OA19490A - RNAi agents for inhibiting expression of alpha-ENaC and methods of use. - Google Patents

RNAi agents for inhibiting expression of alpha-ENaC and methods of use. Download PDF

Info

Publication number
OA19490A
OA19490A OA1201900482 OA19490A OA 19490 A OA19490 A OA 19490A OA 1201900482 OA1201900482 OA 1201900482 OA 19490 A OA19490 A OA 19490A
Authority
OA
OAPI
Prior art keywords
rnai agent
alpha
nucléotides
enac
sense strand
Prior art date
Application number
OA1201900482
Inventor
Rui ZHU
Tao Pei
Zhen Li
Anthony Nicholas
Erik W. Bush
Original Assignee
Arrowhead Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Arrowhead Pharmaceuticals, Inc. filed Critical Arrowhead Pharmaceuticals, Inc.
Publication of OA19490A publication Critical patent/OA19490A/en

Links

Abstract

Described are RNAi agents, compositions that include RNAi agents, and methods for inhibition of an alpha-ENaC (SCNN1A) gene. The alphaENaC RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of an alpha-ENaC gene. Pharmaceutical compositions that include one or more alpha-ENaC RNAi agents, optionally with one or more additional therapeutics, are also described. Delivery of the described alpha-ENaC RNAi agents to epithelial cells, such as pulmonary epithelial cells, in vivo, provides for inhibition of alpha-ENaC gene expression and reduction in ENaC activity, which can provide a therapeutic benefit to subjects, including human subjects.

Description

ENaC is expressed on the apical membrane of épithélial cells, particularly in the lung. rénal distal convoluted tubule, gastrointestinal (GI) tract, reproductive tract, and ocular surface epithelium in the eye. In these epithelia, ENaC channeis médiate influx of extracellular sodium ions which are then actively transported from the cell by the basolateral sodium/potassium ATPase, establishing an osmotic gradient and causing épithélial luminal water to be absorbed into the interstitium. In the kidney, ENaC médiates electrolyte balance and blood pressure, and is the target of systemic small molécule diuretics such as amiloride. In the lung, airway épithélial ENaC plays a key rôle in the régulation of lung hydration and mucociliary clearance.
Type 1 pseudohypoaldosteronism (PHA) patients that carry loss-of-function mutations in SCNN1A, SCNN1B, or SCNN1G, produce excess airway surface liquid and hâve significantly higher mucociliary clearance rates. Conversely, airway épithélial ENaC activity is significantly eievated in cystic fîbrosis (CF) patients of ail génotypes. Enhanced ENaC activity, together with reduced cystic fîbrosis transmembrane conductance regulator (CFTR) chloride channel activity, is the primary pathogenic mechanism that underlies airway déhydration and mucociliary stasis in CF lung disease patients.
Inhaled small molécule ENaC inhibitors hâve shown initial promise in the treatment of CF, but their clinical development has been limited by short duration of action in the lung and on-target toxicity (hyperkalemia) associated with inhibition of rénal ENaC. (See, e.g., O’Riordan et al., 27 J. Aérosol Med. & Pulmonaiy Drug Dev., 200-208 (2014)).
Certain RNAi agents capable of inhibiting the expression of an alpha-ENaC gene (i.e., SCNN1A) hâve been previously identified, such as those disclosed in, for example, LJ.S. Patent No. 7,718,632. However, the sequences and modifications of the alpha-ENaC RNAi agents disclosed herein differ from those previously disclosed or known in the art. The alpha-ENaC RNAi agents disclosed herein provide for higbly potent and efficient inhibition of the expression of an alpha-ENaC gene.
SUMMARY
There exists aneed fornovel RNA interférence (RNAi) agents (termed RNAi agent, RNAi trigger, or trigger), e.g., double stranded RNAi agents, that are able to selectively and etiiciently inhibit the expression of the alpha-ENaC gene (i.e., SCNN1A). Further, there exists a need for compositions of novel aipha-ENaC-specific RNAi agents for the treatment of diseases associated with enhanced ENaC activity.
In general, the présent disclosure features alpha-ENaC gene-specific RNAi agents, compositions that include alpha-ENaC RNAi agents, and methods for inhibiting expression of an alpha-ENaC gene in vitro and/or in vivo using the alpha-ENaC RNAi agents and compositions that include alpha-ENaC RNAi agents described herein. The alpha-ENaC RNAi agents described herem are able to selectively and efïïciently decrease expression of an alpha-ENaC gene, and thereby reduce ENaC levels in a subject, reduce ENaC activity in a subject, or reduce both ENaC levels and ENaC activity in a subject, e.g., a human or animal subject.
The described alpha-ENaC RNAi agents can be used in methods for therapeutic treatment (including preventative or prophylactic treatment) of symptoms and diseases associated with enhanced or elevated ENaC activity levels, including, but not limited to varions respiratory diseases such as cystic fibrosis, chronic bronchitis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infections, primary ciliary dyskinesia, and lung carcinoma cystic fibrosis. For example, in subjects suffering from cystic fibrosis (CF), increased ENaC activity is known to contribute to drying mucus in the airway and a reduced ability of the lung to ciear toxins and infections agents. Further, it is also known that CF subjects that hâve inherited poorly functioning ENaC genes hâve shown milder lung disease, providing additional evidence that inhibition ENaC levels may be bénéficiai for certain patient populations. The described alpha-ENaC RNAi agents can also be used, for exaniple, for the therapeutic treatment (including prophylactic or preventative treatment) of symptoms and diseases associated with enhanced or elevated ENaC activity levels in the ocular surface epithelium, such as the conjunctival epithelium, including for the treatment of ocular diseases and disorders such as dry eye syndrome. The alpha-ENaC RNAi agents disclosed herem can selectively reduce alpha-ENaC expression, which can lead to a réduction in ENaC activity. The methods disclosed herein include the administration of one or more alpha-ENaC RNAi agents to a subject, e.g., a human or animai subject, by any suitable means known in the art, such as aérosol inhalation or dry powder inhalation, mtranasal administration, intratracheal administration, or oropharyngeal aspiration administration.
In one aspect, the disciosure features RNAi agents for inhibiting expression of an alphaENaC gene, wherein the RNAi agent includes a sense strand and an antisense strand. Also described herein are compositions that include or consist of an RNAi agent capable of inhibiting the expression of an alpha-ENaC gene, wherein the RNAi agent includes or consists of a sense strand and an antisense strand, and the composition further comprises at least one pharmaceutically acceptable excipient.
In another aspect, the disciosure features compositions that include one or more of the disclosed alpha-ENaC RNAi agents that are able to selectively and efficiently decrease expression of the alpha-ENaC gene. The compositions that include one or more alphaENaC RNAi agents described herein can be administered to a subject, such as a human or animal subject, for the treatment (including prophylactic treatment or inhibition) of symptoms and diseases associated with enhanced or elevated ENaC activity (also referred to herein as enhanced ENaC channel activity levels or elevated ENaC channel activity levels).
Each alpha-ENaC RNAi agent disclosed herein includes a sense strand and an antisense strand. The sense strand and the antisense strand can be partially, substantially, or fully complementary to each other. The length of the RNAi agent sense and antisense strands described herein each can be 16 to 30 nucléotides. In some embodiments, the sense and antisense strands are independently 17 to 26 nucléotides in length. The sense and antisense strands can be either the same length or different lengths. In some embodiments, the sense and antisense strands are independently 21 to 26 nucléotides in length. In some embodiments, the sense and antisense strands are independently 21 to 24 nucléotides in length. In some embodiments, both the sense strand and the antisense strand are 21 nucléotides in length. In some embodiments, the sense and/or antisense strands are independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucléotides in length. The RNAi agents described herein, upon delivery to a cell expressing alpha-ENaC, inhibit the expression of one or more alpha-ENaC genes in vivo or in vitro.
An alpha-ENaC RNAi agent described herein includes at least 16 consecutive nucléotides that hâve at least 85% identity to a core stretch sequence (also referred to herein as a “core stretch” or “core sequence”) of the saine number of nucléotides in an alpha-ENaC mRNA. in some embodiments, this sense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucléotides in length. In some embodiments, this sense strand core stretch is 17 nucléotides in length. In some embodiments, this sense strand core stretch is 19 nucléotides in length.
An antisense strand of an alpha-ENaC RNAi agent described herein includes at least 16 consecutive nucléotides that hâve at least 85% complementarity to a core stretch of the saine number of nucléotides in an alpha-ENaC mRNA and to the corresponding sense strand. In some embodiments, this antisense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucléotides in length.
In some embodiments, the alpha-ENaC RNAi agents disclosed herem target a portion of an alpha-ENaC gene having the sequence of any of the sequences disclosed in Table 1.
Examples of alpha-ENaC RNAi agent sense strands and antisense strands that can be used in an alpha-ENaC RNAi agent are provided in Tables 3 and 4. Examples of alpha-ENaC RNAi agent duplexes are provided in Table 5. Examples of 19-nucleotide core stretch sequences that may consist of or may be included in the sense strands and antisense strands of certain alpha-ENaC RNAi agents disclosed herein, are provided in Table 2.
In another aspect, the disclosure features methods for delivering alpha-ENaC RNAi agents to épithélial cells in a subject, such as a mammal, in vivo. Also described herein are compositions for use in such methods. In some embodiments, disclosed herein are methods for delivering alpha-ENaC RNAi agents to pulmonary épithélial cells in vivo to a subject. In some embodiments, disclosed herein are methods for delivering alpha-ElNaC RNAi agents to pulmonary épithélial cells of a human subject in vivo. The one or more alphaENaC RNAi agents can be delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. Nucleic acid delivery methods include, but are not limited to, by encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as hydrogels, cyclodextnns, biodégradable nanocapsules, and bioadhesive microspheres, proteinaceous vectors, or Dynamic Polyconjugates™ (DPCs) (see, for example WO 2000/053722, WO 2008/022309, WO 2011/104169, and WO 2012/083185, each of which is incorporated herein by reference).
In some embodiments, an alpha-ENaC RNAi agent is delivered to cells or tissues by covalently linking the RNAi agent to a targeting group. In some embodiments, the targeting group can include a cell receptor ligand, such as an integrin targeting ligand. Integrins are a family of transmembrane receptors that faciiitate cell-extracelluiar matrix (ECM) adhesion. In particuiar, integrin alpha-v-beta-6 (ανβό) is an epitheiial-specific integrin that is known to be a receptor for ECM proteins and the TGF-beta latency-associated peptide (LAP), and is expressed in varions cells and tissues. Integrin ανβό is known to be highly upregulated m injured pulmonary epithelium. In some embodiments, the alpha-ENaC RNAi agents described herein are linked to an integrin targeting ligand that has afiinity for integrin ανβό. As referred to herein, an “ανβό integrin targeting ligand” is a compound that has arimtty for integrin ανβό, which can be utilized as a ligand to faciiitate the targeting and delivery of an RNAi agent to which it is attached to the desired cells and/or tissues (i.e., to cells expressing integrin ανβό). In some embodiments, multiple ανβό integrin targeting ligands or clusters of ανβό integrin targeting ligands are linked to an alpha-ENaC RNAi agent. In some embodiments, the alpha-ENaC RNAi agent-ανβό integrin targeting ligand conjugales are selectively internalized by lung épithélial cells, either through receptormediated endocytosis or by other means.
Examples of targeting groups useful for delivering alpha-ENaC RNAi agents that include ανβό integrin targeting ligands are disclosed, for example, in International Patent Application Publication No. WO 2018/085415 and in. U S. Provisional Patent Application Nos. 62/580,398 and 62/646,739, the contents of each of which are incorporated by reference herein in its entirety.
A targeting group can be linked to the 3' or 5' end of a sense strand or an antisense strand of an alpha-ENaC RNAi agent. In some embodiments, a targeting group is linked to the 3' or 5' end of the sense strand. In some embodiments, a targeting group is linked to the 5' end of the sense strand. In some embodiments, a targeting group is linked intemally to a. nucléotide on the sense strand and/or the antisense strand of the RNAi agent. In some embodiments, a targeting group is linked to the RNAi agent via a linker.
A targeting group, with or without a linker, can be attached to the 5' or 3’ end of any of the sense and/or antisense strands disclosed in Tables 2, 3, and 4. A linker, with or without a targeting group, can be attached to the 5' or 3' end of any of the sense and/or antisense strands disclosed in Tables 2, 3, and 4.
In another aspect, the disclosure features compositions that include one or more alpha-ENaC RNAi agents that hâve the duplex structures disclosed in Table 5.
In some embodiments, described herein are compositions that include a combination or cocktail of at least two alpha-ENaC RNAi agents having different sequences. In some embodiments, the two or more alpha-ENaC RNAi agents are each separately and independently linked to targeting groups. In some embodiments, the two or more alphaENaC RNAi agents are each Hnked to targeting groups that include or consist of integrin targeting ligands. In some embodiments, the two or more alpha-ENaC RNAi agents are each linked to targeting groups that include or consist of ανβό integrin targeting ligands.
In another aspect, the disclosure features methods for inhibiting alpha-ENaC gene expression in a subject, the methods including administering to the subject an amount of an alpha-ENaC RNAi agent capable of inhibiting the expression of an alpha-ENaC gene, wherein the alpha-ENaC RNAi agent comprises a sense strand and an antisense strand. Also described herein are compositions for use in such methods.
In a further aspect, the disclosure features methods of treatment (including prophylactic or preventative treatment) of diseases or symptoms caused by enhanced or elevated ENaC activity, the methods comprising administering to a subject in need thereof an alpha-ENaC RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Table 2 or Table 3. Also described herein are compositions for use in such methods.
In some embodiments, the described alpha-ENaC RNAi agents are optionally combined with one or more additional (i.e., second, third, etc.) therapeutics. A second therapeutic can be another alpha-ENaC RNAi agent (e.g., an alpha-ENaC RNAi agent that targets a different sequence within the alpha-ENaC gene). An additional therapeutic can also be a small molécule drug, anübody, antibody fragment, and/or aptamer. The alpha-ENaC RNAi agents, with or without the one or more additional therapeutics, can be combined with one or more excipients to form pharmaceutical compositions.
In some embodiments, compositions for delivering an alpha-ENaC RNAi agent to an épithélial cell in vivo are described. In some embodiments, an alpha-ENaC RNAi agent is delivered without being conjugated to atargeting ligand or pharmacokinetic (PK) modulator (referred to as being “naked” or a “naked RNAi agent’'). In some embodiments, an alphaENaC RNAi agent is conjugated to a targeting group, a linking group, a PK modulator, and/or another non-nucleotide group. In some embodiments, an alpha-ENaC RNAi agent is conjugated to a targeting group wherein the targeting group includes an integrin targeting ligand. In some embodiment, the integrin targeting ligand is an ανβ6 integrin targeting ligand. In some embodiments, a targeting group mciudes one or more ανβό integrin targeting ligands.
In some embodiments, an alpha-ENaC RNAi agent is linked to one or more linking groups or other non-nucleotide groups or compounds, such as pharmacokinetic modulators. In some embodiments, an alpha-ENaC RNAi agent is conjugated to a polyethylene glycol (PEG) moiety, or to a hydrophobie group having 12 or more carbon atoms, such as a cholestérol or palmitoyl group. In some embodiments, an alpha-ENaC RNAi agent is Imked to one or more pharmacokinetic modulators selected from cholestérol or cholesteiyl dérivatives, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, or aralkynyl groups, each of which may be linear, branched, cyclic, and/or substituted or unsubstituted. In some embodiments, the location of attachment for these moieties is at the 5’ or 3’ end of the sense strand, at the 2’ position of the ribose ring of any given. nucléotide of the sense strand, and/or attached to the phosphate or phosphorothioate backbone at any position of the sense strand.
In some embodiments, one or more of the described alpha-ENaC RNAi agents are administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.
The use of alpha-ENaC RNAi agents provides methods for therapeutic (including prophylactic) treatmeni of diseases or disorders associated wilh enhanced or elevaied ENaC activity. The described alpha-ENaC RNAi agents are capable of inhibiting (e.g., inhibit) the expression of alpha-ENaC. Alpha-ENaC RNAi agents can also be used to treat various 5 respiratoiy diseases, including cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma. respiratory tract infections, primary ciliary dyskmesia, and lung carcinoma cystic fibrosis. Alpha-ENaC RNAi agents can further be used to treat, for example, varions ocular diseases and disorders, such as dry eye. Such methods of treatmeni include administration of an alpha-ENaC RNAi 10 agent to a human being or animal having elevaied or enhanced ENaC activity levels.
Described herein are compositions for delivery of alpha-ENaC RNAi agents to pulmonary épithélial cells. Furthermore, compositions for delivery of alpha-ENaC RNAi agents to cells, including rénal épithélial cells and/or épithélial cells in the G1 or reproductive tract and/or and ocular surface épithélial cells in the eye, in vivo, are generally described herein. 15
The pharmaceutical compositions including one or more alpha-ENaC RNAi agents can be administered in a number of ways depending upon whether local or systemic treatmeni is desired. Administration can be, but is not limited to, for exampie, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implanted device), and 20 intraparenchymal administration. In some embodimenis, the pharmaceutical compositions described herein are administered by inhalation (such as dry' powder or aérosol inhalation), intranasal administration, intratracheal administration, or oropharyngeal aspiration administration.
The described alpha-ENaC RNAi agents an d'or compositions that include alpha-ENaC RNAi agents can be used in methods for therapeutic treatmeni of disease or conditions caused by enhanced or elevated ENaC activity levels. Such methods include administration of an alpha-ENaC RNAi agent as described herein to a subject, e.g., a human or animal subject.
In another aspect, the disclosure provides methods for the treatment (including prophylactic treatmeni) of a pathological State (such as a condition or disease) mediated at least in part by alpha-ENaC expression, wherein the methods include admimstenng to a subject a therapeutically effective amount of an RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Table 2 or Table 3.
In some embodiments, methods for inhibiting expression of an alpha-ENaC gene are disclosed herein, wherein the methods include administering ίο a cell an RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Table 2 or Table 3.
In some embodiments, methods for the treatment (including prophylactic treatment) of a pathological State mediated at least in part by alpha-ENaC expression are disclosed herein, wherein the methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 2 or Table 4.
In some embodiments, methods for inhibiting expression of an alpha-ENaC gene are disclosed herein, wherein the methods comprise administering to a cell an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in 'fable 2 or Table 4.
In some embodiments, methods for the treatment (including prophylactic treatment) of a pathological State mediated at least in part by alpha-ENaC expression are disclosed herein, wherein die methods include administering to a subject a therapeutically effective amount of an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 4, and an antisense strand comprising the sequence of any of the sequences in Table 3.
In some embodiments, methods for inhibiting expression of an alpha-ENaC gene are disclosed herein, wherein the methods include administering to a cell an RNAi agent that includes a sense strand comprising the sequence of any of the sequences in Table 4, and an antisense strand comprising the sequence of any of the sequences in Table 3.
in some embodiments, methods of inhibiting expression of an alpha-ENaC gene are disclosed herein, wherein tire methods include administering to a subject an alpha-ENaC
RNAi agent that includes a sense strand consisting of the nucleobase sequence of any of the sequences in Table 4, and the antisense strand consisting of the nucleobase sequence of any of the sequences in Table 3, In other embodiments, disclosed herein are methods of inhibiting expression of an alpha-ENaC gene, wherein the methods mclude administering to a subject an alpha-ENaC RNAi agent that includes a sense strand consisting of the modified sequence of any of the modified sequences in Table 4, and the antisense strand consisting of the modified sequence of any of the modified sequences in Table 3.
In some embodiments, methods for inhibiting expression of an alpha-ENaC gene in a cell are disclosed herein, wherein the methods include administering one or more alpha-ENaC RN Ai agents having a duplex structure of one of the duplexes set forth in Table 5.
The alpha-ENaC RNAi agents disclosed herein are designed to target spécifie positions on an alpha-ENaC gene (SEQ ID NO:1). As defined herein, an antisense strand sequence is designed to target an alpha-ENaC gene at a given position on the gene when the 5' terminal nucleobase of the antisense strand is aligned with a position that is 19 nucléotides downstream (towards the 3' end) from the position on the gene when base pairing to the gene. For example, as illustrated in Tables 1 and 2 herein, an antisense strand sequence designed to target an alpha-ENaC gene at position 972 requîtes that when base pairing to the gene. the 5' terminal nucleobase of the antisense strand is aligned with position 990 of the alpha-ENaC gene.
As provided herein, an alpha-ENaC RNAi agent does not require that the nucleobase at position 1 (5' -> 3') of the antisense strand be complementary to the gene, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the gene across a core stretch sequence of at least 16 consecutive nucléotides. For example, for an alpha-ENaC RNAi agent disclosed herein that is designed to target position 972 of an alpha-ENaC gene, the 5' terminal nucleobase of the antisense strand of the of the alpha-ENaC RNAi agent must be aligned with position 990 of the gene; however, the 5' terminal nucleobase of the antisense strand may be, but is not required to be, complementary to position 990 of an alpha-ENaC gene, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the gene across a core stretch sequence of at least 16 consecutive nucléotides. As shown by, among oiher things, the varions examples disclosed herein, the spécifie site of binding of the gene by the antisense strand of the alpha-ENaC RNAi agent (e.g., whether the alpha-ENaC RNAi agent is designed to target an alpha-ENaC gene at position 972, at position 1291, al position 1000, or at some other position) is a important factor for the level of inhibition achieved by the alpha-ENaC RNAi agent.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises anucleoba.se sequence differing by 0 or 1 nudeobases from the nucléotide sequence (5' -> 3')
UAUUUGLiUCUGGGUGCACAGG (SEQ ID NO:3). in some embodiments, an alphaENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucléotide sequence differing by no more than 1 nucléotide from the nucléotide sequence (5' -» 3') UAUCUGUUCOGGIJDGCACAGG (SEQ ID NO:3), wherein ail or substantially ail of the nucléotides are modified nucléotides. In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucléotide sequence (5' -> 3') UAUUUGL!IJCUGGIJUGCACAGG (SEQ ID NO:3), wherein SEQ ID NO:3 is located at positions 1-21 (5' -> 3') of the antisense strand.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucléotide sequence differing by no more than 1 nucléotide from the nucleoti.de sequence (5' -> 3') usAfsusUfuGfiiUfcUfgGfuüfgCfaCfaGfsg (SEQ ID NO:2), wherein a, c, g, and u represent 2'-O-methyI adenosine, cytidine, guanosine, or uridme, respectivelv; Af. Cf, Gf. and Uf represent 2'-fluoro adenosine, cytidine, guanosine. or uridine, respectivelv; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to die antisense strand. As the person of ordinary skill m the art would clearly understand, lhe inclusion of a phosphorothioate linkage as shown in the modified nucléotide sequences disclosed herein replaces the phosphodiester linkage typically présent in oligonucleotides (see, e.g., Figs. 12A through 12G showmg ail intemucleoside linkages).
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essenliaJly of, or comprises the nucléotide sequence (5' 3') usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO:2), wherein a, c, g, and ti represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s représente a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary to the antisense strand.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes a sense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases front the nucieotide sequence (5' -> 3')
CCUGUGCAACCAGAACAAAUA (SEQ ID NO:5). In some embodiments, an alphaENaC RNAi agent disclosed herein includes a sense strand that consists of, consists essentially of, or comprises a nucieotide sequence differing by no more than 1 nucieotide from the nucieotide sequence (5' -> 3') CCUGUGCAACCAGAACAAAUA (SEQ ID NO:5), wherein ail or substantially ail of the nucléotides are rnodified nucléotides. In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucieotide sequence (5' 3') CCUGUGCAACCAGAACAAAUA (SEQ ID NO:5), wherein SEQ ID NO:5 is located at. positions 1 -21 (5' 3') of the antisense strand.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes a sense strand that consists of, consists essentially of, or comprises a rnodified nucieotide sequence differing by no more than 1 nucieotide from the nucieotide sequence (5’ “> 3') cscugugcaAfCfCfagaacaaaua (SEQ ID NO:4), wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the antisense strand is at least substantially complementary to the sense strand. In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes a sense strand that consists of, consists essentially of, or comprises the rnodified nucieotide sequence (5' Ό· 3') cscugugcaAfCfCfagaacaaaua (SEQ ID NO:4), wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively, and s represents aphosphorothioate iinkage, and wherein the antisense strand is at least substantially compiementary to the sense strand. In some embodiments, one or more inverted abasic residues are added to the 5’ end of the sense strand, to the 3’ end of the sense strand, or to both the 5’ and the 3’ end of the sense strand of SEQ ID NO:4. In some embodiments, a targeting ligand, such as an ανβ6 integrin targeting ligand, may be covalently linked to the 5’ end of the sense strand, to the 3’ end of the sense strand, or to both the 5’ and the 3’ end of the sense strand of SEQ ID NO:4.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucléotide sequence (5' 3')
UAUUUGUUCUGGUUGCACAGG (SEQ ID NO:3) and a sense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucléotide sequence (5’ -> 3') CCUGUGCAACCAGAACAAAUA (SEQ ID NO:5). In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucléotide sequence differing by no more than 1 nucléotide from the nucléotide sequence (5' 3')
UAUUUGUUCUGGUUGCACAGG (SEQ ID NO:3), wherein ail or substantially ail of the nucléotides are modifîed nucléotides, and a sense strand that consists of, consists essentially of, or comprises a nucléotide sequence differing by no more than 1 nucléotide from the nucléotide sequence (5' 3') CCUGUGCAACCAGAACAAAUA (SEQ ID NO:5), wherein ail or substantially ail of the nucléotides are modifîed nucléotides.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modifîed nucléotide sequence (5' > 3') usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO:2), and a sense strand that consists of, consists essentially of, or comprises the modifîed nucléotide sequence (5' -> 3') cscugugcaAfCfCfagaacaaaua (SEQ ID NO:4), wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorotlnoate Iinkage. In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modifiée! nucléotide sequence (5' -> 3') usAfsusUfuGfuUfcüfgGfuüfgCfaCfaGfsg (SEQID NO:2), and a sense strand that consists of, consists essentially of, or comprises the modified nucieotide sequence (5' -> 3') cscugugcaAfCfCfagaacaaaua (SEQ ID NO:4), and wherein the sense strand further comprises an inverted abasic residue at the 3’ termina] end and an ανβ6 integrin targeting ligand covalently linkedto the 5’ terminal end.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence that differs by 0 or l nucleobases from the nucieotide sequence (5' -> 3') UAL'UUGL'UCLTGGUUGCACxAGC (SEQ ID NO:7). In some embodiments, an alphaENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucieotide sequence differing by no more than I nucieotide from the nucieotide sequence (5' -> 3 ) UALiUUGIJUCUGGDLïGCACAGC (SEQ ID NO:7), wherein ail or substanüally ail of the nucléotides are modified nucléotides. In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucieotide sequence (5' -> 3') UAUUUGCUCUGGLÎUGCACAGC (SEQ ID NO:7), wherein SEQ ID NO:7 is located at positions 1-21 (5' -> 3') of the antisense strand.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucieotide sequence differing by no more than 1 nucieotide from the modified nucieotide sequence (5' -> 3') usAfsusLïfuGfuüfcUfgGfuüfgCfaCfaGfsc (SEQ ID NO:6), wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage, and wherein the sense strand is at least substantially complementary’ to the antisense strand.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes a sense strand that consists of, consists essentially of, or comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucieotide sequence (5' -> 3')
GCUGUGCAACCAGAACAAAUA (SEQ ID NO:9). in some embodiments, an alphaENaC RNAi agent disclosed herein includes a sense strand thaï consists of, consiste essentially of, or comprises a nucléotide sequence differing by no more than 1 nucléotide from the nucléotide sequence (5' -> 3') GCUGUGCAACCAGAACAAAUA (SEQ ID 5 N0:9), wherein ail or substantially ail of the nucléotides are modified nucléotides. In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucieobase sequence differing by 0 or 1 nucleobases from the nucléotide sequence (5' -> 3’) GCUGUGCAACCAGAACAAAUA (SEQ ID NO:9), wherein SEQ ID N0:9 is localed at positions 1-21 (5' -> 3') of the antisense 10 strand.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes a sense strand that consists of, consists essentially of, or comprises a modified nucléotide sequence that differs by no more than 1 nucléotide from the nucléotide sequence (5' -> 3’) 15 gscugugcaAfCfCfagaacaaaua (SEQ ID NO:8), wherein a, c, g, and u represent 2'-O-methyl adenosine. cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2 fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a. phosphorothioate linkage, and wherein the antisense strand is at least substantially complementary to the sense strand. In some embodiments, one or more inverted abasic 20 residues may be added to the 5' end of the sense strand, to the 3' end of the sense strand, or to both the 5’ and the 3’ end of the sense strand of SEQ ID NO:8. In some embodiments, a targeting ligand, such as an ανβ6 integrin targeting ligand, may be covalently Imked to the 5’ end of the sense strand, to the 3' end of the sense strand, or to both the 5 and the 3 end of the sense strand of SEQ ID NO:8.
In some embodiments, an alpha-ENaC RN Ai agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucieobase sequence differing by 0 or 1 nucleobases from the nucléotide sequence (5' 3')
UAUUUGUUCUGGUUGCACAGC (SEQ ID NO:7) and a sense strand that consists of, 30 consists essentially of, or comprises a nucieobase sequence differing by 0 or 1 nucleobases from the nucléotide sequence (5' 3') GCUGUGCAACCAGAACAAAUA (SEQ ID
NO:9). In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists ot, consists essentially ot, or comprises a nucléotide sequence differing by no more than 1 nucléotide from the nucléotide sequence (5' -> 3') UAUUUGUUCUGGUUGCACAGC (SEQID NO:7), wherein ail or substanlially ail of the nucléotides are modified nucléotides, and a sense strand that consists of, consiste essentially of, or comprises a nucléotide sequence differing by no more than 1 nucléotide from the nucléotide sequence (5' -> 3') GCUGUGCAACCAGAACAAAUA (SEQ ID NO:9), wherein ail or substanlially ail of the nucléotides are modified nucléotides.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucléotide sequence differing by no more than 1 nucléotide from the nucléotide sequence (5' -> 3') usAfsusUfuGfiiUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO:6), and a sense strand that consists of, consists essentially of, or comprises a modified nucléotide sequence differing by no more than 1 nucléotide from the nucléotide sequence (5' -> 3') gscugugcaAfCfCfagaacaaaua (SEQ ID NO: 8), wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage. In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucléotide sequence (5' -> 3') usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO:6), and a sense strand that consists of, consists essentially of, or comprises the modified nucléotide sequence (5' -> 3') gscugugcaAfCfCfagaacaaaua (SEQ ID N 0:8), and wherein the sense strand further comprises an inverted abasic residue at the 3' terminal end and an ανβ6 integrin targeting ligand covalently linked to the 5’ terminal end.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucléotide sequence differing by no more than. 1 nucléotide from the nucléotide sequence (5' -> 3') cPrpusAfsusUfuGfuUfcUfgGfuüfgCfaCfaGfsg (SEQ ID NO:10), wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage, cPrpu represents a 5’-cyclopropyl phosphonate-2'O-methyl uridine (see Table 6), and wherein the sense strand is at least substantially complementary to the antisense strand.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand thaï consists of, consists essentially of, or comprises a modified nucléotide sequence differing by no more than 1 nucléotide from the nucléotide sequence (5' -> 3') cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10), and a sense strand that consists of, consists essentially of, or comprises a modified nucléotide sequence differing by no more than 1 nucléotide from the nucléotide sequence (5' Ά 3') cscugugcaAfCfCfagaacaaaua (SEQ ID NO:4), wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage, and cPrpu represents a 5’-cyclopropyl phosphonate-2;-O-methyl uridine (see Table 6). In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises the modified nucléotide sequence (5' A 3') cPrpusAfsusUfuGfuLifcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10), and a sense strand that consists of, consists essentially of, or comprises the modified nucléotide sequence (5' -> 3') cscugugcaAfCfCfagaacaaaua (SEQ ID NO:4), and wherein the sense strand further comprises an inverted abasic residue at the 3’ terminal end and an ανβ6 integrin targeting ligand covalently linked to the 5’ terminal end.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucléotide sequence that differs by 0 or 1 nucléotides from one of the following nucléotide sequences (5' 3'):
UAUUUGUUCUGGUUGCACAGG (SEQ ID NO:3); UAUUUGUUCUGGUUGCACAGC (SEQ IDN0:7); UGADUUGDUCUGGUUGCACAG (SEQ ID NO:230); or AGAAGUCAUUCUGCUCUGCUU (SEQ ID NO:254);
wherein the alpha-ENaC RNAi agent further includes a sense strand that is at least parti ally complementary to the antisense strand; and wherein the ail or substantially ail of the nucléotides on both the antisense strand and the sense strand are modified nucléotides.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a nucléotide sequence that differs by 0 or I nucléotides from one of the following nucléotide sequences (5' -> 3'):
UAUUUGUUCUGGUUGCACAGG (SEQ ID NO:3); UAUUUGUUCUGGUUGCACAGC (SEQ ID NO:7); UGAUUUGUUCUGGUUGCACAG (SEQ ID NO 23i A or AGAAGUCAUUCUGCUCUGCUU (SEQ ID NO:254);
wherein the alpha-ENaC RNAi agent further includes a sense strandthat is at least partially complementaxy to the antisense strand; wherein the ail or substantially ail of the nucléotides on both the antisense strand and the sense strand are modified nucléotides; wherein the sense strand includes an inverted abasic residue at the 3’ terminai end; and wherein an ανβό integrin targeting ligand is Imked to at the 5’ terminal end of the sense strand.
lii some embodiments, an alpha-ENaC RNAi agent disclosed herem includes an antisense strand that consists of, consists essentially of, or comprises a nucléotide sequence that differs by 0 or 1 nucléotides from one of the following nucléotide sequences (5' -> 3'):
UAUUUGUUCUGGUUGCACAGG (SEQ ID NO:3);
UAUUUGUUCUGGUUGCACAGC (SEQ IDNO:7);
UGAUUUGUUCUGGUUGCACAG (SEQ ID NO:230); or AGAAGUCAUUCUGCUCUGCUU (SEQ ID NO:254);
wherein the alpha-ENaC RNAi agent further includes a sense strand that is at least partially complementaiy to the antisense strand; wherein the ali or substantially ail of the nucléotides 20 on both the antisense strand and the sense strand are modified nucléotides; wherein the sense strand includes an inverted abasic residue at the 3 terminal end; wherein an ανβό integrin targeting ligand is linked to ai the 5’ terminal end of the sense strand; and wherein the respective antisense strand sequence is located at positions 1-21 of the antisense strand.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand and a sense strand, wherein the antisense strand and the sense strand consist of, consist essentially of, or comprise nucléotide sequences that differ by 0 or 1 nucléotides from one of the following nucléotide sequence (5' -> 3') pairs:
UAUUUGUUCUGGUUGCACAGG (SEQ ID NO:3) and
CCUGUGCAACCAGAACAAAUA (SEQ ID NO:5);
UAUUUGUUCUGGUUGCACAGC (SEQ ID NO: 7) and
GCUGUGCAACCAGAACAAÂUA (SEQ ID NO:9);
UGAUUUGUUCUGGUUGCACAG (SEQ ID NO:230) and
CUGUGCAACCAGAACAAAUCA (SEQ ID NO:259); or
AGAAGUCAUUCUGCUCUGCUU (SEQ ID NO:254) and
GCAGAGCAGAAUGACUUCUUU (SEQ ID NO:289);
wherein ail or substantially ail of the nucléotides on both the antisense strand and the sense strand are modified nucléotides.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand and a sense strand, wherein the antisense strand and the sense strand consist. of.
consist essentially of, or comprise nucléotide sequences that differ by 0 or 1 nucléotides
from one of the following nucléotide sequences (5' 3') pairs UAUUUGUUCUGGUUGCACAGG (SEQ ID NO: 3) and
CCUGUGCAACCAGAACAAAUA (SEQ ID NO:5);
UAUUUGUUC UGGUUGCACAGC (SEQ GCUGUGCAACCAGAACAAAUA (SEQ ID NO:9); ID NO:7) and
UGAUUUGUUCUGGUUGCACAG (SEQ CUGUGCAACCAGAACAAAUCA (SEQ ID NO:259); or ID NO:230) and
AGAAGUCAUUCUGCUCUGCUU (SEQ GCAGAGCAGAAUGACUUCUUL’ (SEQ ID NO:289); ID NO:254) and
wherein ail or substantially ail of the nucléotides on both the antisense strand and the sense strand are modified nucléotides; wherein tire sense strand includes an inverted abasic residue at the 3’ terminal end; and wherein an ανβ6 integrin targeting ligand is linked to at the 5' terminal end of the sense strand.
In some embodiments, an alpha-ENaC RNAi agent disclosed herem includes an antisense strand that consists of, consists essentially of, or comprises a modified nucléotide sequence that differs by 0 or 1 nucléotides from one of the following nucléotide sequences (5' -> 3'): usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO:2);
usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO:6); cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10), usGfsasUfuUfgUfuCfuGfgUfuGfcAfcAfsg (SEQ ID NO: 107); or asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu (SEQ ID NO: 152);
wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosme, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage, cPrpu represents a 5’cyclopropyl phosphonate-2'-O-methyl uridine (see Table 6); wherein the alpha-ENaC RNAi agent further includes the sense strand that is at least partially complemenlary to the antisense strand; and wherein the ail or substantially ail of the nucléotides on the sense strand are modified nucléotides.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that consists of, consists essentially of, or comprises a modified nucléotide sequence that differs by 0 or 1 nucléotides from one of the following nucléotide sequences (5' 3'):
usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO:2); usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO:6);
cPrpusAfsusGfuGfuUfcCfgGfuLJfgCfaCfaGfsg (SEQ ID NO: 10), usGfsasUfuüfgUfuCfuGfgUfuGfcAfcAfsg (SEQ ID NO: 107); or asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu (SEQ ID NO: 152);
wherein the alpha-ENaC RNAi agent further includes the sense strand that is at least partially complementary to the antisense strand; wherein the ail or substantially ail of the nucléotides on the sense strand are modified nucléotides; wherein the sense strand includes an inverted abasic residue at the 3’ terminal end; and wherein an ανβ6 integrin targeting ligand is hnked to at the 5 ‘ terminal end of the sense strand.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand and a sense strand that consists of, consists essentially of, or comprise modified nucléotide sequences that differs by 0 or 1 nucléotides from one of the following nucléotide sequence pairs (5' -> 3'):
usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO:2) and cscugugcaAfCfCfagaacaaaua (SEQ ID NO:4);
usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO:6) and gscugugcaAfCfCfagaacaaaua (SEQ ID NO:8);
cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10) and cscugugcaAfCfCfagaacaaaua (SEQ ID NO:4);
usGfsasUfuUfgUfuCfuGfgüfuGfcAfcAfsg (SEQ ID NO: 107) and csugugcaaCfCfAfgaacaaaucas (SEQ ID NO:293); or asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu (SEQ ID NO:152) and gscagagCfAfGfaaugacuucuuu (SEQ ID NO :294):
wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine. guanosine, or uridine, 5 respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s représente a phosphorothioate linkage, and cPrpu représente a 5’cyclopropyl phosphonate-2'-O-methyl uridine (see Table 6).
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense 10 strand and a sense strand that consiste of, consists essentiaily of, or comprises one of the following nucléotide sequence pairs (5' -> 3'):
usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO:2) and cscugugcaAfCfCfagaacaaaua (SEQ ID NO:4);
usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO:6) and gscugugcaAfCfCfagaacaaaua (SEQ ID NO:8);
cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10) and cscugugcaAfCfCfagaacaaaua (SEQ ID NO:4);
usGfsasUfuLTgïJfuCfuGfgUfuGfcAfcAfsg (SEQ ID NO: 107) and csugugcaaCfCfAfgaacaaaucas (SEQ ID NO:293); or asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu (SEQ ID NO: 152) and gscagagCfAfGfaaugacuucuuu (SEQ ID NO:294);
wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s représente a phosphorothioate linkage, and cPrpu represents a 5’25 cyclopropyl phosphonate-2'-O-methyl uridine (see Table 6); wherein the sense strand includes an inverted abasic residue at the 3’ terminal end; and wherein an ανβ6 integrin targeting ligand is linked to at the 5’ terminal end of the sense strand.
In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense 30 strand comprises a nucleobase sequence that di fiers by 0 or 1 nucleobases from the nucléotide sequence (5' -> 3') UAUUUGUUCUGGUUGCACA (SEQ ID NO:21). In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that comprises a nucléotide sequence differing by no more than 1 nucléotide from the nucléotide sequence (5' -» 3') UAUUUGUUCUGGUUGCACA (SEQ ID NO:21), wherein ail or substantially ali of the nucléotides are modified nucléotides. In some embodiments, an alpha-ENaC RNAi agent disclosed herein includes an antisense strand that comprises a nucleobase sequence differing by 0 or 1 nucleobases from the nucléotide sequence (5' -> 3') 5 UAUUUGUUCUGGUUGCACA (SEQ ID N0:21), wherein SEQ ID N0:21 is located at positions 1-19 (5' -> 3') of the antisense strand.
As used herein, the terms “oligonucleotide” and “poiynucléotide” mean a polymer of linked nucleosides each of which can be independently modified or unmodrfied.
As used herein, an “RNAi agent” (also referred to as an “RNAi trigger”) means a composition that contains an RNA or RNA-like (e.g., cheinicaliy modified RNA) oligonucleotide molécule that is capable of degrading or inhibiting (e.g., dégradés or mbibits under appropriate conditions) translation of messenger RNA (mRNA) transcripts of a target 15 mRNA in a sequence spécifie manner. As used herein, RNAi agents may operate through the RNA interférence mechanism (i.e., inducing RNA interférence through interaction with the RNA interférence pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells), or by any alternative mechanism(s) or pathway(s). While it is believed that RNAi agents, as that term is used herein, operate primarily through the RNA 20 interférence mechanism, the disclosed RNAi agents are not bound by or lirnited to any particular pathway or mechanism of action. RNAi agents disclosed herein are comprised of a sense strand and an antisense strand, and include, but are not limited to: short interfering RNAs (siRNAs), double stranded RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), and dicer substrates. The antisense strand of the RNAi agents described 25 herein is at least partially complementary to the mRNA being targeted (i.e. alpha-ENaC mRNA). RNAi agents can include one or more modified nucléotides andOr one or more non-phosphodiester linkages.
As used herein, the terms “silence,” “reduce,” “inhibit,” “down-regulate,” or “knockdown” 30 when referring to expression of a given gene, mean that. the expression of the gene, as measured by the level of RNA transcribed fromthe gene or the level of polypeptide, protein, or protein subunit translated from the mRNA in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, is reduced when the cell, group of cells, tissue, organ, or subject is treated with the RNAi agents described herein as compared to a second celh group of cells, tissue, organ, or subject that has not or hâve not been so treated.
As used herein, the terms “sequence” and “nucieotide sequence” mean a succession or order of nucleobases or nucléotides, described with a succession of Setters using standard nomenclature.
As used herein, a “base,” “nucieotide base,” or “nucleobase,” is a heterocyclic pyrimidine or purine compound that is a comportent of a. nucieotide, and includes the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. A nucleobase may further be rnodified to include, without limitation, universal bases, hydrophobie bases, promiscuous bases, size-expanded bases, and fluorinated bases. (See, e.g., Modifïed Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such rnodified nucleobases (including phosphoramidite compounds that include rnodified nucleobases) is known in the ail.
As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleobase or nucieotide sequence (e.g., RNAi agent sense strand or targeted mRNA) in relation to a second nucleobase or nucieotide sequence (e.g., RNAi agent antisense strand or a single-stranded antisense oligonucleotide), means the ability of an oligonucleotide or polynucleotide including the first nucieotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or similar conditions in vitro)) and form a duplex or double belical structure under certain standard conditions with an oligonucleotide or polynucleotide including the second nucieotide sequence. Complementary' sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or rnodified nucléotides or nucieotide mimics, at least to the extent that the above hybridization requirements are fulfilled. Sequence identity or complementarity is independent of modification. For example, a and Af, as defmed herein, are complementary to U (or T) and identical to A for the purposes of determining identity or complementarity.
As used herein, “perfectly complementary” or “fully complementary'” means that in a hybridized pair of nucleobase or nucieotide sequence molécules, ail (100%) of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the saine number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise ail or a part of a first or second nucléotide sequence.
As used herein, “partially complementary” means that in ahybridized pair of nucieobase or nucléotide sequence molécules, at least 70%, but nol ail, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise ail or a part of a first or second nucléotide sequence.
As used herein, “substantially complementary” means that in a hybridized pair of nucieobase or nucléotide sequence molécules, at least 85%, but not ail, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise ail or a part of a first or second nucléotide sequence.
As used herein, the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” are used with respect to the nucieobase or nucléotide matching between the sense strand and the antisense strand of an RNAi agent, or between the antisense strand of an RNAi agent and a sequence of an alphaENaC mRNA.
As used herein, the terms “substantially identical” or “substantiel identily,” as applied to a nucleic acid sequence means that a nucléotide sequence (or a portion of a nucléotide sequence) has at least about 85% sequence identily or more, e.g., at least 90%, at least 95%, or at least 99% identily, compared to a référencé sequence. Percentage of sequence identity is determmed by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which the same type of nucleic acid base occurs in both sequences to yield the number of matched positions, di viding the number of matched positions by the total number of positions in the window of comparison and multiplying the resuit by 100 to yield the percentage of sequence identity-. The inventions disclosed herein encompass nucléotide sequences substantially identical to those disclosed herein.
As used herein, the terms “treat,” “treatment,” and the like, mean the methods or steps taken to provide relief from or alleviation of the number, severity, and/or frequency of one or more symptoms of a disease in a subject. As used herein, “treat” and “treatment’ may include 5 preventative treatment, management, prophylactic treatment, and/or inhibition or réduction of the number, severity, and/or frequency of one or more symptoms of adisease in asubject.
As used herein, the phrase “introducing into a cell,” when referring to an RNAi agent, means functionally delivering the RNAi agent into a cell. The phrase “functional delivery,” means 10 delivering the RN Ai agent to the cell in a manner that enables the RNAi agent to hâve the expected biological activity, e.g., sequence-specific inhibition of gene expression.
-¾
Unless stated otherwise, use of the symbol as used herein means that any group or groups may be hnked thereto that is in accordance with the scope of the inventions described 15 herein.
As used herein, the term “isomers” refèrs to compounds that hâve identical molecular formulae, but that differ in the nature or the sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms 20 in space are termed “stereoisomers.” Stereoisomers that are not mirror images of one another are termed “diastereoisomers,” and stereoisomers that are non-superimposable mirror images are termed “enantiomers,” or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is termed a “chiral center.”
As used herein, unless specifically identified in a structure as having a particular confonnation, for each structure in which asymmetric centers are présent and thus give nse to enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent ail such possible isomers, including their optically pure and racemic forms. For example, the structures disclosed herein are intended to cover 30 mixtures of diastereomers as well as single stereoisomers.
As used in a claim herein, the phrase “consi sting of’ excludes any element, step, or ingrédient not specified in the claim. When used in a claim herein, the phrase “consisting essentially of” limits the scope of a claim to the specifîed materials or steps and those that do not materially affect the basic and novel characteristic(s) of the ciaimed invention.
The person of ordinary skill in the art would readily understand and appreciate that the compounds and compositions disclosed herein may hâve certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated State, dependmg upon the environment in which the compound or composition is placed. Accordingly, as used herein, the structures disclosed herein envisage that certain functional groups, such as, for example, OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to cover the disclosed compounds and compositions regardless of their State of protonation based on the environment (such as pH), as would be readily understood by the person of ordinary skill in the art.
As used herein, the term “linked” or “conjugated” when referring io the connection between two compounds or molécules means that two compounds or molécules are joined by a covalent bond. Unless stated, the terms “linked” and “conjugated” as used herein may refer to the connection between a first compound and a second compound either with or without any intervening atoms or groups of atoms.
As used herein, the term “including” is used to herein mean, and is used interchangeably with, the phrase “including but not limited to.” The term “or” is used herein to mean, and is used interchangeably with, the term “and/or,” unless the context clearly indicates otherwise.
Unless otherwise defined, ail technical and scientific terms used herein hâve the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or équivalent to ihose described herein can be used in the practice or testing of the présent invention, suitable methods and materials are described below. Ail publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the présent spécification, including définitions, will control. In addition, the materials, methods, and examples are illustrative only and not mtended to be iimiting.
Other objects, features, aspects, and advantages of the invention will be apparent from the following detailed description, accompanying figures, and from the daims.
Brief Description of the Drawings
FIG. 1. Histogram showing relative expression of mouse whole lung alpha-ENaC expression after administration of varions alpha-ENaC RNAi agents compared to vehicle control.
FIG. 2. Histogram showing relative expression of mouse whole lung alpha-ENaC expression after administration of alpha-ENaC RNAi agents AD04025 and AD04858 compared to vehicle control.
FIG. 3. Graph showing relative expression of rat whole lung alpha-ENaC expression of alpha-ENaC RNAi agents AD04025 and AD04025-conjugate (i.e., AD04025 conjugated to a peptide-based ανβ6 épithélial cell targeting ligand).
FIG. 4. Chemical structure représentation of the tridentate ανβ6 épithélial cell targeting ligand referred to herein as Tri-SM2.
FIG. 5. Chemical structure représentation of the tridentate ανβ6 épithélial cell targeting ligand referred to herein as Tri-SMl.
FIG. 6. Chemical structure représentation of the tridentate ανβ6 épithélial cell targeting ligand referred to herein as Tri-SM6.1.
FIG. 7. Chemical structure représentation of the tridentate ανβ6 épithélial cell targeting ligand referred to herein as Tri-SM9.
FIG. 8. Chemical structure représentation of the tridentate ανβ6 épithélial cell targeting ligand referred to herein as Tri-SM6.
FIG. 9. Chemical structure représentation of the tridentate ανβ6 épithélial cell targeting ligand referred to herein as Tri-SM8.
FIG. 10. Chemical structure représentation of the tridentate ανβ6 épithélial cell targeting ligand referred to herein as Tri-SMIO.
FIG. 11. Chemical structure représentation of the tridentate ανβό épithélial cell targeting ligand referred to herein as Tri-SMl 1.
FIG. Î2A. Schematic diagram of the modified sense and antisense strands of alpha-ENaC RNAi agent AD05453 (see Tables 3-5), shown with an amino group on the 5’ terminal end of the sense strand for facilitating the linkage to targeting ligands.
The following abbrevialions are used in Figures 12A to 12G. a, c, g, and u are 2'-Omethyl modified nucléotides; Af, Cf, Gf, and Uf are 2'-fluoro modified nucléotides; p is a phosphodiester linkage; s is a phosphorothioate linkage; invAb is an inverted abasic residue; cPrp is a 5’ terminal cyclopropyl phosphonate group (see Table 6); NH2-C6 is a Ce amino group (.see Table 6); and TriAlkl4 is a tri-alkyne linker having the structure depicted herein (see Table 6).
FIG. 12B. Schematic diagram of the modified sense and antisense strands of alpha-ENaC RNAi agent AD05924 (see Tables 3-5), shown functionalized with a tri-alkyne group on the 5’ terminal end of the sense strand for facilitating the linkage to targeting ligands. As described herein, AD05453 and AD05924 hâve the same modified nucléotide sequences, and represent alternative approaches to synthesizing an alpha ENaC-RNAi agent conjugale disclosed herein.
FIG. 12C. Schematic diagram of the modified sense and antisense strands of alpha-ENaC RNAi agent AD05625 (see Tables 3-5), shown functionalized with an amino group on the 5’ terminal end of the sense strand for facilitating the linkage to targeting ligands.
FIG. 12D. Schematic diagram of the modified sense and antisense strands of alpha-ENaC RNAi agent AD05347 (see Tables 3-5), shown functionalized with an amino group on the 5? terminal end of the sense strand for facilitating the linkage to targeting ligands.
FIG. 12E. Schematic diagram of the modified sense and antisense strands of alpha-ENaC RNAi agent AD05831 (see Tables 3-5), shown functionalized with an amino group on the 5’ terminal end of the sense strand for facilitating the linkage to targeting ligands.
FIG. 12F. Schematic diagram of the modified sense and antisense strands of alpha-ENaC RNAi agent AD05833 (see Tables 3-5), shown functionalized with an amino group on the 5’ terminal end of the sense strand for facilitating the linkage to targeting ligands.
FIG. 12G. Schematic diagram of the modified sense and antisense strands of both alphaENaC RNAi agent AD05453 and alpha-ENaC RNAi agent AD05924 (see Tables 35), wherein X represents a tridentate ανβό integrin targeting ligand (including any linkers).
FIG. 12H. Schematic diagram of an example tridentate ανβό integrin targeting ligandRNAi agent conjugale described herein, wherein a tridentate ανβό integrin targeting ligand is conjugated to tire 5’ terminal end of the sense strand. As shown therein, each ανβό represents an ανβό integrin targeting compound.
FIG. 13A to 13D. Chemical structure représentation of alpha-ENaC RNAi agent AD05453, including an NH2-C6 terminal amino group, shown as a sodium sait.
FIG. 14A to 14D. Chemical structure représentation of alpha-ENaC RNAi agent AD05924, including a tri-alkyne functionalized linker group (TriAlkl4), shown as a sodium sait.
FIG. 15A to 15E. Chemical structure représentation of alpha-ENaC RNAi agent AD05453, shown conjugated to Tri-SM6.1, as a sodium sait. As discussed herein, the sanie Chemical structure can be synthesized using a tri-alkyne functionalized linker group (TriAlkl4), which can be added through phosphoramidite synthesis, as set forth in the modified sense strand nucléotide sequence for alpha-ENaC RNAi agent AD05924 (Le., AM07807-SS in Table 4).
FIG. 16A to 16D. Chemical structure représentation of alpha-ENaC RNAi agent z\D05453, including a NH2-C6 terminal functionalized amino group, shown as a free acid.
Detailed Description
RNAi Agents
Described herein are RNAi agents for inhibiting expression of the alpha-ENaC (i.e., SCNN1A) gene (refened to herein as alpha-ENaC RNAi agents or alpha-ENaC RNAi triggers). Each alpha-ENaC RNAi agent comprises a sense strand and an antisense strand. The sense strand and the antisense strand each can be 16 to 30 nucléotides in length. In some embodiments, the sense and antisense strands each can be 17 to 26 nucléotides in length. The sense and antisense strands can be either the same length or they can be different lenglhs. In some embodiments, the sense and antisense strands are each independently 17 to 26 nucléotides in length. In some embodiments, the sense and antisense strands are each independently 17-21 nucléotides in length. In some embodiments. both the sense and antisense strands are each 21-26 nucléotides in length. In some embodiments, the sense and antisense strands are each 21-24 nucléotides in length. In some embodiments, the sense strand is about 19 nucléotides in length while the antisense strand is about 21 nucléotides in length. In some embodiments, the sense strand is about 21 nucléotides in length while the antisense strand is about 23 nucléotides in length. In some embodiments, both the sense and antisense strands are each 21 nucléotides in length. In some embodiments, the RNAi agent sense and antisense strands are each independently 16, 17, 18, 19, 20, 21,22, 23, 24, 25, or 26 nucléotides in length. In some embodiments, a double stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucléotides.
In some embodiments, the région of perfect, substantial, or partial complementarity between the sense strand and the antisense strand is 16-26 (e.g., 16,17, 18, 19, 20, 21, 22,23, 24, 25, or 26) nucléotides in length and occurs at or near the 5' end of the antisense strand (e.g., this région may be separated from the 5' end of the antisense strand by 0,1, 2, 3, or 4 nucléotides that are not perfectly, substantially, or partially complementary).
The sense strand and antisense strand each contain a core stretch (also referred to herein as a ‘‘core sequence” or a cors stretch sequence”)) that is 16 to 23 nucléotides in length. An antisense strand core stretch is 10030 (perfectly) complementary or at least 85% (substantially) complementary to a nucléotide sequence (sometimes referred to, e.g., as a target sequence) présent in the alpha-ENaC target. A sense strand core stretch is 100% (perfectly) complementary or at least 85% (substantially) complementary to a core stretch in the antisense strand, and thus the sense strand core stretch is typically perfectly identical or at least 85% identical to a nucléotide sequence (target sequence) présent in the alphaENaC mRNA target. A sense strand core stretch can be the same length as a corresponding antisense core stretch or it can be a different length. In some embodiments, the antisense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucléotides in length. In some embodiments, the sense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucléotides in length.
Examples of nucléotide sequences used in forming alpha-ENaC RNAi agents are provided m Tables 2, 3, and 4. Examples of RNAi agent duplexes, that include the sense strand and antisense strand nucieotide sequences in Tables 2, 3, and 4, are shown in Table 5.
The alpha-ENaC RNAi agent sense and antisense strands anneal to form a duplex. A sense strand and an antisense strand of an alpha-ENaC RNAi agent can be partially, substantially, or fully complementary to each other. Within the complementary duplex région, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 16, at least 17, at least 18, at least 19. at least 20, at least 21, at least 22, or at least 23 nucléotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucieotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of an alphaENaC RNAi agent hâve a région of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucléotides that is at least 85% base paired or 100% base paired.)
In some embodiments, the antisense strand of an alpha-ENaC RNAi agent disclosed herein differs by 0, 1,2, or 3 nucléotides from any of the antisense strand sequences m Table 2 or Table 3. In some embodiments, the sense strand of an alpha-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucléotides from any of the sense strand sequences m Table 2 or Table 4.
The sense strand and/or the antisense strand can optionally and independendy contain an additional 1, 2, 3, 4, 5, or 6 nucléotides (extension) at the 3’ end, the 5' end, or both the 3' and 5' ends of the core stretch sequences. Tire antisense strand additional nucléotides, it présent, may or may not be complementary' to the corresponding sequence in the alphaENaC mRNA. The sense strand additional nucléotides, if présent, may or may not be identical to the corresponding sequence in the alpha-ENaC mRNA. Tire antisense strand additional nucléotides, if présent, may or may not be complementary to the corresponding sense strands additional nucléotides, if présent.
As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucléotides at the 5' and/or 3' end of the sense strand core stretch sequence and/or antisense strand core stretch sequence. The extension nucléotides on a sense strand may or may not be complementaiy to nucléotides, either core stretch sequence nucléotides or extension nucléotides, in the corresponding antisense strand. Conversely, the extension nucléotides on an antisense strand may or may not be complementaty to nucléotides, either core stretch nucléotides or extension nucléotides, in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of an RNAi agent contain 3' and 5' extensions. In some embodiments, one or more of the 3' extension nucléotides of one strand base pairs with one or more 5' extension nucléotides of the other strand. In other embodiments, one or more of 3' extension nucléotides of one strand do not base pair with one or more 5' extension nucléotides of the other strand. In some embodiments, an alpha-ENaC RNAi agent has an antisense strand having a 3' extension and a sense strand having a 5' extension. In some embodiments, the extension nucleotide(s) are unpaired and form an overhang. As used herein, an “overhang” refers to a stretch of one or more unpaired nucléotides located at a termina] end of either the sense strand or the antisense strand that does not form part of the hybridized or dupiexed portion of an RNAi agent disclosed herein.
In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand having a 3' extension of 1,2, 3,4, 5, or 6 nucléotides in length. In other embodiments, an alpha-ENaC RNAi agent comprises an antisense strand having a 3' extension of 1, 2, or 3 nucléotides in length. In some embodiments, one or more of the antisense strand extension nucléotides comprise uracil or thymidine nucléotides or nucléotides that are complementary to the corresponding alpha-ENaC mRNA sequence.
In some embodiments, the 3' end of the antisense strand can include additional abasic residues (Ab). An “abasic residue” or “abasic site” is a nucléotide or nucleoside that lacks a nucleobase at the 1' position of the sugar moiety. (See, e.g., U.S. Patent No. 5,998,203). In some embodiments, Ab or AbAb can be added to the 3' end of the antisense strand. In some embodiments, abasic residue(s) can be added as inverted abasic residues (invAb) (see Table 6). (See, e.g., F. Czaudema, Nucleic Acids Res., 2003, 31(11), 2705-1,6).
In some embodiments, the sense strand or the antisense strand may include a “terminal cap,” which as used herein is a non-nucleotide compound or other moiely that can be incorporated at one or more termini of a strand of an RNAi agent disclosed herem, and can provide the RNAi agent, in some instances, with certain bénéficiai properties, such as, for example, protection against exonuclease dégradation. Terminal caps are generally known in the art, and include inverted abasic residues, fis well as carbon chains such as a terminal C-„ Cô, or C12 group. In some embodiments, a terminai cap is présent at either the 5’ terminai end, the 3’ terminai end, or both the 5' and 3' terminal ends of the sense strand.
In some embodiments, an alpha-ENaC RNAi agent comprises a sense strand having a 3' extension of I, 2, 3, 4, or 5 nucléotides in length. in some embodiments, one or more of the sense strand extension nucléotides comprises adenosine, uracii, or thymidine nucléotides, AT dinucleoti.de, or nucléotides that correspond to nucléotides in the alpha-ENaC mRNA sequence. In some embodiments, the 3' sense strand extension includes or consists of one of the foilowing sequences, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each iisted 5' to 3').
In some embodiments, the 3' end of the sense strand may include additional abasic residues. In some embodiments, UUAb, U Ab, or Ab are added to the 3' end of the sense strand.
In some embodiments, one or more inverted abasic residues (invAb) are added to the 3' end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near the terminal end or terminal ends of the sense strand of an RNAi agent allows for enhanced activity or other desired properties of an RNAi agent.
In some embodiments, an alpha-ENaC RNAi agent comprises a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucléotides in length. In some embodiments, one or more of the sense strand extension nucléotides comprise uracii or adenosine nucléotides or nucléotides that correspond to nucléotides in the alpha-ENaC mRNA sequence. In some embodiments, the sense strand 5' extension is one of the foilowing sequences, but is not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed 5' to 3'). A sense strand can hâve a 3' extension and,for a 5’ extension.
In some embodiments, the 5' end of the sense strand can include one or more addiiional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues can be mserted between the targeting ligand and the nucieobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent. In some embodiments, an abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.
In some embodiments, the 3' end of the antisense strand core stretch sequence, or the 3' end of the antisense strand sequence, may include an inverted abasic residue (invAb (see Table 6)).
Examples of sequences used in forming alpha-ENaC RNAi agents are provided in Tables 2, 3, and 4. In some embodiments, an alpha-ENaC RNAi agent, antisense strand includes a sequence of any of tire sequences in Tables 2 or 3. In some embodiments, an alpha-ENaC RNAi agent antisense strand includes the sequence of nucléotides (from 5' end 3’ end) 117, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24, of any of the sequences in Table 2 or Table 3. In certain embodiments, an alphaENaC RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3. In some embodiments, an alpha-ENaC RNAi agent sense strand includes the sequence of any of the sequences in Tables 2 or 4. In some embodiments, an alpha-ENaC RNAi agent sense strand includes the sequence ofnucléotides (from 5’ end -à 3' end) 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 2-19, 2-20, 2-21, 2-22, 223, 2-24, 3-20, 3-21,3-22, 3-23, 3-24, 4-21,4-22, 4-23, 4-24, 5-22, 5-23, or 5-24, of any of the sequences in Tables 2 or 4. In certain embodiments, an alpha-ENaC RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4.
In some embodiments, the sense and antisense strands of the RNAi agents described herein contam the same number of nucléotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain diffèrent numbers of nucléotides. In some embodiments, the sense strand 5' end and the antisense strand 3' end of an RNAi agent form a blunt end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt-ended. As used herein a “blunt end” refers to an end of a double stranded RNAi agent in which the terminal nucléotides of the two annealed strands are complementary (form a complementary base-pair).
In some embodiments, the sense strand 5' end and the antisense strand 3' end of an ‘RNAi agent form a frayed end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form a frayed end. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein, a frayed end refers to an end of a double stranded RNAi agent in which the terminal nucléotides of the two annealed strands from a pair (i.e., do not form an overhang) but are not complementary (i.e. form a non-complementary pair). In some embodiments, one or more unpaired nucléotides at the end of one strand of a double stranded RNAi agent form an overhang. dire unpaired nucléotides may be on the sense strand or the antisense strand, creating either 3' or 5' overhangs. In some embodiments, the RNAi agent contains: a blunt end and a frayed end, a blunt end and 5' overhang end, a blunt end and a 3' overhang end, a frayed end and a 5' overhang end, a frayed end and a 3' overhang end, two 5' overhang ends, two 3' overhang ends, a 5' overhang end and a 3' overhang end, two frayed ends, or two blunt ends. Typically, when présent, overhangs are located at the 3’ terminal ends of the sense strand, the antisense strand, or both the sense strand and the antisense strand.
Modifîed nucléotides, when used in varions polynucleotide or oligonucleotide constructs, can preserve activity of the compound in cells while at the same time increasing the sérum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans upon administering of the polynucleotide or oligonucleotide construct.
In some embodiments, an alpha-ENaC RNAi agent is prepared or provided as a sait, mixed sait, or a free-acid. In some embodiments, an alpha-ENaC RNAi agent is prepared as a sodium sait. Such forms that are well known in the art are w'ithm the scope of the inventions disclosed herein.
Modified Nucléotides
In some embodiments, an alpha-ENaC RNAi agent contains one or more modified nucléotides. As used herein, a “modified nucléotide'’ is a nucléotide other than a ribonucleotide (2'-hydroxyl nucléotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100’%) of the nucléotides are modified nucléotides. As used herein, modified nucléotides can include, but are not limited to, deoxyribonucleotides, nucléotide mimics, abasic nucléotides (represented herein as Ab), 2'-modifïed nucléotides, 3' to 3' linkages (inverted) nucléotides (represented herein as invdN, invN, invn), modified nucleobasecomprising nucléotides, bridged nucléotides, peptide nucleic acids (PNAs), 2',3'-seco nucléotide mimics (unlocked nucleobase analogues, represented herein as NuNAorNUNA), locked nucléotides (represented herein as Nlna or NLNA), 3'-O-methoxy (2' intemucleoside linked) nucléotides (represented herein as 3'-OMen), 2'-F-Arabino nucléotides (represented herein as NfANA or Nîana), 5'-Me, 2'-fluoro nucléotide (represented herein as 5Me-Nf), morpholino nucléotides, vinyl phosphonate deoxyribonucleotides (represented herein as vpdN), vinyl phosphonate containing nucléotides, and cyclopropyl phosphonate containing nucléotides (cPrpN). 2'-modified nucléotides (i.e., a nucléotide with a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucléotides (represented herein as a lower case ietter ‘n’ in a nucléotide sequence), 2'-deoxy-2'-fluoro nucléotides (also referred to herein as 2'-fluoro nucléotide, and represented herein as Nf), 2'-deoxy nucléotides (represented herein as dN), 2'-methoxyethyl (2'-O-2-methoxylethyl) nucléotides (also referred to herein as 2'-MOE, and represented herein as NM), 2'-amino nucléotides, and 2'-alkyl nucléotides. It is not necessary for ail positions in a given compound to be uniformly modified. Conversely, more than one modification can be incorporated in a single alpha-ENaC RNAi agent or even in a single nucléotide thereof. The alpha-ENaC RNAi agent sense strands and antisense strands can be synthesized and/or modified by methods known in tire art. Modification at one nucieotide is independent of modification at another nucieotide.
Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynyl cytosine), 5-methyl cytosine (5-meC), 5-hydroxymethyl cytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) denvatives of adenine and guanine, 2alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyL or 2-n-butyl) and other aikyl dérivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trif!uoromethyL and other 5-substituted uraciis and cytosines, 7-methylguanine and 7-methyladenine, 8azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3deazaadenine.
In some embodiments, ail or substantially ail of the nucléotides of an RNAi agent are modified nucléotides. As used herein, an RNAi agent wherein substantially ail of the nucléotides présent are modified nucléotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucléotides in both the sense strand and the antisense strand being ribonucleotides (i.e., unmodified). As used herein, a sense strand wherein substantially ail of the nucléotides présent are modified nucléotides is a sense strand having two or fewer (i.e,, 0, i, or 2) nucléotides in the sense strand. being unm.odi.fied ribonucleotides. As used herein, an antisense sense strand wherein substantially ail of the nucléotides présent are modified nucléotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucléotides in the sense strand being unmodified ribonucleotides. In some embodiments, one or more nucléotides of an RNAi agent is an unmodified ribonucleotide.
Modified Intemucleoside Linkages
In some embodiments. one or more nucléotides of an alpha-ENaC RNAi agent are linked by non-standard linkages or backbones (i.e., modified intemucleoside linkages or modified backbones). Modified intemucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lower case “s”), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkyl phosphonates (e.g., methyl phosphonates or 3'-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-amino phosphoramidate, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of boranophosphates, or boranophosphates having inverted polarity wherein the adjacent pairs of nucleoside units are imked 3'-5' to 5'-3' or 2'-5' to 5'2’. In some embodiments, a modified intemucleoside linkage or backbone lacks a phosphorus atom. Modified intemucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter-sugar linkages. In some embodiments, modified intemucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, suifoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyl eneimino and methyl enehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.
In some embodiments, a sense strand of an alpha-ENaC RNzki agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, an antisense strand of an alpha-ENaC RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, a sense strand of an alpha-ENaC RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, an antisense strand of an alpha-ENaC RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate linkages.
In some embodiments, an alpha-ENaC RNAi agent sense strand contains at least two phosphorothioate intemucleoside linkages. In some embodiments, the at least two phosphorothioate intemucleoside linkages are between the nucléotides at positions 1-3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate intemucleoside linkage is at the 5’ end of the sense strand, and another phosphorothioate linkage is at the 3’ end of the sense strand. In some embodiments, the at least two phosphorothioate intemucleoside linkages are between the nucléotides at positions 1-3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the 5' end of the sense strand. In some embodiments, an alpha-ENaC RNAi agent 5 antisense strand contains four phosphorothioate intemucleoside linkages. In some embodiments, the four phosphorothioate intemucleoside linkages are between the nucléotides at positions 1-3 from the 5' end of the antisense strand and between the nucléotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end. In some embodiments, an alpha-ENaC RNAi agent contains ai least two phosphorothioate 10 intemucleoside linkages in the sense strand and three or four phosphorothioate intemucleoside linkages in the antisense strand.
In some embodiments, an alpha-ENaC RNAi agent contains one or more rnodified nucléotides and one or more rnodified intemucleoside linkages. In some embodiments, a 15 2'-modified nucleoside is combined with rnodified intemucleoside Imkage.
Alpha-ENaC RNAi Agents
In some embodiments, the alpha-ENaC RNAi agents disclosed herein target an alpha-ENaC gene at or near the positions of the alpha-ENaC sequence shown in Table 1. In some 20 embodiments, the antisense strand of an alpha-ENaC RNAi agent disclosed herein includes a core stretch sequence that is fully, substantially, or at least partially complementary' to a target alpha-ENaC 19-mer sequence disclosed m Table 1.
Table 1. Alpha-ENaC 19-mer mRNA Target Sequences (taken from homo sapiens sodium channel épithélial 1 alpha subunit (SCNN1A), transcript variant 1, GenBank NM_001038.5 (SEQ ID NO:1))
SEQ ID No. alpha-ENaC 19-mer Target Sequences (5' -> 3') Corresponding Positions on SEQ ID NO: 1
11 UGUGCAACCAGAACAAAUC 972-990
12 GUGCAACCAGAACAAAUCG 973-991
13 GCAGAGCAGAAUGACUUCA 1289-1307
14 AGAGCAGAAUGACUUCAUU 1291-1309
15 CUACCAGACAUACUCAUCA 1000-1018
16 UCUACCAGACAUACUCAUC 999-1017
SEQ ID No. 17 alpha-ENaC 19-mer Target Sequences (5' -» 3f) CUUUGACCUGUACAAAUAC Corresponding Positions on SEQ ID NO: 1 763-781
18 UGGAAGGAC UGGAAGAUCG 944-962
19 GGAAGGACUGGAAGAUCGG 945-963
20 CUGUGCCUACAUCUUCUAU 1579-1597
In some embodiments, an alpha-ENaC RNAi agent includes an antisense strand wherein position 19 of the antisense strand (5'->3') is capable of forming a base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments. an alpha-ENaC 5 agent includes an antisense strand wherein position 1 of the antisense strand (5'->3') is capable of forming a base pair with position 19 of a 19-mer target sequence disclosed in Table 1.
In some embodiments, an alpha-ENaC agent includes an antisense strand wherein position 10 2 ofthe antisense strand (5’ -> 3') is capable of forming abase pair with position 18 of a 19mer target sequence disclosed in Table 1. In some embodiments, an alpha-ENaC agent includes an antisense strand wherein positions 2 through 18 of the antisense strand (5' -> 3') are capable of forming base pairs with each of the respective complementary bases located at positions 18 through 2 of the 19-mer target sequence disclosed in Table 1.
For the RNAi agents disclosed herein, the nucléotide at position 1 of the antisense strand (from 5' end -> 3' end) can be perfectly complementary to the alpha-ENaC gene, or can be non-complementary to the alpha-ENaC gene. In some embodiments, the nucléotide at position 1 of the antisense strand (from 5’ end 3' end) is a U, A, or dT. In some 20 embodiments, the nucléotide at position 1 of the antisense strand (from 5' end -à 3' end) forms an A:U or U: A base pair with the sense strand.
In some embodiments, an alpha-ENaC RNAi agent antisense strand comprises the sequence of nucléotides (from 5' end -> 3' end) 2-18 or 2-19 of any of the antisense strand sequences 25 in Table 2 or Table 3. In some embodiments, an alpha-ENaC RNAi sense strand comprises the sequence of nucléotides (from 5' end -> 3' end) 1-17, 1-18, or 2-18 of any of the sense strand sequences in 'Fable 2 or Table 4.
In some embodiments, an alpha-ENaC RNAi agent is comprised of (i) an antisense strand comprising ihe sequence of nucléotides (from 5' end -> 3' end) 2-18 or 2-19 of any of the antisense strand sequences m Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucléotides (from 5' end 3’ end) 1-17 or 1-18 of any of the sense strand 5 sequences in Table 2 or Table 4.
In some embodiments, the alpha-ENaC RNAi agents include core 19-mer nucieotide sequences shown in the following Table 2.
Table 2. Alpha-ENaC RNAi Agent Antisense Strand and Sense Strand Core Stretch Base Sequences (N-any nucleobase)
SEQ ID NO: Antisense Strand Base Sequence (5' -> 3') (Shown as an Unmodifîed Nucléotide Sequence) SEQ ID NO: Sense Strand Base Sequence (5' -> 3P) (Shown as an Unmodifîed Nucléotide Sequence) Corresponding Positions on SEQ I» NO: 1
21 UAUUUGUUCUGGUUGCACA 60 UGUGCAACCAGAACAAAUA 972-990
22 AAUUUGUUCUGGUUGCACA 61 UGUGCAACCAGAACAAAUU 972-990
23 GAUUUGUUCUGGUUGCACA 62 UGUGCAACCAGAACAAAUC 972-990
24 NAUUUGUUCUGGUUGCACA 63 UGUGCAACCAGAACAAAUN 972-990
25 NAUUUGUUCUGGUUGCACN 64 NGUGCAACCAGAACAAAUN 972-990
26 AAUGAAGUCAUUCUGCUCU 65 AGAGCAGAAUGACUUCAUU 1291-1309
27 UAUGAAGUCAUUCUGCUCU 66 AGAGCAGAAUGACUUCAUA 1291-1309
28 NAUGAAGU C AUUCU GC UC U 67 AGAGCAGAAUGACUUCAUN 1291-1309
29 NAUGAAGUCAUUCUGCUCN 68 NGAGCAGAAUGACUUCAUN 1291-1309
30 UGAUGAGUAUGUCUGGUAG 69 CUACCAGACAUACUCAUCA 1000-1018
31 NGAUGAGUAUGUCUGGUAG 70 CUACCAGACAUACUCAUCN 1000-1018
32 NGAUGAGUAUGUCUGGUAN 71 NUACCAGACAUACUCAUCN 1000-1018
33 GAUGAGUAUGUCUGGUAGA 72 UCUACCAGACAUACUCAUC 999-1017
34 UAUGAGUAUGUCUGGUAGA 73 UCUACCAGACAUACUCAUA 999-1017
35 NAUGAGUAUGUCUGGUAGA 74 UCUACCAGACAUACUCAUN 999-1017
36 NAUGAGUAUGUCUGGUAGN 75 NCUACCAGACAUACUCAUN 999-1017
37 CGAUUUGUUCUGGUUGCAC 76 GUGCAACCAGAACAAAUCG 973-991
38 UGAUUUGUUCUGGUUGCAC 77 GUGCAACCAGAACAAAUCA 973-991
39 NGAUUUGUUCUGGUUGCAC 78 GUGCAACCAGAACAAAUCN 973-991
40 NGAUUUGUUCUGGUUGCAN 79 NUGCAACCAGAACAAAUCN 973-991
41 GUAUUUGUACAGGUCAAAG 80 C UUUGACC UGUACAAAUAC 763-781
42 UUAUUUGUACAGGUCAAAG 81 CUUUGACCUGUACAAAUAA 763-781
43 NUAUUUGUAC AGGUCAAAG 82 CUUUGACCUGUACAAAUAN 763-781
44 NUAUUUGUACAGGUCAAAN 83 NUUUGACCUGUACAAAUAN 763-781
SEQ ID NO: Antisense Strand Base Sequence (5' 3') (Show» as an Unmodilïed Nucléotide Sequence) SEQ ID NO: Sense Strand Base Sequence (5' 3') (Shown as an Unniodified Nucléotide Sequence) Corresponding Positions on SEQ ID NO: I
45 CGAUCUUCCAGUCCUUCCA 84 UGGAAGGACUGGAAGAUCG 944-962
46 UGAUCUUCCAGUCCUUCCA 85 UGGAAGGACUGGAAGAUCA 944-962
47 NGAUCUUCCAGUCCUUCCA 86 UGGAAGGACUGGAAGAUCN 944-962
48 NGAUCUUCCAGUCCUUCCN 87 NGGAAGGACUGGAAGAUCN 944-962
49 CCGAUCUUCCAGUCCUUCC 88 GGAAGGACUGGAAGAUCGG 945-963
50 UCGAUCUUCCAGUCCUUCC 89 GGAAGGACUGGAAGAUCGA 945-963
51 NCGAUCUUCCAGUCCUUCC 90 GGAAGGACUGGAAGAUCGN 945-963
52 NCGAUCUUCCAGUCCUUCN 91 NGAAGGACUGGAAGAUCGN 945-963
53 UGAAGUCAUUCUGCUCUGC 92 GCAGAGCAGAAUGACUUCA 1289-1307
54 NGAAGUCAUUCUGCUCUGC 93 GCAGAGCAGAAUGACUUCN 1289-1307
55 NGAAGUCAUUCUGCUCUGN 94 NCAGAGCAGAAUGACUUCN 1289-1307
56 AUAGAAGAUGUAGGCACAG 95 CUGUGCCUACAUCUUCUAU 1579-1597
57 UUAGAAGAUGUAGGCACAG 96 CUGUGCCUACAUCUUCUAA 1579-1597
58 NUAGAAGAUGUAGGCACAG 97 CUGUGCCUACAUCUUCUAN 1579-1597
59 NUAGAAGAUGU AGGCACAN 98 NUGUGCCUACAUCUUCUAN 1579-1597
The alpha-ENaC RNAi agent sense strands and antisense strands that comprise or consist of the nucléotide sequences in Table 2 can be modified nucléotides or unmodified nucléotides. In some embodiments, the alpha-ENaC RNAi agents having the sense and antisense strand sequences that comprise or consist of any of the nucléotide sequences in Table 2 are ail or substantially ail modified nucléotides.
In some embodiments, the antisense strand of an alpha-ENaC RNAi agent disclosed herein differs by 0, l, 2, or 3 nucléotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of an alpha-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucléotides from any of the sense strand sequences in Table 2.
As used herein, each N listed in a sequence disclosed in Table 2 may be independently selected from any and ail nucleobases (including those found on both modified and unmodified nucléotides). In some embodiments, an N nucléotide listed in a sequence disclosed in Table 2 has a nucleobase that is complementary to the N nucléotide at the corresponding position on the other strand. In some embodiments, an N nucléotide listed in a sequence disclosed in Table 2 has a nucleobase that is not complementary to the N nucléotide at the corresponding position on the other strand. In some embodiments, an N nucléotide listed in a sequence disclosed in Table 2 has a nucleobase that is the same fis the N nucléotide at the corresponding position on the other strand. In some embodiments, an N nucléotide listed in a sequence disclosed in Table 2 has a nucleobase that is different from the N nucléotide at the corresponding position on the other strand.
Certain modified alpha-ENaC RNAi agent sense and antisense strands are provided in Table 3 and Table 4. Modified alpha-ENaC RNAi agent antisense strands, as well as their underlying unmodified nucleobase sequences, are provided in Table 3. Modified alpha-ENaC RNAi agent sense strands, as well as their underlying unmodified nucleobase sequences, are provided in Table 4. In forming alpha-ENaC RNAi agents, each of the nucléotides in each of the underlying base sequences listed in Tables 3 and 4, as well as in Table 2, above, can be a modified nucléotide.
The alpha-ENaC RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence iisted in Table 2, or Table 4 can be hybridized to any antisense strand containing a sequence Iisted in Table 2 or Table 3, provided the two sequences hâve a région of at least 85% complementarity over a contiguous 16,17, 18, 5 19, 20, or 21 nucieotide sequence.
In some embodiments, an alpha-ENaC RNAi agent antisense strand comprises a nucieotide sequence of any of the sequences in Table 2 or Table 3.
In some embodiments, an alpha-ENaC RNAi agent comprises or consiste of a duplex having the nucleobase sequences of the sense strand and the antisense strand of any of the sequences in Table 2, Table 3, or Table 4.
Examples of antisense strands containing modified nucléotides are provided in Table 3.
Examples of sense strands containing modified nucléotides are provided in Table 4.
As used m fables 3 and 4, the following notations are used to indicate modified nucléotides, targeting groups, and linking groups:
A
C
G U
I a
c es g gs is t ts u us Nf = adenosine-3'-phosphate = cyiidine-3'-phosphate = guanosine-3'-phosphate = uridine-3'-phosphate = inosine-3 '-phosphate = 2'-O-methyladenosme-3'-phosphate = 2'-O-methyIadenosine-3'-phosphorothioate = 2'-O-methylcytidine-3 '-phosphate = 2'-O-methyl cytidine-3 '-phosphorothioate = 2'-O-methylguanosine-3'-phosphate = 2'-O-methyiguanosine-3'-phosphoiOthioate = 2'-O-methylinosine-3’-phosphate = 2'-O-metbylinosine-3'-phosphorothioate = 2'-O-methyl-5-methyluridine-3'-phosphate = 2'-O-methyl-5-methyluridine-3'-phosphorothioate = 2'-O-methyluridine-3 '-phosphate
- 2'-0-methyl uridine-3'-phosphorothioate = any 2'-fluoro modified nucieotide
Af = 2'-fluoroadenosine-3'-phosphate
Afs = 2Mluoroadenosine-3'-phosporothioate
Cf = 2'-fluorocytidine-3'-phosphate
Cfs = 2'-fluorocytidine-3'-phosphoroÎhioate
5 Gf = 2'-fluoroguanosine-3'-phosphate
Gfs = 2'-fluoroguanosine-3 '-phosphorothioate
Tf = 2'-f1uoro-5'-methyluridine-3'-phosphate
Tfs - 2'-fluoro-5'-methylundirie-3'-phosphorothioate
Uf = 2'-fluorouridine-3 '-phosphate
10 Ufs = 2'-fhiorouridine-3'-phosphorothioate
dN = any 2'-deoxyribonudeotide
dT = 2'-deoxythymidine-3'-phosphate
Nuna = 2',3'-seco nucléotide mimics (unlocked nucleobase analogs)-3'-
Phosphate
15 Nunas = 2',3'-seco nucléotide mimics (unlocked nucleobase analogs)-3'-
Phosphorotbioate
Auna = 2',3'-seco-adenosine-3'-phosphate
AunaS = 2',3'-seco-adenosine-3'-phosphorothioate
C(JMA = 2',3'-seco-cytidine-3'-phosphate
20 Cunas 2',3'-seco-cytidine-3'-phosphorothioate
Guna = 2',3'-seco-guanosine-3'-phosphate
Gunas = 2',3’-seco-guanosine-3'-phosphorothioate
Duna = 2',3'-seco-uridine-3'-phosphate
Uuna.s = 2'.3'-seco-uridine-3'-phosphorothioate
25 a_2N = see Table 7
a_2Ns = see Table 7
pu_2N = see Table 7
pu_2Ns see Table 7
D2us = see Table 7
30 Npu = see Table 7
Nus = see Table 7
Nlna = ïocked nucléotide
NÎana = 2-F-Arabino nucléotide
NM :=: 2'-O-(2-methoxyethyl) nucléotide
35 AM = 2'-O-(2-methoxyethyl)adenosine-3'-phosphate
AMs = 2'-O-(2-methoxyethyl)adenosine-3'-phosphorothioate
TM - 2'-O-(2-methoxyethyl)thymidine-3'-phosphate
TMs = 2'-O-(2-methoxyethyl)thymidine-3 '-phosphorothioate
R = ribitol
40 (invdN) = any inverted deoxyribonucleotide (3'-3' linked nucléotide)
(invAb) = inverted (3'-3' linked) abasic deoxyribonucleotide-5'phosphate, see Table 7 (invAb)s = inverted (3'-3'linked) abasic deoxyribonucieotide-5 phosphorothioate, see Table 7 (invn) = any inverted 2'-0Me nucléotide (3'-3' linked nucléotide) s = phosphorothioate Iinkage vpdN = vinyl phosphonate deoxyribonucleotide (5Me-N0 = 5'-Me, 2'-fluoro nucléotide cPrp = cyclopropyl phosphonate, see Table 7 epTcPr = see Table 7 epTM = see Table 7 spus = see Table 7 (Chol-TEG) - see Table 7 (TEG-Biotin) = see Table 7 (PEG-C3-SS) = see Table 7 (Alk-SS-C6) = see Table 7 (C6-SS-Alk) = see Table 7 (C6-SS-C6) = see Table 7 (6-SS-6) = see Table 7 (C6-SS-Alk-Me) = see Table 7 (NH2-C6) = see Table 7 (TriAlk#) = see Table 7 (TriAlk#)s = see Table 7
As the person of ordinary skill in the art would readily understand, unless otherwise indicated by the sequence (such as, for example, by a phosphorothioate Iinkage “s”), when présent in an oligonucleotide, the nucléotide monomers are mutually linked by 5’-3’-phosphodiester bonds. Further, the person. of ordinary skill in the art would readily understand that the terminal nucléotide at the 3’ end of a given oligonucleotide sequence would typically hâve a hydroxyl (-OH) group at the respective 3’ position of the given monomer instead of a phosphate moiety ex vivo. Moreover, as the person of ordinary skill would readily understand and appreciate, while the phosphorothioate Chemical structures depicted herein typically show the anion on the sulfur atom, the inventions disclosed herein encompass ail phosphorothioate tautomers and/or diastereomers (e.g., where the sulfur atom has a double-bond and the anion is on an oxygen atom). Unless expressly indicated otherwise herein, such understandings of the person of ordinary skill in the art are used when describing the alpha-ENaC RNAi agents and compositions of alpha-ENaC RNAi agents disclosed herein.
Certain examples of targeting groups and linking groups used with the alpha-ENaC RNAi agents disclosed herein are included in the Chemical structures provided below in Table 6. Each sense strand and/or antisense strand can hâve any targeting groups or linking groups iisted herein, as well as other targeting or linking groups, conjugated to the 5' and/or 3' end of the 5 sequence.
Table 3. Alpha-ENaC RNAi Agent Antisense Strand Sequences
AS Strand ID Modifted Antisense Strand (5' —» 3') SEQ ID NO. Underlying Base Sequence (5' 3') (Shown as an Unmedified Nucieotide Sequence) SEQ ID NO.
AM04730-AS us Afs us u uGfuU ici J f gGfuU fgCfaC faGfc us g 99 UAUUUGUUCUGGUUGCACAGCUG 224
AM05080-AS us.MsusUfuGfuUfcUfgGfuUfgCfaCfaGfcusg 100 UAUUUGUUCUGGUUGCACAGCUG 224
AM05081-AS usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc 6 UAUUUGUUCUGGUUGCACAGC 7
AM05082-AS usAfsusUfuGfuUfcUfgGfuUfgCfaCfagsc 101 UAUUUGUUCUGGUUGCACAGC___ 7
AM05083-AS us Afs us UfuGfuU fcUfgGfuUfgCfaC fausu 102 UAUUUGUUCUGGUUGCACAUU 226
AM05084-AS vpusAfsusUfuGfuUfcUfgGfuüfgCfaCfaGfsc 103 UAUUUGUUCUGGU UGCACAGC__ 7
AM05085-AS asAfsusUfuGfuUfcUfgGfuUfgCfaCfagsc 104 AAUUUGUUCUGGUUGCACAGC 227
AM05772-AS usÂfsusGfaAfgUfcAfuUfcUfgCfnCfuGfsc 105 UAUGAAGUCAUUCUGCUCÜGC 228
AM05773-AS usGfsasUfgAfgUfaUfgUfcUfgGfuAfgAfsa 106 ÎJGÂÜGÂGUAUGUCUGGUAGAA 229
AM05774-AS usGfsasUfuUfgUfuCfuGfgUfuGfcAfcAfsg 107 U GAUUUGUUCUGGUUGCACAG 230
AM05775-AS usAfsusGfaGfuAfuGfuCfuGfgUfaGfaAfsg 108 UAUGAGUÀUGUCUGGUAGAAG 231
AM05776-AS usUfsasUfuUfgUfaCfaGfgUfcAfaAfgAfsg 109 UUAUUUGUACAGGUCAAAGAG 232
AM05777-AS usAfsusGiWgUfCfAtWTcUfgCfuCfuGfsc 110 UAUGAAGUCAUUCUGCUCÜGC _ 228______
AM05778-AS usGfsasUfgAfgUfAfUfgUfcUfgGfuAfgAfsa 111 WÂijGÂGÛÀÛGÜClJGGUAGAA__ 229
AM05779-AS usGfsasUfuUfgUtUfCfuGfgUfuGfcAfcAfsg 112 UGAUUUGUUCUGGUUGCACAG 230
AM05780-AS usAfsusGfaGfuAft.lfGfuCfuGfgUfaGfaAfsg 113 UAUGAGUAUGUCUGGUAGAAG 231
AM05781-AS usUfsasUfuUfgUfAfCfaGfgüfcAlWgAfsg 114 UUAUUUGUACAGGUCAAAGAG 232
AM05782-AS usAfsusGfaAfgUfCfAfuUfcUfgCfuCfuusu 115 UAUGAAGUCAUUCUGCUCUUU 233
AM05783-AS usGfsasÜfgAfgUfAfUfgUfcUfgGfuAfgusu 116 ÜGÂÜGÂGÜÂÏjGÏÏCÜGGUAGUU 234
AM05784-AS usGfsasUfuUfgUfUfCfuGfgUfuGfcAfcusu 117 UGAUUUGUUCUGGUUGCACUU 235
AM05785-AS usAfsusGfaGfuAfüfGfuCfuGfgUfaGfausu 118 UAUGAGUAUGUCUGGUAGAUU 236
AM05786-AS usUfsasUfuUfgUfAfCfaGfgUfcAfaAfgusu 119 UUAUUUGUACAGGUCAAAGUU__ 237
AM05916-AS cPrpusAfuUfuGfuUfcUfgGfuUfgCfaCfaGfsc 120 UAUUUGUUCUGGUUGCACAGC 7
AM05917-AS cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc 121 UAU UUGUUCUGGUUGCACAGC 7
AM06240-AS cPrpuAfu U fuGfuU fcU fgGfuU fgCfaC faGfc 122 UAUUUGUUCUGGUUGCACAGC 7
AM06460-AS cPrpuAfuUfuGfuUfcUfgGfuUfgCfaCfaGfc(invAb) 123 UAUUUGUUCUGGUUGCACAGC 7
AM06461-AS cPrpuAfuUfuGfuUfcUfgGfuUfgCfaCfaGfsc 124 UAUUUGUUCUGGUUGCACAGC 7
AM06462-AS cPrpusAfsuUfuGfuUfcUfgGfuUfgCfaCfaGfsc 125 UAUUUGUUCUGGUUGCACAGC 7
AM06691-AS usGfsasUfcUftiCfcAfgüfcCfuUfcCfaGfsu 126 UGAUCUUCCAGUCCUUCCÀGÜ 238
AM06693-AS usCfsgsAfuCfuUfcCfaGfuCfcUfuCfcAfsg 127 UCGAUCUUCCAGUCCUUCCAG 239
AM06695-AS usGfsasAfgüfcAfuUfcüfgCfuCfuGfcGfsc 128 UGAAGUCAUUCUGCUCUGCGC 240
AM06697-AS asüfsasGfaAfg AfiiGriAtgGfcAi'cAfgCfsc 129 AUAGA\GAUGUAGGCACAGCC 241
AM06699-AS us AfsusCfpU fgAfcAfg AfgGfg Afg AfcUfsc 130 UAUCGUGACAGAGGGAGACUC 242
AM06701-AS usUfsgs AfcCfaUfcGfuG iaCfaGfaGfgGfsa 131 UUGACCAUCGUGACAGAGGGA 243
AM06765-AS idPrpuAfuUfuGftiUfcUfgGfuUfgCfaCfaGuNACuNA 132 UAUUUGUUCUGGUUGCACAGC 7
AM06766-AS cP^uAfuLTuGfuUfcUfgGfuUfgCfaCfaGæ^ 133 UAUUUGUUCUGGUUGCACAGCU 244
AM06767-AS cPrpuAfuUfuGftiUfcUfgGfuLifgCfaCfaGfcUuNAUuNA 134 UAUUUGUUCUGGUUGCACAGCUU 245
AM07066-AS cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg 10 UAUUUGUUCUGGUUGCACAGG 3
AM07I70-AS cPrpusAfsusUfuGiUuNAUfcUfgGfuUfgCfaCfaGfsg 135 UAUUUGUUCUGGUUGCACAGG 3
AM07174-AS cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsu 136 UAUUUGUUCUGGUUGCACAGÜ 247
AM07200-AS usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg 2 UAUUUGUUCUGGUUGCACAGG 3
AM07204-AS usAfsusUfuGfUuNAUfcUfgGfuUfgCfaCfaGfsg 137 UAUUUGUUCUGGUUGCACAGG 3
AM07206-AS us AfsusUfuGfuUfcUfgGfuUfgCfaCf gGl sg 13 8 UAUUUGUUCUGGUUGCACGGG 248
AM07208-AS usAfsusUfuGfuUfcUfgGfuUfgCfaCfgGfsu 139 UAUUUGUUCUGGUUGCACGGU 249__
AM07333-AS usAfsusUfuGfuUfcUfgGfuUfgCfaCfcGfsu 140 UAUUUGUUCUGGUUGCACCGU 250
AM07335-AS usAfsusUfuGfuüfcUfgGfuUfgCfaCfaGfsu 141 UAUUUGUUCUGGUUGCACAGU 247
AM07340-AS usAfsusUfuGfuU'fcUfgGfuUfgCfaCfaGfsa 142 UAUUUGUUCUGGUUGCACAGA_____251
AM07409-AS pusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg 143 UAUUUGUUCUGGUUGCACAGG_____3
AM07410-AS D2usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg 144 UAUUUGUUCUGGUUGCACAGG___________ 3
AM074I I - AS spusAfsusUfuGfuUfcUfgGfuUfgCfaCtaGfsg 145 UAUUUGUUCUGGUUGCACAGG_________ 3
AM07412-AS epusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg 146 U AU UUGU U C UGGU UGCAC ÂGG 3
AM07484-AS Ui in as Afsus (J fuGfuU fc U fgGfuüfgCfaC faGfsg 147 U AUUU GUUCU GGUUGCACAGG 3
AM07485-AS isAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg 148 ÏAUUUGUUŒGGUUGCACAGG 252
AM07496-AS us AfsusU fuguucugGfuü fgC faC faGfsu 149 UAUUUGUUC UGGUUGCACAGU 247
AM07497-AS usAfsusUfuguucUfgGfuUfgcaCfaGfsu 150 UAUUUGUUCUGGUUGCACAGU 247
AM07605-AS TMsAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc 151 TALWGUUCUGGUUGCACAGC 253
AM07669-AS asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu 152 AGAAGUCAUUCUGCUCUGCUU 254
en
Table 4. Alpha-ENaC Agent Sense Strand Sequences
Strand II) Modified Sense Strand (5' —» 3‘) SEQ ID NO. Underlying Base Sequence (5' —> 3') (Shown as an Unmodified Nucieotide Sequence) SEQ ID NO.
AM05073-SS gscugugCfaAfcCfaGfaacaaauas(invAb) 153 GCUGlïGCAACCAGAACAAAUA 255
AM05074-SS gscugugcaAfCfCfagaacaaauas(invAb) 154 GCUGUGCAACCAGAACAAAEA 255
AM05075-SS asaugugcaAfCfCfagaacaaauas(invAb) 295 AAUGUGCAACCAGAACAAAUA 296
AM05077-SS gscugugcaAfCfCfagaacaaauus(invAb) 155 GCUGUGCAACCAGAACAAAUU 256
AM05487-SS (NH2-C6)sgscugugcaAfCfCfagaacaaauas(invAb) 156 GCUGlïGCAACCAGAACAAAUA 255
AMO5787-SS gscagagcaGfAfAfugacuucauas(invAb) 157 GCAGAGCAGAAUGACUUCAUA 257
AM05788-SS usucuaccaGfAfCfauacucaucas(mvAb) 158 UUCCACCAGACAUACUCAUCA 258
AM05789-SS csugugcaaCfCfAfgaacaaaucas(invAb) 159 CUGUGCAACCAGAACAAAUCA 259
AM05790-SS csuucuaccAfGfAfcauacucauas(invAb) 160 CUUCUACCAGACAUACUCAUA 260
AM05791-SS csucuuugaCfCfUfguacaaauaas(invAb) 161 CUCUÜUGACCUGUACAAAUAA 261
AM05792-SS (invAb)AfgAfgCfaGfAfAfuGfaCfuUfcauausu(invAb) 162 AGAGCAGAAUGACUUCAUAUU 262
AM05793-SS (mv Ab)CfuAfcC faGfAfC faU faCfuC faucausu(in v Ab) 163 CUACCAGACAUACUCAUCAUU 263
AM05794-SS (invAb)GfuGfcAfaCtCTAfgAfaCfaAfaucausu(invAb) 164 GUGCAACCAGAACAAAUCAUU 264
AM05795-SS (invAb)UfcUfaCfcAfGfAfcAfuAfcUfcauausu(invAb) 165 UCUACCAGACAUACUCAUAUU 265
AM05796-SS (invAb)CfuUfuGfaCfCfUfgUfaCfaAfauaausu(invAb) 166 CUUUGACCUGUÂCAAÂÙAAÜÜ 266
AM06162-SS (invAb)gcugugcaAfCfCfagaacaaaua(ïnvAb) 167 GCUGlïGCAACCAGAACAAAUA 255
AM06246-SS gcugugcaAfC fCfagaacaaau(invd A) 168 GCUGUGCAACCAGAACAAAIJA 255
AM06459-SS gcugugcaAfCfCfagaacaaaua(invAb) 169 GCUGlïGCAACCAGAACAAAUA 255
AM06690-SS (NH2-C6)sascuggaagGfAfCfuggaagaucas(invAb) 170 ACUGGAAGGACUGGAAGAUCA 267
AM06692-SS (NH2-C6)scsuggaaggAfCfUfggaagaucgas(invAb) 171 CUGGAAGGACUGGAAGAUCGA 268
AM06694-SS (NH2-C6)sgscgcagagCfAfGfaaugacuucas(invAb) 172 GCGCAGAGCAGAAUGACUUCA 269
AM06696-SS (NH2-C6)sgsgcugugcCfUfAfcaucuucuaus(invAb) 173 GGCUGUGCCUACAUCUUCUAU 270
en ω
Strand ID Modified Sense Strand (5' * 3') SEQ ID NO. Underlying Base Sequence (5' —» 3') (Shown as an Unmodified Nucléotide Sequence)__ SEQ ID NO.
AM06698-SS (NH2-C6)sgsagucuccCfUfCfugucacgauas(mvAb) 174 GAGUCUCCCUCWUCACGAUA 271
AM06700-SS (NH2-C6)suscccucugUfCfAfcgauggucaas(invAb) 175 UCCCUCUGL'CACGAUGGUCAA 272
AM07064-SS (NH2-C6)gsc ugugcaAfC fC fagaacaaauas (in v Ab) 176 GCUGIJGCAACCAGAACAAAUA__ 255
AM07065-SS (NH2-C6)scscugugcaAfCfCfagaacaaauas(invAb) 177 CCUGUœAACCAGAACAAAUA 273
AM07067-SS (NH2-C6)cscugugcaAfC fC fagaacaaauas(invAb) 178 CCUGUGCAACCAGAACAAAUA 273
AM07169-SS (NH2-C6)scscugugcaAfCfCfaGaacaaauas(invAb) 179 CCUGUGCAACCAGAACAAAUA 273
AM07171-SS (NH2-C6)scscugugcaAfCrCraiaacaaauasiinv_Ab) 180 CCUGUGCAACCA1AACAAAUA 274
AM07172-SS (NH2-C6)scscugugcaAfCfCfagaacaa__2Nauas(invAb) 181 CCUGUGCAACCAGAACA(A2n)AUA 275
AM07173-SS (NH2-C6)sascugugcaAfCfCfagaacaaauas(invAb) 182 ACUGUGCAACCAGAACAAAÜA 276
AM07201-SS (NH2-C6)cscugugcaAfCfCfaGaacaaauas(invAb) 183 CCUGUGCAACCAGAACAAAUA 273
AM07202-SS (NH2-C6)cscugugcaAfCfCfaiaacaaauas(invAb) 184 CCUGUGC AACCAIAAC AAAU A 274
AM07203-SS (NH2-C6)cscugugcaAfCfUfagaacaaauas(invAb) 185 CCUGUGCAACUAGAACAAAUA.......... 277
AM07205-SS (NH2-C6)csccgugcaAfCfCfagaacaaauas(invAb) 186 CCCGUGCÆACCAGAACAAAUA 278
AM07207-SS (NH2-C6)asccgugcaAfCfCfagaacaaauas(invAb) 187 ACCGUGCAACCAGAACAAAUA__ 279
AM07217-SS (NH2-C6)cscugugcaAfCfCfagaacaaauas(invAb)s(C6-SSC6) 188 CCUGUGCAACCAGAACAAAUA 273
AM07218-SS (NH2-C6)cs cugugcaAfC fCfagaacaaauas(inv Ab)(C 6-S S C6) 189 CCUGUGCAACCAGAACAAAUA 273
AM07276-SS (Tri Alk l )sgscugugcaAfCf(Tagaacaaauas(inv Ab) 190 CCUGUGCAACCAGAACAAAUA 255
AM07280-SS (NH2-C6)cscugugcaAfCfCfagaacaaauas(invAb)s(6-SS-6) 191 CCUGUGCAACCAGAACAAAUA 273
AM0728J-SS (NH2-C6)cscugugcaAæfCfagaacaaauas(invAb)(6-SS-6) 192 CCUGUGCAACCAGAACAAAUA 273
AM07329-SS (TriAlkl)cscugugcaAfCfCfagaacaaauas(invAb) 193 CCUGUGCAACCAGAACAAAUA 273
AM07330-SS (TriAlk2)cscugugcaAfCfCfagaacaaauas(invAb) 194 CCUGUGCAACCAGAACAAAUA^__ 273
AM07331-SS (TriAlk3)cscugugcaAfCfCfagaacaaauas(invAb) 195 CCUGUGCAACCAGAACAAAUA 273
en
Strand ID Modified Sense Strand (5' -> 3') SEQ ID NO. Underlying Base Sequence (S' —» 3') (Shown as an Unmodifïed Nucieotide Sequence) SEQ ID NO.
AM07332-SS (NH2-C6)ascggugcaAfCfCfagaacaaauas(invAb) 196 ACGGUGCAACCAGAACAAAUA 280
AM07334-SS (NH2-C6)ascugugcaAfCfCfagaacaaauas(invAb) 197 ACUGUGCAACCAGAACAAAUA 276
AM07336-SS (NH2-C6)ascugugcaAfCfCfagaacaaa_2Nuas(inv Ab) 198 ACUGUGCAACCAGAACAA(A2n)UA 281
AM07337-SS (NII2-C6)ascugugcaAfCfCfagaacaa_2Nauas(invAb) 199 ACUGUGCAACCAGAACA(A2n)AUA 282
AM07338-SS (NH2-C6)ascugugcaAfC fC fagaaca_2N aauas(inv Ab) 200 ACUGUœAACCAGAAC(A2l5ÂÂUA 283
AM07339-SS (NH2 -C6)uscugugcaA fC fC fagaacaaauas (inv Ab) 201 UCUGUGCAACCAGAACAAAUA 284
AM07341-SS (NH2-C6)cscugugcaAfCfCfagaacaa2Nauas(invAb) 202 CCUGUGCAACCAGAACA(A2n)AUA 285
AM07342-SS (NH2-C6)cscugugcaAfCfCfaGaacaa_2Nauas(invAb) 203 CCUGUGC AACC AGAAC A( A2r)AUA 275
AM07343-SS (NH2-C6)cscugugcaAfCfCfagaacaaa_2Nuas(invAb) 204 CCUGUGCAACCAGAACAA(A21%b3 286
AM07344-SS (NH2-C6)cscugugcaAfCæfagaaca_2Naauas(invAb) 205 CCUGUGC AACCAGAAC(A2n)AAUA 287
AM07400-SS (TriAÎk4)cscugugcaAfCfCfagaacaaauas(invAb) 206 CCUGUGCAACCAGAACÂAAÜA 273
AM07401-SS (TriÀik5)cscugugcaAfCfCfagaacaaauas(mvAb) 207 CCUGUGCAACCAGAACAAAUA 273
AM07402-SS (TriAlk6)cscugugcaAfCfCfagaacaaauas(invAb) 208 CCUGUGCAACCAGAACAAAÜA 273
AM07486-SS (NH2-C6)cscugugcaAfCfCfagaacaaaucs(invAb) 209 CCUGUGCAACCAGAACAAAUC 288
AM07495-SS (NH2-C6)ascUfglJfgCfaAfCfCfagaacaaauas(invAb) 210 ACUGUGCAACCAGAACAAAUA 276
AM07498-SS (NH2-C6)ascUfgUfgCfaAfcCfaGfaacaaauas(invAb) 211 ACUGUGCAACCAGAACAAAUA 276
AM07499-SS (NH2-C6XscUTgÙfgC^ 212 ÀCUGUGC AACC AG AACA(A2n) AU A 282
AM07594-SS (Tri Alk7)cs cugugca AfC fCfagaacaa auas(in v Ab) 213 CCUGUGC AACCAGAACAAAÜA 273
AM07595-SS (TriAlk8)cscugugcaAfCfCfagaacaaauas(invAb) 214 CCUGUGCAACCAGAACAAAÜA 273
AM07606-SS (NH2-C6)sgscugugcaAfCfCfagaacaaauas(invAb)(C6-SS- C6)(invAb) 215 GCUGUGCAACCAGAACAAAÜA 255
AM076H-SS (TriAlk9)cscugugcaAflCfCfagaacaaauas(invAb) 216 CCUGUGCAACCAGAACAAAÜA 273
AM07612-SS (TriAlklO)cscugugcaAfCfCfagaacawias(mvAb) 217 CCUGUGCAACCAGAACAAAÜA 273
AM07665-SS (NH2-C6)ascuggaagGfAfCfuggaagaucas(invAb) 218 ACUGGAAGGACUGGAAGAUCA 267
Strand ID Modified Sense Strand (5' 3') SEQ ID NO. Underlying Base Sequence (5' —► 3’) (Shown as an Umnodified Nucieotide Sequence) SEQ ID NO.
AM07666-SS (NH2-C6)scsugugcaaCfCfAfgaacaaaucas(in vAb) 2Ί9 CUGUGCAACCAGAACAAAUCA 259
AM07667-SS (NH2-C6)csugugcaaCfCiAfgaacaaaucas(invAb) 220 CUGUGCAACCAGAACAAAUCA 259
AM07668-SS (NH2-C6)sgscagagCfAfGfaaugacuucuuus(invAb) 221 GCAGAGCAGAAUGACUUCUUU 289
AM07670-SS (NH2-C6)gscagagCfAfGfaaugacuucuuus(invAb) 222 GCAGAGCAGAAUGACUUCUUU 289
AM07807-SS (TriA!kl4)cscugugcaAfCfCfagaacaaauas(invAb) 223 CCUGUGCAACCÀGÂÂCAAAUA 273
(A2N) = 2-aminoadenine nucieotide en c»
The alpha-ENaC RNAi agents disclosed herein are formed by annealmg an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3. provided the two sequences hâve a région of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucléotide sequence.
In some embodiments, the antisense strand of an alpha-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucléotides from any of the antisense strand sequences in Table 3. In some embodiments, the sense strand of an alpha-ENaC RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucléotides from any of the sense strand sequences in Table 4.
In some embodiments, an alpha-ENaC RNAi agent antisense strand comprises a nucléotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, an alphaENaC RNAi agent antisense strand comprises the sequence of nucléotides (from 5’ end 3’ end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 124, or 2-24 of any of the sequences in Table 2 or Table 3. In certain embodiments, an alphaENaC RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3.
In some embodiments, an alpha-ENaC RNAi agent sense strand comprises the nucléotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, an alphaENaC RNAi agent sense strand comprises the sequence of nucléotides (from 5’ end -> 3’ end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 324, or 4-24, of any of the sequences in Table 2 or Table 4. In certain embodiments, an alphaENaC RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3.
For the RNAi agents disclosed herein, the nucléotide at position 1 of the antisense strand (from 5' end -> 3' end) can be perfeclly complementary to the alpha-ENaC gene, or can be non-complementary to the alpha-ENaC gene. In some embodiments, the nucléotide at position I of the antisense strand (from 5' end 3' end) is a U, A, or dT (or a modified version of U, A or dT). In some embodiments, the nucléotide at position 1 of the antisense strand (from 5’ end 3’ end) forms an A:U or U: A base pair with the sense strand.
In some embodiments, an alpha-ENaC RNAi agent antisense strand comprises the sequence of nucléotides (from 5' end -> 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, an alpha-ENaC RNAi sense strand comprises the sequence of nucléotides (from 5’ end 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2 or Table 4.
In some embodiments, an alpha-ENaC RNAi agent includes (i) an antisense strand comprising the sequence of nucléotides (from 5' end -> 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucléotides (from 5' end 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2 or Table 4.
A sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in fable 2 or Table 3 provided the two sequences hâve a région of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleoüde sequence. In some embodiments, the alpha-ENaC RNAi agent has a sense strand consisting of the modifîed sequence of any of the modifîed sequences in Table 4, and an antisense strand consisting of the modifîed sequence of any of the modifîed sequences in Table 3. Certain représentative sequence pairings are exemplifïed by the Duplex ID Nos. shown in Table 5.
hi some embodiments, an alpha-ENaC RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the Duplex ID Nos. presented herein. In some embodiments, an alpha-ENaC RNAi agent consists of any of the Duplex ID Nos. presented herein. In some embodiments, an alpha-ENaC RNAi agent comprises the sense strand and antisense strand nucléotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, an alpha-ENaC RNAi agent comprises the sense strand and antisense strand nucléotide sequences of any of the .Duplex ID Nos. presented herein and a targeting group, linking group, and/or other non-nucieotide group wherein the targeting group, linking group, and/or other non-nucieotide group is covalently hnked (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, an alphaENaC RNAi agent includes the sense strand and antisense strand modified nucléotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, an alphaENaC RNAi agent comprises the sense strand and antisense strand modified nucléotide sequences of any of the Duplex ID Nos. presented herein and a targeting group, linking group, and/or other non-nucleotide group, wherein the targeting group, linking group, and/or other non-nucleotide group is covalently linked to the sense strand or the antisense strand.
In some embodiments, an alpha-ENaC RNAi agent comprises fin antisense strand and a sense strand having the nucléotide sequences of any of the antisense strand/sense strand duplexes of Table 2 or Table 5, and further comprises a targeting group. In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand and a sense strand having the nucléotide sequences of any of the antisense strand/sense strand duplexes of 'fable 2 or Table 5, and further comprises one or more ανβό integrin targeting ligands.
In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand and a sense strand having the nucléotide sequences of any of the antisense strand/sense strand duplexes of Table 2 or Table 5, and further comprises a targeting group that is an integrin targeting ligand. In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand and a sense strand having the nucléotide sequences of any of the antisense strand/sense strand duplexes of Table 2 or Table 5, and further comprises one or more ανβό integrin targeting ligands or clusters of ανβό integrin targeting ligands (e.g., a tridentate ανβό integrin targeting ligand).
In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand and a sense strand having the modified nucléotide sequences of any of the antisense strand/sense strand duplexes of Table 5.
In some embodiments, an alpha-ENaC RNAi agent comprises an antisense strand and a sense strand having the modified nucléotide sequences of any of the antisense strand/sense strand duplexes of Table 5, and further comprises an integrin targeting ligand.
In some embodiments, an alpha-ENaC RNAi agent comprises, consists of, or consists essentially of any of the duplexes of Table 5.
Strand ID Numbers
Duplex ID Antisense Strand ID Sense Strand ID
AD04019 AM04730-AS AM05073-SS
AD04020 AM04730-AS AM05074-SS
AD04021 AD04022 _AM050_80-AS AM05081-AS” AM05074-SS “ÀMÔ5Ô74^S“
AD04023 AM05082-AS AM05074-SS
AD04024 AM05083-AS AM05075-SS
AD04025 AM05084-AS AM05074-SS
AD04026 AM05085-AS AM05077-SS
AD04526 AM05772-AS AM05787-SS
AD04527 AM05773-AS AM05788-SS
AD04528 AM05774-AS AM05789-SS
AD04529 AM05775-AS AM05790-SS
AD04530 AM05776-AS AM05791-SS
AD04531 AM05777-AS AM05792-SS
AD04532 AM05778-AS AM05793-SS
AD04533 AM05779-AS AM05794-SS
AD04534 AM05780-AS AM05795-SS
AD04535 AM05781-AS AM05796-SS
AD04536 AM05782-AS AM05792-SS
AD04537 AM05783-AS AM05793-SS
AD04538 AM05784-AS AM05794-SS
AD04539 AM0578.5-AS AM05795-SS
AD04540 AM05786-AS AM05796-SS
AD04835 AM05917-AS AM05487-SS
AD04858 AM05917-AS AM05074-SS
AD04859 AM06240-AS AM06162-SS
AD04976 AM06460-AS AM06459-SS
AD04977 AM06461-AS AM06459-SS
AD04978 AM05916-AS AM06459-SS
AD04979 AM06462-AS AM06459-SS
AD04980 AM06462-AS AM06246-SS
AD05116 AM06691-AS AM06690-SS
AD05117 AM06693-AS AM06692-SS
AD05118 AM06695-AS AM06694-SS
AD05119 AM06697-AS AM06696-SS
AD05120 AM06699-AS AM06698-SS
AD05121 AM06701-AS AM06700-SS
AD05160 AM06240-AS AM06459-SS
Table 5. Alpha-ENaC RNAi Agent Duplexes with Corresponding Sense and Antisense
Duplex Antisense Sense Strand
I» Strand ID ID
AD05161 AM06765-AS AM06459-SS
AD05162 AM06766-AS AM06459-SS
AD05163 AM06767-AS AM06459-SS
AD05345 AM05917-AS AM07064-SS
AD05346 AM07066-AS AM07065-SS
AD05347 AM07066-AS AM07067-SS
AD05426 AM07066-AS AM07169-SS
AD05427 AM07170-AS AM07065-SS
AD05428 AM07066-AS AM07171-SS
AD05429 AM07066-AS AM07172-SS
AD05430 AM07174-AS AM07173-SS
AD05453 AM07200-AS AM07067-SS
AD05454 AM07200-AS AM07201-SS
AD05455 AM07200-AS AM07202-SS
AD05456 AM07200-AS AM07203-SS
AD05457 AM07204-AS AM07067-SS
AD05458 AM07206-AS AM07205-SS
AD05459 AM07208-AS AM07207-SS
AD05471 AM07066-AS AM07217-SS
AD05472 AM07066-AS .AM07218-SS
AD05473 AM07200-AS AM07217-SS
AD05474 AM07200-AS AM07218-SS
AD05515 AM05081-AS AM07276-SS
AD05548 AM07200-AS AM07280-SS
AD05549 AM07200-AS /VM07281-SS
AD05558 AM07200-AS AM07329-SS
AD05559 AM07200-AS AM07330-SS
AD05560 AM07200-AS AM07331-SS
AD05561 AM07333-AS AM07332-SS
AD05562 AM07335-AS AM07334-SS
AD05563 AM07335-AS AM07336-SS
AD05564 AM07335-AS AM07337-SS
AD05565 AM07335-AS AM07338-SS
AD05566 AM07340-AS AM07339-SS
AD05567 AM07200-AS /W07341-SS
AD05568 AM07200-AS AM07172-SS
AD05569 AM07200-AS AM07342-SS
AD05570 AM07200-AS AM07343-SS
Duplex ID Antisense Strand ÏD Sense Strand ID
ADOS 571 AM07200-AS AM07344-SS
AD05611 AM07200-AS AM07400-SS
AD05612 AM07200-AS AM07401-SS
AD05613 AM07200-AS AM07402-SS
AD05618 AM07409-AS AM07067-SS
AD05619 AM07410-AS AM07067-SS
AD05622 AM07411-AS AM07067-SS
AD05 623 AM07412-AS AM07067-SS
AD05625 AM05081-AS AM05487-SS
AD0567I AM07484-AS AM07067-SS
AD05672 AM07485-AS AM07067-SS
AD05673 AM07485-AS AM07486-SS
AD05683 AM07174-AS AM07334-SS
AD05684 AM07335-AS AM07495-SS
AD05685 AM07496-AS AM07495-SS
AD05686 AM07497-AS AM07334-SS
AD05687 AM07496-AS AM07498-SS
AD05688 AM07174-AS AM07337-SS
AD05689 AM07335-AS AM07499-SS
AD05690 AM07496-AS AM07499-SS
ADOS 691 AM07497-AS AM07337-SS
AD05757 AM07200-AS AM07594-SS
AD05758 AM07200-AS· AM07595-SS
ADOS 772 AM07605-AS AM05487-SS
AD05773 AM05081-AS AM07606-SS
AD05778 AM07200-AS AM07611-SS
AD05779 AM07200-AS AM07612-SS
AD05829 AM06691-AS AM07665-SS
AD05830 AM05774-AS AM07666-SS
ADOS 831 AM05774-AS AM07667-SS
ADOS 832 AM07669-AS AM07668-SS
AD05833 AM07669-AS AM07670-SS
AD05924 AM07200-AS AM07807-SS
In some embodiments, an alpha-ENaC RNAi agent is prepared or provided as a sait, mixed sait, or a free-acid. The RNAi agents described herein, upon delivery to a cell expressing an alpha-ENaC gene, inhibit or knockdown expression of one or more alpha-ENaC genes in vivo and/or in vitro.
Targeting Groups, Linking Groups, Pharmacokinetic (PK) Modulators, and Delivery Vehicles ïn some embodiments, an alpha-ENaC RNAi agent contains or is conjugated to one or more non-nucleotide groups including, but not limited to, a targeting group, a linking group, a pharmacokinetic (PK) modulator, a delivery polymer, or a delivery vehicle. The nonnucleotide group can enhance targeting, delivery-, or attachaient of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 6. The non-nucleotide group can 1Q be covalently linked to the 3’ and/or 5' end of either the sense strand and/or the antisense strand. In some embodiments, an alpha-ENaC RNAi agent contains a non-nucleotide group linked to the 3' and/or 5' end of the sense strand. In some embodiments, a non-nucleotide group is linked to the 5' end of an alpha-ENaC RNAi agent sense strand. A non-nucleotide group can be linked directly or indirectly to the RNAi agent via a linker/linking group. In Ί 5 some embodiments, a non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or réversible bond or linker.
In some embodiments, a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an RNAi agent or conjugale to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the conjugale. In sorne embodiments, a non-nucleotide group enhances endocytosis of the RNAi agent.
Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of a conjugale or RNAi agent to which they are attached to improve cell-specific (including, in some cases, organ spécifie) distribution and cell-specific (or organ spécifie) uptake of the conjugale or RNAi agent. A targeting group can be monovalent, divalent, (rivaient, tetravalent, or hâve higher valency for the target to which it is directed.
Représentative targeting groups include, without limitation, compounds with affinity to cell surface molécule, cell receptor ligands, hapten, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molécules. In some embodiments, a targeting group is linked to an RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and/or ribilol (abasic ribose) residues, which in some instances can serve as linkers. In some embodiments, a targeting group comprises an integrin targeting ligand.
The alpha-ENaC RNAi agents described herein can be synthesized having a reactive group, such as an amino group (also referred to herein as an amine), at the 5'-terminus and/or the 3'terminus. The reactive group can be used subsequently to attach a targeting moiety using methods typical in the art.
For example, in some embodiments, the alpha-ENaC RNAi agents disclosed herein are 10 synthesized having an NH2-C6 group at the 5'-terminus of the sense strand of the RNAi agent.
The terminal amino group subsequently can be reacted to form. a conjugate with, for example, a group that includes an ανβό integrin targeting ligand. In some embodiments, the alphaENaC RNAi agents disclosed herein are synthesized having one or more alkynegroups at die 5'-terminus of the sense strand of the RNAi agent. The terminal alkyne group(s) can 15 subsequently be reacted to form a conjugate with, for example, a group that includes an ανβό integrin targeting ligand.
In some embodiments, a targeting group comprises an integrin targeting ligand. In some embodiments, an integrin targeting ligand is an ανβό integrin targeting ligand. The use of an ανβό integrin targeting ligand facilitâtes cell-specific targeting to cells having ανβό on its respective surface, and binding of the integrin targeting ligand can facilitate entry of the 20 therapeutic agent, such as an RNAi agent, to which it is linked, into cells such as épithélial ceils, including pulmonary épithélial cells and rénal épithélial cells. Integrin targeting ligands can be monomeric or monovalent (e.g., having a single integrin targeting moiety) or multimeric or multivalent (e.g., having multiple integrin targeting moieties). The targeting group can be attached to the 3' and/or 5' end of the RNAi oligonucleotide using methods 25 known in the art. The préparation of targeting groups, such as ανβό integrin targeting ligands, is described, for example, in International Patent Application Publication No. WO 2018/085415 and in U.S. Provisional Patent Application Nos. 62/580,398 and 62/646,739, the contents of each of which are incorporated herein in its entirety.
Embodiments of the présent disclosure include pharmaceutical compositions for delivering an alpha-ENaC RNAi agent to a pulmonaiy épithélial cell in vivo. Such pharmaceutical compositions can include, for example, an alpha-ENaC RNAi agent conjugated to a targeting group that comprises an integrin targeting ligand. In some embodiments, the integrin targeting 5 ligand is comprised of an ανβό integrin ligand.
In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitâtes covalent linkage of the agent to a targeting group, pharmacokinetic modulator, delivery polymer, or delivery vehicle. The linking group can be linked to the 3' and/or the 5' end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking Ί Q group is linked to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to tire 5' or 3' end of an RNAi agent sense strand. In some embodiments, a linking group is conjugated to the 5' end of an RNAi agent sense strand. Examples of linking groups, include, but are not limited to: Alk-SMPT-C6, Alk-SS-C6, DBCO-TEG, Me-Alk-SS-C6, and C6-SS-Alk-Me, reactive groups such a primary amines and alkynes, alkyl groups, abasic 15 residues/nucleotides, amino acids, tri-alkyne functionalized groups, ribitol, and/or PEG groups.
A linker or linking group is a connection between two atoms that links one Chemical group (such as an RNAi agent) or segment of interest to another Chemical group (such as a targeting group, pharmacokinetic modulator, or delivery' polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. A linkage can optionally include 20 a spacer that increases the distance between the two joined atoms. A spacer may further add flexibilité' and/or length to the linkage. Spacers include, but are not be limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucléotides, and saccharides. Spacer groups are well known in the art and the preceding list 25 is not meant to limit the scope of the description.
In some embodiments, targeting groups are linked to the alpha-ENaC RNAi agents without the use of an additional linker. In some embodiments, the targeting group is designed having a linker readily présent to facilitate the linkage to an alpha-ENaC RNAi agent. In some embodiments, when two or more RNAi agents are inciuded in a composition, the two or more
RNAi agents can be linked to their respective targeting groups usingthe same linkers. In some embodiments, when two or more RNAi agents are included in a composition, the two or more RNAi agents are linked to their respective targeting groups using different linkers.
Any ofthe alpha-ENaC RNAi agent nucléotide sequences listed in Tables 2, 3, and 4, whether 5 modifîed or unmodrfied, can contain 3' and/or 5' targeting group(s), linking group(s), and/or pharmacokinetic modulator(s). Any of the alpha-ENaC RNAi agent sequences listed in Tables 3 and 4, or are otherwise described herein, which contain a 3' or 5' targeting group, linking group, or pharmacokinetic modulator can altematively contain no 3' or 5' targeting group, linking group, or pharmacokinetic modulator, or can contain a different 3' or 5' Ί Q targeting group, linking group, or pharmacokinetic modulator including, but not limited to, those depicted in Table 6. Any of the alpha-ENaC RNAi agent duplexes listed in Table 5, whether modifîed or unmodified, can further comprise a targeting group or linking group, including, but not limited to, those depicted in Table 6, and the targeting group or linking group can be attached to the 3' or 5' terminus of either the sense strand or the antisense strand 15 of the alpha-ENaC RNAi agent duplex.
Examples of certain targeting groups and linking groups are provided in Table 6.
Table 6. Structures Representing Various Modifîed Nucléotides, Targeting Groups, and
When positioned intemally in oligonucleotide:
Iinkage towards 5’ end of oligonucleotide
end of
Iinkage towards 3' oligonucleotide (invAb)
When positioned internally in oligonucleotide:
Iinkage towards 5' end of oligonucleotide
end of
Iinkage towards 3' oligonucleotide (invAb)s
When positioned at the 3' terminal end of oligonucleotide:
linkage towards 5‘ end of oligonucleotide
HO
When positioned at the 3' terminal end of oligonucleotide:
(C6-SS-C6)
When positioned intemally in oligonucleotide:
linkage towards 5' end of oligonucleotide linkage towards 3' end of oligonucleotide
(C6-SS-C6)
When positioned atthe 3' terminal end of oligonucleotide:
(TriAlkl)
(TriAlkl )s
(TriAlk2)
(TriAlk2)s
(TriAlkô)
(TriAIk6)s
(TriAlklO)s
(TriAlkll)
(TriAlkl l)s
(TriAlkl2)
Altematively, other linking groups known in the art may be used.
In some embodiments, a delivery vehicle may be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of the RNAi agent to a cell or tissue. A delivery vehicle can include, or consist of, but is not limited to: a polymer, such 5 as an amphipathic polymer, a membrane active polymer, a peptide, a mehttin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine.
In some embodiments, the RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery Systems avatlable in the art. The RNAi 1Q agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholestérol and cholesteryl dérivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example WO 2000/053722, WO 2008/022309, WO 2011/104169, and WO 2012/083185, WO 2013/032829, WO 2013/158141, each of which is incorporaled herein by reference), or other delivery Systems available in the art.
Pharmaceutical Compositions and Formulations
The alpha-ENaC RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as '‘médicaments”). In some embodiments, pharmaceutical compositions include at least one alpha-ENaC RNAi agent. These pharmaceutical compositions are particularly useful in the inhibition of the expression 5 of alpha-ENaC mRNA in a target ceil, a group of cells, a tissue, or an organism. The pharmaceutical compositions can be used to treat a subject having a disease, disorder, or condition that would beneiït from réduction in the level of the target mRNA, or inhibition in expression of the target gene. The pharmaceutical compositions can be used to treat a subject at risk of developing a disease or disorder that would benefit from réduction of the level of 1Q the target mRNA or an inhibition in expression the target gene. In one embodiment, the method includes administering an alpha-ENaC RNAi agent linked to a targeting ligand as described herein, to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and/or delivery polymers) are added to the pharmaceutical compositions that include an alpha-ENaC RNAi 15 agent, thereby forming a pharmaceutical formulation or médicament suitable for in vivo delivery to a subject, including a human.
The pharmaceutical compositions that include an alpha-ENaC RNAi agent and methods disclosed herein decrease the level of the target mRN A in a cell, group of cells, group of cells, tissue, organ, or subject, including by administering to the subject a therapeutically effective 2Q amount of a herein described alpha-ENaC RNAi agent, thereby inhibiting the expression of alpha-ENaC mRNA in the subject. In some embodiments, the subject has been previously identified or diagnosed as having a disease or disorder that is mediated at least in part by ENaC expression. In some embodiments, the subject has been previously identified or diagnosed as having enhanced ENaC activity in one or more cells or tissues. In. some 25 embodiments, the subject has been previously diagnosed with having one or more respiratory diseuses such as cystic fîbrosis, chrome bronchitis, non-cystic fîbrosis bronchiectasis, chrome obstructive pulmonary disease (COPD), asthma, respiratory tract infections, primary ciliary dyskinesia, and iung carcinoma cystic fîbrosis. In some embodiments, the subject has been previously diagnosed with having one or more ocular diseases such as dry eye. In some embodiments, the subject has been suffering from symptoms associated with one or more respiratory diseases that is associated with or caused by enhanced ENaC activity.
In some embodiments, the described pharmaceutical compositions including an alpha-ENaC RNAi agent are used for treating or managing clinical présentations in a subject that would 5 benefit from the inhibition of expression of ENaC. In some embodiments, a therapeutically or prophylactically effective amount of one or more of pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed alpha-ENaC RNAi agents can be used to decrease the number, severity, and/or frequency of symptoms of a disease in a subject.
The described pharmaceutical compositions that include an alpha-ENaC RNAi agent can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from réduction or inhibition in expression of alpha-ENaC mRNA. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions that include an alpha-ENaC RNAi agent thereby treating the symptom. In other 15 embodiments, the subject is administered a prophylactically effective amount of one or more alpha-ENaC RNAi agents, thereby preventing or inhibiting the at least one symptom.
The route of administration is the path by which an alpha-ENaC RNAi agent is brought into contact with the body. In general, methods of administering drugs, oligonucleotides, and nucleic acids, for treatment of a mammal are well known in the art and can be applied to 20 administration of the compositions described herein. The alpha-ENaC RNAi agents disclosed herein can be administered via any suitable route in a préparation appropriately tailored to the particular route. Thus, in some embodiments, the herein described pharmaceutical compositions are administered via inhalation, intranasal administration, intratracheal administration, or oropharyngeal aspiration administration. In some embodiments, the 25 pharmaceutical compositions can be administered by injection, for example, intravenously, intramuscularly, intracutaneously, subcutaneously, intraarticularly, or intraperitoneally, or topically.
The pharmaceutical compositions including an alpha-ENaC RNAi agent described herein can be delivered to a cell, group of cells, tissue, or subject usmg oligonucleotide delivery technologies known in the art. In general, any suitable method recognized in the art for delivering a nucleic acid molécule (in vitro or in vivo) can be adapied for use with the compositions descnbed herein. For example, delivery can be by local administration, (e.g., direct injection, implantation, or topical administering), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parentéral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), inlramuscular, transdermal, aimay (aérosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In some embodiments, the compositions are administered via inhalation, intranasal administration, oropharyngeal aspiration administration, or mtratracheal administration. For example, in some embodiments. it is desired that the alpha-ENaC RNAi agents described herein inhibât the expression of an alpha-ENaC gene in the pulmonaiy epithelium, for which administration via inhalation (e.g., by an inhaler device, such as a metered-dose inhaler, or a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler) is particularly suitable and advantageous.
In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.
As used herein, a pharmaceutical composition or médicament includes a pharmacologically effective amount of at least one of the described therapeutic compounds and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than the Active Pharmaceutical Ingrédient (API, therapeutic product, e.g., alpha-ENaC RNAi agent) that are intentionally included in the drug delivery' System. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage. Excipients can act to a) aid in processing of the drug delivery System during manufacture, b) protect, support or enhance stability, bioavailability or patient acceptability of the API, c) assis! in product identification, and/or d) enhance any other attribute of the overall safety, effectiveness, of delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.
Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti-foaming agents, anti-oxidants, bmders, buffermg agents, carriers, coating agents, colors, delivery enhancers, deliveiy polymers, détergents, dextran, dextrose, diïuents, désintégrants, emulsifiers, extenders, fillers, flavors, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickening agents, tomcity agents, vehicles, water-repeliing agents, and wetting agents.
Pharmaceutical compositions suitable for injectable use include stérile aqueous solutions (where water-soluble) or dispersions and stérile powders for the extemporaneous préparation of stérile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, éthanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be préférable to include isotonie agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
Stérile injectable solutions can be prepared by incorporating the active compound in the required amount in. an appropriais solvent with one or a combination of ingrédients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating tire active compound into a stérile vehicie which contains a basic dispersion medium and the required other ingrédients from those enumerated above. In the case of stérile powders for the préparation of stérile injectable solutions, methods of préparation include vacuum drying and freeze-diying which yields a powder of the active ingrédient plus any additional desired ingrédient from a previously sterile-filtered solution thereof.
Formulations suitable for intra-articular administration can be in the form of a stérile aqueous préparation of the drug that can be in microcryslahme form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodégradable polymer Systems can also be used to présent the drug for both intra-articular and ophthalmic administration.
Formulations suitable for inhalation administration can be prepared by incorporating the active compound in the desired amount in an appropriate solvent, followed by stérile filtration. In general, formulations for inhalation administration are stérile solutions at physiological pH and hâve low viscosity (< 5 cP). Salis may be added to the formulation to balance tonicity. In some cases, surfactants or co-solvents can be added to mcrease active 10 compound solubility and improve aérosol characteristics. In some cases, excipients can be added to control viscosity in order to ensure size and distribution of nebulized droplets.
The active compounds can be prepared with carriers that will protect the compound against rapid élimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery Systems. Biodégradable, biocompatible polymers can be 15 used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for préparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the ait, for example, as described in U. S. Patent No. 4,522,811.
The alpha-ENaC RNAi agents can be formulated in compositions in dosage unit form for ease of administration and unifomiity of dosage. Dosage unit form refers to physicaliy discrète umts suited as unitary dosages for the subject to be treated; each unit containing a predetermined. quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The spécification for the 25 dosage unit forms of the disclosure are dictated by and directly dépendent on the unique characteristics of the active compound and the therapeutic effect to be achieved, and the limitations inhérent in the art of compounding such an active compound for the treatmeni of individuais.
A pharmaceutical composition can contain other additionai components commonly round in pharmaceutical compositions. Such additionai components include. but are not limited to: anti-pruritics, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamine, diphenhydramine, etc.). It is also envisioned that cells, tissues, or isolated organs that express or comprise the herein defîned RNAi agents may be used as '‘pharmaceutical compositions.” As usedherein, “pharmacologicaliy effective amount,” “therapeuticaily effective amount,” or simply “effective amount” refers to that amount of an RNAi agent to produce a pharmacologicai, therapeutic, or préventive resuit.
In some embodiments, the methods disclosed herein further comprise the step of admimstering a second therapeutic or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic is another alpha-ENaC RNAi agent (e.g., an alpha-ENaC RNAi agent that targets a different sequence within the alphaENaC target). In other embodiments, the second therapeutic can be a small molécule drug, an antibody, an antibody fragment, and-'or an aptamer.
Generally, an effective amount of an alpha-ENaC RNAi agent disclosed herein will be in the range of from about 0.0001 to about 20 mg/kg of body weight/day, e.g., from about 0.001 to about 3 mg/kg of body weight/day. In some embodiments, an effective amount of an alphaENaC RNAi agent will be in the range of from about 0.001 to about 0.500 mg/kg of body weight per dose. In some embodiments, an effective amount of an alpha-ENaC RNAi agent will be in the range of from about 0.001 to about 0.100 mg/kg of body weight per dose. In some embodiments, an effective amount of an alpha-ENaC RNAi agent will be in the range of from about 0.001 to about 0.050 mg/kg of body weight per dose. The amount administered will also iikely dépend on such variables as the overali health status of the patient, the relative biological efficacy of the compound delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. Also, it is to be understood that the initial dosage administered can be increased beyond the above upper level to rapidly achieve the desired blood-level or tissue level, or the initiai dosage can be smaller than the optimum.
For treatment of disease or for formation of a médicament or composition for treatment of a disease, the pharmaceutical compositions described herein including an alpha-ENaC RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment including, but not Iimited lo: a second or other RNAi agent, a smali molécule drug, an antibodv, an antibody fragment, peptide, and/or an aptamer.
The described alpha-ENaC RNAi agents, when added to pharmaceutically acceptable excipients or adjuvants, can be packaged into kits, containers, packs, or dispensera. The phannaceutical compositions described herein can be packaged in dry powder or aérosol inhalera, other metered-dose inhalera, nebulizers, pre-fdled syrmges, or vials.
Methods of Treatment and Inhibition of Expression
The alpha-ENaC RNAi agents disclosed herein can be used to treat a subject (e.g., a human 3 or other mammal) having a disease or disorder that would benefit from administration of the
RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) that would benefit from a réduction and/or inhibition in expression of alpha-ENaC mRNA.
In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., 5 a human) having a disease or disorder for which the subject would benefit from réduction in
ENaC channel activity, including but not Iimited to, for example, cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratoiy tract infections, primary ciliary dyskinesia, and/or lung carcinoma cystic fibrosis andfor dry eye. Treatment of a subject can include therapeutic and/or 20 prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more alpha-ENaC RN Ai agents described herein. The subject can be ahuman, patient, or human patient. The subject may be an adult, adolescent, child, or infant, zkdministration of a pharmaceutical composition described herein can be to a human being or animai.
Increased ENaC activity is known to promote airway surface liquid déhydration and impair 25 mucociliary clearance. In some embodiments, the described alpha-ENaC RNAi agents are used to treat at least one symptom mediated at least in part by ENaC activity levels, in a subject. The subject is administered a therapeutically effective amount of any one or more of the described alpha-ENaC RNAi agents. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described RNAi agents, thereby treating the subject by preventing or inhibiting the at least one symptom.
In certain embodiments, the présent disclosure provides methods for treatment of diseases, disorders, conditions, or pathological States mediated at least in part by alpha-ENaC gene 5 expression, in a patient in need thereof, wherein the methods include administering to the patient any of the alpha-ENaC RNAi agents described herein.
In some embodiments, the alpha-ENaC RNAi agents are used to treat or manage a clinical présentation or pathological State in a subject, wherein the clinical présentation or pathological State is mediated at least in part by ENaC expression. The subject is administered j q a therapeutically effective amount of one or more of the alpha-ENaC RNAi agents or alphaENaC RNAi agent-containing compositions described herein. In some embodiments, the method comprises administering a. composition comprising an alpha-ENaC RNAi agent described herein to a subj ect to be treated.
In some embodiments, the gene expression level and/or mRNA level of an alpha-ENaC gene 15 in certain épithélial cells of subject to whom a described alpha-ENaC RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%, relative to the subject prior to being administered the alpha-ENaC RNAi agent or to a subject not receiving the alpha-ENaC RNAi agent. In some embodiments, the ENaC 20 levels or ENaC channel activity levels in certain épithélial cells of a subject to whom a described alpha-ENaC RN Ai agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99%, relative to the subject prior to being administered the alpha-ENaC RNAi agent or to asubject not receiving the alpha-ENaC RNAi 25 agent. The gene expression level, protein level, and/or mRNA level in the subject may be reduced in a cell, group of cells, and/or tissue of the subject. In some embodiments, the alphaENaC mRNA levels in certain épithélial cells subject to whom a described alpha-ENaC RNAi agent bas been administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject prior to being 30 administered the alpha-ENaC RNAi agent or to a subject not receiving the alpha-ENaC RNAi agent. In some embodiments, the level oi the ENaC heterotrimeric protein complex in certain épithélial cells in a subject to whom a described alpha-ENaC RNAi agent has been administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject prior to being administered the alpha-ENaC RNAi agent or to a subject not receiving the alpha-ENaC RNAi agent. The ENaC level in the subject may be reduced in a cell, group of cells, tissue, blood, and/or other fluid of the subject. For example, in some embodiments, the level of alpha-ENaC mRNA and/or ENaC heterotrimeric protein complex in pulmonary épithélial cells of a subject to whom a described alpha-ENaC RNAi agent has been administered is reduced by ai least about 30%, 35%, 40%, 45%, 50%, 55%. 60%, 65%, 70%, 75%. 80%, 85%, 90%, 95%, or 98% relative to the subject prior to being administered the alpha-ENaC RNAi agent or to a subject not receiving the alpha-ENaC RNAi agent. In some embodiments, the level of alpha-ENaC mRNA and/or ENaC heterotrimeric protein complex and/or ENaC channel activity levels in a subset of pulmonary épithélial cells, such as airway épithélial cells, of a subject to whom a described alpha-ENaC RNAi agent has been administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%. 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject prior to being administered the alpha-ENaC RNAi agent or to a subject not receiving the alpha-ENaC RNAi agent.
A réduction in gene expression, mRNA, and protein levels can be assessed by any methods known in the art. Réduction or decrease in alpha-ENaC mRNA level, ENaC channel activity level, and/or ENaC heterotrimeric protein complex levels, are collectively referred to herein as a réduction or decrease in alpha-ENaC or inhibiting or reducing the expression ofthe alphaENaC gene. The Examples set forth herein illustrais known methods for assessing inhibition of alpha-ENaC gene expression.
Cells, Tissues, Organs, and Non-Human Organisais
Cells, tissues, organs, and non-human organisais that include at least one of the alpha-ENaC RNAi agents described herein are contempiated. The cell, tissue, organ, or non-human organisai is made by delivering the RNAi agent, to the cell, tissue, organ, or non-human organisai.
The above provided embodiments and items are now iliustrated with the following, nonlimiting examples.
Examples
Example 1. Synthesis of alpha-ENaC RNAi Agents.
The Alpha-ENaC RNAi agent duplexes shown in Table 5 were synthesized in accordance with the following:
A. Synthesis. The sense and antisense strands of the alpha-ENaC RNAi agents were synthesized according to phosphoramidite technology on solid phase used in oligonucleotide synthesis. Depending on the scale, a MerMade96E® (Bioautomation), a MerMadel2® (Bioautomation), or an OP Pilot 100 (GE Healthcare) was used. Synthèses were performed on a solid support made of controlled pore glass (CPG, 500 Â or 600Â, obtained from Prime
Synthesis, Aston, PA, USA). Ail RNA and 2'-modifîed RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2'-Omethyl phosphoramidites that were used included the following: (5'-O-dimethoxytrityl-N*>(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5'-O-dimethoxy-trityl-N4-(acetyl)-2M3-methyl-cytidine-3'-O-(2-cyanoethyl-N,N15 diisopropyl-amino) phosphoramidite, (5'-O-dimethoxytrityl-N2-(isobutyryl)-2'-O-methylguanosine-3'-O-(2-cyanoethyl-N,N-diisopropy1amino) phosphoramidite, and 5'-OdimethoxytntyI-2'-O-methyl-uridme-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2f-deoxy-2'-fluoro-phosphoramidites carried the same protecting groups as the 2'-O-methyl RNA amidites. 5’-dimethoxytrityl-2'-O-methyl-inosine-3’-O-(220 cyanœfliyl-NJX-diisopropylamino) phosphoramidites were purchased from Glen Research (Virginia). The inverted abasic (3'-O-dim.ethoxytrityd-2'-deoxyribose-5'-O-(2-cyanoethyl-N,Ndiisopropylamino) phosphoramidites were purchased from ChemGenes (Wilmington, MA, USA). The following UNA phosphoramidites were used: 5^4,4'-Dimethoxytrityl)-N6(benzoyl)-2',3'-seco-adenosine, 2'-benzoyl-34(2-cyanoethyl)-(N,N-diisopropyl)]25 phosphoramidite, 5'-(4,4'-Dimethoxytrityl)-N-acetyl-2',3'-seco-cytosine, 2'-benzoyl-3'-[(2cyanoethyl)-(N,N-diiso-propyl)]-phosphoramidite, 5'-(4,4'-Dimedioxytrityl)-N-isobutyryi2',3'-seco-guanosine, 2M>enzoyl-34(2-cyanoetbyI)-(N,N-diisopropyl)]-phosphoramidite, and 5M4,4'-Dmiethoxy-tntyl)-2',3'~seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N- diiso propyl)|-phosphoramidite. TFA aminolink phosphoramidites were also commercially purchased (ThermoFisher).
Tri-alkyne-containing phosphoramidites were dissoived in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while ail other amidites were dissoived in anhydrous 5 acetonitrile (50 mM) and molecular sieves (3Â) were added. 5-Benzylthio-lH-tetrazoIe (BTT, 250 mM in acetonitrile) or 5-Ethylthio-lH-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 minutes (RNA), 90 seconds (2' OMe), and 60 seconds (2' F). ïn order to introduce phosphorothioate linkages, a 100 mM solutionof3-phenyl l,2,4-dithiazoline-5-one(POS, obtained fromPolyOrg, Inc., Leominster, 10 MA, USA) in anhydrous acetonitrile was employed.
Altematively, tri-alkyne moieties were introduced post-synthetically (see section E, below). For this route, the sense strand was functionalized with a 5' and/or 3' terminal nucléotide containing a primary amine. TFA aminolink phosphoramidite was dissoived in anhydrous acetonitrile (50 mM) and molecular sieves (3Â) were added. 5-Benzylthio-lH-tetrazole 15 (BTT, 250 mM in acetonitrile) or 5-Ethylthio-lH-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 10 minutes (RNA), 90 seconds (2' OMe), and 60 seconds (2' F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl l,2,4-dithiazoiine-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was employed.
2Q B. Cleavage and deprotection of support bound oligomer. After finalization of the solid phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt. % methylamine in water and 28% to 31 % ammonium hydroxide solution (Aldrich) for 1.5 hours at 30°C. The solution was evaporated and the solid residue was reconstituted in water (see below·).
C. Purification. Crude oligomers were purified by anionic exchange HPLC using a TSKgel SuperQ-5PW 13pm column and Shimadzu LC-8 System. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% Acetonitrile and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled then run on size exclusion HPLC using a GE Healthcare XK 16/40 column packed with Sephadex G-25 fine with a running buffer of lOOmM ammonium bicarbonate. pH 6.7 and 20% Acetonilrile or fîltered water. Altematively, pooled fractions were desalted and exchanged into an appropriais buffer or solvent System via tangential flow filtration.
D. Annealing Complementary strands were mixed by combining equimolar RNA 5 solutions (sense and antisense) in 1 χ PBS (Phosphate-Buffered Saline, 1 χ, Corning, Ceilgro) to form the RNAi agents. Some RNAi agents were lyophilized and stored at -15 to -25°C. Duplex concentration was determined by measuring the solution absorbance on a UV-Vis spectrometer in lx PBS. The solution absorbance at 260 nm was then multiplied by a conversion factor and the dilution factor to détermine the duplex concentration. Unless 10 otherwise stated, the conversion factor used was 0.037 mg/(mL-cm).
E. Conjugation of Tri-alkyne linker. Either prior to or after annealing, the 5' or 3' amine functionalized sense strand is conjugated to a tri-alkyne linker. An example tri-alkyne linker structure that can be used in forming the constructs disclosed herein is as follows:
The following describes the conjugation of tri-alkyne linker to the annealed duplex: Amine-functionalized duplex was dissolved in 90%
DMSO/10% H2O, at -50-70 mg/mL. 40 équivalents triethylamine was added, followed by 3 équivalents tri-alkyne-PNP. Once complété, the conjugate was precipitated twice in a solvent System of lx phosphate buffered saline/acetonitrile (1:14 ratio), and dried.
F. Conjugation of Targeting Ligands. Either prior to or after annealing, the 5' or 3' tridentate alkyne functionalized sense strand is conjugated to targeting ligands. The following 20 example describes the conjugation of targeting ligands to the annealed duplex: Stock solutions of 0.5M Tris(3-hydroxypropyltriazolylmethyl)amme (ΤΗΡΤΑ), 0.5M of Cu(II) sulfate pentahydraie (Cu(II)SO4 · 5H2O) and 2M solution of sodium ascorbate were prepared in deionized water. A 75 mg'mL solution in DMSO of targeting ligand was made. In a 1.5 mL centrifuge tube containing tri-alkyne functionalized duplex (3mg, 75pL, 40mghnL in 5 deionized water, ~15,000 g/mol), 25 pL of IMHepes pH 8.5 bufferis added. Aller vortexing, pL of DMSO was added and the solution is vortexed. Targeting ligand was added to the reaction (6 equivalents/duplex, 2 equivalents/alkyne, -15pL) and the solution is vortexed. Using pH paper, pH was checked and confirmed to be pH ~8. In a separate 1.5 mL centrifuge tube, 50 pL of 0.5M THPTA was mixed with lOuL of 0.5MCu(H)SÛ4 · 5HzO, vortexed, and 10 incubated at room temp for 5 min. Aller 5 min, THPTA/'Cu solution (7.2 pL, 6 équivalents
5:1 THPTA:Cu) w?as added to the reaction vial, and vortexed. Immediately afterwards, 2M ascorbate (5 pL, 50 équivalents per duplex, 16.7 per alkyne) was added to the reaction vial and vortexed. Once the reaction was complété (typically complété in 0.5-lh), the reaction was immediately purified by non-denaturing anion exchange chromatography.
Example 2. In Vivo Intratracheal Administration of Alpha-ENaCRNAi Agents in Mice.
To assess the activity of alpha-ENaC RNAi agents in vivo, male 1CR mice were administered 50 microliters via a microsprayer device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration on study days 1 and 2, of either isotonie saline vehicle for use as a control, or 5 mg/kg of one of the following alpha-ENaC RNAi agents without 2Q conjugale ligand (i.e., naked RNAi agent”) formulated in isotonie saline: AD04019,
AD04020, AD04021, AD04022, AD04023, AD04024, AD04025, or AD04026. (See, e.g., Tables 3 through 6 for Chemical structure information for the chemrcally modifîed duplexes used in this Example).
Either 4 or 5 mice were dosed per group. Mice were sacrificed (sac) on study day 9, and total 25 RNA was isolated from both longs following collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GzAPDH expression, and expressed as fraction of vehicle control group (géométrie mean, +/- 95% confidence interval).
Figure 1 shows the relative expression of tire identified alpha-ENaC RNAi agent 30 compositions (AD04019, AD04020, AD0402I, AD04022, AD04023, AD04024, AD04025, and AD04026), with each RNAi agent showing a signiiïcant réduction in lung alpha-ENaC expression compared to the vehicle control.
Example 3. in Vivo Intratracheal Administration of Alpha-ENaC RNAi Agents in Mice.
On study days l and 2, male ICR mice were administered 50 microliters via a microsprayer device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration, of either isotonie saline vehicle to use as a control, or 3 mg/kg of an alpha-ENaC RN Ai agent (i.e., either AD04025 or AD04858 (see, e.g., Tables 3 through 6 for Chemical structure information for the chemically modified duplexes used in this Example)), formulated in isotonie saline. Either 4 or 5 mice were dosed per group. Mice were sacrificed on study day
9, and total RNA was isolated from both lungs following collection and homogenization.
Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (géométrie mean, +/- 95% confidence interval).
Figure 2 shows the relative expression of alpha-ENaC RNAi agents AD04025 and AD04858, 15 with both RNAi agents showing a significant réduction in lung alpha-ENaC expression compared to control.
Example 4. In Vivo Intratracheal Administration of Alpha-ENaC RNAi Agents With and IVithout Conjugation to Epithelial Cell Targeting Ligands in Rais.
On study days 1 and 2, male Sprague Dawley rats were administered 200 microliters via a microsprayer device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration, of either 0.5 mg/kg, 1.5 mg/kg, or 5 mg/kg of an alpha-ENaC RNAi agent formulated m isotonie saline. Five (5) rats were dosed per group. Rats were sacrificed on study day 9, and total RNA w'as isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression w’as quantitated by probe25 based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (géométrie mean, +/- 95% confidence interval).
Figure 3 shows the relative expression of alpha-ENaC RNAi agents AD04025 and AD04025conjugate. AD04025-conjugate was synthesized by post-syntheticaily linkmg a peptide-based integrin targeting ligand having affînity for ανβ6 integrin, via a masked poly-L-lysine (PLL) scaffold, to an amino group that was added to 5’ termina! end of the sense strand of the RNAi agent. (See. e.g., Tables 3 through 6 for Chemical structure information for the chemically modified duplexes used in this Example). While both the naked RNAi agent and the RNAi agent-conjugate showed a substantial réduction in lung alpha-ENaC expression compared to baseline measurements, the AD04025-conjugate showed a numerically improved level of knockdown across each of the three dosage levels measured (0.5 mg/kg, 1.5 mg/kg, and 5 mg/kg), with a particularly noticeable improvement at the 1.5 mg/kg dose (78% knockdown with ligand vs. 47% knockdown without ligand).
Example 5. In Vivo Oropharyngeal Aspiration Administration of Alpha-ENaC RNAi 10 Agents Conjugated to Epithelial Cell Targeting Ligands in Rats.
On study day 1, male Sprague Dawley rats were dosed via oropharyngeal (“OP”) aspiration administration with 200 microliters using a pipette, according to the foilowing dosing groups recited in Table 7 :
Table 7. Dosing Groups of Rats in Example 5
Group RNAi Agent and Dose Dosing Regimen
1 Isotonie saline (no RNAi agent) Single OP dose on day 1
2 0.5 mg/kg of AD05347 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM2) at the 5' terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
3 0.5 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM2) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
4 0.5 mg/kg of AD05454 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM2) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day I
5 0.5 mg/kg of AD05455 conjugated to a tridentate srnall molécule ανβό épithélial cell targeting ligand (Tri-SM2) at the 5“ terminai end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
6 0.5 mg/kg of AD05456 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM2) at the 5’ terminai end of the sense strand, formulated in isotonie saline.________________________________________________________ Single OP dose on day 1
/ 0.5 mg/kg of AD05457 conjugaied to a tridentate small molécule ανβ6 épithélial cell targeting ligand (Tri-SM2) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
(See, e.g., Tables 3 through 6 for Chemical structure information for the chemically modified duplexes used in this Example).
The tridentate small molécule ανβ6 épithélial cell targeting ligand referred to as Tri-SM2 in Croups 2 through 7 has the structure represented in Figure 4, which was conjugaied to the 5 RNAi agent via the terminal amine (i.e., by forming a covalent bond with the terminal NH2CT group) on the 5’ terminal end of the sense strand.
Five (5) rats were dosed per group (n=5). Rats were sacriftced on sludy day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNNDX) mRNA expression was quantitated by probe-based quantitative PCR, normalized -] Q to GAPDH expression, and expressed as fraction of vehicie control group (géométrie mean, +/- 95% confidence mien al).
Table 8. Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 5
Group ID Average Relative rENaC mRNA Expression (n=5 for each group) Low (error) High (error)
Group 1 (isotonie saline) 1.000 0.161 0.192
Group 2 (0.5 mg/kg AD05347) 0.411 0.039 0.042
Group 3 (0.5 mg/kg AD05453) 0.678 0.092 0.106
Group 4 (0.5 mg/kg AD05454) 0.728 0.127 0.154
Group 5 (0.5 mg/kg AD05455) 0.663 0.075 0.084
Group 6 (0.5 mg/kg AD05456) 0.633 0.101 0.120
Group 7 (0.5 mg/kg AD05457) 0.726 0.174 0.228
As shown in Table 8 above, each of the alpha-ENaC RNAi agents showed a réduction in mRNA expression in rats compared to control. For example, AD05347, which includes a cyciopropyl-phosphonate group located at the 5? terminal end of the antisense strand, had an average réduction of approximately 59% (0.411) of mRNA compared to the control group.
Further, each of the other alpha-ENaC RNAi agents showed a réduction of at least approximately 27% of rENaC mRNA compared to control.
Example 6. In Vivo Intratracheal Administration ofAlpha-ENaCRNAi Agents Conjugated to Epithelial Cell Targeting Ligands in Rats.
On study day 1, male Sprague Dawley rats were administered 200 microliters via a microsprayer device (Penn Century, Philadelphia, PA) suitable for mtratracheal (IT) administration, of eilher isotonie saline vehicle for use as a control, or one of the foilowing alpha-ENaC RNAi agents according to the foilowing dosing groups recited in Table 9:
Table 9. Dosing Groups of Rats in Example 6
Group RNAi Agent and Dose Dosing Regimen
1 Isotonie saline (no RNAi agent) Single IT dose on day 1
2 1.5 mg/kg of AD04835 conjugated to a tridentate small molécule ανβ6 épithélial cell targeting ligand (Tri-SMl) at the 5’ terminai end of the sense strand, formulated in isotonie saline. Single IT dose on day 1.
3 1.5 mg/kg of AD04835 conjugated to a tridentate small moiecule ανβ6 épithélial cell targeting ligand (Tri-SMl) further including a cysteine-PEG? linkage at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single IT dose on day 1
4 1.5 mg/kg of AD05346 conjugated to a tridentate small molécule ανβ6 épithélial cell targeting ligand (Tri-SMl) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Smgle IT dose on day 1
5 1.5 mg/kg of AD05345 conjugated to a tridentate small moiecule ανβ6 épithélial cell targeting ligand (Tri-SMl) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single IT dose on day 1
6 1.5 mg/kg of AD05347 conjugated to a tridentate small moiecule ανβ6 épithélial cell targeting ligand (Tri-SMl) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single IT dose on day 1
7 1.5 mg/kg of AD04835 conjugated to a monodentate peptidebased ανβ6 épithélial cell targeting ligand which further included a PEGzo linker, followed by a peptide linker (PheCitPhePro (SEQ ID NO: 290)), a 20 kilodalton (KDa) PEG group, and a cysteine linker, which was then conjugated at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single IT dose on day 1
(See. e.g, Tables 3 through 6 for Chemical structure information for the chemically rnodified duplexes used in Unis Example).
The tridentate small molécule ανβ6 épithélial cell targeting ligand referred to as Tri-SMl in Groups 2, 5, and 6, has the structure represented in Figure 5, which was conjugated to the RNAi agent via the terminal amine (i e., by forming a covalent bond with the terminal NH2Ce group) on the 5’ terminal end of the sense strand. For Groups 3 and 4, the tridentate small molécule ligand in Groups 3 and 4 replaced the glutaric linker shown in Figure 5 with a linker that included cysteme-PEG?. linkage, represented as follows:
Five (5) rats were dosed in each of Groups 1, 2, 3, 4, 5, and 7 (n=5), and four (4) rats were dosed in Group 6. Rats were sacriiïced on study day 9, and total RNA was isoiated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1 A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GzkPDH expression, and expressed as fraction of vehicle control group (géométrie mean, +/- 95% confidence interval).
Table 10. Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 6
Group ÏD Average Relative rENaC mRNA Expression Low (errer) High (errer)
Group 1 (isotonie saline) 1.000 0.082 0.089
Group 2 (1.5 mg/kg AD04835-Tri-SMl) 0.453 0.098 0.126
Group 3 (1.5 mg/kg AD04835-PEG2-Cys-Tri- SM1) 0.365 0.076 0.095
Group 4 (1.5 mg/kg AD07065-PEG2-Cys-Tri- SM1) 0.412 0.136 0.204
Group 5 (1.5 mg/kg ADO5345-Tri-SM1) 0.404 0.097 0.128
Group 6 (1.5 mg/kg ADO5347-Tn-SM1) 0.311 0.048 0.057
Group 7 (1.5 mg/kg AD05453-Cys-PEG20kDapeptide linker-PEG2o-Tri-peptide ligand) 0.354 0.078 0.101
As shown in Table 10 above, each of the alpha-ENaC RNAi agents showed a réduction in mRNA expression in rats compared to control. In addition, the use of a tridentate small molécule ανβό épithélial cell targeting ligand shows comparable réduction in mRNA expression when compared to a peptide-based ανβό épithélial cell targeting ligand that further included a 20 kDa PEG PK modifier.
Example 7. In Vivo Oropharyngeal Aspiration Administration of Alpha-ENaC RNAi Agents Conjugated to Epithelial Cell Targeting Ligands in Rats.
On study day L male Sprague Dawley rats were dosed via oropharyngeal (“OP”) aspiration administration with 200 microliters using a pipette, according to the following dosing groups
1Q recited in Table 11 :
Table 11. Dosing Groups of Rats in Example 7
Group RNAi Agent and Dose Dosing Reginien
1 Isotonie saline (no RNAi agent) Single OP dose on day 1
2 0.5 mg/kg of AD05347 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM2) at the 5' terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
3 0.5 mg/kg of AD05458 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM2) atthe 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
4 0.5 mg/kg of AD05459 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM2) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day I
5 0.5 mg/kg of AD05562 conjugated to a tridentate small molécule ανβό épithélial cell targetmg ligand (Tri-SM2) at the 5‘ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
6 0.5 mg/kg of ADO5563 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM2) at the 5‘ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
>7 ! 0.5 mg/kg of AD05564 conjugated to a tridentate small molécule ανβό épithélial cell targetmg ligand (Tri-SM2) that Single OP dose on day 1
further includes a cysteine linking group al the 5’ terminal end of the sense strand, formulated in isotonie saline.
8 0.5 mg/kg of AD05565 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tn-SM2) at the 5' terminai end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
9 0.5 mg/kg of AD05567 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM2) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
10 0.5 mg/kg of AD05570 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM2) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
(See, e.g.. Tables 3 through 6 for Chemical structure information for the chemically modified duplexes used in this Example).
The tridentate small molécule ανβό épithélial cell targeting ligand referred to as Tri-SM2 in each of Groups 2-6 and 8-10, has the structure represented in Figure 4, which was conjugated 5 to the RNAi agent via the terminal amine (i.e., by forming a covalent bond with the terminal
NHj-Ce group) on the 5’ terminal end of the sense strand. The ligand for Group 7 included a cysteme linking group (see. e.g., Example 6).
Four (4) rats were dosed in Groups 1, 2, 3, 4, 5, 6, 7, and 9 (n=4), and three (3) rats were dosed in Groups 8 and 10 (n=3). Rats were sacrifîced on study day 9, and total RNA was 1Q isolated from both iungs following collection and homogenization. Alpha-ENaC (SCNN1 A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (géométrie mean, +/- 95% confidence interval).
Table 12. Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 7
Group ID Number of rats (n=) Aver age Relative rENaC mRNA Expression Low (error) High (error)
Group 1 (isotonie saline) 4 1.000 0.041 0.043
Group 2 (0.5 mg/kg AD05347) 4 0.457 0.088 0.109
Group 3 (0.5 mg/kg AD05458) 4 0.708 0.055 0.059
Group 4 (0.5 mg/kg AD05459) 4 0.753 0.174 0.227
Group 5 (0.5 mg/kg AD05562) 4 0.608 i 0.056 0.062
Group 6 (0.5 mg/kg AD05563) 4 0.621 1 0.048 0.053
Group 7 (0.5 mg/kg AD05564) 4 0.569 ί 0.095 0.114
Group 8 (0.5 mg/kg AD05565) 3 0.627 i 0.066 0.073
Group 9 (0.5 mg-'kg AD05567) 4 0.638 | 0.087 0.100
Group 10 (0.5 mg/kg AD05570) 3 0.645 0.123 0.151
As shown in Table 12 above, each of the alpha-ENaC RNAi agents showed a réduction in mRNA expression in rats compared to control. For example, AD05347 showed approximately a 54% réduction (0.457) in average rENaC mRNA expression compared to control.
Example 8. In Vivo Oropharyngeal Aspiration Administration qfAlpha-ENaC RNAi
Agents Conjugated to Epithelial Cell Targeting Ligands in Rats.
On study day 1, male Sprague Dawley rats were dosed via orophary ngeal (“OP”) aspiration administration with 200 microliters using a pipette, according to the following dosing groups recited in Table 13:
Table 13. Dosmg Groups of Rats in Example 8
Group RNAi Agent and Dose Dosing Regimen
1 Isotonie saline (no RNAi agent) Single OP dose on day I
2 0.5 mg/kg of AD05347 conjugated to a tridentate small molécule ανβ6 épithélial cell targeting ligand (Tri-SM2) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
3 i 0.5 mg/kg of AD05347 conjugated to a tridentate small molécule ανβ6 épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie 1 saline. Single OP dose on day 1
4 0.5 mg/kg of zAD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM2) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
5 | 0.5 mg/kg of AD05453 conjugated to a tridentate small | molécule ανβ6 épithélial cell targeting ligand (TH-SM9) ai the Single OP dose on day 1
100
57 terminai end of the sense strand, formulated in isotonie sahne.
6 0.5 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
7 0.5 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM8) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
8 0.5 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
9 0.5 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SMIO) at the 5’ terminai end of the sense strand, formulated m isotonie saline. Single OP dose on day l
10 Ô.5 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SMll) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
11 0.5 mg/kg of AD05453 conjugated to a tridentate peptidebased ανβό épithélial cell targetingligand at the 5’ terminal end of the sense strand, formulated in isotonie saline.__ Single OP dose on day 1
{See. e.g., Tables 3 through 6 for Chemical structure information for the chemicaliy modified duplexes used in this Example).
The tridentate small molécule ανβό épithélial cell targeting ligand referred to as Tri-SM2 in Group 2 and Group 4 has the structure represented in Figure 4; the tridentate small molécule ανβό épithélial cell targeting ligand referred to as Tri-SM6.1 in Groups 3 and 8 has the 5 structure represented in Figure 6; the tridentate small molécule ανβό épithélial cell targeting ligand referred to as Tri-SM9 in Group 5 has the structure represented in Figure 7; the tridentate small molécule ανβό épithélial cell targeting ligand referred to as Tri-SM6 in Group 6 has the structure represented in Figure 8; the tridentate small molécule ανβό épithélial cell targeting ligand referred to as Tri-SM8 in Group 7 has the structure represented m Figure 9;
-| 0 the tridentate small molécule ανβό épithélial cell targeting ligand referred to as Tri-SMIO in Group 9 has the structure represented in Figure 10; and the tridentate small molécule ανβό épithélial cell targeting ligand referred to as Tri-SMll in Group 10 has the structure represented m Figure 11. Each of the respective tridentate small molécule ανβό épithélial
101
cell targeting ligands were added by conjugation via the amino group on the 5’ terminal end of the respective alpha-ENaC RNAi agent.
Four (4) rats were dosed in each Group (n=4). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC 5 (SCNN1 A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (géométrie mean, +/- 95% confidence interval).
Table 14. Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 8
Group ID Average Relative rENaC mRNA Expression Low (error) High (errer)
Group 1 (isotonie saline) 1.000 0.162 0.193
Group 2 (0.5 mg/kg AD05347-Tri-SM2) 0.469 0.101 0.129
Group 3 (0.5 mg/kg AD05347-Tri-SM6.1) 0.358 0.078 0.100
Group 4 (0.5 mg/kg AD05453-Tri-SM2) 0.562 0.086 0.102
Group 5 (0.5 mg/kg AD05453-Tri-SM9) 0.620 0.168 0.230
Group 6 (0.5 mg/kg AD05453-Tri-SM6) 0.559 0.099 0.120
Group 7 (0.5 mg/kg AD05453-Tri-SM8) 0.691 0.072 0.081
Group 8 (0.5 mg/kg AD05453-Tri-SM6.1) 0.454 0.055 0.063
Group 9 (0.5 mg/kg AD05453-Tri-SM10) 0.454 0.080 0.097
Group 10 (0.5 mg/kg AD05453-Tri-SMl 1) 0.577 0.113 0.140
Group 11 (0.5 mg/kg AD05453-tridentate peptide ligand) 0.558 0.057 0.064
As shown in Table 14 above, each of the alpha-ENaC RNAi agents showed a réduction in mRNA expression in rats compared to control. For example, AD05347-Tri-SM6.1 (Group 10 3) showed approximately a 64% réduction (0.358) in average rENaC mRNA expression compared to control, and AD05453-Tri-SM6.1 (Group 8) showed approximately a 55% réduction (0.454) in average rENaC mRNA expression compared to control. Further, Groupe 8 and 9 aebieved approximately 55% réduction (0.454) in average rENaC mRNA expression without the use of a 5' terminal cyclopropyl-phosphonate modification on the antisense 15 strand, and showed a comparable inhibitory effect to Group 2, which had approximately 53%
102 réduction (0.469) in average rENaC mRNA expression with 5’ antisense cyclopropylphosphonate modification. Moreover, as observed in groups 4, 6, 8. 9, and JO, tridentate small molécule ανβό épithélial cell targeting ligands were comparable or in some instances numerically superior to Group 11 (e.g., Groups 8 and 9 that included Tri-SM6.1 and Tri5 SMI 0), which utilized atridentate peptide-based ανβό épithélial cell targeting ligand known to hâve affinily for integrin ανβό (See International Patent Application Publication No. WO 2018/085415 at Fig. 11 for Chemical structure information).
Example 9. In Vivo Oropharyngeal Aspiration Administration of Alpha-ENaC RNAi
Agents Conjugated to Epithelial Cell Targeting Ligands in Rats.
On study day 1, male Sprague Dawley rats were dosed via oropharyngeal (‘ΌΡ’) aspiration administration with 200 microliters using a pipette, which included the foilowing dosing groups recited in Table 15:
Table 15. Dosing Groups of Rats in Example 9
Group RNAi Agent and Dose Dosing Regimen
1 Isotonie saline (no RNAi agent) Single OP dose on day l
2 0.5 mg/kg of AD05453 without any targeting ligand (i.e., “naked RNAi agent”), formulated in isotonie saline Single OP dose on day 1
3 0.5 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
4 0.5 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM7) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
5 0.5 mg/kg of AD05618 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
6 0.5 mg/kg of AD05562 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the T terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
7 0.5 mg/kg of AD05564 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at Single OP dose on day 1
103
the 5’ terminal end of the sense strand, formulated in isotonie saline. ΐ
8 0.5 mg/kg of AD05567 conjugaied to a tridentate small molécule ανβ6 épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminai end of the sense strand, formulated in isotonie saline. Smgie OP ΐ dose on day 1 ί
(See, e.g., Tables 3 through 6 for Chemical structure information for the chemically modified duplexes used in this Example).
The tridentate small molécule ανβ6 épithélial cell targeting ligand referred to as Tri-SM6.1 in Groups 3 and 5-8 lias tire structure represented in Figure 6.
Four (4) rats were dosed in each Group (n=4). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1 A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicie control group (géométrie mean, +/- 95% confidence intervai).
Table 16. .Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 9
Group ÏD Average Relative rENaC mRNA Expression Low (error) High (error)
Group 1 (isotonie saline) 1.00 0.180 0.219
Group 2 (0.5 mg/kg AD05453) 0.713 0.139 0.173
Group 3 (0.5 mg/kg AD05453-Tri-SM6.1) 0.562 0.082 0.096
Group 4 (0.5 mg/kg AD05453-Tri-SM7) 0.768 0.059 0.064
Group 5 (0.5 mg/kg AD05618-Tri-SM6.1) 0.524 0.074 0.086
Group 6 (0.5 mg/kg AD05562-Tri-SM6.1) 0.784 0.07 0.077
Group 7 (0.5 mg/kg AD05564-Tn-SM6.1) 0.921 0.104 0.117
Group 8 (0.5 mg/kg AD05567-Tri-SM6.1) 0.707 0.084 0.096
jQ As shown in Table 16 above, each of the alpha-ENaC RNAi agents showed a réduction in mRNA expression in rais compared to control. Further, when administered naked, AD05453 showed only approximateiy 29% inhibition (0.713), while when conjugaied to Tri-SM6.1 integrin targeting ligand it showed a 44% réduction (0.562) in average rENaC mRNA expression.
104
Example 10. In Vivo Oropharyngeal Aspiration Administration of Alpha-ENaCRNAi
Agents Conjugated to Epithelial Cell Targeting Ligands in Rats.
On study day 1, male Sprague Dawley rats were dosed via oropharyngeal (“OP”) aspiration administration with 200 microliters using a pipette, which included the foilowing dosing groups recited in Table 17:
Table 17. Dosing Groups of Rats in Example 10
Group RNAi Agent and Dose Dosing Regimen
1 Isotonie saline (no RNAi agent) Single OP dose on day l
2 0.5 mg/kg of AD05347 conjugated to a tridentate small moiecule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
3 0.5 mg/kg of AD05453 conjugated to a tridentate small moiecule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ tenninal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
4 0.5 mg-'kg of AD05671 conjugated to a tridentate small moiecule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
5 0.5 mg/kg of AD05672 conjugated to a tridentate small moiecule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie salme. Single OP dose on day 1
6 0.5 mg/kg of AD05673 conjugated to a tridentate small moiecule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day l
0.5 mg/kg of AD05558 conjugated to a tridentate small moiecule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ tenninal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
8 0.5 mg/kg of AD05560 conjugated to a tridentate small moiecule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
9 0.5 mg/kg of AD05611 conjugated to a tridentate small moiecule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
105
10 0.5 mg/kg of AD056I3 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP | dose on day 1 ί
(See, e.g., Tables 3 through 6 for Chemical structure information for the chemicaily modified duplexes used in this Example).
The tridentate small molécule ανβό épithélial cell targeting ligand referred to as Tri-SM6.1 in Croups 2-10 has the structure represented in Figure 6.
Four (4) rats were dosed in each Group (n=4). Rats were sacrificed on study day 9, and total
RNA was isolated from both lungs following collection and homogemzation. Alpha-ENaC (SCNN1 A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAP DH expression, and expressed as fraction of vehicle control group (géométrie mean, +/- 95% confidence interval).
Table 18. Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 10
Group ÏD Average Relative rENaC mRNzk Expression Low (error) High (error)
Group 1 (isotonie saline) 1.000 0.084 0.092
Group 2 (0.5 mg/kg AD05347-Tri-SM6.1) 0.375 0.128 0.194
Group 3 (0.5 mg/kg AD05453-Tri-SM6.1) 0.597 0.163 0.224
Group 4 (0.5 mg/kg AD05671-Tri-SM6.1) 0.663 0.062 0.068
Group 5 (0.5 mg/kg AD05672-Tri-SM6.1) 0.808 0.114 0.133
Group 6 (0.5 mg/kg AD05673-Tri-SM6.1) 0.623 0.100 0.119
Group 7 (0.5 mg/kg AD05558-Tri-SM6.1) 0.533 0.043 0.047
Group 8 (0.5 mg/kg AD05560-Tri-SM6.1) 0.647 0.122 0.150
Group 9 (0.5 mg/kg AD05611-Tri-SM6.1) 0.477 0.067 0.078
Group 10 (0.5 mg/kg AD05613-Tri-SM6.1) 0.640 0.165 0.223
As shown in Table 18 above, each of the alpha-ENaC RNAi agents showed a. réduction in mRNA expression in rats compared to control.
106
Example IL In Vivo Oropharyngeal Aspiration Administration of Alpha-ENaC RNAi Agents Conjugated to Epithelial Cell Targeting Ligands in Rais.
On study day 1, male Sprague Dawley rats were dosed via oropharyngeal (“OP”) aspiration administration with 200 microliters using a pipette, which mcluded the following dosing g groups recited in Table 19:
Table 19. Dosing Groups of Rats in Example 1 i
Group RNAi zkgent and Dose Dosing Regimen
1 Isotonie saline (no RNAi agent) Single OP dose on day 1
2 0.5 mg/kg of AD05347 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie sahne. Single OP dose on day 1
3 0.5 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie sahne. Single OP dose on day 1
4 0.5 mg/kg of AD05618 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
5 0.5 mgzkg of AD05619 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie sahne. Single OP dose on day 1
6 0.5 mg/kg of AD05622 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.I) at the 5’ terminal end of the sense strand, formulated in isotonie saime. Single OP dose on day 1
0.5 mg/kg of zAD05623 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5‘ terminal end of'the sense strand, formulated in isotonie saline. Single OP dose on day 1
(See. e.g., Tables 3 through 6 for Chemical structure information for the chemically modifîed duplexes used in this Example).
The tri dentale small molécule ανβό épithélial cell targeting ligand referred to as Tri-SM6.1 in Groups 2-7 has the structure represented in Figure 6.
107
Five (5) rats were dosed in each Group (n=5). Rats were sacriiïced on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (géométrie mean, 5 +/- 95% confidence interval).
Table 20. Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 11
Group ID Average Relative rENaC mRNA Expression Low (error) High (error)
Group 1 (isotonie saline) 1.000 0.195 0.242
Group 2 (0.5 mg/kg AD05347-Tri-SM6.1) 0.383 0.041 0.046
Group 3 (0.5 mg/kg AD05453-Tri-SM6.1) 0.489 0.168 0.257
Group 4 (0.5 mg/kg AD05618-Tri-SM6.1) 0.770 0.185 0.244
Group 5 (0.5 mg/kg AD05619-Tn-SM6.1) 0.719 0.080 0.090
Group 6 (0.5 mg/kg AD05622-Tri-SM6.1) 0.564 0.168 0.239
Group 7 (0.5 mg/kg AD05623-Tri-SM6.1) 0.575 0.115 0.144
As shown in Table 20 above, each of the alpha-ENaC RNAi agents showed a réduction in mRNA expression in rats compared to control.
Example 12. In Vivo Oropharyngeal Aspiration Administration of Alpha-ENaCRNAi Agents Conjugated to Epithelial Cell Targeting Ligands in Rats.
q On study day L male Sprague Dawley rats were dosed via oropharyngeal (“OP”) aspiration administration with 200 inicroliters usmg a pipette, according to tire following dosing groups recited in Table 21 :
Table 21. Dosing Groups of Rats in Example 12
Group RNAi Agent and Dose Dosing Regimen
1 Isotonie saline (no RNAi agent) Single OP dose on dav 1
2 0.5 mg/kg of AD05347 conjugated to a tridentate small molécule ανβ6 épithélial cell targeting ligand (Tri-SM6.1) at Single OP dose on day 1
108
the 5’ terminal end of the sense strand, formulated m isotonie saline.
3 0.5 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
4 0.5 mg/kg of ADO5683 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day I
5 0.5 mg/kg of AD05684 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
6 0.5 mg/kg of AD05685 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated m isotonie saline. Single OP dose on day 1
/ 0.5 mg/kg of AD05686 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
8 0.5 mg/kg of AD05687 conjugated to a tridentate small molécule ανβό epithehal cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
9 0.5 mg/kg of AD05564 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminai end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
10 0.5 mg/kg of AD05688 conjugated to a tridentate small molécule ανβό epithehal cell targeting ligand (Tri-SM6.1) at the 5’ terminai end of the sense strand, formulated m isotonie saline. Single OP dose on day 1
11 0.5 m.g-'kg of AD05689 conjugated to a tridentate small molécule ανβό epithehal cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
12 0.5 mg/kg of AD05690 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminai end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
13 0.5 mg/kg of AD05691 conjugated to a tridentate small molécule ανβό epithehal cell targeting ligand (Tri-SM6.l) at the 5’ terminal end of the sense strand, formulated m isotonie saline _____________________________________________________________________________________ Single OP dose on day l
(See, e.g., Tables 3 through 6 for Chemical structure information for the chemically modified duplexes used in this Example).
109
The tridentate small molécule ανβό épithélial cell targeting ligand referred to as Tri-SM6.1 in Groups 2-13 has the structure represented in Figure 6.
Four (4) rats were dosed in each Group (n=:4). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (géométrie mean, +/- 95% confidence interval).
Table 22. Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 12
Group ID Average Relative rENaC mRNA Expression Low (error) High (error)
Group 1 (isotonie saline) 1.000 0.157 0.186
Group 2 (0.5 mg-'kg AD05347-Tri-SM6.1) 0.534 0.066 0.075
Group 3 (0.5 mg/kg AD05453-Tn-SM6.1) 0.573 0.086 0.101
Group 4 (0.5 mg/kg AD05683-Tri-SM6.1) 0.547 0.052 0.057
Group 5 (0.5 mg/kg AD05684-Tri-SM6.1) 0.755 0.158 0.200
Group 6 (0.5 mg/kg AD05685-Tn-SM6.1) 0.609 0.077 0.089
Group 7 (0.5 mg/kg AD05686-Tri-SM6.1) 0.591 0.077 0.089
Group 8 (0.5 mg/kg AD05687-Tri-SM6.1) 0.624 0.099 0.118
Group 9 (0.5 mg/kg AD05564-Tri-SM6.1) 0.787 0.172 0.221
Group 10 (0.5 mg/kg AD05688-Tri-SM6.1) 0.563 0.072 0.082
Group 11 (0.5 mg/kg AD05689-Tri-SM6.1) 0.693 0.136 0.169
Group 12 (0.5 mg/kg AD05590-Tri-SM6.1) 0.651 0.159 0.211
Group 13 (0.5 mg/kg AD05691-Tri-SM6.1) 0.870 0.132 0.155
As shown in Table 22 above, each of the alpha-ENaC RNAi agents showed a réduction in mRNA expression in rats compared to control.
Example 13. Dose Ranging Study of Oropharyngeal Aspiration Administration of AlphaENaC RNAi Agents Conjugated to Epithelial Cell TargetingLigands in Rats.
110
On study day 1, male Sprague Dawley rats were dosed via oropharyngeal (“OP”) aspiration administration with 200 microliters using a pipette, according to the following dosing groups recited in Table 23:
Table 23. Dosing Groups of Rats in Example 13
Group RNAi Agent and Dose Dosing j Regimen
1 Isotonie saline (no RNAi agent) Single OP dose on day I
2 0.0625 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
3 0.125 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
4 0.25 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminai end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
5 0.5 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day I
6 0.75 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) al the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day I
7 1.0 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie salme. Single OP dose on day 1
8 3.0 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6. lat the 5’ terminal end of the sense strand, formulated in isotonie saline. Single OP dose on day 1
(See. e.g., 'fables 3 through 6 for Chemical structure information for the chemically modified duplexes used in this Example).
The tridentate small molécule ανβό épithélial cell targeting ligand referred to as Tn-SM6.1 in Groups 2-8 has the structure represented in Figure 6.
111
Six (6) rats were dosed in each of Groups 1, 2, 3, 4, 7, and 8 (n=5). Four rats were dosed in Groups 5 and 6 (n=4). Rais were sacrifîced on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (géométrie mean, +/- 95% confidence interval).
Table 24. Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 13
GroupID Average Relative rENaC mRNA Expression Low (error) High (error)
Group 1 (isotonie saline) 1.000 0.1 i 1 0.125
Group 2 (0 9625 mg/kg AD05453-Tri-SM6/l) 0.695 0.083 0.095
Group 3 (0.125 mg/kg AD05453-Tri-SM6.1) 0.747 0.139 0.171
Group 4 (0.25 mg/kg AD05453-Tri-SM6.1) 0.631 0.080 0.092
Group 5 (0.5 mg/kg AD05453-Tri-SM6.1) 0.492 0.034 0.037
Group 6 (0.75 mg-'kg AD05453-Tri-SM6.1) 0.485 0.113 0.147
Group 7 (1.0 mg/kg AD05453-Tri-SM6.1) 0.433 0.077 0.094
Group 8 (3.0 mg/kg AD05453-Tri-SM6.1) 0.324 0.052 0.062
(See. e.g., Tables 3 through 6 for Chemical structure information for the chemîcally modified duplexes used in this Example).
As shown m Table 24 above, alpha-ENaC RNAi agent AD05453 showed a réduction in mRNA expression in rats compared to control at each of the dosage levels administered.
Example 14. ht Vivo Intratracheal Administration ofAlpha-ENaC RNAi Agents in Mice. On study days 1 and 2, male ICR mice were administered 50 mîcroliters via a microsprayer device (Penn Century, Philadelphia, PA) of either isotonie saline vehicle for use as a. control, or 5 mg/kg of one of the following alpha-ENaC RNAi agents without a conjugate ligand (Le., “naked RNAi agent”), formulated m isotonie saline: AD04025, AD04526, AD04527, AD04528, AD04529, AD04530, AD04531, AD04536, or AD04537. 4 mice were dosed per group (n=4). Mice were sacrifîced on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1 A) mRNA expression
112 was quantitated by probe-based quantitative PCR. normalized to GAPDH expression, and expressed as fraction of vehicle control group (géométrie mean, +i- 95% confidence interval).
Table 25. Average Relative mENaC mRNA Expression at Sacrifice (Day 9) in Example 14
GroupID Average Relative mENaC mRNA Expression Low (error) High (error)
Group 1 (isotonie saline) 1.000 0.117 0.132
Group 2 (0.5 mg/kg AD04025) 0.451 0.097 0.123
Group 3 (0.5 mg/kg AD04526) 0.585 0.108 0.132
Group 4 (0.5 mg/kg AD04527) 0.403 0.101 0.134
Group 5 (0.5 mg/kg AD04528) 0.498 0.117 0.153
Group 6 (0.5 mg/kg AD04529) 0.480 0.042 0.047
Group 7 (0.5 mg/kg AD04530) 0.670 0.006 0.006
Group 8 (0.5 mg/kg AD04531) 0.662 0.103 0.122
Group 9 (0.5 mg/kg AD04536) 0.746 0.101 0.117
Group 10 (0.5 mg'kg AD04537) 0.409 0.021 0.022
(See. e.g., Tables 3 through 6 for Chemical structure information for the chemically modified duplexes used in this Example).
As shown in Table 25 above, each of the alpha-ENaC RNAi agents showed a réduction in mRNA expression in rats compared to control.
Example 15. In Vivo Intratracheal Administration of Alpha-ENaC RNAi Agents in Mice. On study days 1 and 2, male ICR mice were administered 50 microliters via a microsprayer device (Penn Century', Philadelphia, PA) of either isotonie saline vehicle for use as a control, or 5 mg/kg of one of the following alpha-ENaC RNAi agents without a conjugale ligand (i.e., “naked RNAi agent”), formulated in isotonie saline: AD04025, AD04538, AD04539, AD04532, AD04533, AD04534, AD04535, or AD04540. (See, e.g., Tables 3 through 6 for Chemical structure information for the chemically modified duplexes used in tins Example).
Four (4) mice were dosed per group (n=4). Mice were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (S CNN 1 A) mRNA expression was quantitated by probe-based quantitative PCR, normalized
113
ίο GAPDH expression, and expressed as fraction of vehicle control group (géométrie mean, +/- 95% confidence interva’}.
Table 26. Average Relative mENaC mRNA Expression at Sacrifice (Day 9) in Example 15
GroupID Average Relative mENaC mRNA Expression Low (error) High (error)
Group 1 (isotonie saline) 1.000 0.081 0.088
Group 2 (0.5 mg/kg AD04025) 0.448 0.097 0.125
Group 3 (0.5 mg/kg AD04538) 0.855 0.101 0.115
Group 4 (0.5 mg/kg AD04539) 0.833 0.076 0.083
Group 5 (0.5 mg/kg AD04532) 0.581 0.127 0.162
Group 6 (0.5 mg/kg AD04533) 0.743 0.041 0.044
Group 7 (0.5 mg/kg AD04534) 1.006 0.127 0/146
Group 8 (0.5 mg/kg AD04535) 1.042 0.119 0.134
Group 9 (0.5 mg/kg AD04540) 0.982 0.111 0.125
(See, e.g., Tables 3 through 6 for Chemical structure information for the chemically modified duplexes used in this Example).
As shown in Table 26 above, the underlying sequence of the respective alpha-ENaC RNAi agent impacts the level of ENaC gene inhibition achieved. For example, alpha-ENaC RNAi 5 agent AD04025 includes an antisense strand sequence that is designed to target position 972 of the alpha-ENaC gene (i.e., nucléotides 1-19 of the antisense strand are designed to be at least partially complementary7 to the alpha-ENaC gene (SEQ ID NC): 1) at positions 972-990). AD04525 achieved the highest level of inhibition of the RNAi agents tested in this Example and showed approximately 55% knockdown of gene expression (0.448) compared to control.
The remaining Alpha-ENaC RNAi agents were designed to target different positions on the gene, including alpha-ENaC RNAi agents AD04538 (targeting gene position 973), AD04539 (targeting gene position 999), AD04532 (targeting gene position 1000), AD04533 (also targeting gene position 973), AD04534 (also targeting gene position 999), AD04535 (targeting gene position 1291), and AD04540 (targeting gene position 763). As shown above, Ί 5 an alpha-ENaC RNAi agent that is designed to target the gene at a different position can hâve different inhibitory activity (e.g., compare alpha-ENaC mRNA knockdown levels of AD04025 (position 972) with AD04538 (position 973) and AD04533 (position 973)).
114
Furthermore, when comparing alpha-ENaC RNAi agents at the saine position (e.g., AD04539 and AD04534), despile bolh sequences having underlying nucleobases designed lo inhibit the gene at the same position (e.g., gene position 999), slight modifications of the underlymg base sequence and/or the inclusion of different modified nucléotides can lead to at least 5 numerically different inhibition activity.
Example 16. In Vivo Intratracheal Administration of Alpha-ENaC RNAi Agents in Rats.
On study days 1 and 2, male Sprague Dawley rats were administered 200 microliters via a microsprayer device (Penn Century, Philadelphia, PA) of either isotonie saline vehicle for use as a control, or approximately 3 mg/kg of one of the foilowing alpha-ENaC RNAi agents 10 without a conjugale ligand (i.e., “naked RNAi agent”), formulated in isotonie saline:
AD04835, AD04022, ADOS 116, AD05117, AD05118, or ADOS 119. (See, e.g., Tables 3 through 6 for Chemical structure information for the chemically modified duplexes used in this Example).
Five (5) rats w’ere dosed per group (n=5). Rats were sacrificed on study day 9, and total RNA was isolated from bolh lungs foilowing collection and. homogenization. Alpha-ENaC 15 (SCNN1 A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (géométrie mean, +/- 95% confidence interval).
Table 27. Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 16
Group ID Average Relative rENaC mRNA Expression Low (error) High (error)
Group 1 (isotonie saline) 1.000 0.171 0.207
Group 2 (0.5 mg/kg AD04835) 0.281 0.043 0.050
Group 3 (0.5 mg/kg AD04022) 0.297 0.055 0.067
Group 4 (0.5 mg/kg ADOS 116) 0.554 0.095 0.115
Group 5 (0.5 mg/kg AD05117) 0.532 0.097 0.119
Group (s (0.5 mg/kg AD05118) 0.300 0.034 0.038
Group 7 (0.5 mg/kg AD05119) 0.496 0.075 0.089
(See, e.g., Tables 3 through 6 for Chemical structure information for the chemically modified duplexes used in this Example).
115
Table 27, above, provides additional data showing that the underlying sequence of the respective alpha-ENaC RNAi agent impacts the level of ENaC gene inhibition achieved. For example, alpha-ENaC RNAi agents AD04025 and AD04835 each include an antisense strand sequence that is designed to target position 972 of the alpha-ENaC gene (i.e., nucléotides 15 19 of the antisense strand are designed to be at least partially complementary to the alphaENaC gene (SEQ ID NO:1) at positions 972-990). Of the alpha-ENaC RNAi agents tested in this Example, these two RNAi agents showed the greatest level ofknockdown at greater than 70%. The remaining Alpha-ENaC RNAi agents were designed to target different positions on. the gene, including alpha-ENaC RNAi agents AD05116 (targeting gene position 10 944), AD05117 (targeting gene position 945), AD05118 (targeting gene position 1289), and
AD05119 (targeting gene position 1579).
Example 17. Multiple Dose, Dose Ranging Study of Oropharyngeal Aspiration Administration of Alpha-ENaCRNAi Agents Conjugaied to Epithelial Cell Targeting Ligands in Rats.
On study day 1. study day 2, and study day 3, male Sprague Dawley rats were dosed via 15 oropharyngeal (“OP”) aspiration administration with 200 microliters using a pipette, according to the following dosmg groupe recited m Table 28:
Table 28. Dosing Groups of Rats in Example 17
Group RNAi Agent and Dose Dosing Regimen
1 Isotonie saline (no RNAi agent) OP dose on day 1, day 2, and day 3 (three total doses)
2 0.005 mg/kg of AD05453 conjugaied to a tridentate small molécule ανβ6 épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. OP dose on day 1, day 2, and day 3 (three total doses)
3 0.01 mg/kg of AD05453 conjugated to a tridentate small molécule ανβ6 épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminai end of the sense strand, formulated in isotonie saline. OP dose on day 1, day 2, and day 3 (three total doses)
4 0.025 mg/kg of AD05453 conjugated to a tridentate small molécule ανβ6 épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. OP dose on day 1, day 2, and day 3 (three total doses)
116
5 0.05 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. OP dose on day 1, day 2, and day 3 (three total doses)
6 0.10 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. OP dose on day 1, day 2, and day 3 (three total doses)
7 0.50 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of tire sense strand, formulated in isotonie saline. OP dose on day 1, day 2, and day 3 (three total doses)
(See. e.g., Tables 3 through 6 for Chemical structure information for the chemically modifîed duplexes used in this Example). As noted herein, the same RNAi agent-tridentate small molécule ανβό épithélial cell targeting ligand conjugale structure (i.e., Tri-SM6.1-AD05453) in this Example may be altematively synthesized by using the tri-alkyne functionalized linking group (TnAIkl4) as shown in AD05924, instead of post-synthetic addition to the terminal amino group, as shown in AD05453. (See also Example 1).
The tridentate small molécule ανβό épithélial cell targeting ligand referred to as Tri-SM6.1 in Groups 2-7 has the structure represented in Figure 6.
Seven (7) rats were dosed in each of Groups 1, 2, 3, 4, 5, and 6 (n=7), and six (6) rats were 10 dosed in Group 7 (n=6). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1 A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (géométrie mean, +/- 95% confidence interval).
Table 29. Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 17
GroupID Average Relative rENaC mRNA Expression Low (error) High (error)
Group 1 (isotonie saline) 1.000 0.127 0.146
Group 2 (0.005 mg-'kg AD05453-Tri-SM6.1) 0.852 0.097 0.109
Group 3 (0.01 mg'kg AD05453-Tri-SM6.1) 0.663 0.103 0.121
Group 4 (0.025 mg/kg AD05453-Tri-SM6.1) 0.589 0.131 0.168
117
Group 5 (0.05 mg/kg AD05453-Tri-SM6.1) 0.480 1 0.058 0.066
Group 6 (0.10 mg/kg AD05453-Tri-SM6.1) 0.432 1 0.056 0.064
Group 7 (0.50 mg/kg AD05453-Tn-SM6.1) 0.279 | 0.034 0.039
As shown in Table 29 above, alpha-ENaC RNAi agent AD05453 showed a réduction in mRNA expression in rats compared lo control at each of the dosage levels administered. Further, multiple OP dose administration showed signs of further knockdown of rENaC mRNA expression compared to single dose when using the same alpha-ENaC RNAi agent (compare, e.g., Group 7 of Example 17 with Group 5 of Example 13).
Example 18. In Vivo Intrairacheal Administration ofAlpha-ENaC RNAi Agents in Mice and Human COPD Sputum Stahility Assessment.
To assess and compare the activity and stability of a known prior art duplex to the RNAi agents disclosed herein, a duplex having the following rnodified structure, as disclosed 10 International Patent Application Publication No: WO 2008/152131 to Novartis et al. (see
Table IC iherein at ND-9201), was synthesized:
Antisense strand sequence (5’ 3’): GAUUUGUUCUGGUUGcAcAdTsdT (SEQ ID NO:
291)
Sense strand sequence (5’ -> 3’): uGuGcAAccAGAAcAAAucdTsdT (SEQ IDNO: 292) (hereinafter referred to as ND-9201). According to WO 2008/152131, ND-9201 showed 15 comparatively potent in vitro inhibition of alpha-ENaC gene expression.
First, studies were conducted to assess alpha-ENaC inhibition activity in vivo. On study days I and 2, male ICR mice were administered via a microsprayer device (Penn Century, Philadelphia, PA) either isotonie glucose (D5W) vehicle for use as a control, or approximately 10 mg/kg of ND-9201 formulated in D5W. Mice were sacrificed on day 9, and total RNA 2Q was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1 A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group. For comparison, on study days 1 and 2, male ICR mice were administered via a microsprayer device (Penn Century, Philadelphia, PA) either D5W vehicle for use as a control, or approximately 5 mg/kg 25 of the RNAi agent AD04025 disclosed herein formulated in D5W. (See, e.g., Tables 3 through 6 for Chemical structure information for the chemically rnodified duplex of
118
AD04025). Mice were similarly sacrificed on day 9, and total RNA was isolated from both longs following collection and homogenization. Alpha-ENaC (SCNNl A) mRNA expression was quantitated by probe-based quantitative PCR. normalized to GAPDH expression, and expressed as fraction of vehicle control group.
For ND-9201, at 10 mg/kg dosing on days 1 and 2, approximately 25% inhibition of mENaC mRNA expression was achieved in mice in vivo.
For AD04025, at only 5 mg/kg dosing on days I and 2. approximately 65% inhibition of mENaC mRNA expression was achieved in mice in vivo, thus showing a substantiel improvement in inhibition activity over the known prior art duplex ND-9201.
Additionally, stability studies were conducted with ND-9201 and AD04858 in human sputum taken from patients diagnosed with COPD (See, e.g., Tables 3 through 6 for Chemical structure information for the chemically modified duplex of AD04858). A solution containing 50 pL of sputum and 350 pL of lysis buffer was vortexed, and 12.5 pL of either ND-9201 or AD04858 was added and briefly vortexed each hour. LCMS was conducted on the samples to détermine the remaining full-length product of both the sense strand and the antisense strand of each of the molécules over time. After 6 hours, AD04858 showed improved stability, as it had approximately 20 to 30% greater full-length product présent for both tire sense strand and the antisense strand.
Exemple JR In Vivo Study of Oropharyngeal Aspiration Administration of Alpha-ENaC 20 RNAi Agents Conjugated to Epithelial Cell Targeting Ligands in Rats.
On study day 1 and study day 2, male Sprague Dawley rats were dosed via oropharyngeal (“OP”) aspiration administration with 200 microliters using a pipette, which included the following dosing groups recited in Table 30:
Table 30. Dosing Groups of Rats in Example 19
Group RNAi Agent and Dose Dosing Reginien
1 Isotonie saline (no RNAi agent) OP dose on day 1 i and day 2 i
119
2 0.025 mg/kg of AD05625 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5' terminal end of the sense strand, formulated in isotonie saline. OP dose on day 1 and day 2
3 0.50 mg/kg of AD05453 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5 ’ terminal end of the sense strand, formulated in isotonie saline. OP dose on day 1 and day 2
4 0.50 mg/kg of AD05829 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of tire sense strand, formulated in isotonie saline. OP dose on day 1 and day 2
5 0.50 mg/kg of AD05831 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5’ terminal end of the sense strand, formulated in isotonie saline. OP dose on day 1 and day 2
6 0.50 mg/kg of ADO5833 conjugated to a tridentate small molécule ανβό épithélial cell targeting ligand (Tri-SM6.1) at the 5 ’ terminal end of the sense strand, formulated in isotonie saline. OP dose on day 1 and day 2
(See, e.g., Tables 3 through 6 for Chemical structure information for the chemically modified duplexes used in this Example).
The tridentate small molécule ανβό épithélial cell targeting ligand referred to as Tri-SM6.1 in Groups 2-7 has the structure represented in Figure 6.
Four (4) rats were dosed in each Group (n-7). Rats were sacrificed on study day 9, and total RNA was isolated from both lungs following collection and homogenization. Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probe-based quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group (géométrie mean, +/- 95% confidence interval).
Table 31. Average Relative rENaC mRNA Expression at Sacrifice (Day 9) in Example 19
Group ID Average Relative rENaC mRNA Expression Low (error) High (error)
Group 1 (isotonie saline) 1.000 0.196 0.243
Group 2 (0.25 mg/kg AD05625-Tri-SM6.1) 0.663 0.107 0.127
Group 3 (0.50 mg/kg AD05453-Tn-SM6.1 ) 0.490 0.091 0.111
Group 4 (0.50 mg/kg AD05829-Tri-SM6.1) 0.767 0.163 0.207
120
Group 5 (0.50 mg/kg AD05831-Tri-SM6.1) 0.542 0.113 0.142
Group 6 (0.50 mg/kg AD05833-Tri-SM6.1) 0.599 0.025 0.026
In Table 31 above, alpha-ENaC RNAi agents AD05625 and AD05453 each included an antisense strand that was designed to target the alpha-ENaC gene beginning ai position 972 (see SEQ ID NO:l); AD05829 included an antisense strand that was designed to target the alpha-ENaC gene beginning at position 944; AD05831 included an antisense strand that was 5 designed to target the alpha-ENaC gene beginning at position 973; and ADO 1289 included an antisense strand that was designed to target the alpha-ENaC gene beginning at position 1289. Each of the alpha-ENaC RNAi agents showed inhibition of gene expression, with RNAi agent AD05453 showmg cornparaliveiy poient inhibition of alpha-ENaC.
Example 20. In Vivo Topical Ocular Administration of Alpha-ENaC RNAi Agents in Mice.
To evaluate the ability of alpha-ENaC RNAi agents to inhibit expression of alpha ENaC mRNA in the ocular surface epithelium, CB57BI/6 mice (n=3 / group) received twice daily topical ocular instillations of saline vehicle or 400 micrograms AD04858 (in two microliter volume) in both eyes for five days. (See, e.g., Tables 3 through 6 for Chemical structure information for the chemically modified duplex of AD04858). On study day five, mice were sacrificed, samples of the conjunctival epithelium collected and total RNA isolated from tissue homogenate. Alpha-ENaC (SCNN1A) mRNA expression was quantitated by probebased quantitative PCR, normalized to GAPDH expression, and expressed as fraction of vehicle control group.
Aller five days of twice daily topical dosing of AD04858, conjunctival samples from treated 20 mice expressed significantly less (approximately 24%) alpha ENaC mRNA than samples from vehicle treated Controls
Other Embodiments
It is to be understood that while the invention has been descnbed in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of
121 the invention, which is defined by the scope of the appended daims. Other aspects, advantages, and modifications are within the scope of the following daims.

Claims (65)

1. An RNAi agent for inhibiting expression of an alpha-ENaC gene, comprising:
an antisense strand comprising at least 17 contiguous nucléotides differing by 0 or 1 nucléotides from any one of the sequences provided in Table 2 or Table 3; and a sense strand comprising a nucléotide sequence that is at least partially complementary to the antisense strand.
2. The RNAi agent of claim 1, wherein the antisense strand comprises nucléotides 2-18 of any one of the sequences provided in Table 2 or Table 3.
3. The RNAi agent of claim 1 or claim 2, wherein the sense strand comprises a nucléotide sequence of at least 17 contiguous nucléotides differing by 0 or 1 nucléotides from any one of the sequences provided in Table 2 or Table 4, and wherein the sense strand has a région of at least 85% complementarity over the 17 contiguous nucléotides to the antisense strand.
4. The RNAi agent of any one of claims 1-3, wherein at least one nucléotide of the alphaENaC RNAi agent is a modified nucléotide or includes a modified intemucleoside linkage.
5. The RNAi agent of any one of claims 1-3, wherein ail or substantially ail of the nucléotides are modified nucléotides.
6. The RNAi agent of any one of claims 4-5, wherein the modified nucléotide is selected from the group consisting of: 2'-O-methyl nucléotide, 2'-fluoro nucléotide, 2'-deoxy nucléotide, 2',3'-seco nucléotide mimic, locked nucléotide, 2’-F-arabino nucléotide, 2'-methoxyethyl nucléotide, abasic nucléotide, ribitol, inverted nucléotide, inverted 2'-O-methyl nucléotide, inverted 2'-deoxy nucléotide, 2'-amino-modified nucléotide, 2'-alkyl-modified nucléotide, morpholino nucléotide, vinyl phosphonate deoxyribonucleotide, and 3'-O-methyl nucléotide.
7. The RNAi agent of claim 5, wherein ail or substantially ail of the nucléotides are modified with either 2'-O-methyl nucléotides or 2'-fluoro nucléotides.
8. The RNAi agent of any one of claims 1-7, wherein the antisense strand comprises the nucléotide sequence of any one of the modified sequences provided in Table 3.
9. The RNAi agent of any one of claims 1-8, wherein the sense strand comprises the nucléotide sequence of any one of the modified sequences provided in Table 4.
10. The RNAi agent of claim 1, wherein the antisense strand comprises the nucléotide sequence of any one of the modified sequences provided in Table 3 and the sense strand
123 comprises the nucléotide sequence of any one ofthe modified sequences provided in Table 4.
11. The RNAi agent of any one of daims 1-10, wherein the RNAi agent is linked to a targeting ligand.
5
12. The RNAi agent of daim 11, wherein the targeting ligand comprises an integrin targeting ligand.
13. The RNAi agent of daim 12, wherein the integrin targeting ligand is an ανβό integrin targeting ligand.
14. The RNAi agent of daim 13, wherein the ανβό integrin targeting ligand has the structure
10 represented by any one of the structures of Figures 4-11.
15. The RNAi agent of any one of daims 11-14, wherein the targeting ligand is conjugated to the sense strand.
16. The RNAi agent of daim 15, wherein the targeting ligand is conjugated to the 5’ terminal end of the sense strand.
15
17. The RNAi agent of any one of daims 1-16, wherein the sense strand is between 18 and 30 nucléotides in length, and the antisense strand is between 18 and 30 nucléotides in length.
18. The RNAi agent of daim 17, wherein the sense strand and the antisense strand are each between 18 and 27 nucléotides in length.
19. The RNAi agent of daim 18, wherein the sense strand and the antisense strand are each
20 between 18 and 24 nucléotides in length.
20. The RNAi agent of daim 19, wherein the sense strand and the antisense strand are each 21 nucléotides in length.
21. The RNAi agent of daim 20, wherein the RNAi agent has two blunt ends.
22. The RNAi agent of any one of daims 1-21, wherein the sense strand comprises one or two
25 terminal caps.
23. The RNAi agent of any one of daims 1-22, wherein the sense strand comprises one or two inverted abasic residues.
24. The RNAi agent of daim 1, wherein the RNAi agent is comprised of a sense strand and an antisense strand that form a duplex having the structure of any one ofthe duplexes in Table 30 5.
124
25. The RNAi agent of claim 1, wherein the RNAi agent is comprised of a sense strand and an antisense strand, wherein the antisense strand comprises a modified nucieotide sequence that differs by 0 or 1 nucléotides from one of the following nucieotide sequences (5' -> 3'): usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO:2);
usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO:6); cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10); usGfsasUfuUfgUfuCfuGfgUfuGfcAfcAfsg (SEQ ID NO: 107); or asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu (SEQ ID NO: 152);
wherein a, c, g, and u represent 2'-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage, cPrpu represents a 5’cyclopropyl phosphonate-2'-O-methyl uridine; and wherein ail or substantially ail of the nucléotides on the sense strand are modified nucléotides.
26. The RNAi agent of claim 25, wherein the antisense strand comprises a modified nucieotide sequence that differs by 0 or 1 nucléotides from usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO:2).
27. The RNAi agent of claim 25, wherein the antisense strand comprises a modified nucieotide sequence that differs by 0 or 1 nucléotides from usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsc (SEQ ID NO:6).
28. The RNAi agent of claim 25, wherein the antisense strand comprises a modified nucieotide sequence that differs by 0 or 1 nucléotides from cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO: 10).
29. The RNAi agent of claim 25, wherein the antisense strand comprises a modified nucieotide sequence that differs by 0 or 1 nucléotides from usGfsasUfuUfgUfuCfuGfgUfuGfcAfcAfsg (SEQ ID NO: 107).
30. The RNAi agent of claim 25, wherein the antisense strand comprises a modified nucieotide sequence that differs by 0 or 1 nucléotides from asGfsasAfgUfcAfuUfcUfgCfuCfuGfcusu (SEQ ID NO: 152).
31. The RNAi agent of any one of daims 25-30, wherein the sense strand further includes an abasic residue at the 3’ terminal end.
125
32. The RNAi agent of claim 1, wherein the RNAi agent comprises an antisense strand and a sense strand, wherein the antisense strand and the sense strand comprise a nucléotide sequence pair selected from the group consisting of: SEQ ID NOs:2 and 4; SEQ ID NOs: 3 and 5; SEQ ID NOs: 6 and 8; SEQ ID NOs: 7 and 9; and SEQ ID NOs: 10 and 4.
33. The RNAi agent of claim 1, wherein the RNAi agent has the duplex structure selected from the group consisting of: AD05453, AD05625, AD05347, AD05831, AD05833, AD04835, and AD05924.
34. The RNAi agent of claim 1, wherein the RNAi agent includes an antisense strand and a sense strand, wherein the antisense strand and the sense strand consist of, consist essentially of, or comprise nucléotide sequences that differ by 0 or 1 nucléotides from one of the foilowing nucléotide sequence (5'^3') pairs:
UAUUUGUUCUGGUUGCACAGG (SEQ ID NO:3) and CCUGUGCAACCAGAACAAAUA (SEQ ID NO:5);
UAUUUGUUCUGGUUGCACAGG (SEQ ID NO:7) and GCUGUGCAACCAGAACAAAUA (SEQ ID NO:9);
UGAUUUGUUCUGGUUGCACAG (SEQ ID NO:230) and CUGUGCAACCAGAACAAAUCA (SEQ ID NO:259); or AGAAGUCAUUCUGCUCUGCU U (SEQ ID NO:254) and
GCAGAGCAGAAUGACUUCUUU (SEQ ID NO:289).
35. The RNAi agent of claim 34, wherein the antisense strand and the sense strand consist of consist essentially of, or comprise nucléotide sequences that differ by 0 or 1 nucléotides from UAUUUGUUCUGGUUGCACAGG (SEQ ID NO:3) and CCUGUGCAACCAGAACAAAUA (SEQ ID NO:5).
36. The RNAi agent of claim 34, wherein the antisense strand and the sense strand consist of consist essentially of, or comprise nucléotide sequences that differ by 0 or 1 nucléotides from UAUUUGUUCUGGUUGCACAGG (SEQ ID NO:7) and GCUGUGCAACCAGAACAAAUA (SEQ ID NO:9).
37. The RNAi agent of claim 34, wherein the antisense strand and the sense strand consist of consist essentially of, or comprise nucléotide sequences that differ by 0 or 1 nucléotides from UGAUUUGUUCUGGUUGCACAG (SEQ ID NO:230) and CUGUGCAACCAGAACAAAUCA (SEQ ID NO:259.
126
38. The RNAi agent of claim 34, wherein the antisense strand and the sense strand consist of consist essentially of, or comprise nucieotide sequences that differ by 0 or 1 nucléotides from AGAAGUCAUUCUGCUCUGCUU (SEQ ID NO:254) and GCAGAGCAGAAUGACUUCUUU (SEQ ID NO:289).
39. The RNAi agent of any one of daims 34-38, wherein ail or substantially ail of the nucléotides are modified nucléotides.
40. The RNAi agent of any one of daims 24-38, wherein the sense strand of the RNAi agent is linked to targeting ligand.
41. The RNAi agent of daim 40, wherein the targeting ligand has affinity for a cell receptor expressed on an épithélial cell.
42. The RNAi agent of any one of daims 40-41, wherein the targeting ligand is an ανβό integrin targeting ligand.
43. A composition comprising the RNAi agent of any one of daims 1-42, wherein the composition comprises a pharmaceutically acceptable excipient.
44. The composition of daim 43, further comprising a second RNAi agent for inhibiting the expression of alpha-ENaC.
45. The composition of any one of daims 43-44, further comprising one or more additional therapeutics.
46. The composition of claim 45, wherein the composition is formulated for administration by inhalation.
47. The composition of claim 46, wherein the composition is delivered by a metered-dose inhaler, jet nebulizer, vibrating mesh nebulizer, or soft mist inhaler.
48. An in vitro method for inhibiting expression of an alpha-ENaC gene in a cell, the method comprising introducing into a cell, in vitro, an effective amount of an RNAi agent of any one of daims 1-42 or the composition of any one of daims 43-47.
49. The RNAi agent of any one of daims 1-42 or the composition of any one of daims 43-47 for use in a method for inhibiting expression of an alpha-ENaC gene in a cell.
50. Use of the RNAi agent of any one of daims 1-42 in the manufacture of a composition for inhibiting expression of an alpha-ENaC gene in a cell.
51. The RNAi agent for use of daim 49 or the use of claim 50, wherein the cell is within a subject.
127
52. The method of claim 51, wherein the subject is a human subject.
53. The method of claim 48 or the RNAi agent for use or the use of any one of daims 40-43, wherein the alpha-ENaC gene expression is inhibited by at least 30%.
54. A composition of any one of daims 43-47 for use in a method of treating one or more symptoms or diseases associated with enhanced or elevated ENaC activity levels.
55. Use of an RNAi agent of any one of daims 1-42 in the manufacture of a composition for treating one or more symptoms or diseases associated with enhanced or elevated ENaC activity levels.
56. The composition for use of claim 54 or the use of claim 55, wherein the disease is a respiratory disease.
57. The composition for use or the use of daim 56, wherein the respiratory disease is cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infections, primary ciliary dyskinesia, or lung carcinoma cystic fibrosis.
58. The composition for use of claim 54 or the use of daim 55, wherein the disease is an ocular disease.
59. The composition for use or the use of any one of daims 54-58, wherein the RNAi agent is administered at a dose of 0.001 mg/kg to 0.500 mg/kg of body weight.
60. The composition for use or the use of any of daims 54-59, wherein the RNAi agent is administered in two or more doses.
61. Use of the RNAi agent of any one of daims 1-33, in the manufacture of a composition for the treatment of a disease, disorder, or symptom that is mediated at least in part by ENaC activity and/or alpha-ENaC gene expression.
62. The RNAi agent of any one of daims 1-33 for use in a method of treating a disease, disorder, or symptom that is mediated at least in part by ENaC activity and/or alpha- ENaC gene expression.
63. A composition according to any one of daims 43-47, for use in a method of treating a disease, disorder, or symptom that is mediated at least in part by ENaC activity and/or alpha-ENaC gene expression.
128
64. Use of the composition according to any one of daims 43-47, for the manufacture of a médicament for treatment of a disease, disorder, or symptom that is mediated at least in part by ENaC activity and/or alpha-ENaC gene expression.
65. The RNAi agent for use, or the composition for use, or the use of any one of daims 62-64, 5 wherein the disease is cystic fibrosis.
OA1201900482 2017-07-06 2018-07-05 RNAi agents for inhibiting expression of alpha-ENaC and methods of use. OA19490A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US62/529,132 2017-07-06
US62/631,683 2018-02-17
US62/679,549 2018-06-01

Publications (1)

Publication Number Publication Date
OA19490A true OA19490A (en) 2020-10-23

Family

ID=

Similar Documents

Publication Publication Date Title
TWI826365B (en) ALPHA-1 ANTITRYPSIN (AAT) RNAi AGENTS, COMPOSITIONS INCLUDING AAT RNAi AGENTS, AND METHODS OF USE
CA3048661A1 (en) Compositions and methods for inhibition of factor xii gene expression
CN113164509A (en) RNAi agents for inhibiting expression of 17 beta-HSD type 13 (HSD17B13), compositions thereof and methods of use
US20220090077A1 (en) RNAi Agents for Inhibiting Expression of Alpha-ENaC And Methods of Use
CA3176418A1 (en) Rnai agents for inhibiting expression of pnpla3, pharmaceutical compositions thereof, and methods of use
JP7473472B2 (en) RNAi agents and compositions for inhibiting asialoglycoprotein receptor 1 expression
OA19490A (en) RNAi agents for inhibiting expression of alpha-ENaC and methods of use.
EA040178B1 (en) RNAi AGENTS FOR INHIBITION OF ALPHA-ENaC EXPRESSION AND METHODS OF APPLICATION
US20230013022A1 (en) RNAi Agents for Inhibiting Expression of Beta-ENaC, Compositions Thereof, and Methods of Use
JP2024516096A (en) RNAi agents for inhibiting expression of receptor for advanced glycation end products, compositions thereof, and methods of use
CN117440817A (en) RNAi agents for inhibiting expression of advanced glycation end product receptors, compositions and methods of use thereof
WO2024092105A2 (en) Rnai agents for inhibiting expression of complement component c3 (c3), pharmaceutical compositions thereof, and methods of use