Herdewijn P, ed., WileyVCH, 2008); those disclosed in The Concise Encyclopedîa Of Polymer Science And Engineering (pages 858-859, Kroschwitz JL, ed., John Wiley & Sons, 1990), those disclosed by Englisch étal. (Angewandte Chemie, International Edition, 30, 613, 1991), and those disclosed by Sanghvi YS (Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke ST and Lebleu B, ed., CRC Press, 1993). Certain of these nucleobases are particularly useful for increasing the bindîng affmity of the oligomeric compounds featured in the technology described herein. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6, and 0-6 substituted purines, including 2aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosïne substitutions hâve been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi YS, et al., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, pp. 276-278, 1993) and are exemplary base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

Représentative U.S. patents that teach the préparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, U.S. Pat. No. 3,687,808; U.S. Pat. Nos. 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177;

5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,681,941;

5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368;

6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088; each of which is incorporated herein by reference for teachings relevant to methods of preparing such 5 modifications.

siRNAs can also be modified to include one or more adenosîne-glycol nucleic acid (GNA). A description of adenosine-GNA can be found, for example, in Zhang, et al. (JACS 2005, 127(12):4174-75) which is incorporated herein by reference for teachings relevant to methods of preparing GNA modifications.

The RNA of an siRNA can also be modified to include one or more locked nucleic acids (LNA). A locked nucleic acid is a nucléotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons. This structure effectïvely “locks” the ribose in the 3'-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in sérum, and to reduce off-target effects (Elmen J, et al., Nucleic Acids Research 2005, 33(l):439-47; Mook OR, et al., Mol Cane Ther 2007, 6(3):833-43; Grunweller A, et al., Nucleic Acids Research 2003, 31(12):3185-93).

Représentative U.S. Patents that teacb the préparation of locked nucleic acid nucléotides include, but are not limited to, the foliowing: U.S. Pat. Nos. 6,268,490;

6,670,461; 6,794,499; 6,998,484; 7,053,207; 7,084,125; and 7,399,845; each of which is incorporated herein by reference for teachings relevant to methods of preparing such modifications.

In some embodiments, the siRNA includes modifications involving chemically linkîng to the RNA one or more ligands, moieties, or conjugates that enhance the activity, cellular distribution, or cellular uptake of the siRNA. Such moieties include but are not limited to lipid moieties such as a cholestérol moiety (Letsinger, et al., Proc. Natl. Acid. Sci. USA 1989, 86:6553-56), cbolic acid (Manoharan, et al., Biorg. Med. Chem. Let. 1990, 4:1053-60), athioether, e.g., beryl-S-tritylthiol (Manoharan, et al., Ann. N.Y. Acad. Sci. 1992, 660:306-9); Manoharan, et al., Biorg. Med. Chem. Let.

1993, 3:2765-70), a thiocholesterol (Oberhauser, et ai., Nucl. Acids Res. 1992, 20:533

38), an aîiphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras, et al., EMBO J 1991, 10:1111-18; Kabanov, et al., FEBS Lett. 1990, 259:327-30; Svinarchuk, et al., Biochimie 1993, 75:49-54), a phospholipîd, e.g., di-hexadecyl-rac-glyceroi or triethyl-ammonium l,2-dî-0-hexadecyl-rac-glycero-3-phosphonate (Manoharan, et al., Tetrahedron Lett. 1995, 36:3651-54; Shea, et al., Nucl. Acids Res. 1990, 18:3777-83), a polyamine or a polyethyiene glycol chain (Manoharan, et al., Nucleosides & Nucléotides 1995, 14:969- 73), or adamantane acetic acid (Manoharan, et al., Tetrahedron Lett. 1995, 36:3651-54), apalmityl moiety (Mishra, et al., Biochim.

Biophys. Acta 1995, 1264:229-37), or an octadecy lamine or hexylaminocarbonyloxycholesterol moiety (Crooke, et al., J. Pharmacol. Exp. Ther. 1996, 277:92337).

In some embodiments, a ligand alters the distribution, targeting, or lifetime of an siRNA into which it is incorporated. In some embodiments, a ligand provides an enhanced affïnity for a selected target, e.g., molécule, cell, or cell type, compartment, e.g, a cellular or organ compartment, tissue, organ, or région of the body, as, e.g., compared to a species absent such a ligand. ïn such embodiments, the ligands will not take part in duplex paîrîng in a duplexed nucleic acid.

Ligands can include a naturally occurring substance, such as a protein (e.g., human sérum albumin (HSA), low-densîty lîpoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, înulin, cyclodextrin, or hyaluronic acid); or a lipîd. The ligand can also be a recombinant or synthetic molécule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysîne (PLL), poly L-aspartic acid, poly Lglutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divïnyl ether-maleic anhydride copolymer, N-(2hydroxypropyl)methacrylamide copolymer (HMPA), polyethyiene glycol (PEG), polyvinyl alcohol (PVA), polyuréthane, poly(2-ethylacryllic acid), Nisopropylacrylamide polymers, or polyphosphazine. Examples of polyamines include: polyethylenimine, polylysîne (PLL), spermine, spermidine, polyamine, pseudopeptidepolyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationîc porphyrin, quatemary sait of a polyamine, and alpha helical peptide.

Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, giycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a liver cell. A targeting group can be a thyrotropîn, melanotropin, lectin, giycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholestérol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic. Other examples of ligands include dyes, intercalating agents (e.g., acridînes), cross- linkers (e.g., psoralene, mitomycin C), porphyrîns (TPPC4, texaphyrin, Sapphyrîn), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g·, EDTA), lipophilie molécules (e.g., cholestérol, cholic acid, adamantane acetic acid, 1 -pyrene butyric acid, dihydrotestosterone, 1,3-BisO(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglyceroi, borneol, menthol, 1,3 -propanediol, heptadecyl group, palmitic acid, myristic acid,03-(oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine), peptide conjugales (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substîtuted alkyl, radiolabeled markers, enzymes, haptens (e.g., bîotin), transport/absorption facilitators (e.g., aspirin, vitamin E, folie acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugales, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, and AP.

Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molécules having a spécifie affinity for a co-ligand, or antibodies e.g, an antibody, that binds to a specified cell type such as a hepatic cell. Ligands can also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetylgalactosamine, N-acetyl-glucosamine multivalent mannose, and multivalent fucose. The

ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-KB.

The ligand can be a substance, e.g., a drug, which can increase the uptake of the siRNA into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, micro filaments, and/or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasîn, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

In some embodiments, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a liver cell. Exemplary vitamins include vitamin A, E, and K.

Other exemplary vitamins include are B vitamin, e.g., folie acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrîents taken up by target cells such as liver cells. Also included are HSA and low density lipoprotein (LDL).

In some embodiments, a ligand attached to an siRNA as described herein acts as a pharmacokinetic (PK) modulator. As used herein, a “PK modulator” refers to a pharmacokinetic modulator. PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins, etc. Exemplary PK modulators include, but are not limited to, cholestérol, fatty acids, cholic acid, lithocholic acid, diaikylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin, etc. Oligonucleotides that comprise a number of phosphorothîoate linkages are also known to bind to sérum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases, or 20 bases, comprising multiple of phosphorothîoate linkages in the backbone are also amenable to the technology described herein as ligands (e.g., as PK modulating ligands). In addition, aptamers that bind sérum components (e.g., sérum proteins) are also suitable for use as PK modulating ligands in the embodiments described herein.

(i) Lipid conjugales. In some embodiments, the ligand or conjugale is a lipid or lipid-based molécule. A lipid or lipîd-based ligand can (a) increase résistance to dégradation of the conjugale, (b) increase targeting or transport into a target cell or cell membrane, and/or (c) can be used to adjust binding to a sérum protein, e.g., HSA. Such a lipid or lipid-based molécule may bind a sérum protein, e.g., human sérum albumin (HSA). An HSA-binding ligand allows for distribution of the conjugale to a target tissue, e.g., a non-kidney target tissue of the body. For example, the target tîssue can be the lîver, including parenchymal cells ofthe liver. Other molécules that can bind HSA can also be used as ligands. For example, neproxîn or aspirin can be used.

A lipid based ligand can be used to inhibit, e.g., control the bînding ofthe conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less lîkely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.

In some embodiments, the lipid based ligand binds HSA. The lipid based ligand may bind to HSA with a sufFicient affinity such that the conjugate will be distributed to a non-kidney tissue. In certain particular embodiments, the HSA-lîgand binding is réversible.

In some embodiments, the lipid based ligand binds HSA weakly or not at ail, such that the conjugate will be distributed to the kidney. Other moieties that target to kidney cells can also be used in place of or în addition to the lipid based ligand.

(ii) Cell Perméation Peptide and Agents. In another aspect, the ligand is a cellpermeation agent, such as a helical cell-permeation agent. In some embodiments, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent ts a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. In some embodiments, the helical agent is an alpha-helical agent. In certain particular embodiments, the helical agent has a lipophilie and a lipophobic phase.

A “cell perméation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. A microbial cell-permeating peptide can be, for example, an alpha-helical linear peptide (e.g., LL-37 or Ceropin PI), a disulfide bond-containing peptide (e.g., a-defensin, βdefensin, or bactenecin), or a peptide containing only one or two dominating amino acids (e.g., PR-39 or îndolîcidin).

The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetîc) is a molécule capable of folding into a defïned three-dimensional structure similar to a natural peptide. The attachaient of peptide and peptidomimetics to siRNA can affect pharmacokinetic distribution of the RNAi, such as by enhancing cellular récognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.

A peptide or peptidomimetic can be, for example, a cell perméation peptide, cationic peptide, amphipathic peptide, or hydrophobie peptide (e.g., consisting primarily of Tyr, Trp or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobie membrane translocation sequence (MTS). An exemplary hydrophobie MTS-containing peptide is RFGF, which has the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO:7). An RFGF analogue (e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO:8) containing a hydrophobie MTS can also be a targeting moiety. The peptide moiety can be a “delivery” peptide, which can carry large polar molécules including peptides, oligonucleotides, and proteins across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO:9) and the Drosophila Antennapedîa protein (RQIKIWFQNRRMKWK (SEQ ID NO:10) hâve been found to be capable of functîoning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display lîbrary, or one-bead-one- compound (OBOC) combinatorial library (Lam, et al., Nature 1991, 354:82-84).

A cell perméation peptide can also include a nuciear localization signal (NLS). For example, a cell perméation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV- 1 gp41 and the NLS of SV40 large T antigen (Simeoni, et al., Nucl. Acids Res. 1993,31:2717-24).

(iii) Carbohydrate Conjugales. In some embodiments, the siRNA oligonucleotides described herein further comprise carbohydrate conjugates. The carbohydrate conjugates may be advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use. As used herein, “carbohydrate” refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched, or cyclic) with an oxygen, nitrogen, or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched, or cyclic), with an oxygen, nitrogen, or sulfur atom bonded to each carbon atom. Représentative carbohydrates include the sugars (mono-, di-, tri-, and oligosaccharides containing from about 4-9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose, and polysaccharide gums. Spécifie monosaccharîdes include C5 and above (in some embodiments, C5-C8) sugars; and diand trisaccharides include sugars having two or three monosaccharide units (in some embodiments, C5-C8).

In some embodiments, the carbohydrate conjugate is selected from the group consisting of:

(Formula I),

(Formula XV),

(Formula XVI),

OH

Another représentative carbohydrate conjugale for use in the embodiments described herein includes, but is not limited to,

(Formula XXII), wherein when one of X or Y is an oligonucleotide, the other is a hydrogen.

In some embodiments, the carbohydrate conjugale further comprises another ligand such as, but not limited to, a PK modulator, an endosomolytic ligand, or a cell 10 perméation peptide.

(iv) Linkers. In some embodiments, the conjugales described herein can be attached to the siRNA oligonucleotide with various linkers that can be cleavable or noncleavable.

The term “linker” or “linking group” means an organic moiety that connects two 15 parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO2, S02NH, or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroaryl alkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyi, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyciylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, and alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, or substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic, or substituted aliphatic. In certain embodiments, the linker is between 1-24 atoms, between 4-24 atoms, between 6-18 atoms, between 8-18 atoms, or between 8-16 atoms.

A cleavable lînking group is one which is sufficiently stable outsîde the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In certain embodiments, the cleavable lînking group îs cleaved at least 10 times, or at least 100 times faster in the target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or sérum).

Cleavable lînking groups are susceptible to cleavage agents, e.g, pH, redox potentîal, or the presence of degradative molécules. Generally, cleavage agents are more prévalent or found at higher levels or activities inside cells than in sérum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which hâve no substrate specificîty, including, e.g., oxîdative or reductîve enzymes or reductive agents such as mercaptans, présent in cells, that can dégradé a redox cleavable linking group by réduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that resuit in a pH of live or lower; enzymes that can hydrolyze or dégradé an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate spécifie), and phosphatases. A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human sérum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes hâve a more acidic pH, in the range of 5.5-6.0, and lysosomes hâve an even more acidic pH at around 5.0. Some linkers will hâve a cleavable linking group that is cieaved at a particular pH, thereby releasing the cationic lipîd from the ligand inside the cell, or into the desired compartment of the cell.

A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can dépend on the cell to be targeted. For example, lîver-targeting ligands can be linked to the cationic lipids through a linker that includes an ester group. Lîver cells are rich in esterases, and therefore the linker will be cieaved more efficîently in liver cells than in cell types that are not esterase-rich. Other cell types rich in esterases include cells ofthe lung, rénal cortex, and testis.

Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.

In general, the suitability of a candidate cleavable linking group can be evaluated by testîng the ability of a degradative agent (or condition) to cleave the candidate linking group. It can be désirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other nontarget tissue. Thus one can détermine the relative susceptibility to cleavage between a first and a second condition, where the First is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biologîcal fluids, e.g., blood or sérum. The évaluations can be carried out in cell-free Systems, in cells, in cell culture, in organ or tissue culture, or in whole animais. It can be useful to make initial évaluations in cell-free or culture conditions and to confirm by further évaluations in whole animais. In certain embodiments, useful candidate compounds are cleaved at least 2, at least 4, at least 10 or at least 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or sérum (or under in vitro conditions selected to mimic extracellular conditions).

One class of cleavable linking groups are redox cleavable linking groups that are cleaved upon réduction or oxîdation. An example of reductively cleavable linking group is a disulphide linking group (-S-S-). To détermine if a candidate cleavable linking group îs a suitable “reductively cleavable linking group,” or for example is suitable for use with a particular RNAi moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or sérum conditions. In some embodiments, candidate compounds are cleaved by at most 10% în the blood. In certain embodiments, useful candidate compounds are degraded at least 2, at least 4, at least 10, or at least 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kînetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.

Phosphate-based cleavable linking groups are cleaved by agents that dégradé or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate-based linking groups are -O-P(O)(ORk)-O-, -O-P(S)(ORk)-O-, -O-P(S)(SRk)-O-, -SP(O)(ORk)-O-, -O- P(O)(ORk)-S-, -S-P(O)(ORk)-S-, -O-P(S)(ORk)-S-, -S-P(S)(ORk)O-, -O-P(O)(Rk)-O-, -O- P(S)(Rk)-O-, -S-P(O)(Rk)-O-, -S-P(S)(Rk)-O-, -S-P(O)(Rk)S-, -O-P(S)( Rk)-S-, In certain embodiments, the phosphate-based linking groups are selected from: -O-P(O)(OH)-O-, -O-P(S)(OH)-O-, -O-P(S)(SH)-O-, -S-P(O)(OH)-O-, O- P(0)(OH)-S-, -S-P(O)(OH)-S-, -O-P(S)(OH)-S-, -S-P(S)(OH)-O-, -O-P(O)(H)-O-, 20553

O- P(S)(H)-O-, -S-P(O)(H)-O-, -S-P(S)(H)-O-, -S-P(O)(H)-S-, and -O-P(S)(H)-S-. In particular embodiments, the phosphate-linking group is -O-P(O)(OH)-O-. These candidates can be evaluated using methods analogous to those described above.

Acid cleavable linking groups are linking groups that are cleaved under acidic conditions. In some embodiments, acid cleavable linking groups are cleaved în an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.5, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, spécifie low pH organelles, such as endosomes and lysosomes, can provide a cleaving environment for acid cleavable linking groups. Exemples of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can hâve the general formula -C=N-, C(O)O, or -OC(O). In some embodiments, the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.

Ester-based cleavable linking groups are cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include but are not limited to esters of alkylene, alkenylene, and alkynylene groups. Ester cleavable linking groups hâve the general formula -C(O)O-, or -OC(O)-. These candidates can be evaluated using methods analogous to those described above.

Peptide-based cleavable linking groups are cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptîdes, trîpeptides, etc.) and polypeptides. Peptide-based cleavable groups do not include the amide group (-C(O)NH-). The amide group can be formed between any alkylene, alkenylene, or alkynelene. A peptide bond is a spécial type of amide bond formed between amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptidebased cleavable linking groups hâve the general formula NHCHRAC(O)NHCHRBC(O)-, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.

Représentative carbohydrate conjugates with linkers include, but are not limited to,

(Formula XXIII),

(Formula XXVI),

(Formula XXVII),

(Formula XXXVIII),

(Formula XXIX), and

(Formula XXX), wherein when one of X or Y is an oligonucleotide, the other is a hydrogen.

In certain embodiments ofthe compositions and methods, a ligand is one or more “GalNAc” (N-acetylgalactosamine) dérivatives attached through a bivalent or trivalent branched lînker. For example, in some embodiments the siRNA is conjugated to a GalNAc ligand as shown in the foliowing schematic:

wherein X is O or S.

In some embodiments, the combination therapy includes an siRNA that is conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of formula (XXXI) - (XXXIV):

10 Formula (XXXI) , p2A_02A_R2A ____η-2Α_^2Α A Jq^2A ^-p2B θ2Β p2B _____T2B |_2B U^2BJ ✓ P^4A-O^4A-R^4A ____γ4Α_|_4Α ^q4A S p4B_Q4B^_R4B _____-p4B_|_4B ^q , 01 (Formula XXXIII)

(Formula XXXII) ^p3A q3A r3A ____γ3Α |_3A Λ Jq^3A ow N \ p3B π3Β__-|-3B |_3B ^M Jq^3B pSA q5A _R5A__γ5Α |_5A ^qT __p 5 B q5B & \---Lp5C.Q5C._R5C L_T5C,_LSC q^sc (Formula XXXIV)

wherein;

q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B, and q5C represent independently for each occurrence 0-20 and wherein the repeating unit can be the same or different;

p2A p2B p3A p3B p4A p4B pSA p5B, p5C, y2A y2B, γ3Α, y3B, y4A, y4B^ ψ4Α, ψ5Β, and T^5C are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH₂, CH₂NH, or CH₂O;

Q^2A, Q^2B, Q^3A, Q^3B, Q^4A, Q^4B, Q^5A, Q^5B, and Q^5C are independently for each occurrence absent, alkylene, or substituted alkylene wherein one or more methylenes can be interrupted or terminated by one or more of O, S, S (O), SO₂, N(Rⁿ), C(R')=C(R”), OC or C(O);

R^2A, r2b, r3a, p3B, r4a, r4b, rsa, _an(j p5C _{are eac}p i_nc]_ependently for each occurrence absent. NH, O, S, CH₂, C(O)O, C(O)NH, NHCH(R^a)C(O), -C(O)-CH(R^a)O

L^2a, L^2B, L^3A, L^3B, L^4A, L^4B, L^5A, L^5B, and L^5C represent the ligand; i.e., each independently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; and R^a is H or amino acid side chain. Trîvalent conjugating GalNAc dérivatives are particularly useful for use with siRNAs for inhibîting the expression of a target gene, such as those of formula (XXXV):

(Formula XXXV) ___TSA_|_5A t _____γ5Β ^5B _q5B _-j-5C_|_5C

wherein L^5A, L2^B and L^5C represent a monosaccharide, such as GalNAc dérivative.

Examples of suitable bivalent and trivalent branched linker groups conjugating GalNAc dérivatives include, but are not limited to, the structures recited above as formulas I, VI, X, IX, and XII.

Représentative U.S. patents that teach the préparation of RNA conjugates include U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941 ; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; and 7,037,646; each of which is incorporated herein by reference for the teachings relevant to such methods of préparation.

In certain instances, the RNA of an siRNA can be modified by a non-ligand group. A number of non-ligand molécules hâve been conjugated to siRNAs in order to enhance the activity, cellular distribution or cellular uptake of the siRNAs, and procedures for performing such conjugations are availabié in the scientîfic literature. Such non-lîgand moieties hâve included lipid moietîes, such as cholestérol (Kubo, T., et al., Biochem. Biophys. Res. Comm. 365(1):54-61 (2007); Letsinger, et al., Proc. Natl. Acad. Sci. USA 86:6553 (1989)), cholic acid (Manoharan, et al., Bioorg. Med. Chem. Lett. 4:1053 (1994)), a thioether, e.g., hexyl-S-tritylthiol (Manoharan, et al., Ann. N.Y. Acad. Sci. 660:306 (1992); Manoharan, et al., Bioorg. Med. Chem. Let. 3:2765 (1993)), a thiocholesterol (Oberhauser, et al., Nucl. Acids Res. 20:533 (1992)), an alîphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras, et al., EMBO J. 10:111 (1991); Kabanov, et al., FEBS Lett. 259:327 (1990); Svinarchuk, et al., Biochimie 75:49 (1993)), a phospholipîd, e.g., di-hexadecyl-rac-glyceroi or triethylammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan, et al., Tetrahedron Lett. 36:3651 (1995); Shea, étal., Nucl. Acids Res. 18:3777 (1990)), a polyamine or a polyethylene glycol chain (Manoharan, et al., Nucleosides & Nucléotides 14:969 (1995)), or adamantane acetîc acid (Manoharan, et al·, Tetrahedron Lett. 36:3651 (1195)), a palmityl moiety (Mishra, et al., Biochîm. Biophys. Acta 1264:229 (1995)), or an octadecy lamine or hexylamino-carbonyl-oxy cholestérol moiety (Crooke, et al., J. Pharmacoî. Exp. Ther. 277:923 (1996)).

Typical conjugation protocols involve the synthesîs of an RNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molécule being conjugated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugale by HPLC typically affords the pure conjugale.

b. Pharmaceutical Compositions and Delivery of siRNA

In some embodiments, pharmaceutical compositions containing an siRNA, as described herein, and a pharmaceutically acceptable carrier or excipient are provided. The pharmaceutical composition containing the siRNA can be used to treat HBV infection. Such pharmaceutical compositions are formulated based on the mode of delivery. For exampîe, compositions may be formulated for systemic administration via parentéral delivery, e.g., by subcutaneous (SC) delivery.

A “pharmaceutically acceptable carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent, or any other pharmacologically inert vehïcle for delivering one or more agents, such as nucleic acids, to an animal. The excipient can be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with the agent (e.g., a nucleic acid) and the other components of a given pharmaceutical composition. Typical pharmaceutically acceptable carriers or excipients include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone, hydroxypropyl methylcellulose); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates, calcium hydrogen phosphate); lubricants (e.g., magnésium stéarate, talc, silica, colloïdal Silicon dioxide, stearic acid, métal lie stéarates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate); disîntegrants (e.g., starch, sodium starch glycolate); and wetting agents (e.g., sodium lauryl sulphate).

Pharmaceutically acceptable organic or inorganîc excipients suitable for nonparenteral administration that do not deleteriously react with nucleic acids can also be usedto formulate siRNA compositions. Suitable pharmaceutically acceptable carriers for formulations used in non-parenteral delivery include, but are not limited to, water, sait solutions, alcohols, polyethylene glycols, gelatîn, lactose, amylose, magnésium stéarate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, and the like.

Formulations for topîcal administration of nucleic acids can include stérile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquîd or solid oil bases. The solutions can also contain buffers, diluents, and other suitable additives. Pharmaceutically acceptable organic or inorganîc excipients suitable for non-parenteral administration that do not deleteriously react with nucleic acids can be used.

In some embodiments, administration of pharmaceutical compositions and formulations described herein can be topical (e.g., by a transdermal patch), pulmonary (e.g, by inhalation or insufflation of powders or aérosols, inciuding by nebulizer); intratracheal; intranasal; epidermal and transdermal; oral; or parentéral. Parentéral administration includes intravenous, intraarterial, subeutaneous, intraperitoneal, and intramuscular injection or infusion; subdermal administration (e.g., via an implanted device); or intracranial administration (e.g., by intraparenchymal, intrathecal, or întraventricular, administration).

In some embodiments, the pharmaceutical composition comprises a stérile solution of HBV02 formulated in water for subeutaneous injection. In some embodiments, the pharmaceutical composition comprises a stérile solution of HBV02 formulated in water for subeutaneous injection at a free acid concentration of 200 mg/mL.

[n some embodiments, the pharmaceutical compositions containing an siRNA described herein are administered in dosages sufficîentto inhibit expression ofan HBV gene. In some embodiments, a dose of an siRNA is in the range of 0.001 to 200.0 milligrams per kilogram body weight of the récipient per day, or in the range of 1 to 50 milligrams per kilogram body weight per day. For example, an siRNA can be administered at 0.01 mg/kg, 0.05 mg/kg, 0.5 mg/kg, 1 mg/kg, 1.5 mg/kg, 2 mg/kg, 3 mg/kg, 10 mg/kg, 20 mg/kg, 30 mg/kg, 40 mg/kg, or 50 mg/kg per single dose. The pharmaceutical composition can be administered once daîly, or it can be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuons infusion or delivery through a controlled release formulation. In that case, the siRNA contaîned in each sub-dose must be correspondîngly smaller in order to achieve the total daily dosage. The dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation which provides sustained release of the siRNA over a several day period. Sustained release formulations are well known in the art and are particularly use fui for delivery of agents at a particular site, such as could be used with the agents of the technology described herein. In such embodiments, the dosage unit contains a corresponding multiple of the daily dose.

In some embodiments, a pharmaceutical composition comprising an siRNA that 20 targets HBV described herein (e.g., HBV02) contains the siRNA at a dose of 0.8 mg/kg, 1.7 mg/kg, 3.3 mg/kg, 6.7 mg/kg, or 15 mg/kg.

In some embodiments, a pharmaceutical composition comprising an siRNA described herein (e.g., HBV02) contains the siRNA at a dose of 20 mg, 50 mg, 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 25 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, or 900 mg.

In some embodiments, a pharmaceutical composition comprising an siRNA described herein (e.g., HBV02) contains the siRNA at a dose of 20 mg, 50 mg, 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 400 mg, or 450 mg.

In some embodiments, a pharmaceutical composition comprising an siRNA described herein (e.g., HBV02) contains the siRNA at a dose of 200 mg.

ΠΙ. Methods of Treatment and Additional Therapeutic Agents

The présent disclosure provides for methods of treating HBV infection with an siRNA described herein. In some embodiments, a method of treating HBV comprising administering HBV02 to the subject is provided.

In some embodiments of the aforementioned methods, the method further comprises administering pegylated interferon-alpha (PEG-IFNa) to the subject.

In some further embodiments of the aforementioned methods, the method further comprises administering a nucleoside/nucleotide reverse transcriptase inhibitor (NRTI) to the subject. In some embodiments, the NRTI is administered before, sîmultaneously with, or sequentially after administration ofthe HBV02.

In some embodiments, a method of treating HBV is provided, comprising administering HBV02, and PEG-IFNa to a subject. In some embodiments, the PEGIFNa is administered before, sîmultaneously with, or sequentially after administration ofthe HBV02.

In some embodiments, a method of treating HBV is provided, comprising administering HBV02, and PEG-IFNa, to a subject, wherein the subject has previously been administered an NRTI. In some embodiments, the PEG-IFNa is sîmultaneously with, or sequentially after administration ofthe HBV02.

In some embodiments, a method of treating HBV is provided, comprising administering HBV02, wherein the subject has previously been administered PEGIFNa and previously administered an NRTI.

In any of the aforementioned methods, the HBV infection may be chronic HBV infection.

As used herein, “nucleoside/nucleotide reverse transcriptase inhibitor” or “nucleos(t)îde reverse transcriptase inhibitor” (NRTI) refers to an inhibitor of DNA réplication that is structurally sîmilar to a nucléotide or nucleoside and speciflcally inhibits réplication ofthe HBV cccDNA by inhibiting the action of HBV polymerase, and does not signifïcantly inhibit the réplication ofthe host (e.g., human) DNA. Such inhibitors include tenofovir, tenofovir disoproxil fumarate (TDF), tenofovîr alafenamide (TAF), lamivudine, adefovîr, adefovir dipivoxil, entecavir (ETV), telbivudîne, AGX20553

1009, emtricîtabine (FTC), clevudine, ritonavir, dipivoxil, lobucavir, famvir, N-AcetylCysteine (NAC), PC 1323, theradigm-HBV, thymosin-alpha, ganciclovir, besifovir (ANA-380/LB-80380), and tenofvir-exaliades (TLX/CMX157). In some embodiments, the NRT1 îs entecavir (ETV). In some embodiments, the NRTI is tenofovir. In some embodiments, the NRTI is lamivudine. In some embodiments, the NRTI îs adefovïr or adefovîr dipivoxil.

As used herein, a “subject” is an animal, such as a mammal, including any mammal that can be infected with HBV, e.g., a primate (such as a human, a non-human primate, e.g., a monkey, or a chimpanzee), or an animal that is considered an acceptable clinical model of HBV infection, HBV-AAV mouse model (see, e.g., Yang, et al„ Cell and Mol Immunol 11:71 (2014)) or the HBV 1.3xfs transgenic mouse model (Guidotti, et al., J. Virol. 69:6158 (1995)). In some embodiments, the subject has a hepatitis B virus (HBV) infection. In some embodiments, the subject is a human, such as a human being having an HBV infection, especially a chronic hepatitis B virus infection.

As used herein, the ternis “treating” or “treatment” refer to a bénéficiai or desired resuit including, but not limited to, alleviation or amelioration of one or more signs or symptoms associated with unwanted HBV gene expression or HBV réplication, e.g, the presence of sérum or liver HBV cccDNA, the presence of sérum HBV DNA, the presence of sérum or liver HBV antigen, e.g., HBsAg or HBeAg, elevated ALT, elevated AST (normal range is typically considered about 10 to 34 U/L), the absence of or low level of anti-HBV antibodies; a liver injury; cirrhosis; delta hepatitis; acute hepatitis B; acute fulminant hepatitis B; chronic hepatitis B; liver fibrosis; end-stage liver disease; hepatocellular carcinoma; sérum sickness-like syndrome; anorexia; nausea; vomiting, low-grade fever; myalgia; fatigabilîty; disordered gustatory acuity and smell sensations (aversion to food and cigarettes); or right upper quadrant and epigastric pain (intermittent, mild to moderate); hepatic encephalopathy; somnolence; disturbances in sleep pattern; mental confusion; coma; ascites; gastrointestinal bleeding; coagulopathy; jaundice; hepatomegaly (mildly enlarged, soft liver); splenomegaly; palmar erythema; spider nevi; muscle wasting; spider angiomas; vasculitis; varîceal bleeding; peripheral edema; gynecomastia; testicular atrophy; abdominal collateral

veins (caput médusa); ALT levels higher than AST levels; elevated gamma-glutamyl transpeptîdase (GGT) (normal range is typically considered about 8 to 65 U/L) and alkaline phosphatase (ALP) levels (normal range is typically considered about 44 to 147 IU/L (international units per liter), not more than 3 times the ULN); slightly low albumin levels; elevated sérum iron levels; leukopenia (Le., granulocytopenia); lymphocytesis; increased érythrocyte sédimentation rate (ESR); shortened red blood cell survival; hemolysîs; thrombocytopenia; a prolongation ofthe international normal ized ratio (INR); presence of sérum or liver HBsAg, HBeAg, Hepatitis B core antîbody (anti-HBc) immunoglobulin M (IgM); hepatitis B surface antibody (anti-HBs), 10 hepatitis B e antibody (anti-HBe), or HBV DNA; increased bilirubin levels;

hyperglobulinemîa; the presence of tissue-nonspecific antibodies, such as antî-smooth muscle antibodies (ASMAs) or antinuciear antibodies (ANAs) (10-20%); the presence of tissue-specific antibodies, such as antibodies against the thyroid gland (10-20%); elevated levels of rheumatoid factor (RF); low platelet and whîte blood cell counts;

lobular, with degenerative and regenerative hepatocellular changes, and accompanying inflammation; and predominantly centrîlobular necrosis, whether détectable or undetectable. The lîkelihood of developing, e.g., liver fibrosis, îs reduced, for example, when an îndividual having one or more risk factors for liver fibrosis, e.g., chronic hepatitis B infection, either fails to deveiop liver fibrosis or develops liver fibrosis with 20 less severity relative to a population having the same risk factors and not receiving treatment as described herein. “Treatment” can also mean prolonging survival as compared to expected survival in the absence of treatment.

As used herein, the terms “preventing” or “prévention” refer to the failure to deveiop a disease, disorder, or condition, or the réduction in the development of a sîgn 25 or symptom associated with such a disease, disorder, or condition (e.g., by a clïnîcally relevant amount), or the exhibition of delayed signs or symptoms delayed (e.g., by days, weeks, months, or years). Prévention may requirethe administration of more than one dose.

In some embodiments, treatment of HBV infection results in a “functional cure” 30 of hepatitis B. As used herein, functional cure is understood as clearance of circulating

HBsAg and is may be accompanied by conversion to a status in which HBsAg antîbodies become détectable using a clinically relevant assay. For example, détectable antîbodies can include a signal higher than 10 mlU/ml as measured by Chemiluminescent Microparticle Immunoassay (CMIA) or any other immunoassay.

Functional cure does not require clearance of ail réplicative forms of HBV (e.g., cccDNA from the liver). Anti-HBs séroconversion occurs spontaneously in about 0.21% of chronically infected patients per year. However, even after anti-HBs séroconversion, low level persistence of HBV is often observed for décades indicating that a functional rather than a complété cure occurs. Without being bound to a particular 10 mechanism, the immune system may be able to keep HBV in check under conditions in which a functional cure has been achieved. A functional cure permits discontinuation of any treatment for the HBV infection. However, it is understood that a “functional cure” for HBV infection may not be sufficient to prevent or treat diseases or conditions that resuit from HBV infection, e.g., lîver fibrosis, HCC, or cirrhosis. In some spécifie embodiments, a “functional cure” can refer to a sustaîned réduction in sérum HBsAg, such as <1 lU/mL, for at least 3 months, at least 6 months, or at least one year following the initiation of a treatment regîmen or the completîon of a treatment regimen. The formai endpoint accepted by the U.S. Food and Drug Administration, or the FDA, for demonstrating a functional cure of HBV is undetectable HBsAg, defïned as less than 20 0.05 international unîts per mil iilîter, or lU/ml, as well as HBV DNA less than the lower limit of quantification, in the blood six months after the end of therapy.

As used herein, the term “Hepatitis B virus-associated disease” or “HBVassocîated disease,” is a disease or disorder that is caused by, or associated with HBV infection or réplication. The term “HBV-associated disease” includes a disease, disorder 25 or condition that would benefit from réduction in HBV gene expression or réplication.

Non-limiting examples of HBV-associated diseases include, for example, hepatitis D virus infection, delta hepatitis, acute hepatitis B; acute fulminant hepatitis B; chronic hepatitis B; liver fibrosis; end-stage liver disease; and hepatocellular carcînoma.

In some embodiments, an HBV-associated disease is chronic hepatitis. Chronic 30 hepatitis B is defïned by one of the following criteria: (1) positive sérum HBsAg, HBV

DNA, or HBeAg on two occasions at least 6 months apart (any combination of these tests performed 6 months apart is acceptable); or (2) négative immunoglobulin M (IgM) antîbodies to HBV core antigen (IgM antî-HBc) and a positive resuit on one of the following tests: HBsAg, HBeAg, or HBV DNA (see Figure 2). Chronic HBV typîcally includes inflammation of the liver that lasts more than six months. Subjects having chronic HBV are HBsAg positive and hâve either hîgh viremia (>10⁴ HBV-DNA copies / ml blood) or low viremia (<IO³ HBV-DNA copies l ml blood). In certain embodiments, subjects hâve been infected with HBV for at least five years. In certain embodiments, subjects hâve been infected with HBV for at least ten years. In certain embodiments, subjects became infected with HBV at birth. Subjects having chronic hepatitis B disease can be immune tolérant or hâve an inactive chronic infection without any evidence of active disease, and they are also asymptomatic. Patients with chronic active hepatitis, especially during the réplicative state, may hâve symptoms simîlar to those of acute hepatitis. Subjects having chronic hepatitis B disease may hâve an active chronic infection accompanied by necroinflammatory liver disease, hâve increased hépatocyte tum-over in the absence of détectable necroînflammation, or hâve an inactive chronic infection without any evidence of active disease, and they are also asymptomatic. The persistence of HBV infection in chronic HBV subjects is the resuit of cccHBV DNA.

HBeAg status represents multiple différences between subjects (Table 2). HBeAg status may affect responses to different thérapies, and approximately one third of patients with HBV are HBeAg-positive.

Table 2: HBeAg status.

	HBeAg-positive	HBeAg-negative
Age	Younger	Older
Approximate average HBsAg levels	10⁴-10⁵ IH/mL	IO³IU/mL
Transcriptional activity	cccDNA > intDNA	intDNA > cccDNA
HBV-specific immune profile	Less compromised	More compromised

In some embodiments, a subject having chronic HBV is HBeAg positive. In some other embodiments, a subject having chronic HBV is HBeAg négative. Subjects having chronic HBV hâve a level of sérum HBV DNA of less than 10^e1 and a persistent élévation in transaminases, for examples ALT, A ST, and gamma-glutamyl transferase.

A subject having chronic HBV may hâve a liver biopsy score of less than 4 (e.g., a necroinflammatory score).

In some embodiments, an HBV-associated disease is acute fulminant hepatitis B. A subject having acute fulminant hepatitis B has symptoms of acute hepatitis and the additional symptoms of confusion or coma (due to the liver's failure to detoxify

Chemicals) and bruising or bîeeding (due to a lack of blood clotting factors).

Subjects having an HBV infection, e.g., chronic HBV, may develop liver fibrosis. Accordingly, in some embodiments, an HBV-associated disease is liver fibrosis. Liver fibrosis, or cirrhosis, is defined histologically as a diffuse hepatic process characterized by fibrosis (excess fibrous connective tîssue) and the conversion of normal liver architecture into structurally abnormal nodules.

Subjects having an HBV infection, e.g., chronic HBV, may develop end-stage liver disease. Accordingly, in some embodiments, an HBV-associated disease is endstage liver disease. For example, liver fibrosis may progress to a point where the body may no longer be able to compensate for, e.g., reduced liver function, as a resuit of liver 20 fibrosis (i.e., decompensated liver), and resuit în, e.g, mental and neurological symptoms and liver failure.

Subjects having an HBV infection, e.g., chronic HBV, may develop hepatocellular carcinoma (HCC), also referred to as malignant hepatoma. Accordingly, in some embodiments, an HBV-associated disease is HCC. HCC commonly develops în 25 subjects having chronic HBV and may be fibrolamellar, pseudoglandular (adenoid), pleomorphic (giant cell), or clear cell.

In some embodiments of the methods and uses described herein, a thereapeutîcally effective amount of siRNA, PEG-IFNa, or both is administered to a subject. “Therapeutically effective amount,” as used herein, is intended to include the 30 amount of an active agent, that, when administered to a subject for treating a subject having an HBV infection or HBV-associated disease, is sufficient to effect treatment of the disease (e.g., by diminishing or maintaining the existing disease or one or more symptoms of disease). The “therapeutically effective amount” may vary depending on the active agent, how it is admînistered, the disease and its severity, and the history, âge, weight, family history, genetic makeup, stage of pathological processes mediated by HBV gene expression, the types of preceding or concomitant treatments, îf any, and other individual characteristics ofthe subject to be treated. A therapeutically effective amount may require the administration of more than one dose.

A “therapeutically effective amount” also includes an amount of an active agent that produces some desired effect at a reasonable benefit/risk ratio applicable to any treatment. Therapeutic agents (e.g., siRNA, PEG-IFNa) used in the methods of the présent disclosure may be admînistered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.

The term “sample,” as used herein, includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues présent withîn a subject. Examples of biologîcal fluids include blood, sérum, and serosal fluids, plasma, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs or localized régions. For example, samples may be derîved from particular organs, parts of organs, or fluids or cells withîn those organs. In certain embodiments, samples may be derîved from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hépatocytes). In certain embodiments, a “sample derîved from a subject” refers to blood, or plasma or sérum obtained from blood drawn from the subject. In further embodiments, a “sample derîved from a subject” refers to lîver tissue (or subcomponents thereof) or blood tissue (or subcomponents thereof, e.g., sérum) derîved from the subject.

Some embodiments of the présent disclosure provide methods of treating chronic HBV infection or an HBV-associated disease ίη a subject in need thereof, comprising: administering to the subject an siRNA, wherein the siRNA has a sense strand comprising 5'- gsusguGfcAfCfUfucgcuucacaL96 -3’ (SEQ ID NO:5) and an antisense strand comprising 5'- usGfsuga(Agn)gCfGtaaguGfcAfcacsusu -3' (SEQ ID

NO:6), wherein a, c, g, and u are 2’-O-methyladenosine-3'-phosphate, 2’-Omethylcytidine-3'-phosphate, 2^,-O-methylguanosine-3'-phosphate, and 2'-Omethyluridine-3'-phosphate, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine-3'phosphate, 2'-fluorocytidine-3'-phosphate, 2'-fluoroguanosîne-3’-phosphate, and 2'fluorouridine-3’-phosphate, respectively; (Agn) is adenosine-glycol nucleic acid (GNA); s is a phosphorothioate linkage; and L96 is N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4hydroxyprolinol. In some embodiments of the methods, the method further comprises administering to the subject a peglyated interferon-alpha (PEG-IFNa). In some embodiments, the siRNA and PEG-IFNa are administered to the subject over the same time period. In some embodiments, siRNA is administered to the subject for a period of time before the PEG-IFNa is administered to the subject. In some embodiments, the PEG-IFNa is administered to the subject for a period of time before the siRNA is administered to the subject. In some embodiments, the subject has been administered PEG-IFNa prior to the administration of the siRNA. In some embodiments, the subject is administered PEG-IFNa during the same period of time that the subject is administered the siRNA. In some embodiments, the subject is subsequently administered PEG-IFNa after being administered the siRNA.

In some embodiments of the aforementioned methods, the methods further comprise administering to the subject a NRTI, In some embodiments of the aforementioned methods, the subject being administered the siRNA has been administered a NRTI prior to the administration of the siRNA. In some embodiments, the subject has been administered a NRTI for at least 2 months, at least 3 months, at least 4 months, at least 5 months, or at least 6 months prior to the administration of the siRNA. In some embodiments, the subject has been administered a NRTI for at least 2 months prior to the administration of the siRNA. In some embodiments, the subject has been administered a NRTI for at least 6 months prior to the administration ofthe siRNA. In some embodiments, the subject is administered a NRTI during the same period of time that the subject is administered the siRNA. In some embodiments of the methods, the subject is subsequently administered NRTI after being administered the siRNA.

Some embodiments of the présent disclosure provide an siRNA for use in the treatment of a chronic HBV infection in a subject, wherein the siRNA has a sense strand comprising 5'- gsusguGfcAfCfUfucgcuucacaL96 -3' (SEQ ID NO:5) and an antisense strand comprising 5'- usGfsuga(Agn)gCfGfaaguGfcAfcacsusu -3' (SEQ ID NO:6), wherein a, c, g, and u are 2'-O-methyladenosine-3’-phosphate, 2'-Omethylcytidîne-3'-phosphate, 2'-O-methylguanosine-3'-phosphate, and 2'-Omethyluridine-3'-phosphate, respectîvely; Af, Cf, Gf, and Uf are 2'-fluoroadenosine-3’phosphate, 2'-fluorocytidine-3'-phosphate, 2'-fluoroguanosine-3'-phosphate, and 2'fluorouridine-3'-phosphate, respectîvely; (Agn) is adenosine-glycol nucleic acid (GNA); s is a phosphorothioate linkage; and L96 is N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4hydroxyprolinol. In some embodiments of the siRNA for use, the subject is also administered a PEG-IFNa. In some embodiments, the siRNA and PEG-IFNa are administered to the subject over the same time period. In some embodiments, the siRNA is administered to the subject for a period of time before the PEG-IFNa is administered to the subject. In some embodiments, the PEG-IFNa îs administered to the subject for a period of time before the siRNA is administered to the subject. In some embodiments, the subject has been administered PEG-IFNa prior to the administration of the siRNA. In some embodiments, the subject is administered PEG-IFNa during the same period of time that the subject is administered the siRNA. In some embodiments, the subject is subsequently administered PEG-IFNa. In any of the aforementioned siRNAs for use, the subject may also be administered a NRTI or hâve previously been administered a NRTI. In some embodiments, the subject has been administered a NRTI prior to the administration of the siRNA. In some embodiments, the subject has been administered a NRTI for at least 2 months, at least 3 months, at least 4 months, at least 5 months, or at least 6 months prior to the administration of the siRNA. In some embodiments, the subject has been administered a NRTI for at least 2 months prior to the administration of the siRNA. In some embodiments, the subject has been administered a NRTI for at least 6 months prior to the administration of the siRNA, In some embodiments, the subject is administered a NRTI during the same period of time that the subject is administered the siRNA. ïn some embodiments, the subject js subsequently administered a NRTI.

Some embodiments of the présent disclosure provides the use of an siRNA in the manufacture of a médicament for the treatment of a chronic HBV infection, wherein the siRNA has a sense strand comprising 5'- gsusguGfcAfCfUfucgcuucacaL96 -3' (SEQ ID NO:5) and an antisense strand comprising 5'usGfsuga(Agn)gCfGfaaguGfcAfcacsusu -3’ (SEQ ID N 0:6), wherein a, c, g, and u are 2’-O-methyladenosine-3’-phosphate, 2'-O-methylcytidine-3'-phosphate, 2’-Omethylguanosine-3’-phosphate, and 2’-O-methyluridine-3'-phosphate, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine-3'-phosphate, 2'-fluorocytidine-3'-phosphate, 2'fluoroguanosine-3’-phosphate, and 2'-fluorouridine-3 -phosphate, respectively; (Agn) is adenosine-glycol nucleic acid (GNA); s is a phosphorothioate linkage; and L96 is N[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinoL

Some embodiments of the présent disclosure provides the use of an siRNA and PEG-IFNa in the manufacture of a médicament for the treatment of a chronic HBV infection, wherein the siRNA has a sense strand comprising 5'gsusguGfcAfCfUfucgcuucacaL96 -3' (SEQ ID NO:5) and an antisense strand comprising 5 - usGfsuga(Agn)gCfGfaaguGfcAfcacsusu -3' (SEQ ID NO:6), wherein a, c, g, and u are 2'-O-methyl adenosîne-3’-phosphate, 2'-O-methylcytidine-3'-phosphate, 2-O-methylguanosine-3'-phosphate, and 2'-O-methyluridine-3'-phosphate, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine-3'-phosphate, 2'-fluorocytidine-3'-phosphate, 2’-fluoroguanosine-3'-phosphate, and 2'-fluorouridine-3'-phosphate, respectively; (Agn) is adenosine-glycol nucleic acid (GNA); s is a phosphorothioate linkage; and L96 isN[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolînol.

Some embodiments of the présent disclosure provides the use of an siRNA, PEG-IFNa, and an NRTI in the manufacture of a médicament for the treatment of a chronic HBV infection, wherein the siRNA has a sense strand comprising 5'gsusguGfcAfCIUfucgcuucacaL96 -3' (SEQ ID NO:5) and an antisense strand comprising 5'- usGfsuga(Agn)gCfGfaaguGfcAfcacsusu -3' (SEQ ID NO:6), wherein a, c, g, and u are 2'-O-methyladenosine-3'-phosphate, 2'-O-methylcytidine-3'-phosphate.

2’-0-methylguanosine-3’-phosphate, and 2'-O-methyluridine-3'-phosphate, respectîvely; Af, Cf, Gf, and Uf are 2'-fluoroadenosine-3'-phosphate, 2'-fluorocytidîne-3'-phosphate, 2'-fluoroguanosine-3'-phosphate, and 2'-fluorouridine-3'-phosphate, respectîvely; (Agn) is adenosine-glycol nucleic acid (GNA); s is a phosphorothioate linkage; and L96 is N5 [trîs(GaINAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol.

In some embodiments of the aforementîoned methods, compositions for use, or uses, the dose of the siRNA is 0.8 mg/kg, 1.7 mg/kg, 3.3 mg/kg, 6.7 mg/kg, or 15 mg/kg. In some embodiments of the aforementîoned methods, compositions for use, or uses, the dose of the siRNA is 20 mg, 50 mg, 100 mg, 150 mg, 200 mg, 250 mg, 300 10 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, or 900 mg. In some embodiments of the aforementîoned methods, compositions for use, or uses, the dose ofthe siRNA is 50 mg, 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 400 mg, or 450 mg. In some embodiments of the aforementîoned methods, compositions for use, or uses, the dose of the siRNA is 200 mg. In some embodiments of the aforementîoned methods, compositions for use, or uses, the dose of the siRNA is at least 200 mg.

In some embodiments of the aforementîoned methods, compositions for use, or uses, the siRNA is administered weekly.

In some embodiments ofthe aforementîoned methods, compositions for use, or 20 uses, more than one dose of the siRNA is administered. For example, in some embodiments, two doses of the siRNA are administered, wherein the second dose is administered 2, 3, or 4 weeks after the first dose. In some particular embodiments, two doses of the siRNA are administered, wherein the second dose is administered 4 weeks after the first dose.

In some embodiments of the aforementîoned methods, two, three, four, five, six, or more doses of the siRNA are administered. For example, in some embodiments, two 400-mg doses of the siRNA are administered to the subject. In some embodiments, six 200-mg doses of the siRNA are administered to the subject.

In some embodiments of the methods, compositions for use, or uses described 30 herein, the method comprises:

(a) administering to the subject two or more doses of at least 200 mg of an siRNA having a sense strand comprising 5'- gsusguGfcAæfUfucgcuucacaL96 -3' (SEQ ID NO:5) and an antisense strand comprising 5'usGfsuga(Agn)gCfGfaaguGfcAfcacsusu -3' (SEQ ID NO:6), wherein a, c, g, and u are 2'-O-methyladenosine-3'-phosphate, 2'-O-methylcytidine-3'-phosphate, 2’-Omethylguanosine-3'-phosphate, and 2^,-0-methyluridine-3’-phosphate, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine-3’-phosphate, 2'-fluorocytidine-3’-phosphate, 2'fluoroguanosine-3'-phosphate, and 2^,-fluorouridine-3'-phosphate, respectively; (Agn) is adenosine-glycol nucleic acid (GNA); s is a phosphorothioate linkage; and L96 is N[tris(GalNAc-alkyl)-amîdodecanoyl)]-4-hydroxyprolinol; and (b) administering to the subject a nucleoside/nucleotide reverse transcriptase inhibitor (NRTl);

wherein the subject is HBeAg négative or HBeAg positive. In some embodiments, the method further comprises adrmnistereing to the subject a PEG-IFNa.

In some embodiments of the aforementîoned methods, compositions for use, or uses, the siRNA is administered via subeutaneous injection. In some embodiments, the siRNA comprises administering 1, 2, or 3 subeutaneous injections per dose.

In some embodiments of the aforementîoned methods, compositions for use, or uses, the dose of the PEG-IFNa is 50 pg, 100 pg, 150 pg, or 200 pg. Tn some embodiments, the dose of the PEG-IFNa is 180 pg.

In some embodiments of the aforementîoned methods, compositions for use, or uses, the PEG-IFNa is administered weekly.

In some embodiments of the aforementîoned methods, compositions for use, or uses, the PEG-IFNa is administered via subeutaneous injection.

In some embodiments of the aforementîoned methods, compositions for use, or uses, the NRTI may be tenofovir, tenofovir disoproxil fumarate (TDF), tenofovir alafenamide (TAF), lamivudine, adefovir, adefovir dipivoxil, entecavîr (ETV), teîbivudine, AGX-1009, emtricîtabîne (FTC), clevudine, ritonavir, dipivoxil, lobucavir, famvir, N-Acetyî-Cysteine (NAC), PC 1323, theradigm-HBV, thymosin-alpha,

ganciclovir, besifovir (ANA-380/LB-80380), or tenofvir-exaliades (TLX/CMXI57). In some embodiments, the NRTI is entecavir (ETV). In some embodiments, the NRTI is tenofovir. In some embodiments, the NRTI is lamivudîne. In some embodiments, the NRTI is adefovir or adefovîr dîpivoxil.

In some embodiments of the aforementioned methods, compositions for use, or uses, the subject îs HBeAg négative. In some embodiments, the subject is HBeAg positive.

The siRNA can be présent eîther in the same pharmaceutical composition as the other active agents, or the active agents may be présent in different pharmaceutical compositions. Such different pharmaceutical compositions may be administered eîther combined/sîmultaneously or at separate times or at separate locations (e.g., separate parts of the body).

IV. Kits for HBV Therapy

Also provided herein are kits including components of the HBV therapy. The kits may include an siRNA (e.g., HBV02) and, optionally one or both of (a) PEG-IFNa and (b) a NRTI (e.g., entecavir, tenofovir, lamivudîne, or adefovir or adefovir dîpivoxil). Kits may additionally include instructions for preparing and/or administering the components of the HBV combination therapy.

Some embodiments of the présent disclosure provide a kit comprising: a pharmaceutical composition comprising an siRNA according to any of the preceding claims, and a pharmaceutically acceptable excipient; and a pharmaceutical composition comprising PEG-IFNa, and a pharmaceutically acceptable excipient. In some embodiments, the kit further comprises a NRTI, and a pharmaceutically acceptable excipient.

EXAMPLES

EXAMPLE 1

Treatment of Chronic HBV Infection with HBV02

Safety, tolerability, pharmacokinetics (PK), and antiviral activity of HBV02 are 5 evaluated în a Phase 1/2, randomized, double-blind, placebo-controlled clinîcal study.

The study includes three parts. Part A îs a single ascending dose design in healthy volunteers. Parts B and C are multiple ascending dose designs in subjects with chronic HBV on nucleos(t)ide reverse transcriptase inhibitor (NRTI) therapy. Subjects in Part B are HBeAg négative; subjects in Part C are HBeAg positive. HBeAg positivîty reflects 10 high levels of active réplication of the virus in a person's liver cells.

In Part A, a single dose of HBV02 is administered to healthy adult subjects.

Each dose can consist of up to 2 subcutaneous (SC) injections based on assîgned doselevel. Four dose-level cohorts are included in Part A: 50 mg, 100 mg, 200 mg, and 400 mg. Two sentinel subjects are randomized 1:1 to HBV02 or placebo. The sentinel 15 subjects are dosed concurrently and monitored for 24 hours; if the investigator has no safety concerns, the remainder of the subjects in the same cohort are dosed. The remaining subjects will be randomized 5:1 to HBV02 or placebo. Two optional cohorts in Part A may be added following the same stratification, including sentinel dosing, up to a maximum dose of 900 mg. In addition to the optional cohorts, a total of 8 “floater” 20 subjects may be added to expand any cohort in Part A. “Floater” subjects are to be added in incréments of 4 and randomized 3:1 to HBV02 or placebo. The Part A dose escalation plan is shown in Table 3. The single ascending dose design for Part A is shown in Figure 3.

Table 3. Part A Dose Escalation Plan.

Cohort	Weight-based dose (mg/kg)	Fixed dose^a(mg)	Dose Escalation Factor
la	0.8	50	-
2a	1.7	100	2.0-fold
3a	3.3	200	2.0-fold
4a	_________6.7_________	400	2.0-fold

Optional: 5a and 6a

Up to 15

U p to 900

Up to 2.25-fold ^a Based on average adult weight of 60 kg

Data from Part A are reviewed prior to initiating the dose-level cohort in subjects with chronic HBV infection. The cohort dosing strategy for Part B/C of this study is staggered; 2 dose levels in Part A (la: 50 mg and 2a: 100 mg) are completed and data reviewed before beginning dosing at the starting dose in Part B ( 1 b: 50 mg). Part C is inîtiated at the Part C starting dose (3c: 200 mg) at the same time that the équivalent Part B dose level cohort is inîtiated (3b: 200 mg).

Subjects in Part B are non-cirrhotic adult subjects with HBeAg-negative chronic 10 HBV infection, and hâve been on NRTI therapy for > 6 months and hâve sérum HBV

DNA levels < 90 lU/mL. To exclude the presence of fibresis or cîrrhosîs, screening includes a noninvasive assessment of lîver fibrosis, such as a FibroScan évaluation, unless the subject has results from a FibroScan évaluation performed within 6 months prior to screening or a lîver bîopsy performed within 1 year prior to screening that confirms the absence of Metavir F3 fîbrosis or F4 cirrhosis.

Two doses of HBV02 are administered to subjects 4 weeks apart. Each dose can consist of up to 2 SC injections based on assigned dose-level. Three dose-level cohorts are included in Part B, 50 mg, 100 mg, and 200 mg, such that the cumulative dose received for subjects in Part B is 100 mg, 200 mg, and 400 mg. Each cohort is randomized 3:1 to HBV02 or placebo. Two optional cohorts in Part B may be added following the same stratification, by a factor of 1.5-fold, up to a maximum of 450 mg per dose (900 mg cumulative dose). In addition to the optional cohorts, a total of 16 “floater” subjects may be added to expand any cohort in Part B. “Floater” subjects are to be added in incréments of 4 and randomized 3:1 to HBV02 or placebo. Cohort 1b is inîtiated after cumulative review of ail available safety data, inclusive of the Week 4 laboratory and c 1 i n i cal data of the last available healthy volunteer subject in the 100 mg cohort (Cohort 2a). The dose escalatîon plan for Parts B and C is shown in Table 4. The multiple ascending dose design for Part B/C is shown in Figure 4.

Subjects in Part C are non-cirrhotic adult subjects with HBeAg-posîtive chronic 30 HBV infection, and hâve been on NRTI therapy for > 6 months and hâve sérum HBV

DNA levels < 90 lU/mL. To exclude the presence of fibrosis or cïrrhosis, screening includes a noninvasive assessment of liver fibrosîs, such as a FibroScan évaluation, unless the subject has results from a FibroScan évaluation performed within 6 months prior to screening or a liver biopsy performed within 1 year prior to screening that 5 confirms the absence of Metavir F3 fibrosîs or F4 cïrrhosis Two doses of HBV02 are admînistered to subjects 4 weeks apart. Each dose can consist of up to 2 SC injections based on assigned dose-leveL To accommodate the anticipated lower prevalence of HBeAg-positive patients on NRTI therapy, only I dose level cohort (200 mg) is planned for HBeAg-positive subjects. Part C includes one dose-level cohort, 200 mg, 10 such that the cumulative dose received for subjects in Part C is 400 mg. The cohort is randomized 3:1 to HBV02 or placebo. Two optional cohorts in Part C may be added following the same stratification, by a factor of 1.5-fold, up to a maximum of 450 mg per dose (900 mg cumulative dose). In addition to the optional cohorts, a total of 16 floater” subjects may be added to expand any cohort in Part C. “Floater” subjects are 15 to be added in incréments of 4 and randomized 3:1 to HBV02 or placebo. The only planned cohort in Part C, Cohort 3c, ïs inîtîated at the same tîme as Cohort 3b after review of ail availabié safety data inclusive of Week 6 clînîcal and laboratory data from Cohort 2b. Subjects in Cohort 3c receive HBV02 at the same dose level as subjects in Cohort 3b (200 mg admînistered twice at a dosing interval of 4 weeks).

Table 4. Part B/C Dose Escalatîon Plan.

Cohort	Weight-based dose (mg/kg)	Fixed dose* (mg)	Dose Escalatîon Factor
1b	0.8	50	-
2b	1.7	100	2.0-fold
3b and 3c	3.3	200	2.0-fold
Optional: 4b and 4c	Up to 5	Up to 300	Up to 1.5-fold
Optional: 5b and 6c	Up to 7.5	Up to 450	Up to 1.5-fold

^a Based on average adult weight of 60 kg

Summaries of the study drug dosing and administration for Parts A-C are shown in Table 5 and Figures 5A and 5B.

Table 5. Study Drug Dose and Administration

Cohort	Visit Dose Level (mg)	Visit Dose Volume (mL)	Cumulative Dose (mg)	Injections Per Dose Administration	Injections Total	Cumulative Dose Volume (mL)^a
la	50	0.25	50	1	1	0.25
2a	100	0.50	100	1	1	0.50
3a	200	LO	200	1	1	1.0
4a	400	2.0	400	2	2	2.0
Optional: 5a	<900	<4.5	<900	3	3	<4.5
Optional: 6a	<900	<4.5	<900	3	3	<4.5
1b	50	0.25	100	1	2	0.50
2b	100	0.50	200	1	2	1.0
3b	200	1.0	400	1	2	2.0
Optional: 4b	<300	< L5	<600	I	2	<3
Optional: 5b	<450	<2.5	<900	2	4	<5
3c	200	LO	400	1	2	2.0
Optional: 4c	<300	<1.5	<600	1	2	<3
Optional: 5c	<450	<2.5	<900	2	4	<5

^a Injection volume per site not exceeding 1.5 mL

HBV02 is supplied as a stérile solution for SC injection at a free acid concentration of 200 mg/mL. The placebo is stérile, preservative-free normal saline 0.9% solution for SC injection.

Following administration of FIBV02 or placebo and any adverse effects are noted. P K parameters of HBV02 and possible métabolites are also measured and may include plasma: maximum concentration, time to reach maximum concentration, area 10 under the concentration versus time curve [to last measurable timepoint and to infinity], percent of area extrapolated, apparent terminal élimination half-life, clearance, and volume of distribution; urine: fraction eliminated in the urine and rénal clearance. The foliowing are also determined: maximum réduction of sérum HBsAg from Day 1 until Week 16; nurnber of subjects with sérum HBsAg loss at any timepoint; nurnber of subjects with sustained sérum HBsAg loss for> 6 months; nurnber of subjects with anti-HBs séroconversion at any timepoint; nurnber of subjects with HBeAg loss and/or anti-HBe séroconversion at any timepoint (for HBeAg-positive subjects in Part C only); assessment of the effect of HBV02 on other markers of HBV infection including détection of sérum HBcrAg, HBV RNA, and HBV DNA; and évaluation of potential biomarkers for host responses to infection and/or therapy, including genetic, metabolic, and proteomic parameters. In order to evaluate the PK parameters, blood samples are collected predose (< 15 min prier to dosing), and then 30 min, 1 hr, 2 hr, 4 hr, 6 hr, 8 hr, 10 hr, 12 hr, 24 hr, and 48 hr after dosing; and urine samples are collected predose (< 15 min prior to dosing), and then collected and pooled for 0-4 hr, 4-8 hr, 8-12 hr, 12-24 hr, 48 hr, and 1 week after dosing. For subjects in Parts B or C, blood samples for measuring HBsAg, anti-HBs, HBeAg, anti-HBe, HBV DNA, HBV RNA, or HBcrAg may be collected at one or more of the foliowing timepoînts: screening (28 days to 1 day before dosing), day 1 (dosing), day 2 (after dosing), weekly during the dosing period, weekly for 4 weeks post-dosing, 12 weeks after dosing, 16 weeks after dosing, 20 weeks after dosing, and 24 weeks after dosing,

Fasting is not required for the study procedures.

EXAMPLE 2

Treatment of Chronic HBV with HBV02 Alone or in Combination with PEG-lFNa

Safety, tolerability, pharmacokinetics, and antiviral activity of HBV02 alone or in combination with PEG-IFNa are evaluated in a Phase 1/2 clinical study. The study includes four parts. Parts A-C are a randomized, double-blind, placebo-controlled clinical study of HBV02 administered subcutaneously to healthy adult subjects or noncirrhotic adult subjects with chronic HBV infection who are on NRTI therapy. Part A is a single ascending dose design in healthy volunteers. Parts B and C are multiple ascending dose designs in non-cirrhotîc subjects with chronic HBV on NRTI therapy.

Subjects in Part B are HBeAg négative; subjects in Part C are HBeAg positive. HBeAg positivity reflects high levels of active réplication of the virus in a person's liver cells. Part D is a randomized, open-label Phase 2 study of HBV02 administered alone or in combination with PEG-IFNa in non-cirrhotic adult subjects with chronic HBV on NRTI therapy; Part D includes HBeAg-positive and HBeAg-negative subjects.

In Part A, a single dose of HBV02 is administered to healthy adult subjects. Each dose can consist of up to 3 subcutaneous (SC) injections based on assigned doselevel. Four dose-level cohorts are included in Part A: 50 mg, 100 mg, 200 mg, and 400 mg. Two sentinel subjects are randomized 1:1 to HBV02 or placebo. The sentinel subjects are dosed concurrently and monitored for 24 hours; if the investigator has no safety concerns, the remainder of the subjects in the same cohort are dosed. The remaining subjects will be randomized 5:1 to HBV02 or placebo. Two optîonal cohorts in Part A may be added following the same stratification, including sentinel dosing, up to a maximum dose of 900 mg. In addition to the optîonal cohorts, a total of 8 “floater” subjects may be added to expand any cohort in Part A. “Floater” subjects are to be added in incréments of 4 and randomized 3:1 to HBV02 or placebo. The single ascending dose design for Part A is shown in Figure 3.

Subjects în Part B are non-cirrhotic adult subjects with HBeAg-negative chronic HBV infection, and hâve been on NRTI therapy for > 6 months and hâve sérum HBV DNA levels < 90 lU/mL. To exclude the presence of fibrosis or cirrhosis, screening includes a noninvasive assessment of liver fibrosis, such as a FîbroScan évaluation. Two doses of HBV02 are administered to subjects 4 weeks apart. Each dose can consist of up to 2 SC injections based on assigned dose-level. Three dose-level cohorts are included in Part B, 50 mg, 100 mg, and 200 mg, such that the cumulative dose received for subjects in Part B is 100 mg, 200 mg, and 400 mg. Each cohort is randomized 3:1 to HBV02 or placebo. To accommodate the anticipated lower prcvalence of HBeAgpositive patients on NRTI therapy, only I dose level cohort (200 mg) is planned for HBeAg-positive subjects. Two optîonal cohorts in Part B may be added following the same stratification, up to a maximum of 450 mg per dose (900 mg cumulative dose). In addition to the optîonal cohorts, a total of 16 “floater” subjects may be added to expand any cohort in Part B. “Floater” subjects are to be added m incréments of 4 and randomized 3:1 to HBV02 or placebo. Cohort 1b is initiated after cumulative review of ail available safety data, inclusive of the Week 4 laboratory and clinical data of the last available healthy volunteer subject in the 100 mg cohort (Cohort 2a). The dose escalation plan for Parts B and C is shown in Table 5. The multiple ascending dose design for Part B/C is shown in Figure 4.

Subjects in Part C are non-cirrhotic adult subjects with HBeAg-positive chronic HBV infection, and hâve been on NRTI therapy for > 6 months and hâve sérum HBV DNA levels < 90 ÎU/mL. Two doses of HBV02 are administered to subjects 4 weeks apart. Each dose can consist of up to 2 SC injections based on assigned dose-level. Part C includes one dose-level cohort, 200 mg, such that the cumulative dose received for subjects in Part C is 400 mg. The cohort is randomized 3:1 to HBV02 or placebo. Two optional cohorts in Part C may be added following the saine stratification, up to a maximum of 450 mg per dose (900 mg cumulative dose). In addition to the optional cohorts, a total of 16 “floater” subjects may be added to expand any cohort in Part C. “Floater” subjects are to be added în incréments of 4 and randomized 3:1 to HBV02 or placebo.

Subjects in Part D are non-cirrhotic adult subjects with HBeAg-positive or HBeAg-negatîve chronic HBV infection, and hâve been on NRTI therapy for > 2 months and hâve sérum HBV DNA levels < 90 IU/mL and sérum HBsAg levels > 50 IU/mL. Dose level and number of doses of HBV02 în Part D is determined based on the safety and tolerability of HBV02 in Parts A-C and analysis of antiviral activity of HBV02 in Parts B and C. The dose level in Part D does not exceed the highest dose level evaluated in Parts B and C, and the number of doses will be up to 6 doses (e.g., between 3 and 6 doses) administered every 4 weeks. Subjects are randomized to one of Cohort Id, Cohort 2d, Cohort 3d, and Cohort 4d (optional) (e.g., 100 subjects total, 25 subjects per cohort). In Cohort Id, up to 6 doses (e.g., 3 to 6 doses) of HBV02 are administered to subjects at a frequency of every 4 weeks. Each subject receives a dose of HBV02 on day 1, week 4, and week 8 and may receive additionaî doses at weeks 12, 16, and 20. In Cohort 2d, up to 6 (e.g., 3 to 6 doses) of HBV02 are administered to subjects 4 weeks apart, and PEG-IFNa is administered for 24 weekly doses (i.e., each dose given 1 week apart), starting on day 1. Each subject receives a dose of HBV02 on day 1, week 4, and week 8 and may receive additionaî doses at weeks 12, 16, and 20. In Cohort 3d, up to 6 (e.g., 3 to 6 doses) of HBV02 are administered to subjects 4 weeks apart, and PEG-IFNa is administered for 12 weekly doses (i.e., each dose given 1 week apart), starting at week 12. Each subject receives a dose of HBV02 on day 1, week 4, and week 8 and may receive additionaî doses at weeks 12, 16, and 20. In Cohort 4d, 3 doses of HBV02 are administered to subjects 4 weeks apart, and PEG-IFNa is administered for 12 weekly doses (i.e., each dose given 1 week apart), starting at day 1. Each subject receives a dose of HBV02 on day 1, week 4, and week 8. The doses of PEG-INFa administered to subjects in Cohorts 2d, 3d, and 4d is 180 pg, administered by SC injection. Figures 6A-6D are schematics illustratîng the study designs for Part D. The drug administration schedule for cohort 4d is shown in Table 6.

Table 6.

Cohort 4d Study Drug Administration Schedule (DI=Day I, WI=Week I, eic].

DI

Wl

W2

W3

W4

W5

W6

W7

W8

W9

W10

Wll

HBV02

X

PEG- INFa³

X

^a Subjects who discontinue from PEG-IFNa treatment due to PEG-IFNa-related adverse reactions may continue to receive treatment with HBV02.

To exclude the presence of cirrhosis, screening of subjects enrolled in Part B/C and Part D includes a noninvasive assessment of liver fibrosis such as a FibroScan évaluation, unless the subject has results from a FibroScan évaluation performed within 6 months prior to screening or a liver biopsy performed within 1 year prior to screening that confirms the absence of Metavir F3 fibrosis or F4 cirrhosis.

HBV02 is supplied as a stérile solution for SC injection at a free acid concentration of 200 mg/mL The placebo is stérile, preservatîve-free normal saline 0.9% solution for SC injection.

Following administration of HBV02 or placebo and any adverse effects are noted. PK parameters of HBV02 and possible métabolites are also measured and may include plasma: maximum concentration, time to reach maximum concentration, area under the concentration versus time curve [to last measurable tîmepoint and to infinity], percent of area extrapolated, apparent terminal élimination half-life, clearance, and volume of distribution; urine: fraction eliminated in the urine and rénal clearance. The following are also determined: maximum réduction of sérum HBsAg from Day 1 until Week 16; number of subjects with sérum HBsAg loss at any tîmepoint; number of subjects with sustained sérum HBsAg loss for > 6 months; number of subjects with anti-HBs séroconversion at any tîmepoint; number of subjects with HBeAg loss and/or anti-HBe séroconversion at any tîmepoint (for HBeAg-positive subjects in Part C and Part D only); assessment of the effect of HBV02 on other markers of HBV infection including détection of sérum HBcrAg, HBV RNA, and HBV DNA; and évaluation of potential bîomarkers for host responses to infection and/or therapy, including genetic, metabolic, and proteomic parameters.

Data from Part A are reviewed prior to initiating the dose-level cohort in subjects with chronic HBV infection. The cohort dosing strategy for Part B/C of this study is staggered; 2 dose levels in Part A (la: 50 mg and 2a: 100 mg) are completed and data reviewed before beginning dosing at the starting dose in Part B (!b: 50 mg). Part C is initiated at the Part C starting dose (3c: 200 mg) at the same time that the équivalent Part B dose level cohort is initiated (3b: 200 mg).

Fasting is not required for the study procedures.

Figures 7A and 7B show the study design for Parts A-D.

EXAMPLE 3

Treatment of Chronic HBV with HBV02 Alone or in Combination with PEG-IFNa

Safety, tolerability, pharmacokinetics, and antiviral activity of HBV02 were evaluated in a Phase 1/2 clinical study. The study includes four parts. Parts A-C are a randomized, double-blind, placebo-controlled clinical study of HBV02 administered subcutaneously to healthy adult subjects or non-cirrhotic adult subjects with chronic HBV infection who are on NRTI therapy. Part A is a single ascendîng dose design in healthy volunteers. Parts B and C are multiple ascendîng dose designs ïn non-cirrhotîc subjects with chronic HBV on NRTI therapy. Subjects in Part B are HBeAg négative; subjects in Part C are HBeAg positive. HBeAg positivity reflects high levels of active réplication of the virus in a person's liver cells. HBeAg positive patients are generally younger, and thought to hâve more preserved immune fonction, as compared to HBeAg négative patients who are generally older and hâve experienced greater immune exhaustion. HBeAg négative patients are also thought to hâve larger amounts of integrated DNA compared to HBeAg positive patients. Part D is a randomized, openlabel Phase 2 study of HBV02 administered alone or in combination with PEG-IFNa in non-cirrhotic adult subjects with chronic HBV on NRTI therapy; Part D includes HBeAg-positive and HBeAg-negative subjects.

L Preliminary Animal Dosing Study

Doses of HBV02 used in the study were determined by calculating the human équivalent doses (HEDs) of the no observed adverse effect levels (NOAELs) în animal toxicology studies and applyîng a safety margin to those HEDs. Body surface area (m/kg²) conversion factors were used to calculate HEDs of animal doses. No toxicity was observed în a rat Good Laboratory Practice (GLP) study after 3 biweekly doses of HBV02 at the highest dose tested, 150 mg/kg, correspondîng to a HED of 24 mg/kg/dose (Table 7). No toxicity was observed in a non-human primate (NHP) GLP study after 3 biweekly doses of HBV02 at the highest dose tested, 300 mg/kg, correspondîng to a HED of 97 mg/kg/dose (Table 7). Using this methodology, the

proposed starting dose of 0.8 mg/kg in humans represents the 30-fold safety margin of the HED of the NOAEL projected ïn rats, and the 120-fold safety margin of the HED of the NOAEL projected in NHPs. Other siRNAs using the GalNAc platform hâve demonstrated meaningful lîver target engagement at 1 to 15 mg/kg. Furthermore, a statistically significant décliné in HBsAg in preclinical FIBV mouse models at a dose range of 1 to 9 mg/kg was observed.

Table 7. Proposed Starting Dose for HBV02.

Study Species and Duration	NOAEL (mg/kg)	HED (mg/kg)	Starting Dose (mg/kg)
Cynomolgus monkey 4-week study (3 biweekly doses) followed by 13-week recovery	300	97	0.8 ( 120-fold safety margin)
Rat 4-week study (3 biweekly doses) followed by 13-week recovery	150	24	0.8 (30-fold safety margin)

A fixed dose of HBV02 was used in the ciinical study because HBV02, like other GalNAc-conjugated siRNAs, is taken up by the lîver and minimally distributed to other organs and tissues. Therefore, weight-based dosing is not anticipated to reduce the inter-individual variation in the pharmacokinetics (PK) of HBV02 in adults and a fixed dose has the advantage of avoiding potential dose calculation errors.

ii. Methods

The study design is shown in Figure 12.

In Part A, a single dose of HBV02 was administered to healthy adult subjects. Each dose consisted of up to 3 subcutaneous (SC) injections based on assigned doselevel. Six dose-level cohorts were included in Part A: 50 mg, 100 mg, 200 mg, 400 mg, 600 mg, and 900 mg. Two sentinel subjects were randomized 1 : ! to HBV02 or placebo.

The sentinel subjects were dosed concurrently and monitored for 24 hours; if the investigator had no safety concems, the remainder of the subjects in the same cohort were dosed.

Subjects in Part B were non-cirrhotic adult subjects with HBeAg-negative chronic HBV infection, and hâve been on NRTI therapy for > 6 months and hâve sérum HBV DNA levels < 90 lU/mL. To exclude the presence of fibrosis or cirrhosis, screening included a nonînvasive assessment of liver fibrosis. Two doses of HBV02 were administered to subjects 4 weeks apart (i.e., on Day 1 and Day 29). Each dose consisted of up to 2 SC injections based on assîgned dose-level. Six cohorts were included in Part B, at doses of 20 mg, 50 mg, 100 mg, or 200 mg, such that the cumulative dose received for subjects in Part B was 40 mg, 100 mg, 200 mg, or 400 mg. Each cohort was randomized 3:1 to HBV02 or placebo. The 50 mg cohort of Part B was initiated after cumulative review of ail available safety data, inclusive of the Week 4 laboratory and clinical data of the last available healthy volunteer subject in the 100 mg cohort.

Subjects în Part C were non-cirrhotic adult subjects with HBeAg-posîtîve chronic HBV infection, and hâve been on NRTI therapy for > 6 months and hâve sérum HBV DNA levels < 90 lU/mL. To accommodate the anticipated lower prevalence of HBeAg-positive patients on NRTI therapy, only 2 dose level cohorts (50 mg and 200 mg) were included for HBeAg-positive subjects. Two doses of HBV02 were administered to subjects 4 weeks apart (i.e., on Day 1 and Day 29). Each dose consisted of up to 2 SC injections based on assîgned dose-level. Part C included two dose-level cohorts, 50 mg and 200 mg, such that the cumulative dose received for subjects in Part C was 100 mg or 400 mg. The cohort was randomized 3:1 to HBV02 or placebo.

Patients with chronic HBV who experienced a greater than 10% décliné from baseline sérum HBsAg at Week 16 in HBsAg were followed for up to 32 additional weeks.

Inclusion criterîa for Parts B and C included: âge 18-65 years; détectable sérum HBsAg for > 6 months; on NRTI therapy for > 6 months; HBsAg > 150 lü/mL; HBV DNA < 90 ÏU/mL; and sérum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) <2 ^x upper lîmit of normal (ULN). Exclusion criterîa included: significant fibrosis or cirrhosis (FîbroScan > 8.5 kPa at screening or Metavîr F3/F4 liver biopsy within i year); bilirubin, international normalized ratio (INR), or prothrombin time > ULN; active HIV, HCV, or hepatitîs Delta virus infection; and créatinine clearance < 60 mL/min (Cockcroft-Gault).

Subjects in Part D are non-cirrhotic adult subjects with HBeAg-positive or HBeAg-negative chronic HBV infection, and hâve been on NRTI therapy for > 2 months and hâve sérum HBV DNA levels < 90 HJ/mL and sérum HBsAg levels > 50 lU/mL. Dose level and number of doses of HBV02 in Part D is determined based on the safety and tolerability of HBV02 in Parts A-C and analysis of antiviral activity of HBV02 în Parts B and C. The dose level in Part D does not exceed the highest dose level evaluated in Parts B and C, and the number of doses will be up to 6 doses (e.g., between 3 and 6 doses) administered every 4 weeks. Subjects are randomized to one of Cohort Id, Cohort 2d, Cohort 3d, and Cohort 4d (optional) (e.g., 100 subjects total, 25 subjects per cohort). In Cohort Id, up to 6 doses (e.g., 3 to 6 doses) of HBV02 are administered to subjects at a frequency of every 4 weeks. Each subject receives a dose of HBV02 on day 1, week 4, and week 8 and may receive additional doses at weeks 12, 16, and 20. In Cohort 2d, up to 6 (e.g., 3 to 6 doses) of HBV02 are administered to subjects 4 weeks apart, and PEG-IFNa is administered for 24 weekly doses (i.e., each dose given 1 week apart), starting on day 1. Each subject receives a dose of HBV02 on day 1, week 4, and week 8 and may receive additional doses at weeks 12, 16, and 20. In Cohort 3d, up to 6 (e.g., 3 to 6 doses) of HBV02 are administered to subjects 4 weeks apart, and PEG-IFNa is administered for 12 weekly doses (i.e., each dose gîven 1 week apart), starting at week 12. Each subject receives a dose of HBV02 on day I, week 4, and week 8 and may receive additional doses at weeks 12, 16, and 20. In Cohort 4d, 3 doses of HBV02 are administered to subjects 4 weeks apart, and PEG-IFNa is administered for 12 weekly doses (i.e., each dose given 1 week apart), starting at day 1. Each subject receives a dose of HBV02 on day I, week 4, and week 8. The doses of PEG-INFa administered to subjects in Cohorts 2d, 3d, and 4d is 180 pg, administered by SC injection. Figures 6A-6D are schematics illustrating the study designs for Part D. The drug administration schedule for cohort 4d is shown în Table 8.

Table 8.

Cohort 4d Study Drug Administration Schedule (Dl=Day I, WI=Week 1, efc.T

DI

W1

W2

W3

W4

W5

W6

W7

W8

W9

W10

Wll

HBV02

X

PEG- INFa^a

X

To exclude the presence of cirrhosis, screening of subjects enrolled in Parts B and C included a noninvasive assessment of lîver fibrosis such as a FibroScan évaluation, unless the subject had resuIts from a FibroScan évaluation performed withîn 6 months prior to screening or a liver biopsy performed within 1 year prior to screening that confirmed the absence of Metavir F3 fibrosis or F4 cirrhosis. The same methods are used to exclude ctrrhotic subjects from inclusion in Part D.

HBV02 was supplied as a stérile solution for SC injection at a free acid concentration of 200 mg/mL. The placebo was stérile, preservative-free normal saline 0.9% solution for SC injection.

Following administration of HBV02 or placebo, any adverse effects were noted. PK parameters of HBV02 and possible métabolites were also measured and included plasma: maximum concentration, tîme to reach maximum concentration, area under the concentration versus time curve [to last measurable tîmepoint and to infinîty], percent of area extrapolated, apparent terminal élimination half-life, clearance, and volume of distribution; urine: fraction eliminated in the urine and rénal clearance. The following were also determined: maximum réduction of sérum HBsAg from Day 1 until Week 16; number of subjects with sérum HBsAg loss at any tîmepoint; number of subjects with sustained sérum HBsAg loss for > 6 months; number of subjects with anti-HBs séroconversion at any tîmepoint; number of subjects with HBeAg loss and/or anti-I IBe séroconversion at any tîmepoint (for HBeAg-positive subjects in Part C and Part D only); assessment of the effect of HBV02 on other markers of HBV infection including

détection of sérum HBcrAg, HBV RNA, and HBV DNA; and évaluation of potential biomarkers for host responses to infection and/or therapy, including genetic, metabolic, and proteomic parameters. In order to evaluate the PK parameters for subjects in Part A, blood samples were collected predose (< 15 min prior to dosing), and then 30 min, 1 hr, 5 2 hr, 4 hr, 6 hr, 8 hr, 10 hr, 12 hr, 24 hr, and 48 hr after dosing; and urine samples were collected predose (< 15 min prior to dosing), and then collected and pooled for 0-4 hr, 4-8 hr, 8-12 hr, 12-24 hr, 48 hr, and 1 week after dosing. For subjects in Parts B or C, blood samples for measuring HBsAg, anti-HBs, HBeAg, anti-HBe, HBV DNA, HBV RNA, or HBcrAg were collected at one or more of the following timepoints: screening 10 (28 days to 1 day before dosing), day I (dosing), day 2 (after dosing), weekly during the dosing period, weekly for 4 weeks post-dosing, 12 weeks after dosing, 16 weeks after dosing, 20 weeks after dosing, and 24 weeks after dosing.

Data from Part A were reviewed prior to initiating the dose-level cohort in subjects with chronic HBV infection. The cohort dosing strategy for Part B/C of this 15 study was staggered; 2 dose levels în Part A (50 mg and 100 mg) were completed and data reviewed before beginning dosing at the starting dose în Part B (50 mg). Part C was initiated at the Part C starting dose (200 mg) at the same time that the équivalent Part B dose level cohort is initiated (200 mg).

Fasting was not required for the study procedures.

iii. Prelimînary Results from Parts A and B

Figure 9A illustrâtes the Part A, Part B, and Part C study design at the time dosing was completed for Part A cohorts 1 through 5 (50 mg, 100 mg, 200 mg, 400 mg, 600 mg) and for Part B cohorts I through 2 (50 mg, 100 mg). Figure 9B illustrâtes the Part A completed dosing for cohorts I through 5, and the wîthdrawal of subjects în the 25 different cohorts. Figure 9C depicts the Part B completed dosing for cohorts 1 through 2, and the wîthdrawal of subjects in the different cohorts.

The preîiminary démographie data for subjects included in Parts A and B are shown în Table 9 below.

Table 9: Demographics for subjects enrolled in Parts A and B.

			Part A Cohorts 1-5 N = 4I	Part B Cohorts 1,2,4 N =13 (10 active, 3 placebo)
Gen der		Male	13 (31.7%)	11 (84.6%)
	Female	28 (68.3%)	2(15.4%)
Race/Ethnicity		Whîte	21 (51.2%)	1 (7.7%)
	Asian	8 (19.5%)	11 (84.6%)
	Native Hawaiîan/Pacific Islander	3 (7.3%)	0
	Other	9 (30.0%)	1 (Maori) (7.7%)
	Hispanic	1 (2.4%)	0
Other		Age mean (range)	25.9 (19 to 41)	43 (31 to 53)
	Baseline HBsAg mean (range)	N/A	3253 (547 to 16,522)
	HBV génotype	N/A	unknown

A summary of Adverse Events (AE) in from the preliminary analysis of the completed dosing portions of Parts A and B îs presented in Table 10.

Table 10 Summary of Adverse Events.

Number of Subjects with:	Part A Cohorts 1-5 N=41	Part B Cohorts 1, 2, 4 N=13 (10 active, 3 placebo)
Any AEs	32 (78%)	4(31%)
Grade 1	30 (73%)	4(31%)
Grade 2	2 (4.9%), URI	0
Grade 3 or 4	0	0
Any treatment-emergent adverse events (TEAEs) (4 weeks post-dose)	25 (61%)	4(31%)

Any treatment-related AEs (ail occurred 4 weeks post-dose)	3 (7.3%), ail grade i • Headache • Injection site tenderness • Abdominal discomfort	1 (7.7%), grade 1 • Injection site pain
Injection site reactions	6(15%) • 5/6 had injection site pain • 1/6 bruising	l (7.7%)

Subjects in Parts A and B showed no significant abnormalities in laboratory values, hyperbîlirubînemia, or elevated TNR. Some subjects in Parts A and B exhîbited abnormalities in their liver function lab values (Figures 10A, 10B, and 11). Two out of

41 subjects in Part A had ALT élévations on Day 1 prior to dosing (normal ALT at screening). In Part B, 1 out of 12 subjects showed grade 1 ALT (39 U/L, 1.1 x ULN) and AST (50 U/L, 1.5 x ULN) élévations at Week 8. One subject in cohort 3a (200 mg) with ALT at the upper limit of normal on day 29 was associated with strenuous exercise and high créatinine kinase (CK: 5811 U/L). Two subjects in cohort 4a (400 mg) had

ALT above the upper limit of normal on Day 1 prior to dosing. One admitted to strenuous exercise, had high CK of 20,001 U/L, and withdrew on day 2 unrelated to adverse events. The second subject with ALT élévation resolved by Day 8 wîthout intervention. As shown in Figure 11, one female subject in cohort 2b (100 mg) showed grade 1 ALT élévation at Week 8.

Subjects from Part B showed a decrease in HBsAg over time in the active groups of cohort 1 and 2. Figure 12A depicts the change in HBsAg in cohorts 1b (50 mg) and 2b (100 mg) for subjects receiving HBV02 or placebo. Figure 12B depicts the change in HBsAg in cohorts l b and 2b for only subjects receiving HBV02. In cohort 4b (the 20mg x2 group), a subject had a 0.47 log décliné 2 weeks after the first dose.

Figure 12C shows the mean change in HBsAg in cohorts 1b and 2b from Day I to Week 4 or Week 20 (depending on cohort), following administration of HBV02, with 3 subjects with chronic HBV infection (HBeAg négative) having received 50mg of HBV02 on Day 1 and Day 28, and six subjects having received 100 mg on Day 1. In the mg cohort, the average décliné în HBsAg at Week 12, after two doses, was 1.5 logio, or approximately 30-fold réduction. Ail subjects in this cohort reached their apparent maximal décliné in HBsAg, which has ranged from 0.6 to 2.2 logio. In the 100 mg cohort, ail subjects had reached Week 4, where an average décliné of 0.7 logio, or 5 approximately six-fold réduction, was observed after one dose.

Among the 10 HBeAg-negative subjects in Part B, 7 subjects were good responders, showing a 0.29 to 0.95-log décliné in HBsAg 2 weeks after the first dose (20, 50, or 100 mg). Two out of 10 were intermediate responders, showing a 0.06 to 0.21 -log décliné in HBsAg 2 weeks after the first dose of 20, 50, or 100 mg. Finally, 10 one ofthe 10 subjects was a “non-responder,” showing a 0.16-log increase in HBsAg 2 weeks after the first dose. Possible reasons for the presence of intermediate and nonresponders include: dose response, pharmacokinetîcs, viral résistance, and host factors.

HBV02 was well-tolerated among the subjects. Single doses ranging from 50 to 600 mg were well tolerated in healthy volunteer subjects. Two doses ranging from 50 to 15 100 mg were well tolerated în HBeAg-negative subjects. There was a high interpatient variability în HBsAg décliné, with a rebound 12 weeks after the last dose.

iv. Demographics and Baseline Characteristics - Parts A, B, and C The demographics and baseline characteristics of subjects in Parts A, B, and C are shown în Table 11, Table 12, and Table 13, respectively. AH subjects in Parts B and 20 C were NRTI suppressed and had FibroScan <8.5 kPa or Metavir F0/F1/F2.

Table 11.

Demographics and baseline characteristics of subjects in Part A (healthy volunteers).

	HBV02	Placebo n=12
	50 mg n=6	100 mg n=6	200 mg n=6	400 mg n=7“	600 mg n=6	900 mg n=6	Overall n=37
Mean âge, y (SD)	25 (3)	23 (4)	27(4)	24 (4)	29 (6)	33 (10)	27(6)	27(7)

Male sex, n (%)	0	2(33)	3(50)	0	3 (50)	3(50)	11 (30)	7(58)
Mean weight, kg (SD)	62(12)	63 (7)	75(5)	65 (10)	72 (8)	72 (12)	68 (10)	76(10)
Mean BMI, kg/m²(SD)	23(5)	23 (3)	24 (2)	25 (4)	26(1)	26 (4)	25 (3)	24 (2)
Race, n (%)
Asian	2(33)	3(50)	0	0	2(33)	1 (17)	8 (22)	1(8)
White	2(33)	2(33)	5 (83)	5(71)	3 (50)	3(50)	20 (54)	8(67)
Other	1(17)	1(17)	1(17)	1 (14)	1(17)	2(33)	6(16)	1 (8)

SD=standard déviation.

“includes replacement volunteer

Table 12. Demographics and baseline characteristics of subjects in Part B (HBeAg-negative patients).

	HBV02	Placebo n=6
	20 mg n=3	50 mg n=6	100 mg n=6	200 mg n=3	Overall n-18
Mean âge, y (SD)	40 (9)	43(11)	45(6)	55(4)	45 (9)	44 (7)
Male sex, n (%)	2(67)	5 (83)	5(83)	0	12 (67)	3(50)
Race, n (%)
Asian	3(100)	5 (83)	5 (83)	3 (100)	16(89)	6(100)
White	0	0	1(17)	0	1(6)	0

	HBV02	Placebo n~6
	20 mg n=3	50 mg n=6	100 mg n=6	200 mg n=3	Overall n=18
Other	0	1(17)	0	0	1 (6)	0
Mean log_]QHBsAg (SD)	3.3 (0.3)	3.3 (0.5)	3.4 (0.5)	3.3 (0.4)	3.3 (0.4)	3.5 (0.4)

SD=standard déviation.

Table 13. Demographics and baseline characterîstîcs of subjects în Part C (HBeAg-positive patients).

	HBV02	Placebo n=2
50 mg n = 3	200 mg n=3	Overall n=6
Mean âge, y (SD)	35 (10)	34(13)	34(10)	59(8)
Male sex, n (%)	1(33)	2(67)	3 (50)	1(50)
Race, n (%)
Asian	3 (100)	3(100)	6(100)	2(100)
White	0	0	0	0
Other	0	0	0	0
Mean log θ HbsAg (SD)	3.5 (0.3)	3.9 (0.6)	3.7 (0.5)	3.2 (0.3)

SD=standard déviation.

v. Safety and Tolerability - Results from Parts A, B, and C

Prelimînary data were obtained from Parts A, B, and C based on 37 healthy volunteers that received HBV02; 12 healthy volunteers that received placebo; 24 patients with chronic HBV on NRTIs that received HBV02; and 8 patients with chronic HBV on NRTIs that received placebo. HBV02 was generally well-tolerated.

Across healthy volunteers and chronic HBV patients, HBV02 was generally well-tolerated in healthy volunteers gîven as a single dose up to 900 mg and in patients given as two doses of 20 mg, 50 mg, 100 mg, or 200 mg each dose. No clinically significant alanine transaminase (ALT) abnormalities, which are a marker of liver inflammation, were observed through Week 16 for chronic HBV patients (Parts B and C) (Figures 13A-13E). No Grade > 2 ALT élévations, levels of bilirubin > ULN, or clinically relevant changes or trends in other iaboratory parameters, vital signs, or ECGs were observed.

For Part A, no post-baseline ALT élévations to > ULN were associated with încreases in bilirubin > ULN. No changes in functional status of the liver (e.g., album in, coagulation parameters) or clinîcal sîgns/symptoms of hepatic dysfunction were observed in any HBV02-treated subject. Transient ALT élévations were observed with HBV02 în 1/6 (17%) and 4/6 (67%) subjects after a single dose of 1 and 3 mg/kg, respectîvely. These élévations were asymptomatic and not accompanied by hyperbilirubinemia. In contrast, no ALT élévations potentially related to HBV02 were observed with single doses of HBV02 ranging from 50 - 600 mg (~ 0.8 to 10 mg/kg). In the Part A 900 mg (~15 mg/kg) cohort, mîld, asymptomatic Grade l ALT élévations, with no associated changes în bilirubin, were observed in a subset of subjects (5/6 of subjects having ALT élévations 1.1-2.6 x ULN). The ALT levels for subjects in Part A, including relative to subjects administered HBV01 (a similar siRNA lacking the GNA modification), are shown in Figure 14. These results suggest that incorporating ESC+· technology (providing enhanced stability and minimized off-target activity through encorporation of a GNA modification) decreases the propensity of sîRNAs to cause ALT élévations in healthy volunteers at dose levels anticipated to be clinically relevant.

No dose-related trends in the frequency of adverse events were observed. The majority of treatment emergent adverse events that were preported were mild in severity, and no patients dîscontinued due to an adverse event. The most common adverse event was headache (6/24, 25%). Three Grade 3 adverse events of upper5 respiratory tract infection, chest pain, and low phosphate levels in the blood were reported, but were not considered to be related to HBV02. There was a single Grade 3 adverse event of hypophosphatemia observed in a patient on tenofovir disoproxil fumarate. Two serions adverse events, or SAEs, were reported, both in Part B. The first, a Grade 2 headache, resolved with intravenous fluids and non-opioid pain médications.

This patient had additional symptoms of fever, nausea, vomiting, and déhydration, assessed as being consistent with a viral syndrome. The second SAE, a Grade 4 dépréssion, occurred over 50 days after the last drug dose was administered, and was assessed to be unrelated to HBV02 treatment.

A summary of the treatment emergent adverse events is shown in Table 14.

Table 14, Summary of treatment emergent adverse events (AE).

Patients, n (%)	HBV02 n=24	Placebo n=8
Any AE	13 (54)	2(25)
T reatmentrelated AE	5(21)	0
Grade >3 AE	1 (4)	0
Serious AE	1(4)	0

vi. Pharmacokinetics - Results from Part A

Preliminary pharmacokînetîc (PK) data from the first-in-human Phase 1 randomized, blinded, placebo-controlled, dose ranging study of HBV02 in healthy volunteers were analyzed. Plasma samples were assessed for six single ascending dose 20 cohorts of eight subjects (6:2 active:placebo) that received a single subcutaneous (SC) dose of HBV02 ranging from 50 to 900 mg.

Elîgibility criterîa included the following: Age 1 8 to 55 y; Body mass index (BMI) 18.0 -< 32 kg/m²; CLcr < 90 mL/min (Cockcroft-Gault); and no clinically significant ECG abnormalities or clinically significant chronic medical condition.

Intensive plasma and urine PK samples were collected for 1 week. Serial plasma samples were collected over 24 hr, at 48 hr, and 1 week post dose. Pooled urine samples were collected over 24 hr, and single void samples were collected at 48 hr and 1 week postdose. Concentrations of HBV02 and (N-1)3' HBV02 antisense métabolite in plasma and urine were measured using valîdated liquid chromatography tandem mass spectroscopy assays (lower limit of quantitation (LLOQ) of 10 ng/mL in plasma and urine). PK parameters were estimated using standard noncompartmental methods in WinNonlin®, V6.3.0 (Certara L.P., Princeton, NJ). AS(N-1)3' HBV02, the primary circulating métabolite with equal potency to HBV02, is formed by the loss of one nucléotide from the 3’ end of the antisense strand of FIBV02.

Figure 15A and Figure 15B show plasma concentration vs. time profiles for HBV02 and AS(N-1)3' HBV02, respectively, after a single SC dose in healthy volunteers. HBV02 exhibited linear kinetics in plasma after SC injection. HBV02 was absorbed after SC injection with médian T_max of 4-8 hours. HBV02 was not measurable in plasma after 48 hours for any subject, consistent with rapid GalNAc-mediated liver uptake; the médian apparent élimination half-life (ti/2) ranged from 2.85-5.71 hours. The short plasma half-life likely represents the distribution half life (see Agarwal S, et al., Clin Pharmacol Ther. 2020 Jan 29, doi: !0.1002/cpt.l802). A rapid conversion of HBV02 to the (N-1)3’ métabolite, referred to as AS(N-I)3' HBV02, was observed. AS(N-1)3' HBV02 had a médian T_mæ< of 2-10 hr, was quantifiable only at doses > 100 mg, and had concentrations generally -10 fold lower compared to HBV02.

IIBV02 plasma exposures (AUCo-izand C_max) appeared to increase in a dose proportional manner up to 200 mg and exhibited slightly greater than dose-proportîonal increase at doses above 200 mg (Figure 16; Figure 17; Table 15). Following a single SC dose of HBV02 of 50 to 900 mg, plasma area under the curve (AUCiast) and meanmaximum concentrations (Cmax) increased with dose with mean exposures ranging between 786 to 74,700 ng*hr/mL and 77.8 to 6010 ng/mL, respectively. A similar trend was observed for AS(N-1)3' HBV02. These results indicate transient saturation of ASGPR-mediated hepatic uptake of HBV02 resulting in higher circulating concentrations at higher doses (see Agarwal et al., 2020, supra).

Table 15. Fold-change between HBV02 plasma exposure and dose.

Dose Range	Fold Change	AUCo-12	Cmax
50 - 200 mg	4	4.57	4.59
200 - 900 mg	4.5	8.08	7.05

Interpatient variability in HBV02 plasma PK parameters was generally low (-30%).

The most prévalent active métabolite (—12%), AS(N-I)3' HBV02, is equally potent as HBV02. AS(N-1)3' HBV02 was détectable in plasma in 0/6 subjects at 50 mg, 3/6 subjects at 100 mg, and in ail subjects at 200, 400, 600, and 900 mg. The PK proiile of the metabolîte was similar to HBV02 with AUCiast and C_max values of AS(N-1)3' HBV02 in plasma <11% of HBV02.

AUCo-12 and Cma* of AS(N-1)3' HBV02 in plasma were <11% of total drug related material.

A summary of the plasma PK parameters for HBV02 and AS(N-1)3' HBV02 observed after a single SC dose in healthy volunteers is shown in Figure 18.

Urine concentration vs. time profiles for HBV02 and AS(N-I)3' HBV02 are shown in Figures 19A and I9B, respectively. Low concentrations of HBV02 and AS(N1)3' HBV02 were detected in urine through the last measured time-point at 1 week postdose in ail cohorts. The PK profile of HBV02 in urine mirrored that of plasma where calculable.

A summary of the urine PK parameters for HBV02 and AS(N-1)3' HBV02 in healthy volunteers is shown in Figure 20. Approximately 17—46% and 2-7% of the administered dose (50-900 mg) was excreted in urine as unchanged HBV02 and AS(N1)3' HBV02, respectively, over the first 24-hr period. The fraction of HBV02 excreted into urine over 24 hr post-dose increased with dose level. This likely resulted from a rate of HBV02 hepatic uptake by ASGPR far in excess of rénal élimination (see Agarwal et. al, 2020, supra), and mirrors greater than dose proportîonal increases in plasma HBV02. The rénal clearance of HBV02 approached glomeruiar filtration rate.

These preliminary data show that HBV02 demonstrated favorable PK properties în healthy volunteers.

vii. Efficacy —Results from Parts B and C

Preliminary data were obtained from B and C based on 24 patients with chronic HBV on NRTIs that received HBV02; and 8 patients wîth chronic HBV on NRTIs that received placebo. Initial data demonstrated substantial réductions in HBsAg în patients at doses rangîng from 20 mg to 200 mg.

The biologie activity of HBV02 was assessed by déclinés in HBsAg. The activity of HBV02 through Week 16 în the 200 mg cohorts of Part B, HBeAg-negative, and Part C, HBeAg-positive, îs shown in Figures 21A and 21 B. For Parts B and C, the average baseline HBsAg levels were 3.3 logwIU/mL and 3.9 logio.IU/mL, respectively. The average décliné in HBsAg across HBeAg-negative and HBeAg-positive subjects at Week 16 was 1.5 logio, or an approximately 32-fold réduction. The déclinés observed in HBsAg at Week 16 ranged from 0.97 logio to 2.2 logio, or an approximately nine to 160-fold réduction, after two 200 mg doses of HBV02 given four weeks apart. The average HBsAg level at Week 16 was 314 IU/mL, with half of patients achieving HBsAg values < 100 IU/mL and 5/6 achieving HBsAg values < 1000 IU/mL.

The change in HBsAg from baseline through Week 16, by dose, is shown in Figure 22. The percent of patients having HBsAg levels <100 IU/mL at Week 24 was 33% for patients receiving 20 mg HBV02, 44% for patients receiving 50 mg HBV02, 50% for patients receiving 100 mg HBV02, and 50% for patients receiving 200 mg HBV02. Individual maximum HBsAg change from baseline is shown in Figure 23. Similar réductions were observed in HBeAg-positive and HBeAg-negative patients. At Week 24, the mean change în HBsAg observed in patients administered HBV02 at 20 mg, 50 mg, lOOmg, and 200 mg was -0.76 logio,-0.93 logio, -1.23 logio, and -1.43 logio, respectively. Ail 6 patients who received 2 doses of 200 mg achieved > 1.0 logio décliné in HBsAg. Individual HBsAg change from baseline at Week 24 is shown in Figure 24, indicating a dose-dependent durabiiity in HBsAg décliné.

These results show that HBV02 was well tolerated, with no safety signais observed. Dose-dependent HBsAg réductions in HBeAg-negative and HBeAg-positive patients were observed across the dose range of 20 to 200 mg of HBV02 (2 doses delivered), which were durable at the higher doses for at least 6 months. Similar HBsAg réductions were obsereved in both HBeAg-negative and HBeAg-positive patients, demonstrating that HBV02 can decrease HBsAg în patients regardless of the stage of their disease. Ail patients who received 2 doses of 200 mg achieved a > 1-iogio réduction in HBsAg, and at Week 24, the mean décliné in HBsAg was -1.43 logio. Overall, these results support the potential of HBV02 as a backbone for a finite treatment regimen aimed at functional cure of chronic HBV infection. In particular, the ability of HBV02 to resuit in substantiel déclinés in HBsAg after only two doses suggests that HBV02 has the potential to play an important rôle in the functional cure of chronic HBV.

While spécifie embodiments hâve been illustrated and described, it will be readily appreciated that the various embodiments described above can be combined to provide further embodiments, and that various changes can be made thereîn without departing from the spirit and scope of the invention.

AIL ofthe U.S. patents, U.S. patent application publications, U.S. patent applications, foreîgn patents, foreign patent applications, and non-patent publications referred to in this spécification or Iisted in the Application Data Sheet, including U.S. Provisional Patent Applications Nos. 62/846927 filed May 13, 2019, 62/893646 filed August 29, 2019, 62/992785 filed March 20, 2020, 62/994177 filed March 24, 2020, and 63/009910 filed April 14, 2020, are incorporated herein by reference, in their entirety, unless explîcitly stated otherwise. Aspects of the embodiments can be modified, if necessary to employ concepts of the varions patents, applications and publications to provîde yet further embodiments.

These and other changes can be made to the embodiments in light of the abovedetailed description. In general, in the following daims, the tenns used should not be construed to limit the daims to the spécifie embodiments disclosed in the spécification and the daims, but should be construed to include ah possible embodiments along with the full scope of équivalents to which such daims are entitled. Accordingly, the daims are not limited by the disclosure.

Claims

1. An siRNA for use in the treatment of a chronic HBV infection in a subject, wherein the siRNA has a sense strand comprising 5'- gsusguGfcAfCfUfucgcuucacaL96 -3' (SEQ ID NO:5) and an antisense strand comprising 5'- usGfsuga(Agn)gCfGfaaguGfcAfcacsusu

2. The siRNA for use of claim 1, wherein the siRNA is for administration to the subject with the PEG-IFNa over the same time period.

3. The siRNA for use of claim 1 or 2, wherein the siRNA is for administration to the

4. The siRNA for use of claim 1 or 2, wherein the siRNA is for administration to the subject after administration of the PEG-IFNa to the subject for a period of time.

5 administration in 1, 2, or 3 subcutaneous injections per dose.

5'-gsusguGfcAfCfUfucgcuucacaL96 -3' (SEQ ID NO:5) and an antisense strand comprising 5usGfsuga(Agn)gCfGfaaguGfcAfcacsusu -3' (SEQ ID NO:6), wherein a, c, g, and u are 2'-O-methyladenosine-3'-phosphate, 2'-O-methylcytidine-3'phosphate, 2'-O-methylguanosine-3'-phosphate, and 2'-O-methyluridine-3'-phosphate, respectively;

Af, Cf, Gf, and Uf are 2'-fluoroadenosine-3'-phosphate, 2^,-fluorocytidine-3'-phosphate, 2'fluoroguanosine-3'-phosphate, and 2^,-fluorouridine-3'-phosphate, respectively;

(Agn) is adenosine-glycol nucleîc acid (GNA);

s is a phosphorothioate linkage; and

L96 is N-[tris(GaINAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol.

5 subject with subséquent administration of PEG-IFNa.

5. The siRNA for use of claim 1 or 2, wherein the subject has been administered PEG-IFNa prior to the administration of the siRNA.

101

5 -3’ (SEQ ID NO:6), wherein a, c, g, and u are 2'-O-methyladenosine-3'-phosphate, 2'-O-methylcytidine-3’phosphate, 2'-O-methylguanosine-3'-phosphate, and 2'-O-methyluridine-3'-phosphate, respectively;

Af, Cf, Gf, and Uf are 2'-fluoroadenosine-3'-phosphate, 2'-fluorocytidine-3'-phosphate, 2'10 fluoroguanosine-3'-phosphate, and 2'-fluorouridine-3'-phosphate, respectively;

(Agn) is adenosine-glycol nucleic acid (GNA);

s is a phosphorothioate linkage; and

L96 is N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol; and wherein the siRNA is for use with a PEG-IFNa and the siRNA is for administration to the

6. The siRNA for use of daim 1-5, wherein the siRNA is for administration to the subject with administration of PEG-IFNa during the same period of time that the subject is administered the siRNA.

7. The siRNA for use of daim 1-6, wherein the siRNA is for administration to the

8. The siRNA for use of any one of claims 1-7, wherein the siRNA is for use with a nucleoside/nucleotide reverse transcriptase inhibitor (NRTI).

9. The siRNA for use of any one of claims 1-8, wherein the subject has been administered a NRTI prior to the administration ofthe siRNA.

10

10 (a) a pharmaceutical composition comprising an siRNA, and a pharmaceutically acceptable excipient, wherein the siRNA has a sense strand comprising 5'gsusguGfcAfCfUfucgcuucacaL96 -3’ (SEQ JD NO:5) and an antisense strand comprising 5'usGfsuga(Agn)gCfGfaaguGfcAfcacsusu -3' (SEQ ID NO:6), wherein a, c, g, and u are 2'-O-methyladenosine-3'-phosphate, 2'-O-methylcytidine-3'15 phosphate, 2'-O-methylguanosine-3'~phosphate, and 2'-O-methyluridine-3'-phosphate, respectively;

Af, Cf, Gf, and Uf are 2'-fluoroadenosine-3'-phosphate, 2'-fluorocytidine-3'-phosphate, 2'fluoroguanosine-3'-phosphate, and 2'-fluorouridine-3'-phosphate, respectively;

(Agn) is adenosine-glycol nucleic acid (GNA);

10. The siRNA for use of any one of claims 1-9, wherein the subject has been administered a NRTI for at ieast 2 months or at feast 6 months prior to the administration of the siRNA.

11. The siRNA for use of any one of daims 1-10, wherein the siRNA is for administration to the subject with administration of a NRTI during the same period of time that 15 the subject is administered the siRNA.

12. The siRNA for use of any one of daims 1-11, wherein the siRNA is for administration to the subject with subséquent administration of a NRTI.

13. Use of an siRNA in the manufacture of a médicament for the treatment of a chronic HBV infection, wherein the siRNA has a sense strand comprising 5'20553

102 gsusguGfcAfCfUfucgcuucacaL96 -3' (SEQ ID NO:5) and an antisense strand comprising 5'usGfsuga(Agn)gCfGfaaguGfcAfcacsusu -3' (SEQ ID NO:6), wherein a, c, g, and u are 2'-O-methyladenosIne-3'-phosphate, 2'-O-methylcytidine-3'phosphate, 2'-O-methyiguanosine-3'-phosphate, and 2'-O-methyluridine-3'-phosphate, respectively;

Af, Cf, Gf, and Uf are S'-fluoroadenosine-S'-phosphate, 2'-fluorocytidine-3'-phosphate, 2'fluoroguanosine-3’-phosphate, and 2'-fluorouridine-3'-phosphate, respectively;

(Agn) is adenosine-glycol nucleic acid (GNA);

s is a phosphorothioate linkage; and

L96 is N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol; and wherein the subject has been administered, is administered, or will be administered PEG-IFNa.

14. Use of an siRNA and PEG-IFNa in the manufacture of a médicament for the treatment of a chronic HBV infection, wherein the siRNA has a sense strand comprising 5'gsusguGfcAfCfUfucgcuucacaL96 -3’ (SEQ ID NO:5) and an antisense strand comprising 5'usGfsuga(Agn)gCfGfaaguGfcAfcacsusu -3' (SEQ ID NO:6), wherein a, c, g, and u are Z-O-methyladenosine-S'-phosphate, 2'-O-methylcytidine-3'phosphate, 2'-O-methylguanosine-3'-phosphate, and 2'-O-methyluridine-3'-phosphate, respectively;

Af, Cf, Gf, and Uf are 2'-fluorûadenosine-3'-phosphate, 2'-fluorocytidine-3'-phosphate, 2'fluoroguanosine-3'-phosphate, and 2'-fluorouridine-3'-phosphate, respectively;

(Agn) is adenosine-glycol nucleic acid (GNA);

s is a phosphorothioate linkage; and

L96 is N-[tris(GaiNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol.

15 (FTC), clevudîne, ritonavir, dipîvoxil, lobucavir, famvir, N-Acetyl-Cysteine (NAC), PC 1323, theradigm-HBV, thymosin-alpha, ganciciovir, besifovir (ANA-380/LB-80380), or tenofvirexaliades (TLX/CMX157).

28. The composition for use or use according to claim 27, wherein the NRTI is entecavir (ETV).

15. Use of an siRNA, PEG-IFNa, and an NRTI in the manufacture of a médicament for the treatment of a chronic HBV infection, wherein the siRNA has a sense strand comprising

103

15 subject with the PEG-IFNa before, concurrently with, or after administration of the siRNA to the subject.

16. The composition for use or use according to any one of daims 1-15, wherein the dose of the siRNA is 0.8 mg/kg, 1.7 mg/kg, 3.3 mg/kg, 6.7 mg/kg, or 15 mg/kg.

17. The composition for use or use according to any one of daims 1-16, wherein the dose of the siRNA is 20 mg, 50 mg, 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 400 mg, or 450 mg.

18. The composition for use or use according to any one of daims 1-17, wherein the siRNA is for administration weekly or in more than one dose with each dose separated by 2, 3, or 4 weeks.

19. The composition for use or use according to any one of daims 1-17, wherein the siRNA is for administration in two, three, four, five, six, or more doses of the siRNA with each dose separated by 1, 2, 3, or 4 weeks.

20 s is a phosphorothîoate linkage; and

L96 is N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyproiinol; and (b) a pharmaceutical composition comprising PEG-JFNa, and a pharmaceutically acceptable excipient.

35. The kit according to daim 34, further comprising (c) a NRTI, and a

20 29 The composition for use or use according to claim 27, wherein the NRTI is tenofovir.

105

30. The composition for use or use according to claim 27, wherein the NRTI is lamivudine.

31. The composition for use or use according to claim 27, wherein the NRTI is adefovir or adefovir dipivoxil.

5

32. The composition for use or use according to any one of daims 1 -31, wherein the subject is HBeAg négative.

33. The composition for use or use according to any one of daims 1-31, wherein the subject is HBeAg positive.

34. A kit comprising:

20. The composition for use or use according to any one of daims 1-19, wherein the siRNA is for administration in six 200-mg doses.

20 subject for a period of time before administration of the PEG-IFNa to the subject.

21. The composition for use or use according to any one of daims 1 -19, wherein the

104 siRNA is for administration in two 400-mg doses of the siRNA.

22. The composition for use or use according to any one of claims 1-21, wherein the siRNA is for administration via subcutaneous injection.

23. The composition for use or use according to claim 22, wherein the siRNA is for

24. The composition for use or use according to any one of claims 1 -23, wherein the dose of the PEG-IFNa is 50 pg, 100 pg, 150 pg, or 200 pg.

25. The composition for use or use according to any one of claims 1 -24, wherein the PEG-IFNa îs for weekly administration.

10

26. The composition for use or use according to any one of claims 1-25, wherein the

PEG-IFNa is for administration via subcutaneous injection.

27. The composition for use or use according to any one of claims 8-12 and 15-26, wherein the NRTI is tenofovir, tenofovir disoproxil fumarate (TDF), tenofovir alafenamide (TAF), lamivudine, adefovir, adefovir dipîvoxil, entecavir (ETV), telbivudine, AGX-1009, emtricitabine

25 pharmaceutically acceptable excipient.