OA18769A - Methods of polynucleotide preparation using multivalent cation salt compositions. - Google Patents

Abstract

Aspects of the disclosure include methods for the préparation of a polynucleotide. In some embodiments, the method includes contacting a first polynucleotide composition including: a polynucleotide having a sequence of 7 or more nucleoside subunits and at least two of the nucleoside subunits are joined by a N3'—»P5' thiophosphoramidate inter-subunit linkage; and non-target synthetic products and reagents; with a multivalent cation sait to precipitate a polynucleotide sait including at least one multivalent cation counterion; and separating the polynucleotide sait from the contacted first polynucleotide composition to produce a second polynucleotide composition including the polynucleotide sait. In certain embodiments, the method further includes contacting the polynucleotide sait with a reverse phase chromatography support; and eluting from the chromatography support a third polynucleotide composition including the polynucleotide. Also provided are compositions including a sait of the polynucleotide including at least one multivalent cation counterion.

Description

METHODS OF POLYNUCLEOTIDE PREPARATION USING MULTIVALENT CATION SALT COMPOSITIONS

CROSS REFERENCE TO RELATED APPLICATION

[0001] Pursuant to 35 U.S.C. § 119(e), this application daims priority to the filîng date of U.S. provisional application serial No. 62/151,891, filed April 23, 2015, the disclosure of which is herein incorporated by reference.

INTRODUCTION

[0002] Nucleic acid polymer chemistry has played a rôle in many developing technologies in the pharmaceutical, diagnostic, and analytical fields, and more particularly in the subfields of antisense and anti-gene therapeutics, combinatorial chemistry, branched DNA signal amplification, and arraybased DNA diagnostics and analysis. Some of this polymer chemistry has been directed to improving the binding strength, specificity, and nuclease résistance of naturel nucleic acid polymers, such as DNA. Peptide nucleic acid (PNAs), phosphorothîoate, methylphosphonate and phosphoramidate internucleoside linkages are examples of some polymer chemistries that hâve been applied to polynucleotides to provide for one or more désirable properties such as nuclease résistance, cellular uptake and solubîlity.

[0003] Polynucleotide N3'—>P5' phosphoramidates can form stable duplexes with complementary DNA and RNA strands, as well as stable triplexes with DNA duplexes, and are résistant to nucleases. Polynucleotide N3'-+P5‘ thiophosphoramidates hâve found use as potent antisense agents both in vitro and in vivo. Polynucleotide containing compounds that inhibit telomerase activity can be used to treat telomerase-mediated disorders, such as cancer, since cancer cells express telomerase activity and normal human somatic cells do not possess telomerase activity at biologically relevant levels. As such, methods of preparing and isolating such polynucleotides are of interest.

SUMMARY

[0004] Aspects of the disclosure include methods for the préparation of a polynucleotide. In some embodiments, the method includes contacting a first polynucleotide composition including: a polynucleotide having a sequence of 7 or more nucleoside subunits where at least two of the nucleoside subunits are joined by a N3’—»P5' thiophosphoramidate inter-subunit linkage; and nontarget synthetic products and reagents; with a multivalent cation sait to precipitate a first polynucleotide sait including at least one multivalent cation counterion; and separating the polynucleotide sait from the contacted first polynucleotide composition to produce a second polynucleotide composition including the first polynucleotide sait. In certain embodiments, the method further includes contacting the first polynucleotide sait with a reverse phase chromatography support; and eluting from the chromatography support a third polynucleotide composition including a second polynucleotide sait. Also provided are compositions including a sait of the polynucleotide including at least one multivalent cation counterion. In some embodiments, the at least one multivalent cation counterion is selected from the group consisting of magnésium, zinc, aluminium, and calcium.

BRIEF DESCRIPTION OF THE FIGURES

[0005] The skilled artisan will understand that the drawings, described below, are for illustration purposes only. The drawings are not rntended to lîmit the scope of the présent teachings in any way. [0006] Figure 1 shows HPLC chromatograms of Imetelstat-Mg in 1M NaCI solutions at a variety of pH’s.

[0007] Figure 2 depicts the results of an elemental analysis of Imetelstat Sodium treated with a variety of salts.

[0008] Figure 3 depicts the results of an elemental analysis of Imetelstat Sodium treated with increasing équivalents of magnésium chloride sait.

[0009] Figure 4 depicts the results of an elemental analysis of Imetelstat TEA treated with increasing équivalents of magnésium chloride sait.

DEFINITIONS

[0010] Before describîng exemplary embodiments in greater detail, the following définitions are set forth to illustrate and define the meaning and scope of the ternis used in the description.

[0011] The following terms hâve the following meanings unless otherwise indicated. Any undefined temns hâve their art recognized meanings.

[0012] As used herein, the terms polynucleotide and oligonucleotide are used interchangeably to refer to a compound containing a plurality of nucleoside moiety subunits or nucleoside residues that are linked by internucleoside bonds or intemucleosidic linkages. Whenever a polynucleotide is represented by a sequence of letters, such as ATGUCCTG, it is understood that the nucléotides are in 5’—»3' order from left to right and that A dénotés deoxyadenosine, C dénotés deoxycytidine, G dénotés deoxyguanosine, T dénotés thymidine, and U dénotés deoxyuridine, unless otherwise noted.

[0013] As used herein, nucleoside includes the natural nucleosides, including 2'-deoxy and 2’hydroxyl forms, e.g. as described in Komberg and Baker, DNA Réplication, 2nd Ed. (Freeman, San Francisco, 1992). Analogs in reference to nucleosides includes synthetic nucleosides having modified base moieties and/or modified sugar moieties, e.g. described generally by Scheit, Nucléotide Analogs (John Wiley, New York, 1980). Such analogs include synthetic nucleosides designed to enhance binding properties, e.g. stability, specificity, or the like, such as disclosed by Uhlmann and Peyman (Chemical Reviews, 90:543-584,1990). In some embodiments, a nucleoside or nucleoside analog includes a 3'-hydroxyl group or a 3’-amino group.

[0014] The terms base and “nucleobase are used interchangeably and defined herein to include (i) conventional DNA and RNA bases (uracil, thymine, adenine, guanine, and cytosine), and (ii) modified bases or base analogs (e.g., 5-methyl-cytosine, 5-bromouracil, or inosine). A base analog is a Chemical whose molecular structure mimics that of a conventional DNA or RNA base. [0015] As used herein, pyrimidine means the pyrimidines occurring in natural nucleosides, including cytosine, thymine, and uracil, and common analogs thereof, such as those containing oxy, methyt, propynyl, methoxy, hydroxyl, amino, thio, halo, and like, substituents. The term as used herein further includes pyrimidines with common protecting groups attached, such as N4benzoylcytosine. Further pyrimidine protecting groups of interest include but are not limited to, those protecting groups are disclosed by Beaucage and lyer Tetrahedron 48: 2223-2311 (1992).

[0016] As used herein, purine means the purines occurring in natural nucleosides, including adenine, guanine, and hypoxanthine, and common analogs thereof, such as those containing oxy, methyl, propynyl, methoxy, hydroxyl, amino, thio, halo, and like, substituents. The term as used herein further includes purines with common protection groups attached, such as N2benzoylguanine, N2-isobutyrylguanine, N6-benzoyladenine, and the like. Further common purine protection groups are disclosed by Beaucage and lyer Tetrahedron 48: 2223-2311 (1992). As used herein, the term -protected- as a component of a Chemical name refers to art-recognized protection groups for a particular moiety of a compound, e.g. ’’5'-protected- hydroxyl in reference to a nucleoside includes triphenylmethyl (i.e., trityl), p-anisyldiphenylmethyl (i.e., monomethoxytrityl or MMT), di-p-anisylphenylmethyl (i.e., dimethoxytrityl or DMT), and the like; and a protected nucleobase in reference to a nucleobase including a heteroatom protected with a group such as a dimethylaminoformamidine (DMF), benzoyl (Bz), isobutyryl, and the like. Art-recognized protecting groups include those described in the following référencés: Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); Amarnath and Broom, Chemical Reviews, 77:183-217, 1977; Pon et al., Biotechniques, 6:768-775, 1988; Ohtsuka et al., Nucleic Acids Research, 10:65536570, 1982; Eckstein, editor, Oligonucleotides, and Analogues: A Practical Approach (IRL Press, Oxford, 1991), Greene and Wuts, Protective Groups in Organic Synthesis, Second Edition, (John Wiley & Sons, New York, 1991 ), Narang, editor, Synthesis and Applications of DNA and RNA (Academie Press, New York, 1987), Beaucage and lyer Tetrahedron 48: 2223-2311 (1992), and like référencés.

[0017] As used herein, polynucleotide N3'—>P5‘ thiophosphoramidate means an oligomer, usually linear, of nucleoside subunits linked by at least one N3'—>P5‘ thiophosphoramidate linkage. In general tenus, the nucleoside subunits comprise nucleosides or nucleoside analogs, but may also comprise more general moieties having compatible chemistry, such as abasic sugars and other hydrocarbon moieties, such as described in the following references: Newton et al., Nucleic Acids Research, 21:1155-1162 (1993); Griffin étal., J. Am. Chem. Soc., 114: 7976-7982 (1992); Jaschke et al., Tetrahedron Letters, 34: 301-304 (1992); Ma et al., International application PCT/CA92/00423; Zon et al., International application PCT/US90/06630; Durand et al., Nucleic Acids Research, 18: 6353-6359 (1990); Salunkhe et al., J. Am. Chem. Soc., 114: 8768-8772 (1992); and the like. In some instances, the temn means a polynucleotide where ail intemucleosidic linkages are replaced by N3'—>P5' thiophosphoramidate linkages. As such, the term comprehends partially as well as fully amidated oligomers. In some instances, the term means a polynucleotide where ail the intemucleosidic linkages are replaced by N3'—►P5' thiophosphoramidate linkages and wherein the nucleoside subunits are the natural nucleosides or analogs thereof. A subject polynucleotide N3’—>P5’ thiophosphoramidate in which every linkage is an N3'—*P5' thiophosphoramidate linkage (fully amidated) may be imbedded in or attached to other oligonucleotides or polynucleotides to form a larger oligomer which is partially amidated. A subject polynucleotide N3'—>P5' thiophosphoramidate may include any convenient 3' and/or 5' terminal groups. In some embodiments, the polynucleotide N3'—>P5' thiophosphoramidate includes a 3’-hydroxyl terminal group or a 3’-amino terminal group. [0018] As used herein, the ternis “phosphate and “phosphate group are meant to encompass a thiophosphate group and an oxophosphate group.

[0019] As used herein, the term phosphoramidite amino group refers to the amino group, NR⁴R⁵, attached to the phosphorus atom of a phosphoramidite group, and the term phosphoramidite nitrogen refers to the nitrogen atom of the phosphoramidite amino group.

[0020] “Alkyl refers to monovalent saturated aliphatic hydrocarbyl groups having from 1 to 10 carbon atoms and such as 1 to 6 carbon atoms (e.g., “an alkyl of 1 to 6 carbons atoms), or 1 to 5 (e.g., “an alkyl of 1 to 5 carbons atoms”), or 1 to 4 (e.g., “an alkyl of 1 to 4 carbons atoms), or 1 to 3 carbon atoms (e.g., “an alkyl of 1 to 3 carbons atoms). This term includes, by way of example, linear and branched hydrocarbyl groups such as methyl (CH₃-), ethyl (CH₃CH₂-), n-propyl (CH₃CH₂CH₂-), isopropyl ((CH₃)₂CH-), n-butyl (CH₃CH₂CH₂CH₂-), isobutyl ((CH₃)₂CHCH₂-), sec-butyl ((CH₃)(CH₃CH₂)CH-), t-butyl ((CH₃)₃C-), n-pentyl (CH₃CH₂CH₂CH₂CH₂-), and neopentyl ((CH₃)₃CCH₂)·

[00211 The term “substituted alkyl” refers to an alkyl group as defined herein wherein one or more carbon atoms in the alkyl chain hâve been optionally replaced with a heteroatom such as -O-, -N-, -S, -S(O)_n- (where n is 0 to 2), -NR- (where R is hydrogen or alkyl) and having from 1 to 5 substituents selected from the group consisting of alkoxy, substituted alkoxy, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, acyl, acylamino, acyloxy, amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, oxo, thioketo, carboxyl, carboxylalkyl, thioaryloxy, thioheteroaryloxy, thioheterocyclooxy, thiol, thioalkoxy, substituted thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, hydroxyamino, alkoxyamino, nitro, -SO-a!kyl, -SO-aryl, -SO-heteroaryl, -SO₂-alkyl, -SO₂-aryl, -SO₂-heteroaryl, and -NR^aR^b, wherein R^a and R^b may be the same or different and are chosen from hydrogen, optionally substituted alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, aryl, heteroaryl and heterocyclic. In some instances, a “substituted alkyl” refers to an alkyl group as defined herein having from 1 to 5 substituents selected from the group consisting of alkoxy, cycloalkyl, cycloalkenyl, acyl, acylamino, acyloxy, amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, carboxyl, carboxylalkyl, thiol, thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, sulfonamido, and NR^aR^b, wherein R³ and R^b may be the same or different and are chosen from hydrogen, alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, aryl, heteroaryl and heterocyclic.

[0022] “Alkoxy” refers to the group -O-alkyl, wherein alkyl is as defined herein. Alkoxy includes, by way of example, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, t-butoxy, sec-butoxy, npentoxy, and the like. The terni “alkoxy also refera to the groups alkenyl-O-, cycloalkyl-O-, cycloalkenyl-O-, and alkynyl-O-, where alkenyl, cycloalkyl, cycloalkenyl, and alkynyl are as defined herein.

[0023] The terni “substituted alkoxy refera to the groups substituted alkyl-O-, substituted alkenylθ', substituted cycloalkyl-O-, substituted cycloalkenyl-O-, and substituted alkynyl-O- where substituted alkyl, substituted alkenyl, substituted cycloalkyl, substituted cycloalkenyl and substituted alkynyl are as defined herein.

[0024] “Acyl refers to the groups H-C(O)-, alkyl-C(O)-, substituted alkyl-C(O)-, alkenyl-C(O)-, substituted alkenyl-C(O)-, alkynyl-C(O)-, substituted alkynyl-C(O)-, cycloalkyl-C(O)-, substituted cycloalkyl-C(O)-, cycloalkenyl-C(O)-, substituted cycloalkenyl-C(O)-, aryl-C(O)-, substituted aryl-C(O), heteroaryl-C(O)-, substituted heteroaryl-C(O)-, heterocyclyl-C(O)-, and substituted heterocyclylC(O)-, wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, and substituted heterocyclic are as defined herein. For example, acyl includes the “acetyl group CH₃C(O)[0025] The term “substituted amino refera to the group -NRR where each R is independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, alkenyl, substituted alkenyl, cycloalkenyl, substituted cycloalkenyl, alkynyl, substituted alkynyl, aryl, heteroaryl, and heterocyclyl provided that at least one R is not hydrogen.

[0026] “Halo or “halogen refera to fluoro, chloro, bromo, and iodo. [0027] “Hydroxy or “hydroxyl” refera to the group -OH.

[0028] “Heteroaryl” refers to an aromatic group of from 1 to 15 carbon atoms, such as from 1 to 10 carbon atoms and 1 to 10 heteroatoms selected from the group consisting of oxygen, nitrogen, and sulfur within the ring. Such heteroaryl groups can hâve a single ring (such as, pyridinyl, imidazolyl or furyl) or multiple condensed rings in a ring system (for example as tn groups such as, indolizinyl, quinolinyl, benzofuran, benzimidazolyl or benzothienyl), wherein at least one ring within the ring system is aromatic, provided that the point of attachment is through an atom of an aromatic ring. In certain embodiments, the nitrogen and/or sulfur ring atom(s) of the heteroaryl group are optionally oxidized to provide for the N-oxide (N—>O), sulfinyl, or sulfonyl moieties. This term includes, by way of example, pyridinyl, pyrrolyl, indolyl, thiophenyl, and furanyl. Unless otherwise constrained by the définition for the heteroaryl substituent, such heteroaryl groups can be optionally substituted with 1 to 5 substituents, or from 1 to 3 substituents, selected from acyloxy, hydroxy, thiol, acyl, alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, substituted alkyl, substituted alkoxy, substituted alkenyl, substituted alkynyl, substituted cycloalkyl, substituted cycloalkenyl, amino, substituted amino, aminoacyl, acylamino, alkaryl, aryl, aryloxy, azido, carboxyl, carboxylalkyl, cyano, halogen, nitro, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, aminoacyloxy, oxyacylamino, thioalkoxy, substituted thioalkoxy, thioaryloxy, thioheteroaryloxy, -SO-alkyl, -SO-substituted alkyl, SO-aryl, -SO-heteroaryl, -SO₂-alkyl, -SO₂-substituted alkyl, -SO₂-aryl and -SO₂-heteroaryl, and trihalomethyl. In such cases, a heteroaryl group that is substituted with from 1 to 5 substituents (e.g., as described herein) is referred to as a “substituted heteroaryl”.

[0029] “Heterocycîe,” “heterocyclic,” “heterocycloalkyl, and “heterocyclyl refer to a saturated or unsaturated group having a single ring or multiple condensed rings, including fused bridged and spiro ring Systems, and having from 3 to 20 ring atoms, including 1 to 10 hetero atoms. These ring atoms are selected from the group consisting of nitrogen, sulfur, or oxygen, wherein, in fused ring Systems, one or more ofthe rings can be cycloalkyl, aryl, or heteroaryl, provided that the point of attachment is through the non-aromatic ring. In certain embodiments, the nitrogen and/or sulfur atom(s) of the heterocyclic group are optionally oxidized to provide for the N-oxide, -S(O)-, or -SO₂- moieties.

[0030] Examples of heterocycles and heteroaryls include, but are not limited to, azetidine, pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indolizine, isoindole, indole, dihydroindole, indazole, purine, quinolizine, isoquinoline, quinoline, phthalazine, naphthylpyridine, quinoxaline, quinazoline, cinnolïne, pteridine, carbazole, carboline, phenanthridine, acridine, phenanthroline, isothiazole, phenazine, isoxazole, phenoxazine, phenothiazine, ïmidazolidine, imidazoline, piperidine, piperazine, indoline, phthalimide, 1,2,3,4-tetrahydroisoquinoline, 4,5,6,7tetrahydrobenzo[b]thiophene, thiazole, thiazolidine, thiophene, benzo[b]thiophene, morpholinyl, thiomorpholinyl (also referred to as thiamorpholinyl), 1,1-dioxothiomorpholinyl, piperidinyl, pyrrolidine, tetrahydrofuranyl, and the like.

[0031] Unless otherwise constrained by the définition for the heterocyclic substituent, such heterocyclic groups can be optionaily substituted with 1 to 5, or from 1 to 3 substituents, selected from alkoxy, substituted alkoxy, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, acyl, acylamino, acyloxy, amîno, substituted amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, oxo, thioketo, carboxyl, carboxylalkyl, thioaryloxy, thioheteroaryloxy, thioheterocyclooxy, thiol, thioalkoxy, substituted thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, hydroxyamino, alkoxyamino, nitro, -SO-alkyl, -SO-substituted alkyl, -SO-aryl, -SO-heteroaryl, -SO₂-alkyl, -SO₂-substituted alkyl, -SO₂-aryl, -SO₂heteroaryl, and fused heterocycle.

[0032] “Nitro refers to the group -NO₂.

[0033] “Oxo refers to the atom (=0).

[0034] “Thiol” refers to the group -SH.

[0035] “Thioxo” or the term “thioketo refers to the atom (=S).

[0036] In addition to the disclosure herein, the term “substituted, when used to modify a specified group or radical, can also mean that one or more hydrogen atoms of the specified group or radical are each, independently of one another, replaced with the same or different substituent groups as defined below.

[0037] In addition to the groups disclosed with respect to the individual ternis herein, substituent groups for substituting for one or more hydrogens (any two hydrogens on a single carbon can be replaced with =O, =NR⁷⁰, =N-OR⁷⁰, =N2 or =S) in the specified group or radical are, unless otherwise specified, -R⁶⁰, halo, =0, -OR⁷⁰, -SR⁷⁰, -NR⁸⁰R⁸⁰, trihalomethyl, -CN, -OCN, -SCN, -NO, -NO2, =N₂, -N₃, -SO₂R⁷⁰, -SO2O’M⁺, -SO2OR⁷⁰, -OSO2R⁷⁰, -OSO2O“M‘, -OSO₂OR⁷⁰, -P(O)(O’ )2(M⁺)2, -P(O)(OR⁷⁰)O-M⁺, -P(O)(OR⁷⁰)₂₁ -C(O)R⁷⁰, -C(S)R⁷⁰, -C(NR⁷⁰)R⁷⁰, -C(O)CT

M⁺, -C(O)OR⁷⁰, -C(S)OR⁷⁰, -C(O)NR^e0R⁸⁰, -C(NR⁷⁰)NR⁸⁰R⁸⁰, -OC(O)R⁷⁰, -OC(S)R⁷⁰, -OC(O)O M⁺, -O C(O)OR⁷⁰, -OC(S)OR⁷⁰, -NR⁷⁰C(O)R⁷⁰, -NR⁷⁰C(S)R⁷⁰, -NR⁷⁰CO₂

M⁺, -NR⁷⁰CO2R⁷⁰, -NR⁷⁰C(S)OR⁷⁰, -NR⁷⁰C(0)NR⁸⁰R⁸⁰, -NR⁷⁰C(NR⁷⁰)R⁷⁰ and -NR⁷⁰C(NR⁷⁰)NR⁸⁰R⁸⁰, where R⁶⁰ is selected from the group consisting of optionally substituted alkyl, cycloalkyl, heteroalkyl, heterocycloalkylalkyl, cycloalkylalkyl, aryl, arylalkyl, heteroaryl and heteroarylalkyl, each R⁷⁰ is independently hydrogen or R⁶⁰; each R⁸⁰ is independently R⁷⁰ or alternative^, two R⁸⁰ s, taken together with the nitrogen atom to which they are bonded, form a 5-, 6- or 7-membered heterocycloalkyl which may optionally include from 1 to 4 of the same or different additional heteroatoms selected from the group consisting of O, N and S, of which N may hâve -H or C1-C3 alkyl substitution; and each M⁺ is a counter ion with a net single positive charge. Each M⁺ may independently be, for example, an alkali ion, such as K⁺, Na⁺, Li⁺; an ammonium ion, such as ⁺N(R⁶⁰)4; or an alkaline earth ion, such as [Ca²⁺]05, [Mg²⁺]05, or [Ba²*]₀₅ (“subscript 0.5 means that one of the counter ions for such divalent alkali earth ions can be an ionized form of a compound of the invention and the other a counter ion such as chloride, or two ionized compounds disclosed herein can serve as counter ions for such divalent alkali earth ions, or a doubly ionized compound of the invention can serve as the counter ion for such divalent alkali earth ions). As spécifie examples, -NR⁸⁰R⁸⁰ is meant to include -NH₂, -NH-alkyl, N-pyrrolidinyl, A/-piperazinyl, 4/V-methylpiperazin-1-yl and N-morpholinyl.

[0038] In addition to the disclosure herein, in a certain embodiment, a group that is substituted has 1, 2, 3, or 4 substituents, 1,2, or 3 substituents, 1 or 2 substituents, or 1 substituent.

[0039] It is understood that in ali substituted groups defined above, polymers arrived at by defining substituents with further substituents to themselves (e.g., substituted aryl having a substituted aryl group as a substituent which is itself substituted with a substituted aryl group, which is further substituted by a substituted aryl group, etc.) are not intended for inclusion herein. In such cases, the maximum number of such substitutions is three. For example, serial substitutions of substituted aryl groups specifically contemplated herein are limited to substituted aryl-(substituted aryl)-substituted aryl.

[0040] Unless indicated otherwise, the nomenclature of substituents that are not explicitly defined herein are arrived at by naming the terminal portion of the functionality followed by the adjacent functionality toward the point of attachment.

[0041] As to any of the groups disclosed herein which contain one or more substituents, it is understood, of course, that such groups do not contain any substitution or substitution patterns which are sterically impractical and/or synthetically non-feasible. In addition, the subject compounds include ail stereochemical isomers arising from the substitution of these compounds.

[0042] The term “phamnaceutically acceptable sait” means a sait which is acceptable for administration to a patient, such as a mammal (salts with counterions having acceptable mammalian safety for a given dosage régime). Such salts can be derived from pharmaceutically acceptable inorganic or organic bases and from pharmaceutically acceptable inorganic or organic acids.

“Pharmaceutically acceptable sait refers to pharmaceutically acceptable salts of a compound, which salts are derived from a variety of organic and inorganic counter ions well known in the art and include, by way of example only, sodium, and the like; and when the molécule contains a basic functionality, salts of organic or inorganic acids, such as hydrochloride, and the like. Pharmaceutically acceptable salts of interest include, but are not limited to, aluminium, ammonium, arginine, barium, benzathine, calcium, cholinate, ethylenediamine, lysine, lithium, magnésium, meglumine, procaine, potassium, sodium, tromethamine, N-methylglucamine, N,N'-dibenzylethylene-diamine, chloroprocaine, diethanolamine, ethanolamine, piperazine, zinc, diisopropylamine, triethylamine, diisopropylethylamine and triethanolamine salts.

[0043] The term “sait thereof means a compound formed when a proton of an acid is replaced by a cation, such as a métal cation or an organic cation and the like. Where applicable, the sait is a pharmaceutically acceptable sait, although this is not required for salts of intermediate compounds that are not intended for administration to a patient. By way of example, salts of the présent compounds include those wherein the compound is protonated by an inorganic or organic acid to form a cation, with the conjugate base of the inorganic or organic acid as the anionic component of the sait. Salts of interest include, but are not limited to, aluminium, ammonium, arginine, barium, benzathine, calcium, césium, cholinate, ethylenediamine, lithium, magnésium, meglumine, procaine, N-methylglucamine, piperazine, potassium, sodium, tromethamine, zinc, N,N'-dibenzylethylenediamine, chloroprocaine, diethanolamine, ethanolamine, piperazine, diisopropylamine, triethylamine, diisopropylethylamine and triethanolamine salts. It is understood that for any of the polynucleotide structures depicted herein that include a backbone of internucleoside linkages, such polynucleotides may also include any convenient sait forms. In some embodiments, acidic forms of the internucleoside linkages are depicted for simplicity. In some instances, the sait of the subject compound is a monovalent cation sait. In certain instances, the sait of the subject compound is a divalent cation sait. In some instances, the sait of the subject compound is a trivalent cation sait.

[0044] “Solvaté” refers to a complex formed by combination of solvent molécules with molécules or ions of the soluté. The solvent can be an organic compound, an inorganic compound, or a mixture of both. Some examples of solvents include, but are not limited to, methanol, A/.N-dimethylformamide, tetrahydrofuran, dimethylsulfoxide, and water. When the solvent is water, the solvaté formed is a hydrate,

[0045] “Stereoisomer and “stereoisomers refer to compounds that hâve same atomic connectivity but different atomic arrangement in space. Stereoisomers include cis-trans isomers, E and Z isomers, enantiomers, and diastereomers.

[0046] “Tautomer” refers to altemate forms of a molécule that differ only in electronic bonding of atoms and/or in the position of a proton, such as enol-keto and imine-enamine tautomers, -NHP(=S)(OH)-O- and -NH-P(=O)(SH)-O-, or the tautomeric forms of heteroaryl groups containing a N=C(H)-NH- ring atom arrangement, such as pyrazoles, imidazoles, benzimidazoles, triazoles, and tetrazoles. A person of ordinary skill in the art would recognize that other tautomeric arrangements of the groups described herein are possible. For example, it is understood that a polynucleotide described by the following structure:

O=PSH

*«2 also encompasses the following structure showing one possible altemate tautomeric arrangement of linkage groups:

S=^-CH nps^ nps^ nps^ nps¹^ nps^ nps^¹ nps) ^2 where “nps represents a thiophosphoramidate linkage (—NH—P(=O)(SH)—O— or—NH— P(=S)(OH)—O—) connecting the 3-carbon of one nucleoside to the 5'-carbon of the adjacent nucleoside. It is understood that ail tautomeric forms of a subject compound are encompassed by a structure where one possible tautomeric arrangement of the groups of the compound is described, even if not specifically indicated. Any convenient tautomeric arrangement of the groups of the subject compounds may be utilized in describing the compounds.

(0047] It will be appreciated that the term “or a sait or solvaté or stereoisomer thereof is intended to include ail permutations of salts, solvatés and stereoisomers, such as a solvaté of a pharmaceutically acceptable sait of a stereoisomer of subject compound. It is understood that the term “or a sait thereof is intended to include ail permutations of salts. It is understood that the term “or a pharmaceutically acceptable sait thereof is intended to include ail permutations of salts. It is understood that the terni “or a solvaté thereof is intended to include ail permutations of solvatés. It is understood that the term “or a stereoisomer thereof is intended to include ail permutations of stereoisomers. It is understood that the term “or a tautomer thereof is intended to include ail permutations of tautomers. Thus for example it follows that rt is intended to include a solvaté of a pharmaceutically acceptable sait of a tautomer of a stereoisomer of subject compound.

[0048] As used herein the term “isolated is meant to describe a compound of interest that is in an environment different from that in which the compound naturally occurs. “Isolated” is meant to include compounds that are within samples that are substantially enriched for the compound of interest and/or in which the compound of interest is partially or substantially purified.

[0049] As used herein, the term “substantially purified” refers to a compound that is removed from its naturel environment and is at least 60% free, at least 75% free, at least 80% free, at least 81% free, at least 82% free, at least 83% free, at least 84% free, at least 85% free, at least 86% free, at least 87% free, at least 88% free, at least 89% free, at least 90% free, at least 91% free, at least 92% free, at least 93% free, at least 94% free, at least 95% free, at least 96% free, at least 97% free, at least 98% free, at least 99% free, or more than 99% free, from other components with which it is naturally associated.

[0050[ The term “physiological conditions is meant to encompass those conditions compatible with living cells, e.g., predominantly aqueous conditions of a température, pH, salinity, etc. that are compatible with living cells.

[0051] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictâtes otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0052] It must be noted that as used herein and in the appended daims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictâtes otherwise. It is further noted that the daims may be drafted to exclude any optional element. As such, this statement is intended to serve as antécédent basis for use of such exclusive terminology as “solely, “only and the like in connection with the récitation of daim éléments, or use of a “négative limitation.

[0053] Other définitions of tenus may appear throughout the spécification.

DESCRIPTION OF EXEMPLARY EMBODIMENTS

[0054] As summarized above, aspects of the disclosure include methods for the préparation of a polynucleotide. In some embodiments, the method includes contacting a first polynucleotide composition including: a polynucleotide having a sequence of 7 or more nucleoside subunits where at least two of the nucleoside subunits are joined by a N3'—>P5' thîophosphoramidate inter-subunit linkage; and non-target synthetic products and reagents; with a multivalent cation sait to precipitate a first polynucleotide sait including at least one multivalent cation counterion; and separating the first polynucleotide sait from the contacted first polynucleotide composition to produce a second polynucleotide composition including the first polynucleotide sait. In certain embodiments, the method further includes contacting the polynucleotide sait with a reverse phase chromatography support; and eluting from the chromatography support a third polynucleotide composition including the polynucleotide. In some instances, third polynucleotide composition includes a second polynucleotide sait. Also provided are compositions including a sait of the polynucleotide including at least one multivalent cation counterion. In some embodiments, the at least one multivalent cation counterion is selected from the group consîsting of magnésium, zinc, aluminium, and calcium.

[0055] Before the various embodiments are described, it is to be understood that the teachings of this disclosure are not limited to the particular embodiments described, and as such can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the présent teachings will be limited only by the appended daims.

[0056| The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described in any way. While the présent teachings are described in conjunction with various embodiments, it is not intended that the présent teachings be limited to such embodiments. On the contrary, the présent teachings encompass various alternatives, modifications, and équivalents, as will be appreciated by those of skill in the art.

[0057] Unless defined otherwise, ail technical and scientific terms used herein hâve the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or équivalent to those described herein can also be used in the practice or testing of the présent invention, methods and materials of interest are now described. Ail publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited.

[0058] The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present daims are not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided can be different from the actual publication dates which can be independently confirmed.

[0059] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, variousfeatures ofthe invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. Ail combinations ofthe embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed, to the extent that such combinations embrace subject matter that are, for example, compounds that are stable compounds (i.e., compounds that can be made, isolated, characterized, and tested for biological activity). In addition, ail sub-combinations ofthe various embodiments and éléments thereof (e.g., éléments of the Chemical groups listed in the embodiments describing such variables) are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein. [0060] Ail patents and publications, including ail sequences disclosed within such patents and publications, referred to herein are expressly incorporated by reference.

[0061] In further describing the subject invention, methods of preparing a polynucleotide are described first in greater detail. Next, polynucleotide compositions of interest for practicing the subject methods are reviewed.

Methods of Préparation

[0062] Aspects of the present disclosure include methods for the préparation of a polynucleotide. In some embodiments, the method includes contacting a first polynucleotide composition including a polynucleotide (e.g., as described herein) and non-target synthesis products and agents, with a multivalent cation sait to precipitate a polynucleotide sait including at least one multivalent cation counterion. Précipitation of the polynucleotide sait using the subject methods provides for removal of ail soluble non-target synthesis products and agents. In some embodiments, the method includes separating the polynucleotide sait from the contacted first polynucleotide composition to produce a second polynucleotide composition including the polynucleotide sait. In certain embodiments, the first polynucleotide composition, the polynucleotide sait and the second polynucleotide composition each include a target polynucleotide having a sequence of 7 or more nucleoside subunits where at least two of the nucleoside subunits are joined by a N3'—>P5' thiophosphoramidate inter-subunit linkage (e.g., as described herein).

[0063] The second polynucleotide composition may hâve a reduced amount of non-target synthesis products and agents as compared to the first polynucleotide composition. By reduced amount of non-target synthesis products and agents is meant that there is a 10% or more by weight réduction of the non-target synthesis products and agents in the second polynucleotide composition as compared to the first polynucleotide composition, such as a 15% or more by weight réduction, 20% or more by weight réduction, 25% or more by weight réduction, 30% or more by weight réduction, 35% or more by weight réduction, 40% or more by weight réduction, 45% or more by weight réduction, 50% or more by weight réduction, 55% or more by weight réduction, 60% or more by weight réduction, 65% or more by weight réduction, 70% or more by weight réduction, 75% or more by weight réduction, 80% or more by weight réduction, 85% or more by weight réduction, 90% or more by weight réduction, or 95% or more by weight réduction. As such, the subject methods may provide for sélective précipitation of target polynucleotide over non-target synthesis products and agent. In certain embodiments, the subject methods provide for împroved selectivity of précipitation as compared to a control method of polynucleotide précipitation using an organic solvent, such as neat éthanol or an éthanol solution (see e.g., Crouse J, Amorese D (1987). Ethanol Précipitation: Ammonium Acetate as an Alternative to Sodium Acetate. Focus 9 (2): 3-5). By împroved selectivity of précipitation is meant that 5% or more by weight of non-target synthesis products and agents are removed from the second polynucleotide composition as compared to a control composition, such as 10% or more by weight, 15% or more by weight, 20% or more by weight, 25% or more by weight,

30% or more by weight, 35% or more by weight, 40% or more by weight, 45% or more by weight,

50% or more by weight, 55% or more by weight, 60% or more by weight, 65% or more by weight,

70% or more by weight, 75% or more by weight, 80% or more by weight, 85% or more by weight,

90% or more by weight, or 95% or more by weight of non-target synthesis products and agents are removed, The reduced amount of non-target synthesis products and agents as compared to the first polynucleotide composition may be determined using any convenient methods, for example using HPLC methods.

[0064] As used herein, the ternis “target synthetic polynucleotide” and “target polynucleotide are used interchangeably and refer to a polynucleotide having a particular desired sequence of nucléotides that is synthesized on a support via any convenient stepwise solid phase polynucleotide synthesis method (e.g., as described herein), and where the polynucleotide is devoid of any protecting groups that are utilized solely for purposes of executing the synthetic strategy of the target polynucleotide. Such protecting groups may be removed from a polynucleotide in the final steps of solid phase synthesis, e.g., during final deprotection and cleavage of the polynucleotide from a support to produce the target polynucleotide. As used herein, the temn “non-target refers to any convenient component, e.g., a compound, a polynucleotide or dérivative thereof, an agent, etc., or mixtures thereof that is not the desired target product of a synthesis.

[0065] The target polynucleotide can include any convenient number of nucleoside subunits, such as between 7 and 500 nucleoside subunits, between 7 and 100 nucleoside subunits, between 7 and 75 nucleoside subunits, between 7 and 50 nucleoside subunits, between 7 and 40 nucleoside subunits, between 7 and 30 nucleoside subunits, between 7 and 20 nucleoside subunits, between 7 and 15 nucleoside subunits, between 10 and 15 nucleoside subunits, or between 13 and 15 nucleoside subunits. In some instances, the target polynucleotide has between 7 and 100 nucleoside subunits, such as between 7 and 50 nucleoside subunits, between 10 and 50 nucleoside subunits, between 10 and 40 nucleoside subunits, between 10 and 30 nucleoside subunits, between 10 and 25 nucleoside subunits, between 10 and 20 nucleoside subunits, between 12 and 18 nucleoside subunits, or between 12 and 16 nucleoside subunits. In certain cases, the target polynucleotide has 7, 8, 9, 10, 11, 12, 13,14,15,16,17,18,19, 20, 21,22, 23, 24 or 25 nucleoside subunits.

[0066] As used herein, the term “non-target synthesis products and agents” refers collectively to a variety of non-target components that may be present in a crude synthetic product of solid phase polynucleotide synthesis, including but not limited to: non-target polynucleotide products of the synthesis, such as truncated polynucleotides, capped polynucleotide fragments (i.e., sequences that were capped after a failed subunit coupling), polynucleotides including deletion(s) (i.e., missing one or more target nucleoside monomers or dimers, e.g., as described herein) and derivatized polynucleotides (e.g., polynucleotide sequences that undergo an undesirable side reaction during synthesis or cleavage); and agents such as cleaved linkers, products of deprotection, e.g., removed protecting group products such as phosphorus protecting groups products and base protecting group products (e.g., exocyclic amine protecting group products), cleavage reagents and/or cleavage scavengers and residual synthesis reagents, such as monomers, dimers, coupling, capping or deprotection reagents.

[0067] In certain embodiments, the methods provide for sélective précipitation of target polynucleotide over non-target synthesis products and agents that include polynucleotides having 6 nucleoside subunits or less, such as 5 or less, 4 or less, 3 or less or 2 nucleoside subunits. In certain cases, ail non-target synthesis products and agents which are not polynucleotides remain soluble during the sélective précipitation step of the subject methods and may thus be easily removed from the resulting polynucleotide sait precipitate.

[0068] The subject methods may include précipitation and séparation of the target polynucleotide from a crude synthetic préparation to produce a polynucleotide composition that has several désirable properties, such as a reduced amount of non-target synthesis products and agents (e.g., synthesis reagents, cleavage reagents, scavengers, removed protecting groups, cleavage side products (linkers, capping groups, etc.), and small polynucleotide fragments).

[0069] In some embodiments, the subject methods include precipitating the polynucleotide from a crude synthetic préparation as a multivalent cation sait prior to chromatography purification. In certain cases, the subject methods are methods of purification of a target polynucleotide. Précipitation of the crude polynucleotide composition using a multivalent cation sait produces a polynucleotide sait precipitate including at least one multivalent cation counterion. In some cases, the polynucleotide sait precipitate includes a mixture of monovalent and multivalent cation counterions which form ion pairs with the polyanionic polynucleotide backbone. As used here, the terms “multivalent cation sait and “multivalent sait when used in reference to a polynucleotide are used interchangeably to refer to a polynucleotide sait that includes at least one multivalent cation counterion that is ion paired to an anionic inter-subunit linkage group of the polynucleotide backbone. In some instances, the multivalent cation sait of the polynucleotide includes a mixture of monovalent and multivalent cations. In some embodiments, the multivalent cation may provide for aggregation of the target polynucleotide by ion pairing to anionic inter-subunit linkage groups of two or more polynucleotide backbones. In certain instances, a divalent cation ion pairs with two distinct polynucleotides to form a dimer. In some cases, further aggregation of the polynucleotides may be achieved by additional multivalent interactions mediated by additional multivalent cations. As such, in some cases, the subject methods may provide for sélective aggregation and précipitation of target polynucleotides over non-target synthetic products and agents.

[0070] In some embodiments of the method, the at least one multivalent cation counterion is divalent. In certain embodiments, the at least one multivalent cation counterion is selected from the group consisting of magnésium, zinc and calcium. In some embodiments, the at least one multivalent cation counterion is trivalent. In certain embodiments, the at least one multivalent cation counterion is aluminium. In some embodiments, the polynucleotide sait further includes a monovalent cation counterion. In such cases, the polynucleotide sait is a mixed sait, e.g., a sait including two or more different cation counterions.

[0071] Any convenient methods of precipitating a polynucleotide may find use in the subject methods. The step of contacting the first polynucleotide composition with a multivalent cation sait to precipitate a polynucleotide sait including at least one multivalent cation counterion may be achieved using any convenient methods. Any convenient multivalent cations and salts thereof (e.g., as described herein) may be utilized in the contacting step to produce the precipitate. In certain instances, a sait of a polynucleotide including at least one multivalent cation counterion is produced in a solution phase, e.g., via the addition of a multivalent cation sait to a solution including the polynucleotide. Once the multivalent cation sait has been added to the solution the precipitate may then form. In some cases, a sait of a polynucleotide including at least one multivalent cation counterion may be formed on an ion exchange support. Any convenient ion exchange supports may be utilized in the contacting step. In some cases, the ion exchange support is a strong cation exchange resin. In some embodiments of the method, the contacting step includes eluting the first polynucleotide composition from a cation exchange support that includes multivalent cation counterions. As used herein, the term “cation exchange support” refers to a support which is itself anionic and is capable of ion pairing with a cationic analyte, such as a multivalent cation of interest. Any convenient eluant may be utilized for the step of eluting from the cation exchange support. In some instances, the precipitate forms in the eulate after the polynucleotide sait has been eluted from the cation exchange support.

[0072] The subject methods may be performed on any convenient crude synthetic préparation of a target synthetic polynucleotide. In some instances, the first polynucleotide composition is a crude synthetic préparation of a target synthetic polynucleotide. In certain embodiments, the first polynucleotide composition is a composition that is the product of cleavage of a target polynucleotide from a support, post synthesis. As such, the first polynucleotide composition may include a variety of non-target synthetic products and agents. The subject methods provide for sélective précipitation of the polynucleotide sait over non-target synthesis products and agents, which remain in solution and thus can be easily removed from the resulting precipitate.

[0073] Any convenient methods of synthesis (e.g., as described herein) may be utilized to synthesize the target polynucleotide. Following synthesis, the target polynucleotide is cleaved from the support on which stepwise synthesis is performed. Following cleavage, the full length target polynucleotide may be purified to remove undesirable synthesis and cleavage reagents and to remove non-target polynucleotide fragments, and dérivatives thereof. The subject methods including précipitation of the polynucleotide sait including at least one multivalent cation counterion may be performed at any convenient stage of the préparation of a target polynucleotide, such as post synthesis and prior to reverse phase chromatography purification.

[0074] As used herein, the terms “crude synthetic préparation”, “crude composition” and “crude polynucleotide refer to a composition including the synthetic products of solid phase polynucleotide synthesis that are collected post synthesis via cleavage from a solid phase synthesis support, where the composition is unpurified, Le., no chromatography purification has been performed on the composition. Chromatography purification refers to any convenient purification method that includes absorption of target polynucleotide to a chromatography support and subséquent elution and resolution of the target polynucleotide from non-target polynucleotides. In some cases, chromatography purification refers to reverse phase chromatography purification.

[0080] Separating the precipitate from the contactée! first polynucleotide composition produces a second polynucleotide composition including the first polynucleotide sait. In some cases, sélective précipitation of the first polynucleotide sait using the multivalent cation sait via the subject methods produces a second polynucleotide composition that includes a reduced amount of non-target synthetic products and agents.

[0081] After sélective précipitation, the subject polynucleotide salts may then be converted into a soluble polynucleotide sait by cation exchange of the at least one multivalent cation counterion away from the polynucleotide and replacement with another cation counterion of interest (e.g., as described herein). As such, the subject methods provide for réversible formation of a first polynucleotide sait including at least one multivalent cation counterion. As used herein, the terms “réversible formation” and “réversible exchange are used interchangeably and refer to the préparation of a polynucleotide sait by, e.g., sélective précipitation (e.g., as described herein), where the sait formed may also be subsequently dissociated to exchange away the at least one multivalent cation sait from the sait. In some cases, polynucleotide salts which are insoluble in any solvent may be referred to as îrreversibly formed salts. In some embodiments, the method includes exchanging the at least one multivalent cation counterion away from the first polynucleotide sait to produce a soluble second polynucleotide sait, where the exchanging includes dissociating the multivalent cation counterion and ion pairing with a soluble sait cation of interest. In certain instances, the soluble second polynucleotide sait is a monovalent sait. In certain instances, the soluble second polynucleotide sait is a sodium sait. In certain instances, the soluble second polynucleotide sait is a triethylammonium sait. In some instances, the first and second polynucleotide are distinct from each other, Le., include different cation counterions. The dissociation of the subject polynucleotide salts and exchange of the at least one multivalent cation counterion may be achieved using any convenient methods. In certain instances, dissociation is achieved using reverse phase chromatography, e.g., as described herein. In some cases, ion exchange chromatography may be utilized to achieve dissociation. In certain embodiments, dissociation of the first polynucleotide sait is achieved by dissolution of the sait in a solvent including a cation counterion of interest.

[0082] After the séparation, further purification steps may be performed on the second polynucleotide composition. In some embodiments, the method further includes: contacting the first polynucleotide sait with a reverse phase chromatography support; and eluting from the chromatography support a third polynucleotide composition including the polynucleotide. In certain embodiments, the third polynucleotide composition includes a second polynucleotide sait. Any convenient reverse phase chromatography methods may be utilized to purify the polynucleotide sait. Reverse phase chromatography methods and supports of interest include, but are not limited to, chromatographie purification using ion-pair reversed-phase chromatography, C18 reversed-phase chromatography and those methods and supports described by Chen et al., Journal of Chromatography A, Volume 1288, 3 May 2013, Pages 73-81; and Zimmermann et al., Journal of Chromatography A, Volume 1354, 8 August 2014, Pages 43-55. In some embodiments, the second polynucleotide composition is loaded directly onto the reverse phase chromatography support. By loaded directly on the support is meant that the second polynucleotide composition produced using the subject method is added directly, e.g., as an isolated solid precipitate, to the reverse phase chromatography support. In some instances, the reverse phase chromatography support is a resin configured as a column and the polynucleotide composition is added to the top of the resin bed. In certain embodiments, the method further includes dissolving the second polynucleotide composition in a solvent. Any convenient solvents may be utilized, including but not limited to, aqueous buffers, organic solvents miscible with water and mixtures thereof. In such cases, a solution of the second polynucleotide composition may be contacted with the reverse phase chromatography support to absorb the polynucleotide to the support prior to elution.

[0083J In some cases, the contacting includes absorbing the polynucleotide onto the reverse phase chromatography support and subsequently eluting the polynucleotide to provide for chromatographie resolution of the target polynucleotide from non-target polynucleotide and residual synthetic agents that are présent in the composition. The eluate containing target polynucleotide is collected. Any convenient eluants may be utilized to elute the polynucleotide from the reverse phase chromatography support. The eluant may be selected according to a variety of factors, such as the nature of the reverse phase chromatography support, the target oligonucleotide, particular desired salts of the target polynucleotide, etc. In some instances, the at least one multivalent cation counterion of the first polynucleotide sait is ion exchanged on the reverse phase chromatography support with another distinct cation counterion of interest that is included in the eluant. In such cases, when the polynucleotide is eluted from the reverse phase chromatography support, it is in a different sait form (i.e., a second polynucleotide sait) that when it was loaded because the at least one multivalent cation counterion is been exchanged away from the polynucleotide. In certain instances, the sait form of the polynucleotide that is eluted from the support in the third polynucleotide composition is more water soluble than the first polynucleotide sait including at least one multivalent cation counterion.

[0084] In certain embodiments, the third polynucleotide composition includes a second polynucleotide sait that is a pharmaceutically acceptable sait of the polynucleotide. In certain instances, the third composition includes includes a second polynucleotide sait that is a monovalent cation sait of the polynucleotide. In certain cases, the third composition includes a second polynucleotide sait that is a triethylammonium sait of the polynucleotide. In certain cases, the third composition includes a second polynucleotide sait that is a sodium sait of the polynucleotide. It is understood that after the polynucleotide is purified by reverse phase chromatography, any number of further cation counterion exchange steps may be performed on the polynucleotide sait to produce a desired sait form of the polynucleotide. In some embodiments, the method further includes ion exchanging cation counterions from the second polynucleotide sait to produce a third polynucleotide sait. In certain embodiments, the third polynucleotide sait is a pharmaceutically acceptable sait of the polynucleotide. In certain instances, the third polynucleotide sait is a monovalent cation sait of the polynucleotide. In certain instances, the third polynucleotide sait is a sodium sait of the polynucleotide (e.g., as described herein).

[0085] In certain instances, the first composition includes a monovalent cation sait of the polynucleotide. In certain cases, the monovalent cation sait is selected from the group consisting of sodium, ammonium and alkyl ammonium. In certain instances, the alkyl ammonium is selected from the group consisting of dimethylammonium, méthylammonium, ethylammonium and triethylammonium. In certain cases, the first composition includes an ammonium sait of the polynucleotide. In certain cases, the first composition includes an alkyl ammonium sait of the polynucleotide. In certain cases, the first composition includes a triethylammonium sait of the polynucleotide. In certain cases, the first composition includes a sodium sait of the polynucleotide. The first polynucleotide composition may be contacted with a multivalent cation sait to precipitate a first polynucleotide sait including at least one multivalent cation counterion. As such, in certain embodiments, the contacted first polynucleotide composition includes the first polynucleotide sait including at least one multivalent cation counterion.

[0086] Considered to be embraced within the scope of this invention are embodiments of any of the above-indicated embodiments of the method, where the polynucleotide is as described herein.

Methods of Synthesis

[0087] Any convenient polynucleotide synthesis methods, strategies and chemistries may be utilized to préparé the crude synthetic product polynucleotide compositions which find use in the subject methods of préparation. Polynucleotide synthesis chemistries and methods of interest that may be adapted for use in the subject methods include, but are not limited to, phosphoramidite, Hphosphonate, phosphodiester, phosphotriester, phosphite triester. The polynucleotide components of the invention compounds may be synthesized by adapting any conventional protocols for the type of chemistry selected. Methods of interest for the synthesis of oligonucleotides having N3'—>P5' thiophosphoramidate chemistries include, but are not limited to, those methods described in U.S. 5,824,793, McCurdy et aL, (1997) Tetrahedron Letters, 38:207-210; Pongracz & Gryaznov, (1999) Tetrahedron Letters, 49:7661-7664; US 6,835,826, US 7,494,982, US 7,485,717 and US 5,684,143.

[0088] In some cases, a polynucleotide of interest is synthesized via sequential couplings starting from the 5’-terminal and proceeding to the 3'-terminal of the target polynucleotide sequence. In certain cases, a polynucleotide of interest is synthesized via sequential couplings starting from the 3’terminal and proceeding to the 5'-terminal of the target polynucleotide sequence. In some embodiments, the polynucleotide is synthesized by sequential couplings of monomer phosphoramidites to the growing terminal of the polynucleotide. The 5’-terminal nucleoside subunit may be attached to any convenient solid support via an optional linking group or 5'-terminal group. Once the first subunit is attached to the solid support, the subunit may be deprotected to produce a free, immobilized 3’-temninal group, Then, subunit couplings to the growing oligonucleotide chain may be achieved. In some instances, the method includes coupling a support bound 3’-terminal group with a 3'-protected-nucleotide-5'-phosphoramidite monomer. In certain embodiments, the 3'-terminal group is a 3’-hydroxyl group. In certain embodiments, the 3'-tenminal group is a 3'-amino group.

[0089] In some instances, the method of polynucleotide synthesis includes the steps of: (a) deprotecting the protected 3'-amino group of a terminal nucleoside attached to a solid phase support, the deprotecting forming a free 3'-amino group; (b) contacting the free 3'-amino group with a 3'protected amino-nucleoside-5'-phosphoramidite monomer in the presence of a nucleophilic catalyst to form an internucleoside N3'—>P5' phosphoramidite linkage; and (c) oxidizîng the linkage to produce a N3'—>P5’ thiophosphoramidate linkage. In some embodiments, the method includes (d) repeating steps (a) through (c) until the polynucleotide is synthesized.

[0090] In some cases, the method includes coupling a support bound 3’-terminal group with a 3'protected-dinucleotide-5'-phosphoramidite dimer. Polynucleotide synthesis methods of interest include, but are not limited to, those methods of solid phase synthesis including at least one coupling of a dinucleotide dimer as described in PCT Publication No. WO2015/168310 which application daims the benefit of U.S. Provisional Application Serial No. 61/987,396. The target polynucleotide sequence may be synthesized via a retrosynthetic strategy that includes sequential couplings of both dimer and monomer subunits to the 3’terminal group of the growing oligonucleotide chain. In some embodiments, the polynucleotide is synthesized using a method including at least one coupling of a dinucleotide dimer to the free 3’ terminal group of a growing polynucleotide chain.

[0091] In some instances, the method of polynucleotide synthesis includes the steps of: (a) deprotecting the protected 3'-amino group of a terminal nucleoside attached to a solid phase support, the deprotecting forming a free 3'-amino group; (b) contacting the free 3'-amino group with a 3'protected amino-dinucleotide thiophosphoramidate or phosphoramidite-5'-phosphoramidite dimer in the presence of a nucleophilic catalyst to form an internucleoside N3'—»P5' phosphoramidite linkage; and (c) oxidizing the linkage a N3'-+P5' thiophosphoramidate linkage. In some embodiments, the method includes (d) repeating steps (a) through (c) until the polynucleotide is synthesized, where is step (b) a 3'-protected amino-dinucleotide thiophosphoramidate-5'-phosphoramidite dimer or 3'protected amino-nucleotide-5’-phosphoramidite monomer may be utilized.

[0092] Any convenient protecting group strategies may be utilized in the subject methods to protect the base, phosphoramidite, phosphoramidate, 5’, 2’ and/or 3’groups of the polynucleotide.

Protecting groups of interest include, but are not limited to, those protecting groups described by Ohkubo et al., Org. Lett., 2010, 12 (11), pp 2496-2499; and Beaucage and lyer, Tetrahedron 48: 2223-2311 (1992).

[0093] As used herein, the term “phosphate protecting group refers to a protecting group that may be attached to a phosphorus-containing intersubunit linkage of an oligonucleotide. When present, a phosphate protecting group may prevent (i.e., block) reaction of the phosphorus-containing linkage at the location where the phosphate protecting group is attached. Any convenient phosphorus-containing intersubunit linkages (e.g., P(lll) and P(V) linkages) may be protected by the subject phosphate protecting groups, including, but not limited to, phosphoramidite, oxophosphoramidate, thiophosphoramidate, phosphate ester, thiophosphate ester, phosphodiester linkages and the like. The phosphate protecting group may be attached to an available oxygen atom of the phosphorus-containing intersubunit linkage. Any convenient protecting groups may be utilized as a phosphate protecting group. In certain embodiments, a phosphate protecting group is methyl, or β-cyanoethyl.

[0094] In some instances, the 3’-terminal group ofthe growing polynucleotide chain may include a 3’-hydroxyl, a 3’-amino group or a protected version thereof. Any convenient hydroxyl and/or amino protecting groups may be utilized at the 3’-terminal group during polynucleotide synthesis. In some embodiments, the 3’terminal group is a protected 3’-amino group and the method includes deprotecting or removing the protecting group to produce a free 3’amino group. As used herein, the term free amino group means an amino group available for reacting with the phosphoramidite group of an incoming monomer or dimer. In some embodiments, a free amino group is a primary amine. After the deprotection (e.g., detritylation) step, the amino group may be in the form of a sait (e.g., the sait of a conjugate base of the acid used for detritylation). This sait may be optionally neutralized with a basic solution such as 2% triethylamine or pyridine in acetonitrile after the detritylation step.

[0095] 3’-Protection of the incoming subunit phosphoramidites prevents undesirable polymerization of the chain. In some embodiments, the 3’-terminal group is a protected 3’-hydroxyl group and the method includes deprotecting or removing the protecting group to produce a free 3'hydroxyl group. In some embodiments, the 3’-terminal group is a protected 3'-amino group and the method includes deprotecting or removing the protecting group to produce a free 3’-amino group. The protected 3’-amino or 3’-hydroxyl group may be protected with a trityl protecting group. In certain embodiments, the trityl protecting group is triphenylmethyl (Tr orTrt, Ph₃C-). In certain embodiments, the trityl protecting group is 4,4’-dimethoxytrityl (DMT). Deprotection of the 3'-temninal amino or hydroxyl group may be achieved using any convenient methods. Methods of interest include, but are not limited to, those methods described by Beaucage and lyer, Tetrahedron 48: 2223-2311 (1992). In some cases, deprotection of the protected 3' amino group of a terminal nucleoside includes detritylation to produce a free 3’terminal group, e.g., acid-catalyzed detritylation. In some cases, the dimer or monomer subunit phosphoramidites include a protected 3’-hydroxyl or 3’-amino group that is the same as the 3’-terminal group of the terminal nucleoside attached to the solid support.

[0096] Any convenient solid phase supports may be used for the synthesis of polynucleotides according to the subject methods. Solid supports of interest include, but are not limited to, microparticles made of controlled pore glass (CPG), highly cross-linked polystyrène (e.g., NittoPhase HL 400 or GE Primer 350), acrylic copolymers, cellulose, nylon, dextran, latex, polyacrolein, and the like, such as those disclosed in the following exemplary references: Meth. Enzymol., Section A, pagesl 1-147, voL44 (Academie Press, New York, 1976); U.S. Pat. Nos. 4,678,814; 4,413,070; and 4,046;720; and Pon, Chapter 19, in Agrawal, edîtor, Methods in Molecular Biology, VoL20, (Humana Press, Totowa, N.J., 1993). Further supports of interest include polystyrène beads; polystyrène grafted with polyethylene glycol (e.g., TentaGel™, Rapp Polymère, Tubingen Gemnany); and the like. Sélection of the support characteristics, such as material, porosity, size, shape, and the like, and the type of linking moiety employed dépends on a variety of factors, such as protection groups employed, length of final product, quantity of final product, and the like. Exemplary linking moieties are disclosed in Pon et al., Biotechniques, 6:768-775 (1988); Webb , U.S. Pat. No. 4,659,774; Barany et al., International patent application PCT/US91/06103; Brown et al., J. Chem. Soc. Commun., 1989: 891893; Damha et aL, Nucleic Acids Research, 18: 3813-3821(1990); Beattie et al., Clinical Chemistry, 39: 719-722 (1993); Maskos and Southern, Nucleic Acids Research, 20:1679-1684 (1992); and the like.

[0097] In some embodiments, the solid supports that find use in the subject methods include CPG and polystyrène grafted with polyethylene glycol and possessing a terminal amino group (e.g., TentaGel-NH₂ ™, Rapp Polymère, Tubingen Gemnany). The aminopropyl group may be used as a spacer between CPG and the nucleoside linkage. In some cases, the linkage to the 5'-hydroxyl of the first nucleoside is a succinyl group which provides a base-labile ester linkage that may be cleaved after synthesis with aqueous ammonia.

[0098] Following deprotection, the support-bound nucleoside is capable of reacting with a dimer or monomer subunit phosphoramidite to form an internucleoside linkage. It is understood that the support-bound nucleoside may refer to a single residue attached to a solid support or may refer to the terminal residue of an oligonucleotide chain that is attached to the support. Any convenient coupling chemistry, coupling reagents and methods may be utilized in the subject methods. Any convenient sélections conceming coupling conditions, protecting groups, solid phase supports, linking groups, deprotection reagents, reagents to cleave products from solid phase supports, purification of product, and the like, may be made in the context of the subject methods according to the guidance of, e.g. Gait, edîtor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); Amarnath and Broom, Chemical Reviews, Vol. 77, pgs. 183-217 (1977); Pon et aL, Biotechniques, Vol. 6, pgs. 768-775 (1988); Ohtsuka et al., Nucleic Acids Research, Vol. 10, pgs. 6553-6570 (1982); Eckstein, editor Oligonucleotides, and Analogues: A Practical Approach (IRL Press, Oxford, 1991), Greene and Wuts “Protective Groups in Organic Synthesis, Third édition, Wiley, New York 1999, Narang, editor, Synthesis and Applications of DNA and RNA (Academie Press, New York, 1987), Beaucage and lyer, 10 Tetrahedron 48: 2223-2311 (1992), and like référencés.

[0099] In some instances, after coupling, unreacted 3’-amino groups of a support-bound growing chain of the polynucleotide may be optionally capped with a convenient capping agent before the next deprotection step (e.g., detritylation step) to rentier them inert to subséquent coupling steps.

This capping step may improve the HPLC profile of the préparation to make purification more facile, 15 and may also improve the overall yield of product. Capping reagents useful in the subject methods include electrophilic reagents such as acetic anhydride and isobutyric anhydride, acid chlorides such as adamantyl carbonyl chloride, pivaoyl chloride, and the like, isothiocyanates, chloroformâtes, etc. Also useful are phosphoramidites in conjunction with an activator and followed by oxidation, and Hphosphonate salts such as triethylammonium isopropyl-H-phosphonate used in conjunction with an 20 acid chloride such as pivaoyl chloride or adamantyl carbonyl chloride.

[00100] In some embodiments, the method includes oxidizing an intemucleoside N3’—►P5' phosphoramidite linkage. As used herein, the terms oxidize, oxidation, “oxidizing”, and the like, in référencé to a phosphorus-containing intemucleosidic linkage means a process or treatment for converting the phosphores atom of the linkage from a phosphores (III) form to a phosphores (V) form.

Oxidation of the internucleotide linkages may be performed at any convenient point in the synthesis using any convenient methods. In some embodiments, oxidation is performed in a stepwise manner, e.g., during every coupling cycle. In other embodiments, oxidation of multiple internucleotide linkages is performed atthe end of the synthesis. In some instances, oxidizing a N3'—►PS' phosphoramidite linkage (e.g., using an iodine/water based oxidizing agent) produces an oxo-phosphoramidate linkage. In other instances, oxidizing a N3'~>P5' phosphoramidite linkage includes sulfurization to produce a N3'—>P5’ thiophosphoramîdate linkage. Sulfurization may be performed using any convenient methods. Sulfurization methods of interest include those described by Gryazonov et aL in W02001018015 and US6,114,519. Sulfurizing agents of interest include, but are not limited to, elemental sulfur, thiuram disulfides such as tetraethyl thiuram disulfide, acyl disulfides such as phenacyldisulfide, phenyl acetyl disulfide, phosphinothioyl disulfides such as S-Tetra™, and 1,1 dioxo-3H-1,2-benzodithiol-3-one. In some embodiments, sulfurization may be performed using phenyl acetyl disulfide in 2,6-lutidine. In certain embodiments, sulfurization may be performed using Beaucage reagent, using methods as described by lyer et al., J. Organic Chemistry 55:4693-4699, 1990.

[00101] Cleavage of the polynucleotide from the solid phase synthesis support may be achieved using any convenient methods and reagents, which may be selected depending on a variety offactors, such as the nature ofthe support, linker chemistry and the protecting group strategy utilized during synthesis. The sélections made in the synthesis and cleavage of a target polynucleotide may détermine the identities of the non-target synthesis products and agent présent in the first polynucleotide composition.

[00102] In some embodiments, priorto cleavage, the phosphorus protecting groups of the polynucleotide are removed to avoid the formation of any potential undesirable adducts of the cleaved protecting group (e.g., the β-cyanoethyl protecting group) with the polynucleotide. Methods of interest that may be adapted for use in deprotecting and cleavîng polynucleotides include those described in US7,199,236. In some embodiments, the polynucleotide is cleaved from the support using an ammonia solution to remove any base protecting groups (e.g., exocyclic amino protecting groups) and any remaining phosphorus protecting groups. Any convenient conditions may be utilized in the polynucleotide cleavage reaction. In some cases, the cleavage is performed at a température in the range of 40-60°C. In some instances, the cleavage is performed over an extended period of time, such as a time in the range of 12-24 hours. Post cleavage of the polynucleotide, the support may then be removed by filtration and rinsed. The combined filtrate and rinse solutions, which now contain the crude synthetic préparation of polynucleotide, may be utilized in the subject methods of préparation, before being carried forward to further purification steps. In some cases, purification of a polynucleotide solution includes préparative Reversed Phase-High Performance Liquid Chromatography (RP-HPLC) RP HPLC, e.g., using Kromasil C18 at 45-55°C. In some instances, the polynucleotide compositions of the subject methods may undergo any number of convenient desalting and concentration steps, e.g., by using a Tangential Flow Filtration (TFF) apparatus equipped with polyethersulfone membranes with a pore diameter cut-off size of 1,000 Da.

Polynucleotide Compositions

[00103] Aspects of the présent disclosure include polynucleotide sait compositions including multivalent cation counterions. In some embodiments, the composition includes: a sait of a polynucleotide including at least one multivalent cation counterion, where the polynucleotide has a sequence of 7 or more nucleoside subunits and at least two of the nucleoside subunits are joined by _a N3'-+P5' thiophosphoramidate inter-subunit linkage. In certain embodiments, the polynucleotide has a sequence of 7 or more nucleoside subunits complementary to the RNA component of human telomerase.

[00104] Multivalent cation counterions

[00105] Any convenient multivalent cations may find use as a counterion in the subject polynucleotide salts. As such, a multivalent cation may form an ion pair with an anionic site on a polynucleotide backbone in the subject polynucleotide compositions. Polynucleotides may include nucleoside subunits linked by phosphorus-containing intersubunit linkages (e.g., P(V) linkages) such as phosphoramidate, thiophosphoramidate, phosphate ester, phosphodiester linkages and the like. It is understood that the intersubunit linkages of the polynucleotide may be negatively charged (e.g., în an aqueous solution) and ion paired with a cationic counterion. Such intersubunit linkages may be referred to as anionic groups of the polynucleotide backbone.

[00106] As used herein, the temn multivalent cation refers to a cation capable of forming multiple ion pairs, e.g., a multiply charged cation, such as a double charged or a triply charged cation. Any convenient multivalent cations may find use in the subject polynucleotide sait compositions. In some embodiments, a multivalent cation ion pairs to two or more adjacent anionic groups of the polynucleotide backbone. In some embodiments, a multivalent cation ion pairs to one anionic group of the polynucleotide backbone. In some embodiments, the multivalent cation counterion is divalent. Divalent cation counterions of interest include, but are not limited to, magnésium, zinc and calcium. In some embodiments, the multivalent cation counterion is trivalent. Trivalent cation counterions of interest include, but are not limited to, aluminium. In certain embodiments of the composition, the at least one multivalent cation counterion is selected from the group consisting of magnésium, zinc, aluminium and calcium. In certain embodiments of the composition, the at least one multivalent cation counterion is magnésium. In certain embodiments of the composition, the at least one multivalent cation counterion is zinc. In certain embodiments of the composition, the at least one multivalent cation counterion is aluminium. In certain embodiments of the composition, the at least one multivalent cation counterion is calcium.

[00107] It is understood that the number of cation counterions that are présent in a polynucleotide sait is dépendent on a variety of factors, such as the length of the polyanionic backbone, the valency of the cations in the salts, the pH of the solution, aggregation of polynucleotides in the composition, etc. The subject compositions may include at least one multivalent cation counterion to the polyanionic polynucleotide backbone in the subject polynucleotide compositions, such as 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 15 or more, 20 or more, 30 or more, 40 or more, 50 or more, 100 or more, or even more multivalent cation counterions. In certain embodiments, a polynucleotide having n nucleoside subunits may include between 1 and (n-1 )/2 (if n is an odd integer) divalent cation counterion(s) or between 1 and (n-2)/2 (if n is an even integer) divalent cation counterion(s). In some instances, a polynucleotide sait that includes at least one multivalent cation, may further include a variety of other cation counterions, which may be monovalent, divalent or trivalent. In certain instances, n is in the range of 7 to 50, such as 7 to 40,10 to 40, 10 to 30,10 to 25,10 to 20, or in the range of 12 to 15 nucleoside subunits. [00108] In some embodiments of the composition, the polynucleotide sait may include 3 mol% or more of the multivalent cation counterion relative to a polyanionic backbone of the polynucleotide (i.e., relative to a theoretical maximum inclusion of cation counterions along the polyanionic backbone), such as 4 mol% or more, 5 mol% or more, 6 mol% or more, 7 mol% or more, 8 mol% or more, 9 mol% or more, 10 mol% or more, 11 mol% or more, 12 mol% or more, 13 mol% or more, 14 mol% or more, 15 mol% or more, 16 mol% or more, 17 mol% or more, 18 mol% or more, 19 mol% or more, 20 mol% or more, 25 mol% or more, 30 mol% or more, 35 mol% or more, 40 mol% or more, 45 mol% or more, 50 mol% or more, 55 mol% or more, 60 mol% or more, or even more, of the multivalent cation counterion relative to a polyanionic backbone of the polynucleotide. In some embodiments of the subject compositions, the polynucleotide may include 10 mol% or more of the multivalent cation counterion relative to a polyanionic backbone of the polynucleotide. For example, a polynucleotide sait that includes a polyanionic backbone of 10 internucleoside subunit linkages and includes one divalent cation counterion ion pairing to two of the linkages, is described as including 20 mol% of the divalent cation counterion. If the one divalent cation counterion ion pairs to only one of the linkages instead of two, the polynucleotide sait is described as including 10 mol% of the divalent cation counterion. As such, the mol% value refers to a level of occupation of the polyanionic polynucleotide backbone by the multivalent cation counterions that are present in the polynucleotide sait. For example, one Mg²⁺cation in a 13-mer polynucleotide sait having 12 internucleoside subunit linkages gives 16.7 mol% occupation of the backbone. It is understood that in some embodiments, the polynucleotide sait may include additional ion pairing sites at the terminais of the polynucleotide (e.g., a 5’-thiophosphate group), and if present, such sites should be included in the mol% value of the compound.

[00109] In some embodiments of the composition, the polynucleotide sait includes 90 mol% or less of the multivalent cation counterion relative to a polyanionic backbone of the polynucleotide, such as 70 mol% or less, 65 mol% or less, 60 mol% or less, 50 mol% or less, or even less of the multivalent cation counterion.

[00110] In certain embodiments of the composition, the polynucleotide sait includes 3 to 90 mol% of the multivalent cation counterion relative to a polyanionic backbone of the polynucleotide, such as 3 to 65 mol% (e.g., 6 to 50 mol%, 10 to 50 mol% or 10 to 40 mol%), 3 to 50 mol%, 3 to 40 mol%, 3 to mol%, 3 to 20 mol% or 3 to 15 mol% of the multivalent cation counterion relative to a polyanionic backbone of the polynucleotide.

[00111] In certain instances of the composition, the polynucleotide sait includes 3 to 60 mol% of a divalent cation counterion relative to a polyanionic backbone of the polynucleotide, such as 3 to 50 mol% (e.g., 5 to 50 mol%), 3 to 40 mol%, 3 to 30 mol%, 3 to 20 mol%, 3 to 15 mol%, such as 3-12 mol% of a divalent cation counterion,

[00112] In certain instances of the composition, the polynucleotide sait includes 3 to 60 mol% of a magnésium cation counterion relative to a polyanionic backbone of the polynucleotide, such as magnésium, 5-50 mol%, 5-40 mol%, 10-40 mol% or 20-40 mol% of a magnésium cation counterion. [00113] In certain instances of the composition, the polynucleotide sait includes 10 to 70 mol% of a trivalent cation counterion relative to a polyanionic backbone of the polynucleotide, such as 10 to 60 mol%, 20 to 60 mol%, 20 to 50 mol% or 30 to 50 mol% of a trivalent cation counterion.In some embodiments of the composition, the polynucleotide sait includes 0.5 % or more by weight of the multivalent cation counterion (e.g., magnésium), such as 0.6 % or more, 0.7 % or more, 0.8 % or more, 0.9 % or more, 1.1 % or more, 1.2 % or more, 1.3 % or more, 1.4 % or more, 1.5 % or more,

1.6 % or more, 1.7 % or more, 1.8 % or more, 1.9 % or more, 2.0 % or more, 2.1 % or more, 2.2 % or more, 2.3 % or more 2.4 % or more, 2.5 % or more, 2.6 % or more, 2.7 % or more, 2.8 % or more, 2.9 % or more, 3.0 % or more by weight of the multivalent cation counterion.

[00114] The polynucleotide sait is a mixed sait that includes a mixture of multivalent and monovalent cation counterions. In certain embodiments of the composition, the polynucleotide sait includes a ratio of multivalent cation counterion to monovalent cation counterion of at least 0.05 or more by molarity, such as 0.10 or more, 0.15 or more, 0.20 or more, 0.25 or more, 0.30 or more, 0.35 or more, 0.40 or more, 0.45 or more, 0.50 or more, 0.55 or more, 0.60 or more, 0.65 or more, 0.70 or more by molarity, or even more of multivalent cation counterion to monovalent cation counterion.

[00115] In some instances, the polynucleotide sait includes a ratio of multivalent to monovalent cation counterion of 1:12 by molarity. In some instances, the polynucleotide sait includes a ratio of multivalent to monovalent cation counterion of 1:11 by molarity. In some instances, the polynucleotide sait includes a ratio of multivalent to monovalent cation counterion of 1:10 by molarity. In some instances, the polynucleotide sait includes a ratio of multivalent to monovalent cation counterion of 1:9 by molarity. In some instances, the polynucleotide sait includes a ratio of multivalent to monovalent cation counterion of 1:8 by molarity. In some instances, the polynucleotide sait includes a ratio of multivalent to monovalent cation counterion of 1:7 by molarity. In some instances, the polynucleotide sait includes a ratio of multivalent to monovalent cation counterion of 1:6 by molarity. In some instances, the polynucleotide sait includes a ratio of multivalent to monovalent cation counterion of 1:5 by molarity. In some instances, the polynucleotide sait includes a ratio of multivalent to monovalent cation counterion of 1:4 by molarity. In some instances, the polynucleotide sait includes a ratio of multivalent to monovalent cation counterion of 2:9 by molarity. In some instances, the polynucleotide sait includes a ratio of multivalent to monovalent cation counterion of 3:7 by molarity. In some instances, the polynucleotide sait includes a ratio of multivalent to monovalent cation counterion of 4:5 by molarity. In some instances, the polynucleotide sait includes a ratio of multivalent to monovalent cation counterion of 5:3 by molarity.

[00116] In certain instances of the mixed polynucleotide sait, the multivalent cation counterion is magnésium and the monovalent cation counterion is sodium. In certain instances of the mixed polynucleotide sait, the multivalent cation counterion is magnésium and the monovalent cation counterion is ammonium. In certain instances of the mixed polynucleotide sait, the multivalent cation counterion is magnésium and the monovalent cation counterion is triethylammonium. In certain instances ofthe mixed polynucleotide sait, the multivalent cation counterion is aluminium. In certain instances ofthe mixed polynucleotide sait, the multivalent cation counterion is zinc. In certain instances ofthe mixed polynucleotide sait, the multivalent cation counterion is calcium. In certain instances ofthe mixed polynucleotide sait, the monovalent cation counterion is sodium. In certain instances ofthe mixed polynucleotide sait, the monovalent cation counterion is ammonium. In certain instances ofthe mixed polynucleotide sait, the monovalent cation counterion is triethylammonium.In certain embodiments, the polynucleotide sait includes one multivalent cation counterion. In certain embodiments, the polynucleotide sait includes 2 multivalent cation counterions. In certain embodiments, the polynucleotide sait includes 3 multivalent cation counterions. In certain embodiments, the polynucleotide sait includes 4 multivalent cation counterions. In certain embodiments, the polynucleotide sait includes 5 multivalent cation counterions. In certain embodiments, the polynucleotide sait includes 6 multivalent cation counterions. In certain embodiments, the polynucleotide sait includes 7 multivalent cation counterions. In certain embodiments, the polynucleotide sait includes 8 multivalent cation counterions. In certain embodiments, the polynucleotide sait includes 9 multivalent cation counterions. In certain embodiments, the polynucleotide sait includes 10 multivalent cation counterions.

[00117] In addition to a target polynucleotide, a variety of non-target polynucleotide synthesis products may be produced during polynucleotide synthesis. Minor products that may be présent in polynucleotide préparations include, but are not limited to, délétion products (e.g., products lacking one or more nucleoside residues), products that include one or more protecting groups, terminated products (e.g., products that include a capped polynucleotide chain), products that lack one or more nucleobases, products that include partially oxidized phosphoramidite linkages and products that include partially sulfurized linkages.

[00118] The subject methods provide for compositions that include an improved purity of target polynucleotide in the composition. In some embodiments, the composition includes 20% or more by weight of the target polynucleotide, such as 25% or more, 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or even 95% or more by weight of the target polynucleotide. In certain embodiments, the composition includes 50% or more by weight of the target polynucleotide. In certain embodiments, the composition includes 55% or more by weight of the target polynucleotide. In certain embodiments, the composition includes 60% or more by weight of the target polynucleotide. In certain embodiments, the composition includes 65% or more by weight of the target polynucleotide. In certain embodiments, the composition includes 70% or more by weight of the target polynucleotide. In certain embodiments, the composition includes 75% or more by weight of the target polynucleotide. In certain embodiments, the composition includes 80% or more by weight of the target polynucleotide. In certain embodiments, the composition includes 85% or more by weight of the target polynucleotide. In certain embodiments, the composition includes 90% or more by weight of the target polynucleotide. In certain embodiments, the composition includes 95% or more by weight of the target polynucleotide.

[00119] The subject methods provide for compositions including a reduced amount of non-target synthesis products and agents. By reduced amount is meant that the amount by weight of the nontarget synthesis products and agents in the composition is reduced relative to a control method. In some embodiments, the subject compositions include non-target synthesis products and agents in an amount of 50% or less of the total non-target polynucleotides in the composition, such as 40% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less or even 5% or less of the nontarget synthesis products and agents.

[00120] Any of a wide variety of polynucleotide compositions can be prepared using the methods described herein. A variety of classes and types of polynucleotides are of interest for préparation using the subject methods (e.g., as described herein). Polynucleotides suitable for préparation according to the subject methods include, but are not limited to, anti-sense polynucleotides, RNA polynucleotides, siRNA polynucleotides, RNAi polynucleotides, DNA aptamers, micro RNA and the like.

[00121] In some embodiments, the polynucleotide is described by Formula (I):

R⁶ R³

Formula (I) wherein:

each B is independently a purine, a protected purine, a pyrimidine or a protected pyrimidine, or an analog thereof;

each X is independently oxygen or sulfur;

each R³ is independently hydrogen, fluoro, hydroxyl, an alkoxy, a substituted alkoxy or a protected hydroxyl;

R⁶ is amino, hydroxyl, a protected amino, a protected hydroxy, -O-T-Z or-NH-T-Z;

each T is independently an optional linker;

each Z is independently H, a lipid, a carrier, an oligonucleotide, a polymer, a polypeptide, a détectable label, or a tag; and n is an integer of 1 to 1000. It is understood that the oligonucleotides of Formula (l), may exist in a sait form. As such, the intemucleoside linkages of Formula (I) may be in a sait form that includes any convenient counterion. Such forms are intended to be included within the scope of the present disclosure. It is understood that other tautomerîc arrangements of the intemucleoside linkages of the polynucleotide described in Formula (I) may be possible. Such forms are intended to be included within the scope of the present disclosure.

[00122] In some embodiments of Formula (I), each R³ is hydrogen. In some embodiments of Formula (I), each R³ is fluoro. In some embodiments of Formula (I), each R³ is hydroxyl. In some embodiments of Formula (I), R⁶ is amino. In certain embodiments of Formula (I), R⁶ is hydroxyl. In some embodiments of Formula (I), Z is H. In some embodiments of Formula (I), Z is a lipid (e.g., as described herein). In certain cases, the lipid is a fatty acid (e.g., as described herein). In some embodiments of Formula (I), Z is a carrier. In some embodiments of Formula (I), Z is an oligonucleotide. In some embodiments of Formula (I), Z is a polymer. In certain cases, the polymer is a PEG. In some embodiments of Formula (I), Z is a polypeptide. In some embodiments of Formula (l), Z is a détectable label. In some embodiments of Formula (I), Z is a tag. In some embodiments of Formula (I), T is absent. In some embodiments, each B is independently selected from A, C, G, T and U.

[00123] In certain embodiments of Formula (I), n is an integer of between 7 and 500, such as between 7 and 100, between 7 and 75, between 7 and 50, between 7 and 40, between 7 and 30, between 7 and 20, between 7 and 15, between 10 and 15, or between 13 and 15. In certain embodiments, n is an integer of between 7 and 100, such as between 7 and 50, between 10 and 50, between 10 and 40, between 10 and 30, between 10 and 25, between 10 and 20, between 12 and 18, or between 12 and 16. In certain embodiments, n is 7, 8, 9,10, 11, 12, 13, 14, 15,16,17, 18,19, 20, 21, 22, 23, 24 or 25.

[00124] Polynucleotides complementary to RNA component of Telomerase |00125| Aspects of the disclosure include compounds and compositions including polynucleotides complementary to the RNA component of human telomerase, and methods for preparing the same. The compounds may inhibit telomerase activity in cells with a high potency and hâve cellular uptake characteristics.

[00126] In certain instances, the polynucleotide includes a sequence of 7 or more nucleoside subunits complementary to the RNA component of human telomerase, such as 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 20 or more, 30 or more, 50 or more nucleoside subunits complementary to the RNA component of human telomerase.

[00127] In some embodiments, the polynucleotide includes between 3 and 50 contiguous nucleoside subunits complementary to the RNA component of human telomerase, such as between 5 and 40, between 7 and 40,10 and 40, between 10 and 30, between 10 and 25, between 10 and 20, or between 12 and 15 nucleoside subunits. In certain embodiments, the polynucleotide includes a sequence of 7 or more contiguous nucleoside subunits complementary to the RNA component of human telomerase, such as 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 20 or more, 30 or more, 50 or more contiguous nucleoside subunits complementary to the RNA component of human telomerase.

[00128] In some embodiments, the polynucleotide is a compound described by the formula: O-(x-L)_n where O represents the polynucleotide including a sequence of nucleoside subunits complementary to the RNA component of human telomerase, x is an optional linker group, L represents a lipid moiety and n is an integer from 1-5. In some instances, n is 5. In some instances, n is 4. In some instances, n is 3. In some instances, n is 2. In some instances, n is 1. Design of the compounds therefore requires the sélection of two entities, O and L, and the détermination of the structural linkage(s) between these entities, which may involve the optional lînker group x.

[00129] In some embodiments, the polynucleotide compound may be described by the formula: O-(x-L)_n where O represents the polynucleotide including a sequence of nucleoside subunits complementary to the RNA component of human telomerase, x is an optional linker group, L represents the lipid moiety and n is 1, such as a polynucleotide of Formula (I), or a sait thereof, wherein in Formula (I), Z is the lipid moiety, T is the optional linker (e.g., as described herein) and the B groups correspond to the sequence of nucleoside subunits complementary to the RNA component of human telomerase. [00130] The polynucleotide component O may be regarded as the “effector component of the compound in that it is this componentthat effects inhibition ofthe telomerase enzyme by binding to the RNA component of telomerase. Thus, the sequence of O is selected such that it includes a région that is complementary to the sequence of the telomerase RNA, which is shown in SEQ ID NO:1. The région that is complementary to the telomerase RNA component may in theory be targeted to any portion of the telomerase RNA, but particular régions of the telomerase RNA are preferred targets for inhibitory polynucleotides. One preferred target région is the région spanning nucléotides 30-67 of SEQ ID NO:1, which includes the “template région,” an 11 nucléotide région of sequence 5'CUAACCCUAAC-3’ (SEQ ID NO; 21) that spans nucléotide 46-56 of SEQ ID NO: 1. The template région functions to specify the sequence of the telomeric repeats that telomerase adds to the chromosome ends and is essential to the activity ofthe telomerase enzyme (see Chen et al., Cell 100:503-514, 2000; Kim et al.. Proc. Natl. Acad. Sci., USA 98(14):7982-7987, 2001). Compounds of interest that contain a polynucleotide moiety including a sequence complementary to ail or part of the template région are thus of interest. Another target région of interest is the région spanning nucléotides 137-179 of hTR (see Pruzan et al., Nucl. Acids Research, 30:559-588, 2002). Within this région, the sequence spanning 141-153 is a preferred target. PCT publication WO 98/28442 describes the use of polynucleotides of at least 7 nucléotides in length to inhibit telomerase, where the polynucleotides are designed to be complementaryto accessible portions ofthe hTR sequence outside ofthe template région, including nucléotides 137-196, 290-319, and 350-380 of hTR.

[001311 The région of O that is targeted to the hTR sequence is in some cases exactly complementary to the corresponding hTR sequence. While mismatches may be tolerated in certain instances, they are expected to decrease the specificity and activity of the résultant polynucleotide conjugale, in some embodiments, the base sequence of the polynucleotide O is thus selected to include a sequence of at least 5 nucléotides exactly complementary to the telomerase RNA, and enhanced telomerase inhibition may be obtained if increasing lengths of complementary sequence are employed, such as at least 6, at least 7, at least 8, at least 10, at least 12, at least 13 or at least nucléotides exactly complementary to the telomerase RNA. In other embodiments, the sequence of the polynucleotide includes a sequence of from at least 7 to 20, from at least 8 to 20, from at least 10 to 20 or from at least 10 to 15 nucléotides exactly complementary to the telomerase RNA sequence. Optimal telomerase inhibitory activity may be obtained when the full length of the polynucleotide O is selected to be complementary to the telomerase RNA. However, it is not necessary that the full length of the polynucleotide component be exactly complementary to the target sequence, and the polynucleotide sequence may include régions that are not complementary to the target sequence. Such régions may be added, for example, to confer other properties on the compound, such as sequences that facilitate purification. If the polynucleotide component O is to include régions that are not complementary to the target sequence, such régions may be positioned at one or both of the 5' or 3’ temnini. In instances where the région of exact complementarity is targeted to the template région, effective telomerase inhibition may be achieved with a short (5-8 nucléotide) région of exact complementarity to which a telomerase-like (G-rich) sequence is joined at the 5' end.

[00132] Exemplary sequences that are complementary to the human telomerase RNA and which may be included as part of the polynucleotide component O, or which may be used as the entire polynucleotide component O include the following:

hTR complementary sequences (régions of Polynucleotide sequence SEQ ID NO:1 of U.S. Publication 2012329858);

GGGUUGCGGA GGGUGGGCCU GGGAGGGGUG GUGGCCAUUU UUUGUCUAAC CCUAACUGAG AAGGGCGUAG GCGCCGUGCU UUUGCUCCCC GCGCGCUGUU UUUCUCGCUG ACUUUCAGCG GGCGGAAAAG CCUCGGCCUG CCGCCUUCCA CCGUUCAUUC UAGAGCAAAC AAAAAAUGUC AGCUGCUGGC CCGUUCGCCC CUCCCGGGGA CCUGCGGCGG GUCGCCUGCC CAGCCCCCGA ACCCCGCCUG GAGGCCGCGG UCGGCCCGGG GCUUCUCCGG AGGCACCCAC UGCCACCGCG AAGAGUUGGG CUCUGUCAGC CGCGGGUCUC UCGGGGGCGA GGGCGAGGUU CAGGCCUUUC AGGCCGCAGG AAGAGGAACG GAGCGAGUCC CCGCGCGCGG CGCGAUUCCC UGAGCUGUGG GACGUGCACC CAGGACUCGG CUCACACAUG C (SEQ ID NO: 1) GCTCTAGAATGAACGGTGGAAGGCGGCAGG 137-166 (SEQ ID NO: 2) GTGGAAGGCGGCAGG 137-151 (SEQ ID NO: 6) GGAAGGCGGCAGG 137-149 (SEQ ID NO: 7) GTGGAAGGCGGCA 139-151 (SEQ ID NO: 8) GTGGAAGGCGG 141-151 (SEQ ID NO: 9) CGGTGGAAGGCGG 141-153 (SEQ ID NO: 10) ACGGTGGAAGGCG 142-154 (SEQ ID NO: 11)

AACGGTGGAAGGCGGC 143-155 (SEQ ID NO: 12)

ATGAACGGTGGAAGGCGG 144-158 (SEQ ID NO: 13) ACATTTTTTGTTTGCTCTAG 160-179 (SEQ ID NO: 14) TAGGGTTAGACAA 42-54 (SEQ ID NO: 3) GTTAGGGTTAG 46-56 (SEQ ID NO: 4) GTTAGGGTTAGAC 44-56 (SEQ ID NO: 15) GTTAGGGTTAGACAA 42-56 (SEQ ID NO: 16) GGGTTAGAC 44-52 (SEQ ID NO: 19) CAGTTAGGG 50-58 (SEQ ID NO: 20) CCCTTCTCAGTT 54-65 (SEQ ID NO: 17) CGCCCTTCTCAG 56-67 (SEQ ID NO: 18)

[00133] In some embodiments, the polynucleotide includes a sequence selected from the group consisting of: GTTAGGGTTAG (SEQ ID NO:4); TAGGGTTAGACAA (SEQ ID NO:3); and CAGTTAGGGTTAG (SEQ ID NO:5).

[00134] The choice of the type of inter-nucleoside linkages used in the synthesis of the O component may be made from any of the available polynucleotide chemistries, including but not limited to, phosphodiester, phosphotriester, methylphosphonate, P3'—»N5' phosphoramidate, N3'—>P5' phosphoramidate, N3’—>P5' thiophosphoramidate, and phosphorothioate linkages. In some embodiments, the polynucleotide component O has at least one N3¹—>P5' thiophosphoramidate lînkage. In certain embodiments, the nucleoside subunits complementary to the RNA component of human telomerase are ail joined by N3'—>P5' thiophosphoramidate inter-subunit linkages. In certain cases, the N3'—»P5' thiophosphoramidate inter-subunit linkage has the following structure:

3'—NH—P(S)(OR)—O—5’ where R is hydrogen, or a sait thereof. It is understood that for any of the polynucleotide components O described herein that include such an inter-subunit linkage, such polynucleotide components O may also include any convenient sait forms of the linkage. As such, the inter-subunit linkage may be in a sait form that includes any convenient counterion.

[00135] In some embodiments, at least two of the nucleoside subunits are joined by a N3'—»P5' thiophosphoramidate inter-subunit linkage, and the other inter-subunit linkages each independently are selected from N3'-+P5' oxo-phosphoramidate and N3'—>P5' thiophosphoramidate inter-subunit linkages. In some embodiments, the nucleoside subunits are joined by inter-subunit linkages each independently selected from N3‘—>P5' oxo-phosphoramidate and N3'—>P5' thiophosphoramidate intersubunit linkages. In some embodiments, the nucleoside subunits are joined by inter-subunit linkages each independently selected from N3'—>P5' oxo-phosphoramidate and N3'—»P5' thiophosphoramidate inter-subunit linkages; provided that at least two ofthe nucleoside subunits are joined by a N3'—>P5' thiophosphoramidate inter-subunit linkage. In some embodiments, the nucleoside subunits are joined by are ail joined by N3'—>P5' thiophosphoramidate inter-subunit linkages.

[00136] In some embodiments, the polynucleotide comportent O has the sequence TAGGGTTAGACAA (SEQ ID NO:3), and the nucleoside subunits are joined by inter-subunit linkages comprising at least one N3'—>P5‘ thiophosphoramidate linkage. In some embodiments, the polynucleotide comportent O has the sequence TAGGGTTAGACAA (SEQ ID NO:3), and the nucleoside subunits are joined by inter-subunit linkages comprising at least two N3'-*P5' thiophosphoramidate linkages. In some embodiments, the polynucleotide comportent O has the sequence TAGGGTTAGACAA (SEQ ID NO:3), and the nucleoside subunits are joined by intersubunit linkages comprising at least three N3'-»P5‘ thiophosphoramidate linkages. In some embodiments, the polynucleotide comportent O has the sequence TAGGGTTAGACAA (SEQ ID NO:3), and the nucleoside subunits are joined by inter-subunit linkages comprising at least four N3'—»P5'thiophosphoramidate linkages. In some embodiments, the polynucleotide comportent O has the sequence TAGGGTTAGACAA (SEQ ID NO:3), and the nucleoside subunits are joined by intersubunit linkages comprising at least five N3‘—>P5' thiophosphoramidate linkages. In some embodiments, the polynucleotide comportent O has the sequence TAGGGTTAGACAA (SEQ ID NO:3), and the nucleoside subunits are joined by inter-subunit linkages comprising at least six

N3'—>P5' thiophosphoramidate linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3), and the nucleoside subunits are joined by intersubunit linkages comprising at least seven N3'—+P5' thiophosphoramidate linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3), and the nucleoside subunits are joined by inter-subunit linkages comprising at least eight N3'—>P5' thiophosphoramidate linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3), and the nucleoside subunits are joined by intersubunit linkages comprising at least nine N3'->P5' thiophosphoramidate linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3), and the nucleoside subunits are joined by inter-subunit linkages comprising at least ten N3‘—►PS'thiophosphoramidate linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3), and the nucleoside subunits are joined by intersubunit linkages comprising at least eleven N3'—>P5' thiophosphoramidate linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3), and the nucleoside subunits are joined by inter-subunit linkages each independently selected from N3'—>P5' oxo-phosphoramidate and N3'—>P5' thiophosphoramidate inter-subunit linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3), and the nucleoside subunits are joined by inter-subunit linkages each independently selected from N3'-»P5' oxo-phosphoramidate and N3'->P5' thiophosphoramidate inter-subunit linkages; provided that at least two of the nucleoside subunits are joined by a N3‘—>P5' thiophosphoramidate inter-subunit lïnkage. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3), and the nucleoside subunits are ail joined by N3'—»P5' thiophosphoramidate inter-subunit linkages.

[00137] In ail embodiments hereinbefore and hereinafter, N3'—>P5' thiophosphoramidate intersubunit linkages in particular are —NH—P(=O)(SH)—O— or a tautomer thereof, or a sait thereof; and N3'—»P5' oxo-phosphoramidate inter-subunit linkages in particular are —NH—P(=O)(OH)—O— or a tautomer thereof, or a sait thereof. More in particular, in ail embodiments hereinbefore and hereinafter, N3'->P5‘ thiophosphoramidate inter-subunit linkages in particular are —NH— P(=O)(SH)—O— or a tautomer thereof, or a sodium sait thereof; and N3'—»P5' oxo-phosphoramidate inter-subunit linkages in particular are —NH—P(=O)(OH)—O— or a tautomer thereof, or a sodium sait thereof.

[00138] In one of the embodiments, the invention relates to any one of the spécifie structures described herein wherein optionally one or more, in particular one, N3'—►P5’ thiophosphoramidate inter-subunit linkages are replaced by N3’—>P5' oxo-phosphoramidate inter-subunit linkages. In one of the embodiments, the invention relates to any one of the spécifie structures described herein wherein one or more, in particular one, N3'-»P5' thiophosphoramidate inter-subunit linkages are replaced by N3'—>P5' oxo-phosphoramidate inter-subunit linkages.

[00139] In some cases, the subject compounds are more effective in producing telomerase inhibition in cells than corresponding polynucleotides that are not conjugated to lipid components. The lipid component L is beîieved to function to enhance cellular uptake of the compound, particularly in facilitating passage through the cellular membrane. While the mechanism by which this occurs has not been fully elucidated, one possibility is that the lipid component may facilitate binding of the compound to the cell membrane as either a single molécule, or an aggregate (micellar) form, with subséquent internalization. However, understanding of the précisé mechanism is not required for the subject compounds to be utilized.

[00140] The lipid component may be any lipid or lipid dérivative that provides enhanced cellular uptake compared to the unmodifîed polynucleotide. Lipids of interest include, but are not limited to, hydrocarbons, fats (e.g., glycerides, fatty acids and fatty acid dérivatives, such as fatty amides) and sterols. Where the lipid component is a hydrocarbon, the L component may be a substituted or unsubstituted cyclic hydrocarbon or an aliphatic straight chain or branched hydrocarbon, which may be saturated or unsaturated. Examples include straight chain unbranched hydrocarbons that are fully saturated or polyunsaturated. The length of the hydrocarbon chain may vary from C2-C30, but optimal telomerase inhibition may be obtained with carbon chains that are C8-C22. Examples of saturated hydrocarbons (alkanes) of interest are listed below:

Systematic name / Carbon chain

Tetradecane C₁₄H3o

Pentadecane C_1SH₃2 Hexadecane

Heptadecane

Octadecane C-igl·^

Nonadecane C₁₉H₄₀

Eicosane C2₀H₄₂

[00141] Mono- and poly-unsaturated forms (alkenes and polyenes, such as alkadienes and alkatrienes) of hydrocarbons may also be selected, with compounds having one to three double bonds being of interest, although compound having more double bonds may be employed. Alkynes (containing one or more triple bonds) and alkenynes (triple bond(s) and double bond(s)) may also be utilized.

[00142] Substituted forms of hydrocarbons may be employed in the subject compounds, with substituent groups that are inert in vivo and in vitro being of interest. In some cases, the substituent is fluorine. Exemplary generic structures of polyfluorinated hydrocarbons include: CF₃(CF2)_n—(CH₂)_mwhere m is at least 1, in some cases at least 2, and n is 1 to 30, such as fluorotridecane: CF₃(CF₂)₉(CH₂)₃; and CH₃(CH2)_a(CF₂)b(CH2)_c-where a, b and c are independently 1-30.

[00143] Other suitable lipid components of interest include, but are not limited to, simple fatty acids and fatty acid dérivatives, glycerides and more complex lipids such as sterols, for example cholestérol. Fatty acids and their dérivatives of interest may be fully saturated or mono- or polyunsaturated. The length of the carbon chain may vary from C2-C30, but optimal telomerase inhibition may be obtained with carbon chains that are C8-C22. Examples of saturated fatty acids of interest are listed below:

Systematic name /Trivial name / Carbon chain

Tetradecanoic myristic 14:0

Hexadecanoic palmitic 16:0

Octadecanoic stearic 18:0

Eicosanoic arachidic 20:0

[00144] Mono- and poly-unsaturated forms of fatty acids may also be employed, with compounds having one to three double bonds being of interest, although compounds having more double bonds may also be employed. Examples of common mono- and poly-unsaturated fatty acids of interest that may be employed include:

Svstematic name / Trivial name / Carbon chain

Cis-9-hexadecanoic palmitoleic 16:1 (n-7) Cis-6-octadecanoic petroselinic 18:1 (n-12) Cis-9-octadecanoic oleic 18:1 (n-9)

9.12- octadecadienoic linoleic 18:2 (n-6)

6.9.12- octadecatrienoic gamma-linoleic 18:3 (n-6) 9,12,15-octadecatrienoic alpha-linoleic 18:3 (n-3) 5,8,11,14-eicosatetraenoic arachidonic 20:4 (n-6)

[00145] Fatty acids with one or more triple bonds in the carbon chain, as well as branched fatty acids may also be employed in the subject compounds. Substituted forms of fatty acids may be employed in the subject compounds. As with the hydrocarbon groups, substituent groups that are inert in vivo and in vitro are of interest, such as fluorine. Exemplary generic structures of polyfluorinated dérivatives of fatty acids suitable for use in the invention are: CF₃(CF₂)_n—(CH₂)mCO— where m is at least 1, preferably at least 2, and n is 1 to 30, and CH₃(CH₂)_a(CF₂)_b(CH₂)_cCO— where a, b and c are independently 1-30.

[00146] In some cases, between one and five L components (n is 1, 2, 3, 4 or 5) are covalently linked to the O component, via an optionally linker. In some cases, one or two L components are utilized (n=1 or 2). Where more than one L component is linked to the O component, each L component is independently selected.

[00147] It will be appreciated that compounds of the invention described as having a specified hydrocarbon as the L moiety and compounds described as having a specified fatty acid (with the same number of carbon atoms as the specified hydrocarbon) are closely related and differ in structure only in the nature of the bond that joins the L moiety to the polynucleotide, which in turn is a resuit of the synthesis procedure used to produce the compound. For example, and as described in more detail below, when compounds are synthesized having the L moiety conjugated to the 3'-amino terminus of a polynucleotide (having phosphoramidate or thiophosphoramidate intemucleoside linkages), the use of the aldéhyde form of a fatty acid (a fatty aldéhyde) as the starting material results in the formation of an amine linkage between the lipid chain and the polynucleotide, such that the lipid group appears as a hydrocarbon. In contrast, use of the carboxylic acid, acid anhydride or acid chloride forms of the same fatty acid results in the formation of an amide linkage, such that the lipid group appears as a fatty acid dérivative, specifically in this instance a fatty amide (as noted in the définitions section above, for the sake of simplicity, the term “fatty acid when describing the conjugated L group is used broadly herein to include fatty acid dérivatives, including fatty amides). This is illustrated in the following schematics which depict the 3'-amino terminus of a phosphoramidate polynucleotide joined to a C14 lipid component. In schematic A, L is tetradecanoic acid (myristic acid), in which the connection between L and O groups is an amide. In schematic B, L is tetradecane, and the connection between the L and O groups is an amine.

Schematic A

Schematic B

Schematic

HN

NH

[00148] The linkage between the O and L components may be a direct linkage, or may be via an optional linker moiety, e.g., x or optional linker T of Formula (I). The linker group may serve to facilitate the Chemical synthesis of the compounds. Whether or not a linker group is used to médiate the conjugation ofthe O and L components, there are multiple sites on the polynucleotide component O to which the L component(s) may be conveniently conjugated. Suitable linkage points include the 5' and 3' termini, one or more sugar rings, the internucleoside backbone and the nucleobases ofthe polynucleotide. In some cases, the L moiety is attached to the 3‘ or 5' terminus of the polynucleotide. [00149] If the L component is to be attached to the 3' terminus, the attachment may be directly to the 3' substituent, which in the case of the preferred phosphoramîdate and thiophosphoramidate polynucleotides is the 3'-amino group, and in other instances, such as conventional phosphodiester polynucleotides, is a 3-hydroxy group. Alternatively, the L moiety may be linked via a 3'-linked phosphate group, in which a hexadecane hydrocarbon is linked to the 3' phosphate of a thiophosphoramidate polynucleotide through an O-alkyl linker. If the L moiety is to be linked to the 5' terminus, it may be attached through a 5'-linked phosphate group. Attachment to a base on the O moiety may through any suitable atom, for example to the N2 amino group of guanosine. Where n>1 such that a plurality of lipid moieties is to be attached to the O component, the individually selected L components may be attached at any convenient site(s). For example, one L group may be attached to each terminus, various L groups may be attached to the bases, or two or more L groups may be attached at one terminus.

[00150] The optional linker component x may be used to join the O and L components of the compounds. It is understood that the optional linker (e.g., x, or T of Formula (I)) may be attached to the polynucleotide (e.g., O) through a terminal phosphate group, e.g., a 3’-linked or a 5’-linked phosphate group. If a linker is to be employed, it is incorporated into the synthesis procedures as described herein. Examples of suitable linker groups include amino glycerol and O-alkyl glycerol-type linkers which respectively can be depicted by the generic structures:

[ch₂]>;

wherein R' is H, OH, NH₂ or SH; Y is O, S or NR; R is H, an alkyl or a substituted alkyl; and n and m are each independently integers between 1-18.

Examples of suitable linkers of interest are the aminoglycerol linker in which R' is OH, Y is O, and m and n are each 1 :

OH the bis-aminoglycerol linker, in which R' is OH, Y is NH, and m and n are each 1:

and the O-alkyl glycerol linker in which R is H:

—o

[00151] Exemplary lipid-modified polynucleotides that may be prepared according to the subject methods include those compounds described in Figure 1 (e.g., Figures 1A-1DD) of U.S. Application US20120329858 to Gryaznov et al. “Modified oligonucleotides for telomerase inhibition, the disclosure of which is herein incorporated by reference in its entirety.

[00152] In certain embodiments, the composition includes a compound described by the structure:

o=p-sh

nh₂ or a sait thereof, where “nps représente a thiophosphoramidate linkage (e.g., —NH—P(=O)(SH)— O— or a tautomer thereof, or a sait thereof), connecting the 3'-carbon of one nucleoside to the 5’carbon of the adjacent nucleoside. It is understood that the compound described in the formula above may exist in a sait form. Such forms in so far as they may exist, are intended to be included within the scope of the présent disclosure. In certain embodiments, the composition includes a pharmaceutically acceptable sait of the compound. In certain instances, the composition includes a sodium sait of the compound. In certain embodiments, the composition includes a divalent cation sait of the compound, such as a magnésium sait of the compound. In certain embodiments, the composition includes a trivalent cation sait of the compound, such as an aluminium sait of the compound.

[00153] In certain embodiments, the composition includes a compound described by the following structure:

where each M^x+ is independently hydrogen or any convenient counterion of a sait, each x is independently 1,2 or 3 and n is an integer from 5 to 13. In some instances, n is 5, 6, 7, 8, 9, 10,11, 12 or 13. In certain instances, each x is independently 1,2 or 3 and n is an integer from 5 to 12. In certain instances, n is 13. In certain instances, each x is 1. In certain instances, each x is independently 1 or 2. In certain instances, each x is independently 1 or 3. In certain instances, each

M^x* rs independently a cationic counterion. In certain instances, each M^x* is independently a cationic counterion, each x is independently 1,2 or 3 and n is an integer from 5 to 12. In certain instances, each M^x* is independently hydrogen or any convenient cationic counterion, each x is independently 1, 2 or 3 and n is an integer from 5 to 12. In certain instances, M^x+ is hydrogen. In some embodiments, (M^x*)n is (Mg²⁺)(M⁺)n. In some embodiments, (M^x+)n is (Mg²*)2(M*)9. In some embodiments, (M^x*)n is (Mg²*)2(M*)9. In some embodiments, (M^x*)3 is (Mg²*)3(M*)7. In some embodiments, (M^x*)n is (Mg²*)4(M*)5. In some embodiments, (M^x+)n is (Mg²*)5(M*)3. In some embodiments, (M^x*)n is (Mg²*)6(M*). In some embodiments, (M^x*)n is (Mg²*)(M*)i2, where the Mg²* counterion may form an additional ion pair to the anionic backbone of another oligonucleotide. In some embodiments, (M^x*)n is (Mg^z*)₂(M*)₁₁, where the Mg²* counterions may form two an additional ion pairs to the anionic backbone(s) of one or two other oligonucieotide(s). In certain instances, the M* counterion of the mixed magnésium sait is sodium. In certain instances, the M* counterion of the mixed magnésium sait is ammonium. In certain instances, the M* counterion of the mixed magnésium sait is triethylammonium.

[00154] In certain embodiments, the composition includes a compound described by the following structure and may include any convenient cationic counterions of a sait:

[00155] In certain embodiments, the composition includes a compound described by the structure:

Ο

[00156] Lipid modifiée! polynucleotides

[00157] A variety of synthetic approaches can be used to conjugate a lipid moiety L to the polynucleotide, depending on the nature of the linkage selected, including the approaches described in Mishra et al., (1995) Biochemica et Biophysica Acta, 1264:229-237, Shea et al., (1990) Nucleic Acids Res. 18:3777-3783, and Rump et al., (1998) Bioconj. Chem. 9:341-349. The synthesis of compounds in which the lipid moiety rs conjugated at the 5' or 3' terminus of the polynucleotide can be achieved through use of suitable functional groups at the appropriate terminus, in some cases an amino group or a hydroxyl group, which can be reacted with carboxylic acids, acid chlorides, anhydrides and active esters. Thiol groups may also be used as functional groups (see Kupihar et al., (2001) Bioorganic and Médicinal Chemistry 9:1241-1247). Both amino- and thiol- modifiers of different chain lengths are commercially available for polynucleotide synthesis. Polynucleotides having N3'—>P5'thiophosphoramidate linkages contain 3'-amino groups (ratherthan 3’-hydroxy found in most conventional polynucleotide chemistries), and hence these polynucleotides provide a unique opportunity for conjugating lipid groups to the 3'-end of the polynucleotide.

[00158] Various approaches can be used to attach lipid groups to the termini of polynucleotides with the N3'->P5'thiophosphoramidate chemistry (e.g., a palmitoylamido-1-O-(4,4’-dimethoxytrityl)-2O-succinyl propanediol linker). For attachment to the 3' terminus, the conjugated compounds can be synthesized by reacting the free 3'-amino group ofthe fully protected solid support bound polynucleotide with the corresponding acid anhydride followed by deprotection with ammonia and purification. Altematively, coupling of carboxylic acids of lipids to the free 3'-amino group of the support bound polynucleotide using coupling agents such as carbodiimides, HBTU (Ν,Ν,Ν’,Νtetramethyl-O-(1 H-benzotriazol-1-yl)uronium hexafluorophosphate) or 2-chloro-1-methylpyridinium iodide can be used to conjugate the lipid groups. These two methods form an amide bond between the lipid and the polynucleotide. Lipids may also be attached to the polynucleotide chain using a phosphoramidite dérivative ofthe lipid coupled to the polynucleotides during chain élongation. This approach yields a phosphoramidate (e.g., thiophosphoramidate) linkage connecting the lipid and the polynucleotide (exemplifîed by propyl-palmitoyl and 2-hydroxy-propyl-palmitoyl compounds). Still another approach involves reaction of the free 3'-amîno group of the fully protected support bound polynucleotide with a suitable lipid aldéhyde, followed by réduction with sodium cyanoborohydride, which produces an amine linkage.

[00159] For attachment to the 5' terminus, the polynucleotide can be synthesized using a modified, lipid-containing solid support, followed by synthesis of the polynucleotide in the 5’ to 3' direction as described in Pongracz & Gryaznov (1999). An example of the modified support is provided below. In the instance where n=14, the fatty acid is palmitic acid: reaction of 3-amino-1,2-propanediol with palmitoyl chloride, followed by dimethoxytritylation and succinylation provided the intermediate used for coupling to the solid support. In some instances, R may be long chain alkyl amine controlled pore glass. In certain instances, R is a polymeric solid support.

R \

C=O /

H,C\

CH, / '

•CH, 'ODMT

Utility

[00160] The methods and compositions of the invention, e.g., as described above, find use in a variety of applications. Applications of interest include, but are not limited to: therapeutic applications, diagnostic applications, research applications, and screening applications, as reviewed in greater detail below.

[00161] The subject compounds find use in a variety of therapeutic applications. In some embodiments, the methods of producing a polynucleotide are applied to préparé polynucleotides that provide for a therapeutic benefit. The types of diseases which are treatable using the compositions of the présent invention are limitless. For example, the compositions may be used for treatment of a number of genetîc diseases. In some embodiments, the subject methods and compositions hâve antisense applications. In some embodiments, the subject methods and compositions hâve antigene applications. In certain embodiments, the subject methods and compositions hâve telomerase inhibition applications, such as those described in U.S. Patent 6,835,826, and U.S. Publication 20120329858, the disclosures of which are herein incorporated by reference in their entirety.

[00162] The présent disclosure provides compounds that can specifically and potently inhibit telomerase activity, and which may therefore be used to inhibit the prolifération of telomerase-positive cells, such as tumor cells. A very wide variety of cancer cells hâve been shown to be telomerasepositive, including cells from cancer of the skin, connective tissue, adipose, breast, lung, stomach, pancréas, ovary, cervix, utérus, kidney, bladder, colon, prostate, central nervous system (CNS), retina and hématologie tumors (such as myeloma, leukemia and lymphoma). Cancers of interest include, but are not limited to, myelofibrosis, thrombocythemia, myelodysplasic syndrome and myelogenous leukemia.

J00163] The subject compounds can be used to treat hématologie malignancies and myeloproliferative disorders, including but not limited to, essential thrombocythemia (ET), polycythemia vera (PV) chronic myelogenous leukemia (CML), myelofibrosis (MF), chronic neutrophilie leukemia, chronic éosinophilie leukemia, and acute myelogenous leukemia (AML). The subject compounds can be used to treat myelodysplastic syndromes, which include such disease as refractory anémia, refractory anémia with excess blasts, refractory cytopenia with multilineage dysplasia, refractory cytopenia with unilineage dysplasia, and chronic myelomonocytic leukemia (CMML). The subject compounds can be used to treat hematological diseases, such as those described in PCT patent application No. PCT/US13/070437 filed November 15, 2013, the disclosure of which is incorporated herein by reference in its entirety.

[00164] Accordingly, the compounds provided herein are broadly useful in treating a wide range of malignancies. In some instances, the subject compounds can be effective in providing treatments that discriminate between malignant and normal cells to a high degree, avoiding many of the deleterious side-effects présent with most current chemotherapeutic regimens which rely on agents that kill dividing cells indiscriminately. Moreover, in some cases, the subject lipid modified compounds are more potent than équivalent unconjugated oligonucleotides, which means that they can be administered at lower doses, providing enhanced safety and significant réductions in cost of treatment. Telomerase inhibitors may be employed in conjunction with other cancer treatment approaches, including surgical removal of primary tumors, chemotherapeutic agents and radiation treatment. Hence, the invention relates to compounds and compositions provided herein for use as a médicament. The invention also relates to compounds and compositions provided herein for use in treating or preventing any one of the malignancies mentioned hereînbefore.

[00165] The subject compounds and methods fïnd use in a variety of diagnostic applications, including but not limited to, the development of clinîcal diagnostics, e.g., in vitro diagnostics or in vivo tumor imaging agents. Such applications are useful in diagnosing or confirming diagnosis of a disease condition, or susceptibility thereto. The methods are also useful for monitoring disease progression and/or response to treatment in patients who hâve been previously diagnosed with the disease.

Examples

[00166] Example 1: Summary

[00167| These examples describe experiments to préparé various divalent or trivalent forms of Imetelstat, such as Ca, Ba, Mg, Al, Fe, Cu, and Zn from the sodium sait form of Imetelstat. In these experiments, improvements in purity using methods of préparation involving the formation and isolation of salts of the bi-dentate or tri-dentate cations that can bind with one, two or three phosphate groups of Imetelstat were evaluated. The solubility and osmolality of resulting sait forms were also studied.

[00168] The préparation of Imetelstat Calcium, Imetelstat Barium, Imetelstat Magnésium, imetelstat Aluminum, Fe (Il or III) Imetelstat, and Cupric Imetelstat salts were investigated using CaCI₂, MgCI₂, BaCI₂, CuCI₂, ZnCI₂, AICI₃, FeCI₂, and FeCI₃.

[00169] Three methods for sait exchange were studied: use of a strong cation-exchange resin (FINEX MFG 210), précipitation, and simple dissolution. When the Imetelstat Sodium solution was passed through a resin exchanged with CaCI₂, BaCI₂ or MgCI₂, the eluate solutions contained fine powders, indicating that sodium counterions were successfully exchanged from the Imetelstat backbone and replaced with calcium, barium or magnésium counterions. For the other five reagents (CuCI₂, ZnCI₂, A!CI₃, FeCI₂, FeCI₃) which were equilibrated with the cation exchange resin, the top part of resin in the column became aggregated when Imetelstat solution was passed through, also indicating that sodium counterions were successfully exchanged from the Imetelstat backbone.

[00170] Précipitation and dissolution methods were also tested using an excess of sait reagents. When a large excess of sait reagent (e.g. 900 équivalents) was treated with Imetelstat Sodium, a precipitate was formed. The précipitâtes were isolated by filtration. Subséquent tests indicate that seven to fifty équivalents of inorganic sait reagents were necessary to convert ail of the Imetelstat to a precipitate.

[00171] Five équivalents of the three inorganic salts (Mg, Ba or Ca) were each treated with either Imetelstat TEA (triethylammonium) sait form or Imetelstat Na sait form. It was confirmed that précipitation did not occur and the solutions were desalted and freeze-dried. The analysis of freezedried powder by Flame AA (Atomic Absorption) showed that some of the sodium counterions of Imetelstat were exchanged.

[00172] An additional experiment was performed with MgCI₂ using one to nine équivalents of magnésium cation to the Imetelstat form. The sodium counterions were partially exchanged to Mg counterions with the highest exchange occurring at nine équivalents of MgCI_2l with the resulting compositions showing 1.2% by weight of Na and 1.1% by weight of Mg.

[00173] Example 2: Materials and Equipments

[00174] The inorganic reagents, organic solvents, and other materials used for the study are listed in Table 1. Imetelstat Sodium (CAS #1007380-31-5)of Lot# of G163/L-G-13002 provided by Geron was used for the study. Imetelstat ammonium is a crude composition derived from cleavage of Imetelstat from a solid phase synthesis support using ammonia and éthanol (e.g., as described by Gryaznov et al. in US 20120329858) and was obtained from the manufacturées stock. Imetelstat TEA (triethylammonium form) is a composition derived from an HPLC purification column eluate where a triethylammonium acetate (TEAA) contaîning mobile phase is used (e.g., as described by Gryaznov et al. in US 20120329858) and was obtained from the manufacturées stock obtained from various process development studies. The ultrafiltration was performed using a Stirred Ultrafiltration Cell (Amicon 8400, Millipore) with 1KD PES membranes. The lyophilization was conducted using a Speed Vacuum Concentrator (ScanSpeed 40, LaboGene).

[00175] Example 3: Procedure

[00176] Exchanqe By lon-Exchanqe Resin Column

A column of strong cation exchange resin, FINEX MFG 210, was prepared having a column volume of 200 mL (4.6 cm x 12 cm) and the resin was washed with 1M NaOH and water. The column was then equilibrated with a 1M solution of each sait of interest. In total, eight 1M sait solutions were prepared and used (CaCl₂, MgCI₂₁ BaCI_2l CuCI₂, ZnCI₂, AICI₂, FeCI₂, and FeCI₃) in these experiments. A 50 mL solution of Imetelstat sodium at 100 mg/mL was added to the column.

[00177] In case of the CuCI₂, ZnCI₂, AICI_2| FeCI₂₁ and FeCI₃ equilibrated columns, aggregation of Imetelstat on the resin was observed in the top part of column when Imetelstat sodium was loaded onto the column.

[00178] The three columns equilibrated with CaCI₂, MgCI₂ and BaCI₂, sait solutions did not resuit in any Imetelstat aggregation on the column and Imetelstat was recovered from the column eluate, which were observed as cloudy solutions. Fine powders were recovered from these eluates by centrifugation (4000 rpm, 20 min). After centrifugation, it was confirmed that the supernatant did not contain any Imetelstat by HPLC analysis. This indicates that the précipitation and séparation of calcium, magnésium and barium salts of Imetelstat was successfully achieved.

[00179] By Précipitation

[00180] The crystallization or précipitation of divalent or trivalent forms of Imetelstat was investigated using a large excess of inorganic salts of interest (900 équivalents, weight base). 1M sait solutions CaCI₂, MgCI₂₁ BaCI_2l CuCI₂, ZnCI₂, AICI₂, FeCI₂, and FeCI₃ were prepared. Three types of Imetelstat solution: crude Imetelstat solution (ammonium sait), purified Imetelstat (triethylammonium (TEA) sait form), and Imetelstat sodium (Na sait form), were mixed with each sait solution.

[00181] Ail mixed solutions showed précipitâtes of Imetelstat, which were isolated easily by filtration with an Advantec 2 filter paper. This resuit indicates that the précipitation and séparation of multivalent salts of Imetelstat was successfully achieved.

[00182] The solubilities of the précipitâtes isolated under the conditions of large excess of sait regent were înîtially investigated using the following solvents: water, acetonitrile, MeOH, EtOH, IPA (isopropyl alcohol), 0.1M NaOH, 0.1M HCl, 1M NaCI, and NMP.

[00183] For salts precipitated in a large excess of sait reagent, calcium, barium, and magnésium salts of Imetelstat were soluble in a 0.1 M NaOH and 1M NaCI solution, (see Table 2). Solubility studies of Imetelstat precipitate obtained from a large excess of magnésium sait reagent were conducted in 1M NaCI solutions at different concentrations (2mg/mL to 6 mg/mL) and under different pH conditions (pH 8, 9, 10, 11, 12) and analyzed by HPLC (see chromatograms of Figure 1). The Imetelstat precipitate was observed to be soluble at 6 mg/mL and pH 11 to pH 12. The compound also showed stability up to pH 12 without any précipitâtes (Figure 1).

[00184] By Dissolution

[00185] 30 to 50 équivalents sait reagent

[00186] The number of équivalents of sait reagents of interest that could achieve a complété précipitation of Imetelstat was investigated by adding the sait reagent of interest step by step. The complété formation of precipitate was observed in the range of 7 to 50 équivalents of added sait reagent for the eight salts listed in Table 3. As more équivalents of sait reagents were added, a trend towards gel formation with précipitation was observed for ail salts.

[00187] Three types of Imetelstat solution were used: crude Imetelstat ammonium (crude form), Imetelstat triethylammonium (purified TEA sait form), and Imetelstat sodium (Na sait form), were mixed with each sait solution. The Imetelstat ammonium sait was used as either a NH₄OH solution or a solution in water. The Imetelstat ammonium and Imetelstat TEA solutions required approximately 50 équivalents or 30 équivalents of Mg sait reagent, respectively, to achieve complété précipitation. [00188] The solubility of précipitâtes formed from the Imetelstat TEA solution and the Imetelstat ammonium solution were investigated under various pH conditions from pH 8 to pH 12. After leaving the mixed solutions for 6 hrs at RT, the solubility of the Imetelstat-Mg précipitâtes was analyzed by UV absorbance at 260 nm. Both précipitâtes obtained from the Imetelstat ammonium and the Imetelstat TEA showed a similar trend in that more Imetelstat sait dissolved in 1M NaCI solution at high pH (see Table 3).

[00189] This resuit suggests that when the number of équivalents of sait reagent of interest relative to Imetelstat is controlled, complété précipitation of Imetelstat sait may be achieved by any convenient method to produce a precipitate that may be successfully redissolved.

[00190] 5 équivalents sait reagent

[00191] Imetelstat Sodium solution (1 OOmg in 1 mL of water) was mixed with 5 équivalents of eight sait reagents and each solution was desalted by ultrafiltration using a Stirred Ultrafiltration Cell and 1 KD membrane. The ultrafiltered solution was then lyophilized. The resulting powder was analyzed for the content of Na and each métal counterion of interest by Flame AA (atomic absorption spectroscopy. As show in Figure 2 and 3, the highest métal counterion content was 1.1% by weight forZn, Al, and Mg, with Na contents of 2.6%, 1.7%, and 2.6%, respectively.

[00192] 6to9 équivalents sait reagent

[00193] Addition of 6 to 9 équivalents of magnésium sait reagent to Imetelstat Sodium solution was made and the subséquent ultrafiltration and lyophilzation provided the solid product which was completely soluble in water. The analysis of sodium and magnésium content was performed (see results in Figure 3). Addition of nine équivalents of MgCl_z to Imetelstat Sodium solution, produce a composition where the Na and Mg counterion content is 1.1% and 1.2% by weight, respectively.

[00194] 1 to 10 équivalents sait reagent

[00195] To investigate the exchange of Mg with TEA counterions in Imetelstat TEA sait as compared to Imetelstat sodium sait, another set of experiments was designed and performed. One to ten équivalents of MgCI₂ in aqueous solutions were mixed with Imetelstat TEA sait solution (purity > 90% by HPLC). An analysis of the Mg counterion content was performed after ultrafiltration and lyophilization. The results are shown in Figure 4. The addition of up to 10 équivalents of MgCI₂ reagent produced a composition having 1.6% of Mg by weight.

[00196] Example 4: Conclusion

[00197] The préparation of divalent and trivalent sait forms of Imetelstat was achieved including calcium, magnésium, zinc, aluminium, barium, iron(ll), iron (III) and copper salts. When a controlled excess of selected inorganic sait reagents was used (see Table 2 and 3) to precipitate the polynucleotide, précipitâtes were formed which could be subsequently redissolved, and which show împroved purity with respect to fast eluting impurîties using HPLC analysis.

[00198] The use of a magnésium sait reagent produced a soluble solid precipitate of Imetelstat after the exchange step. Précipitâtes were produced which achieved a 1.2 % by weight of magnésium counterion relative to 1.1 % by weight of sodium counterion.

[00199] The précipitation of Imetelstat using divalent or trivalent salts provides for the removal of non-target synthetic products and reagents which remain in solution. The removal of such impurîties présent in crude Imetelstat solutions provides several advantages for subséquent chromatography purification steps of Imetelstat, such as reduced column loading, împroved resolution, reduced number of chromatography purification steps and împroved lifetime of chromatography columns, decreased purification costs and faster purifications.

Table 1. Inorganic Salts, Organic Solvents, and Other Materials

Material	Molecular Formula (Molecular Weight)	Grade or Purity
Calcium Chloride di hydrate	CaCI22H2O (MW 147.01)	à 99 %
Magnésium chloride monohydrate	MgCI2-H2O (MW 203.30)	£ 99 %
Barium chloride dihydrate	BaCI2-2H2O (MW 244.26)	£ 99 %
Copper(ll) chloride dihydrate	CuCI2-2H2O (MW 170.48)	£ 99 %
Zinc chloride	ZnCI2 (MW 136.30)	à 98 %
Aluminum chloride hexahydrate	AICI3-6H2O (MW 241.43)	;> 95 %
Iron (II) chloride tetrahydrate	FeCI2-4H2O (MW 198.81)	> 98 %
Iron (III) chloride hexahydrate	FeCI3-6H2O (MW 270.30)	> 98 %
Sodium chloride	NaCI (MW 58.4)	USP grade

Table 2 (O: Yes, X: No, means not performed)

Method	Imetelsta t T ested	Test Performed	CaCI 2	MgCI2	BaCI 2	CuCl 2	ZnCI 2	aici3	FeCI 2	FeCI 3
Ion Exchang e Resin	Sodium (Na form, 100m g /mL)	Column Pass through	O	O	O	X	X	X	X	X
Precipitatio n in solution after column	O	O	O	-	-	-	-	-

		Filtration of précipitâtes	X	X	X		-	-	-	-
Solubility* of Precipitate	X	X	X		-	-	-	-
Précipita t-ion (900 équivale nt)	Sodium (Na form, 100mg /mL)	Précipitâtes (Filterable)	0	0	0	0	0	0	0	0
Solubility** of Precipitate	X	X	X	X	X	X	X	X
Solubility of Precipitate in 1M NaOH	0	0	0	X	X	X	X	X
TEA (35mg /mL)	Précipitâtes (Filterable)	0	0	0	0	0	0	0	0
Solubility** of Precipitate	X	X	X	X	X	X	X	X
Solubility of Precipitate in 1M NaOH	O	0	X	X	X	X	X	X
Crude (in NH4OH)	Précipitâtes (Filterable)	0	0	0	0	0	0	0	0
Solubility** of Precipitate	X	X	X	-	-	-	-	-

*Tested in Acetonitrile, MeOH, EtOH, IPA, Water, NMP, 1M HCl, 1M NaCI, 1M NaOH “ Tested in Acetonitrile, MeOH, EtOH, IPA, Water, NMP, 1M HCl, 1M NaCI

Table 3

Drssoluti	Sodium	Inorganic	9	15	12	7	50	50	10	11
on	TEA	Sait	15	30	30	10	50	10	50	10

	Crude (in NH4OH)	Equivalents to get complété précipitation	-	>50		-	-	-	-	-
Crude (in water)	-	30	-	-	-	-	-	-
Solubility In 1M NaCI (1 mL)	TEA	Imetelstat-Mg ppt pH 8 pH 9 pH 10 pH 1 6mg (After 64 29C 28 OD 31 CD 70 OD hours) OC	1 pH 12 ) 434 OD
Crude (in water)	Imetelstat-Mg ppt pH 8 pH 9 pH 10 pH11 pH 12 111 377 6mg (After 6 hours) 10 OD 7 OD 17 OD θθ

[00200| Notwithstanding the appended daims, the disdosure set forth herein is also defined by the following clauses:

[00201] 1. A method of preparing a polynucleotide, the method comprising:

contacting a first polynucleotide composition comprising:

a polynucleotide having a sequence of 7 or more nucleoside subunits and at least two of the nucleoside subunits are joined by a N3'—>P5' thiophosphoramidate inter-subunit linkage; and non-target synthetic products and reagents;

with a multivalent cation sait to precipitate a first polynucleotide sait comprising at least one multivalent cation counterion; and separating the first polynucleotide sait from the contacted first polynucleotide composition to produce a second polynucleotide composition comprising the first polynucleotide sait.

[00202] 2. The method of clause 1, further comprising: contacting the first polynucleotide sait with a reverse phase chromatography support; and eluting from the chromatography support a third polynucleotide composition comprising a second polynucleotide sait.

[00203] 3. The method of any one of clauses 1-2, wherein the polynucleotide comprises a sequence comprising 13 or more nucleoside subunits complementary to the RNA component of human telomerase.

[00204] 4. The method of any one of clauses 1-3, wherein the polynucleotide comprises between and 50 contiguous nucleoside subunits complementary to the RNA component of human telomerase.

[00205] 5. The method of any one of clauses 3-4, wherein the nucleoside subunits complementary to the RNA component of human telomerase are ail joined by N3'—>P5' thiophosphoramidate inter-subunit linkages.

[00206] 6. The method of any one of clauses 1-5 wherein the polynucleotide comprises a sequence selected from the group consisting of: GTTAGGGTTAG (SEQ ID NO;4), TAGGGTTAGACAA (SEQ ID NO:3) and CAGTTAGGGTTAG (SEQ ID NO:5).

[00207] 7. The method of any one of clauses 1-6, wherein the polynucleotide is conjugated to a lipid moiety via an optional linker.

[00208] 8, The method of any one of clauses 2-7, wherein the second polynucleotide sait has the io structure:

wherein each M*⁺ is independently hydrogen or a cationic counterion, each x is independently 1, 2 or 3 and n is an integer from 5 to 13.

[00209] 9. The method of any one of clauses 2-8, wherein the second polynucleotide sait is a pharmaceutically acceptable sait of the polynucleotide.

[00210] 10. The method of any one of clauses 2-9, wherein the second polynucleotide sait is a monovalent cation sait of the polynucleotide.

[00211] 11. The method of any one of clauses 2-10, wherein the second polynucleotide sait is a sodium sait of the polynucleotide.

[00212] 12. The method of any one of clauses 1-5, further comprising cleaving the polynucleotide from a support to produce the first polynucleotide composition.

[00213] 13. The method of any one of clauses 1-12, wherein the first composition comprises a monovalent cation sait of the polynucleotide.

[00214| 14. The method of any one of clauses 1-13, wherein the contacting step comprises eluting the first polynucleotide composition from a cation exchange support.

[00215] 15. The method of any one of clauses 1-14, wherein the separating step comprises centrifuging the contacted first polynucleotide composition to spin down the polynucleotide sait precipitate.

[00216] 16. The method of any one of clauses 1-15, wherein the separating step comprises filtering the polynucleotide sait from the contacted first polynucleotide.

[00217] 17. The method of clause 2, wherein the second polynucleotide composition is loaded directly onto the reverse phase chromatography support.

[00218] 18. The method of any one of clauses 1-17, further comprising dissolving the second polynucleotide composition in a solvent.

[00219] 19. The method of any one of clauses 1 -18, wherein the at least one multivalent cation counterion is divalent

[00220] 20. The method of clause 19, wherein the at least one multivalent cation counterion is selected from the group consisting of magnésium, zinc and calcium.

[00221] 21. The method of any one of clauses 1-18, wherein the at least one multivalent cation counterion is trivalent.

[00222] 22. The method of clause 21, wherein the at least one multivalent cation counterion is aluminium.

[00223] 23. The method of any one of clauses 1-22, wherein the polynucleotide sait further comprises a monovalent cation counterion.

[00224] 24. A composition comprising: a sait of a polynucleotide comprising at least one multivalent cation counterion; wherein the polynucleotide has a sequence of 7 or more nucleoside subunits complementary to the RNA component of human telomerase and at least two of the nucleoside subunits are joined by a N3'—*P5’ thiophosphoramidate inter-subunit linkage.

[00225] 25. The composition of clause 24, wherein the at least one multivalent cation counterion is divalent.

[00226] 26. The composition of clause 25, wherein the at least one multivalent cation counterion is selected from the group consisting of magnésium, zinc and calcium.

[00227] 27. The composition of any one of clauses 24-26, wherein the at least one multivalent cation counterion is magnésium.

[00228] 28. The composition of clause 24, wherein the at least one multivalent cation counterion is trivalent.

[00229] 29. The composition of clause 28, wherein the at least one multivalent cation counterion is aluminium.

[00230] 30. The composition of any one of clauses 24-29, wherein the polynucleotide comprises 3 mol % or more ofthe multivalent cation counterion relative to a polyanionic backbone of the polynucleotide.

[00231] 31. The composition of any one of clauses 24-29, wherein the polynucleotide comprises

1.0 % by weight or more of the multivalent cation counterion relative to the polynucleotide.

[00232] 32. The composition of any one of clauses 24-31, wherein the composition is a precipitate.

[00233] 33. The composition of any one of clauses 24-32, wherein the polynucleotide comprises a sequence comprising 13 or more nucleoside subunits complementary to the RNA component of human telomerase.

[00234] 34. The composition of any one of clauses 24-33, wherein the polynucleotide comprises between 10 and 50 contiguous nucleoside subunits complementary to the RNA component of human telomerase.

[00235] 35. The composition of any one of clauses 24-34, wherein the nucleoside subunits complementary to the RNA component of human telomerase are ail joined by N3'—»P5' thiophosphoramidate inter-subunit linkages.

[00236] 36. The composition of any one of clauses 24-35, wherein the polynucleotide comprises a sequence selected from the group consisting of: GTTAGGGTTAG (SEQ ID NO:4), TAGGGTTAGACAA (SEQ ID NO:3) and CAGTTAGGGTTAG (SEQ ID NO:5).

[00237] 37. The composition of any one of clauses 24-36, wherein the polynucleotide is conjugated to a lipid moiety via an optional linker.

[00238] 38. The composition of any one of clauses 24-37, wherein the polynucleotide has the structure:

wherein each M^x+ is independently a cationic counterion, each x is 1, 2 or 3 and n is 5 to

12.

[00239] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is readily apparent to those of ordinary skili in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended daims.

[00240] Accordingly, the preceding merely illustrâtes the principles of the invention. It will be appreciated that those skîlled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthemnore, ail examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being wîthout limitation to such specifîcally recited examples and conditions. Moreover, ail statements herein reciting principles, aspects, and embodiments of the invention as well as spécifie examples thereof, are intended to encompass both structural and functionaî équivalents thereof. Additionally, it is intended that such équivalents include both currently known équivalents and équivalents developed in the future, Le., any éléments developed that perform the same function, regardless of structure. The scope of the présent invention, therefore, is not intended to be limited to the embodiments shown and described herein. Rather, the scope and spirit of présent invention is embodied by the appended embodiments. Ail possible combinations of the above-indicated embodiments are considered to be embraced within the scope of this invention.

Claims (38)

1. What is claimed is:

   1. A method of preparing a polynucleotide, the method comprising: contacting a first polynucleotide composition comprising:

   a polynucleotide having a sequence of 7 or more nucleoside subunits and at least two ofthe nucleoside subunits arejoined bya N3'—>P5’ thiophosphoramidate inter-subunit linkage; and non-target synthetic products and reagents;

   with a multivalent cation sait to precipitate a first polynucleotide sait comprising at least one multivalent cation counterion; and separating the first polynucleotide sait from the contacted first polynucleotide composition to produce a second polynucleotide composition comprising the first polynucleotide sait.
2. 2. The method of claim 1, further comprising:

   contacting the first polynucleotide sait with a reverse phase chromatography support; and eluting from the chromatography support a third polynucleotide composition comprising a second polynucleotide sait.
3. 3. The method of any one of claims 1-2, wherein the polynucleotide comprises a sequence comprising 13 or more nucleoside subunits complementary to the RNA component of human telomerase.
4. 4. The method of any one of claims 1-3, wherein the polynucleotide comprises between 10 and 50 contiguous nucleoside subunits complementary to the RNA component of human telomerase.
5. 5. The method of any one of claims 3-4, wherein the nucleoside subunits complementary to the RNA component of human telomerase are ail joined by N3'—*P5’ thiophosphoramidate inter-subunit linkages.
6. 6. The method of any one of claims 1-5 wherein the polynucleotide comprises a sequence selected from the group consisting of: GTTAGGGTTAG (SEQ ID NO:4), TAGGGTTAGACAA (SEQ ID NO:3) and CAGTTAGGGTTAG (SEQ ID NO:5).
7. 7. The method of any one of claims 1-6, wherein the polynucleotide is conjugated to a lipid moiety via an optional linker.
8. 8. The method of any one of ciaims 2-7, wherein the second polynucleotide sait has the structure:

   wherein each M*⁺ is independently hydrogen or a cationic counterion, each x is independently 1,2 or 5 3 and n is an integer from 5 to 13.
9. 9. The method of any one of ciaims 2-8, wherein the second polynucleotide sait is a pharmaceutically acceptable sait of the polynucleotide.
10. 10 10. The method of any one of ciaims 2-9, wherein the second polynucleotide sait is a monovalent cation sait of the polynucleotide.
11. 11. The method of any one of daims 2-10, wherein the second polynucleotide sait is a sodium sait of the polynucleotide.
12. 12. The method of any one of daims 1-5, further comprising cleaving the polynucleotide from a support to produce the first polynucleotide composition.
13. 13. The method of any one of daims 1-12, wherein the first composition comprises a monovalent cation sait of the polynucleotide.
14. 14. The method of any one of daims 1-13, wherein the contading step comprises eluting the first polynucleotide composition from a cation exchange support.
15. 15. The method of any one of daims 1-14, wherein the separating step comprises centrifuging the contacted first polynucleotide composition to spin down the polynucleotide sait precipitate.
16. 16. The method of any one of daims 1-15, wherein the separating step comprises filtering the polynucleotide sait from the contaded first polynucleotide.
17. 17. The method of claim 2, wherein the second polynucleotide composition is loaded directly onto the reverse phase chromatography support.
18. 18. The method of any one of daims 1-17, further comprising dissolving the second polynucleotide composition in a solvent.
19. 19. The method of any one of daims 1-18, wherein the at least one multivalent cation counterion is divalent.
20. 20. The method of claim 19, wherein the at least one multivalent cation counterion is selected from the group consisting of magnésium, zinc and calcium.
21. 21. The method of any one of daims 1-18, wherein the at least one multivalent cation counterion is trivalent.
22. 22. The method of claim 21, wherein the at least one multivalent cation counterion is aluminium.
23. 23. The method of any one of daims 1-22, wherein the polynudeotide sait further comprises a monovalent cation counterion.
24. 24. A composition comprising:

    a sait of a polynucleotide comprising at least one multivalent cation counterion;

    wherein the polynudeotide has a sequence of 7 or more nucleoside subunits complementary to the RNA component of human telomerase and at least two of the nucleoside subunits are joined by a N3'—>P5' thiophosphoramidate inter-subunit linkage.
25. 25. The composition of daim 24, wherein the at least one multivalent cation counterion is divalent.
26. 26. The composition of claim 25, wherein the at least one multivalent cation counterion is selected from the group consisting of magnésium, zinc and calcium.
27. 27. The composition of any one of daims 24-26, wherein the at least one multivalent cation counterion is magnésium.
28. 28. The composition of daim 24, wherein the at least one multivalent cation counterion is trivalent.
29. 29. The composition of claim 28, wherein the at least one multivalent cation counterion is aluminium.
30. 30. The composition of any one of daims 24-29, wherein the polynucleotide comprises 3 mol % or more of the multivalent cation counterion relative to a polyanionic backbone of the polynucleotide.
31. 31. The composition of any one of daims 24-29, wherein the polynucleotide comprises 1.0 % by weight or more of the multivalent cation counterion relative to the polynucleotide.
32. 32. The composition of any one of daims 24-31, wherein the composition is a precipitate.
33. 33. The composition of any one of daims 24-32, wherein the polynucleotide comprises a sequence comprising 13 or more nucleoside subunits complementary to the RNA component of human telomerase.
34. 34. The composition of any one of ciaims 24-33, wherein the polynucleotide comprises between 10 and 50 contiguous nucleoside subunits complementary to the RNA component of human telomerase.

    5
35. 35. The composition of any one of ciaims 24-34, wherein the nucleoside subunits complementary to the RNA component of human telomerase are ail joined by N3'—*P5‘ thiophosphoramidate intersubunit linkages.
36. 36. The composition of any one of ciaims 24-35, wherein the polynucleotide comprises a

    10 sequence selected from the group consisting of: GTTAGGGTTAG (SEQ ID NO:4), TAGGGTTAGACAA (SEQ ID NO:3) and CAGTTAGGGTTAG (SEQ ID NO:5).
37. 37. The composition of any one of ciaims 24-36, wherein the polynucleotide is conjugated to a lipid moiety via an optional linker.
38. 38. The composition of any one of ciaims 24-37, wherein the polynucleotide has the structure:

    wherein each M^x+ is independently a cationic counterion, each x is 1,2 or 3 and n is 5 to 12.