OA18628A - Composition and method for stabilizing and maintaining the viability of hardy microorganisms. - Google Patents

Abstract

The present application is to provide a composition and method for stabilizing and maintaining the viability of hardy microorganisms from sample collection to downstream analysis. In particular, there is a method for preserving viable hardy bacteria, such as Mycobacteria, Bacillus anthracis, or Clostridium difficile, in a biological sample, comprising contacting the biological sample with a stabilization composition, wherein the stabilization composition comprises a chelating agent, a denaturing, a salt and has a pH between about 6 and about 11.

Description

COMPOSITION AND METHOD FOR STABILIZING AND MAINTAINING THE VIABILITY OF HARDY MICROORGANISMS

FIELD OF THE INVENTION

[0001] The présent application pertains to the field of sample collection and storage.

[0001] 5 More particularly, the présent application relates to compositions and methods for maintaining the viability of hardy microorganisms from sample collection to analysis.

INTRODUCTION

[0002] Tuberculosis (TB) remains a major global health problem. The majority of new infections and deaths occur in developing countries. In 2012 alone, the World Health

[0001] 10 Organization (WHO) estimated 8.6 million people developed TB and 1.3 million died from the disease, including 320,000 deaths among HIV-positive individuals (Global tuberculosis report 2013, WHO). The number of TB deaths is unacceptably large given that most are preventable. The WHO estimâtes that approximately one-third of the world’s population or 2 billion people are infected with tuberculosis and hence at risk of [0001] 15 developing active disease. Alarmingly, the WHO estimated that only one-third of the 3.6 million smear-positive cases of TB were reported in 2001 (WHO. 2001. Global tuberculosis control. WHO/CDS/TB/2001 287:18-19). Early diagnosis of TB remains one of the primary hurdles in curtailing the spread of this disease. Unfortunately, there are a myriad of problems associated with identifying the approximately 30 million individuals [0001] 20 worldwide with active TB.

[0003] Proper handling of biological specimens from the time of collection through ail stages of transport, storage, and Processing is crucial for obtaining microbiological test results that are both timely and clinically relevant (Wilson, 1996). Issues common to ail clinical specimens submitted for microbiological testing include not only proper

[0001] 25 identification, but also collection techniques that maximize recovery of microbial pathogens and minimize contamination by non-pathogens. For specimens such as sputum, feces and urine, the relative proportions of microorganisms présent in vivo must be preserved, or culture results may be misleading. If specimens are handled properly, culture results are easier to interpret, patient care is improved, and costs are potentially [0001] 30 decreased.

-1 18628

[0004] Recently, an emphasis has been placed on guidelines for specimen handling to modify traditional practices to decrease or eliminate unnecessary work, increase laboratory efficiency, and make microbiological testing more cost-effective. It has been a long standing goal of medical science to develop rapid and accurate procedures for the [0001] 5 diagnosis of infectious disease to improve case finding, to reduce time for diagnosis and initiation of treatment, to improve disease surveillance, and hâve fewer patients dropping out of the diagnostic pathway. The laboratory diagnosis of enteric infections is particularly challenging. Problems include the number of potential pathogens, the biological diversity of these organisms, the emergence of new pathogens, intermittent shedding of some [0001] 10 pathogens, multiple specimens are submitted from the same patient, impracticality of testing of fresh specimens in most clinical settings (particularly in outpatient and remote settings), and the cost of transport of specimens to laboratories for culture and molecular diagnostic testing.

[0005] Expectorated sputum is the most commonly collected respiratory specimen for [0001] 15 bacterial cultures to detect the most frequent causative agent of TB, Mycobacterium tuberculosis (MTB). Because respiratory tract specimens will contain “contaminating” microorganisms, specimens should be collected and transported promptly to the laboratory to avoid overgrowth of non-pathogens. Traditionally, the delay between collection and culture inoculation should not exceed 7 days and specimens should be [0001] 20 refrigerated until they can be processed. Prompt transport, Processing and réfrigération help prevent the death of mycobacteria and the overgrowth of normal fast-growing flora in specimens, which otherwise complicate the recovery and détection of pathogens. Processing overgrown or putrefied specimens, if feasible, entails additional labour costs and réductions in culture sensitivity when sputum is stored at room température for longer [0001] 25 than 3 days (Parmasivan et al., 1983). Unless specimens are collected with utmost care and promptly transported to the laboratory under proper conditions, the advantages of culture will not be fully realized.

[0006] Proper sputum collection is critical for optimal results. Ideally, from a new patient, three specimens (2-10 mL each) should be collected in the early morning on consecutive [0001] 30 days and should be processed separately. The WHO recommends two early morning specimens and a third spot specimen when a patient visits the clinic. A réduction from three to two in the number of specimens to be examined for screening TB cases has already been accepted in places with high workloads and limited human resources, provided that quality assurance programmes are implemented.

-218628

[0007] Once received in the laboratory, these highly mucoid specimens must be liquefied and “decontaminated” prior to smear microscopy and culture. The standard procedure recommended by the Centers for Disease Control and Prévention (CDC) is the N-acetylL-cysteine (NALC)-sodium hydroxide (NaOH) procedure (PT Kent and GP Kubica; Public

[0001] 5 Health Microbiology, a Guide for the Level III Laboratory, CDC, Division of Laboratory Training and Consultation, 1985). NALC liquéfiés the mucoid specimen, while NaOH is bactericidal for contaminating/background bacteria and helps in liquéfaction. NaOH also kills mycobacteria, but to a much lesser extent. A “smear-positive” case is defined in patients with at least two initial sputum smear examinations (direct smear microscopy)

[0001] 10 positive for acid-fast bacilli (AFB+).

[0008] A definitive diagnosis of active tuberculosis rests upon the recovery and subséquent identification of the causative organism from a patient’s sécrétions, body fluids, or tissues. Since current culture methods require extended periods of time for completion (up to 42 days), initial management of the patient often is based upon the

[0001] 15 results of microscopie examination of the submitted clinical specimens. Specifically, démonstration of acid-fast bacilli (AFB) in a smear made from a clinical sputum specimen provides a preliminary diagnosis of mycobacterial disease, while the isolation of mycobacteria on culture provides a definite diagnosis of tuberculosis or similar disease due to mycobacteria other than M. tuberculosis (MOTT bacilli) or non-tuberculosis

[0001] 20 mycobacteria (NMT). While smear microscopy is currently the most widely used screening tool, considérable controversy exists regarding the prédictive value of this procedure. It is estimated that microscopy can miss two-thirds of culture-positive cases (Lipsky et al., 1984). As a conséquence, culture techniques still play a key rôle in the diagnosis of mycobacterial disease.

[0001] 25 [0009] The nature of both sputum specimens and the standard Processing method (NALC/NaOH) compromises the détection of MTB (Thornton et al., 1998). First, the specimens, as well as the solutions used to process specimens, can inhibit nucleic acid amplification. Most specimens contain large numbers of saprophytic and/or infectious microorganisms that interfère with culture methods; hence, a decontamination step is

[0001] 30 essential. However, decontamination is known to significantly compromise the viability of mycobacteria (Burdz et al., 2003; Krasnow and Wayne, 1966), and thus Processing lowers the sensitivity of détection by culture as well. Second, the innate nature of the disease produces low copy number and only intermittent shedding of the organisms. The third problem relates to the inhérent physiological nature of the mycobacteria itself which

-318628 includes i) aggregation, dumping, and cording; ii) surface tension caused by the waxy cell wall; iii) buoyancy (which ranges from 0.79 to 1.07, with an average below 1) (Silverstolpe, 1948); (iv) slow growth; and iv) a thick cell wall making Mycobacterium tuberculosis difficult to lyse. Together with the mucoid nature of sputum, these properties

[0001] 5 complicate the collection of mycobacteria by centrifugation causing inefficient sédimentation of these bacilli. Inevitably, some bacilli are poured off with the supernatant fraction following centrifugation. Ail methods approved by the CDC for preparing clinical specimens for détection involve a centrifugation step. The net effect is that mycobacteria are so scarce in processed sédiments that some aliquots hâve no target bacilli and the

[0001] 10 few microorganisms that are collected must be efficiently lysed or must be viable to compete with contaminating bacteria. Finally, the low copy number of MTB requires large specimen volumes, which in turn demands the concentration-decontamination step.

[0010] Several groups hâve tried to develop a method to preserve sputum specimens, so samples can be collected in remote areas and sent to larger centers for Processing. Holz

[0001] 15 et al. (2001 ) and Popov et al (2004) demonstrated that samples can be successfully frozen for up to 10 days before Processing. However, shipping frozen samples is costly and the method may not be feasible in remote and rural areas if liquid nitrogen is not available. Kelly et al. (2003) tested a more cost-effective method of shipping samples, i.e., fixation in formaldéhyde before Processing. However, this method requires significant

[0001] 20 changes in sample Processing methodology, increases the cost of Processing, and MTB organisms are no longer viable for the historical “gold” standard test, culture. Similarly, Dorman et al. (2010) used alcohol (50% (by volume) ethyl alcohol) to preserve induced sputum samples; again making MTB no longer viable for culture.

[0011] There remains a need for a collection method and compositions that can liquefy [0001] 25 sputum and retain the viability of MTB and other hardy microorganisms, while killing the background flora.

[0012] The above information is provided for the purpose of making known information believed by the applicant to be of possible relevance to the présent invention. No admission is necessarily intended, nor should be construed, that any of the preceding

[0001] 30 information constitutes prior art against the présent invention.

SUMMARY OF THE INVENTION

-418628

[0013] An object ofthe présent application is to provide a composition and method for stabilizing and maintaining the viability of hardy microorganisms. In accordance with an aspect of the présent application, there is provided a method for preserving viable hardy bacteria, such as Mycobacteria, Bacillus anthracis, Clostridium difficile or yeast, in a

[0001] 5 biological sample, comprising contacting the biological sample with a stabilization composition, wherein the stabilization composition comprises a chelating agent, a denaturing agent, a sait and has a pH between about 6 and about 11.

[0014] In accordance with another aspect of the application, there is provided a method for liquefying a biological sample comprising contacting the biological sample with a

[0001] 10 stabilization composition, where in the stabilization composition comprises a chelating agent, a detergent, a sait and has a pH between 6 and 11.

[0015] In accordance with another aspect of the application, there is provided a method for stabilizing the microbiome within a biological sample comprising contacting the biological sample with a stabilization composition, where in the stabilization composition

[0001] 15 comprises a chelating agent, a detergent, a sait and has a pH between 6 and 11.

[0016] In accordance with another aspect ofthe application, there is provided a method for characterization of bacterial nucleic acid in a biological sample, comprising:

contacting the biological sample with a stabilization composition, where in the stabilization composition comprises a chelating agent, a detergent, a sait and has a

[0001] 20 pH between 6 and 11; and amplifying the nucleic acid in the sample, wherein the level of amplified nucleic acid remains substantially unchanged if the amplification step occurs immediately after collection, or later.

[0017] In accordance with another aspect of the application, there is provided a [0001] 25 composition comprising: a chelating agent; a detergent; and viable hardy microorganisms.

BRIEF DESCRIPTION OF THE FIGURES

[0018] For a better understanding of the présent invention, as well as other aspects and further features thereof, référencé is made to the following description which is to be used

[0001] 30 in conjunction with the accompanying drawings, where:

-518628

[0019] Figure 1 is a photograph of the gel from Denaturing Gradient Gel Electrophoresis (DGGE) analysis of sputum stored at room température in BD2 buffer;

[0020] Figure 2 is a photograph of the gel from DGGE analysis of sputum stored at room température in BD3 buffer;

[0001] 5 [0021] Figure 3 is a photograph of the gel from DGGE analysis of sputum stored at 4°C following NaOH treatment;

[0022] Figure 4 graphically depicts the results from real-time PCR analysis of low, mid and high TB burdened sputum samples; and

[0023] Figure 5 graphically depicts the viability of B. anthracis spores following treatment [0001] 10 with Sample Transport Chemistry (STC).

[0024] Figure 6 is a photograph of the gel resuit for the t=2 days time point of the presence of M. tuberculosis from human saliva.

DETAILED DESCRIPTION

[0025] Unless defined otherwise, ail technical and scientific terms used herein hâve the [0001] 15 same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0026] As used in the spécification and daims, the singular forms “a”, “an” and “the” include plural references unless the context clearly dictâtes otherwise.

[0027] The term “comprising,” as used herein will be understood to mean that the list

[0001] 20 following is non-exhaustive and may or may not include any other additional suitable items, for example one or more further feature(s), component(s) and/or ingredient(s) as appropriate.

[0028] The term “sample” as used herein will be understood to mean any specimen that potentially contains a substance of interest, which is optionally a nucleic acid, protein or

[0001] 25 other biomolecule of interest. The term “sample” can encompass a solution, such as an aqueous solution, cell, tissue, biopsy, powder, solid, or population of one or more of the same. The sample can be a biological sample, such as saliva, sputum, buccal swab sample, sérum, plasma, blood, buffy coat, pharyngeal, nasal/nasal pharyngeal or sinus swabs or sécrétions, throat swabs or scrapings, urine, mucous, feces, rectal swabs,

-618628 lésion swabs, chyme, vomit, gastric juices, pancreatic juices, gastrointestinal juices, semen/sperm, uréthral swabs and sécrétions, cérébral spinal fluid, products of lactation or menstruation, egg yolk, amniotic fluid, aqueous humour, vitreous humour, cervical sécrétions or swabs, vaginal fluid/secretions/swabs or scrapings, bone marrow samples [0001] 5 and aspirâtes, pleural fluid and effusions, sweat, pus, tears, lymph, bronchial or lung lavage or aspirâtes, peritoneal effusions, cell cultures and cell suspensions, connective tissue, epithelium, épithélial swabs and smears, mucosal membrane, muscle tissue, placental tissue, biopsies, exudates, organ tissue, nerve tissue, hair, skin, nails, plants, plant extracts, algae, soil samples, environmental sample, sewage, wastewater, foodstuff, [0001] 10 meat-processing equipment swabs or the like.

[0029] The term “microorganism” as used herein, will be understood to mean any microscopie organisme and spores, including ail of the prokaryotes, namely the eubacteria and archaeabacteria, and various forms of eukaryote, comprising the protozoa, fungi (e.g., yeast), algae, and animais such as rotifers and planarians.

[0001] 15 [0030] The term “hardy microorganism,” as used herein, refers to microorganisms and spores that are generally résistant to standard lysis or nucleic extraction techniques, such as, one or more species of the Mycobacterium genus, one or more species of the M. tuberculosis complex, MDR strains of M. tuberculosis, one or more species of Clostridium, one or more species of Bacillus, such as Bacillus anthracis, and other

[0001] 20 microorganisms with hardy cell walls

[0031] The terms “Sample Transport Chemistry composition” and “STC composition,” as used herein, refer to compositions that are used to treat and/or store biological samples in order to maintain viability of hardy microorganisms that may or may not be présent in the biological samples.

[0001] 25 [0032] The présent application provides a composition and method for stabilizing hardy microorganisms in biological samples. The présent composition and method is also useful for liquefying viscous biological samples and/or for eliminating or minimizing growth of background bacterial flora in the biological samples during ambient température storage.

[0033] Sample Transport Chemistry

[0001] 30 [0034] The présent stabilization compositions comprise a sample transport chemistry (“STC”) mixture that has been found to function successfully in stabilizing hardy

-718628 microorganisms, such as Mycobacteria, in stored samples such that the hardy microorganisms remain viable for downstream clinical testing. In particular, the hardy microorganisms stored in the STC compositions are viable for culture under standard culture conditions even following storage at room température. The hardy

[0001] 5 microorganisms hâve been found to remain viable for later culture after storage at room température in an STC composition for 1 day or more, for 5 days or more, for a week or more. In one embodiment, the STC composition is useful for storing viable hardy microorganisms in a biological sample at room température for about a week. In this context, the hardy bacteria is understood to be “stabilized” if it remains viable for bacterial

[0001] 10 culture, as determined by the formation of colony forming units of the hardy bacteria under standard culture conditions.

[0035] The STC compositions of the présent application are aqueous compositions that comprise a chelating agent, a denaturing agent and a sait and hâve a pH between about 6 and about 11. Alternatively, the STC compositions of the présent application comprise a

[0001] 15 chelating agent, a denaturing agent, a sait and, optionally, a buffering agent that can be reconstituted by mixture with water, an aqueous solution, or a sample such that the pH of the final mixture is between about 6 and about 11.

[0036] The chelating agent is any Chemical that will form a stable complex with certain métal ions, sequestering the ions so that they cannot normally react with other

[0001] 20 components. A chelator can be, for example, ethylene glycol tetraacetic acid (EGTA), (2hydroxyethyl)ethylenediaminetriacetic acid (HEDTA), diethylene triamine pentaacetic acid (DTPA), nitrilotriacetic acid (NTA), ethylenediaminetriacetic acid (EDTA), cyclohexanediaminetetraacetic acid (CDTA), N,N-bis(carboxymethyl)glycine, citrate anhydrous, sodium citrate, calcium citrate, ammonium citrate, ammonium bicitrate, citric

[0001] 25 acid, diammonium citrate, ferrie ammonium citrate, lithium citrate, or any combination thereof. In one embodiment, the chelating agent is CDTA.

[0037] The denaturing agent is any Chemical that can cause proteins to lose their native secondary and/or tertiary structures. A denaturing agent can be, for example, an anionic detergent, (such as, for example, sodium dodecyl sulfate (SDS), lithium dodecyl sulphate,

[0001] 30 sodium lauroyl sarcosinate (SLS), sodium laureth sulphate (SLES)), a cationic detergent (such as, for example, cetyltrimethyl ammonium bromide (CTAB), which may be used in certain embodiments) or a nonionic detergent (such as, for example, Tween, Triton X, or Brij). In one embodiment, the denaturing agent is SDS.

-818628

[0038] In one embodiment, the STC composition comprises 2% SDS, 12.5 mM CDTA, 250 mM LiCI, 50 mM glycine and has pH 10.5. In an alternative embodiment, the STC butter comprises 4% SDS, 50 mM CDTA, 250 mM LiCI, 140 mM LiOH and has pH 6.8.

[0039] The STC composition additionally comprises a sait, which is preferably an

[0001] 5 inorganic sait. In one example, the sait is LiCI. In another example, the sait can be, for example, lithium bromide, lithium iodide, lithium acetate, or any combination thereof. In yet another example, the sait can be, for example, sodium borate, sodium bromide, sodium iodide, sodium iodate, sodium chloride, sodium fluoride, sodium acetate, sodium phosphate, sodium sulphate, or any combination thereof.

[0001] 10 [0040] The STC composition has a neutral or basic pH. In certain embodiments, the pH is in the range of from 6 to 11, for example, the pH of the STC composition can be about 6.8, or about 10.5. In order to maintain the pH, the composition can further comprise a buffering agent, such as glycine. Alternatively, the composition is adjusted to the appropriate pH using acid or base, such as LiOH.

[0001] 15 [0041] In one embodiment, the STC composition comprises 2% SDS, 12.5 mM CDTA,

250 mM LiCI, 50 mM glycine and has pH 10.5. In an alternative embodiment, the STC buffer comprises 4% SDS, 50 mM CDTA, 250 mM LiCI, 140 mM LiOH and has pH 6.8.

[0042] The présent application further provides compositions comprising the STC composition components, as defined above, and viable hardy bacteria from a sample, [0001] 20 such as a biological sample. In certain embodiments, the hardy bacteria is a

Mycobacteria, such as M. tuberculosis, Bacillus anthracis, optionally in the form of spores, or Clostridium difficile.

[0043] Transport and Storaqe Methods

[0044] The présent application further provides methods for storage of samples, such as [0001] 25 biological samples. The method is particularly useful for storage of biological samples such that they are stabilized in a form suitable for use in downstream clinical diagnostic tests. The downstream clinical diagnostic tests can be, for example, in vitro culture or molecular diagnostics, such as PCR-based diagnostics or sequencing. However, other diagnostic tests can be employed on samples stabilized using the présent STC

[0001] 30 composition.

-918628

[0045] The présent storage method comprises the step of mixing or contacting a biological sample with an amount of the STC composition. The resulting mixture can be stored at room température or ambient température or at a température within the range of from about 4°C to about 40°C. The amount of STC mixed with the sample can be

[0001] 5 varied to accommodate the needs of the user. For example, it can be varied based on the sample type and/or volume, the requirements of downstream analysis, convenience, etc. In one embodiment, the ratio of sample volume to STC composition volume ranges from about 5:1 to about 1:5. In a spécifie embodiment, the sample is mixed with an equal volume ofthe STC composition.

[0001] 10 [0046] Preferably, the storage method is performed at the time of sample collection to avoid the need for later treatment of the sample before analysis. In this way, the potential for contamination and/or the need for specialized sample Processing facilities are minimized. This can be achieved, for example, by providing the STC composition in a sample collection device.

[0001] 15 [0047] The présent inventors hâve determined that the présent storage method is useful in stabilizing the microbiome of a sample. Specifically, the STC composition functions to inhibit growth of the microorganisms in the sample, while retaining the hardy bacteria in the sample viable for future culture. In this way, researchers or clinicians are able to analyze a sample well after sample collection and détermine the microbial components

[0001] 20 and relative amounts of the microorganisms within a sample stored using the STC composition.

[0048] Accordingly, the présent application further provides a method for stabilizing the microbiome of a sample, comprising the step of mixing or contacting the sample with an amount of the STC composition, as defined above.

[0001] 25 [0049] Following treatment of a biological sample with the STC composition, the sample can be transported, stored, or analyzed using standard techniques as required by the user. In one embodiment, the microbiological nucleic acid in the sample is recovered or isolated from the sample. This can be done using standard techniques, or it can be done using a composition comprising an oxidizing agent and buffer, wherein the oxidizing

[0001] 30 agent is periodic acid, periodate or persulfate (as described in co-pending U.S. Provisional application no. 61/977,953, which is incorporated herein by référencé).

[0050] Liquéfaction of Hiqhlv Viscous Samples

-1018628

[0051] The présent application further provides a method for liquefying viscous, mucoid biological samples. Many biological, or bodily, samples are viscous. This can présent significant challenges to accurate diagnostic testing since the samples are difficult to process and since the analytes, bacteria, etc, may not be uniformly dispersed in such [0001] 5 viscous samples. Accordingly, it is particularly bénéficiai to hâve a method for sample Processing that can reduce the viscosity of the sample and improve the uniformity of distribution of the sample components within the sample.

[0052] Diagnostic procedures often require the analysis of biological samples such as body fluids. In particular, nucleic acid based diagnostic methods are becoming more and [0001] 10 more important. However, such methods generally require initial Processing of the biological sample which may be time-consuming, laborious, and associated with the risk of contamination. For example, the diagnosis of tuberculosis involves the analysis of highly viscous liquid biological samples such as sputum, pus, pleural fluid, gastric aspirate, endotrachéal aspirate, transtracheal aspirate, bronchoalveolar lavage, laryngeal [0001] 15 swab, and nasopharyngeal swabs, which are usually inhomogeneous mixtures of many different components of different Chemical and physical behavior. This can présent significant challenges to accurate diagnostic testing since the samples are difficult to process and since the analytes, bacteria, etc, may not be uniformly dispersed in such samples. It would be bénéficiai to hâve a method for sample collection that can reduce [0001] 20 the viscosity of the sample and improve the uniformity of distribution of the sample components within the sample.

[0053] Sputum consists of variable amounts of glycoproteins (mucins), saliva, immune cells, host tissue particles, released DNA, lipids, and proteins from lysed host tissue. Biochemical analyses hâve revealed that mucins MUC5AC and MUC5B secreted by cells [0001] 25 lining the respiratory tract are the major gel-forming polymer components of airway mucus. Cysteine domains présent on these mucins contribute to polymer formation and possibly interaction with neighboring mucin chains by disulfide bonding. Certain sputa can contain variable amounts of blood or residual food particles as contaminants. This results in a very extensive sample-to-sample variability of sputum composition ranging from [0001] 30 homogeneous to multi-phasic on the one side and liquid to highly viscous on the other side. Dépendent of the disease State of individual patients, sputa can furthermore contain inflammatory pathogens, and certain sample components can be extremely pronounced, e.g., blood contamination due to lung inflammation or elevated viscosity due to an extensive DNA release for cystic fibrosis or bronchitis patients.

-11 18628

[0054] Because of the extensive sample heterogeneity Processing of sputum samples such as DNA isolation from sputum for diagnostic purposes is rather challenging. For instance, accessibility and lysis of inflammatory pathogens can be less efficient if they are trapped in a solid and viscous environment.

[0001] 5 [0055] As noted herein, analysis of sputum samples is a standard diagnostic procedure for patients with suspected tuberculosis. The classical methods for diagnosis include examination of sputum smear under a microscope for acid-fast mycobacteria and microbiological analysis of cultured mycobacteria isolated from sputum, which is the current gold standard for identification of pathogens and résistances in tuberculosis

[0001] 10 diagnosis. In addition, some molecular tests hâve been developed. Generally, ail these diagnostic methods aiming at détection of mycobacteria in sputum samples require laborious sample Processing for decontamination and liquéfaction using enzymes such as proteases, lipases, DNases, or glycosidases, détergents, chaotropic agents, chelating agents, and reducing agents among others. Due to the high infection risk any treatment of

[0001] 15 tuberculosis suspected sputa requires an S3 environment with certified laminar flows and extensive protection measures to exclude any exposure of personnel to live bacteria. Thus, for molecular tests it would be of advantage to use sputum directly for nucleic acid diagnostics and circumvent the handling intensive decontamination and liquéfaction procedures.

[0001] 20 [0056] The présent inventors hâve surprisingly found that the STC composition functions to liquefy mucoid biological samples at much lower pH than used in NALC/NaOH, thereby improving the accuracy and/or ease of diagnostic testing, and enabling withdrawal of multiple uniform samples for a multitude of diagnostic tests (e.g. smear microscopy, culture, and molecular diagnostics).

[0001] 25 [0057] In one aspect, there is provided a method of liquefying a sample, such as a biological sample, comprising the step of mixing or contacting the sample with an amount of the STC composition. The resulting mixture can be stored at ambient température, or less. The amount of STC mixed with the sample can be varied to accommodate the needs of the user. For example, it can be varied based on the sample type and/or

[0001] 30 volume, the requirements of downstream analysis, convenience, etc. In one embodiment, the ratio of sample volume to STC composition volume ranges from about 5:1 to about 1:5. In a spécifie embodiment, the sample is mixed with an equal volume of the STC composition.

-1218628

[0058] Preferably, the method of liquefying the sample is performed at the time of sample collection to avoid the need for later treatment of the sample before analysis. In this way, the potential for contamination and/or the need for specialized sample Processing facilities are minimized. This can be achieved, for example, by providing the STC

[0001] 5 composition in a sample collection device.

[0059] Method for Nucleic Acid Détection

[0060] As noted above, molecular diagnostic methods are becoming more important in the arsenal of tools used by researchers and clinicians in analyzing patient samples to identify the presence or absence of potential pathogens. These molecular methods can [0001] 10 additionally be useful in quantifying the degree of infection when a pathogenic organism is présent. While, molecular diagnostic methods are generally quite sensitive, samples having low levels of pathogen présent can be difficult to accurately process to identify or quantify the pathogen présent, particularly when the pathogen is a hardy bacteria and/or the nucleic acid from the pathogen is not efficiently released or isolated from the sample.

[0001] 15 [0061] The présent inventors hâve surprisingly found that the STC composition functions to efficiently release nucleic acid. The inventors hâve shown that samples treated with the STC composition had DNA available in sufficient quantities to be tested for antibiotic résistance markers on Day 0 of testing. In contrast, the standard of care method required the samples to be cultured to generate sufficient bacteria to generate a positive resuit.

[0001] 20 [0062] Accordingly, the présent application provides a method for characterization of bacterial nucleic acid in a biological sample, comprising contacting the biological sample with a stabilization composition, where in the stabilization composition comprises a chelating agent, a detergent, a sait and has a pH between 6 and 11 ; and amplifying the nucleic acid in the sample, wherein the level of amplified nucleic acid remains

[0001] 25 substantially unchanged if the amplification step occurs immediately after collection, or later, and wherein the sample does not require culture prior to amplifying the nucleic acid.

[0063] Kit

[0064] Methods of the invention are conveniently practiced by providing the STC compositions used in such method in the form of a kit. Such a kit preferably contains the

[0001] 30 STC composition as a mixture of dry components or as an aqueous mixture.

-1318628

[0065] Optionally the kit includes a container, which contains the STC composition of the présent invention and that is suitable for sample collection. Examples of suitable containers are those, described in International PCT Application Nos. WO 03/104251 and WO 07/068094, each of which is incorporated herein by reference.

[0001] 5

[0066] To gain a better understanding of the invention described herein, the following examples are set forth. It should be understood that these examples are for illustrative purposes only. Therefore, they should not limit the scope of this invention in any way.

EXAMPLES

[0001] 10 [0067] EXAMPLE 1 : Ambient Température Stabilitv of Mycobacterium tuberculosisspiked Sputum Stored in Sample Transport Chemistry

[0068] One of the major goals for the global control of TB in humans is the laboratory diagnosis of M. tuberculosis, the causative agent of TB, followed by adéquate treatment. Difficulties involved in the collection, transport, and Processing of sputum specimens hâve

[0001] 15 been a major issue in current global TB control efforts. M. tuberculosis is présent in sputum specimens which are often contaminated by other fast growing microflora. The rapid growth of certain less clinically relevant species at ambient température can kill or overgrow medically important pathogens. Therefore, delays in either transport of specimens to the laboratory or availability of trained personnel or infrastructure to perform

[0001] 20 the Processing are problematic.

[0069] In high-burden countries, sputum acid-fast bacilli (AFB) microscopy services are not available in many healthcare facilities, which can force a substantial proportion of pulmonary TB patients to travel long distances to avail diagnostic facilities (Selvam et al., 2007). This lack of infrastructure results in the loss of many patients during treatment and

[0001] 25 means that infectious patients transmit infection within and outside their community. In order to prevent this, India’s DOTS-based Revised National Tuberculosis Control Programme (RNTCP), for instance, has recommended transportation of sputum specimens to microscopy centers. However, organization of such services is difficult for several reasons, including the fact that it nécessitâtes transportation of highly contagious

[0001] 30 sputum samples. Further, transfer of specimens to one centralized laboratory facility can be somewhat erratic and possibly affect microbiologie yield and integrity.

-1418628

[0070] Rapid loss of specimen integrity also présents a significant impediment to both international infectious disease research collaboration, as well as the study of pathogens in remote areas. It is very difficult to transfer a diagnostic specimen from a remote area to a more specialized laboratory and ensure diagnostic accuracy; this is especially relevant [0001] 5 given the potential for delays and température fluctuation during international shipping.

There exists a need in clinical diagnostics for a reliable method for the storage and transport of sputum and other biological samples such that pathogens can be identified, or quantified, even after significant storage and transport.

[0071] In developed countries, sputum samples are transported at 4°C to the laboratory [0001] 10 which adds significantly to overall costs. In many developing countries, due, in part, to cost and lack of infrastructure, sputum specimens are typically transported to laboratories at ambient température (i.e., no cold Chain maintenance). Even storage of sputum specimens at room température for more than 3 days is known to resuit in significant loss of culture viability and increased contamination rate (Paramasivan et al., 1983).

[0001] 15 Unfortunately, initial errors made by preliminary microscopie diagnosis may not be known until weeks later, when the clinical signs are more évident (in false négatives). As a resuit, several groups hâve tried to develop a method to preserve sputum samples to hâve them forwarded to larger centers for Processing. Holz et al (2001 ) and Popova et al (2004) demonstrated that samples can be successfully stored frozen for up to 10 days before

[0001] 20 Processing. Kelly et al (2003) and Dorman et al (2010) proposed fixation of sputum in formaldéhyde and alcohol, respectively, before Processing. However, ail these préservation methods can affect the viability of mycobacteria, impacting their subséquent growth and détection in culture media.

[0072] The présent inventors hâve developed a Chemical collection or transport

[0001] 25 composition that surprisingly stabilizes tough microorganisms in complex sputum specimens during transport and storage, while maintaining the viability of Mycobacteria for diagnostics utilizing smear microscopy, culture, and real-time or quantitative PCR (qPCR). Advantageously, the présent transport composition kills the majority of background microorganisms upon contact with sputum. In this example, attenuated

[0001] 30 Mycobacterium tuberculosis-spiked sputum samples were mixed with a sputum transport chemistry (STC) composition and stored at typical ambient températures (35°C, room température, and 4°C) for as long as 30 days prior to culture, DNA extraction and qPCR.

-1518628

	[0073] Experimental Method [0074] For the présent example, frozen raw sputum samples from healthy TB-negative patients were kindly donated by the Foundation for Innovative Diagnostics (FIND) Tuberculosis Specimen Bank. Using culture and smear analysis, FIND categorized the
[0001] 5	patient samples as ‘Smear négative, Culture négative.’ [0075] Préparation of Mycobacterium tuberculosis-soïked Bioloqical Samples [0076] Raw sputum samples, confirmed as TB-negative were shipped frozen from FIND. Sputum samples were thawed slowly on ice and pooled to form two 8 mL samples. To safely simulate tuberculosis-positive sputum, sputum was spiked with a moderate
[0001] 10	concentration of attenuated M. tuberculosis H37Ra (aMTB) at 5x106 colony forming units/mL (cfu/mL). One 8 mL pooled, spiked sample was split equally into three fractions, each fraction was mixed with an equal volume of BD2 buffer (2% SDS, 12 .5 mM CDTA, 250 mM LiCI, 50 mM glycine, pH 10.5) or Sample Transport Chemistry (STC), and then fractions were held at 4°C, 35°C or room température for up to 30 days. The second 8 mL
[0001] 15	pooled, spiked sample was not treated, i.e., left neat, split equally into three fractions, and then held at 4°C, 35°C or room température, for up to 30 days. [0077] At indicated time points (T=0, 7 days, 14 days and 30 days), aliquots were removed from the fractions stored at various températures. Aliquots were used to inoculate cultures, or DNA was extracted from aliquots utilizing 3 different méthodologies
[0001] 20	(Periodate, Guanidine thiocyanate, Bead-beating), and the extracted DNA was quantified using qPCR and Mycobacterium-spectfic primers. Ail aMTB-spiked fractions were stored at 35°C, 4°C and room température (RT) for 7,14, and 30 days prior to culture and qPCR. [0078] Culture Conditions for MTB-spiked Sputum Fractions
[0001] 25	[0079] At each time point, an aliquot (400 pL) from each of the fractions was isolated for culture. [0080] For BD2 buffer-treated fractions, 400 pL aliquots were centrifuged at 5,000 rpm for 20 minutes to pellet bacteria. Supernatants were discarded and pellets were resuspended in 400 pL stérile PBS, and vortexed until thoroughly mixed.

-1618628

[0081] For non-treated (NT) fractions, 400 gL aliquots were mixed with 200 gL fresh NaOH (2%)-NALC (0.5%)-citrate (1.45%) and incubated at room température for 15 minutes. 600 gL of stérile PBS was added to each tube and centrifuged at 5,000 rpm for 20 minutes. The supernatant was discarded and the pellet was resuspended in 400 gL

[0001] 5 stérile PBS, and vortexed until thoroughly mixed.

[0082] For BD2 buffer-treated and non-treated fractions, 100 gL of resuspended bacteria was then plated directly onto three LB plates using the spread plate method and incubated at 37°C. At approximately day 4, the number of colonies were counted.

[0083] Extraction of DNA from aMTB-spiked BD2 Buffer-Treated Sputum using the

[0001]	10	Periodate Method
		1. At each of the indicated times and températures (0, 7, 14, and 30 days at 35°C, 4°C and RT), a 400 gL aliquot from BD2 buffer-treated fraction was transferred to a fresh tube and centrifuged at 5,000 rpm for 20 minutes to pellet bacteria. 2. Supernatant was discarded and the pellet was resuspended in 400 gL BD2 buffer.
[0001]	15	3. Sodium (meta)periodate was added to a final concentration of 15 mM and vortexed to mix. 4. The mixture was incubated at 70°C in a water bath for 20 minutes. 5. Samples were cooled at room température for 2 minutes. 6. 1M Tris buffer (pH 7) was added to a final concentration of 50 mM.
[0001]	20	7. The mixtures were incubated at room température for 10 minutes. 8. 3M potassium acetate (pH 5.5) was added to a final concentration of 150 mM, vortexed to mix. 9. The mixtures were incubated on ice for 10 minutes and then centrifuged at 13,000 rpm for 5 minutes.
[0001]	25	10. The supernatant was transferred to a clean, labeled tube and the pellet was discarded.

-1718628

[0001] 5

[0001] 10

[0001] 15

[0001] 20

[0001] 25

11. Two volumes of room température 95% éthanol was added to the supernatant in the tube and the tube was inverted 20 times to mix.

12. The mixture was incubated at room température for 10 minutes to precipitate DNA and then centrifuged at 15,000 rpm for 2 minutes to pellet DNA.

13. The supernatant was gently removed and discarded taking care not to disturb the pellet.

14. The pellet was dissolved in 200 pL TE (the mixture was vortexed briefly to fully resuspend DNA).

[0084] Extraction of DNA from aMTB-spiked NT Sputum using Guanidine Thiocvanate Method

1. Freshly prepared and autoclaved 4% solution of sodium hydroxide (NaOH).

2. Freshly prepared and autoclaved 2.9% sodium citrate solution.

3. Equal volumes of the NaOH and sodium citrate solution were mixed and N-acetylL-cysteine (NALC) powder was added to achieve a final concentration of 0.5%; the solution was mixed well and used the same day.

4. At each of the indicated times and températures (0, 7, 14, and 30 days at 35°C, 4°C and RT), a 400 pL aliquot from the NT fraction was transferred to a fresh tube and 200 pL of the fresh NaOH-NALC-citrate was added; the tube was vortexed well to mix.

5. The mixture was incubated at room température for 15 minutes before adding 600 pL stérile PBS and centrifuging at 5,000 rpm for 20 minutes, to pellet bacteria.

6. The supernatant was discarded and 400 pL stérile PBS was added to the pellet; the tube was vortexed to mix.

7. The mixture was centrifuged at 5,000 rpm for 20 minutes to re-pellet bacteria.

8. The supernatant was discarded and the pellet was resuspended in 400 pL stérile PBS.

-1818628

9. Το 200 pL of resuspended pellet, 1 mL DNAzol Reagent (a guanidine thiocyanatedetergent lysing solution, Cat. No. 10503-027, Life Technologies) was added and the mixture was pipetted up and down to lyse the cells; then 0.5 mL of 100% éthanol was added and the tube was inverted 10 times to mix.

[0001] 5 10. The mixture was incubated at room température for 3 minutes and then

centrifuged at 14,000 rpm for 2 minutes to pellet DNA.

11. The DNA pellet was washed twice with 1 mL of 75% éthanol.

12. Ail traces of éthanol were removed and the DNA pellet was dissolved in 200 pL of

8 mM NaOH.

[0001] 10 [0085] Extraction of DNA from aMTB-spiked NT Sputum using “Bead-Beatinq” Method (“Standard of Care)

1.	At each of the indicated times and températures (0, 7, 14, and 30 days at 35°C, 4°C and RT), a 400 pL aliquot was transferred from the NT fraction to a fresh tube and 200 pL of fresh NaOH-NALC-citrate was added; the tube was vortexed well to
[0001] 15	mix.
2.	The mixture was incubated at room température for 15 minutes before adding 600 pL stérile PBS and centrifuging at 5,000 rpm for 20 minutes to pellet bacteria.
3.	The supernatant was discarded and 400 pL stérile PBS was added to the pellet; the tube was vortexed to mix.
[0001] 20 4.	The mixture was centrifuged at 5,000 rpm for 20 minutes to re-pellet bacteria.
5.	The supernatant was discarded and the pellet was resuspended in 400 pL stérile PBS.
6.	Two hundred pL of resuspended bacteria was heated at 80°C for 1-2 hours.
7.	Two hundred mg of 105-150 micron glass beads was added to the heated
[0001] 25	bacteria mixture.

-1918628

8. The mixture containing the glass beads was vigorously shaken for 2 cycles of 1 minute each using a Mini-BeadBeater™ (BioSpec Products); each cycle was followed by 1 minute on ice.

9. The sample was heated at 95°C for 2 minutes prior to PCR.

[0001] 5 [0086] rtPCR Conditions

[0087] In this example, DNA isolated from aMTB-spiked sputum aliquots was subjected to an rtPCR assay (qPCR) spécifie for Mycobacterium, the RD4 Taqman Real-time PCR assay. Primers for RD4 were as follows: RD4-forward 5-CCA CGA CTA TGA CTA GGA CAG CAA-3’ and RD4-reverse 5’-AAG AAC TAT CAA TCG GGC AAG ATC-3’ (Halse et [0001] 10 al. (2011)). Threshold cycle (C_t) values less than 37 were reported as positive, and samples with values greater than 37 were retested; if the results were the same, the resuit was reported as négative, and if they were not, they were reported as inconclusive.

[0088] Results and Discussion

[0089] Generally, in the standard of care (SOC) scénario, sputum specimens remain [0001] 15 untreated (NT) during collection and transport to the laboratory. Upon receipt in the laboratory, sputum undergoes liquéfaction and decontamination with the addition of NALC-NaOH-citrate, followed by culture. The présent example demonstrates that attenuated MTB remained viable to some degree in untreated sputum maintained at room température and 4°C for up to 30 days, but not when maintained at 35°C, since

[0001] 20 subséquent cultures showed no growth (NG) (Table 1 ).

[0090] When practising the method as described in the présent application, sputum specimens would ideally be mixed with Sample Transport Chemistry (e.g. BD2 buffer) at the point of collection, and maintained in this State throughout transport and storage, until processed at the laboratory. At no point would NALC-NaOH-citrate treatment be

[0001] 25 employed. Similar to NT sputum, this example demonstrated that aMTB remained viable in STC alone for at least 30 days at room température and 4°C (Table 1 ). Both methods, STC and NT, failed to support aMTB viability at 35°C for 7 to 30 days. It has been surprisingly found that STC can be added to sputum at the point of collection (T=0), to immediately liquefy specimens and eliminate or minimize growth of background flora, [0001] 30 before it has an opportunity to overtake the specimen, without negatively impacting the viability of the target organism, Mycobacterium, if présent, for at least 30 days.

-2018628

[0091] Table 1. Viability of Mycobacterium in culture

Collection & Transport Method/ Chemistry	Hold Temp	Viability in Culture After Hold Time
Day 0	Day 7	Day 14	Day 30
Sample Transport Chemistry	RT	V	V	V	V
4°C	V	V	V	V
35°C	V	NG	NG	NG
Standard of Care	RT	V	V	V	V
4°C	V	NG	V	V
35°C	V	NG	NG	NG

V: Viable aMTB with no contamination NG: No growth up to 42 days at 35°C

[0092] In aMTB-spiked sputum specimens collected and stored in STC at 35°C, 4°C and room température for up to 30 days, real-time PCR showed that the concentration of

[0001] 5 subsequently extracted aMTB DNA remained stable, irrespective of the storage température and time (see Table 2). Comparable to heat and physical disruption of aMTB with bead-beating, the periodate treatment was found to be equally effective at releasing functional, qPCR-quality DNA from attenuated Mycobacteria tuberculosis. In contrast, extraction using DNAzol (guanidine thiocyanate-detergent) treatment proved to be

[0001] 10 dramatically less effective than either periodate or bead-beating methods for releasing DNA. Notably, STC in combination with periodate increased the sensitivity ofthe Mycobacterium-specific assay by 1 log (3+ C_t values), compared to SOC method in combination with the DNAzol treatment. Hence, the standard NALC-NaOH-citrate laboratory procedure, followed by mechanical bead-beating, can be successfully

[0001] 15 substituted by STC, followed by periodate treatment during Processing of specimens in the laboratory. Importantly, STC can be mixed with sputum at the point of collection to control background flora without negatively impacting Mycobacterium viability.

[0093] Table 2. qPCR of DNA extracted from STC- and SOC-treated, aMTB-spiked sputum.

Collection & Transport Method/ Chemistry

Extraction/ Treatment

Hold Temp

ct, Day 0

Ct· Day 7

Ct, Day 14

Ct, Day 30

-21 18628

Collection & Transport Method/ Chemistry	Extraction/ Treatment	Hold Temp	c„ Day 0	Ct. Day 7	Ct, Day 14	Ct, Day 30
Sample Transport Chemistry (STC)	Periodate	35°C	25.74	24.93	25.3	25.94
4°C	25.77	25.63	25.54	25.74
RT	25.64	25.17	25.75	25.32
Standard of Care (SOC)	DNAzol (guanidine thiocyanatedetergent)	35°C	29.76	30.68	28.79	31.04
4°C	30.3	29.93	29.58	32.52
RT	29.72	29.24	31.11	30.74
Bead-beat	35°C	24.22	25.75	26.74	25.95
4°C	24.3	23.49	25.56	24.8
RT	24.19	24.07	25.32	26.32

[0094] EXAMPLE 2: Sample Transport Chemistry Liquéfiés Sputum upon Contact

[0095] Sputum from humans is used to diagnose tuberculosis and detect infection in

[0001] 5 cystic fibrosis patients. Bacteria are not uniformly distributed in such a highly viscous specimen, which poses a problem for the acid fast staining typically used to identify Mycobacteria. Remarkably, this technique for diagnosing tuberculosis has been found to hâve only about 50% sensitivity, i.e., there is an equal chance of detecting the presence of TB as not detecting it when the patient actually has the disease. This lack of sensitivity

[0001] 10 is due to the inability of existing sample préparation protocols to generate a sample in which the bacteria is uniformly distributed such that there is an equal probability of obtaining Mycobacteria for staining from any portion of the specimen. Hence, liquéfaction and homogenization of sputum specimens is critical to ensure accurate, représentative sputum cultures and molecular diagnostics.

[0001] 15 [0096] Liquéfaction is determined by a réduction in viscosity, the ability to easily pipette the sample, and the complété loss of dense clumps. A variety of mucolytic agents hâve been previously used to liquefy sputum specimens, including, for example, pancreatin, pancreatin-trypsin, and sodium 2-ethylhexyl sulphate (Tergemist), amylase, N-acetyl-Lcysteine (NALC), and dithiothreitol (DTT, Sputolysin) (Hammerschlag et al., 1980). NALC,

[0001] 20 which is one of the more popular liquefying agents, has appréciable inhibitory activity in vitro against Pseudomonas aeruginosa, the principal pathogen in the sputum of most

-2218628 cystic fibrosis (CF) patients. Also, cells that are incompletely released from mucus by these mucolytic agents tend to stain darkly, making correct identification difficult.

[0097] Surprisingly, during handling of mucoid sputum samples, the présent inventors observed that STC alone (BD2 buffer: 2% SDS, 12 .5 mM CDTA, 250 mM LiCI, 50 mM

[0001] 5 glycine, pH 10.5) was sufficient for sputum liquéfaction. A reducing agent, such as NALC or DTT, was not required and the degree of liquéfaction was comparable to that obtained using the current standard of care, 3.5% sodium hydroxide (NaOH) treatment method. Unlike NaOH-NALC-citrate, which needs to be made fresh every 12 to 24 hours, BD2 buffer is stable at room température for months. The Visual observation of liquéfaction

[0001] 10 was confirmed by analyzing high technical replicates for DNA yield using PicoGreen® fluorescent dye and a fluorometric method, as well as qPCR with primers spécifie for 16S rRNA gene.

[0098] Materials & Methods

[0099] In this example, two mL of sputum from a healthy donor was pooled and vortexed.

[0001] 15 An equal volume of BD2 buffer was added, mixed by inversion, and incubated at room température for 15 minutes. At this point, the sputum was completely fluidized. In orderto extract nucleic acid, sputum was treated with protéinase K (160 pg) and incubated at 50°C for 2 hours. Following this incubation, 10 x 200 pL aliquots were removed into fresh tubes as high technical replicates. To each 200 pL aliquot, 10 pL of 3M potassium

[0001] 20 acetate (150 mM final) was added and tubes were held on ice for 10 min. Following centrifugation at 13,000 rpm for 5 min, the supernatant was transferred to fresh tubes. DNA was precipitated with 2 volumes of room température 95% éthanol. After 15 minutes at room température, DNA was pelleted in a 2 minute centrifugation step at 13,000 rpm. The DNA pellet was dissolved in 100 pL ofTE buffer (pH 7.1).

[0001] 25 [00100] Fluorometric Détermination of DNA Concentration

[00101] DNA from 10 purified samples was quantified using PicoGreen®

Fluorescent dye (200x; Invitrogen, Cat. No. P7581 ); Lambda DNA (Invitrogen, Cat. No.25250-010) was used to generate a standard curve [in triplicate; 0-50 ng/pL], PicoGreen® is a fluorescent double-stranded DNA-binding dye (485 nm Excitation/535

[0001] 30 nm Emission) that enables sensitive quantitation of sub-nanogram amounts of doublestranded DNA (dsDNA). Aliquots of each purified sample and Lambda DNA standards were processed in a black flat-bottomed 96 well microplate (Greiner Bio-One, Cat. No.

-2318628

655209) and fluorescence was measured using an Infinité M200 microplate reader (TECAN).

[00102] rtPCR Conditions

[00103] DNA extracted from 10 sputum aliquots was subjected to an rtPCR assay [0001] 5 (qPCR) spécifie for 16S rRNA gene. Primers for 16S rRNA gene are as follows:

BacrRNA173-F 5-ATTACCGCGGCTGCTGG-3’ and BacrRNA173-R 5CCTACGGGAGGCAGCAG-3’. Each PCR reaction contained 2 pL template, 2.5 pL of 1 mg/mL bovine sérum albumin (BSA), 2.5 pL of 10x PCR Buffer, 1.25 pL of 50 mM MgCI₂, 0.5 pL of 10 mM dNTPs, 0.5 pL of 10 pMol forward primer, 0.5 pL of 10 pMol reverse

[0001] 10 primer, 0.5 pL of 0.5 pM Syto 9, 0.2 pL of 5U/pL Taq Polymerase, 12.3 pL of water. Highly purified DNA from E. coli served as a référencé for PCR analysis. Négative Controls included reactions in which no template DNA was added. The C_t value refers to the fractional cycle number at the point where the amplification curve crosses a threshold of détection. The Rotorgene instrument software set a threshold line and calculated the

[0001] 15 Ct values for each sample. Ct values are inversely proportional to the amount of DNA in a sample; a decrease in one Ct value corresponds to a doubling in the amount of DNA detected.

[00104] Results and Conclusions

[00105] Table 3. High technical replicate DNA yield from sputum.

Aliquot	DNA concentration (ng/pL)	ct value
1	54.68	15.10
2	65.04	15.40
3	66.13	15.40
4	62.23	15.30
5	71.03	15.20
6	63.30	15.30
7	68.40	15.40
8	67.43	15.20
9	67.53	15.30
10	71.73	15.20
Average:	65.75	15.28

-2418628

Aliquot	DNA concentration (ng/pL)	Ct value
Standard Déviation:	4.92	0.10
Médian:	66.78	15.30

[00106] Complété réduction of the viscosity of sputum is critical to reducing sampling error and increasing the accuracy of cultures. Expérimentation has shown that sputum was liquefied by the présent chemistry in ratios of 5:1 to 1:5 (sputum:STC).

[0001] 5 [00107] The présent example demonstrates that highly viscous sputum was completely liquefied by a single, 15 minute, room température treatment with an equal volume of STC. Each aliquot withdrawn from STC-treated sputum and analyzed was essentially identical in total DNA concentration, as shown by the PicoGreen fluorometric method (Table 3). This means that there is a uniform distribution of DNA (from any

[0001] 10 source) homogeneously distributed throughout the sample, which is indicative of liquéfaction. Also, qPCR using bacteria-specific primers indicated that each technical replicate contained the same amount of bacterial DNA. Hence, a brief exposure to STC was sufficient to uniformly distribute endogenous bacteria throughout the specimen.

[00108] The présent example demonstrates that STC can be generally mixed with [0001] 15 specimen at the point of sputum collection to generate a liquefied sample at collection.

However, STC can also be added to specimens in the laboratory priorto Processing (e.g., acid fast staining) or culture, to provide a liquefied sample at the time of testing.

[00109] The results herein further demonstrate that the STC composition and the method described herein did not compromise the integrity of the tests, while still ensuring

[0001] 20 the speed and accuracy necessary for implémentation in the field. This simple, rapid, inexpensive sputum sample Processing methodology can make available/accessible more Mycobacteria, when présent, for various détection méthodologies in both resourcerich and -poor settings, preventing further dissémination of disease.

[00110] EXAMPLE 3: Compatibility of Sample Transport Chemistry in Tuberculosis

[0001] 25 Diagnostics using Smear Microscopy, Culture and Molecular Diagnostic Assays

[00111] Globally, about 2 billion people are infected with the potentially highly infectious M. tuberculosis (“MTB”). Every year almost 9 million people develop active

-2518628

	disease, and 2 million people die of the illness. Given the infectious nature of MTB, fast and accurate diagnosis is an important element of MTB treatment and disease control. [00112] Four common first-line drugs used in anti-tuberculosis therapy are Isoniazid (INH), Rifampin (RIF), Ethambutol (EMB), and Pyrazinimide (PZA). MTB strains,
[0001] 5	however, can become résistant to one or more of the drugs, making cure difficult to achieve. RIF résistance is most commonly seen in multi-drug résistant (MDR-TB) strains and has a reported frequency of greater than 95% in such isolâtes (Morris et al, 1995). MDR-TB is defined as a tuberculosis disease caused by a bacterial strain that is résistant to at least INH and RIF. Résistance to RIF or other first-line drugs usually indicates the
[0001] 10	need for full susceptibility testing. [00113] In this example, an independent diagnostics laboratory, Ail India Institute of Medical Sciences (AIIMS, New Delhi, India), with access to human TB-positive sputum specimens, was engaged to compare side-by-side the current gold standard method for diagnosing M. tuberculosis from sputum to the présent invention in which raw sputum
[0001] 15	samples were collected into Sample Transport Chemistry (STC). Testing included 1) smear microscopy, 2) MGIT culture, 3) Cepheid GeneXpert® (PCR-based détection of M. tuberculosis and rifampin (RIF) résistance), and 4) laboratory developed multiplex PCR (LDMP) assay (Gopinath and Singh, 2009) for diagnosing Mycobacterium infections. [00114] The Xpert MTB/RIF Assay for use with the Cepheid GeneXpert System is a
[0001] 20	semi-quantitative, nested real-time PCR in vitro diagnostic test for the détection of 1 ) Mycobacterium tuberculosis complex DNA in sputum samples or concentrated sédiments prepared from induced or expectorated sputa that are either acid-fast bacilli (AFB) smear positive or négative; and 2) Rifampin-resistance associated mutations of the rpoB gene in samples from patients at risk for rifampin résistance.
[0001] 25	[00115] Experimental Method [00116] Processing of Raw Sputum Specimens and Four Diagnostic Tests [00117] Raw sputum samples were collected from six patients with confirmed TB or high probability of active infection with MTB. Specimens (s 4 mL) were manually split by pipette into 2 portions (2 mL each) and treated with an equal volume of freshly
[0001] 30	prepared 4% NaOH/O.5% NALC (gold standard) or STC (BD2 buffer composed of 2%

-2618628

	SDS, 12 .5 mM CDTA, 250 mM LiCI, 50 mM glycine, pH 10.5), priorto being evaluated by culture, AFB smear and two molecular diagnostic assays. [00118] Following the addition of either NaOH/NALC or STC, each portion was treated as follows:
[0001] 5	1. Mixtures were vortexed for 10-15 seconds. 2. Mixtures were allowed to stand for 15 minutes at room température; 20-25 minutes for highly mucoid samples. 3. Tubes were filled to 50 mL mark with phosphate buffer (pH 6.8), then inverted several times to mix thoroughly before centrifuging at 3,000-3,500 RCF for 15
[0001] 10	minutes. 4. The supernatant was carefully poured off and the pellet was resuspended in 1.25 mL stérile phosphate buffer, which was aliquoted as follows: a. Aliquot 1: 300 pL i. Added 300 pL of stérile phosphate buffer (600 pL total volume).
[0001] 15	ii. Acid-fast bacilli (AFB) Smear Examination ( 100 pL) 1. Performed smear according to established laboratory protocols. Smear was done prior to decontamination of sputum (Smear Direct) and after decontamination (DC) with either NaOH/NALC or STC (Smear DC). Smear scoring: 1 +
[0001] 20	dénotés a low positive sample, 2+ dénotés a moderate positive sample, 3+ dénotés a high positive sample. iii. BACTEC™ MGIT-960 Culture (500 uL) 1. Inoculated into BACTEC™ MGIT tubes under stérile conditions in biosafety cabinet type 2.
[0001] 25	2. Loaded inoculated MGIT-960 tubes in the BACTEC™ MGIT-960 System and growth was continuously monitored

up to 42 days in the fluorescence units and tubes flashed

-2718628

[0001] 5

[0001] 10

[0001] 15

[0001] 20

[0001] 25 positive after reaching a cut-off growth. Status of one MGIT culture was not reported.

b. Aliquot 2: 250 pL

i. Added 250 pL of stérile phosphate buffer (500 pL total volume).

ii. Laboratorv Developed Multiplex PCR (LDMP) assay

1. Followed AIIMS protocol for purifying DNA for analysis by LDMP assay (Gopinath and Singh, 2009).

2. Briefly, cell walls were lysed with lysozyme, followed by protéinase K digestion and sodium dodecyl sulphate treatment of proteins.

3. NaCI and hexadecyltrimethylammonium bromide were used to precipitate proteins and macromolecules.

4. Nucleic acids were recovered from aqueous phase after extraction with chloroform and isoamyl alcohol.

5. DNA was precipitated ovemight with isopropanol at -20°C.

6. Pellet was washed with éthanol and reconstituted with 50 pL of TE buffer; 10 pL was used in multiplex PCR.

7. In multiplex PCR (Gopinath and Singh, 2009), three primer sets were used, including Mycobacterium genus spécifie primers (hsp 65) (Telenti et al., 1993), M. avium complex spécifie (MAC) primers (Park et al., 2000) and a novel M. tuberculosis (MTB) complex-specific set of primers targeting cfp 10 or esat (Gopinath and Singh, 2009).

c. Aliquot 3: 300 pL

i. Added 300 pL of stérile phosphate buffer (600 pL total volume).

ii. Cepheid Xpert MTB/RIF Assay

-2818628

1. Added 1.8 mL Cepheid SR buffer (1:3 ratio).

2. Tested according to Cepheid GeneXpert® MTB/RIF Assay for Sputum Sédiments (Protocol H.1).

[0001] 5

3. GeneXpert real-time PCR gives 2 results: 1 ) M. tuberculosis Positive/Negative, and 2) rifampin (RIF) antibiotic Sensitivity or Résistance (Sens/Res) (Table 4).

d. Aliquot 4: 250 pL

	i. Transferred 250 pL of sample to a 2 mL spin tube. ii. Added 250 pL of STC (500 pL total volume).
[0001] 10	iii. DNA extraction protocol for STC-treated samples: 1. Added sodium (meta)periodate to a final concentration of 30 mM; vortex to mix. 2. Incubated at 70°C for 20 minutes; cooled samples to room température.
[0001] 15	3. Added 1M Tris buffer (pH 7) to a final concentration of 50 mM; vortexed to mix. 4. Added 3M potassium acetate (pH 5.5) to a final concentration of 150 mM; vortexed to mix. 5. Incubated on ice for 10 minutes.
[0001] 20	6. Centrifuged at 13,000 rpm for 5 minutes. 7. Transferred supernatant to a clean, labelled tube. Discarded pellet. 8. Added 2 volumes of room température 95% éthanol. 9. Inverted 20 times to mix.

10. Incubated samples at room température for 15 minutes.

-29[0001] 25

11. Centrifuged at 15,000 rpm for 2 minutes to pellet DNA.

12. Gently removed and discarded supernatant taking care not to disturb the pellet.

13. Dissolved the pellet in 100 pL of TE.

[0001] 5 14. Vortexed briefly and let stand at room température for at least 30 minutes.

15. Stored purified DNA at room température or -20°C.

[00119] Results and Conclusions

[00120] Brief exposure of sputum specimens to STC successfully liquefied and [0001] 10 decontaminated specimens from ail 6 patients tested (Table 4) at a level approximately équivalent to that obtained using NaOH/NALC treatment. Following decontamination with NaOH/NALC or STC, inoculated cultures subsequently showed no signs of contamination, indicating that STC was equally effective at killing background microflora in clinical specimens.

[0001] 15 [00121] Smear analysis produced the same diagnostic resuit (1+ to 3+), independent of the decontamination method (Table 4), indicating that STC didn’t alter the acid-fast staining properties of Mycobacteria. Hence, standard laboratory practices for detecting Mycobacteria by microscopy can be readily applied using sputum specimens collected directly into STC.

[0001] 20 [00122] Mycobacteria were cultured from ail 6 patient samples following the liquéfaction and decontamination of sputum with NaOH/NALC or STC. STC did not adversely impact the viability of Mycobacteria in culture and the results obtained were comparable to those obtained using conventional NaOH/NALC treatment (Table 4).

[00123] Molecular diagnostic test results were also équivalent for NaOH/NALC and [0001] 25 STC treated patient samples. Nested real-time PCR analysis using the Cepheid GeneXpert® System indicated that ail 6 patients were positive for Mycobacterium tuberculosis and sensitive to rifampin (Table 4). Al IMS Laboratory Developed Multiplex PCR assay confirmed the 6 patients were in fact positive for M. tuberculosis at the genus and species level, as well as négative for Mycobacterium avium complex (Table 4). STC

-3018628 treated sputum samples were also compatible with Al IMS established TB testing algorithm, a LDMP assay in which nucleic acids were recovered from specimens using a standard chloroform/isoamyl alcohol purification method.

[00124] The présent example demonstrates that raw sputum specimens liquefied

[0001] 5 and decontaminated with STC can be used successfully in standard diagnostic methods for détection and characterization of mycobacterial infection, using the full suite of current méthodologies, including culture, microscopical identification of acid-fast bacilli (AFB) and molecular diagnostic tests. These STC treated samples can also be used in PCR-based tests used for the aetiological mycobacterial species in order to administer the

[0001] 10 appropriate therapy and for better patient management.

[00125] Table 4. Culture, AFB Smear and Molecular Diagnostic Assay Results for M. tuberculosis

Sample #	Sputum Treatmen t Method	AFB Smea r Direct	AFB Smea r DC	MGIT Culture Status	Cephei d Xpert MTB	Cephei d Xpert RIF	AIIMS DNA Extraction & LDP Assay (hsp/esat/MAC)
1	NaOH/ NALC	1 +	1 +	Pos	Pos	Sens	+/+/-
STC	1 +	1 +	Pos	Pos	Sens	+/+/-
2	NaOH/ NALC	1 +	1 +	Pos	Pos	Sens	+/+/-
STC	1 +	1 +	Pos	Pos	Sens	+/+/-
3	NaOH/ NALC	1 +	1 +	Pos	Pos	Sens	+/+/-
STC	1 +	1 +	Pos	Pos	Sens	+/+/-
4	NaOH/ NALC	3+	3+	Pos	Pos	Sens	+/+/-
STC	3+	3+	Pos	Pos	Sens	+/+/-
5	NaOH/ NALC	2+	2+	Pos	Pos	Sens	+/+/-
STC	2+	2+	Not reporte	Pos	Sens	+/+/-

-31 18628

				d
6	NaOH/ NALC	1 +	1 +	Pos	Pos	Sens	+/+/-
STC	1 +	1 +	Pos	Pos	Sens	+/+/-

[0001] 5

[0001] 10

[0001] 15

[0001] 20

[00126] EXAMPLE 4: Sputum Microbiome is Stable in Sample Transport Chemistry

[00127] In the présent example, the Sample Transport Chemistry (STC) compositions were mixed with raw, pooled sputum (TB-free) to assess liquéfaction and decontamination of sputum, as well as stability of the endogenous microbiome with prolonged storage at room température. As a control for the industry standard use of sodium hydroxide in standard sputum decontamination/liquefaction procedures, sputum was also stored long-term following a brief treatment with sodium hydroxide.

[00128] Experimental Method

[00129] Treatment of Sputum Specimens

[00130] Three TB-negative sputum specimens (kindly donated by FIND Tuberculosis Specimen Bank) were pooled and split evenly into three 1 mL aliquots. An equal volume of BD2 buffer (2% SDS, 12.5 mM CDTA, 250 mM LiCI, 50 mM glycine, pH 10.5), BD3 buffer (4% SDS, 50 mM CDTA, 250 mM LiCI, 140 mM LiOH, pH 6.8) and sodium hydroxide (NaOH, 3.5%) was added to the three sputum aliquots and mixed. Within 15 minutes at room température, ail three mixtures were equally liquefied, where liquéfaction was qualitatively determined by a réduction in viscosity, the ability to easily pipette the sample, and the complété loss of dense clumps.

[00131] The NaOH-treated aliquot was pelleted by centrifugation (3,000 rpm for 15 minutes), supernatant was discarded, and the pellet was brought up in PBS and stored at 4°C for up to 28 days. BD2- and BD3-treated sputum samples were maintained at room température (15-25^OC) for up to 28 days in a biosafety cabinet.

[00132] DNA Purification

-3218628

1. At Ο, 1, 7, 21 and 28 days post-treatment (above), 200 pL aliquots from each mixture were pulled for purification of DNA.

2. 81 mg of Protéinase K was added to each aliquot and incubated ovemight at 50°C.

[0001] 5	3.	Each of these aliquots were split into two 100 pL aliquots, one for extraction including sodium (meta)periodate (NPI) and the other without NPI.
	4.	To the +NPI aliquot, NPI was added to a final concentration of 15 mM, incubated
		at 70°C for 20 minutes, and cooled at room température.
	5.	1 M Tris pH 7.1 was added to ail samples to a final concentration of 100 mM;
[0001] 10		incubated at room température for 5 minutes.
	6.	Added 3 M potassium acetate to ail samples to a final concentration of 150 mM.
	7.	Incubated on ice for 10 minutes.
	8.	Centrifuged at 13,200 rpm for 5 minutes; transferred supernatant to a fresh tube
		and discarded the pellet.
[0001] 15	9.	Added 2 volumes of room température 95% éthanol to supernatant.

10. Incubated at room température for 15 minutes.

11. Centrifuged at 13,200 rpm for 2 minutes; discarded the supernatant.

12. Resuspended the DNA pellet in 50 pL TE buffer (pH 7.1).

[00133] Denaturino Gradient Gel Electrophoresis

[0001] 20 [00134] To accurately and reproducibly evaluate the stability of the sputum microbiome in the présent compositions, a relatively new method called Denaturing Gradient Gel Electrophoresis (DGGE) was utilized. This method is based on the idea that if one takes a variable région of the bacterial 16S rRNA gene (in this case the V3 région) and amplifies it using PCR and primers on the flanking conserved région, that amplicons

[0001] 25 will hâve a melting point unique to the species of bacteria (even single nucléotide différences will affect the melt and thus give a different profile).

-3318628

[00135] When this method is applied to a sample containing multiple species of bacteria, the amplification using conserved primers will resuit in an array of amplicons, ail of which are roughly the same length, but hâve a different nucléotide make-up in the nonconserved area. Next, these amplicons are run on a gel that contains a gradient of

[0001] 5 denaturing solution (urea and formamide). The amplicons will dénaturé at different stages on the gel, depending on their nucléotide make-up, thus giving a resolution of ail the species that were présent in the sample.

[00136] In order for the DNA amplicons to not dénaturé to single-stranded form, a -30 nucléotide CG clamp was added to the forward primer which retards the migration of [0001] 10 the amplicons on the gel once the variable section has denatured. In general, a 40%-60% denaturing gradient on the gel provides good resolution of the bands, while capturing most of the sputum species. The gel is run at a constant 55°C in order to facilitate denaturing of the amplicons and also keep the gel at equal température throughout the run.

[0001] 15 [00137] PCR-DGGE was carried out according to the procedure described below.

[00138] PCR Amplification for DGGE (usina 16S Primers with 5’clamp on forward primer)

a. 2 pL of 10 ng/pL purified DNA was added into 12-strip PCR tubes.

b. Master Mix was prepared (98 pL/reaction): 76.7 pL water, 10 pL 10xPCR Buffer, 4 [0001] 20 pL 50 mM MgCI₂, 2.5 pL 10 mM dNTPs, 2 pL 10 pmol Rev Primer (PPUN518R, 5'ATTACCGCGGCTGCTGG -3'), 2 pL 10 pmol Fwd Primer (PRBA338F, 5'CGCCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGG CAGCAG-3'), and 0.8 pL 5 U/pL Taq.

c. 98 pL master mix was added to each tube.

[0001] 25 d. PCR was run on conventional PCR machine: 1 cycle at 92°C for 2 minutes; 28 cycles at 92°C for 60 seconds, 55°C for 30 seconds, 72°C for 60 seconds; followed by 1 cycle at 72°C for 6 minutes.

[00139] DGGE of PCR Amplicons

-3418628

	a. Stock solutions were prepared for an 8% Acrylamide/Bis gel in 40% and 60% denaturing solutions: __________________40%_______60%_______ 40% Acrylamide/Bis 20 mL 20 mL 50x TAE Buffer 2 mL 2 mL Formamide (deionized) 16 mL 24 mL Urea 16.8 g 25.2 g ddH2O UptolOOmL UptolOOmL b. The glass plates and spacers were assembled according to the instruction
[0001] 5	booklet for the DCode System (Bio-Rad). c. To préparé and pour an 8% Acrylamide/Bis gel with a parallel gradient using 40% and 60% denaturing solutions, the following procedure was used: • 20 mL of 40% and 60% denaturing solutions were measured into 2 separate beakers labeled “low density” and “high density,” respectively.
[0001] 10	• 200 pL of 10% ammonium persulfate (APS) was added to each solution. • 20 pL of TEMED was added to each solution. • The solutions were mixed well by swirling. • Each solution was filled into a separate 20 mL syringe. • The syringes were attached to the gel loading apparatus where specified “low
[0001] 15	density” or “high density” for top filling. • Note: The volume adjustment settings for a 16 x 16 cm gel with 1.0 mm spacers was 18.5 mL. • The Y tubing was attached to each of the syringes, with a needle on the other end of the tubing.
[0001] 20	• The needle was placed between the glass plates.

-3518628

	• The gel was poured slowly and consistently by turning the wheel so that the gradient had time to even out. • The gel was allowed to polymerize for a few hours. d. The gel running System was pre-heated with 1xTAE buffer to 55°C.
[0001] 5	e. 8 pL of Fermentas 6x loading dye was added to 42 pL of PCR product. f. The gel was run for 5 minutes at 200 V before turning on the recirculation pump in order to get the samples out of the wells and into the gel. g. The gel was run for 14 hours at 70 V with the recirculation pump on. h. The gel was stained in 1x Sybr Gold for 30 minutes (250 mL 1xTAE + 25 pL
[0001] 10	10,000x SybrGold). i. The gel was destained in 1xTAE for 5 minutes. j. Images were taken under UV light. [00140] 16S rRNA gene PCR was performed using universal primers (V3 région) followed by DGGE using the DCode Universal Mutation Détection System (Bio-Rad).
[0001] 15	[00141] Results and Conclusions [00142] Similar to the standard NaOH treatment, sputa mixed with the présent STC compositions (BD2 and BD3 buffer) were rapidly liquefied at room température. By Visual inspection and handling, the mixtures were reduced in viscosity, easy to pipette, and no dense clumps remained. However, unlike NaOH treatment, which is restricted to a brief
[0001] 20	15-20 minutes to avoid killing mycobacteria, sputum can be collected and stored in the STC compositions for days and weeks at room température without negatively impacting the ability to culture Mycobacteria (see example 1 and 5). [00143] At day 0, DGGE analysis of bacterial 16S rRNA gene représente the microbiome, or varied population of bacteria, présent in this pooled sputum sample at the
[0001] 25	point of collection (Figures 1-3). Over the course of 28 days, the banding pattern resulting from BD2- (Figure 1 )/BD3-(Figure 2) treated or NaOH- (Figure 3) treated sputa remained substantially stable, indicating that these mixtures were bacteriostatic at room

-3618628

I température and 4°C, respectively. For BD2-/BD3-treated sputa, no new bands appeared over time and band intensities remained constant, irrespective of the purification method (+/- NPI) employed.

[00144] The number of bacterial 16S rRNA gene bands from both BD2 and BD3[0001] 5 treated sputa were very similar, indicating that both examples of STC compositions preserved bacteria or bacterial DNA to a similar extent during this time period (Figure 1 and 2). Interestingly, the DGGE banding pattern resulting from NaOH-treated sputum (Figure 3) was not identical to that of BD2-/BD3-treated sputa. There were fewer 16SrRNA gene bands resulting from NaOH-treated sputum suggesting a réduction in the

[0001] 10 diversity of bacterial species. In addition, minor différences in band intensities were noted with DNA purification utilizing NPI following NaOH treatment. It appears that DNA was degraded in the denaturing conditions associated with NaOH treatment and subséquent storage in PBS or the conditions for DNA purification were not idéal.

[00145] EXAMPLE 5: Live M. tuberculosis Recovered From Sputum Treated with [0001] 15 STC for Up to One Week

[00146] Sputum transport chemistry (STC) compositions hâve been found to be successful in liquefying sputum, decontaminating background flora and stabilizing total nucleic acid in the specimen, without killing Mycobacteria présent in the specimen. These bénéficiai properties of the présent STC composition and method provide flexibility to

[0001] 20 testing laboratories. Specimens treated with STC compositions can be collected in remote régions, transported inexpensively to a laboratory under ambient conditions, and still be successfully and accurately evaluated by the currently accepted méthodologies for raw sputum analysis, including culture, smear microscopy and molecular diagnostic assays. This example provides a démonstration of the time window in which

[0001] 25 Mycobacteria remain viable in the STC composition at room température.

[00147] Experimental Methods

[00148] Treatment of Sputum from Cvstic Fibrosis Patients

[00149] Raw clinical sputum samples from Cystic Fibrosis (CF) patients (kindly provided by Dr. M Desjardins, The Ottawa Hospital, Ontario, Canada) were held at 4°C

[0001] 30 for up to 1 week. Sputa (3 mL each) were spiked with 3.3x10⁶ colony forming units (cfu) of a clinical strain of virulent M. tuberculosis (isolated from a confirmed-positive TB

-3718628 patient). Spiked sputum was mixed with an equal volume of BD2 buffer, inverted 5-10 times and left at room température in a biosafety cabinet up to 7 days. After 24 hours and 7 days at room température, samples were vortexed for 10 seconds and centrifuged at 3,000 x g for 15 minutes to sédiment the bacterial pellet. The supernatant was poured off

[0001] 5 and the pellet was resuspended in stérile water. Aliquots were inoculated into multiple MGIT culture tubes (with PANTA/Growth Supplément) and grown at 35°C up to 23 days.

[00150] Results and Conclusions

[00151] TB-spiked sputum held for 24 hours in BD2 buffer prior to inoculation into MGIT tubes showed positive TB growth within 7 days and there was no evidence of

[0001] 10 contamination of these cultures by background flora. TB-spiked sputum held for 7 days in BD2 buffer prior to inoculation into MGIT tubes showed positive TB growth within 21-23 days and there was no evidence of contamination by background flora. The results demonstrate that treatment of clinical sputum samples with BD2 buffer was highly effective at eliminating growth of background flora, while maintaining the viability of

[0001] 15 virulent M. tuberculosis following storage of the STC-treated samples for up to one week. The increased time to positive culture resuit of samples exposed to BD2 buffer for one week, suggested that some mycobacteria were killed and/or growth was inhibited by the longer term storage at room température in the STC composition. Nonetheless, the sample did retain sufficient viable mycobacteria to provide a positive culture test even

[0001] 20 after long-term storage.

[00152] EXAMPLE 6: Sample Transport Chemistry Method Compared to Standard of Care Method for Molecular Détection of Mycobacterium Tuberculosis

[00153] The CDC recommends that clinical specimens be analyzed simultaneously by culture, acid-fast bacillus (AFB) staining, and nucleic acid amplification protocols

[0001] 25 (CDC, 2009). Culture is the “gold standard” for final détermination of TB positivity, but it is slow and can take up to 8 weeks. Staining for AFB is rapid, but has a low sensitivity and low specificity, since it does not distinguish non-tuberculosis mycobacteria (NTM) from members of the M. tuberculosis complex (MTBC). Thus, rapid identification, which is essential to control spread of disease, relies on nucleic acid amplification protocols, such

[0001] 30 as real-time PCR (qPCR) and sequencing.

[00154] The assessment of antibiotic résistance in M. tuberculosis-mfected patients is critically important to patient management and controlling the spread of

-3818628

	disease. Standard methods for drug susceptibility testing (DST) of M. tuberculosis can take weeks to months to provide results. Due to the emergence of multidrug-resistant tuberculosis (MDR-TB) and extensively drug-resistant tuberculosis (XDR-TB), rapid molecular approaches hâve been developed. Mutations within rpoB gene are associated
[0001] 5	with rifampin (RIF) résistance, while mutations within inhA gene are associated with Isoniazid résistance. Halse et al. (2010) developed a two-step molecular approach that utilized antibiotic résistance gene pyrosequencing analysis directly with clinical specimens positive for MTBC by real-time PCR. [00155] In this example, an independent public health diagnostics laboratory,
[0001] 10	Wadsworth Center Mycobacteriology Laboratory, was engaged to compare side-by-side the clinical évaluation of TB-positive sputum samples (kindly donated by Foundation for Innovative Diagnostics (FIND) Tuberculosis Specimen Bank) treated by two distinct methods. Specifically, 1 ) the “Standard of Care” method, consisting of sodium hydroxide treatment followed by bead beating, and 2) the présent method, were compared in terms
[0001] 15	of sensitivity in a CLIA/CLEP-approved rtPCR assay (targeting the RD4 Mycobacterium tuberculosis complex (MTBC) région of différence (RD)) (Halse et al., 2011 ) and antibiotic résistance gene pyrosequencing assay (Halse et al., 2010). In the présent method, TBpositive sputum samples were treated with an STC composition to facilitate liquéfaction and Chemical lysis of cells in the specimen, prior to isolation of DNA and assay testing.
[0001] 20	[00156] In contrast to the use of the STC composition, the “Standard of Care” method includes bead beating, a mechanical method, to break open bacteria in sputum samples. While mechanical bead beating can be effective at breaking open organisms, it does create dangerous aérosols in the laboratory environment. It is, therefore, highly désirable to develop an effective, non-mechanical, Chemical method to safely release
[0001] 25	DNA from Mycobacterium tuberculosis, without negatively impacting the clinical sensitivity of the diagnostic tests. [00157] Experimental Method [00158] Confirmation of viability of Mycobacterium tuberculosis-positix/e Sputum Samples
[0001] 30	[00159] For the présent example, raw sputum samples from confirmed TB-positive patients were kindly donated by the Foundation for Innovative Diagnostics (FIND) Tuberculosis Specimen Bank. Duplicate 0.5 mL aliquots were provided from 30 patient

-3918628 samples and stored frozen. Using culture and smear analysis, FIND categorized these samples as follows (Table 5).

[00160] Table 5. Categorization of TB-Positive Sputum Specimens from FIND

FIND Category Description	DNA Genotek Description	No. of Duplicate Sputum Specimens
Smear négative, Culture positive	LOW	10
Smear positive 1+, Culture positive	MID	10
Smear positive, Culture positive	HIGH	10

[0001] 5 [00161] Aliquots were shipped frozen to Wadsworth Center Mycobacteriology

Laboratory (New York State Department of Health, Albany, New York, U.S.A.), a CLIA/CLEP-approved Clinical Laboratory for further analysis. Sputum Processing, DNA extraction, rtPCR assay and pyrosequencing was conducted by Wadsworth Center Mycobacteriology Laboratory. Upon arrivai at Wadsworth, duplicate aliquots from 30

[0001] 10 donors were thawed on ice; one set of aliquots was processed using the “Standard of Care” Method (Collaborator) and the second set was treated with an STC composition prior to isolation of DNA.

[00162] Treatment of TB-positive Sputum using the “Standard of Care’’ Method (Collaborator)

[0001] 15	1.	0.5 mL 3.5% NaOH was added to liquefy each 0.5 mL sputum aliquot (n=30); the aliquot was vortexed to mix the NaOH.
	2.	The mixture was incubated at room température for 15 minutes.
	3.	The volume of the mixture was brought up to 10 mL with stérile phosphatebuffered saline (PBS).
[0001] 20	4.	The mixture was centrifuged at 5,000 rpm for 20 minutes to pellet bacteria and the supernatant was discarded.
	5.	The pellet was resuspended in 0.5 mL stérile PBS.

-4018628

6. 300 μι of resuspended bacteria was set aside for smear and culture testing to confirm viability of Mycobacterium (see Table 7).

7. To lyse bacteria, 200 mg of 105-150 micron glass beads were added to the remaining 200 pL of resuspended bacteria, followed by two 1 minute cycles of and [0001] 5 bead beating and 1 minute on ice using a Mini-BeadBeater (BioSpec Products).

[00163] Treatment of TB-positive Sputum using Sample Transport Chemistrv (STC) Method

1.	0.5 mL of BD2 buffer (2% SDS, 12 .5 mM CDTA, 250 mM LiCI, 50 mM glycine, pH 10.5) was added to each 0.5 mL sputum aliquot (n=30), which was then vortexed
[0001] 10	to mix.
2.	Protéinase K (400 pg) was added and the mixture was incubated at 50°C in a water bath for 2 hours.
3.	400 pL of the mixture was transferred to a fresh tube and 3M potassium acetate (pH 5.5) was added to a final concentration of 150 mM.
[0001] 15 4.	The mixture was incubated on ice for 10 minutes and then centrifuged at 13,000 rpm for 5 minutes.
5.	The supernatant was transferred to a clean, labeled tube and the pellet was discarded.
6.	Two volumes of room température 95% éthanol were added to the collected
[0001] 20	supernatant and the tube was inverted 20 times to mix.
7.	The samples were incubated at room température for 15 minutes to precipitate DNA and then centrifuged at 15,000 rpm for 2 minutes to pellet DNA.
8.	The supernatant was gently removed taking care not to disturb the pellet.
9.	The pellet was dissolved in 200 pL TE, vortexed briefly to fully resuspend DNA,
[0001] 25	and allowed to stand at room température for a minimum of 30 minutes.

[00164] Real-time PCR for M. tuberculosis and Pyrosequencing for Antibiotic Résistance

-41 18628

[00165] Duplicate reactions of 5 pL ‘neat’ DNA and 5 pL diluted (1:10) DNA from each purified sputum sample (above) were amplified on an ABI 7500 real-time PCR instrument using a CLIA/CLEP-approved real-time PCR assay targeting the RD4 Mycobacterium tuberculosis complex (MTBC) région of différence (RD) (Halse et al., [0001] 5 2011 ). Threshold cycle (C_t) values less than 37 were reported as positive, and samples with values greater than 37 were retested; if the results were the same, the resuit was reported as négative, and if they were not, they were reported as inconclusive.

[00166] Antibiotic résistance profiling was done using the previously published pyrosequencing method for rifampcin résistance (rpoB) (Halse et al, 2010) and an [0001] 10 additional target for isonazid résistance (inhA). DNA obtained from both methods was used in separate PCR reactions to amplify spécifie régions of the rpoB and inhA genes. Mutations in these régions indicate probable résistance to either rifampcin and/or isonazid antibiotics.

[00167] Results and Discussion

[0001] 15 [00168] Today, the standard of care method involves liquéfaction of sputum with sodium hydroxide, followed by isolation of DNA from bacteria using mechanical bead beating. The Chemical method employed in the présent example is completely different in that the BD2 buffer (an STC composition) functions to liquefy sputum and lyse less robust bacteria in one step. Importantly, the présent composition and method appeared to be [0001] 20 just as effective, if not more effective, compared to the standard of care methodology, in leading to the subséquent détection of M. tuberculosis-specific DNA and antibiotic résistance markers.

[00169] Compared to the conventional method (“Collaborator” in Table 6 and Figure 4), the présent “STC” method led to increased sensitivity of M. tuberculosis[0001] 25 spécifie détection by real-time PCR in duplicate sputum samples categorized previously as ‘low’ and ‘mid’ TB-positive by culture and smear microscopy. In this example, not until DNA extracted using the “Standard of Care” method was diluted 10-fold was M.

tuberculosis detected in ‘mid’ and ‘high’ TB-positive sputum samples (Table 6 and Figure 4); whereas 87% of ‘low’ TB-burden sputum samples were detected as positive following [0001] 30 DNA isolation utilizing the “STC” method (Table 2). Only 25% of ‘low’ TB-burden sputum samples were detected as positive by real-time PCR following DNA isolation using the standard of care methodology (Table 6).

-4218628

[00170] Figure 4 illustrâtes the significantly improved limit of détection (lower C_t values by rtPCR) of M. tuberculosis in ail TB-positive sputum samples treated using the STC method, compared to the standard of care method (Collaborator, 1:10). For example, the C_t values for low’ TB-positive sputum ranged from 31.4-45.0 for the “STC” [0001] 5 method, compared to 38.5-45.0 for “Collaborator” method; the C_t values for ‘mid’ TBpositive sputum ranged from 20.9-32.3 for the “STC” method, compared to 26.8-45.0 for “Collaborator” method; the C_t values for ‘high’ TB-positive sputum ranged from 19.8-28.3 for the “STC” method, compared to 27.2-39.3 for “Collaborator” method. The C_t values are consistently lower, for ail TB burden levels, when sputum was treated with STC and

[0001] 10 DNA extracted using the présent method. This lower limit of détection helps ensure an accurate diagnosis of M. tuberculosis from patient sputum samples.

[00171] Similarly, the présent composition and method is compatible with industry standard testing to predict antibiotic résistance in Mycobacterium tuberculosis-posiüve specimens. Pyrosequencing assay results obtained with the standard of care method and [0001] 15 STC method were 100% concordant for the 6 clinical TB-positive sputum specimens tested. Importantly, from these 6 patient sputum specimens, the présent STC method, but not the standard of care method, detected 2 patients (FIND 01 01 2072 and FIND 01 01 2137) with antibiotic résistance markers (inhA and rpoB genes) (Table 7). Even the gold standard culture test failed to show growth of Mycobacteria in these 2 patients’ samples [0001] 20 after52days.

[00172] The impact of the increased recovery of Mycobacteria DNA at the time of testing is best highlighted with the pyrosequencing data. The samples treated with the STC composition had DNA available in sufficient quantities to be tested for antibiotic résistance markers on Day 0 of testing. In contrast, the standard of care method required [0001] 25 an average of 14 days for MGIT cultures to become positive before pyrosequencing could be repeated on samples that were négative by PCR at Day 0. The antibiotic profile of a patient is critical for case management and earlier intervention with the appropriate antibiotic therapy will decrease transmission rates and increase the patients’ chances of recovery. Hence, the présent invention is valuable for rapid, same-day identification of [0001] 30 MTBC by real-time PCR and sensitive enough to detect antibiotic résistance markers for

M. tuberculosis, without waiting for the détection of Mycobacteria by culture.

[00173] Table 6. Percentage of Sputum Samples Detected as TB-Positive by Realtime PCR Following DNA Extraction using 2 Different Methods

-4318628

Method	% Detected LOW* (n=8)	% Detected MID(n=10)	% Detected HIGH (n=10)
Collaborator (neat)	12%	0%	0%
Collaborator (1:10)	25%	70%	100%
STC	87%	100%	100%

*2 data points excluded from low samples -TB was not detected following any extraction method or by culture

[00174] Table 7. Pyrosequencing Results for Two Antibiotic Résistance Markers in

[0001] 5 M. tuberculosis.

Study ID #	Method	Real-time PCR Ct value (in duplicate)	rpoB gene	inhA gene	MGIT Growth
FIND 01 01 2072 LOW	Collaborator	Négative (straight, 1:10)	Failed	Failed	NG
STC	31/31	WT	C(-15)T
FIND 01 01 2137 LOW	Collaborator	34/34(1:10)	Failed	WT	NG
STC	34/32	Asp516Val	WT
FIND 01 01 2166 MID	Collaborator	26/26(1:10)	Failed/WT(M)	WT	Yes(12d)
STC	24/24	WT	WT
FIND 01 01 2287 MID	Collaborator	34/34(1:10)	Failed	G(-17)T	NG
STC	32/32	Failed	G(-17)T
FIND 10 01 0041 HIGH	Collaborator	27/27(1:10)	Failed/WT(M)	C(-15)T	Yes(10d)
STC	20/20	WT	C(-15)T
FIND 10 01 0042 HIGH	Collaborator	31/31 (1:10)	Failed/WT(M)	Failed/WT(M )	Yes(19d)
STC	24/24	WT	WT

WT, Wild type; NG, No Growth; STC, Sample Transport Chemistry

M, Pyrosequencing was done from a heat killed MGIT culture

[00175] EXAMPLE 7: Compatibility of Sample Transport Chemistry in Tuberculosis

Diagnosis using the Cepheid GeneXpert® MTB/RIF Assay

-4418628

[00176] Presently, a leading molecular diagnostic test for M. tuberculosis in sputum specimens is the Cepheid GeneXpert MTB/RIF assay, a nested, real-time PCR-based détection of M. tuberculosis complex DNA and rifampin résistance. In this example, the compatibility of STC composition-treated sputum with the Cepheid GeneXpert MTB/RIF

[0001] 5 assay was evaluated, compared to non-treated sputum from the same patients. Duplicate TB-positive sputum samples from 25 patients were kindly donated by the Tuberculosis Specimen Bank at Foundation for Innovative Diagnostics (FIND). An independent diagnostics laboratory, National Jewish Health (NJH), was engaged to détermine the diagnostic efficacy of STC composition-treated, compared to non-treated, sputum in the

[0001] 10 Cepheid GeneXpert assay.

[00177] Experimental Method

[00178] Préparation of Raw Sputum Specimens for the GeneXpert MTB/RIF Assay

[00179] The présent example utilized duplicate 0.5-1.0 mL aliquots of raw frozen sputum (donated by FIND) from 25 tuberculosis-positive patients. Culture and smear

[0001] 15 microscopy was used by FIND to confirm and categorize these samples as follows (see Table 8):

[00180] Table 8. Categorization of TB-Positive Sputum Specimens from FIND

FIND Category Description	Characterisation with STC treatment	No. of Duplicate Sputum Samples
Smear positive, Culture positive (SS+)	HIGH	5
Smear positive 1+, Culture positive (Smear1+ C+)	MID	10
Smear négative, Culture positive (S- C+)	LOW	10

[00181] Aliquots were shipped frozen to National Jewish Health (Denver, CO, US) [0001] 20 for Processing and testing for TB on the Cepheid System. Upon arrivai at NJH

Mycobacteriology Laboratory, duplicate aliquots from 25 donors were thawed on ice. One set of aliquots was treated with 2 volumes of Cepheid Sample Reagent (SR) Buffer and the second set was treated with an equal volume of an STC composition (2% SDS, 12 .5 mM CDTA, 250 mM LiCI, 50 mM glycine, pH 10.5) to liquefy the specimens.

-4518628

[0001] 5

[0001] 10

[0001] 15

[0001] 20

[0001] 25

[00182] Following the addition of Cepheid SR Buffer, each aliquot was treated as follows:

a. Mixtures were vortexed for 10-15 seconds and allowed to stand for 5 minutes at room température.

b. The mixtures were vortexed for another 10-15 seconds and allowed to stand for 10 minutes at room température

c. Each sample was loaded into a Cepheid GeneXpert MTB/RIF cartridge

d. The test was performed according to Cepheid GeneXpert® MTB/RIF Assay (Protocol H.2).

[00183] Following the addition of STC, each aliquot was treated as follows:

a. Mixtures were vortexed for 10-15 seconds and allowed to stand for 15 minutes at room température.

b. The mixtures were vortexed well to mix and then centrifuged at 3000xg for 20 minutes.

c. The supernatant was carefully poured off.

d. The pellet was resuspended in 1 mL Xpert MTB/RIF SR buffer and vortexed for at least 10 seconds.

e. The mixture was incubated for 10 minutes at room température and vortex for at least 10 seconds.

f. The sample was incubated at room température for an additional 5 minutes.

g. Each 1 mL sample was loaded directly into Cepheid GeneXpert MTB/RIF cartridge.

h. The test was performed according to Cepheid GeneXpert® MTB/RIF Assay (Protocol H.2)

-4618628

[00184] GeneXpert real-time PCR provides 2 results: 1 ) M. tuberculosis Positive/Negative, and 2) rifampin (RIF) antibiotic Sensitivity or Résistance (Sens/Res) (Table 9).

[00185] Table 9. Cepheid GeneXpert MTB/RIF Assay Results

Level of MTB by Smear/ Culture	# of sample s tested	Metho d	MTB	Rifampin
Resuit	Correlatio n	Notes	Resuit	Correlatio n	Notes
High	5	STC NJH	5/5 Positive; 5/5 Positive	100%		2/5 Res; 2/5 Res	100%
Mid	10	STC NJH	8/8 Positive; 8/8 Positive	100%ab		0/9 Res; 0/9 Res	100%
Low	10	STC NJH	8/9 Positive; 9/9 Positive	88%a'c	1 discrepan t call: STC = No MTB detected; NJH = MTB detected	2/8 Res; 1/8 Res	88-100%d	1 discrepan t call: STC = Res; NJH = Sens

^aOne sample was no MTB detected by both methods; exduded from calculations.

^bOne sample failed due to Post Run Analysis Error; exduded from calculations.

'Biological variation in aliquots may hâve played a rôle; additional work may be undertaken to résolve discrepancy.

^d88% if call was incorrect; 100% if call was correct; additional work may be undertaken to résolve discrepancy.

[0001] 5

[00186] Results and Conclusions

[00187] Sédiments extracted from STC composition-treated sputum were fully compatible with the Cepheid GeneXpert® MTB/RIF Assay System. Specimens classified as smear positive/culture positive (both High and Mid) and treated with STC were 100%

[0001] 10 concordant for M. tuberculosis and RIF résistance by the Cepheid molecular assay, compared to untreated sputum from the same patients (Table 9).

-4718628

[00188] For smear negative/culture positive (Low) specimens, there was 88% concordance between STC composition-treated and untreated sputum samples in the détection of M. tuberculosis by real-time PCR (Table 9). Specifically, one donor’s sample treated with STC gave a négative resuit for M. tuberculosis. Biological variation between [0001] 5 different aliquots from the same patient may hâve played a rôle in this instance, making

MTB undetectable in this “Low” specimen.

[00189] When evaluating RIF résistance, there was one discrepant call for smear negative/culture positive (Low) specimens. Two donors were identified as RIF-resistant using STC composition-treated sputum; while 1 donorwas identified as résistant when [0001] 10 untreated sputum was processed using the Cepheid SR buffer method (Protocol H.2).

This discrepancy could be explained by an increase in sensitivity of the assay when sputum was pre-treated with the STC composition prior to analysis.

[00190] EXAMPLE 8: Spores of Bacillus Anthracis Survive Sample Transport Chemistrv

[0001] 15 [00191] Anthrax is an acute, often léthal, disease caused by the rod-shaped, grampositive, aérobic bacterium Bacillus anthracis that normally rests in endospore form in the soil. Like Clostridium difficile, B. anthracis can form dormant endospores, which are very hard to eradicate, surviving harsh conditions for décades or even centuries. Anthrax does not spread directly from one infected animal or person to another, it is spread by spores.

[0001] 20 When spores are inhaled or ingested, or corne into contact with a skin lésion on a host, they may become reactivated and multiply rapidly. The hardiness of anthrax spores, and their ease of production in vitro, makes them extraordinarily well suited to use (in powdered and aérosol form) as biological weapons.

[00192] While previous examples demonstrated that Mycobacterium tuberculosis [0001] 25 remained viable in the présent composition, the présent example demonstrates that other hardy microorganisms, such as Bacillus anthracis spores, remain viable after treatment with an STC composition.

[00193] Experimental Method

[00194] Work was conducted at the New York State Department of Health, [0001] 30 Wadsworth Center, Biodefense Laboratory, USA.

-4818628

	[00195] Préparation of B. anthracis Spores [00196] Frozen stock culture of B. anthracis Sterne Strain was cultured on Trypticase Soy Agar with 5% Sheep’s Blood and incubated at 35°C with 5% CO2 for 24 hours. After initial incubation, this culture was transferred to multiple (minimum of 10)
[0001] 5	Bacillus Sporulation Agar plates and incubated aerobically at 35°C with CO2 for up to 2 weeks. [00197] Malachite Green spore staining was performed every 3 to 4 days to monitor sporulation of B. anthracis in vitro. When the malachite green stains prepared showed almost complété sporulation of organisms, the spores were harvested into 5.0
[0001] 10	mL of PBS (pH 7.4) and stored at room température until use. [00198] Détermination of Spore Concentration [00199] B. anthracis spore suspension was diluted to 10’3 in PBS. An aliquot (10 pL) of this final dilution was loaded into each clean well of a 2-chamber hemocytometer slide. Hemocytometer chambers were observed at 40x magnification without oil for spore
[0001] 15	counting. Spores were visualized as round or oval black cells on the light field grid of the hemocytometer. [00200] T reatment of Spores 1. 700 pL of spore stock suspension was prepared, at the required concentration.
[0001] 20	2. Each sample was split into 2x 350 pL volumes; with one 350 pL aliquot used as untreated or “control”: a. 50 pL aliquot was removed to confirm spores were viable by plating onto Trypticase Soy Agar with 5% Sheep’s Blood (see below). 4. The second 350 pL aliquot was used for STC Method:
[0001] 25	a. 350 pL BD2 buffer (2% SDS, 12 .5 mM CDTA, 250 mM LiCI, 50 mM glycine, pH 10.5) was added to the 350 pL spore stock suspension of B. anthracis-, and vortexed to mix.

-4918628

c. The mixture was incubated at room température for 15 minutes, and then 100 pL was removed for culture (“STC”) and plated onto Trypticase Soy Agar with 5% Sheep’s Blood (see below).

[00201] Culture of Spores to Détermine Viability

[0001] 5 [00202] B. anthracis aliquots were plated directly onto Trypticase Soy Agar with

5% Sheep’s Blood and incubated at 35°C with 5% CO₂. After 24 hours, colony-forming units (CFU) were recorded.

[00203] Results and Discussion

[00204] This example demonstrated that B. anthracis spores were not killed with [0001] 10 STC treatment (Figure 5). Both untreated and STC-treated spores produced équivalent numbers of végétative bacteria following 24 hours under favourable culture conditions.

[00205] EXAMPLE 9: Mycobacterium is Viable in Sample Transport Chemistrv for a Week at Ambient Températures

[00206] Ambient température can vary widely from région to région with [0001] 15 fluctuations throughout the day. During collection and transport to the laboratory, biological samples are exposed to this broad range of températures unless measures are taken. In developing countries, due to high cost and lack of infrastructure, samples are transported to the laboratory at ambient température, compromising the quality of the sample and validity of the test results.

[0001] 20 [00207] In example 1, attenuated Mycobacterium tuberculosis H37Ra (aMTB) spiked into sputum remained viable in the présent composition, STC, at room température (20-25°C) and 4°C up to 30 days. In the présent example, aMTB, in the absence of mucoid sputum, was in direct contact with STC or PBS and exposed to températures ranging from 4°C to 40°C for 1, 2, 3, 4 and 7 days. Following up to 7 days [0001] 25 exposure to STC, the Mycobacteria were cultured to assess viability; time to positive culture resuit was monitored. As control, this experiment was repeated with E. coli, a less hardy microorganism than Mycobacteria.

[00208] Experimental Method

-50I

I

[00209] Treatment of Attenuated Mycobacterium tuberculosis and E. co/ί with STC or PBS

A. aMTB (2x10⁶ CFU/mL) and E. coli (2x10⁶ CFU/mL) were spiked into 10 mL of STC (2% SDS, 12.5 mM CDTA, 250 mM LiCI, 50 mM glycine, pH 10.5) or [0001] 5 phosphate buffered saline (PBS) in multiple 50 mL sterilized tubes.

B. Held each tube at the appropriate température (4°C, room température (20-25°C), or 40°C) for the allotted time (1, 2, 3, 4, or 7 days).

C. Removed 3 mL of spiked microorganism in STC or PBS from each tube.

D. Centrifuged at 3500 rcf for 20 minutes to pellet intact bacteria.

[0001] 10 E. Discarded the supernatant and resuspended the pellet in 0.5 mL stérile PBS

F. Inoculated 100 pL of resuspended bacteria into 5x 5mL supplemented M7H9 broth.

G. Incubated at 37°C and checked for growth daily.

H. Culture control:

[0001] 15 a. Inoculated aMTB (10⁶ CFU/mL) from stock into 5 mL M7H9 broth each day a test sample was cultured.

b. Inoculated E. coli (10⁶ CFU/mL) from stock into 5 mL M7H9 broth each day a test sample was cultured.

c. Incubated control cultures at 37°C with test samples.

[0001] 20 I. Recorded the number of days until positive for ail samples

J. For aMTB, continued incubating until 0.5 McFarland Standard turbidity was reached.

K. For E. coli, continued incubating until 1.0 McFarland Standard turbidity was reached.

[0001] 25 [00210] Extraction of DNA from aMTB Treated in STC or PBS for 30 Pays at 4°C and 40°C

-51 18628

	A. B.	Transferred 200 pL of aMTB (treated with PBS for 30 days at 4°C and 40°C) to a fresh tube and mixed with 200 pL of BD2 buffer. Transferred 200 pL of aMTB (treated with STC for 30 days at 4°C and 40°C) to a fresh tube for DNA extraction.
[0001] 5	C. D. E. F.	Sodium (meta)periodate was added to each tube to a final concentration of 30 mM and vortexed to mix. The mixtures were incubated at 70°C in a water bath for 20 minutes. Samples were cooled at room température for 2 minutes. 1M Tris buffer (pH 7) was added to a final concentration of 50 mM.
[0001]	10	G. H. I.	The mixtures were incubated at room température for 10 minutes. 3M potassium acetate (pH 5.5) was added to a final concentration of 150 mM, vortexed to mix. Mixtures were incubated on ice for 10 minutes and then centrifuged at 13,000 rpm for 5 minutes.
[0001]	15	J. K. L.	Supernatant was transferred to a clean, labelled tube and the pellet was discarded. Two volumes of room température 95% éthanol was added to the supernatant in the tube and the tube was inverted 20 times to mix. The mixture was incubated at room température for 10 minutes to precipitate DNA
[0001]	20	M.	and then centrifuged at 15,000 rpm for 2 minutes to pellet DNA. The supernatant was gently removed and discarded taking care not to disturb the pellet.

The pellet was dissolved in 200 pL TE.

[00211] rtPCR Conditions

-5218628

[00212] DNA isolated from aMTB treated 30 days with STC or PBS at 4°C and 40°C was subjected to qPCR spécifie for Mycobacterium, the RD4 Taqman Real-time PCR assay (same protocol as example 1 ).

[00213] Results and Discussion

[0001] 5 [00214] aMTB is viable in the présent composition, STC, for 7 days over a broad range of températures (4-40°C), typical of transport conditions. Positive aMTB cultures show 0.5 McFarland turbidity growth within the standard 42 days incubation at 35°C (Table 10). aMTB, exposed to STC, loses some viability as it is held at 4°C, room température and 40°C up to 7 days, as shown by the longer times periods to achieve 0.5

[0001] 10 McFarland turbidity growth (Table 10), compared to aMTB exposed to PBS. Interestingly, aMTB in PBS also showed some loss of viability when held at 40°C for even 1 day, suggesting that température has significant impact on aMTB viability.

[00215] In contrast, there was complété loss of viability of E. coli in STC in ail températures tested by day 1 (Table 11 ).There was no loss of viability of E.coli in PBS at

[0001] 15 4°C, room température and 40°C up to 7 days. Hence, STC will keep aMTB viable for at least 7 days ranging from 4-40°C, while at the same time, eliminate bacteria like E.coli on contact, thereby reducing background flora of a biological sample.

[00216] Importantly, qPCR (Table 12), spécifie for MTB DNA, shows that the quantity of aMTB remained constant in STC for 30 days at 4°C and 40°C. Similar values

[0001] 20 were obtained for aMTB treated with PBS at these extreme températures for 30 days (Table 12). Hence, this example shows that aMTB is stable in STC, i.e. it doesn’t proliferate or dégradé over a wide range of températures for at least one month; insuring samples that reach distant laboratories closely represent the State of the patient in vivo.

[0001] 25 [00217] Table 10. Viability of aMTB in STC from 4°C to 40°C

Organism	Chemistry	Hold Température (°C)	Time to Positive Culture (Days to 0.5 McFarland) of aMTB
1 Day in STC	2 Days in STC	3 Days in STC	4 Days in STC	7 Days in STC
aMTB	STC	4	21	23	23	24	28
22	21	23	23	24	28

-5318628

		40	17	16	23	28	38
PBS	4	13	16	15	14	18
22	13	16	15	19	32
40	24	23	29	28	32
aMTB stock	PBS	4	13	16	15	14	18

[00218] Table 11. Viability of E. coli in STC from 4°C to 40°C

Organism	Chemistry	Hold Température (°C)	Time to Positive Culture (Days to 1.0 McFarland) of E. coli
1 Day in STC	2 Days in STC	3 Days in STC	4 Days in STC	7 Days in STC
E. coli	STC	4	NG	NG	NG	NG	NG
22	NG	NG	NG	NG	NG
40	NG	NG	NG	NG	NG
PBS	4	1	1	1	1	1
22	1	1	1	1	1
40	1	1	1	1	1
E. coli stock	PBS	4	1	1	1	*3	1
Note:	‘culture checked after weekend; this culture likely reached 1.0 McFarland in 1 day NG, No growth

[00219] Table 12. qPCR of DNA extracted from STC- and PBS-treated aMTB after

[0001] 5 30 days.

qPCR Replicate	Stock 4°C	PBS-treated aMTB	STC-treated aMTB
4°C	40°C	4°C	40°C
1	20.44	21.29	21.73	21.65	22.73
2	21.01	22.02	21.66	20.71	20.47
3	20.91	23.62	20.89	20.96	21.09

[00220] EXAMPLE 10: Effect of buffer composition on the viability of and DNA extraction from Mycobacterium tuberculosis

-5418628

[00221] As seen in Example 5, M.tuberculosis remains viable in an STC composition BD2 for 7 days at room température. The fundamental components of the STC compositions may be varied or “tailored” for spécifie sample types and uses. The relationship between chelating agents, détergents, pH and buffering agents were

[0001] 5 investigated for their effect on both the viability of attenuated M. tuberculosis, as well as the subséquent recovery of high molecular weight (HMW) DNA.

[00222] In this example, the following STC compositions were tested:

[00223] Table 13: Compositions tested in this example

Chemistry	Sait	Chelating Agent	Detergent	Buffering Agent	pH
BD2	250 mM LiCI	12.5 mM CDTA	2% SDS	50 mM Glycine	10.5
Variant #1	250 mM LiCI	12.5 mM EDTA	2% SDS	50 mM Glycine	10.5
Variant #2	250 mM LiCI	12.5 mM EDTA	2% Triton X100	50 mM Borate	9.3
BD4	250 mM LiCI	12.5 mM CDTA	2% SDS	50 mM Borate	9.3

[0001] 10

[00224] Experimental Methods:

[00225] Plated Colonies and DNA extraction

[00226] Saliva samples were collected from healthy individuals and treated as follows:

[0001] 15	1. 0.4 mL of saliva or water (control for DNA extraction) was mixed with 0.5 mL of
	the above chemistries (Table 13) and tubes were incubated 30 minutes to allow liquéfaction. 2. 100 pL of a suspension of attenuated M. tuberculosis cells (strain h37a; aMTB) washed in PBS were added per sample (one tube per chemistry). Alternatively,
[0001] 20	100 pL of stérile water was added to saliva in chemistries to create un-spiked control samples.

3. Samples were mixed by vortexing and incubated for 30 minutes, 2, 4 and 8 days at room température when samples were serially diluted and spread-plated on

-5518628

	Middlebrook agar plates (see below for details). Colonies on plates were enumerated manually after incubation at 35°C for 3-4 weeks 4. At each time-point outlined in step 3, an aliquot of each sample was subjected to vortex bead-beating to extract total DNA. Briefly, 250 pL of sample was pelleted,
[0001] 5	washed in PBS and brought up in 340 pL of stérile RNase-free water. 30 pL was serially diluted and plated on Middlebrook plates, while 300 pL was added to 300 pL of BD1 (250 mM LiCI, 50 mM CDTA, 4% SDS, pH 6.8) in a screw-capped 2-mL tube containing 250 mg of Cole High-refractive index silica beads. The BD1 sample mixture was then processed in a Bio Spec bead-beater for 1 minute.
[0001] 10	5. Débris was removed by centrifugation for 5 minutes at 15,000 rpm in a microcentrifuge. 6. DNA was purified from samples using an abbreviated version of the method outlined in Example 1 (Extraction of DNA from aMTB-spiked BD2 Buffer-Treated Sputum using the Periodate Method; specifically, steps 8-13 were used, and step
[0001] 15	12 used a 1 hour incubation at -20”C). 7. Samples were centrifuged for 3 minutes at 15,000 rpm in a microcentrifuge, pellets were brought up in 50 pL of RNase-free water and 12 pL were analysed by agarose gel electrophoresis on a 0.8% agarose gel (see Figure 6 below). [00227] Results and Conclusions
[0001] 20	[00228] Table 14 summarizes the results of the énumération of M. tuberculosis colonies after the indicated incubation times. An entry of ND indicates the number of colonies was not determined due to the presence of contamination. On ail other plates, M. tuberculosis was the only bacterium présent. An entry of < 102 indicates that no colonies were observed on the plate with the lowest dilution, which is the limit of détection
[0001] 25	for this method. [00229] Table 14: Enumération of viable M. tuberculosis per 0.6 mL human saliva after incubation in STC compositions for the indicated incubation times.

STC	30 Minutes	2 Days	4 Days	8 Days
BD2	7.0 X105	5.0 x 104	1.0 x 103	< 102
Variant #1	6.8 x 105	5.2 x 105	5.0 x 103	< 102
Variant #2	2.0 X105	4.0 x 104	< 102	< 102
BD4	1.5 x 105	5.0 x 104	5.0 x 103	< 102
Water (control)	1.0 X107	ND	ND	3.0 x 105

-5618628

[00230] Results and Conclusions

[00231] Figure 6 shows (as an example) the agarose gel resuit for the t=2 days time point. Intact high molecular weight (HMW) DNA is recovered after treatment of [0001] 5 saliva samples with BD2 or the indicated chemistry variants. AH samples containing aMTB show a marked increase in the amount of recovered DNA, demonstrating the contribution of aMTB to the total nucleic acids présent. The uppermost band of the DNA ladder (arrowhead) is equal to ~ 23 kB. AH recovered DNA bands are higher than this point, indicating the presence of HMW DNA.

[0001] 10 [00232] In this example, the effect on extraction of DNA from and viability of attenuated M. tuberculosis after incubation in BD2 or the related chemistry variants mixed with saliva was investigated in order to demonstrate the fundamental utility of different combinations of the STC components. DNA extraction from M. tuberculosis was assessed by agarose gel electrophoresis and Controls were included to distinguish

[0001] 15 between salivary DNA and Mycobacterial DNA. Intact high molecular weight (HMW) DNA from M. tuberculosis could be obtained at ail time-points after incubation in ail compositions tested, followed by bead-beating (Figure 6).

[00233] The viability of M. tuberculosis was determined by énumération of plated colonies following incubation in BD2 or related chemistries. M. tuberculosis is notorious

[0001] 20 for forming clumps of cells which make exact détermination of viable MTB cells présent in the samples difficult. Additionally, contamination was observed in samples mixed with borate-buffered chemistry containing triton X-100. Despite these difficulties, the overall trends of survival of M. tuberculosis in these chemistries could be determined. While there is a réduction in viability over time, M. tuberculosis maintains viability even after four

[0001] 25 days incubation in BD2 and related chemistries (Table 14). This is consistent with the results of Example 5, where virulent M. tuberculosis remained viable following storage in the STC composition for up to one week. Whereas ail chemistries drastically reduced viability after 8 days, there is some variation in the impact on viability at earlier time points (compare BD2 to variant #2). In ail cases, saliva samples containing MTB yielded HMW

[0001] 30 DNA at ail time points tested (shown for time point t=2 days in Fig. 6). Ultimately, these data demonstrate that variations ofthe STC compositions perform equally well with respect to HMW DNA recovery and viability of hardy microorganisms. Presently, one of the input requirements of State of the art molecular diagnostic testing is quality, HMW

-5718628

DNA. This example demonstrates that the STC compositions are able to provide such DNA for subséquent molecular diagnostic testing.

[00234] EXAMPLE 11: STC Compositions are Effective in Eliminatino Opportunistic Pathoqens Présent in Sputum

[0001] 5 [00235] In many high burden TB countries, safe and efficient transport of TB positive samples is a problem. Samples are regularly discarded at the Processing laboratory due to putréfaction caused by long transport times at ambient températures. The STC compositions are intended to preserve the viability of hardy microorganisms such as M. tuberculosis, while eliminating the background microflora of sputum and

[0001] 10 thereby allowing transport of sputum samples without the risk of putréfaction prior to molecular and culture TB diagnostics.

[00236] Pseudomonas aeruginosa and Moraxella catarrhalis are opportunistic pathogens capable of causing respiratory tract infections often in immune-compromised or chronically sick persons. P. aeruginosa is a gram négative bacterium that forms

[0001] 15 biofilms and is one of the bacteria most isolated from people with nonsocomial (hospital acquired) infections. Because of its association with people with cystic fibrosis, it is also frequently found in sputum samples. M. catarrhalis is a gram négative bacterium that is capable of both aérobic and anaérobie growth. It can survive for at least three weeks in expectorated sputum and is a potential contaminant of sputum samples even after NALC[0001] 20 NaOH treatment. Here, the ability of P. aeruginosa and M. catarrhalis to survive treatment with STC compositions is investigated.

[00237] a) The impact of STC compositions on background microorganisms in human sputum samples

[00238] Materials and Methods:

[0001] 25 1. 600 pL of pooled, certified TB-negative human sputum (from six donors, Tissue

Solutions, source 53 France) was mixed with 700 pL PBS, BD2 (250 mM LiCI, 12.5 mM CDTA, 2% SDS, 50 mM glycine, pH 10.5) or BD3 (250 mM LiCI, 50 mM CDTA, 4% SDS, pH 6.8).

2. Samples were mixed and incubated at room température for 10 minutes, 3 hours [0001] 30 or 24 hours when serial dilutions were prepared from each sample to détermine number of viable bacteria.

-5818628

3. For plating at each time-point, 100 pL aliquots were washed in PBS (exception: samples in PBS were not washed prior to plating). Serial dilutions were prepared in PBS and 100 pL aliquots of dilutions were plated on trytpic soy agar t=0 (10 mins, 0.17 hour), 3 and 24 hours post incubation. Background flora of bacteria [0001] 5 was enumerated by counting CFUs on these plates after incubation at 35°C (Table A).

[00239] Results:

[0001] 10 [00240] Table 15: Enumération of viable background bacteria per 0.6 mL human sputum after incubation in STC compositions for the indicated incubation times.

Incubation Time (h)	PBS	BD3	BD2
0.17	1.6 x 107	9.3 x 103	90
3	2.3 x 107	1.9 x 103	<10*
24	2.5 x 107	10	<10*

* An entry of < 10 indicates that no colonies were observed on the plate with the lowest dilution (10¹), which is the limit of détection for this method.

[0001] 15

[00241 ] b) The impact of STC compositions on Pseudomonas aeruginosa and Moraxella catarrhalis

[00242] Materials:

• Ovemight cultures of M. catarrhalis ATCC 25238 and P. aeruginosa ATCC 10145 [0001] 20 · Filter-sterilized STC compositions: BD2 (250 mM LiCI, 12.5 mM CDTA, 2% SDS, mM glycine, pH 10.5); BD3 (250 mM LiCI, 50 mM CDTA, 4% SDS, pH 6.8); BD4 (250 mM LiCI, 12.5 mM CDTA, 2% SDS, 50 mM borate, pH 9.3) • stérile water, stérile Dulbecco's phosphate-buffered saline (PBS), trytpic soy broth (TSB), trytpic soy agar (TSA), brain heart infusion (BHI) broth and agar

[0001] 25 · turntable for microbiology

[00243] Experimental Methods:

[00244] Viability determined by plating

-5918628

[0001] 5

[0001] 10

1, M. catarrhalis was grown in BHI broth from a plate stored at 4*C. P. aeruginosa was grown in TSB from a plate stored at 4’C.

2. After overnight growth at 37°C, bacteria were harvested, washed and approximately 100 cells/100 pL PBS were incubated in 1 mL of STC composition (1:1 with water) or PBS.

3. 300 pL aliquots were taken after 15 minutes, 1 hour and 24 hours.

4. At each time-point, the pellets were washed in DPB (P. aeruginosa) or BHI broth (M. catarrhalis) and serial dilutions were made in PBS (P. aeruginosa) or BHI broth (M. catarrhalis).

5. Dilutions were plated on TSA (P. aeruginosa) or BHI agar (M. catarrhalis), and plates were incubated overnight at 35°C; colonies on plates were enumerated by manual counting (Table 16).

[00245] Viability determined by broth growth

[0001]	15	1. 2.	M. catarrhalis was grown in BHI broth from a plate stored at 4’C. P. aeruginosa was grown in TSB from a plate stored at 4’C. After overnight growth at 37°C, bacteria were harvested, washed and approximately 100 cells were incubated in 1 mL of chemistry (1:1 with water) or PBS. The initial inoculum was determined by serial dilutions and énumération on
[0001]	20	3.	agar plates. 300 pL aliquots were taken after 15 minutes and 2 hours.
		4.	At each time-point, intact bacteria were pelleted and washed in TSB or BHI broth.
		5.	The aliquots were then used to inoculate 2 mL of TSB (P. aeruginosa) or BHI broth (M. catarrhalis)
[0001]	25	6.	The broth was incubated at 37°C with shaking, 180 rpm, overnight and any growth

was recorded (Table 17).

[00246] Results:

I

-6018628

[00247] Table 16: Enumération of P.aeruginosa (TSA plates) and M. catarrhalis (BHI plates) following incubation in STC compositions for the indicated incubation times

	Incubation Time (h)	PBS	BD3	BD2	BD4
P.aeruginosa	0.25	9.0 x 107	1.1 x 107	< 100	< 100
1	7.5 x 107	8.5 x 106	< 100	<100
24	1.0 x 108	600	<100	< 100
M. catarrhalis	0.25	3.0 x 108	< 100	< 100	< 100
1	6.0 x 108	< 100	< 100	<100

[0001] 5

[00248] Table 17: Growth of P.aeruginosa (TSB broth) and M. catarrhalis (BHI broth) following incubation in STC compositions for the indicated incubation times

	Incubation Time (h)	PBS	BD3	BD2	BD4
P.aeruginosa	0.25	++	++	—	—
2	++	++		—
M. catarrhalis	0.25	++	—		—
2	++	—		—

[00249] Conclusions

[0001] 10 [00250] While the présent composition préserves the viability of hardy microorganisms such as M. tuberculosis for prolonged periods of time (Examples 5 and 10), it is crucial that the contamination caused by the growth of other more rapidly growing microorganisms is eliminated as soon as possible. Here, we found that the STC compositions are effective at eliminating plate growth of P. aeruginosa and M. catarrhalis

[0001] 15 between 15 minutes and 24 hours of incubation (Table 16). There is variation between compositions, with BD2 and BD4 acting more effectively against P. aeruginosa than BD3 (Tables 16 and 17).

[00251] As the limit of détection of the plate-counting experiment was 100 cells, it is possible that some bacteria survived treatment with the STC compositions that could

[0001] 20 lead to contamination of Mycobacterium broth cultures. To address this, viability after incubation in STC compositions was also investigated by broth culture. Here, any

-61 18628 surviving bacteria should multiply leading to easily observable growth in broth. In agreement with the plating results, only cultures inoculated with cells that had been treated with PBS or P. aeruginosa treated with BD3 resulted in growth of bacteria after overnight incubation (Table 17). This example demonstrates that the STC compositions [0001] 5 can quickly and effectively eliminate less hardy microorganisms, which are a potential source of contamination in biological samples such as sputum, making compositions of the présent invention idéal transport solutions for TB samples.

[00252] EXAMPLE 12: STC Compositions are Effective in Rapidly Eliminatinq both Gram-neqative and Gram-positive Bacterial Species, as well as Yeast Species

[0001] 10 [00253] Hardy microorganisms such as M. tuberculosis can be found in a variety of environments, together with many other bacterial species, as well as other microorganisms such as yeasts. This example demonstrates the broad applicability of the STC compositions in rapidly eliminating the viability of various microorganisms. Several species of bacteria were chosen due to their presence in a range of

[0001] 15 environments such as soil (Bacillus thuringiensis, Bacillus subtilis), human skin (Staphylococcus aureus), and mammalian gastrointestinal tracts ( Yersinia enterocolitica, Candida albicans).

[00254] Materials:

• Overnight cultures

[0001] 20 · Filter-sterilized BD2 (250 mM LiCI, 12.5 mM CDTA, 2% SDS, 50 mM glycine, pH

10.5), BD3 (250 mM LiCI, 50 mM CDTA, 4% SDS, pH 6.8) and BD4 (250 mM LiCI, 12.5 mM CDTA, 2% SDS, 50 mM borate, pH 9.3) • Stérile water, stérile Dulbecco's phosphate-buffered saline (PBS), trytpic soy broth (TSB), trytpic soy agar (TSA), brain heart infusion (BHI) broth and agar, TSB and

[0001] 25 TSA supplemented with 0.1% cysteine (TSBC and TSAC respectively), YEPD plates and broth for yeast.

• Turntable for microbiology

[00255] Experimental Methods:

[0001] 30 1. Bacteria and yeast were grown in the recommended growth media and at the recommended température (see step #5, below for details).

-6218628

[0001] 5

2. After overnight growth cells were harvested, washed and 109 cells in 100 pL PBS were incubated in 1 mL of STC chemistries (1:1 with water) or PBS.

3. 300 pL aliquots were taken after 15 minutes, 1 hour and 24 hours.

4. At each time-point, aliquots were washed and serially diluted in media.

5. Dilutions were plated on YEPD (C. albicans), TSAC (F. philomiragia), BHI agar ( Y. enterocolitica), or TSA (ail others) and plates were incubated overnight at 30°C (Y. enterocolitica, C. albicans), or 35°C (ail others) and colonies on plates enumerated by counting (Table 18).

[0001] 10 [00256] Results:

[00257] Table 18: Enumération of the indicated microorganisms following incubation in STC compositions for the indicated incubation times

Bacterial Species	Incubation Time (h)	Medium	PBS	BD3	BD2	BD4
B. thuringiensis	0.25	TSA	3.2 X107	< 100	< 100	< 100
1	TSA	8.1 xlO7	< 100	< 100	< 100
Y. enterocolitica	0.15	BHI	7.5 x 108	4.8 x 107	< 100	< 100
1	BHI	7.9 x 108	4.0 x 107	< 100	< 100
24	BHI	7.8 x 108	2.8 x 105	< 100	< 100
F. philomiragia	0.15	TSAC	3.7 X 108	1.0 x 108	< 100	Not tested
1	TSAC	2.5 x 108	1.5 x 107	< 100	Not tested
24	TSAC	9.4 x 108	1.4 x 105	< 100	Not tested
S. aureus	0.15	TSA	8.0 X 108	< 100	<100	Not tested
1	TSA	6.4 x 108	< 100	< 100	Not tested
B.subtilis	0.15	TSA	1.1 X 108	< 100	< 100	Not tested
1	TSA	4.7 x 107	< 100	< 100	Not tested
K. pneumonia	0.15	TSA	3.5 X 108	5.7 x 107	< 100	Not tested
1	TSA	2.8 x 108	2.9 x 107	<100	Not tested
24	TSA	1.6 x 107	2.6 x 106	< 100	Not tested
C. albicans	0.15	YEPD	1.7 X 107	< 100	< 100	Not tested
1	YEPD	1.7 x 107	< 100	< 100	Not tested

[00258] Conclusions

[0001] 15 [00259] The effect of incubating both gram-positive (B. thuringiensis, S. aureus, B.

subtilis) and gram-negative (Y. enterocolitica, F. philomiragia, K. pneumonia) bacteria and yeast (C. albicans) in STC compositions was investigated. There was a marked

-6318628 différence in effect of BD3 on the bacterial species tested; while gram-positives and C. albicans completely lost viability within 15 minutes, gram-negative bacteria survived in relatively large numbers even after 24 hours of incubation. The composition BD2 caused rapid réduction (within 15 minutes) of viable bacteria for ail species tested, including the

[0001] 5 yeast. This rapid “decontamination” of the samples is particularly désirable in the context of prolonged sample transport at ambient température conditions. More specifically, TB positive sputum samples will be less likely to be discarded due to putréfaction if a broad range of rapidly growing background bacteria can be quickly and effectively eliminated. This example demonstrates that the STC compositions are effective in eliminating the

[0001] 10 viability of a broad range of microorganisms with differing physical characteristics and originating from diverse environments.

[00260] EXAMPLE 13: DNA from Mycobacterium tuberculosis can be extracted from human sputum samples stored in STC compositions and frozen at -80‘C for 1 week

[00261] While the cost of freezing samples as a method of préservation is

[0001] 15 prohibitively expensive in many developing countries, it is a method often used in wealthier nations. A composition that offers not only the important benefits of ambient température stabilization, but is also able to integrate into molecular diagnostic workflows that incorporate freezing steps is a clear advantage. This example assesses the impact of freezing on the ability to extract DNA suitable for downstream use.

[0001] 20 [00262] Materials • 1.5 x 10⁹ CFU/mL attenuated Mycobacterium tuberculosis (strain h37a; aMTB) in PBS (stored at 4Ό).

• 2-3 mL sputum samples from Tissue Solutions (stored at -80’C).

• Filter-sterilized BD2 (50 mM glycine, 250 mM LiCI, 50 mM CDTA, 2% SDS; pH [0001] 25 10.5) • Sodium (meta) periodate (NPI).

• M7H9 liquid medium (prepared from 2714 Middlebrook 7H9 broth with OADC enrichment and 40 mM sodium pyruvate).

[0001] 30 [00263]

Experimental Methods

-6418628

[0001] 5

[0001] 10

[0001] 15

[0001] 20

1. Sputum was spiked as below and frozen in -80“C in cryological vials for 1 week before extraction and culture:

Sample Number	Sputum Volume	BD2 Volume	aMTB Volume1	aMTB Concentration2
1	600 pL	600 pL	100 pL	2.0 x 107 CFUs/100 pL
2	600 pL	600 pL	100 pL	2.0Χ107CFUs/100 pL

'From a 5 McFarland suspension ²Final concentration in sputum/STC mixture

2. On the day of Processing, the samples were thawed and 200 pL aliquots were made in 1.5 mL screw-cap tubes.

3. They were spun at 3,500g for 20 minutes, the supernatant discarded and the pellet was brought up in 100 pL PBS.

4. DNA was purified from samples using an abbreviated version of the method outlined in Example 1 (Extraction of DNA from aMTB-spiked BD2 Buffer-Treated Sputum using the Periodate Method; specifically, steps 8-14 were used).

5. DNA isolated from aMTB-spiked sputum was used in the Mycobacterium spécifie RD4 Taqman Real-time PCR assay as described in Example 1 (see rtPCR Conditions).

[00264] Results

[00265] Table 19: C_t values obtained from RD4 PCR using DNA isolated from aMTB spiked human sputum samples mixed with STC composition BD2.

Chemistry/sample	Test Condition	aMTB concentration	Ct value
BD2/human sputum	1 week frozen (-80’C)	2.0 x 107 CFUs (100 pL)	21.52
1.0 x 107 CFUs (50 pL)	22.26
2.0 x 106 CFUs (10 pL)	26.31
BD2/human sputum	3h RT (ambient temp)	2.0 x 107 CFUs (100 pL)	21.78
1.0 Χ107 CFUs (50 pL)	23.46
2.0 x 106 CFUs (10 pL)	24.02

[00266] Conclusion

[00267] As can be seen in Table 19, the C₍ values obtained from the RD4 PCR are very similar in both frozen and non-frozen sputum samples spiked with aMTB. This is in

-6518628 line with results described by Holz et al. (2001) where freezing (-20C) did not affect sputum morphology or cell counts. Thus the STC compositions are not only ideally suited for use in areas where réfrigération is costly or inaccessible, but is also suitable for laboratory workflows where frozen storage is the norm. This example demonstrates

[0001] 5 broad utilityof the STC compositions. When samples containing hardy microorganisms such as Mycobacterium tuberculosis are mixed with STC compositions, the microorganisms are stabilized at a variety of storage conditions and they can be recovered many days post collection. The DNA can then be recovered for further use in molecular diagnostic assays.

[0001] 10 [00268] AH publications, patents and patent applications mentioned in this

Spécification are indicative of the level of skill of those skilled in the art to which this invention pertains and are herein incorporated by reference to the same extent as if each individual publication, patent, or patent applications was specifically and individually indicated to be incorporated by reference.

[0001] 15 [00269] The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the invention, and ail such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following daims.

[0001] 20 References:

[00270] Wilson ML (1996) General principles of specimen collection and transport. Clin Inf Dis 22: 766-777.

[00271] Parmasivan CN, Narayana AS, Prabhakar R, Rajagopal MS, Somasundaram PR, Tripathy SP (1983) Effect of storage of sputum specimens at room

[0001] 25 température on smear and culture results. Tubercle 64(2): 119-124.

[00272] Effthimiadis A, Jayaram L, Weston S, Carruthers, S, Hargreave FE (2002) Induced sputum: Time from expectoration to Processing. EurRespirJ 19: 706-708.

[00273] Burdz TV, Wolfe J, Kabani A (2003) Evaluation of sputum decontamination methods for Mycobacterium tuberculosis using viable colony counts and flow cytometry.

[0001 ] 30 Diagn Microbiol Infect Dis 47: 503-509.

-6618628

[00274] Holz O, Mücke M, Zarza P, Loppow D, Jôrres RA, Magnussen H (2001) Freezing of homogenized sputum samples for intermittent storage. Clin Exp Allergy 31: 1328-1331.

[00275] Popov TA, Petlichkovski A, Mustakov TB, DuBushe LM, Popova DN [0001] 5 (2004) Assessment of a protocol for sputum freezing and subséquent examination. J

Allergy Clin Immunol 113: S193.

[00276] Kelly MM, Hargreave FE, Cox GE (2003) A method to preserve sputum for delayed examination. Eur Respir J 22: 996-1000.

[00277] Dorman SC, Bussoli MA, Ritz SA (2010) Alcohol fixation of induced [0001] 10 sputum samples for applications in rural communities. Can Respir J 17(3): 115-121.

[00278] Silverstolpe L (1948) Fôrbâttrad metod for pâvisande av tuberkelbakterier. Nord Med 48: 2220-2222.

[00279] Lipsky BA, Gates J, Tenover FC, Plorde JJ (1984) Factors affecting clinical value of microscopy for acid-fast bacilli. Rev Infect Dis 6: 214-222.

[0001] 15 [00280] Krasnow I, Wayne LG (1966) Sputum digestion. I The mortality rate of tubercle bacilli in various digestion Systems. Am J Clin Pathol 45: 352-355.

[00281] Thornton CG, MacLellan KM, Brink TL JR, Lockwood DE, Romagnoli M, Turner J, Merz WG, Schwalbe RS, Moody M, Lue Y, Passen S (1998) Novel method for Processing respiratory specimens for détection of mycobacteria by using C18[0001] 20 carboxypropylbetaine: Blinded study. J Clin Microbiol 36(7): 1996-2003.

[00282] Kent PT, Kubica GP (1985) Public Health Microbiology, a Guide for the Level III Laboratory. Centers for Disease Control, Division of Laboratory Training and Consultation. Atlanta, GA, US Department of Health and Human Services, US Government Printing Office.

[0001] 25 [00283] Selvam JM, Wares F, Perumal M, Gopi PG, Sudha G, Chandrasekaran V,

Santha T (2007) Health-seeking behaviour of new smear-positive TB patients under a DOTS programme in Tamil Nadu, India. Int J Tuberc Lung Dis 11:161-167.

-6718628

[00284] Paramasivan CN, Narayana AS, Probhakar R, Rajagopal MS, Somasundaram PR, Tripathy SP (1983) Effect of storage of sputum specimens at room température on smear and culture results. Tubercle 64(2): 119-124.

[00285] Hammerschlag MR, Harding L, Macone A, Smith AL, Godlmann DA (1980) [0001] 5 Bacteriology of sputum in cystic fibrosis: Evaluation of dithiothreitol as a mucolytic agent.

J Clin Microbiol 11(6): 552-557.

[00286] Morris S, Bai GH, Suffys P, Portillo-Gomez L, Fairchok M, Rouse D (1995) Molecular mechanisms of multidrug résistance in clinical isolâtes of Mycobacterium tuberculosis. J Infect Dis 171: 954-960.

[0001] 10 [00287] Gopinath K and Singh S (2009) Multiplex PCR assay for simultaneous détection and différentiation of Mycobacterium tuberculosis, Mycobacterium avium complexes and other Mycobacterial species directly from clinical specimens. J Appl Microbiol 107: 425-435.

[00288] Park H, Jang H, Kim C, Chung B, Chang CL, Park SK, Song S (2000) [0001] 15 Détection and identification of mycobacteria by amplification of the internai transcribed spacer régions with genus and species-specific PCR primers. J Clin Microbiol 38: 40804085.

[00289] Telenti A, Marchesi F, Balz M, Bally F, Bottger EC, Bodmer T (1993) Rapid identification of mycobacteria to the species level by polymerase Chain reaction and

[0001] 20 enzyme analysis. J Clin Microbiol 31: 175-178.

[00290] US Centers for Disease Control and Prévention (CDC, 2009) Updated guidelines for the use of nucleic acid amplification tests in the diagnosis of tuberculosis. MMWR Morb Mortal Wkly Rep 58: 7-10.

[00291] Halse TA, Edwards J, Cunningham PL, Wolfgang WJ, Dumas NB, Escuyer [0001] 25 VE, Musser KA (2010) Combined real-time PCR and rpoB gene pyrosequencing for rapid identification of Mycobacterium tuberculosis and détermination of rifampin résistance directly in clinical specimens. J Clin Microbiol 48(4): 1182-1188.

Claims (30)

1. CLAI MS

   1. An ex vivo method for preserving viable hardy bacteria in a biological sample, comprising contacting the biological sample with a stabilization composition, wherein the stabilization composition comprises a chelating agent, a denaturing agent, a sait and has a pH between about 6 and about 11.
2. 2. The method of claim 1, wherein the hardy bacteria is a Mycobacteria, Bacillus anthracis, or Clostridium difficile.
3. 3. The method of claim 2, wherein the Mycobacteria is Mycobacterium tuberculosis and wherein the Bacillus anthracis is stabilized as spores.
4. 4. The method of any one of daims 1 - 3, wherein the biological sample is a mucoid bodily fluid, such as sputum or saliva.
5. 5. The method of any one of daims 1 - 4, wherein the chelating agent is ethylene glycol tetraacetic acid (EGTA), (2-Hydroxyethyl)ethylenediaminetriacetic acid (HEDTA), diethylene triamine pentaacetic acid (DTPA), nitrilotriacetic acid (NTA), ethylenediaminetriacetic acid (EDTA), cyclohexanediaminetetraacetic acid (CDTA), N,Nbis(carboxymethyl)glycine, citrate anhydrous, sodium citrate, calcium citrate, ammonium citrate, ammonium bicitrate, citric acid, diammonium citrate, ferrie ammonium citrate, lithium citrate, or any combination thereof.
6. 6. The method of any one of daims 1 - 5, wherein the denaturing agent is an anionic detergent, (such as, for example, sodium dodecyl sulfate (SDS), lithium dodecyl sulphate, sodium lauroyl sulfate (SLS)), a cationic detergent (such as, for example, cetyltrimethyl ammonium bromide (CTAB) or a nonionic detergent (such as, for example, Tween-20™, Triton X-100 ™, or Brij-58 ™).
7. 7. The method of any one of daims 1-6, wherein the composition comprises: (i) 2% SDS, 12.5 mM CDTA, 250 mM LiCI, 50 mM glycine and has pH 10.5; or (ii) 4% SDS, 50 mM CDTA, 250 mM LiCI, 140 mM LiOH and has pH 6.8.
8. 8. The method of any one of daims 1-7, wherein ail or a portion of the hardy bacteria remain stable following storage at room température, or ambient température or at a température within the range of from about 4°C to about 40°C for 1 day or more, 2

   -6918628 days or more, 3 days or more, 4 days or more, 5 days or more, 6 days or more or 7 days or 1 month or more.
9. 9. An ex vivo method for liquefying a biological sample and preserving viable hardy 5 bacteria in said sample, comprising contacting the biological sample with a stabilization composition, wherein the stabilization composition comprises a chelating agent, a denaturing agent, a sait and has a pH between 6 and 11, wherein the stabilization composition préserves the viable hardy bacteria in the biological sample.
10. 10 10. The method of claim 9, wherein the biological sample is a mucoid bodily fluid, such as sputum or saliva.
11. 11. The method of claim 9 or 10, wherein the chelating agent is ethylene glycol tetraacetic acid (EGTA), (2-Hydroxyethyl)ethylenediaminetriacetic acid (HEDTA), 15 diethylene triamine pentaacetic acid (DTPA), nitrilotriacetic acid (NTA), ethylenediaminetriacetic acid (EDTA), cyclohexanediaminetetraacetic acid (CDTA), N,Nbis(carboxymethyl)glycine, citrate anhydrous, sodium citrate, calcium citrate, ammonium citrate, ammonium bicitrate, citric acid, diammonium citrate, ferrie ammonium citrate, lithium citrate, or any combination thereof.
12. 12. The method of any one of daims 9-11, wherein the denaturing agent is an anionic detergent, (such as, for example, sodium dodecyl sulfate (SDS), lithium dodecyl sulphate, sodium lauroyl sulfate (SLS)), a cationic detergent (such as, for example, cetyltrimethyl ammonium bromide (CTAB) or a nonionic detergent (such as, for example, 25 Tween-20 ™, Triton X-100 ™, or Brij-58 ™).
13. 13. The method of any one of daims 9-12, wherein the composition comprises: (i) 2% SDS, 12.5 mM CDTA, 250 mM LiCI, 50 mM glycine and has pH 10.5; or (ii) 4% SDS, 50 mM CDTA, 250 mM LiCI, 140 mM LiOH and has pH 6.8.
14. 14. An ex vivo method for stabilizing the microbiome within a biological sample comprising contacting the biological sample with a stabilization composition, wherein the stabilization composition comprises a chelating agent, a denaturing agent, a sait and has a pH between 6 and 11.
15. 15. The method of claim 14, wherein the biological sample is a mucoid biological fluid, such as sputum or saliva.

    -7018628
16. 16. The method of claim 14 or 15, wherein the chelating agent is ethylene glycol tetraacetic acid (EGTA), (2-Hydroxyethyl)ethylenediaminetriacetic acid (HEDTA), diethylene triamine pentaacetic acid (DTPA), nitrilotriacetic acid (NTA), ethylenediaminetriacetic acid (EDTA), cyclohexanediaminetetraacetic acid (CDTA), N,Nbis(carboxymethyl)glycine, citrate anhydrous, sodium citrate, calcium citrate, ammonium citrate, ammonium bicitrate, citric acid, diammonium citrate, ferrie ammonium citrate, lithium citrate, or any combination thereof.
17. 17. The method of any one of claims 14-16, wherein the denaturing agent is an anionic detergent, (such as, for example, sodium dodecyl sulfate (SDS), lithium dodecyl sulphate, sodium lauroyl sulfate (SLS)), a cationic detergent (such as, for example, cetyltrimethyl ammonium bromide (CTAB) or a nonionic detergent (such as, for example, Tween-20 ™, Triton X-100 ™, or Brij-58 ™).
18. 18. The method of any one of claims 14-17, wherein the composition comprises: (i) 2% SDS, 12.5 mM CDTA, 250 mM LiCI, 50 mM glycine and has pH 10.5; or (ii) 4% SDS, 50 mM CDTA, 250 mM LiCI, 140 mM LiOH and has pH 6.8.
19. 19. The method of any one of claims 14-18, wherein the stabilization composition préserves, in a viable State, hardy bacteria in a biological sample and reduces or éliminâtes other microbial growth in the sample.
20. 20. An ex vivo method for characterization of bacterial nucleic acid from viable hardy bacteria in a biological sample comprising said viable hardy bacteria, comprising:

    contacting the biological sample with a stabilization composition, wherein the stabilization composition comprises a chelating agent, a denaturing agent, a sait and has a pH between 6 and 11 ; and amplifying the nucleic acid in the sample, wherein the level of amplified nucleic acid remains substantially unchanged if the amplification step occurs immediately after collection, or later.
21. 21. The method of claim 20, wherein the biological sample is a mucoid biological fluid, such as, sputum or saliva.

    -71 18628
22. 22. The method of claim 20 or 21, wherein the chelating agent is ethylene glycol tetraacetic acid (EGTA), (2-Hydroxyethyl)ethylenediaminetriacetic acid (HEDTA), diethylene triamine pentaacetic acid (DTPA), nitrilotriacetic acid (NTA), ethylenediaminetriacetic acid (EDTA), cyclohexanediaminetetraacetic acid (CDTA), N,Nbis(carboxymethyl)glycine, citrate anhydrous, sodium citrate, calcium citrate, ammonium citrate, ammonium bicitrate, citric acid, diammonium citrate, ferrie ammonium citrate, lithium citrate, or any combination thereof.
23. 23. The method of any one of daims 20 - 22, wherein the denaturing agent is an anionic detergent, (such as, for example, sodium dodecyl sulfate (SDS), lithium dodecyl sulphate, sodium lauroyl sulfate (SLS)), a cationic detergent (such as, for example, cetyltrimethyl ammonium bromide (CTAB)) or a nonionic detergent (such as, for example, Tween-20 ™, Triton X-100 ™, or Brij-58 ™).
24. 24. The method of any one of daims 20 - 23, wherein the composition comprises: (i) 2% SDS, 12.5 mM CDTA, 250 mM LiCI, 50 mM glycine and has pH 10.5; or (ii) 4% SDS, 50 mM CDTA, 250 mM LiCI, 140 mM LiOH and has pH 6.8.
25. 25. A composition comprising:

    a chelating agent;

    a denaturing agent; and viable hardy microorganisms.
26. 26. The composition of claim 25, wherein the chelating agent is ethylene glycol tetraacetic acid (EGTA), (2-Hydroxyethyl)ethylenediaminetriacetic acid (HEDTA), diethylene triamine pentaacetic acid (DTPA), nitrilotriacetic acid (NTA), ethylenediaminetriacetic acid (EDTA), cyclohexanediaminetetraacetic acid (CDTA), N,Nbis(carboxymethyl)glycine, citrate anhydrous, sodium citrate, calcium citrate, ammonium citrate, ammonium bicitrate, citric acid, diammonium citrate, ferrie ammonium citrate, lithium citrate, or any combination thereof.
27. 27. The composition of claim 25 or 26, wherein the denaturing agent is an anionic detergent, (such as, for example, sodium dodecyl sulfate (SDS), lithium dodecyl sulphate, sodium lauroyl sulfate (SLS)), a cationic detergent (such as, for example, cetyltrimethyl ammonium bromide (CTAB), or a nonionic detergent (such as, for example, Tween-20 ™, Triton X-100 ™, or Brij-58 ™).

    -7218628
28. 28. The composition of any one of daims 25 - 27, wherein the composition comprises: (i) 2% SDS, 12.5 mM CDTA, 250 mM LiCI, 50 mM glycine and has pH 10.5; or (ii) 4% SDS, 50 mM CDTA, 250 mM LiCI, 140 mM LiOH and has pH 6.8.

    5
29. 29. The composition of any one of daims 25 - 28, wherein the hardy microorganism is a Mycobacteria, Bacillus anthracis, or Clostridium difficile.
30. 30. The composition of daim 29, wherein the Mycobacteria is Mycobacterium tuberculosis and wherein the Bacillus anthracis is in the form of spores.