OA18052A

OA18052A - Hepatitis B core protein allosteric modulators.

Info

Publication number: OA18052A
Application number: OA1201600348
Authority: OA
Inventors: William W. Turner; Lee Daniel Arnold; Hans Maag; Adam Zlotnick
Original assignee: Indiana University Research And Technology Corporation; Assembly Biosciences, Inc.
Priority date: 2014-03-13
Filing date: 2015-03-13
Publication date: 2018-04-06

Abstract

The present disclosure provides, in part, compounds having allosteric effector properties against Hepatitis B virus Cp. Also provided herein are methods of treating viral infections, such as hepatitis B, comprising administering to a patient in need thereof a disclosed compound.

Description

HEPATITIS B CORE PROTEIN ALLOSTERIC MODULATORS

STATEMENT OF GOVERNMENT SUPPORT

This invention was made with govemment support under AI067417 awarded by the National Institutes of Health. The govemment has certain rights in the invention.

RELATED APPLICATIONS

This application claims the benefit of and priority to United States Provisional Patent Applications serial nos. 61/952,467, filed March 13, 2014, and 62/010,025, fïled June 10, 2014, the contents of each of which are hereby incorporated by reference.

BACKGROUND

Hepatitis B (HBV) causes viral Hepatitis that can further lead to chronic liver disease and increase the risk of liver cirrhosis and liver cancer (hepatocellular carcinoma). Worldwide, about 2 billion people hâve been infected with HBV, around 360 million people are chronically infected, and every year HBV infection causes more than one half million deaths (2009; WHO, 2009). HBV can be spread by body fluids: from mother to child, by sex, and via blood products. Children bom to HBV positive mothers may also be infected, unless vaccinated at birth.

The virus particle is composed of a lipid enveloped studded with surface protein (HBsAg) that surrounds the viral core. The core is composed of a protein shell, or capsid, built of 120 core protein (Cp) dimers, which in tum contains the relaxed circular DNA (rcDNA) viral genome as well as viral and host proteins. In an infected cell, the genome is found as a covalently closed circular DNA (cccDNA) in the host cell nucléus. The cccDNA is the template for viral RNAs and thus viral proteins. In the cytoplasm, Cp assembles around a complex of full-length viral RNA (the so-called pregenomic RNA or pgRNA and viral polymerase (P). After assembly, P reverse transcribes the pgRNA to rcDNA within the confines of the capsid to generate the DNA-fïlled viral core. For convenience, we divide the assembly process at the point of capsid assembly and pgRNApackaging. Steps preceding this event are “upstream”; steps following RNA-packaging are “downstream”.

At présent, chronic HBV is primarily treated with nucleos(t)ide analogs (e.g. entecavir) that suppress the virus while the patient remains on treatment but do not eliminate the infection, even after many years of treatment. Once a patient starts taking nucléotide analogs most must continue taking them or risk the possibility of a life threatening immune response to viral rebound. Further, nucleos(t)ide therapy may lead to the emergence of antiviral drug résistance (Deres and RubsamenWaigmann, 1999; Tennant et al., 1998; Zhang et al., 2003) and - in rare patients- adverse events hâve been reported (Ayoub and Keeffe , 2011).

The only FDA approved alternative to nucleos(t)ide analogs is treatment with interferon a or pegylated interferon a. Unfortunately, the adverse event incidence and profile of interferon a can resuit in poor tolerability, and many patients are unable to complété therapy. Moreover, only a small percentage of patients are considered appropriate for interferon therapy, as only a small subset of patients are likely to hâve asustained clinical response to a course of interferon therapy. As a resuit, interferon based thérapies are used in only a small percentage of ail diagnosed patients who elect for treatment.

Thus, current HBV treatments can range from palliative to watchful waiting. Nucleos(t)ide analogs suppress virus production, treating the symptom, but leave the infection intact. Interferon a has severe side effects and less tolerability among patients and is successful as a fînite treatment strategy in only a small minority of patients. There is a clear on-going need for more effective treatments for HBV infections.

SUMMARY

Provided herein are compounds that can hâve properties such as those described below, where the compounds in some embodiments may be represented by:

R⁴ Ο r^!

N-L-R²

I

R^l Formula 1 ’ wherein R², R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, R¹⁰, R^L, Y, T, and L are defined herein. Also provided herein are methods of treating viral infections, such as hepatitis B, comprising administering to a patient a disclosed compound.

For example, the présent disclosure is directed in part to compounds having allosteric effector properties against Hepatitis B virus Cp, a protein found as a dimer, a multimer, and as the protein shell of the HBV core. Without being bound by theory, disclosed compounds may ultimately target multimerization of viral core proteins, which is central to HBV infection, where the core protein multimerizes into shell, or capsid, and/or disclosed compounds may for example, ultimately target interaction of viral core proteins with other macromolecules, such as host or viral nucleic acid, host proteins, or other viral proteins. For example, disclosed compounds may be considered in some embodiments CpAM — core protein allosteric modifîers. CpAM interaction with core protein can allosterically favor an assembly-active form of Cp dimer and lead to viral capsid assembly at an inappropriate time or place or lead to non-standard intersubunit interactions, ail resulting in defective capsids. CpAMs may additionally or altematively affect steps of “upstream” of capsid assembly by altering the concentrations or nature of Cp available as dimer as compared to capsid or other multimeric forms. Disclosed compounds or CpAMs may, in some embodiments, noticeably affect functions upstream of viral assembly such as modulation of cccDNA transcription, RNA stability and/or protein-protein interactions.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 illustrâtes synthetic scheme 1.

Figure 2 illustrâtes synthetic scheme 2.

DETAILED DESCRIPTION

The features and other details of the disclosure will now be more particularly described. Before further description of the présent invention, certain ternis employed in the spécification, examples and appended claims are collected here. These définitions should be read in light of the remainder of the disclosure and as understood by a person of skill in the art. Unless defined otherwise, ail technical and scientific terms used herein hâve the same meaning as commonly understood by a person of ordinary skill in the art.

Définitions

As intended herein, the terms a and an include singular as well as plural references unless the context clearly dictâtes otherwise. For example, the term an assembly effector can include one or more such effectors.

The term “alkyl” as used herein refers to a saturated straight or branched hydrocarbon. Exemplary alkyl groups include, but are not limited to, straight or branched hydrocarbons of 1-6, 1-4, or 1-3 carbon atoms, referred to herein as Ci^alkyl, Cj^alkyl, and Ci^alkyl, respectively. Exemplary alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, 2-methyl-l-butyl, 3-methyl2-butyl, 2-methyl-l-pentyl, 3-methyl-1-pentyl, 4-methyl-l-pentyl, 2-methyl-2-pentyl, 3-methyl-2pentyl, 4-methyl-2-pentyl, 2,2-dimethyl-l-butyl, 3,3-dimethyl-l-butyl, 2-ethyl-l-butyl, butyl, isobutyl, t-butyl, pentyl, isopentyl, neopentyl, hexyl, etc.

The term “alkenyl” as used herein refers to an unsaturated straight or branched hydrocarbon having at least one carbon-carbon double bond. Exemplary alkenyl groups include, but are not limited to, a straight or branched group of 2-6 or 3-4 carbon atoms, referred to herein as C2-6alkenyl, and C3. 4alkenyl, respectively. Exemplary alkenyl groups include, but are not limited to, vinyl, allyl, butenyl, pentenyl, etc.

The term “alkoxy” as used herein refers to a straight or branched alkyl group attached to oxygen (alkyl-O-). Exemplary alkoxy groups include, but are not limited to, alkoxy groups of 1-6 or 2-6 carbon atoms, referred to herein as Ci.₆alkoxy, and C₂-6alkoxy, respectively. Exemplary alkoxy groups include, but are not limited to methoxy, ethoxy, isopropoxy, etc.

The term “alkynyl” as used herein refers to an unsaturated straight or branched hydrocarbon having at least one carbon-carbon triple bond. Exemplary alkynyl groups include, but are not limited to, straight or branched groups of 2-6, or 3-6 carbon atoms, referred to herein as C2-6alkynyl, and C3. ôalkynyl, respectively. Exemplary alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, pentynyl, hexynyl, methylpropynyl, etc.

The ternis “cycloalkyl” or a “carbocyclic group” as used herein refers to a saturated or partially unsaturated hydrocarbon group of, for example, 3-6, or 4-6 carbons, referred to herein as C3. ôcycloalkyl or C^cycloalkyl, respectively. Exemplary cycloalkyl groups include, but are not limited to, cyclohexyl, cyclopentyl, cyclopentenyl, cyclobutyl or cyclopropyl.

The tenus “halo” or “halogen” as used herein refer to F, Cl, Br, or I.

The terms “heteroaryl” or “heteroaromatic group” as used herein refers to a monocyclic aromatic 56 membered ring system containing one or more heteroatoms, for example one to three heteroatoms, such as nitrogen, oxygen, and sulfur. Where possible, said heteroaryl ring may be linked to the adjacent radical though carbon or nitrogen. Examples of heteroaryl rings include but are not limited to furan, thiophene, pyrrole, thiazole, oxazole, isothiazole, isoxazole, imidazole, pyrazole, triazole, pyridine or pyrimidine etc.

The terms “heterocyclyl” or “heterocyclic group” are art-recognized and refer to saturated or partially unsaturated 4-7 membered ring structures, whose ring structures include one to three heteroatoms, such as nitrogen, oxygen, and sulfur. Where possible, heterocyclyl rings may be linked to the adjacent radical through carbon or nitrogen. Examples of heterocyclyl groups include, but are not limited to, pyrrolidine, piperidine, morpholine, thiomorpholine, piperazine, oxetane, azetidine, tetrahydrofuran or dihydrofuran etc

The terms “hydroxy” and “hydroxyl” as used herein refers to the radical -OH.

Treatment as used herein includes the alleviation, prévention, reversai, amelioration or control of a pathology, disease, disorder, process, condition or event, including viral infection. In this context, the term treatment is further to be understood as embracing the use of a drug to inhibit, block, reverse, restrict or control progression of viral infection.

As used herein, the terni “pharmaceutical composition” refers to compositions of matter comprising at least one pharmaceutical compound and optionally a pharmaceutically acceptable carrier.

As used herein, the term “pharmaceutical compound” or “drug” refers to a free compound, its therapeutically suitable salts, solvatés such as hydrates, spécifie crystal forms of the compound or its salts, or therapeutically suitable prodrugs of the compound.

Pharmaceutically or pharmacologically acceptable” include molecular entities and compositions that do not produce an adverse, allergie or other untoward reaction when administered to an animal, or a human, as appropriate. For human administration, préparations should meet sterility, pyrogenicity, and general safety and purity standards as required by FDA Office of Biologics standards.

The term “pharmaceutically acceptable carrier” or “pharmaceutically acceptable excipient” as used herein refers to any and ail solvents, dispersion media, coatings, isotonie and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The compositions may also contain other active compounds providing supplémentai, additional, or enhanced therapeutic functions.

The compounds of the disclosure may contain one or more chiral centers and, therefore, exist as stereoisomers. The term “stereoisomers” when used herein consist of ail enantiomers or diastereomers. These compounds may be designated by the symbols “(+),” “R” or “S,” depending on the configuration of substituents around the stereogenic carbon atom, but the skilled artisan will recognize that a structure may dénoté a chiral center implicitly. The présent invention encompasses various stereoisomers of these compounds and mixtures thereof. Mixtures of enantiomers or diastereomers may be designated “(±)” in nomenclature, but the skilled artisan will recognize that a structure may dénoté a chiral center implicitly.

The compounds of the disclosure may contain one or more double bonds and, therefore, exist as géométrie isomers resulting from the arrangement of substituents around a carbon-carbon double bond. The symbol = dénotés a bond that may be a single, double or triple bond as described herein. Substituents around a carbon-carbon double bond are designated as being in the “Z” or configuration wherein the terms “Z” and are used in accordance with IUPAC standards. Unless otherwise specified, structures depicting double bonds encompass both the and “Z” isomers.

Substituents around a carbon-carbon double bond altematively can be referred to as “cis” or “trans,” where “cis” represents substituents on the same side of the double bond and “trans” represents substituents on opposite sides of the double bond.

Compounds of the disclosure may contain a carbocyclic or heterocyclic ring and therefore, exist as géométrie isomers resulting from the arrangement of substituents around the ring. The arrangement of substituents around a carbocyclic or heterocyclic ring are designated as being in the “Z” or “E” configuration wherein the terms “Z” and “E” are used in accordance with IUP AC standards. Unless otherwise specified, structures depicting carbocyclic or heterocyclic rings encompass both “Z” and “E” isomers. Substituents around a carbocyclic or heterocyclic ring may also be referred to as “cis” or “trans”, where the term “cis” represents substituents on the same side of the plane of the ring and the term “trans” represents substituents on opposite sides of the plane of the ring. Mixtures of compounds wherein the substituents are disposed on both the same and opposite sides of plane of the ring are designated “cis/trans.”

Individual enantiomers and diasteriomers of compounds of the présent invention can be prepared synthetically from commercially available starting materials that contain asymmetric or stereogenic centers, or by préparation of racemic mixtures followed by resolution methods well known to those of ordinary skill in the art. These methods of resolution are exemplified by (1) attachment of a mixture of enantiomers to a chiral auxiliary, séparation of the resulting mixture of diastereomers by recrystallization or chromatography and libération of the optically pure product from the auxiliary, (2) sait formation employing an optically active resolving agent, (3) direct séparation of the mixture of optical enantiomers on chiral liquid chromatographie columns or (4) kinetic resolution using stereoselective chemical or enzymatic reagents. Racemic mixtures can also be resolved into their component enantiomers by well known methods, such as chiral-phase liquid chromatography or crystallizing the compound in a chiral solvent. Stereoselective synthèses, a chemical or enzymatic reaction in which a single reactant forms an unequal mixture of stereoisomers during the création of a new stereocenter or during the transformation of a pre-existing one, are well known in the art. Stereoselective synthèses encompass both enantio- and diastereoselective transformations, and may involve the use of chiral auxiliaries. For examples, see Carreira and Kvaemo, Classics in Stereoselective Synthesis, Wiley-VCH: Weinheim, 2009.

The compounds disclosed herein can exist in solvated as well as unsolvated forms with pharmaceutically acceptable solvents such as water, éthanol, and the like, and it is intended that the invention embrace both solvated and unsolvated forms. In one embodiment, the compound is amorphous. In one embodiment, the compound is a single polymorph. In another embodiment, the compound is a mixture of polymorphs. In another embodiment, the compound is in a crystalline form.

The invention also embraces isotopically labeled compounds of the invention which are identical to those recited herein, except that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine and chlorine, such as ²H, ³H, ¹³C, ¹⁴C, ¹⁵N, ¹⁸O, ¹⁷O, ³¹P, ³²P, ³⁵S, ¹⁸F, and ³⁶Cl, respectively. For example, a compound of the invention may hâve one or more H atom replaced with deuterium.

Certain isotopically-labeled disclosed compounds (e.g., those labeled with ³H and ¹⁴C) are useful in compound and/or substrate tissue distribution assays. Tritiated (i.e., ³H) and carbon-14 (i.e., ¹⁴C) isotopes are particularly preferred for their ease of préparation and detectability. Further, substitution with heavier isotopes such as deuterium (i.e., ²H) may afford certain therapeutic advantages resulting from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements) and hence may be preferred in some circumstances. Isotopically labeled compounds of the invention can generally be prepared by following procedures analogous to those disclosed in the examples herein by substituting an isotopically labeled reagent for a nonisotopically labeled reagent.

The term therapeutically suitable sait, refers to salts or zwitterions of pharmaceutical compounds which are water or oil-soluble or dispersible, suitable for treatment of disorders and effective for their intended use. The salts may be prepared, for instance, during the final isolation and purification of the compounds or separately by reacting an amino group of the compounds with a suitable acid. For example, a compound may be dissolved in a suitable solvent, such as but not limited to methanol and water, and treated with at least one équivalent of an acid, for instance hydrochloric acid. The resulting sait may precipitate out and be isolated by filtration and dried under reduced pressure. Altematively, the solvent and excess acid may be removed under reduced pressure to provide the sait. Représentative salts include acetate, adipate, alginate, citrate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, camphorate, camphorsulfonate, digluconate, glycérophosphate, hemisulfate, heptanoate, hexanoate, form ate, isethionate, fumarate, lactate, maleate, methanesulfonate, naphthylenesulfonate, nicotinate, oxalate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, oxalate, maleate, pivalate, propionate, succinate, tartrate, trichloroacetate, trifluoroacetate, glutamate, para-toluenesulfonate, undecanoate, hydrochloric, hydrobromic, sulfuric, phosphoric, and the like. The amino groups of a compound may also be quatemized with alkyl chlorides, bromides, and iodides such as methyl, ethyl, propyl, isopropyl, butyl, lauryl, myristyl, stearyl, and the like.

Basic addition salts may be prepared, for instance, during the final isolation and purification of pharmaceutical compounds by reaction of a carboxyl group with a suitable base such as the hydroxide, carbonate, or bicarbonate of a métal cation such as lithium, sodium, potassium, calcium, magnésium, or aluminum, or an organic primary, secondary, or tertiary amine. Quatemary amine salts may derived, for example, from methylamine, dimethylamine, trimethylamine, triethylamine, diethylamine, ethylamine, tributylamine, pyridine, Ν,Ν-dimethylaniline, N-methylpiperidine, Nmethylmorpholine, dicyclohexylamine, procaine, dibenzylamine, Ν,Ν-dibenzylphenethylamine, 1ephenamine, and Ν,Ν'-dibenzylethylenediamine, ethylenediamine, ethanolamine, diethanolamine, piperidine, piperazine, and the like.

The term “therapeutically suitable prodrug,” refers to those prodrugs or zwitterions which are suitable for use in contact with the tissues of subjects and are effective for their intended use. The term “prodrug” refers to compounds that are transformed in vivo to a pharmaceutical compound, for example, by hydrolysis in blood. The term “prodrug,” refers to compounds that contain, but are not limited to, substituents known as “therapeutically suitable esters.” The term “therapeutically suitable ester,” refers to alkoxycarbonyl groups appended to the parent molécule on an available carbon atom. More specifically, a “therapeutically suitable ester,” refers to alkoxycarbonyl groups appended to the parent molécule on one or more available aryl, cycloalkyl and/or heterocycle groups. Compounds containing therapeutically suitable esters are an example, but are not intended to limit the scope of compounds considered to be prodrugs. Examples of prodrug ester groups include pivaloyloxymethyl, acetoxymethyl, phthalidyl, indanyl and methoxymethyl, as well as other such groups known in the art. Other examples of prodrug ester groups are found in T. Higuchi and

V. Stella, Pro-drugs as Novel Delivery Systems, Vol. 14 of the A.C.S. Symposium Sériés, and in Edward B. Roche, ed., Bioreversible Carriers in Drug Design, American Pharmaceutical Association and Pergamon Press, 1987, both of which are incoiporated herein by reference.

The terms pharmaceutically effective amount and “effective amount”, as used herein, refer to an amount of a pharmaceutical formulation that will elicit the desired therapeutic effect or response when administered in accordance with the desired treatment regimen. US2011/0144086 describes the use of some diabenzothiazepine molécules (DBTs) as anti-malarial “inhibitors of the plasmodial surface anion channel.” However, no study of DBT molécules as anti-virais has yet been reported.

1. Disclosed compounds contemplated herein may in some embodiments be represented by Formula 1:

Formula 1 wherein:

T is selected from the group consisting of-C(O)-, -CH2-C(O)-, -N(C(O)-CH3)-, -NH-, -O-, and -S(O)_Z-, where z is 0, 1 or 2;

Y is C(Rⁿ)₂ , S(O)_y, NRy and O wherein y is 0, 1, or 2;

Ry is selected from the group consisting of H, methyl, ethyl, propyl, phenyl and benzyl;

Rl is selected from the group consisting of H, methyl, and -C(O)-Ci-3alkyl;

L is a bond or Cm straight chain alkylene optionally substituted by one or two substituents each independently selected from the group consisting of methyl (optionally substituted by halogen or hydroxyl), ethenyl, hydroxyl, NR’R”, phenyl, heterocycle, and halogen and wherein the Cm straight chain alkylene may be interrupted by an -O-;

R² is selected from the group consisting of H, phenyl or naphthyl (wherein the phenyl or naphthyl may be optionally substituted with one, two , three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, C2-6alkenyl, C2-6alkynyl, Ci_6alkoxy, NR’R”, -C(O)- NR’R”, -C(O)-Ci. ealkyl, -C(O)-Ci_6alkoxy, phenyl (optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, cyano, Ci-ôalkyl, C₂. ealkenyl, C₂.₆alkynyl, Cj-galkoxy, NR’R”, C(O)- NR’R”, -C(O)-Ci_₆alkyl, -C(O)-C_walkoxy, S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), S(O)_W-NR’R” (where w is 1, 2 or 3),-NR’-S(O)_w, and S(O)_w-NR’R”(where w is 1, 2 or 3)), heteroaryl (optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci^alkyl, C₂.₆alkenyl, C₂.₆alkynyl, Ci_₆alkoxy, NR’R”, C(O)- NR’R”, -C(O)-Ci_₆alkyl, -C(O)-Ci.₆alkoxy, S(O)_w-C!.6alkyl (where w is 1, 2 or 3), NR’-S(O)_W, and -S(O)_w-NR’R”(where w is 1, 2 or 3)), C₃. ôcycloalkyl, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), -S(O)_W-NR’R” (where w is 1, 2 or 3), and NR’-S(O)_W, (where w is 1, 2 or 3)),

5-6 membered heteroaryl having one, two, or three heteroatoms each independently selected from O, N and S (wherein the 5-6 membered heteroaryl may be optionally substituted on a carbon with one, two , three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci_galkyl, C2_6alkenyl, C₂-6alkynyl, Ci.galkoxy, phenyl (optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci^alkyl, C₂-6alkenyl, C₂-6alkynyl, Cj-ôalkoxy, NR’R”, C(O)- NR’R”, -C(O)-Ci_₆alkyl, C(O)-OH, -C(O)-Ci_6alkoxy, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), -NR’-S(O)_W, and -S(O)_WNR’R”(where w is 1, 2 or 3)), heteroaryl, heterocycle, NR’R”, -C(O)- NR’R”, -C(O)-Ci.₆alkyl, C(O)-C!.6alkoxy, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), -NR’-S(O)_W, and -S(O)_W-NR’R”(where w is 1, 2 or 3), and on a nitrogen by R’),

Ci-ôalkyl, Ci_6alkoxy, C₂-6alkenyl, C₃_iocycloalkyl (optionally substituted with one, two , three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, NR’R”, -C(O)- NR’R”, =CNR’, Ci_₆alkyl, Ci_₆alkoxy, -C(O)-Ci_₆alkyl, and -C(O)-Ci_ ôalkoxy, and wherein the C₃_iocycloalkyl may optionally be a bridged cycloalkyl)), and a 4-6 membered heterocycloalkyl having one or two heteroatoms each independently selected from O, N and S (wherein the 4-6 membered heterocycloalkyl may be optionally substituted with one, two , three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, NR’R”, -C(O)- NR’R”, Cj^alkyl, Ci_6alkoxy, -C(O)-Ci-6alkyl, and -C(O)-Ci_6alkoxy);

R’ is selected, independently for each occurrence, from H, methyl, ethyl, propyl, phenyl, and benzyl;

R” is selected, independently for each occurrence, from H, methyl, ethyl, propyl, butyl, carboxybenzyl, -C(O)-methyl and -C(O)-ethyl, or R’ and R” taken together may form a 4-6 membered heterocycle;

each of moieties R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, R¹⁰, and R¹¹ are independently selected for each occurrence from the group consisting of hydrogen, Ci^alkyl, C2-6alkenyl, C2-6alkynyl, halogen, hydroxyl, nitro, cyano, NR’R”, -C(O)- NR’R”, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), -NR’S(O)_W; and -S(O)_W-NR’R”(where w is 0, 1 or 2), Ci-6alkoxy,-C(O)-OH, -C(O)-Ci-6alkyl, and C(O)-Ci_6alkoxy;

wherein for each occurrence, Ci^alkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, C₂.6alkenyl, C₂-6alkynyl, Ci„6alkoxy, phenyl, NR’R”, -C(O)- NR’R”, S(O)_w-methyl (where w is 1, 2 or 3), -NR’-S(O)_W; and S(O)_W-NR’R”(where w is 0, 1 or 2); Ci-galkoxy may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, phenyl, NR’R”, -C(O)-NR’R”, S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), -NR’-S(O)_W; and S(O)_W-NR’R” (where w is 0, 1 or 2); and C3_6cycloalkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, Ci_6alkoxy, -C(O)-Ci-6alkyl, -C(O)-Ci-6alkoxy, and NR’R”; and pharmaceutically acceptable salts thereof.

For example, in certain embodiments, L may be selected from the group consisting of a bond, -CH2, -CH2-CH2-, or CH₂(CH2)-CH₂-. For example, in certain embodiments, L is C2-3alkylene, or in other embodiments, L is selected from the group consisting of-CH₂-CH2-, -CH2(CH2)-CH2-, -CH2CH₂(OH)-, -CH2-CH2(CH₃OH)-, and -CH₂-CH₂(OH)-CH2-. L may be a bond, or for example, L may be C2-3alkylene-O-. For example, L may be -O-CH2-CH2(OH)-, -CFL-CFLÎCFLOH)-, or — CH2-CH2(OH)-CH2-. In other embodiments, L is -O-.

Y, in certain embodiments, may be S(0)_y (where y is 0, 1 or 2), or NRy. In certain embodiments y is 0 or 2, for example, Y may be S.

In certain other embodiments, R² is phenyl, for example, R² may be phenyl substituted by Ci^alkyl or Ci-ôalkoxy. In other embodiments, R² is phenyl substituted by one or two substituents each selected from the group consisting of fluorine, chlorine, Ci^alkyl (optionally substituted by one, two or three fluorines), Ci_6alkoxy (optionally substituted by one, two or three fluorines), hydroxyl, NR’R”, -S(O)2-NR’R”, heteroaryl, and phenyl (optionally substituted by halogen or hydroxyl). For example, R² may be phenyl substituted by an 5-6 membered heteroaryl selected from the group consisting of:

an exemplary embodiment R² is phenyl substituted by

Tn other embodiments, R² may be a 5-6 membered heteroaryl, for example, R² may be selected from the group consisting of:

In another embodiment, R may be a 4-6 membered heterocycloalkyl, which may be optionally substituted as described above. For example, R² may be selected from the group consisting of:

wherein R³² is selected from the group consisting of H, halogen, phenyl, and Cj-galkyl (optionally substituted by one, two or three halogens); R⁵² is selected from the group consisting of H, halogen, phenyl, and Ci^alkyl (optionally substituted by one, two or three halogens); and R⁴² is selected from the group consisting of H, halogen, phenyl, Ci_6alkyl (optionally substituted by one, two or three halogens), Ci_6alkoxy (optionally substituted by one, two or three halogens), NH₂, -OCH3, NHCH3, andN(CH₃)₂.

R⁴², in some embodiments, may be independently selected for each occurrence from the group consisting of H, methyl, ethyl, propyl, -CF₃, -CH₂CH₃, Cl, F, phenyl, -NH₂, -OCH3, NHCH₃, and

N(CH₃)₂.

In other embodiments, e.g. when R² is a heteroaryl, R² may be optionally substituted on a carbon by one or two substitutents each selected from the group consisting of fluorine, chlorine, phenyl, -NH_2;

NH Ci-6alkyl, and N(Ci-6alkyI)₂, Ci-ôalkyl, and Ci-ôalkoxy. In certain embodiments, R^{5 * * * * 10 11 * * * 15} is CH₂ or CH₂(CH3)Also contemplated herein is a compound of formula 1 or Γ wherein R² is a 4-6 membered heterocycloalkyl or C4-6cycloalkyl, for example, R² is selected from the group of: tetrahydropyranyl, tetrahydrofuran, cyclopentane, cyclohexane, and cyclobutane. In an embodiment, R² is selected from the group consisting of:

A compound represented by:

is also contemplated herein, wherein

Y is S(O)_y, wherein y is 0, 1,2;

L is a bond or ϋμ straight chain alkylene optionally substituted by one or two substituents each independently selected from the group consisting of methyl (optionally substituted by halogen or hydroxyl), hydroxyl and halogen;

R² is selected from phenyl optionally substituted with one, two , three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci_6alkyl, C₂. ealkenyl, C₂.₆alkynyl, Ci_₆alkoxy, NR’R”, -C(O)- NR’R”, -C(O)-Ci_₆alkyl, -C(O)-C_walkoxy, phenyl (optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci-ôalkyl, C2-6alkenyl, C2-6alkynyl, Ci_6alkoxy, NR’R”, C(O)- NR’R”, -C(O)-Ci_6alkyl, -C(O)-Ci-6alkoxy, -S(O)_w-Ci-6alkyl (where w is 1, 2 or 3), NR’S(O)_W, and -S(O)_W-NR’R”(where w is 1, 2 or 3)), 5-6 membered heteroaryl having one, two, or three heteroatoms each independently selected from O, N and S (optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci.₆alkyl, C₂.₆alkenyl, C₂.₆alkynyl, Ci_₆alkoxy, NR’R”, C(O)-NR’R”, -C(O)-Ci_₆alkyl, -C(O)-Ci_ ₆alkoxy, -S(O)_w-Ci_₆alkyl (where w is 1, 2 or 3), -NR’-S(O)_W, and -S(O)_w-NR’R”(where w is 1, 2 or 3)), C3_6cycloalkyl, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), S(O)_W-NR’R” (where w is 1, 2 or 3), and -NR’-S(O)_W, (where w is 1, 2 or 3)), and a 5-6 membered heteroaryl having one, two, or three heteroatoms each independently selected from O, N and S (wherein the 5-6 membered heteroaryl may be optionally substituted on a carbon with one, two , three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci-galkyl, C2-6alkenyl, C₂-6alkynyl, Ci-6alkoxy, phenyl (optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Cj^alkyl, C₂.âalkenyl, C2-6alkynyl, Cj. ealkoxy, NR’R”, C(O)- NR’R”, -C(O)-Ci.₆alkyl, -C(O)-Ci_₆alkoxy, -S(O)_w-Ci.₆alkyl (where w is 1, 2 or 3), S(O)_W-NR’R” (where w is 1, 2 or 3),-NR’-S(O)_w, and -S(O)_w-NR’R”(where w is 1, 2 or 3)), heteroaryl, heterocycle, NR’R”, -C(O)-NR’R”, -C(O)-Ci.₆alkyl, -C(O)-C_walkoxy, -S(O)_w-Ci. 6alkyl (where w is 1,2 or 3),-NR’-S(O)_w, and -S(O)_w-NR’R”(where w is 1, 2 or 3), and on a nitrogen by R’);

R’ is selected, independently for each occurrence, from H, methyl, ethyl, and propyl,

R” is selected, independently for each occurrence, from H, methyl, ethyl, propyl, butyl, C(O)-methyl and -C(O)-ethyl, or R’ and R’ ’ taken together may form a 4-6 membered heterocycle;

each of moieties R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, R¹⁰, and R¹¹ are independently selected for each occurrence from the group consisting of hydrogen, Ci^alkyl, C2-6alkenyl, C2-6alkynyl, halogen, hydroxyl, nitro, cyano, NR’R”, -C(O)- NR’R”, -S(O)_w-Ci_₆alkyl (where w is 1, 2 or 3), NR’-S(O)_Wjand S(O)_W-NR’R”(where w is 0, 1 or 2), Ci_6alkoxy,-C(O)-OH, -C(O)-Ci-6alkyl, and -C(O)-Ci_ ëalkoxy;

wherein for each occurrence, Ci^alkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, C₂_6alkenyl, C₂.₆alkynyl, Ci.₆alkoxy, phenyl, NR’R”, -C(O)- NR’R”, S(O)_w-methyl (where w is 1, 2 or 3), -NR’-S(O)_W> and S(O)_W-NR’R”(where w is 0, 1 or 2); Ci_₆alkoxy may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci_6alkyl, phenyl, NR’R”, -C(O)- NR’R”, S(O)_w-C!.6alkyl (where w is 1, 2 or 3), -NR’-S(O)_W> and S(O)_W-NR’R” (where w is 0, 1 or 2); and C3_6cycloalkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, Ci-6alkoxy, -C(O)-Ci-6alkyl, -C(O)-Ci_6alkoxy, and NR’R” and pharmaceutically acceptable salts thereof.

In some embodiments, compounds of Formula 1, Γ and/or 1” may hâve R⁷ selected from H and F; and/or R⁶ is selected from H and F; and/or R⁵ is selected from H and F. In some embodiments, compounds of Formula 1,1’ and/or 1” may hâve R¹⁰ selected from the group consisting of H, methyl and F and/or R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, R¹⁰, and/or R¹¹ may be H.

In another embodiment, a compound represented by Formula 2 is provided:

wherein

R^m and R^m are each independently selected from the group consisting of H, halogen, Cj. ôalkyl (optionally substituted by one, two or three substituents each independently selected from halogen and hydroxyl), NR’R’ ’, and hydroxyl;

R²² is selected for each occurrence from the group consisting of H, halogen, hydroxyl, nitro, cyano, carboxy, Cj-galkyl, C2-6alkenyl, C2-6alkynyl, Ci_6alkoxy, NR’R”, -C(O)-Ci_6alkyl, C(O)-Ci_6alkoxy, phenyl, heteroaryl, C3_6cycloalkyl, -S(O)_w-Ci.6alkyl (where w is 1, 2 or 3), -S(O)_WNR’R” (where w is 1, 2 or 3), and -NR’-S(O)_W, (where w is 1, 2 or 3));

R’ is selected, independently for each occurrence, from H, methyl, ethyl, and propyl;

R” is selected, independently for each occurrence, from H, methyl, ethyl, propyl, butyl, -C(O)-methyl and -C(O)-ethyl, or R’ and R” taken together with the nitrogen to which they are attached may form a 4-6 membered heterocycle;

each of moieties R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, and R¹⁰ is independently selected for each occurrence from the group consisting of hydrogen, Ci^alkyl, C2-6alkynyl, C2-6alkenyl, halogen, hydroxyl, nitro, cyano, andNR’R”;

wherein for each occurrence, Ci^alkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, C₂-6alkenyl, C₂-6alkynyl, Ci_₆alkoxy, NR’R”, -NR’-S(O)_W, and S(O)_W-NR’R”; Ci.₆alkoxy may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, NR’R”, -NR’-S(O)_W) and S(O)_W-NR’R”; C3. ôcycloalkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, Ci_6alkoxy, -C(O)-Ci-6alkyl, -C(O)-Ci_6alkoxy, and NR’R”; phenyl may be optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci-ôalkyl, C₂.₆alkenyl, C₂.₆alkynyl, Ci.₆alkoxy, NR’R”, C(O)-NR’R”, -C(O)-Ci_₆alkyl, -C(O)-Ci.₆alkoxy, 5 S(0)_w-Ci_6alkyl (where w is 1, 2 or 3), NR’-S(O)_W, and -S(O)_w-NR’R”(where w is 1, 2 or 3), and heteroaryl may be optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci^alkyl, C₂_6alkenyl, C3_6cycloalkyl, C₂. ealkynyl, Ci_₆alkoxy, NR’R”, C(O)-NR’R”, -C(O)-Ci_₆alkyl, -C(O)-Ci_₆alkoxy, -S(O)_w-Ci.₆alkyl (where w is 1, 2 or 3), NR’-S(O)_W, and -S(O)_w-NR’R”(where w is 1, 2 or 3)), C₃_6cycloalkyl; and pharmaceutically acceptable salts thereof.

For example, a compound of Formula 2 may hâve R is selected from H and F; and/or R is selected from H and F; and/or R⁵ is selected from H and F; and/or R¹⁰ is selected from the group consisting of H, methyl and F; and/or each of R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, R¹⁰, and R¹¹ may be H.

For example, provided herein is a compound represented by

, wherein the R moieties are described above. For example, in an embodiment, provided herein is a compound represented by:

O

wherein R²² for example,is selected from the group consisting of:

OI

and “MX, >

R'

Also provided are compounds of Formula 3:

Formula 3

3 wherein the moiety R is selected from the group consisting of phenyl and naphthyl. R is optionally substituted with one or more substituents selected from the group consisting of halogen, hydroxyl, cyano, carboxy, alkoxy, amino-cycloalkyl, phenyl, carbonyl-alkoxy, sulfonyl-alkyl, sulfonyl-amino, and sulfonyl-amino-alkyl.

In addition, compounds of Formula 4 are provided:

Formula 4

wherein moiety R⁴ is selected from the group consisting of pyridinyl, pyrimidinyl, thiazolyl, oxazolyl, piperidinyl, and piperazinyl. R⁴ may be optionally substituted with one or more substituents selected from the group consisting of halogen, hydroxyl, cyano, carboxy, alkoxy, 15 amino-cycloalkyl, phenyl, carbonyl-alkoxy, sulfonyl-alkyl, sulfonyl-amino, and sulfonylaminoalkyl.

In another embodiment, a compound represented by:

R⁶² (Formula 5) is provided wherein

Y is C(Rⁿ)₂, S(O)_y, NRy and O wherein y is 0, 1, or 2;

R^m and R^m are each independently selected from the group consisting of H, halogen, Ci. ôalkyl (optionally substituted by one, two or three substituents each independently selected from halogen and hydroxyl), C₂-6alkenyl (optionally substituted by one, two or three substituents each independently selected from halogen and hydroxyl), NR’R”, and hydroxyl (e.g., R^m and R^m may each be H in certain embodiments);

R⁶² is selected for each occurrence from the group consisting of H, halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, C₂_6alkenyl, C₂.6alkynyl, Ci.6alkoxy, NR’R”, -C(O)-Ci.6alkyl, -C(O)-Ci_ galkoxy, phenyl, heteroaryl, C3_6cycloalkyl, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), -S(O)_W-NR’R” (where w is 1, 2 or 3), and -NR’-S(O)_W, (where w is 1, 2 or 3));

R” is selected, independently for each occurrence, from H, methyl, ethyl, propyl, butyl, C(O)-methyl and -C(O)-ethyl, or R’ and R’ ’ taken together with the nitrogen to which they are attached may form a 4-6 membered heterocycle;

each of moieties R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, and R¹⁰ is independently selected for each occurrence from the group consisting ofhydrogen, Ci^alkyl, C₂.₆alkynyl, C₂.₆alkenyl, halogen, hydroxyl, nitro, cyano, andNR’R”;

wherein for each occurrence, Ci_6alkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy,

C2_6alkenyl, C2-6alkynyl, Ci.galkoxy, NR’R”, -NR’-S(O)_W> and S(O)_W-NR’R”; Ci_6alkoxy may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Cj^alkyl, NR’R”, -NR’-S(O)_W, and S(O)_W-NR’R”; C3ôcycloalkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, Ci_6alkoxy, -C(O)-Ci-6alkyl, -C(O)-Ci_6alkoxy, and NR’R”; phenyl may be optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci^alkyl, C₂.₆alkenyl, C^alkynyl, Ci_₆alkoxy, NR’R”, C(O)-NR’R”, -C(O)-Ci_₆alkyl, -C(O)-Ci.₆alkoxy, S(O)_w-Ci-6alkyl (where w is 1, 2 or 3), NR’-S(O)_W, and -S(O)_w-NR’R”(where w is 1, 2 or 3), and heteroaryl may be optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci^alkyl, C2-6alkenyl, C2.6alkyn.yl, Cj. 6alkoxy, NR’R”, C(O)- NR’R”, -C(O)-Ci-6alkyl, -C(O)-Ci.6alkoxy, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), NR’-S(O)_W, and -S(O)_W-NR’R”(where w is 1, 2 or 3)), and C3_6cycloalkyl; and pharmaceutically acceptable salts thereof.

In an embodiment, a compound of Formula 5 may hâve R selected from H and F and/or R is selected from H and F and/or R⁵ may be selected from H and F; and/or R¹⁰ may be selected from the group consisting of H, methyl and F; and/or R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, R¹⁰, and R¹¹ may be H.

In some embodiments,Y of Formula 5 may be S.

A compound represented by:

wherein

Y is C(R^u)₂ , S(O)_y, NRy and O wherein y is 0, 1, or 2;

R_Y is selected from the group consisting of H, methyl, ethyl, propyl, phenyl and benzyl;

R^m and R^m are each independently selected from the group consisting of H, halogen, Cj. ôalkyl (optionally substituted by one, two or three substituents each independently selected from halogen and hydroxyl), C₂-6alkenyl (optionally substituted by one, two or three substituents each independently selected from halogen and hydroxyl), NR’R”, and hydroxyl (e.g., R^m and R^m may each be H in certain embodiments);

R^c is H or Cbgalkyl;

R⁷² is selected for each occurrence from the group consisting of H, halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, C₂-6alkenyl, C₂-6alkynyl, Ci_6alkoxy, NR’R”, -C(O)-Ci_6alkyl, -C(O)-Ci_ galkoxy, phenyl, heteroaryl, C3„6cycloalkyl, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), -S(O)_W-NR’R” (where w is 1, 2 or 3), and -NR’-S(O)_W, (where w is 1, 2 or 3));

each of moieties R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, and R¹⁰ is independently selected for each occurrence from the group consisting of hydrogen, Ci„6alkyl, C2-6alkynyl, C2-6alkenyl, halogen, hydroxyl, nitro, cyano, and NR’R’ ’ ;

wherein for each occurrence, Ci^alkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, C2-6alkenyl, C₂-6alkynyl, Ci_6alkoxy, NR’R”, -NR’-S(O)_W, and S(O)_W-NR’R”; Ci_6alkoxy may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, NR’R”, -NR’-S(O)_W> and S(O)_W-NR’R”; C₃. ôcycloalkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, Ci.galkoxy, -C(O)-Ci_6alkyl, -C(O)-Ci_6alkoxy, and NR’R”; phenyl may be optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci^alkyl, C₂.₆alkenyl, C₂.₆alkynyl, Ci_₆alkoxy, NR’R”, C(O)-NR’R”, -C(O)-C₁.₆alkyl, -CiOj-C^ealkoxy, S(O)_w-Ci.6alkyl (where w is 1, 2 or 3), NR’-S(O)_W, and -S(O)_w-NR’R”(where w is 1, 2 or 3), and heteroaryl may be optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci^alkyl, C2-6alkenyl, C₂.6alkynyl, Ci. galkoxy, NR’R”, C(O)- NR’R”, -C(O)-Ci_6alkyl, -C(O)-Ci.6alkoxy, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), NR’-S(O)_W, -S(O)_W-NR’R”(where w is 1, 2 or 3)), and C₃.₆cycloalkyl, and pharmaceutically acceptable salts thereof.

In some embodiments, R^c of a compound of formula 6 may be H or methyl, e.g., H; and/or R⁷ may be selected from H and F; and/or R⁶ may be selected from H and F; and/or R⁵ may be selected from H and F; and/or R¹⁰ may beselected from the group consisting of H, methyl and F; and/or R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, R¹⁰, and R¹¹ may be H.

In certain embodiments, the Y moiety of Formula 6 is S.

Provided herein, in certain embodiments, is a compound represented by:

wherein

Y is C(Rⁿ)₂ , S(O)_y, NRy and O wherein y is 0, 1, or 2;

R^m’ and R^m are each independently selected from the group consisting of H, halogen, Ci. ₆alkyl (optionally substituted by one, two or three substituents each independently selected from halogen and hydroxyl), C2-6alkenyl (optionally substituted by one, two or three substituents each independently selected from halogen and hydroxyl), NR’R”, and hydroxyl(e.g., R^m and R^m may each be H in certain embodiments);

R^c is H or Ci-ôalkyl;

R⁷⁸ is selected from the group consisting of H, halogen, hydroxyl, nitro, cyano, carboxy, Ci. ₆alkyl, C₂.₆alkenyl, C₂-6alkynyl, Ci.₆alkoxy, NR’R”, -C(O)-Ci.₆alkyl, -C(O)-Ci_₆alkoxy, phenyl, heteroaryl, C3.6cycloaJ.kyl, -S(O)_w-Ci.6alkyl (where w is 1, 2 or 3), -S(O)_W-NR’R” (where w is 1,2 or 3), and -NR’-S(O)_W, (where w is 1, 2 or 3));

R⁷⁹ is selected from the group consisting of H, halogen, hydroxyl, nitro, cyano, carboxy, Ci. ealkyl, C2_6alkenyl, C2-6alkynyl, Ci.6alkoxy, NR’R”, -C(O)-Ci.6alkyl, -C(O)-Ci-6alkoxy, phenyl, heteroaryl, C3.6cycloalkyl, -S(O)_w-Ci.6alkyl (where w is 1, 2 or 3), -S(O)_W-NR’R” (where w is 1, 2 or 3), and -NR’-S(O)_W, (where w is 1, 2 or 3));

each of moieties R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, and R¹⁰ is independently selected for each occurrence from the group consisting ofhydrogen, Ci^alkyl, C₂-6alkynyl, C2-6alkenyl, halogen, hydroxyl, nitro, cyano, andNR’R”;

wherein for each occurrence, Ci.galkyl may be optionally substituted with one, two, tihree or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, C2-6alkenyl, C₂-6alkynyl, Ci.6alkoxy, NR’R”, -NR’-S(O)_Wj and S(O)_W-NR’R”; Cj.6alkoxy may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, NR’R”, -NR’-S(O)_W> and S(O)_W-NR’R”; C₃. ôcycloalkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, Ci_6alkoxy, -C(O)-Ci.6alkyl, -C(O)-Ci.6alkoxy, and NR’R”; phenyl may be optionally substituted by one, two or tliree substituents each independently selected from the group consisting of halogen, hydroxyl, Ci.6alkyl, C2-6alkenyl, C2-6alkynyl, Ci.6alkoxy, NR’R”, C(O)-NR’R”, -C(O)-Ci-6alkyl, -C(O)-Ci_₆alkoxy, S(O)_w-Ci.₆alkyl (where w is 1, 2 or 3), NR’-S(O)_W, and -S(O)_w-NR’R”(where w is 1, 2 or 3), and heteroaryl may be optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci^alkyl, C2-6alkenyl, C2-6alkynyl, C3. ecycloalkyl, Ci.₆alkoxy, NR’R”, C(O)- NR’R”, -C(O)-Ci.₆alkyl, -C(O)-C^alkoxy, -S(O)_w-Ci_ ₆alkyl (where w is 1, 2 or 3), NR’-S(O)_W, and -S(O)_w-NR’R”(where w is 1, 2 or 3), and pharmaceutically acceptable salts thereof.

R° is H or methyl.

In certain embodiments, compound of formula 7 may hâve R^c as H; and/or R⁷ may be selected from H and F; and/or R⁶ may be selected from H and F; and/or R⁵ may be selected from H and F; and/or R¹⁰ may be selected from the group consisting of H, methyl and F; and/or each of R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, R¹⁰, and R¹¹ may be H.

For example, the présent disclosure also provides, in part, a compound selected from the group consisting a compound of Table 1, 2, 3, 4, 5, 6 and 7. Also contemplated herein are compounds: N((2-methylthiazol-5-yl)methyl)-l l-oxo-10,1 l-dihydrodibenzo[b,f][l,4]thiazepine-8-carboxamide 5oxide, N-((2-aminothiazol-5-yl)methyl)-l l-oxo-10,1 l-dihydrodibenzo[b,f|[l,4]thiazepine-8carboxamide 5-oxide, N-((2-methylthiazol-5-yl)methyl)-l l-oxo-10,11dihydrodibenzo[b,f][l,4]thiazepine-8-carboxamide 5,5-dioxide, N-((2-aminothiazol-5-yl)methyl)1 l-oxo-10,1 l-dihydrodibenzo[b,f][l,4]thiazepine-8-carboxamide 5,5-dioxide, 1 l-oxo-N-(2phenylbutyl)-10,l l-dihydrodibenzo[b,f][l,4]thiazepine-8-carboxamide 5,5-dioxide, N-(2-(4,4difhiorocyclohexyl)ethyl)-l l-oxo-10,1 l-dihydrodibenzo[b,f][l,4]thiazepine-8-carboxamide 5,5dioxide, 3'-(5,5-dioxido-l l-oxo-10,1 l-dihydrodibenzo[b,f][l,4]thiazepine-8-carboxamido)-[l,rbiphenyl]-2-carboxylic acid, 9-methyl-N-((2-methylthiazol-5-yl)methyl)-l l-oxo-10,11dihydrodibenzo[b,f] [1,4]thiazepine-8-carboxamide, N-(2-(4'-fluoro-[l, 1 -biphenyl]-4-yl)ethyl)-11oxo-10,1 l-dihydrodibenzo[b,f][l,4]thiazepine-8-carboxamide 5,5-dioxide, N-((2-aminothiazol-5yl)methyl)-9-methyl-l l-oxo-10,1 l-dihydrodibenzo[b,f][l,4]thiazepine-8-carboxamide, 11-oxo-N(pyrimidin-5-ylmethyl)-10,l l-dihydro-5H-dibenzo[b,e][l,4]diazepine-8-carboxamide, 1 l-oxo-N-(2(pyridin-2-yl)ethyl)-10,l l-dihydro-5H-dibenzo[b,e][l,4]diazepine-8-carboxamide, 1 l-oxo-N-(2(pyridin-3-yl)ethyl)-10,l l-dihydro-5H-dibenzo[b,e][l,4]diazepine-8-carboxamide, 11-oxo-N(pyridin-3 -ylmethyl)-10,11 -dihydro-5H-dibenzo[b,e] [ 1,4]diazepine-8-carboxamide, N-(2-([ 1, Γbiphenyl]-4-yl)ethyl)-l l-oxo-10,1 l-dihydro-5H-dibenzo[b,e][l,4]diazepine-8-carboxamide, 11-oxoN-(pyridin-4-yl)-10,11 -dihydro-5H-dibenzo[b,e] [ 1,4]diazepine-8-carboxamide, N-(4-(N,Ndimethylsulfamoyl)phenethyl)-11 -oxo-10,11 -dihydro-5H-dibenzo[b,e] [1,4]diazepine-8carboxamide, N-([l,l'-biphenyl]-3-yl)-ll-oxo-10,1 l-dihydro-5H-dibenzo[b,e][l,4]diazepine-8carboxamide, (Z)-N-((3-(methylimino)prop-l-en-2-yl)oxy)-l l-oxo-10,11dihydrodibenzo[b,f][l,4]thiazepine-8-carboxamide, 1 l-oxo-N-(pyrimidin-5-yloxy)-10,l 1dihydrodibenzo[b,f] [ 1,4]thiazepine-8-carboxamide, 1 l-oxo-N-(4-(pyrimidin-5-yl)benzyl)-10,1125 dihydrodibenzo[b,f] [ 1,4]thiazepine-8-carboxamide,N-(2-(4'-fluoro-[ 1,1 -biphenyl]-4-yl)ethyl)-11 oxo-10,ll-dihydrodibenzo[b,f][l,4]thiazepine-8-carboxamide,2-chloro-N-((2-methylthiazol-5yl)methyl)-l l-oxo-10,1 l-dihydrodibenzo[b,f][l,4]thiazepine-8-carboxamide,2-chloro-l 1-oxo-N(pyridin-3-ylmethyl)-10,ll-dihydrodibenzo[b,f][l,4]thiazepine-8-carboxamide, 2-chloro-l 1-oxo-N(pyrimidin-5-ylmethyl)-10,11 -dihydrodibenzo[b,f][l,4]thiazepine-8-carboxamide, 3-chloro-N-((2methylthiazol-5-yl)methyl)-11 -oxo-10,11 -dihydrodibenzo[b,f] [ 1,4]thiazepine-8-carboxamide,3chloro-ll-oxo-N-(pyridin-3-ylmethyl)-10,ll-dihydrodibenzo[b,f][l,4]thiazepine-8-carboxamide, 3chloro-11 -oxo-N-(pyrimidin-5-ylmethyl)-10,11 -dihydrodibenzo[b,fj [ 1,4]thiazepine-8-carboxamide, ll-methyl-N-((2-methylthiazol-5-yl)methyl)-6-oxo-6,ll-dihydro-5H-dibenzo[b,e]azepine-3carboxamide, 1 l-methyl-6-oxo-N-(pyridin-3-ylmethyl)-6,l l-dihydro-5H-dibenzo[b,e]azepine-3carboxamide, 1 l-methyl-6-oxo-N-(pyrimidin-5-ylmethyl)-6,l l-dihydro-5H-dibenzo[b,e]azepine-3carboxamide, 2-chloro-l l-oxo-N-(thiazol-5-ylmethyl)-10,ll-dihydrodibenzo[b,f][l,4]thiazepine-8carboxamide, 3-chloro-ll-oxo-N-(thiazol-5-ylmethyl)-10,ll-dihydrodibenzo[b,f][l,4]thiazepine-8carboxamide, 1 l-methyl-6-oxo-N-(thiazol-5-ylmethyl)-6,l l-dihydro-5H-dibenzo[b,e]azepine-3carboxamide, and ll-oxo-N-(2-(thiazol-5-yl)propan-2-yl)-10,lldihydrodibenzo[b,f|[l,4]thiazepine-8-carboxamide;

or a pharmaceutically acceptable sait thereof.

In a second aspect, a method for the synthesis of disclosed compounds is provided. The method foliows Synthetic Scheme 1, as illustrated in FIG. 1. A first mixture comprising reagents 1 and 2 is formed for synthetic step A to yield synthetic intermediate 3. Synthetic step A may be conducted in an organic solvent, for instance a polar aprotic solvent such as dimethyl sulfoxide (DMSO), dimethylformamide (DMF), dioxane, hexamethylphosphorotriamide, and tetrahydrofuran. The reaction may be conducted in the presence of a base, for example a carbonate such as IÂ2CO3, Na₂CO₃, K₂CO₃, Rb₂CO₃, Cs₂CO₃, MgCO₃, CaCO₃, SrCO₃, and BaCO₃.

In reagent 1, moiety-YH is selected from the group consisting of-SH, -OH, and -N(R¹²)H, wherein R¹² is selected from the group consisting of hydrogen and alkyl. In intermediates 3, 4, 5, and in product 6, moiety-Y- is selected from the group consisting of-S-, -O-, and -N(R¹²)-. Moieties P¹ and P² are independently selected carboxyl protecting groups, such as methoxyl or ethoxyl groups. In some cases, at least one of P³ and P⁴ is an amino protecting group, for example selected from the group consisting of carbobenzyloxy (Cbz), p-methoxybenzyl-carbonyl (Moz or 26

MeOZ), tert-butyloxycarbonyl (BOC), 9-fluorenylmethyloxycarbonyl (FMOC), acetyl (Ac), benzoyl (Bz), benzyl (Bn), carbamate group, p-Methoxybenzyl (PMB), 3,4-dimethoxybenzyl (DMPM), pmethoxyphenyl (PMP), tosyl (Ts), sulfonamides (Nosyl andNps). Alternatively, moiety-N(P³)(P⁴) may be a group that can be transformed in an amino group by appropriate chemical reactions. By way of example, moiety -N(P³)(P⁴) may be an -NO₂ group that is transformed into an amino (NH₂) moiety by reaction with a reductant.

In synthetic step B, protecting groups P¹ and P² are removed to yield carboxyl moieties. In instances where P¹ and P² are alkoxy groups, this may be achieved by hydrolysis, for example in the presence of a base or acid. Group -N(P³)(P⁴) is transformed into an amino moiety, as exemplified above, to yield intermediate 4. In synthetic step C, the amino group of intermediate 4 is reacted with the carboxy group on the other phenyl moiety, forming the l,4-thiazepan-5-one moiety of intermediate 5. The formation of this amide bond may be speeded up by the addition of activators. Example activators include carbodiimides, such as Ν,Ν'-dicyclohexylcarbodiimide (DCC), N,N'diisopropylcarbodiimide (DIC), and carbonyl diimidazole (CDI); and triazolols, such as 1-hydroxybenzotriazole (HOBt) and l-hydroxy-7-aza-benzotriazole (HOAt). Other activators include HBTU, HATU, HCTU, TBTU, and PyBOP.

In synthetic step D, intermediate 5 is reacted with a molécule of formula R²NH₂ to create an amide bond and yield products of Formula 6. As with synthetic step C, the formation of the amide bond may be speeded up with an activator. An exemplary Synthetic Scheme is illustrated in FIG. 2.

In a further aspect, a method for treating a hepatitis B infection in a patient in need thereof is provided, comprising administering to a subject or patient an effective amount of a disclosed compound, and/or administering a first disclosed compound and optionally, and additional, different disclosed compound(s). In another embodiment, a method for treating a hepatitis B infection in a patient in need thereof is provided, comprising administering to a subject or patient a therapeutically effective amount of a pharmaceutical composition comprising a disclosed compound, or two or more disclosed compounds.

For use in accordance with this aspect, the appropriate dosage is expected to vary depending on, for example, the particular compound employed, the mode of administration, and the nature and severity of the infection to be treated as well as the spécifie infection to be treated and is within the purview of the treating physician. Usually, an indicated administration dose may be in the range between about 0.1 to about 1000 pg/kg body weight. In some cases, the administration dose of the compound may be less than 400 pg/kg body weight. In other cases, the administration dose may be less than 200 pg/kg body weight. In yet other cases, the administration dose may be in the range between about 0.1 to about 100 pg/kg body weight. The dose may be conveniently administered once daily, or in divided doses up to, for example, four times a day or in sustained release form.

A compound may be administered by any conventional route, in particular: enterally, topically, orally, nasally, e.g. in the form of tablets or capsules, via suppositories, or parenterally, e.g. in the form of injectable solutions or suspensions, for intravenous, intra-muscular, sub-cutaneous, or intraperitoneal injection. Suitable formulations and pharmaceutical compositions will include those formulated in a conventional manner using one or more physiologically acceptable carriers or excipients, and any of those known and commercially available and currently employed in the clinical setting. Thus, the compounds may be formulated for oral, buccal, topical, parentéral, rectal or transdermal administration or in a form suitable for administration by inhalation or insufflation (either orally or nasally).

For oral administration, pharmaceutical compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g. pregelatinised maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g. lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g. magnésium stéarate, talc or silica); disintegrants (e.g. potato starch or sodium starch glycollate); or wetting agents (e.g. sodium lauryl sulphate). Tablets may be coated by methods well known in the art. Liquid préparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid préparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g. sorbitol syrup, cellulose dérivatives or hydrogenated edible fats); emulsifying agents (e.g. lecithin or acacia); non-aqueous vehicles (e.g. almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g. methyl or propyl-p-hydroxybenzoates or sorbic acid). Préparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate.

Préparations for oral administration may also be suitably formulated to give controlled-release or sustained release of the active compound(s) over an extended period. For buccal administration the compositions may take the form of tablets or lozenges formulated in a conventional manner known to the skilled artisan.

A disclosed compound may also be formulated for parentéral administration by injection e.g. by bolus injection or continuons infusion. Formulations for injection may be presented in unit dosage form e.g. in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or émulsions in oily or aqueous vehicles, and may contain additives such as suspending, stabilizing and/or dispersing agents. Alternatively, the compound may be in powder form for constitution with a suitable vehicle, e.g. stérile pyrogen-free water, before use. Compounds may also be formulated for rectal administration as suppositories or rétention enemas, e.g. containing conventional suppository bases such as cocoa butter or other glycerides.

In some cases, a disclosed compound may be administered as part of a combination therapy in conjunction with one or more antivirals. Example antivirals include nucleoside analogs, interferon a, and other assembly effectors, for instance heteroaryldihydropyrimidines (HAPs) such as methyl 4-(2-chloro-4-fluorophenyl)-6-methyl-2-(pyridin-2-yl)-1,4-dihydropyrimidine-5-carboxylate (HAP1). For example, provided herein is a method of treating patient suffering from hepatitis B comprising administering to a subject a first amount of a disclosed compound and a second amount of an antiviral, or other anti HBV agent, for example a second amount of a second compound selected from the group consisting of: another HBV caspid assembly promoter (such as certain compounds disclosed herein or for example, GLS4, BAY 41-4109, AT-130, DVR-23 (e.g., as depicted below),

DVR-23

NVR 3-778, NVR1221 (by code); and N890 (as depicted below):

OH other CpAMs such as those disclosed in the following patent applications hereby incorporated by reference: W02014037480, WO2014184328, W02013006394, WO2014089296, W02014106019, WO2013102655, WO2014184350, WO2014184365, WO2014161888, WO2014131847,

WO2014033176, WO2014033167, and W02014033170; Nucleoside analogs interfering with viral polymerase, such as entecavir (Baraclude), Lamivudine, (Epivir-HBV), Telbivudine (Tyzeka, Sebivo), Adefovir dipivoxil (Hepsera), Tenofovir (Viread), Tenofovir alafenamide fumarate (TAF), prodrugs of tenofavir (e.g. AGX-1009), L-FMAU (Clevudine), LB80380 (Besifovir) and:

viral entry inhibitors such as Myrcludex B and related lipopeptide dérivatives; HBsAg sécrétion inhibitors such as REP 9AC’ and related nucleic acid-based amphipathic polymers, HBF-0529 (PBHBV-001), PBHBV-2-15 as depicted below: :

disruptors of nucleocapsid formation or integrity such as NZ-4/W28F:

cccDNA formation inhibitors: such as BSBI-25, CCC-0346, CCC-0975 (as depicted below):

HBc directed transbodies such as those described in Wang Y, et al, Transbody against hepatitis B virus core protein inhibits hepatitis B virus réplication in vitro, Int. Immunopharmacol (2014), located at //dx.doi.org/10.1016/j.intimp .2015.01.028; antiviral core protein mutant (such as Cpl83V124W and related mutations as described in WO/2013/010069, W02014/074906 each incorporated by reference ); inhibitors of HBx-interactions such as RNAi, antisense and nucleic acid based polymère targeting HBV RNA;, e.g., RNAi (for example ALN-HBV, ARC-520, TKM-HBV, ddRNAi), antisense (ISIS-HBV), or nucleic acid based polymer: (REP 2139-Ca); immunostimulants such as Interferon alpha 2a (Roferon), Intron A (interferon alpha 2b), Pegasys (peginterferon alpha 2a), Pegylated IFN 2b, IFN lambda la and PEG IFN lambda la, Wellferon, Roferon, Infergen, lymphotoxin beta agonists such as CBE11 and BS1); Non-Interferon Immune enhancers such as Thymosin alpha-1 (Zadaxin) and Interleukin-7 (CYT107); TLR-7/9 agonists such as GS-9620, CYT003, Resiquimod; Cyclophilin Inhibitors such as NVP018; OCB-030; SCY-635; Alisporivir; NIM811 and related cyclosporine analogs; vaccines such as GS-4774, TGI050, Core antigen vaccine; SMAC mimetics such as birinapant and other LAP-antagonists; Epigenetic modulators such as KMT inhibitors (EZH1/2, G9a, SETD7, Suv39 inhibitors), PRMT inhibitors, HDAC inhibitors, SIRT agonists, HAT inhibitors, WD antagoniste (e.g. OICR-9429), PARP inhibitors, APE inhibitors, DNMT inhibitors, LSD1 inhibitors, JMJD HDM inhibitors, and Bromodomain antagonists; kinase inhibitors such as TKB1 antagoniste, PLK1 inhibitors, SRPK inhibitors, CDK2 inhibitors, ATM & ATR kinase inhibitors; STING Agonists; Ribavirin; N-acetyl cysteine ; NOV-205 (BAM205); Nitazoxanide (Alinia), Tizoxanide; SB 9200 Small Molécule

Nucleic Acid Hybrid (SMNH); DV-601; Arbidol; FXR agonists (such as GW 4064 and Fexaramin); antibodies, therapeutic proteins, gene therapy, and biologics directed against viral components or interacting host proteins.

In some embodiments, the first and second amounts together comprise a pharmaceutically effective amount. The first amount, the second amount, or both may be the same, more, or less than effective amounts of each compound administered as monotherapies. Therapeutically effective amounts of a disclosed compound and antiviral may be co-administered to the subject, i.e., administered to the subject simultaneously or separately, in any given order and by the same or different routes of administration. In some instances, it may be advantageous to initiate administration of a disclosed compound first, for example one or more days or weeks prior to initiation of administration of the antiviral. Moreover, additional drugs may be given in conjunction with the above combination therapy.

In another embodiment, a disclosed compound may be conjugated (e.g., covalently bound directly or through molecular linker to a free carbon, nitrogen (e.g. an amino group), or oxygen (e.g. an active ester) of a disclosed compound), with a détection moiety, e.g. a fluorophore moiety (such a moiety may for example re-emit a certain light frequency upon binding to a virus and/or upon photon excitation. Contemplated fluorophores include AlexaFluor® 488 (Invitrogen) and BODIPY FL (Invitrogen), as well as fluorescein, rhodamine, cyanine, indocarbocyanine, anthraquinones, fluorescent proteins, aminocoumarin, methoxycoumarin, hydrooxycoumarin, Cy2, Cy3, and the like. Such disclosed compounds conjugated to a détection moiety may be used in e.g. a method for detecting HBV or biological pathways of HBV infection, e.g., in vitro or in vivo', and/or methods of assessing new compounds for biological activity.

EXAMPLES

The compounds described herein can be prepared in a number of ways based on the teachings contained herein and synthetic procedures known in the art. In the description of the synthetic methods described below, it is to be understood that ail proposed reaction conditions, including choice of solvent, reaction atmosphère, reaction température, duration of the experiment and workup procedures, can be chosen to be the conditions standard for that reaction, unless otherwise indicated. It is understood by one skilled in the art of organic synthesis that the functionality présent on various portions of the molécule should be compatible with the reagents and reactions proposed. Substituents not compatible with the reaction conditions will be apparent to one skilled in the art, and altemate methods are therefore indicated. The starting materials for the examples are either commercially available or are readily prepared by standard methods from known materials.

Example 1: Synthesis of ll-oxo-10,11-dihydrodibenzo [A f\ [1,41 thiazepine-8-carboxylic acid (6) - a common intermediate

Synthesis of methyl 4-((2-(methoxycarbonyl) phenyl) thio)-3-nitrobenzoate (3):

To a stirred solution of methyl 4-fluoro-3-nitrobenzoate 2 (30 g, 150.67 mmol) in DMF (300 mL) under inert atmosphère were added césium carbonate (58.76 g, 180.8 mmol) and methyl 2mercaptobenzoate 1 (22.6 mL, 165.47 mmol) at RT; heated to 55-60 °C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (1500 mL) and the precipitated solid was filtered to obtain the crude. The crude was washed with water (500 mL), hexane (200 mL) and dried in vacuo to afford compound 3 (48.8 g, 93%) as yellow solid. TLC: 20% EtOAc/ hexanes (Rf. 0.4); ¹H NMR (CDCI3, 400 MHz): δ 8.85 (s, 1H), 7.99-7.92 (m, 2H), 7.66-7.56 (m, 3H), 6.93 (d, J= 8.6 Hz, 1H), 3.94 (s, 3H), 3.79 (s, 3H).

Synthesis of methyl 3-amino-4-((2-(methoxycarbonyl) phenyl) thio) benzoate (4):

To a stirred solution of compound 3 (48 g, 138.32 mmol) in MeOH (1000 mL) under inert atmosphère was added 10% Pd/C (20 g, wet) at RT under hydrogen atmosphère in an autoclave (100 psi pressure) and stirred for 24 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite, washed with 50% MeOH/ CH2CI2 (500 mL). The filtrate was removed in vacuo to obtain the crude which as triturated with diethyl ether (200 mL), washed with hexane (200 mL) and dried in vacuo to afford compound 4 (40 g, 91%) as yellow solid. TLC: 10% EtOAc/ hexanes (R/ 0.3); ^XH NMR (DMSO-^, 400 MHz): δ 7.95 (dd, J= 7.8, 1.4 Hz, 1H), 7.48-7.35 (m, 3H), 7.23 (td, J= 7.5, 1.1 Hz, 1H), 7.15 (dd, J= 8.0, 1.8 Hz, 1H), 6.66 (dd, 8.2, 0.8 Hz, 1H), 5.67 (br s, 2H), 3.88 (s, 3H), 3.84 (s, 3H).

Synthesis of 3-amino-4-((2-carboxyphenyI) thio) benzoic acid (5):

To a stirred solution of compound 4 (40 g, 126.18 mmol) in THF: H2O (5: 1, 400 mL) was added lithium hydroxide monohydrate (26 g, 619.0 mmol) at 0 C; warmed to RT and stirred for 48 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The pH of the residue was acidifîed with 2 N HCl to ~2. The precipitated solid was filtered and dried in vacuo to afford compound 5 (34.6 g, 95%) as an off-white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.1); ^XH NMR (DMSO-rf_tf, 500 MHz): δ 13.00 (br s, 2H), 7.93 (dd, J= Ί.Ί, 1.0 Hz, 1H), 7.42 (s, 1H), 7.40-7.31 (m, 2H), 7.18 (t, J= 7.4 Hz, 1H), 7.13 (dd, J= 8.0, 1.6 Hz, 1H), 6.61 (d, J= 7.8 Hz, 1H), 5.55 (br s, 2H).

Synthesis of ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8-carboxylic acid (6):

To a stirred solution of compound 5 (31 g, 107.26 mmol) in THF (600 mL) under inert atmosphère was added CDI (86.88 g, 536.29 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was acidifïed with 2 N 5 HCl to pH~4. The obtained solid was filtered and further dried by using toluene (2 x 200 mL) to afford compound 6 (26 g, 90%) as white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.3); *H NMR (DMSO-rf₆, 400 MHz): δ 13.22 (br s, 1H), 10.81 (s, 1H), 7.78 (s, 1H), 7.72-7.64 (m, 3H), 7.57-7.44 (m, 3H).

Example 2: Synthesis of 2-chloro-ll-oxo-10,11-dihydrodibenzo [6, f\ fl, 41 thiazepine-810 carboxylic acid (14) - a common intermediate

Synthesis of 5-chloro-2-((4-methoxybenzyl) thio) benzonitrile (9):

To a stirred solution of 5-chloro-2-fluorobenzonitrile 7 (1 g, 6.41 mmol) in DMF (10 mL) under inert atmosphère was added césium carbonate (2.30 g, 7.05 mmol) at RT; heated to 40 °C and to this was added (4-methoxyphenyl) methanethiol 8 (1.08 g, 7.05 mmol); heated to 60 C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted with EtOAc (2 x 25 mL). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 3-5% EtOAc/ hexanes to afford compound 9 (1 g, 54%) as white solid. TLC: 10% EtOAc/ hexanes (Rf. 0.6); ^-NMR (CDC1₃, 500 MHz): δ 7.57 (s, 1H), 7.39 (d, J= 8.0 Hz, 1H), 7.28-7.27 (m, 1H), 7.20 (d, J= 9.0 Hz, 2H), 6.81 (d, J= 9.0 Hz, 2H), 4.15 (s, 2H), 3.78 (s, 3H).

Synthesis of 5-chloro-2-mercaptobenzonitrile (10):

A stirred solution of compound 9 (1 g, 3.47 mmol) in trifluoro acetic acid (10 mL) under inert atmosphère was stirred at 70 C for 5 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude compound 10 (590 mg) which was carried to the next step without further purification. TLC: 30% EtOAc/ hexanes (Rf. 0.2); ’H-NMR (CDC1₃, 500 MHz): δ 7.57 (s, 1H), 7.41 (d, J= 9.0 Hz, 1H), 7.34 (d, J= 9.0 Hz, 1H), 4.08 (s, 1H).

Synthesis of methyl 4-((4-chloro-2-cyanophenyl) thio)-3-nitrobenzoate (11):

To a stirred solution of compound 10 (620 mg, 3.11 mmol) in DMF (10 mL) under inert atmosphère was added césium carbonate (1.1 g, 3.42 mmol) at RT; heated to 40 °C and stirred for 10 min. To this was added methyl 4-fluoro-3-nitrobenzoate 2 (582 mg, 3.42 mmol) at 60 C and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted with EtOAc (2 x 20 mL). The combined organic extracts were dried over sodium sulfate, fïltered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 25% EtOAc/ hexanes to afford compound 11 (600 mg, 55%) as pale yellow solid. TLC: 30% EtOAc/ hexanes (Rf. 0.4); ’lI-NMR (DMSO-ify, 400 MHz): δ 8.66 (s, 1H), 8.33 (s, 1H), 8.05-8.03 (m, 1H), 7.98-7.92 (m, 2H), 7.02 (d, 7= 8.4 Hz, 1H), 3.86(s, 3H).

Synthesis of methyl 3-amino-4-((4-chloro-2-cyanophenyl) thio) benzoate (12):

To a stirred solution of compound 11 (450 mg, 1.29 mmol) in acetic acid (15 mL) under inert atmosphère was added iron powder (724 mg, 12.9 mmol) at RT; heated to 90 C and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was basified with saturated NaHCC>3 solution (15 mL) and extracted with CH2CI2 (2 x 20 mL). The combined organic extracts were dried over sodium sulfate, fïltered and concentrated in vacuo to obtain the crude. The crude was triturated with 3% EtOAc/ hexanes (2x5 mL) to afford compound 12 (290 mg, 70%) as pale yellow solid. TLC: 20% MeOH/ CH2CI2 (Rf 0.7); Tl-NMR (DMSO-rf₆, 400 MHz): δ 8.05 (s, 1H), 7.63-7.60 (m, 1H), 7.48 (s, 1H), 7.43 (d, J= 8.0 Hz, 1H), 7.14 (d, J= 8.8 Hz, 1H), 6.75 (d, J= 8.8 Hz, 1H), 5.88 (s, 2H), 3.84 (s, 3H).

Synthesis of 2-((2-amino-4-carboxyphenyI) thio)-5-chIorobenzoic acid (13):

co₂h

To a stirred solution of compound 12 (450 mg, 1.41 mmol) in MeOH (10 mL) was added potassium hydroxide (792 mg, 14.1 mmol) in water (3 mL) at 0 °C; heated to 90 C and stirred for 9 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was acidified with 1 N HCl to pH~4.0. The obtained solid was filtered, washed with ether (2x5 mL) and dried in vacuo to afford compound 13 (350 mg, 76%) as an off-white solid. TLC: 20% MeOH/ CH₂C1₂ (Rf. 0.3); *H-NMR (DMS(W_d, 400 MHz): δ 12.92 (br s, 2H), 7.89 (s, 1H), 7.44-7.38 (m, 3H), 7.14 (d, J= 8.8 Hz, 1H), 6.60 (d, J= 8.8 Hz, 1H), 5.64 (br s, 2H).

Synthesis of 2-chloro-ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8-carboxyIic acid (14):

To a stirred solution of compound 13 (30 mg, 0.09 mmol) in THF (2 mL) under inert atmosphère was added CDI (45 mg, 0.27 mmol) at RT and stirred for 7 h. The reaction was monitored by TLC;

after completion of the reaction, the volatiles were removed in vacuo. The residue was acidified with 2 N HCl to pH~4.0. The obtained solid was filtered, washed with ether (2x3 mL) and dried in vacuo to afford compound 14 (15 mg, 53%) as an off-white solid. TLC: 15% MeOH/ CH₂C1₂ (Rf.

0.5); *H-NMR (DMSO-i/_tf, 400 MHz): δ 13.05 (br s, 1H), 10.98 (s, 1H), 7.80 (s, 1H), 7.72-7.70 (m, 3H), 7.64 (s, 2H).

Example 3: Synthesis of 3-chloro-ll-oxo-10,11-dihydrodibenzo [/>, /1 [1, 4] thiazepine-8carboxylic acid (21) - a common intermediate

Synthesis of 4-chloro-2-((4-methoxybenzyI) thio) benzonitrile (16):

To a stirred solution of 4-chloro-2-fluorobenzonitrile 15 (1 g, 6.41 nunol) in DMF (25 mL) under inert atmosphère was added césium carbonate (2.30 g, 7.05 mmol) at RT; heated to 40 C and to this was added (4-methoxyphenyl) methanethiol 8 (1.08 g, 7.05 mmol); heated to 60 C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted with EtOAc (2 x 25 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 4% EtOAc/ hexanes to afford compound 16 (900 mg, 48%) as white solid. TLC: 10% EtOAc/ hexanes (Rf. 0.6); ¹H-NMR (CDC1₃, 400 MHz): δ 7.51 (d, J= 8.4 Hz, 1H), 7.33 (s, 1H), 7.23-7.20 (m, 3H), 6.84 (d, J= 8.4 Hz, 2H), 4.19 (s, 2H), 3.79 (s, 3H).

Synthesis of 4-chloro-2-mercaptobenzonitrile (17):

A stirred solution of compound 16 (900 mg, 3.11 mmol) in trifluoro acetic acid (10 mL) under inert atmosphère at RT was heated to 70 °C and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude compound 17 (527 mg) as brown solid. The crude was carried to the next step without further purification. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.1); ’H-NMR (CDC1₃, 400 MHz): δ 7.52 (d, J= 8.4 Hz, 1H), 7.41 (s, 1H), 7.22-7.19 (m, 1H), 4.13 (s, 1H).

Synthesis of methyl 4-((5-chloro-2-cyanophenyl) thio)-3-nitrobenzoate (18):

To a stirred solution of compound 17 (550 mg, 2.76 mmol) in DMF (15 mL) under inert atmosphère was added césium carbonate (988 mg, 3.04 mmol) at RT; heated to 40 °C and stirred for 10 min. To o

this was added methyl 4-fluoro-3-nitrobenzoate 2 (515 mg, 3.04 mmol) at 60 C and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL). The obtained solid was fîltered, washed with 15% EtOAc/ hexanes (2 x mL) and dried in vacuo to afford compound 18 (700 mg, 73%) as yellow solid. TLC: 20%

EtOAc/ hexanes (Rf. 0.3); ^-NMR (DMSO-<4, 500 MHz): δ 8.69 (s, 1H), 8.18-8.15 (m, 2H), 8.10 (d, J= 8.5 Hz, 1H), 7.92 (d, J= 8.5 Hz, 1H), 7.10 (d, J= 9.0 Hz, 1H), 3.90 (s, 3H).

Synthesis of methyl 3-amino-4-((5-chloro-2-cyanophenyI) thio) benzoate (19):

To a stirred solution of compound 18 (700 mg, 2.01 mmol) in acetic acid (15 mL) under inert atmosphère was added iron powder (1.12 g, 20.11 mmol) at RT; heated to 90 C and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was basified with 10% NaHCO₃ solution (20 mL) and extracted with CH₂C1₂ (2 x 30 mL). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 20% EtOAc/ hexanes to afford compound 19 (500 mg, 78%) as yellow solid. TLC: 30%

EtOAc/ hexanes (Rf 0.8); 'ïï-NMR (DMSO-<4, 500 MHz): δ 7.92 (d, J= 7.5 Hz, 1H), 7.51-7.43 (m, 3H), 7.17 (d, J= 8.0 Hz, 1H), 6.66 (s, 1H), 5.96 (s, 2H), 3.86 (s, 3H).

Synthesis of 2-((2-amino-4-carboxyphenyI) thio)-4-chlorobenzoic acid (20):

To a stirred solution of compound 19 (500 mg, 1.57 mmol) in MeOH (6 mL) was added potassium hydroxide (1.32 mg, 23.5 mmol) in water (6 mL) at 0 °C; heated to 90 C and stirred for 24 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (20 mL) and extracted with EtOAc (2 x 25 mL). The aqueous layer was acidified with 1 N HCl to pH~6.0. The obtained solid was filtered, washed with ether (2x7 mL) and dried in vacuo to afford compound 20 (375 mg, 74%) as an off-white solid. TLC: 20% MeOH/ CH₂C1₂ (Rf. 0.2); ’H-NMR (CDCI_3j 400 MHz): δ 8.05 (d, J= 8.4 Hz, 1H), 7.55-7.47 (m, 3H), 7.17-7.14 (m, 1H), 6.67 (s, 1H).

Synthesis of 3-chloro-ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8-carboxylic acid (21):

To a stirred solution of compound 20 (375 mg, 1.16 mmol) in THF (10 mL) under inert atmosphère was added CDI (564 mg, 3.48 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (15 mL) and acidified with 6 N HCl to pH~1.0. The obtained solid was filtered, washed with ether (2x5 mL) and dried in vacuo to afford compound 21 (285 mg, 81%) as an off-white solid. TLC: 20% MeOH/ CH₂C1₂ (Rf. 0.4); ’H-NMR (DMSO-î/₆, 400 MHz): δ 14.56 (br s, 2H), 10.90 (s, 1H), 9.11 (s, 1H), 7.71-7.65 (m, 4H).

Example 4: Synthesis of l-fluoro-ll-oxo-10,11-dihydrodibenzo \b, f\ [1, 4] thiazepine-8carboxylic acid (28) - a common intermediate

Synthesis of methyl 2-fluoro-6-((4-methoxybenzyl) thio) benzoate (23):

To a stirred solution of methyl 2, 6-difluorobenzoate 22 (10 g, 58.13 mmol) in DMF (100 mL) under inert atmosphère were added (4-methoxyphenyl) methanethiol 8 (8.96 g, 58.13 mmol), césium carbonate (20.8 g, 63.95 mmol) at 0 °C; warmed to 10 C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water 10 (200 mL) and extracted with EtOAc (2 x 800 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacno to obtain the crude. The crude was purified through silica gel column chromatography using 10-15% EtOAc/ hexanes to afford compound 23 (7.5 g, 42%) as white solid. TLC: 10% EtOAc/ hexanes^/ 0.3); NMR (DMSO-î/₆, 400 MHz) δ

7.53-7.44 (m, 1H), 7.35 (d, J= 8.0 Hz, 1H), 7.26 (d, J= 8.6 Hz, 2H), 7.15 (t, J= 9.0 Hz, 1H), 6.86 (d, J= 8.7 Hz, 2H), 4.22 (s, 2H), 3.72 (s, 3H), 3.33 (s, 3H).

Synthesis of methyl 2-fluoro-6-mercaptobenzoate (24):

A stirred solution of compound 23 (7.5 g, 24.5 mmol) in trifluoro acetic acid (100 mL) at RT under inert atmosphère was heated to 60-65 C and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed and dried in vacuo to obtain compound 24 (4.6 g) as brown syrup. The crude was carried forward for next step without further purification. TLC: 10% EtOAc/ hexanes (Rf. 0.7).

Synthesis of methyl 2-fluoro-6-((4-(methoxycarbonyl)-2-nitrophenyl) thio) benzoate (25):

To a stirred solution of methyl 4-fluoro-3-nitrobenzoate 2 (4.5 g, 22.61 mmol) in DMF (100 mL) under inert atmosphère were added compound 24 (4.6 g, crude), césium carbonate (11 g, 33.91 mmol) at RT; heated to 60-65 °C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (600 mL) and stirred for 1 h. The precipitated solid was filtered, titurated with 10% EtOAc/ hexanes(2 x 20 mL) and dried in vacuo to afford compound 25 (7 g, 85%) as yellow solid. TLC: 20% EtOAc/ hexanes (Rf. 0.3); ¹H NMR (DMSO-îZ₆, 400 MHz): δ 8.65 (s, 1H), 8.08 (dd, J= 8.6, 1.9 Hz, 1H), 7.79-7.72 (m, 1H), 7.67-7.61 (m, 2H), 7.01 (d, J= 8.6 Hz, 1H), 3.88 (s, 3H), 3.72 (s, 3H).

Synthesis of methyl 2-((2-amino-4-(methoxycarbonyl) phenyl) thio)-6-fluorobenzoate (26):

To a stirred solution of compound 25 (7.09 g, 19.17 mmol) in MeOH (200 mL) under inert atmosphère was added 10% Pd/ C (3.5 g) at RT and stirred under hydrogen at 80 psi for 16 h in an autoclave. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite and washed with 40% MeOH/ CH2CI2 (3 x 500 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude compound was triturated with 20% EtOAc/ hexanes (200 mL) and dried in vacuo to afford compound 26 (5 g, 78%) as an off-white solid. TLC: 20% EtOAc/ hexanes (Rf 0.4); *H NMR (DMSO-é?₆, 400 MHz): δ 7.45-7.36 (m, 3H), 7.19-7.11 (m, 2H), 6.68 (d, J= 7.7 Hz, 1H), 5.71 (s, 2H), 3.90 (s, 3H), 3.83 (s, 3H).

Synthesis of 2-((2-amino-4-carboxyphenyl) thio)-6-fluorobenzoic acid (27):

To a stirred solution of compound 26 (5 g, 14.92 mmol) in THF: H2O (5: 1, 90 mL) was added lithium hydroxide monohydrate (3.13 g, 74.62 mmol) at RT and stirred for 16 h and heated to 80 C for 5 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (200 mL) and acidified with 2 N HCl to pH~4. The precipitated solid was filtered and dried in vacuo to afford compound 27 (4 g, 87%) as an off-white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.1); *H NMR (DMSO-J₆,400 MHz): δ 12.89 (br s, 1H), 7.42-7.36 (m, 2H), 7.35-7.31 (m, 1H), 7.14 -7.08 (m, 2H), 6.63 (d, J= 8.0 Hz, 1H), 5.75 (br s,2H).

Synthesis of l-fluoro-ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8-carboxylic acid (28):

To a stirred solution of compound 27 (4 g, 13.02 mmol) in THF (100 mL) under inert atmosphère was added CDI (10.56 g, 65.1 mmol) at RT and stirred for 26 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted 5 with ice cold water (80 mL) and acidified with 2 N HCl to pH~4. The precipitated solid was filtered and dried in vacuo to afford compound 28 (3.3 g, 88%) as an off-white solid. TLC: 15% MeOH/ CH₂C1₂ (Rf. 0.2); ^JH NMR (DMSO-rZ_d, 400 MHz): δ 13.33 (br s, 2H), 11.00 (s, 1H), 7.77 (s, 1H), 7.69-7.67 (m, 2H), 7.53-7.47 (m, 1H), 7.42-7.39 (m, 1H), 7.35-7.29 (m, 1H).

Example 5: Synthesis of 2-fluoro-ll-oxo-10,11-dihydrodibenzo |7x f\ fl, 41 thiazepine-810 carboxylic acid (35) - a common intermediate

Synthesis of methyl-5-fluoro-2-((4-methoxybenzyl) thio) benzoate (30):

To a stirred solution of methyl 2, 5-difluorobenzoate 29 (1 g, 5.80 mmol) in DMF (20 mL) under argon atmosphère were added (4-methoxyphenyl) methanethiol 8 (985 mg, 6.39 mmol), césium carbonate (2.07 g, 6.39 mmol) at RT and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (30 mL) and extracted with CH2CI2 (2x30 mL). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 5-7% EtOAc/ hexanes to afford compound 30 (700 mg, 40%) as white solid. TLC: 10% EtOAc/hexanes (Rf Q3)·, *H-NMR (CDC1₃, 400 MHz): δ 7.64-7.61 (m, 1H), 7.32-7.29 (m, 3H), 7.17-7.09 (m, 1H), 6.86-6.82 (m, 2H), 4.09 (s, 2H), 3.90 (s, 3H), 3.79 (s, 3H).

Synthesis of methyl 5-fluoro-2-mercaptobenzoate (31):

A stirred solution of compound 30 (700 mg, 2.28 mmol) in trifluoro acetic acid (7 mL) at RT under argon atmosphère was heated to 60-65 °C and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed and dried in vacuo to obtain compound 31 (380 mg, 89%) as brown syrup. TLC: 10% EtOAc/ hexanes (Rf. 0.7); ’H-NMR (DMSO-r/g, 400 MHz): δ 7.70-7.58 (m, 2H), 7.42-7.35 (m, 1H), 5.42 (s, 1H), 3.86 (s, 3H).

Synthesis of methyl 5-fluoro-2-((4-(methoxycarbonyl)-2-nitrophenyl) thio) benzoate (32):

To a stirred solution of methyl 4-fluoro-3-nitrobenzoate 2 (350 mg, 1.75 mmol) in DMF (10 mL) under argon atmosphère were added compound 31 (360 mg, 1.93 mmol), césium carbonate (1.14 g, 3.51 mmol) at RT; heated to 60-65 °C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (30 mL) and extracted with CH2CI2 (2 x 40 mL). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 7-10% EtOAc/ hexanes to afford compound 32 (500 mg, 78%) as yellow solid. TLC: 10% EtOAc/hexanes (Rf. 0.3); ^-NMR (DMSO-4, 400 MHz): δ 8.64 (s, 1H), 8.048.02 (m, 1H), 7.83-7.79 (m, 2H), 7.64-7.59 (m, 1H), 7.01 (d, J = 8.4 Hz, 1H), 3.88 (s, 3H), 3.71 (s, 3H).

Synthesis of methyl 2-((2-amino-4-(methoxycarbonyl) phenyl) thio)-5-fluorobenzoate (33):

To a stirred solution of compound 32 (500 mg, 1.36 mmol) in MeOH (10 mL) under argon atmosphère was added 10% Pd/ C (300 mg) at RT and stirred under hydrogen atmosphère (balloon pressure) for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was fiitered through celite and washed with 20% MeOH/ CH2CI2 (2 x 30 mL). The combined organic extracts were dried over sodium sulfate, fiitered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 8-10% EtOAc/ hexanes to afford compound 33 (300 mg, 66%) as pale yellow solid. TLC: 30% EtOAc/ hexanes^/ 0.5); *H-NMR (DMSO-4,400 MHz): δ 7.78 (d, 9.6 Hz, 1H), 7.45-7.41 (m, 2H),

7.35-7.30 (m, 1H), 7.14 (d, 9.6 Hz, 1H), 6.68-6.65 (m, 1H), 5.70 (s, 2H), 3.89 (s, 3H), 3.83 (s,

3H).

Synthesis of 2-((2-amino-4-carboxyphenyI) thio)-5-fluorobenzoic acid (34):

To a stirred solution of compound 33 (300 mg, 0.89 mmol) in THF: H₂O (5: 1, 6 mL) under argon atmosphère was added lithium hydroxide monohydrate (188 mg, 4.47 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (15 mL) and acidified with 6 N HCl to pH~4. The precipitated solid was fiitered and dried in vacuo to afford compound 34 (180 mg, 66%) as white solid. TLC: 50% EtOAc/ hexanes(R/ 0.2); *H-NMR (DMSO-J* 400 MHz): δ 12.99-12.96 (m, 2H), 7.69 (d, 7= 6.8 Hz, 1H), 7.40 (t, J= 7.2 Hz, 2H), 7.29 (t, J= 7.2 Hz, 1H), 7.13 (d, 7= 7.2

Hz, 1H), 6.64-6.61 (m, 1H), 5.64-5.61 (m, 2H).

Synthesis of 2-fluoro-ll-oxo-10,11-dihydrodibenzo [b,j\ [1, 4] thiazepine-8-carboxylic acid (35):

To a stirred solution of compound 34 (180 mg, 0.58 mmol) in THF (10 mL) under argon atmosphère was added CDI (284 mg, 1.75 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with ice cold water (10 mL) and acidifïed with 6 N HCl to pH~4. The precipitated solid was filtered and dried in vacuo to afford compound 35 (80 mg, 47%) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.2); *H-NMR (DMSO-J_tf, 400 MHz): δ 13.30 (br s, 1H), 10.93 (s, 1H), 7.70 (s, 1H), 7.67 (d, 7= 7.6 Hz, 2H), 7.59 (t, 7= 7.6 Hz, 1H), 7.48 (t, 7= 7.6 Hz, 1H), 7.40-7.35 (m, 1H).

Example 6: Synthesis of 3-fluoro-ll-oxo-10,11-dihydrodibenzo [6, f\ [1, 41 thiazepine-8carboxylic acid (42) - a common intermediate

Synthesis of methyl 4-fluoro-2-((4-methoxybenzyl) thio) benzoate (37):

CO₂Me

To a stirred solution of methyl 2-bromo-4-fluorobenzoate 36 (2 g, 8.58 mmol) in 1,4-dioxane (50 mL) under inert atmosphère were added (4-methoxyphenyl) methanethiol 8 (1.58 g, 10.25 mmol), césium carbonate (4.18 g, 12.80 mmol) at RT and purged under argon atmosphère for 30 min. To this was added Pd(dppf)₂Cl₂ (306 mg, 0.42 mmol); heated to 120 °C and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted with EtOAc (2 x 250 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 7% EtOAc/ hexanes to afford compound 37 (1.6 g, 61%) as an off-white solid. TLC: 10% EtOAc/ hexanes(R/ 0.4); ^JH NMR (CDC1₃, 400 MHz): δ 8.01 (dd, J= 8.7, 6.2 Hz, 1H), 7.34 (d, J= 7.9 Hz, 2H), 7.04 (dd, J= 10.3, 2.4 Hz, 1H), 6.88-6.80 (m, 3H), 4.09 (s, 2H), 3.88 (s, 3H), 3.80 (s, 3H).

Synthesis of methyl 4-fluoro-2-mercaptobenzoate (38):

'SH

A stirred solution of compound 37 (2.2 g, 7.18 mmol) in trifluoro acetic acid (30 mL) at RT under inert atmosphère was heated to 90 °C and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain compound 38 (1.33 g, crude) as brown syrup. The crude was carried forward for next step without further purification. TLC: 10% EtOAc/hexanes (R/. 0.8).

Synthesis of methyl 4-fluoro-2-((4-(methoxycarbonyl)-2-nitrophenyl) thio) benzoate (39):

To a stirred solution of methyl 4-fluoro-3-nitrobenzoate 2 (1.29 g, 6.93 mmol) in DMF (50 mL) under inert atmosphère were added césium carbonate (2.93 g, 9.01 mmol) and compound 38 (1.2 g,

O

6.03 mmol) at RT; heated to 55-60 C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL), the precipitated solid was filtered to obtain the crude. The crude was washed with pentane (2 x 20 mL) and dried in vacuo to afford compound 39 (1.5 g, 68%) as yellow solid. TLC: 10% EtOAc/ hexanes (Rf. 0.3);

*H-NMR (DMSO-iZtf, 400 MHz): δ 8.63 (s, 1H), 8.13-8.04 (m, 2H), 7.53-7.46 (m, 2H), 7.24 (d, J= 8.4 Hz, 1H), 3.89 (s, 3H), 3.72 (s, 3H).

Synthesis of 2-((4-carboxy-2-nitrophenyl) thio)-4-fluorobenzoic acid (40):

To a stirred solution of compound 39 (1.5 g, 4.10 mmol) in THF: H₂O (4: 1, 20 mL) was added lithium hydroxide monohydrate (690 mg, 16.4 mmol) at RT, heated to 80 C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The pH of the residue was acidified with 2 N HCl to ~6. The precipitated solid was filtered and dried in vacuo to afford compound 40 (1.2 g, 86%) as an off-white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.2); ^-NMR (DMSO-<4, 400 MHz): δ 13.46 (br s, 2H), 8.58 (s, 1H), 8.08-8.01 (m, 2H), 7.45-7.40 (m, 1H), 7.38-7.35 (m, 1H), 7.29 (d, J= 8.4 Hz, 1H).

Synthesis of 2-((2-amino-4-carboxyphenyl) thio)-4-fluorobenzoic acid (41):

To a stirred solution of compound 40 (1.2 g, 3.56 mmol) in MeOH (50 mL) under inert atmosphère was added 10% Pd/ C (300 mg) at RT and stirred under hydrogen atmosphère (balloon pressure) for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite, washed with MeOH (20 mL). The fîltrate was removed in vacuo to obtain the crude which as triturated with 10% EtOAc/ n-pentane (50 mL) to afford compound 41 (1 g, 91%) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (R/. 0.3); ^-NMR (DMSO-î/₆,400 MHz): δ 12.96 (br s, 2H), 8.06-8.02 (m, 1H), 7.46 (s, 1H), 7.40 (d, J= 8.0 Hz, 1H), 7.16 (d, J= 8.0 Hz, 1H), 7.077.02 (m, 1H), 6.24 (d, J= 8.0 Hz, 1H), 5.67 (br s, 2H).

Synthesis of 3-fluoro-ll-oxo-10,11-dihydrodibenzo [b,f\ [1,4] thiazepine-8-carboxylic acid (42):

To a stirred solution of compound 41 (1 g, 3.25 mmol) in THF (30 mL) under inert atmosphère was added CDI (1.61 g, 9.77 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was acidified with 2 N HCl to pH~4. The obtained solid was filtered, washed with water (20 mL), ether (2x5 mL) and dried in vacuo to afford compound 42 (760 mg, 80%) as white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.3); ^-NMR (DMSO-^, 400 MHz): δ 13.24 (br s, 1H), 10.83 (s, 1H), 7.78-7.74 (m, 2H), 7.69-7.66 (m, 2H), 7.47.7.44 (_m, 1H), 7.35-7.30 (m, 1H).

Example 7: Synthesis of 4-fluoro-ll-oxo-10,11-dihydrodibenzo Γ/x fi [1, 4] thiazepine-815 carboxylic acid (50) - a common intermediate

Synthesis of methyl 2, 3-difluorobenzoate (44):

F

F .CO₂Me

To a stirred solution of 2, 3-difluorobenzoic acid 43 (1 g, 6.28 mmol) in MeOH (10 mL) under inert o atmosphère was added Conc. H2SO4 (5 mL) at 0 C and heated to reflux for 36 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (25 mL) and pH adjusted to ~8 with saturated sodium bicarbonate solution (20 mL) and extracted with EtOAc (2 x 20 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 20% EtOAc/ hexanes to afford compound 44 (800 mg, 74%) as an off-white solid. TLC: 40% EtOAc/ hexanes (Rf 0.8); ^XH NMR (DMSO-<4, 500 MHz) δ 7.80 - 7.65 (m, 2H), 7.41-7.23 (m, 1H), 3.88 (s, 3H).

Synthesis of methyl 3-fluoro-2-((4-methoxybenzyl) thio) benzoate (45):

•SPMB

To a stirred solution of compound 44 (800 mg, 4.65 mmol) in DMF (10 mL) under inert atmosphère were added (4-methoxyphenyl) methanethiol 8 (282 mg, 5.11 mmol), césium carbonate (1.66 g, 5.11 mmol) at RT and stirred for 6 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted water (25 mL) and extracted with ether (2 x 40 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 20% EtOAc/ hexanes to afford compound 45 (750 mg, 53%) as an off-white solid. TLC: 20% EtOAc/ hexanes (Rf. 0.4); Ή NMR (DMSO-zZ* 500 MHz): δ 7.49-7.36 (m, 3H), 7.10 (d, J = 8.9 Hz, 2H), 6.79 (d, J= 8.9 Hz, 2H), 4.06 (s, 2H), 3.81 (s, 3H), 3.70 (s, 3H);

Synthesis of methyl 3-fiuoro-2-mercaptobenzoate (46):

A stirred solution of compound 45 (750 mg, 2.45 mmol) in trifluoro acetic acid (7 mL) at RT under inert atmosphère was heated to 70 C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain compound 46 (1.1 g, crude) as colorless liquid. The crude was carried forward for next step. TLC: 30% EtOAc/ hexanes (Rf. 0.8).

Synthesis of methyl 3-fluoro-2-((4-(methoxycarbonyl)-2-nitrophenyl) thio) benzoate (47):

To a stirred solution of compound 46 (5.96 g, 3.20 mmol) in DMF (100 mL) under inert atmosphère were added methyl 4-fluoro-3-nitrobenzoate 2 (5.8 g, 2.91 mmol), césium carbonate (10.41 g, 3.20 mmol) at RT; heated to 80 °C and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice cold water (25 mL). The obtained solid was fîltered, washed with hexane (2x10 mL) and dried in vacuo to afford compound 47 (7.8 g, 73%) as an pale yellow solid. TLC: 30% EtOAc/ hexanes(R/ 0.5); ¹H NMR (DMSO-d«, 500 MHz): δ 8.67 (s, 1H), 8.05 (dd, J= 8.7, 1.7 Hz, 1H), 7.94-7.75 (m, 2H), 7.73-7.67 (m, 1H), 7.00 (d, J= 8.4 Hz, 1H), 3.88 (s, 3H), 3.77-3.64 (m, 3H).

Synthesis of methyl 2-((2-amino-4-(methoxycarbonyl) phenyl) thio)-3-fluorobenzoate (48):

To a stirred solution of compound 47 (670 mg, 1.83 mmol) in MeOH (10 mL) under inert atmosphère was added 10% Pd/C (150 mg) at RT and stirred under hydrogen atmosphère (balloon pressure) for 12 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was fîltered through celite and the filtrate was concentrated in vacuo to afford compound 48 (500 mg, 81%) as an off-white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.4); *H NMR (DMSO-rfô, 400 MHz): δ 7.58-7.50 (m, 2H), 7.48-7.41 (m, 1H), 7.33 (s, 1H), 7.04 (s, 2H), 5.59 (br s, 2H), 3.82 (s, 3H), 3.79 (s, 3H).

Synthesis of 2-((2-amino-4-carboxyphenyI) thio)-3-fluorobenzoic acid (49):

To a stirred solution of compound 48 (500 mg, 1.49 mmol) in THF: H₂O (4: 1, 20 mL) was added lithium hydroxide monohydrate (376 mg, 8.95 mmol) at RT; heated to 80 C and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (25 mL) and washed with diethyl ether (2 x 25 mL). The aqueous layer was acidified with 2 N HCl to pH~4 and extracted with EtOAc (2 x 20 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude which was washed with diethyl ether (2x5 mL) and dried in vacuo to afford compound 49 (300 mg, 65%) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.2); *H NMR (DMSO-rfô, 500 MHz): δ 12.68 (br s, 2H), 7.54-7.45 (m, 2H), 7.39-7.32 (m, 1H), 7.28 (s, 1H), 7.097.06 (m, 1H), 7.02-6.96 (m, 1H), 5.56 (br s, 2H);

Synthesis of 4-fluoro-ll-oxo-10,11-dihydrodibenzo {b,f\ [1, 4] thiazepine-8-carboxylic acid (50):

To a stirred solution of compound 49 (300 mg, 0.97 mmol) in THF (15 mL) under inert atmosphère was added CDI (474 mg, 2.92 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The pH of the residue was acidified with 4 N HCl to ~2. The obtained solid was filtered, washed with diethyl ether (2x5 mL) and dried in vacuo to afford compound 50 (150 mg, 53%) as an off-white solid. TLC: 15%

MeOH/ CH₂C1₂ (Rf. 0.5); *H NMR (DMSO-J₆,400 MHz): δ 13.38 (br s, 1H), 10.92 (s, 1H), 7.79 (s,

1H), 7.75-7.66 (m, 2H), 7.55-7.46 (m, 3H).

Example 8: Synthesis of 7-fluoro-ll-oxo-10,11-dihydrodibenzo \b, f\ Fl, 41 thiazepine-8carboxylic acid (55) - a common intermediate

Synthesis of methyl 2-fluoro-4-((2-(methoxycarbonyl) phenyl) thio)-5-nitrobenzoate (52):

o

COOMe

S2

To a stirred solution of methyl 2, 4-difluoro-5-nitrobenzoate 51 (9.0 g, 41.45 mmol) in DMF (100 mT,) under inert atmosphère were added methyl 2-mercaptobenzoate 1 (6.97 g, 41.45 mmol), césium 10 carbonate (14.82 g, 45.60 mmol) at 0 °C; warmed to 10 °C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (800 mT,) and extracted with EtOAc (2 x 500 mL). The combined organic extracts were dried under sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 10% EtOAc/ hexanes to afford compound 52 (11 g, 15 73%) as an off-white solid. TLC: 10% EtOAc/ hexanes (Rf. 0.4); ^JH NMR (DMSO-î/^400 MHz):

δ 8.69 (d, J= 6.8 Hz, 1H), 8.04-7.92 (m, 1H), 7.81-7.69 (m, 3H), 6.60 (d, J= 11.5 Hz, 1H), 3.88 (s, 3H), 3.73 (s, 3H).

Synthesis of methyl 5-amino-2-fluoro-4-((2-(methoxycarbonyl) phenyl) thio) benzoate (53):

ο

COOMe

Το a stiired solution of compound 52 (11 g, 30.13 mmol) in MeOH (400 mL) under inert atmosphère was added 10% Pd/ C (5 g) at RT and stirred under hydrogen atmosphère (balloon pressure) for 24 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was fïltered through celite, washed with 30% MeOH/ CH2CI2 (3 x 60 mL). The filtrate was removed in vacuo to afford compound 53 (6.5 g, 64%) as an off-white solid. TLC: 20% EtOAc/ hexanes (Rf. 0.4); Ti NMR (DMSO-J_6j400 MHz): δ 8.01-7.88 (m, 1H), 7.45-7.40 (m, 1H), 7.34-7.24 (m, 3H), 6.72 (dd, J= 8.2, 0.8 Hz, 1H), 5.51 (s, 2H), 3.88 (s, 3H), 3.85 (s, 3H).

Synthesis of 5-amino-4-((2-carboxyphenyI) thio)-2-fluorobenzoic acid (54):

COOH

To a stirred solution of compound 53 (6.5 g, 19.4 mmol) in THF: H2O (4: 1, 90 mL) was added lithium hydroxide monohydrate (4 g, 97.01 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The pH of the residue was acidified with 2 N HCl to ~4. The precipitated solid was fïltered and dried in vacuo to afford compound 54 (4.5 g, 75.6%) as an off-white solid. TLC: 30% EtOAc/ hexane (Rf. 0.2); ^JH NMR (DMSO-îZ₆₎ 400 MHz): δ 13.19 (br s, 2H), 7.96 (dd, J= 7.7, 1.5 Hz, 1H), 7.39 (t, J= 7.3 Hz, 1H), 7.30 (d, J= 6.6 Hz, 1H), 7.27-7.20 (m, 2H), 6.68 (dd, J= 8.2, 0.7 Hz, 1H), 5.42 (br s, 2H).

Synthesis of 7-fluoro-ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8-carboxylic acid (55):

To a stirred solution of compound 54 (4.5 g, 14.65 mmol) in THF (100 mL) under inert atmosphère was added CDI (11.88 g, 73.28 mmol) at 0 °C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with 2 N HCl to pH~4; the precipitated solid was fîltered, dried in vacuo to afford compound 55 (3.5 g, 83%) as an off-white solid. TLC: 15% MeOH/ CH₂C1₂ (Rf. 0.2); *H NMR (DMSO-d_6i400 MHz): δ 13.61 (br s, 1H), 10.75 (s, 1H), 7.74-7.65 (m, 2H), 7.59-7.45 (m, 4H).

Example 9: Synthesis of 7, 9-difluoro-ll-oxo-10,11-dihydrodibenzo [b, f\ fl, 4] thiazepine-8carboxylic acid (62) - a Common Intermediate

Synthesis of 2, 4, 6-trifluoro-3-nitrobenzoic acid (57):

To 2, 4, 6-trifluorobenzoic acid 56 (15 g, 85.22 mmol) at 0 °C, fuming nitric acid (20 mL) was added dropwise for 10 min; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice cold water (500 mL) and extracted with EtOAc (2 x 200 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to afford compound 57 (20 g) as pale yellow liquid. TLC: 5% MeOH/ CH₂C1₂+ 0.05 mL CH3COOH (Rf. 0.2); *H NMR (DMSO-îZ₆,400 MHz): δ 14.12 (br s, 1H), 7.83 (td, J= 10.5, 2.1 Hz, 1H).

Synthesis of methyl 2, 4, 6-trifluoro-3-nitrobenzoate (58):

To a stirred solution of compound 57 (20 g) in MeOH (200 mL) under argon atmosphère was added concentrated sulfuric acid (20 mL) dropwise for 20 min at 0 C and heated to reflux for 48 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (500 mL) and extracted with EtOAc (4 x 200 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 5-8% EtOAc/ hexanes to afford compound 58 (14 g, 70% for 2 steps) as pale yellow syrup. TLC: 20% EtOAc/ hexane (Rf. 0.8); *H NMR (DMSO-î/₆, 400 MHz): δ 7.88 (td, 10.6, 2.2 Hz, 1H), 3.93 (s, 3H).

Synthesis of methyl 2, 6-difluoro-4-((2-(methoxycarbonyl) phenyl) thio)-3-nitrobenzoate (59):

F O

COOMe

To a stirred solution of compounds 58 (14 g, 59.57 mmol) in DMF (300 mL) under inert atmosphère were added methyl 2-mercaptobenzoate 1 (11.1 g, 66.07 mmol), césium carbonate (38.77 g, 119.14 mmol) at 0 °C; warmed to RT and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice cold water (200 mL) and extracted with EtOAc (3 x 300 mL). The combined organic extracts were washed with water (200 mT,), brine (200 mL), dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography to afford compound 59 (14.5 g, 64%) as yellow syrup. TLC: 10% EtOAc/ hexanes (Rf. 0.2); ^JH NMR (DMSO-î/ô, 500

MHz): δ 7.98 (dd, J= Ί.Ί, 1.3 Hz, 1H), 7.66-7.61 (m, 1H), 7.59-7.55 (m, 1H), 7.46 (d, J= 7.8 Hz,

1H), 7.19 (d, J= 9.3 Hz, 1H), 3.93 (s, 3H), 3.81 (s, 3H).

Synthesis of methyl 3-amino-2, 6-difluoro-4-((2-(methoxycarbonyl) phenyl) thio) benzoate (60):

F O

COOMe

To a stirred solution of compound 59 (18 g, 46.99) in MeOH (400 mL) under inert atmosphère was added Pd/C (9 g, 50% wet) at RT and stirred under hydrogen atmosphère in an autoclave (5 kg/cm²pressure) for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite, washed with MeOH (500 mL). The filtrate was concentrated in vacuo to afford compound 60 (15.1 g, 91%) as colorless semi solid. TLC: 20% EtOAc/ hexanes (À/ 0.5); Tl NMR (DMSO-J₆,500 MHz): δ 8.00-7.93 (m, 1H), 7.48-7.42 (m, 1H), 7.31-7.21 (m, 2H), 6.76-6.64 (m, 1H), 5.54-5.47 (m, 2H), 3.91 (s, 3H), 3.89 (s, 3H).

Synthesis of 3-amino-4-((2-carboxyphenyl) thio)-2, 6-difluorobenzoic acid (61):

F O

COOH

To a stirred solution of compound 60 (15.1 g, 39.42 mmol) in THF: H2O (4: 1, 250 mL) was added lithium hydroxide monohydrate (8.3 g, 197.61 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo, diluted with water (100 mL) and washed with EtOAc (2 x 100 mL). The pH of the aqueous layer was acidified with 4 N HCl to ~4. The precipitated solid was filtered, washed with water (100 mL), pentane (100 mL). The obtained solid was further dried using toluene (150 mL) to afford compound 61 (11 g, 79%) as an off-white solid. TLC: 20% EtOAc/ hexanes (Rf. 0.2); *H NMR (DMSO-îZô, 400 MHz): δ 13.24 (br s, 1H), 7.97 (dd, J= 7.7, 1.4 Hz, 1H), 7.46-7.39 (m, 1H), 7.28-7.19 (m, 2H), 6.66 (d, J= 8.2 Hz, 1H), 5.39 (br s, 2H).

Synthesis of 7, 9-difluoro-ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8-carboxylic acid (62):

To a stirred solution of compound 61 (10 g, 30.76 mmol) in THF (200 mL) under argon atmosphère 5 was added CDI (14.9 g, 81.97 mmol) at RT and stirred for 24 h. The reaction was monitored by

TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (300 mL) and the pH was adjusted to ~3 with 2 N HCl. The obtained solid was filtered, washed with water (100 mL), pentane (50 mL) and diethyl ether (150 mL) and dried in vacuo to obtain compound 62 (2.83 g, 30%) as brick red solid. TLC: 15% MeOH/ CH2CI2 (Rf. 0.3); ³H

NMR (DMSO-rfe, 500 MHz): δ 14.19 (br s, 1H), 10.64 (s, 1H), 7.73-7.66 (m, 2H), 7.58- 7.48 (m, 3H).

Example 10: 2-methoxy-ll-oxo-10, 11-dihydrodibenzo [Z>, f\ il, 41 thiazepine-8-carboxylic acid (70) - a common intermediate

Synthesis of methyl 5-methoxy-2-(((trifluoromethyl) sulfonyl) oxy) benzoate (64):

To a stirred solution of methyl 2-hydroxy-5-methoxybenzoate 63 (2 g, 10.97 mmol) in pyridine (8 mL) under inert atmosphère was added triflic anhydride (3.56 g, 12.62 mmol) at 0 °C; warmed to RT 5 and stirred for 2 h; heated to 40 C and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (40 mL) and extracted with ether (3 x 40 mL). The combined organic extracts were washed with 1 N HCl (40 mL), water (40 mL), brine (40 mL), dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using

5-10% EtOAc/ hexanes to afford compound 64 (2.9 g, 85%) as colorless liquid. TLC: 10% EtOAc/ hexanes (Rf. 0.6); ^-NMR (CDC1₃, 500 MHz): δ 7.50 (s, 1H), 7.09 (d, J= 7.5 Hz, 1H), 7.03 (d, J = 7.5 Hz, 1H), 3.94 (s, 3H), 3.84 (s, 3H).

Synthesis of methyl-5-methoxy-2-((4-methoxybenzyl) thio) benzoate (65):

To a stirred solution of compound 64 (500 mg, 1.59 mmol) in 1, 4-dioxane (10 mL) under inert atmosphère were added (4-methoxyphenyl) methanethiol 8 (270 mg, 1.75 mmol), césium carbonate (1.035 g, 3.18 mmol) at RT and degassed for 20 min. To this was added Pd(dppf)2C12 (29.1 mg, 0.039 mmol); heated to 110 °C and stirred for 10 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted with

EtOAc (2 x 30 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 10-15% EtOAc/ hexanes to afford compound 65 (280 mg, 55%) as pale yellow solid. TLC: 10% EtOAc/hexanes(Æ/ 0.4); ¹H-NMR (CDCI3, 500 MHz): δ 7.42 (s, 1H), 7.28-7.25 (m, 3H), 6.98 (d, J= 8.5 Hz, 1H), 6.84 (d, J= 8.5 Hz, 2H), 4.08 (s, 2H), 3.93 (s, 3H), 3.83 (s,3H),3.81 (s,3H).

Synthesis of methyl 2-mercapto-5-methoxybenzoate (66):

CO₂Me

SH

A stirred solution of compound 65 (280 mg, 0.88 mmol) in trifluoro acetic acid (10 mL) at RT under inert atmosphère was heated to 70 C and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain compound 66 (170 mg, crude) as brown syrup. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.8); ’H-NMR (DMSO-J_tf, 400 MHz): δ 7.68 (d, 8.0 Hz, 1H), 7.48 (d, J= 7.2 Hz, 1H), 7.39 (s, 1H), 5.13 (s, 1H), 3.88 (s, 3H), 3.84 (s,

3H).

Synthesis of methyl 5-methoxy-2-((4-(methoxycarbonyl)-2-nitrophenyl) thio) benzoate (67):

To a stirred solution of compound 66 (150 mg, 0.75 mmol) in DMF (5 mL) under inert atmosphère were added methyl 4-fluoro-3-nitrobenzoate 2 (164 mg, 0.82 mmol), césium carbonate (490 mg, 1.50 mmol) at RT; heated to 55-60 °C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted with CH₂C1₂ (2 x 30 mL). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 15-25% EtOAc/hexanes to afford compound 67 (200 mg, 70%) as yellow solid. TLC: 10% EtOAc/ hexanes^/ 0.3); ’H-NMR (DMSO-î/₆, 400 MHz): δ 8.64 (s, 1H), 8.02 (d, J= 8.4 Hz, 1H), 7.69 (d, J= 8.8 Hz, 1H), 7.59-7.54 (m, 1H), 7.31 (d, J= 8.8 Hz, 1H), 6.94 (d, J = 8.8 Hz, 1H), 3.88 (s, 3H), 3.87 (s, 3H), 3.68 (s, 3H).

Synthesis of methyl 2-((2-amino-4-(methoxycarbonyl) phenyl) thio)-5-methoxybenzoate (68):

To a stirred solution of compound 67 (200 mg, 0.53 mmol) in MeOH (10 mL) under inert atmosphère was added 10% Pd/ C (100 mg) at RT and stirred under hydrogen atmosphère (balloon pressure) for 26 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite and washed with 50% CH2CI2/ MeOH (2 x 25 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 15-20% EtOAc/ hexanes to afford compound 68 (120 mg, 65%) as yellow solid. TLC: 30% EtOAc/ hexanesÇK/ 0.6); ’H-NMR (DMSO-d₆, 400 MHz): δ 7.42 (s, 2H), 7.36 (d, J= 8.0 Hz, 1H), 7.12 (d, 7= 8.0 Hz, 1H), 7.05 (d, 7= 8.4 Hz, 1H), 6.66 (d, 7= 8.8 Hz, 1H), 5.61 (s, 2H), 3.87 (s, 3H), 3.83 (s, 3H), 3.75 (s, 3H).

Synthesis of 2-((2-amino-4-carboxyphenyl) thio)-5-methoxybenzoic acid (69):

nh₂

To a stirred solution of compound 68 (120 mg, 0.34 mmol) in THF: H₂O (4: 1,5 mL) was added lithium hydroxide monohydrate (72.5 mg, 1.72 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (10 mL) and acidified with 6 N HCl to pH~4. The precipitated solid was filtered and dried in vacuo to afford compound 69 (80 mg, 73%) as an off-white solid. TLC: 40% EtOAc/ hexanes (Rf. 0.2); *H-NMR (DMSO-7₆, 400 MHz): δ 12.99 (br s, 2H), 7.41 (d, 7= 8.4 Hz, 2H), 7.35 (d, 7= 7.6 Hz, 1H), 7.12 (d, 7= 7.6 Hz, 1H), 7.01 (d, 7= 8.8 Hz, 1H), 6.61 (d, 7= 8.8 Hz, 1H), 5.54 (br s, 2H), 3.74 (s, 3H).

Synthesis of 2-methoxy-ll-oxo-10,11-dihydrodibenzo [b,f\ [1, 4] thiazepine-8-carboxylic acid (70):

To a stirred solution of compound 69 (80 mg, 0.25 mmol) in THF (5 mL) under inert atmosphère was added CDI (122 mg, 0.75 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (10 mL) and acidified with 6 N HCl to pH~4. The precipitated solid was filtered and dried in vacuo to afford compound 70 (40 mg, 53%) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.4); *H-NMR (DMSO-</₆, 400 MHz): δ 13.15 (br s, 1H), 10.79 (s, 1H), 7.78 (s, 1H), 7.69-7.66 (m, 2H), 7.44-7.42 (m, 1H), 7.20-7.19 (m, 1H), 7.08-7.05 (m, 1H), 3.77 (s, 3H).

Example 11: 7-methoxy-ll-oxo-10,11-dihydrodibenzo |7x f] [1, 4] thiazepine-8-carboxylic acid (76) - a common intermediate

Synthesis of methyl 4-fluoro-2-methoxy-5-nitrobenzoate (72):

To a stirred solution of methyl 4-fhroro-2-methoxybenzoate 71 (500 mg, 2.50 mmol) in sulfuric acid 15 (1 mL) under inert atmosphère was added the mixture of nitric acid (0.125 mL), sulfuric acid (0.5 mL) at -5 C and stirred for 10 min. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (25 mL) and extracted with CH₂C1₂ (2 x 30 mL). The combined organic extracts were washed with 10% NaHCO₃ solution (20 mL), dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was triturated with diethyl ether (2x5 mL) to afford compound 72 (200 mg, 33%) as an off-white solid. TLC: 20%

EtOAc/ hexanes (Rf. 0.4); ’H-NMR (CDCI_3j 400 MHz): δ 8.69 (d, J= 8.8 Hz, 1H), 6.83 (d, J= 12.8 Hz, 1H), 4.01 (s, 3H), 3.92 (s, 3H).

Synthesis of methyl 2-methoxy-4-((2-(methoxycarbonyl) phenyl) thio)-5-nitrobenzoate (73):

CO₂Me

To a stirred solution of compound 72 (200 mg, 0.81 mmol) in DMF (4 mL) under inert atmosphère were added methyl 2-mercaptobenzoate 1 (151 mg, 0.89 mmol), césium carbonate (318 mg, 0.97 mmol) at RT; heated to 80 C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice water (20 mL) and extracted with EtOAc (2 x 35 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 15% EtOAc/ hexanes to afford compound 73 (200 mg, 61%) as yellow solid.

TLC: 20% EtOAc/ hexanes (Rf. 0.4); *H-NMR (CDC1₃, 400 MHz): δ 8.80 (s, 1H), 7.94-7.92 (m, 1H), 7.70 (t, 7= 8.0 Hz, 1H), 7.61-7.59 (m, 2H), 6.30 (s, 1H), 3.90 (s, 3H), 3.82 (s, 3H), 3.52 (s, 3H).

Synthesis of methyl 5-amino-2-methoxy-4-((2-(methoxycarbonyl) phenyl) thio) benzoate (74):

Y^S'^^OMe

CO2M©

To a stirred solution of compound 73 (200 mg, 0.53 mmol) in MeOH (15 mL) under inert atmosphère was added 10% Pd/C (100 mg) at RT and stirred under hydrogen atmosphère (balloon pressure) for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite and the filtrate was concentrated in vacuo to obtain the crude. The crade was purified through silica gel column chromatography using 15% EtOAc/ hexanes to afford compound 74 (110 mg, 60%) as yellow sticky solid. TLC: 20% EtOAc/ hexanes (Rf. 0.6); ’H-NMR (CDCI₃,400 MHz): δ 7.99 (d, 7= 8.0 Hz, 1H), 7.54 (s, 1H), 7.34-7.31 (m, 1H),

7.20 (t, J= 8.0 Hz, 1H), 7.12 (s, 1H), 6.80 (d, J= 8.4 Hz, 1H), 3.96 (s, 3H), 3.88 (s, 3H), 3.80 (s, 3H).

Synthesis of 5-amino-4-((2-carboxyphenyl) thio)-2-methoxybenzoic acid (75):

To a stirred solution of compound 74 (110 mg, 0.31 mmol) in THF: H₂O (5: 1,3 mL) was added lithium hydroxide monohydrate (66 mg, 1.58 mmol) at RT; heated to 70 C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (15 mL) and extracted with EtOAc (2 x 25 mL). The aqueous layer was acidifîed to pH~2 with 6 N HCl, the obtained solid was filtered, washed with n-hexane (2x5 mL) and dried in vacuo to afford compound 75 (70 mg, 70%) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.2); ’H-NMR (DMSO-rf₆, 500 MHz): δ 12.78 (br s, 2H), 7.94 (d, J= 7.5 Hz, 1H), 7.36 (t, J= 7.5 Hz, 1H), 7.20 (t, J= 7.5 Hz, 1H), 7.13 (s, 1H), 7.05 (s, 1H), 6.67 (d, J= 8.5 Hz, 1H), 5.11 (br s, 2H), 3.68 (s, 3H).

Synthesis of 7-methoxy-ll-oxo-10,11-dihydrodibenzo [b,f\ [1, 4] thiazepine-8-carboxylic acid (76):

To a stirred solution of compound 75 (70 mg, 0.21 mmol) in THF (2 mL) under inert atmosphère was added CDI (106 mg, 0.65 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo, diluted with ice water (15 mL), acidifîed with 6 N HCl, the obtained solid was filtered, washed with 20% EtOAc/ hexanes and dried in vacuo to afford compound 76 (40 mg, 61%) as an off-white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.3); ’H-NMR (DMSO-d₆,400 MHz): δ 12.88 (br s, 1H), 10.64 (s, 1H), 7.71-7.69 (m, 1H), 7.58-7.42 (m, 4H), 7.28 (s, 1H), 3.81 (s, 3H).

Example 12: Synthesis of 6-methyl-ll-oxo-10,11-dihydrodibenzo [6, M [1, 41 thiazepine-8carboxylic acid (82) - a common intermediate

Synthesis of methyl 4-bromo-3-methyl-5-nitrobenzoate (78):

To a stirred solution of methyl 4-bromo-3-methylbenzoate 77 (500 mg, 2.18 mmol) in sulfuric acid: trifluoro acetic acid (1: 0.1, 6.6 mL) under inert atmosphère was added potassium nitrate (231 mg, 2.29 mmol) at 0 °C; warmed to RT and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with ice water (20 mL) and extracted 10 with EtOAc (2 x 20 mL). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to afford crude compound 78 (540 mg, 95%) as yellow oil. TLC: 10% EtOAc/hexanes (Rf. 0.4); *H-NMR (DMSO-r/_d, 400 MHz): δ 8.25 (s, 1H), 8.17 (s, 1H), 3.89 (s, 3H), 2.53 (s, 3H).

Synthesis of methyl 4-((2-(methoxycarbonyl) phenyl) thio)-3-methyl-5-nitrobenzoate (79):

To a stirred solution of methyl 2-mercaptobenzoate 1 (575 mg, 2.18 mmol) in DMF (6 mL) under inert atmosphère were added césium carbonate (1.42 g, 4.37 mmol), compound 78 (385 mg, 2.29 mmol) at RT; heated to 65 °C and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted with EtOAc (2 x 25 mL). The combined organic extracts were washed with water (15 mL), brine (15 mL), dried over sodium sulfate, filtered and concentrated in vacuo to afford the crude. The crude was recrystallized using CH2CI2: n-pentane (1: 4, 5 mL) to afford compound 79 (120 mg, 16%) as yellow solid. TLC: 20% EtOAc/ hexanes (Rf. 0.4); ’H-NMR (DMSO-rf_d, 400 MHz): δ 8.32 (s, 1H), 8.24 (s, 1H), 7.63-7.59 (m, 1H), 7.49-7.45 (m, 1H), 7.23 (t, J= 8.0 Hz, 1H), 6.61 (d, J= 8.0 Hz, 1H), 3.92 (s, 3H), 3.89 (s, 3H), 2.35 (s, 3H).

Synthesis of methyl 3-amino-4-((2-(methoxycarbonyl) phenyl) thio)-5-methylbenzoate (80):

To a stirred solution of compound 79 (200 mg, 0.55 mmol) in MeOH (5 mL) under inert atmosphère was added Pd/C (70 mg) at RT and stirred under hydrogen atmosphère for 6 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude compound 80 (175 mg, 96%) as yellow solid. TLC: 30% EtOAc/ hexanes (Rf. 0.7); ¹HNMR (DMSO-ίήί, 400 MHz): δ 7.96 (d, J= 7.6 Hz, 1H), 7.38-7.31 (m, 2H), 7.24-7.20 (m, 1H), 7.14 (s, 1H), 6.56 (d, J= 8.0 Hz, 1H), 5.67 (s, 2H), 3.89 (s, 3H), 3.83 (s, 3H), 2.25 (s, 3H).

Synthesis of 3-amino-4-((2-carboxyphenyl) thio)-5-methylbenzoic acid (81):

To a stirred solution of compound 80 (160 mg, 0.48 mmol) in THF: H₂O (3: 1.5, 4.5 mL) was added lithium hydroxide (118 mg, 2.90 mmol) at RT and stirred for 24 h; heated to reflux and stirred for 12 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (15 mL), fiitered the precipitated solid and dried in vacuo to afford the crude compound 81 (140 mg, 96%) as an off-white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.2); *H-NMR (DMSO-r/₆, 400 MHz): δ 13.00 (br s, 2H), 7.95 (d, J= 8.0 Hz, 1H), 7.35-7.29 (m, 2H), 7.19 (t, J= 7.6 Hz, 1H), 7.13 (s, 1H), 6.54 (d, J= 8.0 Hz, 1H), 5.30 (br s, 2H), 2.25 (s, 3H).

Synthesis of 6-methyl-ll-oxo-10,11-dihydrodibenzo [b,j\ [1, 4] thiazepine-8-carboxyIic acid (82)

To a stirred solution of compound 81 (140 mg, 0.46 mmol) in THF (5 mL) under inert atmosphère was added CDI (375 mg, 2.31 mmol) at RT and stirred for 24 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo and neutralized with 1 N 15 HCl, fiitered the precipitated solid and dried in vacuo to afford the crude compound 82 (120 mg,

91%) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.4); ’H-NMR (DMSO-rf₆, 400 MHz): δ 13.05 (br s, 1H), 10.73 (s, 1H), 7.69-7.58 (m, 4H), 7.51-7.44 (m, 2H), 2.56 (s, 3H).

Example 13: Synthesis of 7-methyl-ll-oxo-10, 11-dihydrodibenzo \b, f\ [1, 4] thiazepine-8carboxylic acid (88) - a common intermediate

Synthesis of 4-fluoro-2-methyl-5-nitrobenzoic acid (84):

To a stirred solution of 4-fluoro-2-methylbenzoic acid 83 (500 mg, 3.24 mmol) in concentrated sulfuric acid (2.5 mL) under inert atmosphère was added potassium nitrate (655 mg, 6.49 mmol) at 0 °C; warmed to RT and stirred for 6 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with ice water (20 mL), filtered the precipitated solid and dried in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 5% MeOH/ CH2CI2 to afford compound 84 (300 mg, 60%) as brown syrup.

TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.3); ^I-NMR (DMSO-4₆,500 MHz): δ 13.56 (br s, 1H), 8.52 (d, J = 8.0 Hz, 1H), 7.61 (d, J= 12.5 Hz, 1H), 2.63 (s, 3H).

Synthesis of 4-((2-(methoxycarbonyl) phenyl) thio)-2-methyl-5-nitrobenzoic acid (85):

CC^Me NO2

To a stirred solution of methyl 2-mercaptobenzoate 1 (514 mg, 3.08 mmol) in DMF (10 mL) under inert atmosphère were added césium carbonate (1.81 g, 5.57 mmol), compound 84 (560 mg, 2.78 mmol) at RT; heated to 60 °C and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed under reduced pressure. The residue was diluted with water (20 mL) and pH was adjusted to ~2 with 1 N HCl, fîltered the precipitated solid and dried in vacuo to afford compound 85 (500 mg, 52%) as an off-white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.4); ’H-NMR (DMSO-î/₆, 400 MHz): δ 13.47 (br s, 1H), 8.59 (s, 1H), 7.94 (d, J= 7.2 Hz, 1H), 7.68-7.60 (m, 3H), 6.83 (s, 1H), 3.72 (s, 3H), 2.40 (s, 3H).

Synthesis of methyl 3-amino-4-((2-(methoxycarbonyl) phenyl) thio)-5-methylbenzoate (86):

To a stirred solution of compound 85 (500 mg, 1.45 mmol) in THF: H₂O (2:1, 15 mL) was added lithium hydroxide monohydrate (300 mg, 7.31 mmol) at RT and stirred for 8 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (15 mL), and pH was adjusted to ~2 with 1 N HCl, fîltered the precipitated solid and dried in vacuo to afford crude compound 86 (500 mg) as an off-white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.1); *H-NMR (DMSO-rf_ô, 400 MHz): δ 13.51 (br s, 2H), 8.57 (s, 1H), 7.92 (d, J= 7.2 Hz, 1H), 7.64-7.58 (m, 2H), 7.53 (t, J= 8.0 Hz, 1H), 6.89 (s, 1H), 2.41 (s, 3H).

Synthesis of 5-amino-4-((2-carboxyphenyl) thio)-2-methy!benzoic acid (87):

co₂h nh₂

To a stirred solution of compound 86 (500 mg) in MeOH (15 mL) under inert atmosphère was added Pd/ C (250 mg) at RT and stirred under hydrogen atmosphère for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to afford crude compound 87 (430 mg) as an off-white solid. TLC: MeOH/ CH₂C1₂ (Rf. 0.1); LC-MS: 84.24%;

304.5 (M⁺+l); (column; X-Select CSH C-18, (50 x 3.0 mm, 3.5 pm); RT 3.75 min. 0.05% TFA (Aq): ACN; 0.8 mL/min).

Synthesis of 7-methyl-ll-oxo-10,11-dihydrodibenzo [b,/] [1, 4] thiazepine-8-carboxylic acid (88):

To a stirred solution of compound 87 (430 mg) in THF (20 mL) under inert atmosphère was added

CDI (1.15 g, 7.09 mmol) at RT and stirred for 18 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo and neutralized with 1 N HCl, fïltered the precipitated solid and dried in vacuo to afford the crude compound 88 (290 mg) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.5); ^-NMR (DMSO-rf₆, 500 MHz): δ 13.15 (br s, 1H), 10.68 (s, 1H), 7.69-7.68 (m, 2H), 7.67-7.44 (m, 4H), 2.44 (s, 3H).

Example 14: 9-methyl-ll-oxo-10,11-dihydrodibenzo \b„ f\ [1,41 thiazepine-8-carboxylic acid (96) - a common intermediate and Synthesis of 7-methyI-ll-oxo-10,11-dihydrodibenzo FA f] fl, 4] thiazepine-8-carboxyIic acid (88) a common intermediate - Alternate Approach

Synthesis of mixture of 4-fluoro-2-methyl-3-nitrobenzoic acid (89) and 4-fluoro-2-methyl-5nitrobenzoic acid (84):

To a stirred solution of 4-fluoro-2-methylbenzoic acid 83 (10 g, 64.51 mmol) in acetic acid (50 mL) under inert atmosphère was added fuming nitric acid (50 mL) at RT and heated to 80 °C for 6 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice cold water (100 mL). The precipitate was filtered and dried in vacuo to afford mixture of compounds 84 and 89 (5.3 g, 40%) as white solid. TLC: 70% EtOAc/ hexanes (Rf. 0.4); ¹H NMR (DMSO-dô,400 MHz): δ 13.30 (br s, 2H), 8.52 (d, J= 8.0 Hz, 2H), 8.10 (dd, J= 8.9 5.9, Hz, 1H), 7.60 (d, J= 12.5 Hz, 2H), 7.56 (t, J= 9.3 Hz, 1H), 2.63 (s, 6H), 2.48 (s, 3H); (’H NMR showed mixture of compounds 84 and 89 in the ratio of 2: 1).

Synthesis of methyl 4-fluoro-2-methyl-3-nitrobenzoate (91) and methyl 4-fluoro-2-methyl-5nitrobenzoate (90):

To a stirred solution of compound 84 and 89 (10 g) in MeOH (100 mL) under argon atmosphère was conc. sulfuric acid (20 mL) at 0 °C and heated to reflux for 48 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (100 mL) and extracted with EtOAc (2 x 100 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to afford mixture of compounds 90 & 91 (6 g) as colorless thick syrup. TLC: 30% EtOAc/ hexane (Rf. 0.5); ’H NMR (DMSO-î/₆, 500 MHz): δ 8.51 (d, .7=7.8 Hz, 1H), 8.09 (dd, J= 8.8, 5.6 Hz, 0.5H), 7.63 (d, J= 12.4 Hz, 1H), 7.58 (t, 9.1 Hz, 0.5H), 3.87 (s,

4.5H), 2.62 (s, 3H), 2.45 (s, 1.5H); ^H NMR showed mixture of compounds 90: 91 in the ratio of 2: 1).

Synthesis of methyl 4-((2-(methoxycarbonyl) phenyl) thio)-2-methyl-3-nitrobenzoate (93) and methyl 4-((2-(methoxycarbonyl) phenyl) thio)-2-methyl-5-nitrobenzoate (92):

To a stirred solution of compounds 90 and 91 (11 g) in DMF (100 mL) under inert atmosphère were added methyl 2-mercaptobenzoate 1 (10.4 g, 61.97 mmol), césium carbonate (18.5 g, 56.81 mmol) at 0 °C; heated to 80 °C and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice cold water (100 mL) and extracted with EtOAc (2 x 100 mL). The combined organic extracts were washed with water (200 mL), brine (200 mL), dried over sodium sulfate, filtered and concentrated in vacuo to afford a mixture of compounds 93 and 92 (12 g) as a yellow solid. TLC: 20% EtOAc/ hexanes (Rf 0.2); LC-MS: 12.57% + 81.14%; 370.8 (M%1); (column; X-Select CSH C18, (50 x 3.0 mm, 3.5 pm); RT 2.77 min. 0.05% Aq. TFA: ACN; 0.8 mL/min); RT 4.05, 4.14 min.

Synthesis of methyl 3-amino-4-((2-(methoxycarbonyl) phenyl) thio)-2-methylbenzoate (95) and Synthesis of methyl 5-amino-4-((2-(methoxycarbonyl) phenyl) thio)-2-methylbenzoate (94):

95

To a stirred solution of compound 93 and 92 (14 g, crude) in MeOH (500 mL) under inert atmosphère was added Pd/C (1.4 g, 50% wet) at RT and stirred under hydrogen atmosphère in an autoclave (6 kg/ cm² pressure) for 18 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite, washed with MeOH (100 mL). The filtrate was concentrated in vacuo to obtain the crude. The crude was recrystallized with EtOH (20 mL) and further purified through silica gel column chromatography column chromatography using 10% EtOAc/ hexanes to afford compound 95 (3 g, 30%) and 94 (8 g, 63%) as sticky off-white solids. TLC: 30% EtOAc/ hexanes (Rf. 0.4); *H NMR (DMSO-d_6>400 MHz) (95): δ 7.94 (d, J= 7.1 Hz, 1H), 7.40 (t, J= 7.3 Hz, 1H), 7.33-7.26 (m, 2H), 7.22 (dt, J= 7.6, 1.1 Hz, 1H), 6.67 (dd, J= 8.2, 0.8 Hz, 1H), 5.41 (s, 2H), 3.89 (s, 3H), 3.83 (s, 3H), 2.33 (s, 3H). *H NMR (DMSO-4₆,400 MHz) (94): δ 7.94 (dd, .7 = 7.8, 1.4 Hz, 1H), 7.42-7.38 (m, 1H), 7.32 (s, 1H), 7.26 (s, 1H), 7.22 (td, J =7.5, 1.0 Hz, 1H), 6.67 (dd, J= 8.1, 0.8 Hz, 1H), 5.41 (s, 2H), 3.88 (s, 2H), 3.82 (s, 3H), 2.33 (s, 3H).

Synthesis of 3-amino-4-((2-carboxyphenyl) thio)-2-methylbenzoic acid (96):

To a stirred solution of compound 95 (2 g, 6.04 mmol) in THF: H2O (4: 1, 50 mL) was added lithium hydroxide monohydrate (2.5 g, 10.0 mmol) at 0 C; warmed to RT and stirred for 48 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (10 mL) and washed with diethyl ether (2 x 50 mL). The pH of the aqueous layer was acidified with 4 N HCl to ~1. The precipitated solid was filtered and dried in vacuo to afford compound 96 (1.2 g, 66%) as white solid. TLC: 20% MeOH/ CH2CI2 (Rf. 0.2); *H NMR (DMSO-J₆,400 MHz): δ 13.01 (br s, 2H), 7.94 (d, J= 7.4 Hz, 1H), 7.36 (t, J= 7.8 Hz, 1H), 7.28 (d, J= 8.0 Hz, 1H), 7.20 (dt, J= 7.4, 6.3 Hz, 1H), 6.95 (d, J= 8.0 Hz, 1H), 6.61 (d, J = 7.4 Hz, 1H), 5.25 (br s, 2H), 2.27 (s, 3H).

Synthesis of 9-methyl-ll-oxo-10,11-dihydrodibenzo \b,j\ [1, 4] thiazepine-8-carboxylic acid (97):

To a stirred solution of compound 96 (2.6 g, 4.30 mmol) in THF (30 mL) under argon atmosphère was added CDI (3.5 g, 21.50 mmol) at RT; heated to 80 °C and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (20 mL) and pH was adjusted with 4 N HCl to ~2. The obtained solid was filtered, washed with diethyl ether and dried in vacuo to obtain compound 97(1.6 g, 67%) as an off white solid. TLC: 15% MeOH/ CH₂C1₂ (Rf 0.2); ^XH NMR (DMSO-rf₆₎400 MHz): δ 13.20 (br s, 1H), 10.23 (s, 1H), 7.74-7.60 (m, 1H), 7.56-7.51 (m, 2H), 7.50-7.42 (m, 3H), 2.47 (s, 3H).

Example 15: Synthesis of 3-carbamoyl-ll-oxo-10,11-dihydrodibenzo (b, f\ [1, 41 thiazepine-8carboxylic acid (135) - a common intermediate

Synthesis of dimethyl 2-((4-methoxybenzyl) thio) terephthalate (126):

To a stirred solution of dimethyl 2-bromoterephthalate 125 (1 g, 3.66 mmol) in 1, 4-dioxane (50 mL) under inert atmosphère were added (4-methoxyphenyl) methanethiol 8 (620 mg, 4.02 mmol), césium carbonate (2.38 g, 7.32 mmol), Pd(dppf)₂C12 (67 mg, 0.09 mmol) at RT and stirred under argon for 30 min; heated to 110 °C and stirred for 20 h in a sealed tube. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (50 mL) and extracted with EtOAc (2 x 75 mL). The combined organic extracts were dried over sodium sulfate, 10 filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 10% EtOAc/ hexanes to afford compound 126 (680 mg, 54%) as an off-white solid. TLC: 10% EtOAc/hexanes (Rf. 0.3); *H-NMR (CDC1₃, 500 MHz): δ 8.06 (s, 1H),

7.99 (d, J= 8.5 Hz, 1H), 7.77 (d, J= 8.0 Hz, 1H), 7.34 (d, J= 8.5 Hz, 2H), 6.85 (d, J= 8.5 Hz, 2H),

4.18 (s, 2H), 3.93 (s, 3H), 3.91 (s, 3H), 3.79 (s, 3H).

Synthesis of dimethyl 2-mercapto terephthalate (127):

CO₂Me

MeO₂C SH

127

A stirred solution of compound 126 (1.47 g, 4.24 mmol) in trifluoro acetic acid (25 mL) under inert

O atmosphère at RT was heated to 80 C and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude compound 127 (950 mg) as pale green semi-solid which was carried to the next step without any purification. TLC: 15% EtOAc/ hexanes (Rf. 0.7).

Synthesis of dimethyl 2-((4~(teri-butoxycarbonyl)-2-nitrophenyl) thio) terephthalate (129):

To a stirred solution of tert-butyl 4-fluoro-3-nitrobenzoate 128 (400 mg, 1.65 mmol) in DMF (20 mL) under inert atmosphère were added compound 127 (525 mg, crude), césium carbonate (1.07 g, 3.31 mmol) at RT ; heated to 60 C and stirred for 1 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted water (25 mL) and extracted with EtOAc (2 x 40 mL). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 5-7% EtOAc/ hexanes to afford compound 129 (400 mg, 54%) as yellow solid. TLC: 10% EtOAc/ hexanes (Rf. 0.4); ^XH-NMR (CDC1₃, 400 MHz): δ 8.76 (s, 1H), 8.25 (s, 1H), 8.20-8.17 (m, 1H), 7.98 (d, J= 8.4 Hz, 1H), 7.92 (d, J= 8.4 Hz, 1H), 6.91 (d, J= 8.4 Hz, 1H), 3.93 (s, 3H), 3.82 (s, 3H), 1.58 (s, 9H).

Synthesis of dimethyl 2-((2-amino-4-(tert-butoxycarbonyl) phenyl) thio) terephthalate (130):

To a stirred solution of compound 129 (1 g, 2.23 mmol) in MeOH (50 mL) under inert atmosphère was added 10% Pd/C (500 mg) at RT and stirred under hydrogen atmosphère (balloon pressure) for 24 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite and the filtrate was concentrated in vacuo to obtain the crude. The crude was triturated with 2% EtOAc/ w-pentane (2x5 mL) and dried in vacuo to afford compound 130 (800 mg, 86%) as an off-white solid. TLC: 15% EtOAc/ hexanes (Rf. 0.4); ’H-NMR (DMSO-Jô, 400 MHz): δ 8.05 (d, J= 8.0 Hz, 1H), 7.76-7.73 (m, 1H), 7.43-7.40 (m, 2H), 7.27 (s, 1H), 7.13-7.10 (m, 1H), 5.68 (br s, 2H), 3.91 (s, 3H), 3.75 (s, 3H), 1.55 (s, 9H).

Synthesis of 2-((2-amino-4-(to't-butoxycarbonyi) phenyl) thio) terephthalic acid (131):

To a stirred solution of compound 130 (250 mg, 0.59 mmol) in THF: H2O (4: 1, 10 mL) under inert atmosphère was added lithium hydroxide monohydrate (123 mg, 2.99 mmol) at RT and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (25 mL) and extracted with diethyl ether (2 x 25 mL). The aqueous layer was acidified with 2 N HCl to pH~6. The obtained solid was filtered and dried in vacuo to afford compound 131 (180 mg, 77%) as yellow solid. TLC: 10% MeOH/ CH2CI2 (Rf 0.2); ^-NMR (DMSO-<4, 400 MHz): δ 13.16 (br s, 2H), 8.02 (d, J= 8.0 Hz, 1H), 7.70 (d, J= 8.4 Hz, 1H), 7.44-7.40 (m, 2H), 7.16 (s, 1H), 7.13-7.09 (m, 1H), 5.64 (br s, 2H), 1.55 (s, 9H).

Synthesis of 8-(to'i-butoxycarbonyl)-ll-oxo-10,11-dihydrodibenzo [b,f\ [1, 4] thiazepine-3carboxylic acid (132):

132

To a stirred solution of compound 131 (180 mg, 0.46 mmol) in THF (9 mL) under inert atmosphère was added CDI (225 mg, 1.39 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (15 mL) and acidified with HCl. The obtained solid was fîltered and dried in vacuo to afford compound 132 (150 mg, 87%) as an off-white solid. TLC: 7% MeOH/ CH2CI2 (Rf. 0.2); ¹HNMR (DMSO-r/₆, 400 MHz): δ 13.32 (br s, 1H), 10.93 (s, 1H), 8.02 (d, J= 8.4 Hz, 1H), 7.97-7.94 (m, 1H), 7.81-7.77 (m, 2H), 7.71-7.62 (m, 1H), 7.43-7.42 (m, 1H), 1.55-1.51 (m, 9H).

Synthesis of to7-butvl 3-carbamoyl-ll-oxo-10,11-dihydrodibenzo \b,J\ [1, 4] thiazepine-8carboxylate (134):

134

To a stirred solution of compound 132 (150 mg, 0.40 mmol) in DMF (9 mL) under inert atmosphère were added HATU (307 mg, 0.80 mmol), ammonium chloride 133 (43 mg, 0.80 mmol), diisopropyl ethyl amine (0.3 mL, 1.60 mmol) at 0 °C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL). The obtained solid was fîltered, triturated with 10% EtOAc/ hexanes (2x5 mL) and dried in vacuo to afford compound 134 (95 mg, 63%) as white solid. TLC: 7% MeOH/ CH2CI2 (Rf. 0.6); ¹HNMR (DMSO-Jfi, 400 MHz): δ 10.89 (s, 1H), 8.15 (s, 1H), 8.00 (s, 1H), 7.89 (d, J= 8.0 Hz, 1H), 7.77-7.76 (m, 2H), 7.74-7.69 (m, 1H), 7.64 (d, J = 8.0 Hz, 1H), 7.58 (br s, 1H), 1.52 (s, 9H).

Synthesis of 3-carbamoyl-ll-oxo-10,11-dihydrodibenzo \h,f\ [1,4] thiazepine-8-carboxylic acid (135):

135

To a stirred solution of compound 134 (95 mg, 0.25 mmol) in EDC (10 mL) under inert atmosphère was added trifluoroacetic acid (293 mg, 2.56 mmol) at RT; heated to 80 C and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered.

The obtained solid was triturated with 5% CH2CI2 (2x5 mL) and dried in vacuo to afford compound 135 (70 mg, 87%) as white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf 0.2); *H-NMR (DMSO-^, 500 MHz): δ 10.93 (s, 1H), 8.16 (s, 1H), 8.01 (s, 1H), 7.90 (d, J= 8.5 Hz, 1H), 7.817.76 (m, 2H), 7.72-7.68 (m, 2H), 7.59 (s, 1H).

Example 16: ll-oxo-10,11-dihydrodibenzo f\ [1,4] thiazepine-7-carboxylic acid (140) - a common intermediate

Synthesis of methyl 3-((2-(methoxycarbonyl) phenyl) thio)-4-nitrobenzoate (137):

To a stirred solution of methyl 3-fluoro-4-nitrobenzoate 136 (100 mg, 0.50 mmol) in DMF (3 mL) under argon atmosphère was added césium carbonate (180 mg, 0.55 mmol) at RT and heated to 40

C. To this was added methyl 2-mercaptobenzoate 1 (93 mg, 0.55 mmol) in DMF (1 mL) drop wise for 3 min and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was diluted with water (30 mL) and extracted with CH2CI2 (2 x 30 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to afford compound 137 (120 mg, 69%) as yellow crystalline solid. TLC: 20% EtOAc/ hexanes (Rf. 0.3); ^-NMR (DMSO-4₆, 400 MHz): δ 8.30 (d, J= 8.4 Hz, 1H), 7.99-7.93 (m, 2H), 7.65-7.60 (m, 3H), 7.49 (d, J= 7.6 Hz, 1H), 3.80 (s, 3H), 3.74 (s, 3H).

Synthesis of 3-((2-carboxyphenyl) thio)-4-nitrobenzoic acid (138):

To a stirred solution of compound 137 (100 mg, 0.26 mmol) in THF (7 mL) under argon atmosphère was added lithium hydroxide monohydrate (28 mg, 0.66 mmol) in water (3 mL) at RT; heated to reflux and stirred for 2 h. The reaction was monitored by TLC; after completion ofthe reaction, the volatiles were removed in vacuo, diluted with water (20 mL) and pH was adjusted to ~2 with 1 N HCl. The obtained solid was filtered and dried in vacuo to afford compound 138 (72 mg, 85%) as yellow solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.2); Tl-NMR (DMSO-d₆, 400 MHz): δ 13.49 (br s, 2H), 8.25 (d, J= 8.4 Hz, 1H), 7.96-7.91 (m, 2H), 7.66 (s, 1H), 7.60-7.54 (m, 2H), 7.40 (d, J= 7.6 Hz, 1H).

Synthesis of 4-amino-3-((2-carboxyphenyl) thio) benzoic acid (139):

To a stirred solution of compound 138 (70 mg, 0.20 mmol) in MeOH (5 mL) under argon atmosphère was added 10% Pd/C (10 mg) and stirred under hydrogen atmosphère (balloon pressure) for 24 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite, washed with MeOH (2x5 mL) and the filtrate was concentrated in vacuo to afford compound 139 (53 mg, 90%) as an off-white solid. TLC: 20% MeOH/ CH2CI2 (Rf.

0.3); ’H-NMR (DMSO-7₆, 400 MHz): δ 12.91 (br s, 2H), 7.94 (d, J= 6A Hz, 1H), 7.86 (s, 1H),

7.76 (d, 7= 8.4 Hz, 1H), 7.37 (t, 7= 8.0 Hz, 1H), 7.19 (t, J= 7.6 Hz, 1H), 6.83 (d, 7= 8.8 Hz, 1H), 5 6.63 (d, 7= 8.0 Hz, 1H), 6.14 (br s, 2H).

Synthesis of ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-7-carboxylic acid (140):

To a stirred solution of compound 139 (50 mg, 0.17 mmol) in dry THF (3 mL) under argon atmosphère was added CDI (84 mg, 0.51 mmol) at 0 °C; warmed to RT and stirred for 12 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with 1 N HCl (3 mL), water (10 mL). The obtained solid was filtered, washed with ether (2x5 mL) and dried in vacuo to afford compound 140 (28 mg, 61%) as white solid. TLC: 20% MeOH/ CH2CI2 (Rf. 0.5); *H-NMR (DMSO-7_fi, 400 MHz): δ 13.10 (br s, 1H), 10.97 (s, 1H), 8.05 (s, 1H), 7.89 (d, 7= 8.4 Hz, 1H), 7.69 (d, 7= 7.6 Hz, 1H), 7.57 (d, 7= 7.6 Hz, 1H), 7.53-7.44 (m, 2H), 7.31 (d, 7= 8.4 Hz, 1H).

Example 17: Synthesis of 8-aminodibenzo f] [1, 41 thiazepin-11 (lOZQ-one (145) - a common intermediate

Synthesis of methyl 2-((4-amino-2-nitrophenyl) thio) benzoate (142):

To a stirred solution of 4-fluoro-3-nitroaniline 141 (500 mg, 3.20 mmol) in DMF (6 mL) under inert atmosphère was added césium carbonate (1.14 g, 3.50 mmol) at RT and heated to 40 C. To this was added methyl 2-mercaptobenzoate 1 (592 mg, 3.50 mmol) in DMF (1 mL) drop wise for 3 min and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (35 mL) and extracted with CH2CI2 (2x35 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 15% EtOAc/ hexanes to afford compound 142 (600 mg, 62%) as brown syrup. TLC: 30% EtOAc/ hexanes (Rf 0.5); ’H-NMR (DMSO-rf₆, 400 MHz): δ 7.91 (d, J= 8.0 Hz, 1H), 7.44 (t, J= 8.0 Hz, 1H), 7.3015 7.20 (m, 2H), 7.10 (s, 1H), 6.87-6.84 (m, 1H), 6.79 (d, J= 8.0 Hz, 1H), 6.24 (s, 2H), 3.84 (s, 3H).

Synthesis of 2-((4-amino-2-nitrophenyl) thio) benzoic acid (143):

To a stirred solution of compound 142 (600 mg, 1.98 mmol) in THF: H₂O (10: 3, 13 mL) under inert atmosphère was added lithium hydroxide monohydrate (406 mg, 9.90 mmol) at RT; heated to 60 °C and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (50 mL) and extracted with EtOAc (2 x 50 mL). The aqueous layer was acidifïed with HCl to pH~2. The obtained solid was fïltered and dried in vacuo to afford compound 143 (350 mg, 61%) as orange solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.3); ’H-NMR (DMSO-îA, 500 MHz): δ 13.18 (s, 1H), 7.89 (d, J= 7.5 Hz, 1H), 7.38 (t, J= 7.0 Hz, 1H), 7.28 (d, J= 9.0 Hz, 1H), 7.19 (t, J= 8.0 Hz, 1H), 7.07 (s, 1H), 6.84 (d, J= 8.5 Hz, 1H), 6.71 (d, J= 8.5 Hz, 1H), 6.23 (s, 2H).

Synthesis of 2-((2, 4-diaminophenyI) thio) benzoic acid (144):

To a stirred solution of compound 143 (350 mg, 1.20 mmol) in MeOH (10 mL) under inert atmosphère was added 10% Pd/C (100 mg) at RT and stirred under hydrogen atmosphère (balloon pressure) for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was fïltered and the filtrate was concentrated in vacuo to obtain the crude. The crude was washed with n-pentane (2x10 mL) and dried in vacuo to afford compound 144 (250 mg, 80%) as white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.3); ’H-NMR (DMSO-rf_é, 400 MHz): δ 12.60 (br s, 1H), 7.87 (d, J= 7.6 Hz, 1H), 7.32 (t, J= 8.4 Hz, 1H), 7.12 (t, 6.8 Hz, 1H), 6.90 (d, 8.0

Hz, 1H), 6.72 (d, J= 8.0 Hz, 1H), 6.02 (s, 1H), 5.93 (d, J= 8.4 Hz, 1H), 5.02-4.98 (m, 4H).

Synthesis of 8-aminodibenzo \b,f\ [1, 4] thiazepin-11 (ÎO//)^-0116 (145):

To a stirred solution of compound 144 (150 mg, 0.57 mmol) in DMF (4 mL) under inert atmosphère were added HOBt (233 mg, 1.73 mmol), EDCI.HC1 (330 mg, 5.19 mmol), diisopropyl ethyl amine (0.5 mL, 2.87 mmol) at 0 °C; warmed to RT and stirred for 6 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice cold water (30 mL). The obtained solid was fiitered, washed with hexanes (2x10 mL) and dried in vacuo to afford compound 145 (80 mg, 57%) as an off-white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.5); 'H-NMR (DMSO-rftf, 400 MHz): δ 10.40 (s, 1H), 7.63 (d, J= 6.8 Hz, 1H), 7.45-7.37 (m, 3H), 7.12 (d, J= 8.4 Hz, 1H), 6.39 (s, 1H), 6.31 (d, J= 8.4 Hz, 1H), 5.46 (s, 2H).

Example 18: Synthesis of ll-oxo-10,11-dihydrodibenzo ΓΖ>, f\ [1, 4] thiazepine-8-carboxylic acid 5-oxide (156) - a common intermediate

Synthesis of ll-oxo-10,11-dihydrodibenzo [b,f\ [1, 4] thiazepine-8-carboxylic acid 5-oxide (156):

To a stirred solution of 6 (2.5 g, 9.21 mmol) in CH₂C1₂ (50 mL) under inert atmosphère was added m-chloro perbenzoic acid (1.59 g, 9.21 mmol) at RT and stirred for 48 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was the volatiles were removed in vacuo to obtain the crude. The crude was triturated with 10% MeOH/ CH₂C1₂ (2x5 mL), isopropanol (10 mL) to afford compound 156 (2.3 g, 87%) as white solid. TLC: 10% MeOH/ CH₂C1₂+ 0.05 mL CH₃COOH (Rf. 0.4); *H NMR (DMSO-îZ₆,500 MHz): δ 13.36 (br s, 1H), 11.08 (s, 1H), 7.96 (d, J= 7.8 Hz, 1H), 7.92-7.87 (m, 1H), 7.85-7.66 (m, 3H), 7.63 (t, J= 7.8 Hz, 1H), 7.53 (t, J = 7.8 Hz, 1H);

Example 19: Synthesis of ll-oxo-10,11-dihydrodibenzo [/>, fi [1, 4] thiazepine-8-carboxylic acid 5, 5-dioxide (159) - a common intermediate

Synthesis of methyl ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8-carboxylate (157):

To a stirred solution of 6 (500 mg, 1.84 mmol) in MeOH: CH2CI2 (1: 1, 20 mL) under argon atmosphère was added CH2N2 (prepared in situ using 7V-nitrosomethyl urea (0.95 g, 9.2 mmol) +

KOH (0.51 g, 9.22 mmol) at 0 °C; warmed to RT and stirred for 1 h. The reaction was monitored by

TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 20% EtOAc/ hexanes to afford compound 157 (450 mg, 86%) as white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.5); 'H-NMR (DMSO-y/₆, 500 MHz): δ 10.82 (s, 1H), 7.82 (s, 1H), 7.75-7.69 (m, 3H), 7.58-7.63 (m, 3H), 3.82 (s, 3H).

Synthesis of methyl ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8-carboxylate 5, 515 dioxide (158):

o o

158

To a stirred solution of 157 (5 g, 17.54 mmol) in acetic acid (25 mL) was added 30% aqueous hydrogen peroxide (100 mL) at 0 °C; warmed to 50 °C and stirred for 72 h. The reaction was monitored by TLC; after completion of the reaction, the obtained solid was filtered, washed with water (100 mL), 10% EtOAc/ hexanes (100 mL) and dried in vacuo to afford compound 158 (3.5 g,

64%) as white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.3); Ή NMR (DMSO-rf₆, 500 MHz): δ 11.58 (s, 1H), 8.09 (d, J= 8.4 Hz, 1H), 8.01-7.95 (m, 3H), 7.93-7.83 (m, 3H), 3.88 (s, 3H).

Synthesis of ll-oxo-10,11-dihydrodibenzo [6,/] [1, 4] thiazepine-8-carboxylic acid 5, 5-dioxide (159):

OH

159

To a stirred solution of compound 158 (3.5 g, 11.04 mmol) in a mixture of THF: MeOH: H₂O (2: 2: 1, 25 mL) was added lithium hydroxide monohydrate (1.3 g, 33.12 mmol) portion wise for 10 min at 0 °C; warmed to RT and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (20 mL) and acidified with 1 N HCl to pH~2. The obtained solid was filtered, washed with isopropyl alcohol (15 mL) and dried in vacuo to obtain compound 159 (2.8 g, 84%) as white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.1); *H NMR (DMSO-rf₆, 400 MHz): δ 13.65 (br s, 1H), 11.55 (s, 1H), 8.07 (d, J= 8.3 Hz, 1H), 8.03-7.82 (m, 6H).

Example 20: Synthesis of 5-methyl-ll-oxo-10, ll-dihvdro-5W-dibenzo [/?. e] [1, 4] diazepine-8carboxylic acid (164) - a common intermediate

Synthesis of methyl 4-((2-(methoxycarbonyl) phenyl) amino)-3-nitrobenzoate (161):

161

To a stirred solution of methyl 2-aminobenzoate 160 (5 g, 33.07 mmol) in NMP (13 mL) under inert 5 atmosphère were added diisopropylethylamine (18 mL, 103.46 mmol), methyl 4-fluoro-3nitrobenzoate 2 (9.87 g, 49.61 mmol) at RT; heated to 120 °C in a sealed tube and stirred for 24 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with diethyl ether (50 mL) and stirred for 1 h. The obtained solid was filtered, washed with diethyl ether (10 mL) and dried in vacuo to afford compound 161 (3.2 g, 29%) as yellow solid.

TLC: 20% EtOAc/ hexanes (Rf. 0.4); ^XH NMR (DMSO-J₆,400 MHz): δ 11.13 (s, 1H), 8.67 (s, 1H), 8.11-7.94 (m, 2H), 7.70-7.62 (m, 2H), 7.58 (d, J= 9.0 Hz, 1H), 7.32-7.27 (m, 1H), 3.87 (s, 6H).

Synthesis of methyl 4-((2-(methoxycarbonyI) phenyl) (methyl) amino)-3-nitrobenzoate (162):

To a stirred solution of compound 161 (3 g, 9.09 mmol) in DMF (30 mL) under inert atmosphère were added césium carbonate (5.9 g, 18.15 mmol), methyl iodide (0.84 mL, 13.59 mmol) at RT and stirred for 6 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice-cold water (60 mL) and extracted with EtOAc (2 x 100 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 20% EtOAc/ hexanes to afford compound 162 (2.73 g, 88%) as yellow solid. TLC: 30% EtOAc/ hexanes (Rf. 0.4); ^JH NMR (DMSO-d₆,400 MHz): δ 8.07 (s, 1H), 8.06 (d, J= 7.8 Hz, 1H), 7.71 (dd, J= 7.8, 1.5 Hz, 1H), 7.62 (t, J= 7.3 Hz, 1H), 7.40-7.26 (m, 3H), 3.84 (s, 3H), 3.53 (s, 3H), 3.38 (s, 3H).

Synthesis of methyl 5-methyl-ll-oxo-10, ll-dihydro-5/7-dibenzo [b, e] [1, 4] diazepine-8carboxylate (163):

To a stirred solution of compound 162 (2.73 g, 7.93 mmol) in acetic acid (36 mL) under inert atmosphère was added iron powder (7 g, 127.2 mmol) at RT; heated to 80 C and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with CH2CI2 (50 mL), stirred for 2 h and filtered through celite and the filtrate was concentrated in vacuo to obtain the crude. The crude was dissolved in CH2CI2 (200 mL), washed with saturated aqueous NaHCO₃ solution (100 mL), brine (100 mL). The organic extract was dried over sodium sulfate, filtered and concentrated in vacuo to afford compound 163 (2 g, 91%) as an off-white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.4); *H NMR (DMSO-d₆,500 MHz): δ 10.33 (s, 1H), 7.68 (dd, J = 8.5, 1.9 Hz, 1H), 7.65-7.61 (m, 2H), 7.50 (t, J= 7.8 Hz, 1H), 7.28 (d, 8.4 Hz, 1H), 7.21 (d, J=

8.1 Hz, 1H), 7.10 (t, J= 7.4 Hz, 1H), 3.80 (s, 3H), 3.33 (s, 3H).

Synthesis of 5-methyl-ll-oxo-10, ll-dihydro-577-dibenzo [b, e] [1, 4] diazepine-8-carboxylic acid (164):

To a stirred solution of compound 163 (2 g, 7.09 mmol) in THF: H₂O (1: 1, 80 mL) was added lithium hydroxide monohydrate (900 mg, 21.42 mmol) at RT and stirred for 12 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The pH of the residue was adjusted to ~2 with 2 N HCl. The precipitated solid was fîltered and dried in vacuo to afford compound 164 (1.7 g, 89%) as an off-white solid. TLC: 40% EtOAc/ hexanes (Rf. 0.2); *H NMR (DMSO-d₆,400 MHz): δ 12.82 (br s, 1H), 10.33 (s, 1H), 7.70-7.60 (m, 3H), 7.51 (t, J= 7.8

Hz, 1H), 7.27 (d, J= 8.5 Hz, 1H), 7.21 (d, J= 7.8 Hz, 1H), 7.11 (t, J= 7.2 Hz, 1H), 3.32 (s, 3H).

Example 21: Synthesis of 5-ethyi-ll-oxo-10, ll-dihydro-5jH-dibenzo [Z>. e] fl, 4] diazepine-8carboxylic acid (167) - a common intermediate

Synthesis of methyl 4-(ethyl (2-(methoxycarbonyl) phenyl) amino)-3-nitrobenzoate (165):

COoMe C0₂Me

Et NO₂ ¹⁶⁵

To a stirred solution of compound 161 (2.9 g, 8.78 mmol) in DMF (40 mL) under inert atmosphère were added césium carbonate (6 g, 18.46 mmol), ethyl iodide (1.06 mL, 12.82 mmol) at RT and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice-cold water (60 mL), extracted with EtOAc (2 x 100 mL). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude which was titurated with «-pentane (20 mL) to afford compound 165 (2.8 g, 89%) as pale yellow solid. TLC: 30% EtOAc/ hexanes (Rf. 0.5); *H NMR (DMSO-<Z₆,500 MHz): δ 8.05 (dd, J= 9.0, 2.0 Hz, 1H), 8.02 (s, 1H), 7.62-7.57 (m, 2H), 7.45 (d, J= 9.0 Hz, 1H), 7.33 (d, J= 8.1

Hz, 3H).

Synthesis of methyl 5-ethyl-ll-oxo-10, ll-dihydro-5H-dibenzo [b, e] [1, 4] diazepine-8carboxylate (166):

To a stirred solution of compound 165 (2.8 g, 7.82 mmol) in acetic acid (40 mL) under inert atmosphère was added iron powder (6.8 g, 125.1 mmol) at RT; heated to 80 C and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with CH2CI2 (50 mL), stirred for 2 h and filtered through celite. The filtrate was concentrated in vacuo to obtain the crude. The crude was diluted with CH2CI2 (200 mL), washed with saturated aqueous sodium bicarbonate solution (100 mL) and brine (100 mL). The organic extract was dried over sodium sulfate, filtered and concentrated in vacuo to afford compound 166 (2.2 g, 96%) as an off-white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.3); *H NMR (DMSO-<Z₆,500 MHz): δ 10.35 (br s, 1H), 7.70 (dd, J = 8.5, 1.9 Hz, 1H), 7.67 (s, 1H), 7.62 (d, J= 7.5 Hz, 1H), 7.51 (t, J= 8.1 Hz, 1H), 7.29 (d, J= 8.4 Hz, 1H), 7.22 (d, J= 8.1 Hz, 1H), 7.12 (t, J= ΊΑ Hz, 1H), 3.31 (s, 5H), 1.11 (t, J= 6.9 Hz, 3H).

Synthesis of 5-ethyl-ll-oxo-10, ll-dihydro-577-clibenzo [b, e] [1, 4] diazepine-8-carboxylic acid (167):

167

To a stirred solution of compound 166 (2.1 g, 7.09 mmol) in THF: H2O (1: 1, 60 mL) was added lithium hydroxide monohydrate (890 mg, 21.26 mmol) at RT and stirred for 12 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The pH of the residue was acidified to ~2 with 2 N HCl. The precipitated solid was filtered, washed with water (50 mL) and dried in vacuo to afford compound 167 (1.6 g, 80%) as an off-white solid. TLC: 30% 92

EtOAc/ hexanes (Rf. 0.2); ^lH NMR (DMSO-7₆,400 MHz): δ 12.82 (br s, 1H), 10.33 (s, 1H), 7.697.59 (m, 3H), 7.53-7.48 (m, 1H), 7.24 (dd, 7= 19.7, 8.2 Hz, 2H), 7.12 (t, 7= 7.5 Hz, 1H), 3.79 (br s, 2H), 1.12 (t, 7= 7.0 Hz, 3H).

Example 22: Synthesis of 5-benzyl-ll-oxo-lO, ll-dihvdro-5/Z-dibe.nzo \b, é\ [1, 4] diazepine-85 carboxylic acid (170) - a common intermediate

Synthesis of methyl 4-(benzyI (2-(methoxycarbonyI) phenyl) amino)-3-nitrobenzoate (168):

168

To a stirred solution of compound 161 (2.5 g, 7.57 mmol) in DMF (40 mL) under inert atmosphère were added césium carbonate (4.92 g, 15.15 mmol), benzyl bromide (1.34 mL, 11.36 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice-cold water (60 mL) and extracted with EtOAc (2 x 100 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 10%

EtOAc/ hexanes to afford compound 168 (3 g, 91%) as colorless thick syrup. TLC: 20% EtOAc/ hexanes (Rf. 0.4); ^XH NMR (DMSO-7₆,500 MHz): δ 8.04 (s, 1H), 7.97 (dd, 7= 8.8, 1.9 Hz, 1H), 7.61-7.57 (m, 1H), 7.56- 7.50 (m, 3H), 7.40 (t, 7= 8.2 Hz, 2H), 7.34 (t, 7= 7.7 Hz, 2H), 7.28-7.23 (m, 2H), 5.20 (s, 2H), 3.81 (s, 3H), 3.39 (s, 3H).

Synthesis of methyl 5-benzyl-ll-oxo-10, ll-dihydro-5H-dîbenzo [b, e] [1, 4] diazepine-8carboxylate (169):

To a stirred solution of compound 168 (950 mg, 2.26 mmol) in acetic acid (10 mL) under inert

O atmosphère was added ironpowder (2 g, 36.36 mmol) at RT; heated to 80 C and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with CH2CI2 (50 mL), filtered through celite and the filtrate was concentrated in vacuo to obtain the crude. The crude was dissolved in CH2CI2 (200 mL), washed with saturated aqueous sodium bicarbonate solution (100 mL) and brine (100 mL). The organic extract was dried over sodium sulfate, filtered and concentrated in vacuo to afford compound 169 (800 mg, 98%) as an off-white solid. TLC: 20% EtOAc/ hexanes (Rf. 0.4); *H NMR (DMSO-J₆,500 MHz): δ 10.42 (s, 1H), 7.66 (s, 1H), 7.62 (d, J= 8.1 Hz, 2H), 7.48- 7.34 (m, 4H), 7.33-7.21 (m, 3H), 7.15 (t, J= 7.2 Hz, 1H), 7.09 (t, J= 7.4 Hz, 1H), 5.04 (br s, 2H), 3.79 (s, 3H).

Synthesis of 5-benzyl-ll-oxo-10, ll-dihydro-5//-dibenzo [b, e] [1, 4] diazepine-8-carboxylic acid (170):

Bn

170

To a stirred solution of compound 169 (2 g, 5.58 mmol) in THF: H2O (1: 1, 80 mL) was added lithium hydroxide monohydrate (703 mg, 16.73 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The pH of the residue was acidified with 6 N HCl to pH ~2 and stirred for 1 h. The precipitated solid was filtered and dried in vacuo to afford compound 170 (1.5 g, 78%) as an off-white solid. TLC: 50% EtOAc/hexanes (Rf. 0.2); ³H NMR (DMSO-^, 500 MHz): δ 12.87 (br s, 1H), 10.39 (s, 1H), 7.657.55 (m, 3H), 7.47- 7.21 (m, 7H), 7.16-7.04 (m, 2H), 5.02 (br s, 2H).

Example 23: Synthesis of 3-methoxy-ll-oxo-lO, 11-dihydrodibenzo \b, f\ [1, 41 fhiazepine-8carboxylic acid (P-42)

Synthesis of methyl 4-methoxy-2-(((trifluoromethyl) sulfonyl) oxy) benzoate (P-36): To a stirred solution of methyl 2-hydroxy-4-methoxybenzoate P-35 (1 g, 5.49 mmol) in pyridine (5 mL) under argon atmosphère was added triflic anhydride (1 mL, 6.31 mmol) drop wise at 0 C; warmed to RT and stirred for 2 h; heated to 40 C and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (25 mT,) and extracted with diethyl ether (2x30 mL). The combined organic extracts were washed with 1 N HCl (15 mL), water (15 mL), dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 10% EtOAc/ hexanes to afford compound P-36 (1.58 g, 92%) as colorless syrup. TLC: 10% EtOAc/ hexanes (Rf 0.6); *H-NMR (CDC1₃, 500 MHz): δ 8.06 (d, J= 9.0 Hz, 1H), 6.95 (d, J= 8.5 Hz, 1H), 6.78 (s, 1H), 3.93 (s, 3H), 3.88 (s, 3H).

Synthesis of methyl-4-methoxy-2-((4-methoxybenzyl) thio) benzoate (P-37): To a stirred solution of compound P-36 (1 g, 3.18 mmol) in 1, 4-dioxane (15 mL) under argon atmosphère were added (4-methoxyphenyl) methanethiol (539 mg, 3.50 mmol), césium carbonate (2 g, 6.36 mmol) at RT and degassed under argon for 20 min. To this was added Pd(dppf)2C12 (233 mg, 0.31 mmol); heated to 80 °C and stirred for 8 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted with EtOAc (2x35 mL). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 5-7% EtOAc/ hexanes to afford compound P-37 (340 mg, 30%) as an off-white solid. TLC: 10% EtOAc/ hexanes (Rf. 0.4); ’H-NMR (CDC1₃, 500 MHz): δ 7.96 (d, J= 8.5 Hz, 1H), 7.38-7.37 (m, 1H), 7.35 (d, J= 9.0 Hz, 1H), 6.85 (d, 8.0 Hz, 2H), 6.82 (s, 1H), 6.64 (d, J= 8.5 Hz, 1H), 4.10 (s, 2H),

3.86 (s, 3H),3.79(s, 6H).

Synthesis of methyl 2-mercapto-4-methoxybenzoate (P-38): A stirred solution of compound P-37 (330 mg, 1.03 mmol) in trifluoroacetic acid (5 mL) under argon atmosphère was heated to reflux and stirred for 6 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude compound P-38 (340 mg) as brown syrup which was carried to the next step without any further purification. TLC: 10% EtOAc/ hexanes (Rf. 0.7).

Synthesis of methyl 4-methoxy-2-((4-(methoxycarbonyl)-2-nitrophenyl) thio) benzoate (P-39):

To a stirred solution of compound P-38 (200 mg, 1.01 mmol) in DMF (5 mL) under argon atmosphère were added methyl 4-fluoro-3-nitrobenzoate (201 mg, 1.01 mmol), césium carbonate (656 mg, 2.02 mmol) at RT; heated to 40 C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (20 mL) and extracted with EtOAc (2 x 25 mL). The combined organic extracts were washed with water (20 mL), dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 15% EtOAc/ hexanes to afford compound P-39 (280 mg, 74%) as yellow solid. TLC: 20% EtOAc/ hexanes (Rf. 0.4); *H-NMR (CDC1₃, 400 MHz): δ 8.84 (d, J= 7.2 Hz, 1H), 8.03 (d, J= 8.8 Hz, 1H), 7.96-7.92 (m, 1H), 7.78 (s, 1H), 7.17-7.12 (m, 1H), 7.08-6.93 (m, 1H), 3.96-3.93 (m, 3H), 3.85 (s, 3H), 3.803.74 (m, 3H).

Synthesis of methyl 2-((2-amino-4-(methoxycarbonyl) phenyl) thio)-4-methoxybenzoate (P-40): To a stirred solution of compound P-39 (270 mg, 0.71 mmol) in MeOH (10 mL) under argon atmosphère was added 10% Pd/C (80 mg) at RT and stirred under hydrogen atmosphère (balloon pressure) for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was fîltered through celite, washed with CH2CI2 (2 x 25 mL) and the filtrate was concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 15% EtOAc/ hexanes to afford compound P-40 (180 mg, 79%) as colorless syrup. TLC: 20% EtOAc/ hexanes (Rf. 0.5); ’H-NMR (CDC1₃, 400 MHz): δ 8.03 (d, 7= 8.8 Hz, 1H), 7.54-7.40 (m, 1H), 7.08 (d, 7= 8.8 Hz, 1H), 6.79-6.72 (m, 1H), 6.66-6.63 (m, 1H), 6.21-6.14 (m, 1H), 3.95-3.88 (m, 5H), 3.85 (s, 3H), 3.65 (s, 3H).

Synthesis of 2-((2-amino-4-carboxyphenyl) thio)-4-methoxybenzoic acid (P-41): To a stirred solution of compound P-40 (160 mg, 0.46 mmol) in THF: H₂O (2: 1, 6 mL) under argon atmosphère was added lithium hydroxide monohydrate (96 mg, 2.30 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo, diluted with water (20 mL), acidifïed with 1 N HCl to pH~6. The obtained precipitate was filtered and dried in vacuo to afford compound P-41 (85 mg, crude) as an off-white solid. TLC: 50% EtOAc/ hexanes (Rf. 0.2); Ή-NMR (DMSO-7₆,400 MHz): δ 12.84 (br s, 2H), 7.95 (d, J= 8.8 Hz, 1H), 7.44 (s, 1H), 7.40 (d, 7= 8.0 Hz, 1H), 6.13 (s, 1H), 5.58 (br s, 2H), 3.80-3.69 (m, 2H), 3.60 (s, 3H).

Synthesis of 3-methoxy-ll-oxo-10,11-dihydrodibenzo \b,j\ [1, 4] thiazepine-8-carboxylic acid (P-42): To a stirred solution of compound 41 (80 mg, 0.25 mmol) in THF (8 mL) under argon atmosphère was added CDI (203 mg, 1.25 mmol) at 0 °C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo, diluted with water (20 mL), acidified with dilute HCl. The obtained precipitate was filtered and dried in vacuo to afford compound P-42 (50 mg, crude) as an off-white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.3); ’H-NMR (DMSO-^, 400 MHz): δ 13.18 (br s, 1H), 10.64 (s, 1H), 7.77 (s, 1H), 7.66 (s, 2H), 7.16-7.07 (m, 1H), 7.01 (d, 7= 8.8 Hz, 1H), 6.82-6.79 (m, 1H), 3.80 (s, 3H).

Example 24: Synthesis of 2-methyl-ll-oxo-10,11-dihydrodibenzo [A f] [1, 41 thiazepine-8carboxylic acid (P-51)

Synthesis of methyl 2-hydroxy-5-methylbenzoate (P-44): To a stirred solution of 2-hydroxy-5methylbenzoic acid P-43 (2 g, 13.15 mmol) in MeOH (65 mL) under argon atmosphère was added sulphuric acid (0.65 mL) at RT; heated to reflux and stirred for 20 h. The reaction was monitored by 5 TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with ice water (50 mL) and extracted with ether (3 x 40 mL). The combined organic extracts were washed with 10% aqueous NaHCCL solution (until the pH becomes neutral), dried over sodium sulfate, filtered and concentrated in vacuo to obtain compound P-44 (2 g, 92%) as colorless liquid. TLC: 10% EtOAc/ hexanes (Rf. 0.7); ^-NMR (CDC1₃, 500 MHz): δ 10.57 (s, 1H), 7.65 (s, 1H), 10 7.29 (d, J= 7.5 Hz, 1H), 6.90 (d, J= 8.0 Hz, 1H), 3.96 (s, 3H), 2.30 (s, 3H).

Synthesis of methyl 5-methyl-2-(((trifluoromethyl) sulfonyl) oxy) benzoate (P-45): To a stirred solution of compound P-44 (2 g, 12.04 mmol) in pyridine (8 mL) under argon atmosphère was added trifluoro methane sulfonic anhydride (2.3 mL, 13.85 mmol) at 0 C; warmed to RT and stirred for 2 h; heated to 40 °C and stirred for 8 h. The reaction was monitored by TLC; after completion of 15 the reaction, the volatiles were removed in vacuo. The residue was diluted with water (50 mL) and extracted with ether (3 x 50 mL). The combined organic extracts were washed with water (50 mL), brine (50 mT,), 1 N HCl (40 mL), dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 3-5% EtOAc/hexanes to afford compound P-45 (2.6 g, 72%) as colorless liquid. TLC: 7% EtOAc/ hexanes (Rf. 0.6); ’H-NMR (CDC1₃, 500 MHz): δ 7.88 (s, 1H), 7.40 (d, J= 8.5 Hz, 1H), 7.17 (d, J = 8.0 Hz, 1H), 3.96 (s, 3H), 2.42 (s, 3H).

Synthesis of methyl 2-((4-methoxybenzyl) thio)-5-methylbenzoate (P-46): To a stirred solution of compound P-45 (1 g, 3.35 mmol) in 1, 4-dioxane (15 mL) under argon atmosphère were added (4-methoxyphenyl) methanethiol (568 mg, 3.69 mmol), césium carbonate (2.18 g, 6.71 mmol) atRT and degassed for 20 min. To this was added Pd(dppf)2C12 (61.4 mg, 0.083 mmol); heated to 110 C and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (30 mL) and extracted with EtOAc (2 x 40 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 3-5% EtOAc/ hexanes to afford compound P-46 (290 mg, 29%) as yellow solid. TLC: 10% EtOAc/ hexanes (Rf. 0.5); ’H-NMR (CDC1₃, 400 MHz): δ 7.75 (s, 1H), 7.30 (d, J= 8.8 Hz, 2H), 7.22-7.21 (m, 2H), 6.83 (d, J= 8.8 Hz, 2H), 4.09 (s, 2H), 3.89 (s, 3H), 3.79 (s, 3H), 2.32 (s, 3H).

Synthesis of methyl 2-mercapto-5-methylbenzoate (P-47): A stirred solution of compound P-46 (200 mg, 0.66 mmol) in trifluoro acetic acid (10 mL) at RT under argon atmosphère was heated to 70-75 °C and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to afford compound P-47 (100 mg, crude) as yellow syrup. TLC: 10% EtOAc/ hexanes (Rf. 0.7); ’H-NMR (DMSO-4₆, 500 MHz): δ 7.74 (s, 1H), 7.44 (d, J= 8.0 Hz, 1H), 7.26 (d, J= 7.5 Hz, 1H), 5.20 (s, 1H), 3.82 (s, 3H), 2.28 (s, 3H).

Synthesis of methyl 2-((4-(methoxycarbonyl)-2-nitrophenyl) thio)-5-methylbenzoate (P-48): To a stirred solution of compound P-47 (100 mg, 0.50 mmol) in DMF (5 mL) under argon atmosphère were added methyl 4-fluoro-3-nitrobenzoate (100 mg, 0.55 mmol), césium carbonate (326 mg, 1.00 mmol) at RT; heated to 60 °C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (30 mL) and extracted with CH₂C1₂ (2x30 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 10% EtOAc/ hexanes to afford compound P-48 (100 mg, 55%) as yellow solid. TLC: 10% EtOAc/ hexanes (Rf. 0.3); ’H-NMR (DMSO-i/g, 400 MHz): δ 8.63 (s, 1H), 8.03 (d, J= 8.8 Hz, 1H), 7.78 (s, 1H), 7.61 (d, 7.6 Hz, 1H), 7.55-7.53 (m,

1H), 6.99 (d, J= 8.4 Hz, 1H), 3.87 (s, 3H), 3.68 (s, 3H), 2.43 (s, 3H).

Synthesis of methyl 2-((2-amino-4-(methoxycarbonyl) phenyl) thio)-5-methylbenzoate (P-49):

To a stirred solution of compound P-48 (400 mg, 1.10 mmol) in MeOH (20 mL) under argon atmosphère was added 10% Pd/ C (200 mg) at RT and stirred under hydrogen atmosphère (balloon pressure) for 24 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite and washed with 50% MeOH/ CH2CI2 (2 x 25 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 7-10% EtOAc/ hexanes to afford compound P-49 (220 mg, 60%) as pale yellow solid. TLC: 20% EtOAc/ hexanes (Rf. 0.5); ‘lI-NMR (DMSO-d* 500 MHz): δ 7.77 (s, 1H), 7.44 (s, 1H), 7.40 (d, J= 7.5 Hz, 1H), 7.21 (d, J= 8.0 Hz, 1H), 7.16-7.14 (m, 1H), 6.57 (d, J= 8.5 Hz, 1H), 5.63 (br s, 2H), 3.87 (s, 3H), 3.84 (s, 3H), 2.27 (s, 3H).

Synthesis of 2-((2-amino-4-carboxyphenyl) thio)-5-methylbenzoic acid (P-50): To a stirred solution of compound P-49 (220 mg, 0.66 mmol) in THF: H2O (5: 1,6 mL) under argon atmosphère was added lithium hydroxide monohydrate (139 mg, 3.32 mmol) at RT and stirred for 20 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (15 mL) and acidified with 6 N HCl to pH~4. The precipitated solid was filtered and dried in vacuo to afford compound P-50 (110 mg, 55%) as an offwhite solid. TLC: 20% EtOAc/ hexanes (Rf. 0.2); ^JH-NMR (DMSO-r/₆, 500 MHz): δ 12.96 (br s, 2H), 7.76 (s, 1H), 7.42 (s, 1H), 7.37 (d, J= 8.0 Hz, 1H), 7.18 (d, J= 8.0 Hz, 1H), 7.15-7.13 (m, 1H), 6.54 (d, J= 8.0 Hz, 1H), 5.54 (br s, 2H), 2.26 (s, 3H).

Synthesis of 2-methyl-ll-oxo-10,11-dihydrodibenzo [b, f\ [1, 4] thiazepine-8-carboxylic acid (P-51): To a stirred solution of compound P-50 (110 mg, 0.36 mmol) in THF (10 mL) under argon atmosphère was added CDI (176 mg, 1.08 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with ice cold water (20 mL) and acidified with 6 N HCl to pH~4. The precipitated solid was filtered and dried in vacuo to afford compound P-51 (60 mg, 58%) as white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.6); ’H-NMR (DMSO-î/₆, 400 MHz): δ 13.21 (br s, 1H), 10.76 (s, 1H), 7.76 (s, 1H), 7.65 (s, 2H), 7.50 (s, 1H), 7.41 (d, J= 8.0 Hz, 1H), 7.30 (d, J= 8.0 Hz, 1H), 2.29 (s, 3H).

100

Example 25: Synthesis of 3-methyI-ll-oxo-lO, 11-dihydrodibenzo [Z>, f\ [1, 41 thiazepine-8carboxylic acid (P-8)

Synthesis of methyl 4-methyl-2-(((trifluoromethyI) sulfonyl) oxy) benzoate (P-2): To a stirred solution of methyl 2-hydroxy-4-methylbenzoate P-l (950 mg, 5.70 mmol) in pyridine (9.5 mL) under argon atmosphère was added triflic anhydride (1.05 mL, 6.20 mmol) drop wise at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was acidified with 6 N HCl and extracted with diethyl ether (2 x 50 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 2% EtOAc/ hexanes to afford compound P-2 (1.2 g, 71%) as colorless liquid. TLC: 10% EtOAc/ hexanes (Rf. 0.7); ’lI-NMR (CDC1₃, 400 MHz): δ 7.98 (d, J= 8.0 Hz, 1H), 7.28 (d, 8.0 Hz, 1H),

7.09 (s, 1H), 3.94 (s, 3H), 2.45 (s, 3H).

101

Synthesis of methyl 2-((4-methoxybenzyl) thio)-4-methylbenzoate (P-3): To a stirred solution of compound 2 (600 mg, 2.01 mmol) in 1, 4-dioxane (12 mL) under argon atmosphère were added (4methoxyphenyl) methanethiol (341 mg, 2.21 mmol), césium carbonate (1.3 g, 4.02 mmol) at RT and degassed under argon for 20 min. To this was added Pd(dppf)2C12 (36.8 mg, 0.05 mmol); heated to

O

100 C and stirred for 48 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (25 mL) and extracted with EtOAc (2x35 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 3% EtOAc/ hexanes to afford compound 3 (200 mg, 33%) as sticky solid. TLC: 10% EtOAc/ hexanes (Rf. 0.4); *H-NMR (CDC1₃, 500 MHz): δ 7.85 (d, J= 8.5 Hz, 1H), 7.32 (d, J= 8.0 Hz, 2H), 7.14 (s, 1H), 6.94 (d, J= 8.5 Hz, 1H), 6.84 (d, 8.0 Hz, 2H), 4.10 (s, 2H), 3.86 (s, 3H), 3.78 (s, 3H), 2.34 (s, 3H).

Synthesis of methyl 2-mercapto-4-methylbenzoate (P-4): A stirred solution of compound P-3 (200 mg, 0.65 mmol) in trifluoro acetic acid (4 mL) under argon atmosphère at RT was heated to 80 C and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude compound P-4 (115 mg) which was carried to the next step without any further purification. TLC: 10% EtOAc/ hexanes (Rf. 0.8).

Synthesis of methyl 2-((4-(methoxycarbonyI)-2-nitrophenyl) thio)-4-methylbenzoate (P-5): To a stirred solution of methyl 4-fluoro-3-nitrobenzoate (120 mg, 0.60 mmol) in DMF (4 mL) under argon atmosphère were added compound P-4 (115 mg, crude), césium carbonate (392 mg, 1.20 mmol) at RT; heated to 60 °C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted with EtOAc (2x35 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 10% EtOAc/ hexanes to afford compound P-5 (120 mg, 55%) as yellow solid. TLC: 15% EtOAc/ hexanes (Rf. 0.7); Ή-NMR (CDC1₃, 400 MHz): δ 8.85 (s, 1H), 7.95-7.89 (m, 2H), 7.46 (s, 1H), 7.38 (d, J= 8.8 Hz, 1H), 6.93 (d, J= 8.4 Hz, 1H), 3.93 (s, 3H), 3.76 (s, 3H), 2.42 (s, 3H).

Synthesis of methyl 2-((2-amino-4-(methoxycarbonyl) phenyl) thio)-4-methylbenzoate (P-6): To a stirred solution of compound P-5 (120 mg, 0.33 mmol) in MeOH (10 mL) under argon

102 atmosphère was added 10% Pd/C (60 mg) at RT and stirred under hydrogen atmosphère (balloon pressure) for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite, washed with w-pentane (2x5 mL) and dried in vacuo to afford compound P-6 (90 mg, 82%) as yellow sticky solid. TLC: 15% EtOAc/ hexanes (Rf. 0.5); ’H-NMR (DMSO-7₆, 400 MHz): δ 7.86 (d, J= 8.0 Hz, 1H), 7.45 (s, 1H), 7.40 (d, 7= 8.0 Hz, 1H), 7.15 (d, 7= 8.0 Hz, 1H), 7.05 (d, J= 8.0 Hz, 1H), 6.44 (s, 1H), 5.65 (br s, 2H), 3.85-3.84 (m, 6H), 2.13 (s, 3H).

Synthesis of 2-((2-amino-4-carboxyphenyl) thio)-4-methylbenzoic acid (P-7): To a stirred solution of compound P-6 (90 mg, 0.27 mmol) in THF: H₂O (2: 1,3 mL) under argon atmosphère was added lithium hydroxide monohydrate (56 mg, 1.35 mmol) at RT and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (15 mL) and extracted with EtOAc (2 x 20 mL). The aqueous layer was acidified with 2 N HCl, the obtained solid was filtered, washed with n-hexane (2x5 mL) and dried in vacuo to afford compound P-7 (60 mg, 73%) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.2); ^XHNMR (DMSO-i/é, 500 MHz): δ 12.95 (br s, 2H), 7.85 (d, J= 8.0 Hz, 1H), 7.44 (s, 1H), 7.38 (d, 7= 8.0 Hz, 1H), 7.15 (d, J= 7.5 Hz, 1H), 7.02 (d, 7= 8.0 Hz, 1H), 6.42 (s, 1H), 5.57 (br s, 2H), 2.13 (s, 3H).

Synthesis of 3-methyl-ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8-carboxylic acid (P-8): To a stirred solution of compound P-7 (60 mg, 0.19 mmol) in THF (4 mL) under argon atmosphère was added CDI (96 mg, 0.59 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the réaction, the volatiles were removed in vacuo, diluted with water (20 mL), acidified with dil. HCl to pH~ 3. The obtained precipitate was filtered and dried in vacuo to afford compound P-8 (45 mg, 80%) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂(Rf. 0.3); *H-NMR (DMSO-7₆, 400 MHz): δ 13.12 (br s, 1H), 10.72 (s, 1H), 7.76 (d, 7= 8.0 Hz, 2H), 7.59 (d, 7= 8.0 Hz, 2H), 7.37 (s, 1H), 7.26 (s, 1H), 2.30 (s, 3H).

Example 26: Préparation of Compounds

Acids similar to compound 6 (compounds 14, 21, 28, 35, 42, 50, 55, 62, 70, 76, 82, 88, 97,135,140, 145,150,155,156,159,164,167,170, P-8, P-42, P-51) were synthesized as mentioned above and

103 converted to final products either using commercially available amines or by using prepared amines employing Procedures A, B, C, D, E, F, G, H and the results are captured in Table 1.

Procedure A:

To a stirred solution of 6 (50 mg, 0.18 mmol) in DMF (3 mL) under argon atmosphère were added EDCI.HC1 (50 mg, 0.22 mmol), HOBt (35 mg, 0.22 mmol), 2-(5-methyl-l, 3, 4-thiadiazol-2-yl) ethan-l-amine hydrochloride 187 (50 mg, 0.22 mmol) and diisopropyl ethyl amine (0.1 mL, 0.55 mmol) at 0 °C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and stirred for 1 h. The crude was extracted with EtOAc or the precipitated material was either directly dried in vacuo or triturated or purified through silica gel column chromatography to afford the desired compound.

Procedure B:

To a stirred solution of 6 (40 mg, 0.14 mmol) in DMF (4 mL) under argon atmosphère were added pyridin-3-amine 182 (15 mg, 0.16 mmol), HATU (84 mg, 0.22 mmol), diisopropyl ethyl amine (0.05 mL, 0.29 mmol) at 0 °C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice cold water (15 mL), the obtained precipitate was fîltered, or extracted with EtOAc (2x30 mL). The combined organic extracts were dried over sodium sulfate, fîltered, concentrated in vacuo to obtain the crude. The crude was extracted with EtOAc or the precipitated material was directly dried in vacuo, triturated or purified through silica gel column chromatography to afford the desired compound.

Procedure C:

To a stirred solution of compound 35 (50 mg, 0.17 mmol) in CH2CI2 (5 mL) were added oxalyl chloride (0.03 mL, 0.34 mmol) or (0.06 mL, 0.69 mmol), DMF (0.01 mL) under argon atmosphère at 0 °C; warmed to 10 °C and stirred for 2-3 h. After completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was carried to the next step without further purification.

104

To a stirred solution of crude acid chloride (70 mg, crude) in CH2CI2 (5.mL) under argon atmosphère were added 2-chloro-4-fluoroaniIine 184 (25 mg, 0.17 mmol) and pyridine (0.07 mL, 0.86 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted with CH2CI2 (2x30 mL). The combined organic extracts were washed with 1 N HCl (20 mL), 10% NaHCCL solution (30 mL), brine (15 mL) dried over sodium sulfate, filtered and concentrated in vacuo to obtain crude. The precipitated material was either directly dried in vacuo or triturated or purified through silica gel column chromatography /préparative HPLC or by acid-base treatment to afford the desired compound.

Procedure D:

To a stirred solution of 6 (40 mg, 0.14 mmol) in DMF (3 mL) under argon atmosphère was added CDI (71.7 mg, 0.17 mmol) at 0 °C; warmed to RT and stirred for 2 h. To this were added (4(trifluoromethoxy) phenyl) methanamine 172 (33.8 mg, 0.17 mmol), and diisopropyl ethyl amine (0.05 mL, 0.29 mmol) and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mass was diluted with water (15 mL) and stirred for 1 h. The precipitate was filtered or extracted with EtOAc or CH2CI2 and the obtained solid was dried in vacuo or purified by column chromatography or triturated to afford the desired product.

Procedure E:

A stirred solution of 6 (40 mg, 0.14 mmol) in thionyl chloride (1 mL) under argon atmosphère was heated to 90 °C and stirred for 1 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain acid chloride (50 mg, crude) which was carried to the next step without further purification. To a stirred solution of 2-amino pyridine 181 (15 mg, 0.16 mmol) in CH2CI2 (5 mL) under argon atmosphère were added pyridine (0.035 mL), acid chloride (50 mg, crude) at 0 °C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude which was purified through silica gel column chromatography using 2% MeOH/ CH2CI2 to afford the desired product.

Procedure F:

105

To a stirred solution of compound 35 (50 mg, 0.17 mmol) in CH2CI2 (5 mL) under argon atmosphère were added ethyl 2-amino-2-(pyridin-2-yl) acetate hydrochloride 249 (26 mg, 0.17 mmol), propylphosphonic anhydride (-50% solution in EtOAc, 0.22 mL, 0.34 mmol), NMM (0.037 mL, 0.34 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo and diluted with water (20 mL) or the pH of the reaction mixture was adjusted to -8 and extracted with CH2CI2 (2 x 30 mL). The combined organic extracts were dried over sodium sulfate, fïltered and concentrated in vacuo to obtain the crude. The crude was purified either through silica gel column chromatography or triturated to afford the desired product.

Procedure G:

To a stirred solution of compound 159 (100 mg, 0.33 mmol) in CH3CN (2 mL) under argon atmosphère was added thiazol-2-amine 231 (36 mg, 0.36 mmol), propylphosphonic anhydride (-50% solution in EtOAc, 0.8 mL, 1. 32 mmol) and NMM (0.14 mL, 1.32 mmol) at RT in a microwave vial and heated at 100 °C and stirred for 1 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo and diluted with water (20 mL) and the precipitated solid was fïltered. The obtained solid was either directly dried in vacuo or titurated or purified by column chromatography to afford the desired product.

Procedure H:

To a stirred solution of compound 159 (100 mg, 0.33 mmol) in CH₂C1₂ (12 mL) under argon atmosphère were added EDCI.HC1 (188.8 mg, 0.98 mmol), 6-fluorobenzo [<7] thiazol-2-amine 241 (61 mg, 0.36 mmol) and DMAP (120.7 mg, 0.98 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the precipitated solid was fïltered washed with water and titurated to afford the desired product.

106

Représentative Commercially Available Amines Used for Synthesis

171

172

173

174

175

188

185

187

CIH

HNh₂n~^n'^N

194

191

192

196 197 198 199

H₂N	N--. Me—L	^nh₂	r-N JL ^~^ci 1 S
	S		nh₂

201

202

203

Me

205 h₂n

206

208

209

133

207

107

108

Préparation of amines for compound synthesis

Synthesis of 2-cyclohexylethanamine hydrochloride (261):

To a stirred solution of 2-(cyclohex-l-en-l-yl) ethanamine 260 (500 mg, 4.00 mmol) in MeOH (10 mL) under argon atmosphère was added 10% Pd/C (50 mg) at RT and stirred under hydrogen atmosphère (balloon pressure) for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was fiitered through celite, washed with MeOH (2x5 mL) and the filtrate was concentrated in vacuo. The residue was triturated with CH2CI2: EtOAc (1: 1,2 mL), diethyl ether in 1 N HCl (4 mL) to afford compound 261 (250 mg, 38%) as white solid. TLC: 20% EtOAc/ hexanes (Rf. 0.3); *H-NMR (DMSO-J₆, 500 MHz): δ 7.79 (br s, 2H), 2.77 (t, J= 7.5 Hz, 2H), 1.66-1.59 (m, 5H), 1.45-1.41 (m, 2H), 1.32-1.28 (m, 1H), 1.23-1.11 (m, 3H), 0.91-0.84 (m, 2H).

Synthesis of 2-(4-fluorophenoxy) ethan-l-amine hydrochloride (265)

109

Synthesis of 2-(4-fluorophenoxy) acetonitrile (264): To a stirred solution of 4-fluorophenol 262 (1.74 mL, 18.96 mmol) in acetone (50 mL) under argon atmosphère were added potassium carbonate (6.5 g, 47.40 mmol), chloro acetonitrile 263 (1 mL, 15.80 mmol) at RT; heated to reflux and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was fîltered and the fîltrate was concentrated in vacuo. The residue was extracted with diethyl ether (3 x 40 mL). The combined organic extracts were washed withNaOH solution (30 mL), water (30 mL), dried over sodium sulfate, fîltered and concentrated in vacuo to afford compound 264 (2.4 g, 90%) as brown syrup. TLC: 10% EtOAc/ hexanes (Rf. 0.3); ’H-NMR (CDC1₃, 400 MHz): δ 7.06-7.01 (m, 2H), 6.98-6.89 (m, 2H), 4.73 (s, 2H).

Synthesis of 2-(4-fluorophenoxy) ethan-l-amine hydrochloride (265): To a stirred solution of compound 264 (200 mg, 1.32 mmol) in MeOH (10 mL) under argon atmosphère were added HCl (0.3 mL), Pd/C (90 mg) and stirred under hydrogen atmosphère (balloon pressure) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with saturated sodium potassium tartrate solution (20 mL) and extracted with diethyl ether (2 x 20 mL). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to afford compound 265 (130 mg, 65%) as an off-white solid. TLC: 10% EtOAc/hexanes (Rf. 0.2); ’H-NMR (DMSO-rf₆, 400 MHz): δ 8.31-8.28 (m, 2H), 7.17-7.12 (m, 2H), 7.02-6.98 (m, 2H), 4.16 (t, J= 5.2 Hz, 2H), 3.17 (t, 5.2 Hz, 2H).

Synthesis of 2-(4-fluorocyclohexyl) ethan-l-amine hydrochloride (269)

110

Synthesis of 2-(4-hydroxycyciohexyl) acetonitrile (267): To a stirred solution of 2-(4oxocyclohexyl) acetonitrile 266 (200 mg, 1.45 mmol) in EtOH (10 mL) under argon atmosphère was added sodium borohydride (82.7 mg, 2.18 mmol) at 0 °C; warmed to 10-15 °C and stirred for 1 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with ice cold water (2 mL) and the volatiles were removed in vacuo. The residue was diluted with water (20 mL) and extracted with CH2CI2 (2 x 25 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to afford compound 267 (180 mg, 89%) as colorless syrup. TLC: 50% EtOAc/ hexanes (Rf. 0.4); ’H-NMR (CDC1₃, 400 MHz): δ 3.62-3.55 (m, 1H), 2.30-2.24 (m, 2H), 2.06-2.01 (m, 2H), 1.92-1.88 (m, 2H), 1.80-1.78 (m, 1H), 1.70-1.63 (m, 2H), 1.59-1.56 (m, 1H), 1.40-1.16 (m, 2H).

Synthesis of 2-(4-fluorocyclohexyl) acetonitrile (268): To a stirred solution of compound 267 (180 mg, 1.29 mmol) in CH2CI2 (5 mL) under argon atmosphère was added DAST (313 mg, 1.94 mmol) at -20 °C; warmed to RT and stirred for 6 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with ice cold water (20 mL) and extracted with CH2CI2 (2x30 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 5-7% EtOAc/hexanes to afford compound 268 (35 mg, 19%) as colorless syrup. TLC: 20% EtOAc/ hexanes (Rf. 0.4); ’lI-NMR (CDC1₃, 500 MHz): δ 4.88-4.79 (m, 1H), 2.27 (d, J= 7.0 Hz, 2H), 2.10-2.08 (m, 2H), 1.77-1.70 (m, 3H), 1.57-1.33 (m, 4H).

Synthesis of 2-(4-fluorocycIohexyl) ethan-l-amine hydrochloride (269): To a stirred solution of compound 268 (35 mg, 0.24 mmol) in ether (5 mL) under argon atmosphère was added lithium aluminium hydride (18.8 mg, 0.49 mmol) at 0 °C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with saturated sodium potassium tartrate solution (10 mL) at 0-5 °C and extracted with ether (2 x 20 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was dissolved in ether (3 mL), slowly added 2 N HCl in ether (10 mL) and stirred for 1 h. The precipitated solid was filtered and dried in vacuo to afford compound 269 (12 mg, 33%) as pale yellow solid. TLC: 30% EtOAc/ hexanes (Rf. 0.2); ¹H-NMR (DMSO-dô, 400 MHz): δ 7.81 (br s, 2H), 4.87 (br s, 1H), 4.75 (br s, 1H), 2.82-2.77 (m, 2H), 1.89-1.84 (m, 2H), 1.59-1.40 (m, 6H), 1.20 (t, J= 10.0 Hz, 2H).

111

Synthesis of 3-methoxy-3-methylbutan-l-amine (273)

y 7 - MeO^^	TsCI OTs -------*- Y J “ ... MeO^~^ pyridine	NaN₃ DMF	yJ“³MeO^^
270	271		272

H₂, Pd/C \f NH₂

EtOH

273

Synthesis of 3-methoxy-3-methylbutyI 4-methylbenzenesulfonate (271): To a stirred solution of 3-methoxy-3-methylbutan-l-ol 270 (1 g, 8.46 mmol) inpyridine (15 mL) under argon atmosphère was added tosyl chloride (1.6 g, 8.46 mmol) at 0 °C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was quenched with saturated NaHCO₃ solution (20 mL) and extracted with EtOAc (2x10 mL). The combined organic extracts were dried over sodium sulphate, filtered and concentrated in vacuo to afford compound 271 (1.8 g, 78%) as colorless syrup. TLC: 30% EtOAc/ hexanes (Rf. 0.7); ^XH-NMR (CDC1₃, 400 MHz): δ 7.79 (d, J= 8.4 Hz, 2H), 7.34 (d, 7= 7.6 Hz, 2H), 4.13 (t, 7= 7.2 Hz, 2H), 3.10 (s, 3H), 2.45 (s, 3H), 1.87 (t, 7= 7.6 Hz, 2H), 1.12 (s, 6H).

Synthesis of l-azido-3-methoxy-3-methyIbutane (272): To a stirred solution of compound 271 (1 g, 3.67 mmol) in DMF (10 mL) under argon atmosphère was added sodium azide (478 mg, 7.34 mmol) at 0 °C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (30 mL) and extracted with EtOAc (2 x 20 mL). The combined organic extracts were dried over sodium sulphate, filtered and concentrated in vacuo to afford compound 272 (525 mg, 76%) as white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.7); ’H-NMR (CDC1₃, 400 MHz): δ 3.34 (t, 7= 7.6 Hz, 2H), 3.18 (s, 3H), 1.78 (t, J =8.0Hz,2H), 1.18 (s, 6H).

Synthesis of 3-methoxy-3-methylbutan-l-amine (273): To a stirred solution of compound 272 (400 mg, 2.79 mmol) in EtOH (5 mL) under argon atmosphère was added 10% Pd/C (250 mg) at RT and stirred under hydrogen atmosphère (balloon pressure) for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite and the filtrate was

112 concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 80% EtOAc/ hexanes to afford compound 273 (320 mg, 33%) as colorless syrup. TLC: 70% EtOAc/hexanes (Rf. 0.3); ’H-NMR (CDC1₃, 400 MHz): δ 3.18 (s, 3H), 2.80 (t, J = 8.0 Hz, 0.5 H), 2.70 (t, J= 7.6 Hz, 1H), 2.49 (t, J= 8.0 Hz, 0.5H), 1.71 (t, J= 7.6 Hz, 2H), 1.56 (s, 6H).

Synthesis of 3-phenyl-3-(pyrrolidin-l-yI) propan-l-amine (277)

Synthesis of 3-phenyl-3-(pyrrolidin-l-yl) propanenitrile (276): To a stirred solution of cinnamonitrile 274 (500 mg, 3.87 mmol) in H2O (15 mL) were added pyrrolidine 275 (412 mg, 5.80 mmol), ceric ammonium nitrate (2.1 g, 3.87 mmol) at RT, heated to 60 C and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted with EtOAc (2x30 mL). The combined organic extracts were dried over sodium sulphate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 25% EtOAc/ hexanes to afford compound 276 (300 mg, 39%) as colorless syrup. TLC: 30% EtOAc/ hexanes (Rf. 0.5); ’H-NMR (CDCI3, 400 MHz): δ 7.39-7.31 (m, 5H), 3.50-3.35 (m, 1H), 2.80-2.70 (m, 2H), 2.60-2.45 (m, 4H), 1.89-1.72 (m, 4H).

Synthesis of 3-phenyl-3-(pyrrolidin-l-yl) propan-l-amine (277): To a stirred solution of compound 276 (150 mg, 0.75 mmol) in THF (10 mL) under argon atmosphère were added lithium aluminium hydride (57 mg, 1.50 mmol), H2SO4 (0.04 mL, 0.75 mmol) at 0 °C; warmed to RT and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with saturated sodium sulphate and the reaction mixture was filtered through celite, washed with EtOAc (2x5 mL).The volatiles were removed in vacuo to afford compound 277(100 mg, 65%) as an off-white solid. TLC: 10% MeOH/ EtOAc (Rf. 0.3); ¹H-NMR (CDCI3,

113

400 MHz): δ 7.31-7.30 (m, 5H), 3.26-3.22 (m, 1H), 2.59-2.40 (m, 4H), 2.39-2.37 (m, 2H), 2.142.10 (m, 1H), 2.10 -2.04 (m, 1H), 1.98-1.72 (m, 6H).

Synthesis of 2-(5-methyl-l, 3,4-oxadiazoI-2-yl) ethan-l-amine hydrochloride (283) h₂n ^/CO₂H (Boc)₂O

IMNaOH, THF

BocHN'''^x-''^C°^2H h₂n'V

280 O --------------> EDCI.HCI, HOBt, Et₃N, CH₂CI₂

278

279

BocHN^^x/^'N'^NJ|^/ ^H O

281 l₂, TPP,

Et₃N, CH₂CI₂

282

CH₂CI₂

4N HCl in 1, 4-Dioxane

283

Synthesis of 3-((tert-butoxycarbonyl) amino) propanoic acid (279): To a stirred solution of 3aminopropanoic acid 278 (5 g, 51.02 mmol) in THF (50 mL) were added 1 M aqueous sodium hydroxide solution (25 mL) and Boc-anhydride (11.3 mL, 51.02 mmol) at 0 C; warmed to RT and stirred for 12 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The aqueous layer was washed with diethyl ether (2 x 50 mL) and the pH was adjusted to ~6 with 4 M HCl and extracted with diethyl ether (4 x 50 mL). The combined organic extracts were washed with brine (100 mL), dried over sodium sulphate, filtered and concentrated in vacuo to obtain compound 279 (8 g, 79%) as an off-white solid. TLC: 50% EtOAc/ hexanes (Rf. 0.3); ’H-NMR (DMSO-^, 500 MHz): δ 12.18 (br s, 1H), 6.81 (t, J= 4.8 Hz, 1H), 3.11 (q, J= 6.9 Hz, 2H), 2.34 (t, J= 7.1 Hz, 2H), 1.36 (s, 9H).

Synthesis of to'Abutyl (3-(2-acetylhydrazinyl)-3-oxopropyl) carbamate (281) To a stirred solution of compound 279 (1 g, 5.29 mmol) in CH₂C1₂ (15 ML) under argon atmosphère were added EDCI.HCI (1.3 g, 6.87 mmol), HOBt (714 mg, 5.29 mmol), triethyl amine (0.99 ML, 6.87 mmol), acetic acid hydrazide 280 (430 mg, 5.82 mmol) at 0 °C; warmed to RT and stirred for 1.5 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice cold water (5 mL) and extracted with CH₂C1₂ (4 x 20 mL). The combined organic extracts were dried over sodium sulphate, filtered and concentrated in vacuo to obtain crude. The crude was purified through silica gel column cbromatography using 10% EtOAc/ hexanes to afford compound

114

281 (610 mg, 50%) as an off white solid. TLC: 10% EtOAc/ hexanes (Rf. 0.3); ‘H-NMR (DMSOd₆, 400 MHz): δ 9.70 (s, 2H), 6.73 (t, J= 4.Ί Hz, 1H), 3.13 (q, J= 6.6 Hz, 2H), 2.27 (t, J= ΊΑ Hz, 2H), 1.83 (s, 3H), 1.37 (s, 9H).

Synthesis of teri-butyl (2-(5-methyl-l, 3,4-oxadiazol-2-yl) ethyl) carbamate (282): To a stirred solution of triphenyl phosphine (428 mg, 1.63 mmol) in CH2CI2 (5 mL) under argon atmosphère were added iodine (414 mg, 1.63 mmol) and stirred for 15 min. To this were added triethyl amine (0.47 mL, 3.26 mmol), compound 281 (200 mg, 0.81 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 4% EtOAc/ hexanes to afford crude compound 282 (360 mg) as an off-white solid. TLC: 10% EtOAc/ hexanes (Rf. 0.7); 1H NMR shows mixture of compound and TPPO as major impurity. ’H-NMR (DMSO-î/₆, 400 MHz): δ 7.68-7.49 (m, 48H-TPPO as impurity), 6.97 (t, J= 5.0 Hz, 1H), 3.27 (q, J = 6.5 Hz, 2H), 2.89 (t, J= 6.7 Hz, 2H), 2.43 (s, 3H), 1.35 (s, 9H).

Synthesis of 2-(5-methyl-l, 3, 4-oxadiazol-2-yl) ethan-l-amine hydrochloride (283): To a stirred solution of compound 282 (350 mg) in CH2CI2 (5 mL) under argon atmosphère was added 4 N HCl in 1, 4-dioxane (4 mL) at 0 °C; warmed to RT and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was titurated with CH2CI2 (2 mL), diethyl ether (5 mL) and 77-pentane (5 mL) and dried in vacuo to afford crude compound 283 (60 mg) as brown solid. TLC: 10% EtOAc/ hexanes (Rf. 0.1).

Synthesis of (2-ethylthiazol-5-yl) methanamine hydrochloride (292)

115

Synthesis of ethyl 2-chloro-3-oxopropanoate (286): To a stiired solution of ethyl 2-chloroacetate 284 (5 g, 40.98 mmol) and 285 (3.03 g, 40.98 mmol) in diisopropyl ether (100 mL) under argon atmosphère was added potassium tert-butoxide (5.49 g, 45.08 mmol) portion wise for 10 min at 0 C; warmed to RT and stirred for 24 h. The reaction was monitored by TLC; after completion of the reaction, the pH of the reaction mixture was adjusted to ~ 6 using 5 N HCl. The obtained solid was fîltered, washed with diethyl ether (200 mL) and dried in vacuo to afford compound 286 (6 g) as pale brown syrup. TLC: 30% EtOAc/ hexanes (Rf. 0.2); LC-MS: 21.49% + 75.58%; 149.0 (MF-l); (column; X-Select C-18, (50 x 3.0 mm, 3.5 pm); RT 0.56 min, 0.77 min. 5 Mm Aq.hffiLOAc: ACN 0.8 mL/min).

Synthesis of ethyl 2-ethylthiazole-5-carboxyIate (288): To a stirred solution of compound 286 (1

g) in éthanol (25 mL) under argon atmosphère were added propanethioamide 287 (594 mg, 6.67 mmol), dry magnésium sulfate (4 g) at RT and heated to reflux for 24 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo, diluted with EtOAc (2 x 100 mL). The combined organic extracts were washed with saturated sodium bicarbonate solution (2 x 100 mL), brine (50 mL), dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through flash column chromatography using 6% EtOAc/ hexanes to afford compound 288 (330 mg, 27%) as brown syrup. TLC: 10% EtOAc/ hexanes (Rf. 0.4); ^-NMR (DMSO-îZ₆, 400 MHz): δ 8.29 (s, 1H), 4.30 (q, J= 7.1 Hz, 2H), 3.04 (q, J= 7.5 Hz, 2H), 1.31 (t, J= 7.3 Hz, 3H), 1.29 (t, J= 7.3 Hz, 3H).

116

Synthesis of (2-ethylthiazol-5-yl) methanol (289) (SAP-MA1426-31): To a stirred suspension of lithium aluminium hydride (205 mg, 5.40 mmol) in dry THF (15 mL) under inert atmosphère was added compound 288 (500 mg, 2.70 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was cooled to 0 C, quenched with 20% aqueous sodium hydroxide solution (3 mL), filtered through celite and washed with EtOAc (3 x 100 mL). The filtrate was dried over sodium sulfate, filtered and concentrated in vacuo to afford compound 289 (310 mg, 80%) as pale yellow solid. TLC: 50% EtOAc/ hexanes (Rf. 0.4). Tl-NMR (CDC1₃, 400 MHz): δ 7.51 (s, 1H), 4.82 (s, 2H), 3.01 (q, J= 7.5 Hz, 2H), 1.38 (t, J= 7.6 Hz, 3H).

Synthesis of 5-(chloromethyl)-2-ethylthiazole (290) (SAP-MA1426-34): To a stirred solution of compound 289 (300 mg, 2.09 mmol) in CH2CI2 (15 ML) under inert atmosphère were added triethyl amine (0.6 mL, 4.20 mmol), DMAP (25.6 mg, 0.21 mmol) and mesyl chloride (0.19 mL, 2.51 mmol) at 0 C; warmed to RT and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (50 mL) and extracted with CH2CI2 (3 x 100 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to afford compound 290 (500 mg, crude) as pale yellow syrup. TLC: 30% EtOAc/hexanes (Rf. 0.8); LC-MS: 30.71%; 162.0 (ML+l); (column; Ascentis Express C18, (50 x 3.0 mm, 2.7 pm); RT 2.14 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min).

Synthesis of 5-(azidomethyl)-2-ethylthiazole (291) (SAP-MA1426-35): To a stirred solution of compound 290 (500 mg, 2.26 mmol) in DMF (20 mL) under inert atmosphère was added sodium azide (294 mg, 4.52 mmol) at RT and heated to 80 °C for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice cold water (50 mL) and extracted with EtOAc (3 x 100 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through flash column chromatography using 15% EtOAc/ hexanes to afford compound 291 (250 mg, 71%) as pale yellow syrup. TLC: 20% EtOAc/ hexanes (Rf. 0.4); ¹H-NMR (CDC1₃, 400 MHz): δ 7.56 (s, 1H), 4.49 (s, 2H), 3.03 (q, J= 7.6 Hz, 2H), 1.40 (t, J= 7.6 Hz, 3H);

Synthesis of (2-ethylthiazol-5-yl) methanamine hydrochloride (292): To a stirred solution of compound 291 (250 mg, 1.48 mmol) in THF: H₂O (5:1, 12 mL) was added triphenyl phosphine (780

117 mg, 2.97 mmol) at RT and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The obtained solid was further dried using toluene (2x5 mL) to obtain the crude amine.

The above compound was dissolved in CH2CI2 (5 mL) added 4 N HCl in 1, 4-dioxane (4 mL) under 5 inert atmosphère at 0 °C and stirred for 30 min. The volatiles were removed in vacuo to obtain the crude, which was titurated with EtOAc (2 mL), diethyl ether (2 mL) and pentane (5 mL) to afford compound 292 (180 mg, 68%) as an off-white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf 0.2); *H NMR (DMSO-î/ô,500 MHz): δ 8.48 (br s, 3H), 7.74 (s, 1H), 4.25 (q, 7= 5.5 Hz, 2H), 2.98 (q, 7= 7.5 Hz, 2H), 1.28 (t, 7= 7.5 Hz, 3H);

Synthesis of (2-isopropylthiazol-5-yl) methanamine hydrochloride (298)

Synthesis of ethyl 2-isopropylthiazole-5-carboxylate (294): To a stirred solution of compound

286 (3.05 g) in éthanol (60 mL) under argon atmosphère were added 2-methylpropanethioamide 293 (1.5 g, 14.56 mmol), dry magnésium sulfate (5 g) at RT and heated to reflux for 24 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with saturated sodium bicarbonate solution (100 mL), extracted with EtOAc (3 x 100 mT,). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through flash column chromatography using 2% EtOAc/ hexanes to afford compound 294 (550 mg, 17%) as brown syrup. TLC: 10% EtOAc/

118 hexanes (Rf 0.5); *H NMR (500 MHz, DMSO-î/₆) δ 8.31 (s, 1H), 4.30 (q, J= 7.0 Hz, 2H), 3.363.29 (m, 1H), 1.34 (d, J= 6.9 Hz, 6H), 1.29 (t, J= 7.1 Hz, 3H).

Synthesis of (2-isopropylthiazol-5-yl) methanol (295): To a stirred solution of compound 294 (550 mg, 2.76 mmol) in dry THF (10 mL) under inert atmosphère was added lithium aluminium hydride (210 mg, 5.52 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was o monitored by TLC; after completion of the reaction, the reaction mixture was cooled to 0 C, quenched with 15% aqueous sodium hydroxide solution (3 mL), fiitered through celite and washed with EtOAc (100 mL). The filtrate was dried over sodium sulfate, fiitered and concentrated in vacuo to afford compound 295 (360 mg, 83%) as pale yellow syrup. TLC: 50% EtOAc/ hexanes (Rf. 0.3). ’H NMR (400MHz, DMSO-^) δ 7.47 (s, 1H), 5.43 (t, J= 5.7 Hz, 1H), 4.61 (dd, 5.6, 0.6 Hz, 2H), 3.26-3.19 (m, 1H), 1.30 (d, J= 6.9 Hz, 6H).

Synthesis of 5-(chloromethyI)-2-isopropylthiazole (296): To a stirred solution of compound 295 (350 mg, 2.23 mmol) in CH2CI2 (20 mL) under inert atmosphère were added triethyl amine (0.64 mL, 4.45 mmol), DMAP (27.2 mg, 0.22 mmol) and mesyl chloride (0.2 mL, 2.67 mmol) at 0 C; warmed to RT and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (50 mL) and extracted with CH2CI2 (2 x 100 mL). The combined organic extracts were dried over sodium sulfate, fiitered and concentrated in vacuo to afford compound 296 (500 mg, crude) as pale yellow syrup. TLC: 40% EtOAc/ hexanes (Rf. 0.8); LC-MS: 70.54%; 175.8 (M^+l); (column; Ascentis Express C18, (50 x 3.0 mm, 2.7 pm); RT 2.34 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min).

Synthesis of 5-(azidomethyl)-2-isopropylthiazole (297): To a stirred solution of compound 296 (500 mg, 2.26 mmol) in DMF (20 mL) under inert atmosphère was added sodium azide (445 mg, 6.85 mmol) at RT and heated to 80 °C for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice cold water (100 mL) and extracted with EtOAc (2 x 100 mL). The combined organic extracts were dried over sodium sulfate, fiitered and concentrated in vacuo to obtain the crude. The crude was purified through column chromatography using 8% EtOAc/hexanes to afford compound 297 (255 mg, 63%) as colorless liquid. TLC: 10% EtOAc/ hexanes (Rf. 0.4); *H NMR (500 MHz, DMSO-îZ₆): δ = 7.67 (s, 1H), 4.69 (s, 2H), 3.29-3.24 (m, 1H), 1.32 (d, J= 6.9 Hz, 8H).

119

Synthesis of (2-isopropylthiazol-5-yl) methanamine hydrochloride (298): To a stirred solution of compound 297 (250 mg, 1.37 mmol) in THF: H₂O (5:1, 12 mL) was added triphenyl phosphine (720 mg, 2.74 mmol) at RT and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The obtained solid was further dried using toluene (2x5 mL) to obtain the crude amine.

The above crude compound was dissolved in CH2CI2 (5 mL) added 4 N HCl in 1, 4-dioxane (10 mL) under inert atmosphère at 0 C and stirred for 30 min. The volatiles were removed in vacuo to obtain the crude, which was titurated with EtOAc (2 mL), diethyl ether (2 mL) and pentane (5 mL) to afford compound 298 (170 mg, 65%) as low melting hygroscopic solid. TLC: 5% MeOH/

CH2CI2 (Rf. 0.2); ^XH NMR (500 MHz, DMSO-rf₆): δ 8.29 (br s, 2H), 7.72 (s, 1H), 4.25 (d, J= 5.8

Hz, 2H), 3.29-3.24 (m, 1H), 1.30 (d, J= 6.9 Hz, 6H)

Synthesis of (2-methoxythiazol-5-yl) methanamine (300)

299

Na, MeOH

300

Synthesis of (2-methoxythiazol-5-yl) methanamine (300): Sodium métal (46.6 mg, 2.02 mmol) was added slowly to MeOH (5 mL) under argon atmosphère and stirred for 15 min in a sealed tube. To this was added (2-chlorothiazol-5-yl) methanamine 299 (100 mg, 0.67 mmol) and the reaction mixture was heated to 80 °C for 3 h. The reaction was monitored by TLC; after completion the reaction, the reaction mixture was extracted with 20% MeOH/ CH2CI2 (3 x 50 mL). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude compound 300 (32 mg, 33%). The crude was carried forward for next step without purification. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.2); LC-MS: 90.34%; 145.0 (MM); (column; XSelect CSH C18, (50 x 3.0 mm, 3.5 pm); RT 0.88 min. 2.5 mM Aq.NH4OOCH + 5% ACN: ACN + 5% 2.5 mM Aq. NH4OOCH; 1.2 mL/min).

Synthesis of 5-(aminomethyl) thiazol-2-amine dihydrochloride (303)

120

301 (Boc)₂O

NiCI₂,NaBH₄, MeOH

NHBoc

N HCl in 1, 4-Dioxane

302

CH₂CI₂

HCl

303

Synthesis of tert-butyl ((2-((tert-butoxycarbonyl) amino) thiazol-5-yl) methyl) carbamate (302): To a stirred solution of 2-aminotbiazole-5-carbonitrile 301 (300 mg, 2.40 mmol) in MeOH (50 mL) were added Boc-anhydride (1.5 mL, 7.20 mmol), nickel(II) chloride (571 mg, 2.40 mmol) at 0 C. To this was added sodium borohydride (638 mg, 16.80 mmol) portion wise forlO min at 0 °C; warmed to RT and stirred for 18 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with EtOAc (100 mL) and water (75 mL), filtered through celite. The organic layer was dried over sodium sulphate, filtered and concentrated in vacuo to obtain compound 302 (300 mg) as colorless syrup. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.5); ’H NMR (DMSO-d₆,500 MHz): δ 11.24 (br s, 1H), 7.38 (br s, 1H), 7.11 (s, 1H), 4.17 (d, J= 5.5 Hz, 2H), 1.39 (s, 9H), 1.37 (s, 9H).

Synthesis of 5-(aminomethyl) thiazoI-2-amine dihydrochloride (303): To a stirred solution of compound 302 (300 mg) in CH₂C1₂ (10 mL) was added 4 N HCl in 1, 4-dioxane (5 mL) under argon atmosphère at 0-5 °C; warmed to RT and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed under reduced pressure. The obtained solid was washed with CH₂C1₂ (5 mL), EtOAc (5 mL) and dried in vacuo to afford compound 303 (120 mg, HCl sait) as yellow solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.2); *H NMR (DMSO-d₆,500 MHz): δ 9.31 (br s, 1H), 8.53 (br s, 2H), 8.14 (br s, 1H), 7.37 (br s, 1H), 7.27 (br s, 1H), 7.17 (br s, 1H), 4.07 (d, J= 5.5 Hz, 2H).

Synthesis of 4-(aminomethyI)-A-niethylthiazoI-2-ainine hydrochloride (308)

121

Synthesis of teri-butyl ((2-chlorothiazol-4-yl) methyl) carbamate (305): To a stirred solution of (2-chlorothiazol-4-yl) methanamine 304 (200 mg, 1.35 mmol) in CH2CI2 (10 mL) were added triethylamine (0.6 mL, 4.14 mmol) and Boc-anhydride (0.6 mL, 2.7 mmol) at 0 °C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The aqueous layer was washed with CH2CI2 (50 mL), washed with water (50 mL). The organic extract was dried over sodium sulphate, filtered and concentrated in vacuo to obtain compound 305 (200 mg, 60%) as pale yellow sticky solid. TLC: 5% MeOH/ CH2CI2 (Rf. 0.4); ^XH NMR (DMSO-^,400 MHz): δ 7.56 (br s, 1H), 7.49 (s, 1H), 4.24 (d, J= 5.9 Hz, 3H), 1.39 (s, 9H).

Synthesis of to Abutvl ((2-(methylamino) thiazol-4-yl) methyl) carbamate (307): A mixture of compound 305 (100 mg, 0.41 mmol) and methyl amine 306 (5 mL, 33% solution in EtOH) in a sealed tube under argon atmosphère was added diisopropyl ethylamine (0.2 mL, 1.21 mmol) under argon atmosphère at RT and heated to 120 °C for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The crude was purified through silica gel column chromatography using 70% EtOAc/ hexanes to afford compound 307 (90 mg, 92%) as colorless sticky solid. TLC: 50% EtOAc/hexanes (Rf. 0.2); ³H NMR (DMSO-r/^400 MHz): δ 7.26 (d, J= 5.6 Hz, 2H), 6.77 (s, 1H), 4.05 (d, J= 5.7 Hz, 2H), 2.76 (d, J= 4.8 Hz, 3H), 1.38 (s, 9H).

Synthesis of 4-(aminomethyI)-7V-methylthiazol-2-amine hydrochloride (308) To a stirred solution of compound 307 (90 mg, 0.37 mmol) in CH₂C1₂ (3 mL) under argon atmosphère was added 4 N HCl in 1, 4-dioxane (3 mL) at 0 °C; warmed to RT and stirred for 4 h. The reaction was

122 monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The crude was titurated with diethyl ether (5 mL) and dried in vacuo to afford compound 308 (70 mg, HCl sait) as brown solid. TLC: 30% EtOAc/ hexanes (Rf. 0.1); *11 NMR (DMSO-îZ₆,400 MHz): δ 9.73-9.27 (m, 1H), 8.39 (br s, 3H), 7.35 (s, 1H), 4.08 (q, J= 5.3 Hz, 2H), 2.95 (s, 3H).

Synthesis of 4-(aminomethyl)-2V, A-dimethylthiazol-2-amine hydrochloride (310)

Synthesis of teri-butyl ((2-(dimethylamino) thiazol-4-yI) methyl) carbamate (310): To a stirred solution of compound 305 (100 mg, 0.41 mmol) in CH3CN (3 mL) under argon atmosphère were added dimethyl amine hydrochloride 310 (648 mg, 8.06 mmol) and diisopropyl ethylamine (0.2 mL, 1.21 mmol) in a sealed tube at RT and heated to 120 °C for 54 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with EtOAc (2 x 50 mL) washed with water (20 mL). The organic extract was dried over sodium sulphate, fïltered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 20% EtOAc/ hexanes to afford compound 310 (80 mg, 77%) as an off-white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.2); ²H NMR (DMSO-J₆,400 MHz): δ 7.29 (t, J= 4.8 Hz, 1H), 6.89 (s, 1H), 4.08 (d, J= 5.9 Hz, 2H), 2.97 (s, 6H), 1.38 (s, 9H).

Synthesis of 4-(aminoinethyl)-7V, 7V-dimethylthiazol-2-amine hydrochloride (311): To a stirred solution of compound 310 (100 mg, 0.38 mmol) in CH2CI2 (3 mL) under argon atmosphère was added 4 N HCl in 1, 4-dioxane (3 mL) at 0 °C; warmed to RT and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The crude was titurated with diethyl ether (5 mL) and dried in vacuo to afford compound 311 (75 mg, HCl sait)

123 as an off-white solid. TLC: 50% EtOAc/ hexanes (Rf 0.1); *H NMR (DMSO-îZ₆, 400 MHz): δ 8.44 (br s, 3H), 7.38 (s, 1H), 4.10 (q, J= 5.6 Hz, 2H), 3.14 (s, 6H).

Synthesis of (4-ethylthiazol-5-yl) methanamine hydrochloride (319)

Synthesis of ethyl 2-chloro-3-oxopentanoate (313): To a stirred solution of ethyl 3-oxopentanoate 312 (1 g, 6.94 mmol) in CH2CI2 (20 mL) under argon atmosphère was added sulfuryl chloride (0.56 ML, 6.94 mmol) at 0 °C; warmed to RT and stirred for 6 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to afford compound crude 313 (1 g) as colorless liquid. TLC: 10% EtOAc/ hexanes (Rf 0.5); ²H NMR (DMSO-J₆,400 MHz): δ

5.66-5.55 (m, 1H), 5.66-5.55 (m, 1H), 4.22 (q, J= 7.1 Hz, 3H), 2.73-2.67 (m, 2H), 1.22 (t, J= 7.1

Hz, 3H), 0.99 (t, J= 7.2 Hz, 3H).

Synthesis of ethyl 4-ethylthiazole-5-carboxylate (315): To a stirred solution of compound 313 (1 g, crude) in EtOH (10 mL) under inert atmosphère was added thioformamide 314 (3.3 g, 55.55 mmol) at RT; heated at 80 °C and stirred for 24 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was purified through column chromatography using 40% EtOAc/ hexanes to afford compound 315 (300 mg, 30%) as yellow solid. TLC: 20% EtOAc/ hexanes (Rf. 0.4); LC-MS: 51.18%; 185.9 (MÉ+1); (column; Ascentis Express Cl8, (50 x 3.0 mm, 2.7 μιη); RT 2.24 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min).

124

Synthesis of (4-ethylthiazol~5-yl) methanol (316): To a stirred solution of compound 315 (300 mg, 1.62 mmol) in THF (10 mL) under inert atmosphère was added lithium aluminium hydride (123 mg, 3.24 mmol) at 0 C; warmed to RT and stirred for 1 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with saturated 10% NaOH solution (1 mL), filtered through celite. The filtrate was concentrated in vacuo to obtain the crude. The crude was purified through column chromatography using 30% EtOAc/ hexanes to afford compound 316 (200 mg, 86%) as yellow solid. TLC: 30% EtOAc/ hexanes (Rf. 0.4); ⁷H NMR (DMSO-^,400 MHz): δ 8.86 (s, 1H), 5.45 (t, J= 5.5 Hz, 1H), 4.62 (d, 7= 5.5 Hz, 2H), 2.67 (q, 7= 7.5 Hz, 2H), 1.17 (t, 7= 7.5 Hz, 3H).

Synthesis of 5-(chloromethyl)-4-ethylthiazoIe (317): To a stirred solution of compound 316 (200 mg, 1.39 mmol) in CH2CI2 (10 mL) under inert atmosphère were added triethyl amine (0.4 mL, 4.17 mmol), mesyl chloride (0.3 mL, 2.79 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with saturated NaHCO₃ solution (5 mL). The organic extract was dried over sodium sulphate, filtered and concentrated in vacuo to obtain compound 317 (200 mg, crude) as yellow solid. TLC: 30% EtOAc/ hexanes (Rf. 0.7); *H NMR (DMSO-7,5,400 MHz): δ 9.01 (s, 1H), 5.08 (s, 2H), 2.76 (q, 7= 7.5 Hz, 2H), 1.20 (t, 7= 7.5 Hz, 3H).

Synthesis of 5-(azidomethyl)-4-ethyithiazoIe (318): To a stirred solution of compound 317 (400 mg, 2.48 mmol) in DMF (10 mL) under argon atmosphère was added sodium azide (322 mg, 4.96 mmol) at RT; warmed to 80 °C and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with ice-cold water (100 mL) and extracted with EtOAc (2 x 50 mL). The combined organic extracts were dried over sodium sulphate, filtered and concentrated in vacuo to afford crude compound 318 (350 mg) as yellow liquid. The crude was carried forward for next step without further purification. TLC: 20% EtOAc/ hexanes (Rf. 0.5).

Synthesis of (4-ethylthiazoI-5-yl) methanamine hydrochloride (319): To a stirred solution of compound 318 (350 mg) in THF: H₂O (4: 1, 20 mL) was added triphenyl phosphine (1.3 g, 5.20 mmol) at RT and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude.

125

The crude was diluted with CH₂C1₂ (2 mL) cooled to 0 °C; added 4 N HCl 1, 4-dioxane (5 mL) under argon atmosphère and stirred for 1 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude which was titurated with diethyl ether (2x5 mL) dried in vacuo to afford compound 319 (136 mg) as an off-white solid.

TLC: 40% EtOAc/ hexanes (Rf. 0.2); LC-MS: 89.95%; 142.9 (h/T+l); (column; Ascentis Express C18, (50 x 3.0 mm, 2.7 pm); RT 1.29 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min).

Synthesis of (4-isopropylthiazoI-5-yl) methanamine hydrochloride (327)

Synthesis of ethyl 2-chloro-4-methyl-3-oxopentanoate (321): To a stirred solution of ethyl 4methyl-3-oxopentanoate 320 (5 g, 31.64 mmol) in Toluene (50 mL) under argon atmosphère was added sulfuryl chloride (4.26 g, 31.64 mmol) at 0 °C; warmed to RT and stirred for 24 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to afford compound crude 321 (6 g) as brown syrup. TLC: 10% EtOAc/ hexanes (Rf. 0.8).

Synthesis of ethyl 4-isopropyIthiazole-5-carboxylate (323): To a stirred solution of compound 321 (2.1 g) in éthanol (30 mL) under argon atmosphère was added thioformamide 322 (0.667 g, 10.93 mmol) at RT and heated to reflux for 30 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with EtOAc (200 mL), washed with saturated sodium bicarbonate solution (100 mL). The organic extract 126 was dried over sodium sulfate, fîltered and concentrated in vacuo to afford crude compound 323 (230 mg, 11%) as brown syrup. TLC: 10% EtOAc/hexanes (Rf. 0.5); LC-MS: 93.64%; 199.9 (JMT+1); (column; Ascentis Express Cl8, (50 x 3.0 mm, 2.7 pm); RT 2.49 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min).

Synthesis of (4-isopropyIthiazol-5-yl) methanol (324): To a stirred solution of compound 323 (230 mg, 1.15 mmol) in THF (10 mL) under inert atmosphère was added lithium aluminium hydride (87 mg, 2.28 mmol) at 0 °C; warmed to RT and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was cooled to 0 C, quenched with ice-cold water (10 mL), 15% aqueous sodium hydroxide solution (5 mL), fîltered through celite and washed with EtOAc (100 mL). The fîltrate was dried over sodium sulfate, fîltered and concentrated in vacuo to afford crude compound 324 (112 mg) as an off-white solid. TLC: 20% EtOAc/ hexanes (Rf. 0.2). *H NMR (DMSO-4,400 MHz): δ 8.85 (s, 1H), 5.45 (t, J= 5.5 Hz, 1H), 4.64 (d, 5.5 Hz, 2H),

3.14-3.07 (m, 1H), 1.19 (d, J= 6.8 Hz, 6H).

Synthesis of 5-(chloromethyl)-4-isopropylthiazole (325): To a stirred solution of compound 324 (112 mg) in CH2CI2 (10 mL) under inert atmosphère were added triethyl amine (0.21 mL, 2.13 mmol), mesyl chloride (0.08 mL, 0.97 mmol) at 0 C; warmed to RT and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with CH2CI2 (50 mL) washed with NaHCO₃ solution (50 mL), brine (50 mL). The organic extract was dried over sodium sulfate, fîltered and concentrated in vacuo to afford compound 325 (126 mg) as brown thick syrup. TLC: 30% EtOAc/ hexanes (Rf. 0.8); LC-MS: 87.83%; 175.8 (MNl); (column; Ascentis Express C18, (50 x 3.0 mm, 2.7 pm); RT 2.30 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min).

Synthesis of 5-(azidomethyl)-4-isopropylthiazole (326): To a stirred solution of compound 325 (126 mg, 0.53 mmol) in DMF (10 mL) under inert atmosphère was added sodium azide (70 mg, 1.07 mmol) at RT and heated to 80 °C for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with EtOAc (75 mL) washed with water (50 mL). The organic extract were dried over sodium sulfate, fîltered and concentrated in vacuo to afford crude compound 326 (82 mg, 63%) as thick syrup. TLC: 30% EtOAc/ hexanes (Rf. 0.7); *H NMR (DMSO-<Z₆,500 MHz): δ 9.01 (s, 1H), 4.74 (s, 2H), 3.30-3.21 (m, 1H), 1.21 (d, J= 6.8 Hz, 6H);

127

Synthesis of (4-isopropylthiazol-5-yl) naethanamine hydrochloride (327): To a stirred solution of compound 326 (80 mg, 0.43 mmol) in THF: H₂O (4: 1, 10 mL) was added triphenyl phosphine (230 mg, 0.87 mmol) at RT and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The obtained solid was further 5 dried using toluene (2x5 mL) to obtain the crude.

. The crude compound was dissolved in CH2CI2 (3 mL) added 4 N HCl in 1, 4-dioxane (2 mL) under inert atmosphère at 0 C and stirred for 1 h. The volatiles were removed in vacuo to obtain the crude, which was washed with diethyl ether (2 mL) to afford compound 327 (42 mg, 50%) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (R/. 0.2); ‘HNMR (DMSO-A.400 MHz): δ 9.02 (s, 1H), 8.26 (br s, 2H), 4.24 (q, 5.6 Hz, 2H), 3.24-3.17 (m, 1H), 1.19 (d, J= 6.8 Hz, 6H).

Synthesis of (4-chIorothiazoI-5-yI) methanamine hydrochloride (337)

Synthesis of thiazolidine-2, 4-dione (329): To a stirred solution of 2-chloroacetic acid 328 (5 g, 52.9 mmol) in H₂O (10 mL) was added thiourea 314 (3.80 g, 52.9 mmol) at 0 °C stirred for 30 min added concentrated HCl (6 mL) dropwise for 15 min; heated at 110 C and stirred for 24 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was cooled to

128 °C and stirred for 30 min. The precipitated solid was fîltered and dried in vacuo to afford compound 329 (3.2 g, 47%) as white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.2); Ή NMR (400 MHz, DMSO-rf₆): δ 12.01 (br s. 1H), 4.15 (s, 2H).

Synthesis of 2,4-dichlorothiazole-5-carbaldehyde (330): A mixture of compound 329 (2.7 g, 23.07 mmol) in DMF (1.23 mL, 15.98 mmol) at 0 C under argon atmosphère was added phosphorous oxychloride (8.15 mL, 87.17 mmol) dropwise for 15 min at 0 °C; warmed to RT and stirred for 1 h; heated to 120 C and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was poured into ice cold water slowly and extracted with CH2CI2 (3 x 100 mL). The combined organic extracts were washed with saturated NaHCO₃solution (100 mL), water (100 mL), dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through column chromatography using 5% EtOAc/ hexanes to afford compound 330 (1.4 g, 33%) as brown color oil. TLC: 30% EtOAc/ hexanes (Rf. 0.8); ‘H NMR (500 MHz, DMSO-<Z_tf). δ 9.87 (s, 1H).

. Synthesis of 2,4-dichloro-5-(l, 3-dioxoIan-2-yl) thiazole (331): To a stirred solution of compound 330 (1.4 g, 7.73 mmol) in Toluene (20 mL) under argon atmosphère was added ethane-1, 2-diol (1.43 g, 23.20 mmol),/7-toluenesulfonic acid (133 mg, 0.77mmol) at 0 C; heated at 110 °C and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with 10% aqueous NaHCO₃ solution (50 mL) and extracted with EtOAc (2 x 100 mT,). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through column chromatography using 10% EtOAc/ hexanes to afford compound 331 (1.7 g, 98%) as yellow oil. TLC: 10% EtOAc/ hexanes (Rf. 0.2); *H NMR (400 MHz, CDC1₃): δ 6.04 (s, 1H), 4.14-4.07 (m, 2H), 4.06-4.00 (m, 2H).

Synthesis of 4-chloro-5-(l, 3-dioxolan-2-yl) thiazole (332): To a stirred solution of compound 331 (1.7 g, 7.55 mmol) in THF (20 ML) under argon atmosphère was added n-butyl lithium (3.9 mL, 9.82 mmol, 2.5 M solution in THF) dropwise for 10 min at -78 °C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with ice cold water (50 mT,) and extracted with EtOAc (2 x 100 mL). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through column chromatography using 5% EtOAc/ hexanes to afford compound 332 (1.1 g,

129

76%) as yellow oil. TLC: 10% EtOAc/ hexanes (Rf. 0.2); 'il NMR (CDC1₃,500 MHz): δ 8.74 (s, 1H), 6.16 (s, 1H), 4.19-4.15 (m, 2H), 4.08-4.04 (m, 2H).

Synthesis of 4-chlorothiazole-5-carbaldehyde (333): To a stirred solution of compound 332 (1.1 g, 5.75 mmol) in THF (10 mL) was added 5 N aqueous HCl in 1, 4-dioxane (6 mL) at 0 °C; warmed to RT and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was poured into brine (20 mL) extracted with EtOAc (2 x 50 mL). The combined organic extracts were washed with saturated sodium bicarbonate (100 mL) dried over sodium sulfate, filtered and concentrated in vacuo to afford compound 333 (800 mg, 95%) as yellow oil. TLC: 10% EtOAc/ hexanes (Rf. 0.3); *H NMR (CDCI_3j500 MHz): δ 10.11 (s, 1H), 9.00 (s, 1H).

Synthesis of (4-chIorothiazoI-5-yl) methanol (334): To a stirred solution of compound 333 (750 mg, 5.10 mmol) in dry THF (20 mL) under inert atmosphère was added lithium aluminium hydride (193 mg, 5.10 mmol) at 0 C; warmed to RT and stirred for 3 h. The reaction was monitored by o

TLC; after completion of the reaction, the reaction mixture was cooled to 0 C, quenched with 30% aqueous sodium hydroxide solution (3 mL) extracted with EtOAc (2 x 100 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to afford compound 334 (520 mg, 68%) as yellow oil. TLC: 10% EtOAc/ hexanes (Rf. 0.3); 'H NMR (CDCl₃₎500 MHz): δ 8.69 (m, 1H), 4.88 (s, 2H).

Synthesis of (4-chlorothiazol-5-yl) methyl methanesulfonate (335): To a stirred solution of compound 334 (520 mg, 3.48 mmol) in CH2CI2 (15 mL) under inert atmosphère were added triethyl amine (1.23 mL, 8.71 mmol) and mesyl chloride (0.34 mL, 4.18 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (50 mL) and extracted with CH2CI2 (2 x 50 mL). The combined organic extracts were washed with saturated NaHCO₃ (50 mL) dried over sodium sulfate, filtered and concentrated in vacuo to afford compound 335 (600 mg, crude) as brown liquid. TLC: 10% EtOAc/ hexanes (Rf. 0.8'H NMR (CDCl₃,500 MHz): δ 8.74 (s, 1H), 4.79 (s, 2H), 1.44 (s, 3H).

Synthesis of 5-(azidomethyl)-4-chlorothiazoIe (336): To a stirred solution of compound 335 (600 mg, 2.64 mmol) in DMF (10 mL) under inert atmosphère was added sodium azide (343 mg, 5.28 mmol) at RT and heated to 100 °C for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice cold water (100 mL) and extracted with

130 diethyl ether (2 x 50 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to afford compound 336 (250 mg, 54%) as yellow oil. TLC: 8% EtOAc/ hexanes (Rf 0.5); ’HNMR (CDCl₃,400 MHz) δ 8.74 (s, 1H), 4.58 (s, 2H).

Synthesis of (4-chlorothiazoI-5-yl) methanamine hydrochloride (337): To a stirred solution of compound 336 (250 mg, 1.43 mmol) in THF: H₂O (3:1, 13 ML) was added triphenyl phosphine (752 mg, 2.87 mmol) at RT and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo and the residue was acidified with 4 N HCl in 1, 4-dioxane (2 mL) at 0 C. The volatiles were removed in vacuo and the obtained solid was washed with EtOAc (2 mL), diethyl ether (2 mL) to afford compound 337 (110 mg) as yellow solid. TLC: 5% MeOH/ CH₂C1₂ (Rf 0.2); ’lINMR (DMSO-^, 400 MHz): δ 9.19 (s, 1H), 8.52 (br s, 3H), 4.24 (q, J= 5.6 Hz, 2H);

Synthesis of oxetan-3-ylmethanamine (341)

f°-	CH₃N0₂	O₂N ΓΤΟΗ o—¹	MsCI, Et₃N	o₂n	Pd(OH)₂	H₂N
Et₃N	CH₂CI₂	MeOH
338		339		340		341

Synthesis of 3-(nitromethyl) oxetan-3-ol (339): To a stirred solution of oxetan-3-one 338 (500 mg, 0.69 mmol) in nitromethane (1.25 mL) under argon atmosphère was added triethyl amine (0.25 mL) at RT and stirred for 12 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain crude. The crude was purified through silica gel column chromatography using 25% EtOAc/ hexanes to afford compound 339 (750 mg, 81%) as an off white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.3); ^JH NMR (DMSO-<Z₆,400 MHz): δ 6.47 (s, 1H), 4.93 (s, 2H), 4.64 (d, J= 7.5 Hz, 2H), 4.49 (d, J= 7.3 Hz, 2H).

Synthesis of 3-(nitromethylene) oxetane (340): To a stirred solution of compound 339 (750 mg, 5.63 mmol) in CH₂C1₂ (10 mL) under inert atmosphère were added triethyl amine (3.17 mL, 22.55 mmol), mesyl chloride (1.20 mL, 15.50 mmol), at 0 °C; cooled -78 C and stirred for 1 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain crude. The crude was purified through silica gel column chromatography using 25% EtOAc/ hexanes to afford compound 340 (380 mg, 58%) as an off white solid. TLC: 10% EtOAc/

131 hexanes (Rf. 0.5¾ NMR (CDCI₃,400 MHz): δ 6.94-6.92 (m, 1H), 5.68-5.64 (m, 2H), 5.41-5.36 (m, 2H).

Synthesis of oxetan-3-ylmethanamine (341): To a stirred solution of compound 340 (500 mg, 4.34 mmol) in MeOH (10 mL) under inert atmosphère was added Pd(OH)₂ (100 mg) at RT; heated at 45 °C stirred under hydrogen atmosphère (balloon pressure) for 5 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite and washed with MeOH (20 mL). The filtrate was evaporated in vacuo to obtain the crude which was triturated with diethyl ether (2 x 10 mL) to afford crude compound 341 (100 mg) as pale brown solid. TLC: 10% MeOH / CH₂C1₂ (Rf. 0.2); Mass (m/z) (Agilent 6310 Ion Trap): 88.5 (M⁺+l).

Synthesis of 2, 2,2-trifluoro-l-((2-(oxazol-5-yl) ethyl)-k⁴-azanyl) ethan-l-one (347)

Synthesis of oxazol-5-ylmethanol (343): To a stirred solution of ethyl oxazole-5-carboxylate 342 (2 g, 14.18 mmol) in EtOH (20 mL) under argon atmosphère was added sodium borohydride (1.07 g, 28.36 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with saturated ammonium chloride solution (25 mL) and extracted with 5% MeOH/ CH2CI2 (2 x 20 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 5% MeOH/ CH2CI2 to afford compound 343 (810 mg, 58%) as colorless syrup. TLC: 5% MeOH/ CH2CI2 (Rf. 0.3); ¹HNMR (DMSO-î/₆, 500 MHz): δ 8.28 (s, 1H), 7.04 (s, 1H), 5.36 (t, 7= 6.0 Hz, 1H), 4.47 (d, 7= 6.0 Hz, 2H).

Synthesis of 5-(chIoromethyl) oxazole (344): To a stirred solution of compound 343 (800 mg, 8.08 mmol) in CH₂C1₂: w-hexane (1: 1, 10 mL) under argon atmosphère was added thionyl chloride (1.2

132 mL, 16.16 mmol) at 0 C; heated to reflux and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was neutralized with saturated NaHCO₃solution (20 mL) and extracted with ether (2 x 20 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude compound 344 (700 mg) as colorless syrup. TLC: 40% EtOAc/ hexanes (Rf. 0.5); ^JH-NMR (CDC1₃, 400 MHz): δ 7.89 (s, 1H), 7.10 (s, 1H), 4.62 (s, 2H).

Synthesis of 2-(oxazol-5-yl) acetonitrile (345): To a stirred solution of compound 344 (700 mg, 5.95 mmol) in DMF (8 mL) under argon atmosphère was added sodium cyanide (1.02 g, 20.85 o

mmol) at RT; heated to 70 C and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted with ether (2 x 20 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude compound 345 (650 mg) as colorless syrup. TLC: 40% EtOAc/hexanes (Rf. 0.3); ¹H-NMR (CDC1₃, 400 MHz): δ 7.89 (s, 1H), 7.10 (s, 1H), 3.84 (s, 2H).

Synthesis of tert-butyl (2-(oxazol-5-yl) ethyl) carbamate (346): To a stirred solution of compound 345 (50 mg, 0.46 mmol) in MeOH (3 mL) under argon atmosphère were added Boc-anhydride (0.21 mL, 0.92 mmol), nickel chloride hexahydrate (11 mg, 0.04 mmol), sodium borohydride (122 mg, 3.24 mmol) portion wise for 5 min at 0 C; warmed to RT and stirred for 6 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with MeOH (10 mL), filtered through celite and the fïltrate was concentrated in vacuo to obtain the crude. The crude was purifïed through silica gel column chromatography using 30% EtOAc/ hexanes to afford compound 346 (68 mg, 71%) as colorless syrup. TLC: 50% EtOAc/ hexanes (Rf. 0.5); ’H-NMR (CDCI₃, 400 MHz): δ 7.82 (s, 1H), 6.85 (s, 1H), 4.64 (br s, 1H), 3.42-3.40 (m, 2H), 2.89 (t, J= 6.4 Hz, 2H), 1.43 (s, 9H).

Synthesis of 2, 2,2-trifluoro-l-((2-(oxazol-5-yl) ethyl)-/?-azanyl) ethan-l-one (347): To a stirred solution of compound 346 (65 mg, 0.30 mmol) in CH2CI2 (3 mL) under argon atmosphère was added trifluoro acetic acid (0.14 mL, 1.83 mmol) at 0 °C; warmed to RT and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude compound 347 (50 mg) as colorless syrup. TLC: 60% EtOAc/ hexanes (Rf. 0.2); *H-NMR (DMSO-^, 500 MHz): δ 8.30 (s, 1H), 7.85-7.79 (m, 2H), 7.02 (s, 1H), 3.103.05 (m, 2H), 2.98 (t, J= 7.5 Hz, 2H).

133

Synthesis of 2, 2, 2-trifluoro-l-((2-(thiazol-5-yl) ethyl)-k⁴-azanyl) ethan-l-one (352)

Synthesis of 5-(chloromethyl) thiazole (349): To a stirred solution of thiazol-5-ylmethanol 348 (1 g, 8.69 mmol) in CH2CI2 (50 mL) under argon atmosphère were added mesyl chloride (1.09 g, 9.56 mmol) drop wise for 15 min, diisopropyl ethyl amine (1.23 g, 9.56 mmol) at 0-5 C; warmed to RT and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was washed with saturated NaHCCL solution (20 mL) and purified through silica gel column chromatography using 50% EtOAc/ hexanes to afford compound 349 (650 mg, 57%) as yellow liquid. TLC: 5% MeOH/ CH2CI2 (Rf. 0.7); ’H-NMR (CDCI3, 500 MHz): δ 8.84 (s, 1H), 7.86 (s, 1H), 4.84 (s, 2H).

Synthesis of 2-(thiazol-5-yl) acetonitrile (350): To a stirred solution of compound 349 (650 mg, 4.92 mmol) in EtOH: H2O (4: 1, 10 mL) under argon atmosphère was added sodium cyanide (361 mg, 7.38 mmol) at RT; heated to 80 °C and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (20 mL) and extracted with EtOAc (2 x 25 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 70% EtOAc/ hexanes to afford compound 350 (250 mg, 41%) as colorless semi-solid. TLC: 70% EtOAc/ hexanes (Rf 0.4); ^!H-NMR (CDCI3, 500 MHz): δ 8.81 (s, 1H), 7.85 (s, 1H), 3.84 (s, 2H).

Synthesis of tert-buty! (2-(thiazol-5-yI) ethyl) carbamate (351): To a stirred solution of compound 350 (50 mg, 0.40 mmol) in MeOH (3 mL) under argon atmosphère were added Boc-anhydride (175 mg, 0.80 mmol), nickel chloride hexahydrate (9.75 mg, 0.04 mmol), sodium borohydride (107 mg, 2.82 mmol) portion wise for 5 min at 0-5 °C; warmed to RT and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered, washed with 134

EtOAc (2x10 mL) and the filtrate was concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 50% EtOAc/ hexanes to afford compound 351 (20 mg, 22%) as brown solid. TLC: 70% EtOAc/ hexanes (Rf. 0.6); *H-NMR (DMSO-d₆, 400 MHz): δ 8.92 (s, 1H), 7.65 (s, 1H), 6.98-6.96 (m, 1H), 3.15 (q, 2H), 2.95 (t, J= 6.8 Hz, 2H), 1.39 (s, 9H).

Synthesis of 2-(thiazol-5-yl) ethan-l-amine (352): To a stirred solution of compound 351 (20 mg, 0.08 mmol) in CH2CI2 (3 mL) under argon atmosphère was added trifluoro acetic acid (60 mg, 0.53 mmol) at 0-5 °C; warmed to RT and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude compound 352 (10 mg) as colorless liquid. The crude was carried to the next step without any further purification. TLC: 70% EtOAc/ hexanes (Rf. 0.2); *H-NMR (DMSO-4_fi, 400 MHz): δ 9.01 (s, 1H), 7.95-7.89 (m, 2H), 7.76 (s, 1H), 3.16-3.10 (m, 4H).

Synthesis of 2-(4-(pyrimidin-5-yl) phenyl) ethan-l-amine (359)

Synthesis of 5-(4-bromophenyl) pyrimidine (355): To a stirred solution of 5-bromopyrimidine 353 (1 g, 6.32 mmol) in DMF: H2O (4: 1, 25 mL) were added sodium carbonate (1 g, 9.43 mmol) and (4bromophenyl) boronic acid 354 (1.26 g, 6.32 mmol), purged under argon atmosphère for 30 min. To this was added Pd(PPh₃)4 (731 mg, 0.63 mmol) at RT; heated to 80 °C and stirred for 2.5 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mass was filtered through celite; the filtrate was diluted with water (100 mL) and extracted with EtOAc (3x15 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to

135 obtain the crude. The crude was purified through silica gel column chromatography using 15% EtOAc/ hexanes to afford compound 355 (1 g, 67%) as white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.3); *H-NMR (DMSO-rf_à, 500 MHz): δ 9.20 (s, 1H), 9.15 (s, 2H), 7.93 (d, J= 8.5 Hz, 2H), 7.74 (d, J =9.0 Hz, 2H).

Synthesis of (£)-3-(4-(pyrimidin-5-yl) phenyl) acrylamide (357): To a stirred solution of 5-(4bromophenyl) pyrimidine 355 (1 g, 4.27 mmol) in DMF (10 mL) under inert atmosphère was added acrylamide 356 (364 mg, 5.12 mmol) at RT and purged under argon for 10 min. To this were added o-tolyl phosphine (142 mg, 0.47 mmol), Pd(OAc)₂ (4.78 mg, 0.021 mmol), and diisopropyl ethyl amine (0.9 mL, 7.32 mmol) at RT; heated to 130 C and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite washed with 50% MeOH/ CH₂C1₂ (2x10 mL), the fîltrate was concentrated under reduced pressure to afford the crude. The crude was washed with 50% MeOH/ CH₂C1₂ (2x15 mL), dried in vacuo to afford compound 357 (600 mg, 62%) as white solid. TLC: 40% EtOAc/ hexanes (Rf. 0.2); ^]H NMR (400MHz, DMSO-dg) δ 9.23-9.16 (m, 3H), 7.88 (d, J= 8.3 Hz, 2H), 7.72 (d, J= 8.3 Hz, 2H), 7.56 (br s, 1H), 7.48 (d, J= 15.9 Hz, 1H), 7.14 (br s, 1H), 6.70 (d, J= 15.9 Hz, 1H).

Synthesis of 3-(4-(pyrimidin-5-yI) phenyl) propanamide (358): To a stirred solution of compound 357(150 mg, 0.64 mmol) in EtOH (4 mL) under inert atmosphère were added 10% Pd/ C (50 mg) and triethylamine (0.092 mL, 0.64 mmol) at RT and stirred under H₂ (balloon pressure) for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite. The fîltrate was concentrated in vacuo to obtain the crude which was purified by silicagel column. chromatography using 3% MeOH/ CH₂Cl₂to afford compound 358 (65 mg, 43%) as white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.2); ^-NMR (DMSO-rf₆, 400 MHz): δ 9.16 (s, 1H), 9.12 (s, 2H), 7.72 (d, J= 8.0 Hz, 2H), 7.37 (d, J= 8.0 Hz, 2H), 7.29 ( br s, 1H), 6.76 (br s, 1H), 2.87 (t, J= 8.0 Hz, 2H), 2.39 (t, J= 8.0 Hz, 2H).

Synthesis of 2-(4-(pyrimidin-5-yI) phenyl) ethan-l-amine (359): To a stirred solution of compound 358 (65 mg, 0.28 mmol) in THF: H₂O (1:1,3 mL) were added NaOH (128 mg, 0.91 mmol), phenyl-X³-iodanediyl diacetate (92 mg, 0.28 mmol) at 0 C and stirred for 1 h. The reaction was monitored by TLC; after completion of the reaction, the pH of the reaction mixture was adjusted to ~ 2 using 3 N HCl and extracted with CH₂C1₂ (2 x 50 mL). The pH of the aqueous layer was basified to ~ 8 with 3 N NaOH, extracted with THF (2 x 100 mL). The combined organic

136 extracts were dried over sodium sulphate, fîltered and concentrated in vacuo to afford crude compound 359 (40 mg) as white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.3); ^XH-NMR (DMSO-t/₆, 400 MHz): δ 9.16 (s, 1H), 9.11 (s, 2H), 7.72 (d, J= 8.4 Hz, 2H), 7.37 (d, J= 8.0 Hz, 2H), 2.81-2.66 (m, 2H), 1.78-1.69 (m, 2H).

Synthesis of 2-(2-phenylpyrimidin-5-yI) ethan-l-amine hydrochloride (366)

Synthesis of 5-bromo-2-iodopyrimidine (361): To a stirred solution of 5-bromo-2-chloropyrimidine 360 (1 g, 5.16 mmol) in CH₂C1₂ (10 mL) was added hydrogen iodide (5 mL, 57% aqueous solution) at -10 °C; warmed to 0 °C and stirred for 5 h. The reaction was monitored by TLC; after completion 10 of the reaction, the reaction mixture was quenched with solid K₂CO3 (2 g), diluted with water (100 mL) and extracted with CH₂C1₂ (2 x 100 mL). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to obtain crude compound 361 (1.4 g, 94%) as yellow solid. TLC: 10% EtOAc/ hexanes (Rf. 0.7); ’H-NMR (DMSO-îZ₆, 400 MHz): δ 8.55 (s, 2H).

Synthesis of 5-bromo-2-phenylpyrimidine (363): To a stirred solution of compound 361 (1.4 g) in 15 DMF: H₂O (4:1, 20 mL) were added sodium carbonate (783 mg, 7.39 mmol) and phenylboronic acid 362 (451 mg, 3.69 mmol), purged under argon for 30 min. To this was added Pd(PPh3)4 (570 mg, 0.49 mmol) at RT; heated to 80 °C and stirred for 2 h. The reaction was monitored by TLC;

after completion of the reaction, the reaction mass was fîltered through celite; the filtrate was diluted

137 with water (100 mL) and extracted with EtOAc (2 x 100 mL). The combined organic extracts were dried over sodium sulfate, filtered, concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 2% EtOAc/ hexanes to afford compound 363 (400 mg, 35%) as white solid. TLC: 10% EtOAc/ hexanes (Rf. 0.9); ’H-NMR (DMSO-J_tf, 400 MHz): δ 8.83 (s, 2H), 8.41-8.39 (m, 2H), 7.50-7.48 (m, 3H).

Synthesis of (£j-3-(2-phenylpyrimidin-5-yl) acrylamide (364): To a stirred solution of compound

363 (300 mg, 1.28 mmol) in DMF (20 mL) under inert atmosphère was added acrylamide 356 (109 mg, 1.53 mmol) at RT and purged under argon for 10 min. To this were added o-tolyl phosphine (42 mg, 0.07 mmol), palladium acetate (15.7 mg, 0.07 mmol), and diisopropyl ethyl amine (0.28 mL,

1.53 mmol) at RT; heated to 140 C and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted water (100 mL) and extracted with 10% MeOH/ CH2CI2 (2 x 50 mL). The combined organic extracts were dried over sodium sulphate, filtered and concentrated in vacuo to obtain the crude. The crude compound was triturated with 50% EtOAc/ hexanes (10 mL) and dried in vacuo to afford compound 364 (50 mg, 17%) as an off-white solid. TLC: 70% EtOAc/hexanes (Rf. 0.2); ^XH-NMR (DMSO-J₆, 400 MHz): δ 9.10 (s, 2H), 8.438.41 (m, 2H), 7.64 (br s, 1H), 7.55-7.54 (m, 3H), 7.47 (d, 7= 16.0 Hz, 1H), 7.22 (br s, 1H), 6.85 (d, 7= 16.0 Hz,1H).

Synthesis of 3-(2-phenylpyrimidin-5-yl) propanamide (365): To a stirred solution of compound

364 (50 mg, 0.22 mmol) in EtOH (2 mL) under inert atmosphère were added triethyl amine (0.032 mL, 0.22 mmol), 10% Pd/ C (17 mg, dry) at RT and stirred under hydrogen atmosphère (balloon pressure) for 4 h. The reaction was monitored by LC-MS; after completion of the reaction, the reaction mixture was filtered through celite and the filtrate was concentrated in vacuo to obtain the crude which was triturated with 10% EtOAc/ n-pentane (2x5 mL) and dried in vacuo to afford compound 365 (30 mg, 60%) as an off-white solid. TLC: 5% MeOH/ CH2CI2 (Rf. 0.5); ’H-NMR (DMSO-7₆, 400 MHz): δ 8.76 (s, 2H), 8.37-8.35 (m, 2H), 7.52-7.50 (m, 3H), 7.31 (br s, 1H), 6.80 (br s, 1H), 2.85 (t, 7= 7.2 Hz, 2H), 2.46 (t, 7= 7.2 Hz, 2H).

Synthesis of tert-butyl (2-(2-phenylpyrimidin-5-yl) ethyl) carbamate (366): To a stirred solution of compound 365 (15 mg, 0.06 mmol) in THF (2 mL) were added sodium hydroxide (8 mg, 0.2 mmol) in water (0.5 mL), phenyl-X³-iodanediyl diacetate (21 mg, 0.06 mmol) at 0 C and stirred for 30 min. The reaction was monitored by TLC; after completion of the reaction, the volatiles were

138 removed in vacuo. The residue was diluted with water (25 mL) and extracted with EtOAc (2 x 25 mL). The combined organic extracts were dried over sodium sulfate, fïltered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 20% EtOAc/ hexanes to afford compound 366 (10 mg, 51%) as sticky solid. TLC: 50% EtOAc/ hexanes (Rf. 0.9); *H-NMR (CDC1₃, 400 MHz): δ 8.65 (s, 2H), 8.42-8.40 (m, 2H), 7.49-7.47 (m, 3H), 4.62 (br s, 1H), 3.43-3.38 (m, 2H), 2.84 (t, J= 7.2 Hz, 2H), 1.43 (s, 9H).

Synthesis of 2-(2-phenylpyrimidin-5-yl) ethan-l-amine hydrochloride (367): To a stirred solution of compound 366 (80 mg, 0.35 mmol) in CH2CI2 (3 ML) was added 4N HCl in 1, 4Dioxane (0.7 mL) under argon atmosphère at 0 C; warmed to RT and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude and was washed with 20% CH2CI2/ n-pentane (2x5 mL) and dried in vacuo to afford compound 367 (50 mg, HCl sait) as white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.1); ^XHNMR (DMSO-^, 400 MHz): δ 8.84 (s, 2H), 8.40-8.37 (m, 2H), 8.07 (br s, 2H), 7.54-7.52 (m, 3H), 3.19-3.14 (m, 2H), 2.97 (t, J= 7.2 Hz, 2H).

Synthesis of (4-(pyrimidin-5-yl) phenyl) methanamine (372)

Synthesis of (4-(pyrimidin-5-yl) phenyl) methanol (369): To a stirred solution of 4-(pyrimidin-5yl) benzaldehyde 368 (500 mg, 2.71 mmol) in MeOH (20 mL) under argon atmosphère and sodium borohydride (155 mg, 39.99 mmol) at 0 °C; warmed to RT and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, volatiles were removed in vacuo. The residue

139 was diluted with brine solution (100 mL), extracted with EtOAc (2 x 50 mL). The combined organic extracts were dried over sodium sulphate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 5% MeOH/ CH2CI2 to afford compound 369 (260 mg, 51%) as white solid. TLC: 20% EtOAc/ hexanes (Rf. 0.4); 'H-NMR (CDCI3, 500 MHz): δ 9.20 (s, 1H), 8.93 (s, 2H), 7.58 (d, J= 8.5 Hz, 2H), 7.53 (d, 7= 8.0 Hz, 2H), 4.79 (s, 2H).

Synthesis of 4-(pyrimidin-5-yl) benzyl methanesulfonate (370): To a stirred solution of compound 369 (260 mg, 1.39 mmol) in CH2CI2 (10 mL) under argon atmosphère were added

O triethyl amine (0.3 mL, 2.09 mmol), methane sulfonyl chloride (0.16 mL, 2.09 mmol) at 0 C; warmed to RT and stirred for 14 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL), washed with 10% NaHCC>3 solution (30 mL), dried over sodium sulfate, filtered and concentrated in vacuo to obtain crude compound

370 (300 mg) as thick syrup. The crude was carried to the next step without further purification. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.4).

Synthesis of 5-(4-(azidomethyl) phenyl) pyrimidine (371): To a stirred solution of compound 370 (300 mg, crude) in DMF (6 mL) under argon atmosphère was added sodium azide (74 mg, 1.13 mmol) at RT; heated to 60 °C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice water (20 mL) and extracted with EtOAc (2 x 50 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain crude. The crude was purified through silica gel column chromatography using 20% EtOAc/ hexanes to afford compound 371 (45 mg) as colorless thick syrup. TLC: 30% EtOAc/ hexanes (Rf. 0.6); \H-NMR (CDCI3, 400 MHz): δ 9.22 (s, 1H), 8.96 (s, 2H), 7.61 (d, 7= 8.4 Hz, 2H), 7.48 (d, 7= 8.0 Hz, 2H), 4.43 (s, 2H).

Synthesis of (4-(pyrimidin-5-yl) phenyl) methanamine (372): To a stirred solution of compound

371 (40 mg, 0.18 mmol) in THF: H2O (9:1, 2 mL) was added triphenyl phosphine (74 mg, 0.28 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 10% MeOH/ CH2CI2 to afford compound 372 (23 mg, 66%) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.2); *H-NMR (DMSO-7_Ô, 400 MHz): δ

140

9.21 (s, 1H), 9.17 (s, 2H), 8.27 (br s, 2H), 7.87 (d, J= 8.0 Hz, 2H), 7.64 (d, J= 8.4 Hz, 2H), 4.07 (s, 2H).

Synthesis of (2-phenylpyrimidin-5-yl) methanamine (377)

Synthesis of (2-phenylpyrimidin-5-yl) methanol (374): To a stirred solution of 2phenylpyrimidine-5-carbaldehyde 373 (200 mg, 1.08 mmol) in MeOH (20 mL) under argon atmosphère was added sodium borohydride (74 mg, 2.17 mmol) at 0 C; warmed to RT and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice cold water (50 mL), extracted with EtOAc (2 x 50 mL). The combined organic extracts were dried over sodium sulphate, fiitered and concentrated in vacuo to obtain the crude. The crude was purifïed through silica gel column chromatography using 5% MeOH/ CH2CI2 to afford compound 374 (135 mg, 65%) as colorless solid. TLC: 40% EtOAc/ MeOH (Rf. 0.3); ‘ïï-NMR (DMSO-îZ₆, 500 MHz): δ 8.83 (s, 2H), 8.40-8.38 (m, 2H), 7.53-7.51 (m, 3H), 5.45 (t, J= 5.5 Hz, 1H), 4.58 (d, J= 5.5 Hz, 2H).

Synthesis of (2-phenylpyrimidin-5-yl) methyl methanesulfonate (375): To a stirred solution of compound 374 (130 mg, 0.69 mmol) in CH₂C1₂ (5 mL) under argon atmosphère were added triethyl amine (0.4 mL, 2.09 mmol) and methane sulfonyl chloride (0.07 mL, 0.84 mmol) at 0 C; warmed to RT and stirred for 30 min. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted CH2CI2 (50 mL), washed with water (2 x 20 mL). The organic extract was dried over sodium sulfate, fiitered and concentrated in vacuo to obtain crude compound 375 (150 mg) as yellow oil. The crude was carried to the next step without further purification. TLC: 50% EtOAc/ hexanes (Rf. 0.5); 'Η-NMR (DMSO-^, 500 MHz): 9.00 (t, J= 10.0 Hz, 2H), 8.42-8.41 (m, 2H), 7.56-7.55 (m, 3H), 5.40 (s, 2H), 3.32 (s, 3H).

141

Synthesis of 5-(azidomethyl)-2-phenylpyrimidine (376): To a stirred solution of compound 375 (150 mg) in DMF (6 mL) under argon atmosphère was added sodium azide (56 mg, 0.76 mmol) at RT; heated to 60 C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice water (20 mL) and extracted with diethyl ether (2 x 50 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain crude. The crude was purified through silica gel column chromatography using 20% EtOAc/ hexanes to afford compound 376 (60 mg, 49%) as colorless syrup. TLC: 40% EtOAc/ hexanes (Rf. 0.9); ’HNMR (DMSO-4, 400 MHz): δ 8.94 (s, 2H), 8.41 (dd, J= 6.8, 3.0 Hz, 2H), 7.56-7.53 (m, 3H), 4.63 (s, 2H).

Synthesis of (2-phenylpyrimidin-5-yl) methanamine (377): To a stirred solution of compound 376 (90 mg, 0.42 mmol) in THF: H2O (9:1, 4 mL) was added triphenyl phosphine (167 mg, 0.63 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 10% MeOH/ CH2CI2 to afford compound 377 (30 mg, 38%) as yellow solid. TLC: 10% MeOH/ CH₂C1₂ (Rf 0.2); ^JH NMR (DMSO-7_d, 500 MHz): δ 8.96 (s, 2H), 8.40 (d, J= 3.9 Hz, 2H), 7.59-7.45 (m, 3H), 6.84 (br s, 2H), 4.01 (s, 2H).

Synthesis of thiazol-5-amine hydrochloride (380)

378 f-BuOH

379

N·

380

Synthesis of ieri-butyl thiazol-5-yIcarbamate (379): To a stirred solution of thiazole-5-carboxylic acid 378 (400 mg, 3.1 mmol) in t-butanol (6 mL) were added diphenylphosphonic azide (1.34 mL, 6.18 mmol) and triethyl amine (0.89 mL, 6.18 mmol) at RT and heated to 100 C for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 30% EtOAc/ hexanes to afford compound 379 (300 mg, 48%) as white solid. TLC: 50% EtOAc/ hexanes (Rf. 0.8); ’H-NMR (DMSO-7₆, 400 MHz): δ 10.60 (br s, 1H), 8.51 (s, 1H), 8.40 (s, 1H), 1.49 (s, 9H).

142

Synthesis of thiazol-5-amine hydrochloride (380): To a stirred solution of compound 379 (300 mg, 1.5 mmol) in MeOH (5 mL) was added 4 N HCl in 1, 4-Dioxane (5 mL) under argon o

atmosphère at 0 C; warmed to RT and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was washed with n-pentane (2x5 mL) and dried in vacuo to afford compound 380 (150 mg, HCl sait) as pale yellow solid. TLC: 50% EtOAc/ hexanes (Rf. 0.1); *H-NMR (DMSO-rf₆, 500 MHz): δ 9.10 (s, 1H), 7.22 (s, 1H).

Synthesis of 3-(pyrimidin-5-yI) aniline (383)

Synthesis of 5-(3-nitrophenyl) pyrimidine (382): To a stirred solution of 5-bromopyrimidine 353 (2 g, 12.58 mmol) and (3-nitrophenyl) boronic acid 381 (2.3 g, 13.84 mmol) in 1, 2-dimethoxy ethane: H₂O (4:1, 20 mL) under inert atmosphère were added sodium carbonate (2.66 g, 25.17 mmol) at RT and purged under argon atmosphère for 20 min. To this was added Pd(PPh3)4 (726 mg, 0.62 mmol) and heated to 110 °C for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (50 mL) and extracted with EtOAc (2 x 50 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The obtained solid was filtered, dried in vacuo to obtain the crude which was purified through silicagel column chromatography in 50% EtOAc/ hexanes to afford compound 382 (2.5 g, 68%) as an off-white solid. TLC: 60% EtOAc/ hexanes (Rf. 0.3); ^XH NMR (DMSO-i/g, 400 MHz): δ 9.27 (s, 3H), 8.66-8.63 (m, 1H), 8.37-8.25 (m, 2H), 7.84 (t, J= 8.0 Hz, 1H).

Synthesis of 3-(pyrimidin-5-yl) aniline (383): To a stirred solution of compound 382 (1.7 g, 8.45 mmol) in EtOH (30 mL) under inert atmosphère was added 10% Pd/C (500 mg) under argon

143 atmosphère and stirred under H₂ atmosphère (balloon pressure) for 5 h. After completion of the reaction, the reaction mixture was filtered through celite, washed with 5% MeOH/ CH₂C1₂ (50 mL). The filtrate was concentrated in vacuo to obtain the crude which was triturated with mixture of ether: pentane (1:1, 10 ML) and dried in vacuo to afford compound 383 (1.2 g, 86%) as an off-white solid. TLC: 70% % EtOAc/hexanes (Rf. 0.2); *H NMR (DMSO-<4, 400 MHz): δ 9.15 (s, 1H), 9.00 (s, 2H), 7.17 (t, J= 7.8 Hz, 1H), 6.91 - 6.86 (m, 2H), 6.69-6.64 (m, 1H), 5.27 (s, 3H).

Synthesis of 3-(pyrimidin-4-yl) aniline (386)

Synthesis of 2, 4-dichIoro-6-(3-nitrophenyl) pyrimidine (385): To a stirred solution of 2, 4, 6trichloropyrimidine 384 (500 mg, 2.76 mmol) and (3-nitrophenyl) boronic acid 382 (594 mg, 2.76 mmol) in 1, 2-dimethoxy ethane (10 mL) under inert atmosphère were added sodium carbonate (878 mg, 8.28 mmol) at RT and purged under argon atmosphère for 20 min. To this was added Pd(PPh₃)4 (159 mg, 0.13 mmol) and heated to 80 C for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite and the filtrate was concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 10% EtOAc/ hexanes to afford crude compound 385 (200 mg) as yellow solid which was carried forward for next step. TLC: 10% EtOAc/ hexanes (Rf. 0.7).

Synthesis of 3-(pyrimidin-4-yl) aniline (386): To a stirred solution of compound 385 (200 mg, crude) in EtOAc (50 mL) under inert atmosphère were added sodium acetate (304 mg, 3.71 mmol), 10% Pd/C (100 mg, wet) under argon atmosphère and stirred under H₂ atmosphère (balloon pressure) for 6 h. After completion of the reaction, the reaction mixture was filtered through celite, washed with 50% MeOH/ CH₂C1₂ (50 mL). The filtrate was concentrated in vacuo to obtain the

144 crude which was purified through silicagel column chromatography in 90% EtOAc/ hexanes to afford compound 386 (100 mg, 78%) as an off-white solid. TLC: 70% % EtOAc/ hexanes (A/ 0.4);

^JH NMR (400 MHz, DMSO-ife): δ 9.19 (s, 1H), 8.80 (d, J= 5.4 Hz, 1H), 7.91 (dd, J= 5.4, 1.4 Hz, 1H), 7.45-7.43 (m, 1H), 7.30 (d, J= 7.7 Hz, 1H), 7.18 (t, J= 7.8 Hz, 1H), 6.74 (d, J= 7.5 Hz, 1H), 5.31 (s, 2H).

Synthesis of 3-(thiazol-5-yl) aniline (389)

To a stirred solution of 5-bromothiazole 387 (350 mg, 2.13 mmol) in 2-methyl THF (5 mL) under inert atmosphère were added 3-aminophenylboronic acid pinacol ester 388 (600 mg, 2.35 mmol), sodium carbonate (565 mg, 5.33 mmol), at RT and stirred under argon atmosphère for 20 min. To this was added Pd(dppf)2C12 (78 mg, 0.106 mmol) and heated to 110 C and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was fîltered through celite and the filtrate was concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 80% EtOAc/ hexanes to afford compound 389 (200 mg, 52%) as yellow syrup. TLC: 70% EtOAc/ hexanes (Rf. 0.4); LC-MS: 84.49%; 176.8 (MT+1); (column; Ascentis Express Cl8, (50 x 3.0 mm, 2.7 pm); RT 1.40 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min).

Synthesis of 3’-amino-[l, l’-biphenyl]-4-ol (392)

To a stirred solution of 3-bromoaniline 390 (400 mg, 2.32 mmol) and (4-hydroxyphenyl) boronic acid 391 (353 mg, 2.55 mmol) in MeOH (4 mL) under inert atmosphère were added sodium carbonate (493 mg, 4.65 mmol) at RT and purged under argon atmosphère for 20 min. To this was

145 added Pd(OAc)2 (156 mg, 0.23 mmol) and heated to 80 C for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was fîltered through celite, washed with MeOH (20 mL). The filtrate was concentrated in vacuo to obtain the crude. The crude was purifïed through silica gel column chromatography in 20% EtOAc/ hexanes to afford compound 392 (160 mg) as brick red solid. TLC: 30% EtOAc/ hexanes (Rf. 0.4); LC-MS: 67.89%; 185.9 (M⁺+l); (column; Ascentis Express C18, (50 x 3.0 mm, 2.7 pm); RT 2.10 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min).

Synthesis of 5-phenyloxazoI-2-amine (396)

Synthesis of 2-bromo-2-phenylacetaldehyde (394): To a stirred solution of 2-phenylacetaldehyde 393 (500 mg, 4.16 mmol) in 1, 4-Dioxane (2 mL) under inert atmosphère was added bromine (0.27 mL, 4.99 mmol) at 0 C and stirred for 20 min; warmed to RT and stirred for 1 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to afford crude compound 394 (800 mg) as green syrup. The crude was carried forward for next step without further purification. TLC: 10% EtOAc/ hexanes (Rf. 0.7);

Synthesis of 5-phenyloxazol-2-amine (396): To a stirred solution of compound 394 (800 mg, crude) in EtOH (10 mL) under inert atmosphère was added urea 395 (482 mg, 8.04 mmol) at RT; heated at 80 °C and stirred for 6 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo and the residue was diluted with water (60 mL). The pH was neutralized with 10% aqueous NaHCO₃ solution (10 mL) and extracted with EtOAc (2 x 100 mT,). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through flash column chromatography using 23% MeOH/ CH2CI2 to afford compound 396 (200 mg, 32%) as an off-white solid. TLC: 5% MeOH/ CH2CI2 (Rf. 0.5); ¹H NMR (400 MHz, DMSO-J_d): δ 7.45 (d, J= 7.2 Hz, 2H), 7.36 (t, J= 7.8 Hz, 2H), 7.21-7.16 (m, 2H), 6.81 (s, 2H);

146

Synthesis of 5-phenylthiazol-2-amine (397)

Synthesis of 5-phenylthiazoi-2-amine (397): To a stirred solution of 2-bromo-2phenylacetaldehyde 394 (860 mg, crude) in EtOH (20 mL) under inert atmosphère was added thiourea (658 mg, 8.64 mmol) at RT; heated at 80 °C and stirred for 8 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The pH of the residue was neutralized with 10% aqueous NaHCO₃ solution (10 mL) and extracted with EtOAc (2 x 200 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purifîed through flash column chromatography using 2-3% MeOH/ CH2CI2 to afford compound 397 (500 mg, 66%) as an offwhite solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.6); ^JH NMR (400 MHz, DMSO-d₆): δ 7.43-7.38 (m, 3H), 7.32 (t, J= 7.8 Hz, 2H), 7.17 (tt, J= 7.5, 0.9 Hz, 1H), 7.12 (s, 2H).

Synthesis of l-methoxy-3-(pyrimidin-5-yl) propan-2-amine hydrochloride (401)

Synthesis of teri-butyl (l-hydroxy-3-(pyrimidin-5-yl) propan-2-yl) carbamate (399): To a stirred solution of methyl 2-((tert-butoxycarbonyl) amino)-3-(pyrimidin-5-yl) propanoate 398 (200 mg, 0.71 mmol) in MeOH (5 mL) under inert atmosphère was added sodium borohydride (105 mg, 2.84 mmol) at 0 °C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (25 mL) and extracted with 10% MeOH/ CH₂C1₂ (5 x 25 mL). The combined organic extracts were dried over sodium sulfate,

147 filtered and concentrated in vacuo to obtain the crude. The crude was purifîed through silica gel column chromatography using 8% MeOH/ CH₂C1₂ to afford compound 399 (110 mg, 61%) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.4); *H NMR (DMSO-7₆,400 MHz): δ 8.99 (s, 1H), 8.61 (s, 2H), 6.70 (d, 7 = 9.0 Hz, 1H), 4.82 (t, 7= 5.4 Hz, 1H), 3.61 (br s, 2H), 3.45-3.34 (m, 2H), 2.93-2.82 (m, 1H), 1.26 (s, 9H)

Synthesis of tert-butyl (l-methoxy-3-(pyrimidin-5-yI) propan-2-yl) carbamate (400): To a stirred solution of compound 399 (100 mg, 0.39 mmol) in THF (10 mL) were added triethyl benzyl ammonium chloride (9 mg, 0.03 mmol), 50% aqueous sodium hydroxide solution (3.5 mL) and methyl iodide (0.02 mL, 0.39 mmol) at 0 °C; warmed to RT and stirred for 24 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (25 mL) and extracted with EtOAc (3 x 25 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purifîed through silica gel column chromatography using 3% MeOH/ CH2CI2 to afford compound 400 (70 mg, 67%) as colorless syrup. TLC: 5% MeOH/ CH₂C1₂ (Rf 0.5); ^]H NMR (DMSO-7₆,400 MHz): δ 9.00 (s, 1H), 8.62 (s, 2H), 6.84 (d, 7= 8.8 Hz, 1H), 3.78 (brs, 2H), 3.29-3.23 (m, 5H), 2.85 (dd, 7= 13.8, 4.1 Hz, 1H), 1.28-1.21 (m, 9H).

Synthesis of l-methoxy-3-(pyrimidin-5-yl) propan-2-amine hydrochloride (401): To a stirred solution of compound 400 (60 mg, 0.22 mmol) in CH₂C1₂ (3 mL) was added 4 N HCl in 1, 4Dioxane (1 mL) under argon atmosphère at 0 °C; warmed to RT and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was washed with n-pentane (2x5 mL) and dried in vacuo to afford compound 401 (40 mg, HCl sait) as brown solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.1); ^JH NMR (DMSO-/4, 400 MHz); δ 9.11 (s, 1H), 8.75 (s, 2H), 8.24 (br s, 2H), 3.68-3.59 (m, 1H), 3.53-3.48 (m, 1H), 3.39 (dd, 7= 10.5, 5.7 Hz, 1H), 3.30 (s, 3H), 2.95 (t, 7= 7.3 Hz, 2H).

Synthesis of 4-(2-aininoethyl)-/V, /V-dimethylbenzenesulfonamide hydrochloride (406)

148

Synthesis of 4-(2-bromoethyl) benzenesulfonyl chloride (403): To a stirred solution of (2bromoethyl) benzene 402 (5 g, 27.02 mmol) in CH2CI2 (15 mL) under argon atmosphère was added chlorosulfonic acid (5.4 mL, 81.08 mmol) at 0 C; warmed to RT and stirred for 3 h. The reaction was monitored by TLC; after completion the reaction, the reaction mixture was poured into ice-cold water (100 mL) extracted with CH2CI2 (2 x 150 mL). The combined organic extracts were washed with brine (100 mL), separated dried over sodium sulfate, fîltered and concentrated in vacuo to afford crude compound 403 (5 g) as colorless thick syrup. TLC: 10% EtOAc/ hexanes (Rf. 0.6); ΉNMR (DMSO-ritf, 400 MHz): δ 8.00 (d, 8.4 Hz, 2H), 7.47 (d, J= 8.8 Hz, 2H), 3.62 (t, J= 7.2

Hz, 2H), 3.30 (t, 7.2 Hz, 2H).

Synthesis of 4-(2-bromoethyl)-A', A-dimethylbenzenesulfonamide (404): To a stirred solution of compound 403 (5 g, crude) in THF (100 mL) under argon atmosphère were added pyridine (14.37 mL, 176.05 mmol), dimethylamine hydrochlori.de 309 (7.1 g, 88.02 mmol) at 0 C; warmed to RT and stirred for 1 h. The reaction was monitored by TLC; after completion the reaction, the volatiles were removed in vacuo. The residue was diluted with CH2CI2 (500 mL) and washed with 1 N HCl (15 mL). The organic layer was dried over sodium sulfate, fîltered and concentrated in vacuo to obtain crude. The crude was titurated with pentane (30 mL) and dried in vacuo to afford compound 404 (3.5 g, 68%) as an off-white solid. TLC: 20% EtOAc/ hexane (Rf. 0.5); ¹H NMR (CDCI3, 400 MHz): δ 7.74 (d, J= 8.4 Hz, 2H), 7.39 (d, J= 8.5 Hz, 2H), 3.60 (t, J= 7.2 Hz, 2H), 3.25 (t, J= 7.3 Hz, 2H), 2.72 (s, 6H).

149

Synthesis of 4-(2-azidoethyl)-7V, 7V-dimethylbenzenesulfonamide (405): To a stirred solution of compound 404 (500 mg, 1.71 mmol) in DMF (10 mL) under inert atmosphère was added sodium azide (335 mg, 5.15 mmol) at RT and heated to 80 °C for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice-cold water (20 mL) and extracted with CH2CI2 (2 x 200 mL). The combined organic extracts were dried under sodium sulfate, fîltered and concentrated in vacuo to afford compound 405 (350 mg, 80%) as thick syrup. TLC: 20% EtOAc/ hexane (Rf. 0.6); ’H-NMR (DMSO-^, 400 MHz): δ 7.73 (d, J= 8.4 Hz, 2H), 7.40 (d, J= 6.8 Hz, 2H), 3.56 (t, J= 6.8 Hz, 2H), 2.97 (t, J= 6.8 Hz, 2H), 2.71 (s, 6H).

Synthesis of 4-(2-aminoethyl)-7V, 7V-dimethylbenzenesulfonamide hydrochloride (406): To a stirred solution of compound 405 (350 mg, 1.37 mmol) in a mixture of THF: H₂O (4:1, 10 mL) was added triphenyl phosphine (1.08 g, 4.13 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 3-5% MeOH/ CH2Cl₂to afford ffee amine (200 mg) as thick syrup.

To a stirred solution of the ffee amine (200 mg) in CH2CI2 (2 mL) under argon atmosphère was added 4 N HCl in 1, 4-dioxane (0.5 mL) at 0 °C and stirred for 10 min. The volatiles were removed in vacuo to obtain the crude which was washed with diethyl ether (2x5 mL) and dried in vacuo to afford compound 406 (125 mg, 35%) as white solid. TLC: 10% MeOH/ CH2CI2 (Rf. 0.2); ¹H-NMR (DMSO-îZô, 400 MHz): δ 8.04 (br s, 2H), 7.70 (d, J= 8.4 Hz, 2H), 7.54 (d, J= 8.4 Hz, 2H), 3.153.05 (m, 2H), 3.01-2.98 (m, 2H), 2.60 (s, 6H).

Synthesis of 4-(3-aminopropyl)-7V, /V-dimethylbenzencsulfonamide hydrochloride (410)

150

Synthesis of 4-(3-bromopropyl) benzenesulfonyl chloride (407): To a stirred solution of (2bromoethyl) benzene 402 (5 g, 27.02 mmol) in CHCI3 (15 mL) under argon atmosphère was added chlorosulfonic acid (5.4 mL, 81.08 mmol) at 0 °C; warmed to RT and stirred for 3 h. The reaction was monitored by TLC; after completion the reaction, the reaction mixture was poured into ice-cold water (100 mL) extracted with CH2CI2 (2 x 100 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to afford crude compound 407 (5 g) as colorless thick syrup. TLC: 10% EtOAc/ hexanes (Rf. 0.4); ^XH NMR (CDCI3, 400 MHz): δ 7.97 (d, J= 8.8 Hz, 2H), 7.45 (d, J= 8.8 Hz, 2H), 3.40 (t, J= 6.4 Hz, 2H), 2.93 (t, J= 7.2 Hz, 2H), 2.24-2.17 (m, 2H).

Synthesis of 4-(3-cliloropropyl)-A^?, .'V-dimethyibenzenesulfonamide (408): To a stirred solution of compound 407 (5 g, crude) in THF (100 mL) under argon atmosphère were added pyridine (14.42 mL, 176.6 mmol), dimethylamine hydrochloride 309 (7.2 g, 88.33 mmol) at 0 C; warmed to RT and stirred for 1 h. The reaction was monitored by TLC; after completion the reaction, the volatiles were removed the in vacuo. The residue was diluted with water (100 mL) and extracted with CH2CI2 (2 x 100 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 20% EtOAc/ hexanes to afford compound 408 (3 g) as white sticky solid. TLC: 20% EtOAc/ hexanes (Rf. 0.5); ^JH NMR (CDC1₃, 400 MHz): δ 7.71 (d, J= 8.4 Hz, 2H), 7.37 (d, J= 8.0 Hz, 2H), 3.53 (t, J= 6.4 Hz, 1H), 3.40 (t, J= 6.4 Hz, 1H), 2.87 (t, J= 7.2 Hz, 2H), 2.71 (s, 6H), 2.23-2.08 (m, 2H).

Synthesis of 4-(3-azidopropyl)-7V, 7V-dimethyIbenzenesulfonamide (409): To a stirred solution of compound 408 (3 g, 9.83 mmol) in DMF (50 mL) under inert atmosphère was added sodium azide (1.91 g, 29.50 mmol) at RT and heated to 70-80 °C for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice-cold water (20 mL) and extracted with EtOAc (2 x 150 mL). The combined organic extracts were dried under sodium sulfate, filtered and concentrated in vacuo to afford compound 409 (2 g, 76%) as colorless thick syrup. TLC: 20% EtOAc/ hexane (Rf. 0.6); *H NMR (CDC1₃, 500 MHz): δ 7.71 (d, J= 8.1 Hz, 2H), 7.36 (d, J= 8.1 Hz, 2H), 3.32 (t, J= 6.7 Hz, 2H), 2.82-2.77 (m, 2H), 2.71 (s, 6H), 1.98-1.91 (m, 2H).

151

Synthesis of 4-(3-aminopropyI)-7V, Λ-dimethyibeiizenesulfonainide hydrochloride (410): To a stirred solution of compound 409 (2.35 g, 8.76 mmol) in a mixture of THF: H2O (4: 1, 100 mL) was added triphenyl phosphine (6.89 g, 26.30 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 15% MeOH/ CH₂Cl₂to afford free amine (2 g) as thick syrup.

To a stirred solution of the above compound (2 g) in CH2CI2 (20 mL) under argon atmosphère was added 4 N HCl in 1, 4-dioxane (10 mL) at 0 C and stirred for 10 min. The solvent was decanted and the obtained solid was dried in vacuo to afford compound 410 (1.5 g, 70%) as white solid. TLC: 10% MeOH/ CH2CI2 (Rf. 0.2); ^XH-NMR (DMSO-d₆, 400 MHz): δ 8.08 (br s, 3H), 7.68 (d, J= 8.4 Hz, 2H), 7.50 (d, J= 8.4 Hz, 2H), 2.81-2.75 (m, 4H), 2.59 (s, 6H), 1.94-1.86 (m, 2H).

Synthesis of 3'-methoxy-[l, l'-biphenyl]-3-amine (412)

To a stirred solution of 3-bromoaniline 390 (1 g, 5.81 mmol) and (3-methoxyphenyl) boronic acid 411 (883 mg, 5.81 mmol) in Toluene: MeOH (1:1, 20 mL) under inert atmosphère were added sodium carbonate (2.15 g, 20.34 mmol in 10 mL of H2O) at RT and purged under argon atmosphère for 20 min. To this was added Pd(PPh3)4 (335 mg, 0.28 mmol) and heated to 100 C for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite, washed with 50% MeOH/ CH2CI2 (150 mL). The filtrate was evaporated in vacuo to obtain the crude which was purified through silica gel column chromatography in 70% EtOAc/ hexanes to afford compound 412 (500 mg, 54%) as yellow thick syrup. TLC: 70% EtOAc/ hexanes (Rf. 0.5); *H NMR (400 MHz, CDC1₃): δ 7.35-7.30 (m, 1H), 7.25-7.19 (m, 1H), 7.17-7.13 (m, 1H), 7.10-7.08 (m, 1H), 7.00-6.96 (m, 1H), 6.92-6.85 (m, 2H), 6.68-6.65 (m, 1H), 3.85 (s, 3H), 3.72 (br s, 2H);

Synthesis of 3'-amino-[l, l'-biphenyl]-3-ol (413)

152

A mixture of compound 412 (400 mg, 2.01 mmol) in hydrogen iodide (5 mL, 57% aqueous solution) was refluxed for 5 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with ice-cold water and the pH was neutralized with 10% sodium bicarbonate solution (5 mL) and extracted with EtOAc (2 x 50 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The obtained solid was filtered, dried in vacuo to obtain the crude which was purified through silicagel column chromatography in 80% EtOAc/ hexanes to afford compound 413 (200 mg, 54%) as an off-white solid. TLC: 50% EtOAc/ hexanes (Rf. 0.4); *H NMR (400 MHz, DMSO-îZ₆): δ 9.41 (s, 1H), 7.20 (t, J= 7.8 Hz, 1H), 7.06 (t, J= 7.8 Hz, 1H), 6.99-6.88 (m, 2H), 6.78-6.76 (m, 1H), 6.73-6.68 (m, 2H), 6.55-6.52 (m, 1H), 5.12 (s, 2H).

Synthesis of 2-(tetrahydrofuran-2-yl) ethan-l-amine hydrochloride (415)

	i) LAH, ether,RT, 16 h CIH H₂N^
	r \ n
ii) 4 N HCl in 1,4-Dioxane
414	415

To a stirred solution of 2-(tetrahydrofuran-2-yl) acetonitrile 414 (2 g, 17.99 mmol) in ether (20 mL)

O under argon atmosphère was added lithium aluminium hydride (1.36 g, 35.83 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with saturated sodium potassium tartrate solution (30 mL) at 0-5 °C and extracted with ether (2 x 50 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude.

The crude was dissolved in CH2CI2 (5 mL) cooled to 0 C and added 4 N HCl in 1, 4-dioxane (10 mL) under argon atmosphère and stirred at the same température for 30 min. The volatiles were removed in vacuo. The obtained solid was titurated with CH₂C1₂ (2x5 mL) and in vacuo to afford compound 415 (500 mg, HCl sait) as sticky solid. TLC: 10% MeOH/ CH2CI2 (Rf. 0.2).

153

Synthesis of 4-(27/-1, 2, 3-triazol-2-yl) benzaldehyde & 4-(121-1,2, 3-triazol-l-yl) benzaldehyde (418 & 419): To a stirred solution of 4-fluorobenzaldehyde 417 (2 g, 16 mmol) in DMF (50 mL) under argon atmosphère were added 177-1, 2, 3-triazole 417 (1.32 g, 19.2 mmol), potassium carbonate (3.3 g, 24 mmol) at RT; heated to 100 C and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice cold water (35 mL) and extracted with EtOAc (2 x 40 mL). The combined organic extracts were dried over sodium sulfate, fïltered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 20% EtOAc/ hexanes to afford compound 418 (800 mg, 29%) and using 40% EtOAc/ hexanes to afford compound 419 (1 g, 36%) as yellow solids.

Compound 418 analytical data: TLC: 20% EtOAc/hexanes (Rf. 0.8); 'h-NMR (DMSO-îZô, 400 MHz): δ 10.05 (s, 1H), 8.27 (s, 2H), 8.25 (d, J= 8.8 Hz, 2H), 8.11 (d, J= 8.8 Hz, 2H).

Compound 419 analytical data: TLC: 20% EtOAc/hexanes (Rf. 0.3); ¹H-NMR (DMSO-Js, 400 MHz): δ 10.07 (s, 1H), 8.98 (s, 1H), 8.19 (d, J= 8.8 Hz, 2H), 8.13 (d, J= 8.8 Hz, 2H), 8.04 (s, 1H).

Synthesis of (jE)-2-(4-(2-nitrovinyI) phenyl)-227-l, 2, 3-triazole (420): To a stirred solution of compound 418 (400 mg, 2.31 mmol) in AcOH (10 mL) under argon atmosphère were added nitromethane (1.41 mL, 23.12 mmol), ammonium acetate (267 mg, 3.46 mmol) at RT; heated to 100 °C and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo and diluted with water (20 mL). The obtained solid was fïltered, washed with n-hexane and dried in vacuo to afford compound 420 (400 mg, 80%) as yellow solid. TLC: 20% EtOAc/ hexanes (Rf. 0.3); ’H-NMR (DMSO-</₆, 400 MHz): δ 8.29-8.18 (m, 4H), 8.138.05 (m, 4H).

154

Synthesis of 2-(4-(223-1, 2, 3-triazol-2-yl) phenyl) ethan-l-amine hydrochloride (421): To a stirred solution of compound 420 (200 mg, 0.92 mmol) in MeOH (10 mL) under argon atmosphère were added 10% Pd/C (100 mg), HCl (0.2 mL) at RT and stirred under hydrogen atmosphère (balloon pressure) for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite and the filtrate was concentrated in vacuo to obtain the crude. The crude was triturated with 2 M HCl in Et₂O (2x5 mL) and dried in vacuo to afford compound 421 (100 mg, 48%) as an off-white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.2); 'H-NMR (DMSO-î/₆, 400 MHz): δ 8.16 (s, 2H), 8.12 (br s, 2H), 7.98 (d, 7= 8.4 Hz, 2H), 7.46 (d, 7= 8.4 Hz, 2H), 3.10-3.05 (m, 2H), 2.96 (t, 7= 8.4 Hz, 2H).

Synthesis of benzyl (4-(4-(2-aminoethyl) phenoxy) butyl) carbamate hydrochloride (427)

Synthesis of terf-butyi (4-hydroxyphenethyl) carbamate (423): To a stirred solution of 4-(2aminoethyl) phénol 422 (1 g, 7.29 mmol) in 1, 4-dioxane: H₂O (1: 1, 30 mL) were added 2 M o

aqueous sodium hydroxide solution (2 mL) and Boc-anhydride (1.9 mL, 8.25 mmol) at 0 C;

warmed to RT and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the pH of the reaction mixture cooled to 0 C, acidified with 1 M HCl to ~3 and extracted with EtOAc (2 x 50 mL). The combined organic extracts were dried over sodium sulphate, filtered and concentrated in vacuo to afford compound 423 (1.5 g, 87%) as an off-white solid. TLC: 50% EtOAc/hexanes (Rf. 0.8); Ή NMR (DMSO-J₆,500 MHz): δ 9.15 (s, 1H), 6.95 (d,7= 8.4 Hz, 2H),

155

6.83 (t, J= 5.4 Hz, 1H), 6.64 (d, J= 8.1 Hz, 2H), 3.09-3.00 (m, 2H), 2.56-2.51 (m, 2H), 1.35 (s, 9H).

Synthesis of benzyl (4-hydroxybutyl) carbamate (425): To a stirred solution of 4-aminobutan-l-ol 424 (1.0 g, 11.23 mmol) in CH2CI2 (15 mL) under argon atmosphère were added triethyl amine (1.78 mL, 12.35 mmol) and benzyl chloroformate (1.76 mL, 12.35 mmol, 50% solution in toluene) at 0 C; warmed to RT and stirred for 6 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with saturated ammonium chloride (50 mL) at 0 C. The organic layer was washed with brine (50 mL), dried over sodium sulfate, filtered and concentrated in vacuo to afford compound 425 (2.1 g, 84%) as colorless liquid. TLC: 50% EtOAc/ hexanes (Rf. 0.5); *H NMR (DMSO-d₆_ 500 MHz): δ 7.40-7.22 (m, 6H), 4.98 (s, 2H), 4.37 (t, J= 5.1 Hz, 1H), 3.36 (q, J= 5.8 Hz, 2H), 2.97 (q, 6.3 Hz, 2H), 1.51-1.28 (m, 4H).

Synthesis of teri-butyl (4-(4-(((benzyloxy) carbonyl) amino) butoxy) phenethyl) carbamate (426): To a stirred solution of compound 423 (1.5 g, 6.32 mmol) and compound 425 (1.4 g, 6.32 mmol) in THF (50 mL) under argon atmosphère at 0 C were added triphenyl phosphine (1.65 g, 6.32 mmol), diisopropyl azodicarboxylate (1.4 mL, 6.96 mmol) at 0 C; warmed to RT and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was dissolved in 10% EtOAc/ hexanes (5 mL) and the precipitated solid was filtered, washed with hexane (20 mL), dried in vacuo to afford compound 426 (1.9 g, 68%) as an off-white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.7); ’H NMR (DMSO-î/₆, 500 MHz): δ 8.89 (s, 1H), 7.68-7.51 (m, 5H), 7.40-7.24 (m, 2H), 7.07 (d, J= 8.4 Hz, 1H), 6.88-6.78 (m, 2H), 5.00 (s, 2H), 4.80-4.73 (m, 2H), 3.91 (t, J= 6.4 Hz, 2H), 3.11-3.02 (m, 2H), 2.60 (t, J= 7.5 Hz, 2H), 1.72-1.64 (m, 2H), 1.56-1.52 (m, 2H), 1.18 (d, J= 6.1 Hz, 9H).

Synthesis of benzyl (4-(4-(2-aminoethyl) phenoxy) butyl) carbamate hydrochloride (427): To a stirred solution of compound 426 (500 mg, 1.13 mmol) in CH2CI2 (5 mL) was added 4 N HCl in 1, 4-dioxane (3 mL) under argon atmosphère at 0-5 °C; warmed to RT and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed under reduced pressure. The obtained solid was washed with diethyl ether (10 mL), 72-pentane (10 mL) and dried in vacuo to afford compound 427 (200 mg, 47%) as white solid. TLC: 5% MeOH/ CH2CI2 (Rf. 0.4);

^XH NMR (DMSO-rf₆,500 MHz): δ 7.88 (br s, 3H), 7.39-7.28 (m, 5H), 7.15 (d, J= 8.7 Hz, 2H), 6.88

156 (d, J= 8.7 Hz, 2H), 5.00 (s, 2H), 3.93 (t, J= 6.4 Hz, 2H), 3.04 (q, J= 6.1 Hz, 2H), 2.97 (d, J= 6A

Hz, 2H), 2.81-2.76 (m, 2H), 1.73-1.65 (m, 2H), 1.57-1.51 (m, 2H).

Synthesis of 4-phenyloxazol-2-amine (429)

Synthesis of 4-phenyloxazol-2-amine (429): To a stirred solution of 2-bromo-l-phenylethan-l-one 428 (100 mg, 0.50 mmol) in CH3CN (5 ml) under inert atmosphère was added urea 395 (301 mg, 5.02 mmol) at RT; heated at 80 C and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was purified through flash column chromatography using 30% EtOAc/ hexanes to afford compound 429 (50 mg, 63%) as an off-white solid. TLC: 50% EtOAc/ hexanes (Rf. 0.6); ¹H NMR (400 MHz,

DMSO-îZ₆): δ 7.86 (s, 1H), 7.63 (d, 7= 7.0 Hz, 2H), 7.35 (t, 7= 7.6 Hz, 2H), 7.26-7.22 (m, 1H), 6.70 (s, 2H).

Table 1: Synthesis of compounds from compounds 6,14,21,28, 35, 42, 50, 55, 62, 70, 76, 82,

88, 97,103, 112,118, 124,135,140, 145,150,155,156,159,164,167,170, P-42 and various amines

t ¹ t No.” » t _ 1 i * l ; f '	- y Structure ’ ’ ‘¹ ·' ..·ϊ· < ..· 1	Procedure, ilntermediate , Amine	Rx Yield (%) e U	Mass Spec. Found	î 1 ,-Mass Spec.:* Calculated ”<	'il-NMR . ' i _t > ¹ _T ¹ iV
1101		H	D, 6	52	476.0701	476.0715 for C₂₂H₁₉N₃O 4S₂Na (M+Na)+	‘H NMR (400 MHz, DMSOd₆) δ 10.78 (s, 1H), 8.62 (t, J = 5.6 Hz, 1H), 7.76-7.59 (m, 5H), 7.57-7.35 (m, 6H), 7.26 (s, 2H), 3.47 (t, J = 6.6 Hz, 2H), 2.88 (t, J = 7.1 Hz, 2H).

157

1102	....A CC/v Π⁰	D, 6	51	504.1048	504.1028 for C24H23N3O 4S₂Na (M+Na)+	‘H NMR (400 MHz, DMSOd₆) δ 10.78 (s, 1H), 8.60 (t, J = 5.6 Hz, 1H), 7.71-7.57 (m, 5H), 7.55-7.40 (m, 6H), 3.50 (q, J = 6.8 Hz, 2H), 2.91 (t, J = 7.1 Hz, 2H), 2.52 (s, 6H).
1103	1 V^Hi ⁰ H	D, 6	83	453.0936	453.0943 for C23H21N2O 4S2 (M+H)⁺	‘H NMR (400 MHz, DMSOd_fi) δ 10.78 (s, 1H), 8.60 (t,J= 5.5 Hz, 1H), 7.71-7.59 (m, 3H), 7.53 (d, J = 8.3 Hz, 1H), 7.51-7.42 (m, 2H), 7.27 (t,J= 7.3 Hz, 2H), 7.18(dd,J= 15.9, 7.3 Hz, 3H), 3.44 (q, J = 6.9 Hz, 2H), 2.80 (t, J= 7.4 Hz, 2H).
1104			D, 6	63	373.0999	373.1016 for C22H₁₇N₂O ₂S (M-H)’	‘H NMR (400 MHz, DMSOd₆) δ 10.78 (s, 1H), 8.60 (t, J= 5.5 Hz, 1H), 7.71 - 7.59 (m, 3H), 7.53 (d, J = 8.3 Hz, 1H), 7.51-7.42 (m, 2H), 7.27 (t,J= 7.3 Hz, 2H), 7.18(dd,J= 15.9, 7.3 Hz, 3H), 3.44 (q, J = 6.9 Hz, 2H), 2.80 (t, J= 7.4 Hz, 2H).
1105	” h ;	D, 6	80	381.1633	381.1637 for C22H25N2O ₂S (M+H)⁺	*H NMR (400 MHz, DMSOd₆) δ 10.76 (s, 1H), 8.43 (t,J= 5.6 Hz, 1H), 7.71 - 7.59 (m, 3H), 7.58-7.40

158

					(m, 4H), 3.28 - 3.17 (m, 2H), 1.73-1.53 (m, 6H), 1.37 (q, J = 7.0 Hz, 2H), 1.32-1.03 (m, 3H), 0.87 (tt, J = 11.5, 6.1Hz, 2H).
1107	0 y- NH o		D, 6	79	361.1001	361.1011 for C2lH[7N₂O ₂S (M+H)⁺	*H NMR (400 MHz, DMSOd₆) δ 10.77 (s, 1H), 9.08 (t,J= 6.0 Hz, 1H), 7.74-7.58 (m, 4H), 7.57-7.40 (m, 3H), 7.35 - 7.19 (m, 5H), 4.43 (d, J =6.0 Hz, 2H).
1108	0 y-NH 0 ο ΓΜ O U		D, 6	71	389.1307	389.1324 for C₂3H₂iN₂O ₂S (M+H)⁺	‘H NMR (400 MHz, DMSOd₆) δ 10.76 (s, 1H), 8.52 (t, J= 5.6 Hz, 1H), 7.71-7.60 (m, 3H), 7.60-7.42 (m, 4H), 7.30 - 7.13 (m, 5H), 3.23 (q, .7=6.6 Hz, 2H), 2.59 (t,J= 7.7 Hz, 2H), 1.83-1.74 (m, 2H).
1109	0_x r-NH 0	D, 6	81	403.1496	403.1480 for C24H23N2O ₂S (M+H)⁺	‘H NMR (400 MHz, DMSOd₆) δ 10.75 (s, 1H), 8.48 (t,J= 5.6 Hz, 1H), 7.71 - 7.59 (m, 3H), 7.58 - 7.40 (m, 4H), 7.29 7.09 (m, 5H), 3.23 (q,.7=6.5 Hz, 2H), 2.57 (t, J= 7.4 Hz, 2H), 1.63-1.44 (m,4H).

159

1110	0_x K»! P J } CWVXi	D, 6	65	447.1162	447.1143 for C26H20N2O ₂SNa (M+Na)⁺	‘H NMR (400 MHz, DMSOd₆) δ 10.77 (s, 1H), 8.65 (t,J= 5.6 Hz, 1H), 7.83 (t, 7= 8.5 Hz, 3H), 7.78- 7.59 (m, 4H), 7.57-7.35 (m, 7H), 3.55 (q, J = 6.8 Hz, 2H), 2.97 (t, 7=7.3 Hz, 2H).
1111	0 ! >NH 0 A\ ί n ïM AA / A-vrAA	D, 6	36	473.1319	473.1300 for C₂sH₂₂N₂O ₂SNa (M+Na)⁺	‘H NMR (400 MHz, DMSOd₆) δ 10.78 (s, 1H), 8.63 (t, J = 5.7 Hz, 1H), 7.71-7.39 (m, 13H), 7.32 (dd, J =13.3,7.5 Hz, 3H), 3.48 (q, J =6.7 Hz, 2H), 2.85 (t, J = 7.2 Hz, 2H).
1112	0 Ÿ-Mll 0	D, 6	82	459.1154	459.1143 for C₂₇H₂oN₂0 ₂SNa (M+Na)⁺	‘H NMR (400 MHz, DMSOd₆) δ 10.78 (s, 1H), 9.12 (t, J = 6.0 Hz, 1H), 7.76-7.29 (m, 16H), 4.48 (d, J = 5.9 Hz, 2H).
1113	0 >NH 0 A ΓΜ AA a .LJ 1 ν-λ J r MS H	D, 6	83	415.0894	415.0892 for C₂₂H₁₇N₂O ₂SFNa (M+Na)⁺	Ή NMR (400 MHz, DMSOd₆) δ 10.78 (s, 1H), 8.57 (t, J = 5.7 Hz, 1H), 7.65 (ddd, J = 17.4, 6.5,2.8 Hz,3H), 7.57 — 7.40 (m, 4H), 7.23 (dd, J = 8.4, 5.6 Hz, 2H), 7.08 (t, J = 8.8 Hz, 2H), 3.43 (q, J =6.8 Hz, 2H), 2.79 (t, J = 7.2 Hz, 2H).

160

1114	0 Μη p Us-VÎ-MJ ^χ	D, 6	78	427.109	427.1092 for C23H20N2O ₃SNa (M+Na)⁺	‘H NMR (400 MHz, DMSOd₆) δ 10.78 (s, 1H), 8.57 (t, J = 5.6 Hz, 1H), 7.72-7.60 (m, 3H), 7.57 - 7.40 (m, 4H), 7.15 7.08 (m, 2H), 6.87-6.79 (m, 2H), 3.70 (s, 3H), 3.45-3.35 (m, 2H), 2.73 (t, J = 7.4 Hz, 2H).
1115	0 Μη ρ /^νθΗ ÎAVrAr	D, 6	63	391.1121	391.1116 for C22H49N2O ₃S (M+H)⁺	Ή NMR (400 MHz, DMSOd₆) δ 10.78 (s, 1H), 9.14 (s, 1H), 8.55 (t, J = 5.6 Hz, 1H), 7.71 - 7.60 (m, 3H), 7.58 - 7.40 (m, 4H), 6.99 (d, J =8.2 Hz, 2H), 6.65 (d, J = 8.2 Hz, 2H), 3.37 (q, J = 6.8 Hz, 2H), 2.74- 2.63 (m, 2H).
1117	⁰ Λ ζ~ΝΗ 0 0 Η γ\Α /*%Α ίλ-V ^·ν ^0CHj		D, 6	81	455.1049	455.1041 for C24H20N2O ₄SNa (M+Na)⁺	‘H NMR (400 MHz, DMSOd₆) δ 10.78 (s, 1H), 8.60 (t, J = 5.7 Hz, 1H), 7.86 (d, J =8.1 Hz, 2H), 7.71 - 7.60 (m, 3H), 7.57 - 7.40 (m, 4H), 7.36 (d, J = 8.0 Hz, 2H), 3.81 (s,3H), 3.48 (q, J = 6.7 Hz, 2H), 2.88 (t, J = 7.1 Hz, 2H).
1118	0 0 CàsO'b'^-Q ΟΗ		D, 6	76	413.0937	413.0936 for C₂2H₁₈N₂O ₃SNa (M+Na)⁺	‘H NMR (400 MHz, DMSOd₆) δ 10.78 (s, 1H), 9.23 (s, 1H), 8.59 (t, J = 5.6 Hz, 1H), 7.71 - 7.59 (m, 3H), 7.58-7.40

161

					(m, 4H), 7.05 (t, J = 7.7 Hz, 1H), 6.59 (td, J = 9.0, 6.9 Hz, 3H), 3.40 (q, J =6.8 Hz, 2H), 2.70 (t, J = 7.5 Hz, 2H).
1120	0 Ζτ”^ΝΗ νΛ C'^N	D, 6	13	422.1	422.1 (M+Na)⁺	‘H NMR (400 MHz, DMSOd₆) δ 10.78 (s, 1H), 8.59 (t, J = 5.6 Hz, 1H), 7.83 - 7.33 (m, 11H), 3.47 (dd, J = 7.8, 5.1Hz, 2H), 2.90 (t, J = 7.0 Hz, 2H).
1121	ο, — /•ΝΗ 0 f\ 'LZ'S^V*' H W	D, 6	32	458.2	458.2 (M+H)⁺	‘H NMR (400 MHz, DMSOd₆) δ 10.78 (s, 1H), 8.57 (t, J = 5.6 Hz, 1H), 7.71-7.60 (m, 3H), 7.58-7.40 (m, 4H), 7.06- 6.96 (m, 2H), 6.87 - 6.78 (m, 2H), 3.42-3.32 (m, 2H), 3.04 (t, J =5.4 Hz, 4H), 2.68 (t, J = 7.5 Hz, 2H), 1.63 - 1.43 (m, 6H).
1122	0 /-Nil 0		D, 6	49	486.9872	486.9883 for C₂₂H₁₇N₂O ₂SClBr (M+Cl)·	‘H NMR (400 MHz, DMSOd₆) δ 10.78 (s, 1H), 8.58 (t, J = 5.6 Hz, 1H), 7.65 (ddd, J = 17.0,5.8,2.1 Hz, 3H), 7.57- 7.40 (m, 6H), 7.17 (d, J = 8.3 Hz, 2H), 3.43 (q, J =6.7 Hz, 2H), 2.77 (t, J = 7.1 Hz, 2H).
1123	0. /-NH 0 (l-Cr		D, 6	37	361.078	361.0778 for C₁₈H₁₈N₂O ₂SC1	'H NMR (400 MHz, DMSOd₆) δ 10.75 (s, 1H), 8.45 (d, J

162

					(M+C1)·	= 5.7 Hz, 1H), 7.71-7.59 (m, 3H), 7.59 - 7.40 (m, 4H), 3.21 (q, J =6.7 Hz, 2H), 1.45 (p, J = 7.5 Hz, 2H), 1.27 (dt, J = 20.8,10.6 Hz, 2H), 0.86 (td, J = 7.2,2.4 Hz, 3H).
1124	0_κ ^>-ΝΗ Ο ^{S Η} θ'	D, 6	48	439.2	439.2 (M+C1)·	Ή NMR (400 MHz, DMSOd₆) δ 10.78 (s, 1H), 8.59 (t, J = 5.6 Hz, 1H), 7.72-7.61 (m, 3H), 7.58-7.40 (m,4H), 7.18 (t, J =8.0 Hz, 1H), 6.81 — 6.71 (m, 3H), 3.70 (s, 3H), 3.44 (q, J = 7.1 Hz, 2H), 2.78 (t, J = 7.4 Hz, 2H).
1125	ο >-ΝΗ 0 / 0	D, 6	59	433.1206	433.1222 for C₂₄H₂,N₂O ₄S	‘H NMR (400 MHz, DMSOd₆) δ 10.78 (s, 1H), 8.56 (t, J = 5.6 Hz, 1H), 7.71-7.60 (m, 3H), 7.58-7.40 (m,4H), 6.89- 6.76 (m, 2H), 6.70 (dd,J = 8.2, 2.0 Hz, 1H), 3.68 (d, J = 2.0 Hz, 6H), 3.16 (d, J = 5.2 Hz, 2H), 2.73 (t, J = 7.3 Hz, 2H).
1127	ο, %-ΝΗ 0 \\ Χ„Λ J Ν-χχ /	D, 6	49	405.1269	405.1273 for C₂₃H₂iN₂O ₃S (M+H)⁺	‘H NMR (400 MHz, DMSOd_s) δ 10.78 (s, 1H), 8.55 (d, J = 6.3 Hz, 1H), 7.71-7.59 (m, 3H), 7.57-7.40 (m, 4H), 7.22 - 7.07 (m, 2H),

163

					6.94 (d, J =8.3 Hz, 1H), 6.84 (t, J = 7.6 Hz, 1H), 3.76 (d, J = 2.1Hz,3H), 3.40 (q, J =7.0 Hz, 2H), 2.82 - 2.74 (m, 2H).
1130	D, 6	41	391.091	391.0917 for C₂₂H₁₆N₂O ₂fs	‘H NMR (400 MHz, DMSOd₆) δ 10.78 (s, 1H), 8.60 (t, J = 5.6 Hz, 1H), 7.75-7.57 (m, 3H), 7.57 - 7.39 (m, 4H), 7.30 (td, J = 8.0, 6.2 Hz, 1H), 7.09- 6.95 (m, 3H), 3.46 (q,J = 6.7 Hz, 2H), 2.83 (t, J = 7.2 Hz, 2H).
Ο >-ΝΗ 0 η'μ^λ F

1149	D, 6	28	404.1438	404.1433 for C₂₃H₂₂N₃O ₂s	‘H NMR (400 MHz, DMSOd₆) δ 10.75 (s, 1H), 8.49 (t, J = 5.7 Hz, 1H), 8.42 (d, J =5.1 Hz, 2H), 7.71 7.40 (m, 7H), 7.20 (d, J = 5.4 Hz, 2H), 3.24 (q, J =6.5 Hz, 2H), 2.49 (q, J = 2.8,1.7 Hz, 2H), 1.54 (dp, J = 41.6, 7.1Hz, 4H).
Cl

1150	D, 6	75	409.1961	409.1950 for c₂₄h₂₉n₂o ₂s	‘H NMR (400 MHz, DMSOd₆) δ 10.76 (s, 1H), 8.46 (t, J = 5.7 Hz, 1H), 7.71-7.40 (m, 7H),3.19(q,J = 6.6 Hz, 2H), 1.68-1.54 (m, 5H), 1.44 (p, J = 7.2 Hz, 2H), 1.33-1.03 (m, 8H), 0.83 (t, J =
<λ 'LÿZ·' S

164

					11.1 Hz, 2H).
1151	D, 6	74	355.1477	355.1480 for C₂₀H₂₃N₂O ₂s	‘H NMR. (400 MHz, DMSOd₆) δ 10.75 (s, 1H), 8.46 (t, J = 5.7 Hz, 1H), 7.71 - 7.40 (m, 7H), 3.20 (q, J = 6.6 Hz, 2H), 1.46 (p, J =6.9 Hz, 2H), 1.32- 1.20 (m,6H), 0.88 - 0.80 (m, 3H).
α %-νη Ρ

1152	D, 6	59	383.1802	383.1793 for C₂₂H₂₇N₂O ₂s	*H NMR (400 MHz, DMSOd₆) δ 10.75 (s, 1H), 8.46 (t, J = 5.7 Hz, 1H), 7.71-7.40 (m, 7H),3.19(q,J = 6.6 Hz, 2H), 1.50-1.42 (m, 2H), 1.23 (q, J = 4.6,4.0 Hz, 10H), 0.83 (ζ J = 6.6 Hz, 3H).
^η

1154	D, 6	38	462.186	462.1851 for C₂₆H₂₈N₃O ₃s	^lH NMR (400 MHz, DMSOd₆) δ 10.78 (s, 1H), 8.57 (t, J = 5.6 Hz, 1H), 7.71-7.60 (m, 3H), 7.57 - 7.40 (m, 4H), 7.10 (d, J =8.3 Hz, 2H), 6.83 (d, J = 8.2 Hz, 2H), 3.98 (t, J = 5.8 Hz, 2H), 3.44- 3.34 (m, 2H), 2.72 (t, J = 7.4 Hz, 2H), 2.58 (t, J = 5.8 Hz, 2H), 2.19 (s, 6H).
0 ^ΝΗ 0 Η W Ν

1155	D, 6	40	476.2007	476.2008 for ΰ₂₇Η₃ο₃9Ν₃O₃S	‘H NMR (400 MHz, DMSOd₆) δ 10.79 (s, 1H), 10.43 (s, 1H), 8.60 (t, J = 5.6 Hz, 1H),
0 7-Ν^η 0 \| CI- Cx^Xl ΝΛ-Ο^θ^^ν^Ι⁴X/ S Η

165

					7.71-7.40 (m, 7H), 7.13 (d, J = 8.2 Hz, 2H), 6.84 (d, J =8.2 Hz, 2H), 3.99 (t, J =6.1 Hz, 2H), 3.40 (q, J = 6.8 Hz, 2H), 3.16 (dt, J= 13.2, 5.4 Hz, 2H), 2.75 (d, J = 5.0 Hz, 8H), 2.10 (dq, J = 12.2, 6.1 Hz, 2H).
1156	_A K. LÂ.J/V? v hH**i.	D, 6	59	419.2 (M+l)⁺	(DMSO-fZ₆,400 MHz): δ 10.76 (brs, 1H), 8.54 (brs, 1H), 7.697.62 (m, 3H), 7.55-7.45 (m, 4H), 7.17-7.10 (m, 2H), 6.93 (d, .7=8.4 Hz, 1H), 6.82 (t,J= 7.2 Hz, 1H), 4.03-3.99 (m, 2H), 3.43 (d, J = 6.8 Hz, 2H), 2.78 (t, J = 6.8 Hz, 2H), 1.32 (t,J= 6.8 Hz, 3H);
1157	0 λ. ,A-hH Us, J~y< et· =J	D, 6	49	419.2 (M+l)⁺;	‘H-NMR (DMSO-4_d, 400 MHz): δ 10.79 (brs, 1H), 8.598.58 (m, 1H), 7.69-7.63 (m, 3H), 7.55-7.44 (m, 4H), 7.16 (t, J= 8.0 Hz, 1H), 6.75 (t,J= 8.0 Hz, 3H), 3.95 (q, 2H), 3.463.43 (m, 2H), 2.76 (t, J =7.6 Hz, 2H), 1.26 (t,J= 6.8 Hz, 3H)

166

1158		D, 6	52	389.2 (M+l)⁺;	(DMSO-ri,,, 500 MHz): δ 10.76 (s, 1H), 8.64 (t, J= 5.5 Hz, 1H), 7.67-7.62 (m, 3H), 7.55-7.42 (m, 4H), 7.127.06 (m, 4H), 3.40-3.36 (m, 2H), 2.77 (t, J= 8.0 Hz, 2H), 2.28 (s, 3H);
1159	α --¾. +O	D,6	35	391.3 (M+l)⁺;	(DMSO-ri_tf, 400 MHz): δ 10.76 (s, 1H), 8.888.87 (m, 1H), 7.72-7.63 (m, 4H), 7.55-7.43 (m, 3H), 7.22 (t, J= 7.2 Hz, 1H), 7.13 (d, .7=7.6 Hz, 1H), 6.98 (d, 7= 7.2 Hz, 1H), 6.87 (t,J= 7.2 Hz, 1H), 4.40 (d, .7=4.8 Hz, 2H), 3.80 (s, 3H);
1161	0	D, 6	43	391.2 (M+l)⁺;	(DMSO-ri₆,400 MHz): δ 10.76 (s, 1H), 8.99 (t, 7= 4.4 Hz, 1H), 7.69-7.59 (m, 4H), 7.54-7.43 (m, 3H), 7.20 (d, J= 8.4 Hz, 2H), 6.86 (d, J = 8.4 Hz, 2H), 4.36 (d,J= 5.6 Hz, 2H), 3.71 (s, 3H);
1163	cCHa VaSZ T>	A, 6	36	375.0 (M+l)⁺;	(DMSO-di, 400 MHz): δ 10.76 (s, 1H), 9.04 (t, 7= 6.0 Hz, 1H), 7.71-7.61 (m, 4H), 7.55-7.43 (m, 3H), 7.18 (t, 7= 7.2 Hz, 1H), 7.08-7.03 (m, 3H), 4.40 (d,7 = 6.0 Hz, 2H),

167

					2.26 (s, 3H)
1164	ό CCzy-c ~· Sj-W' h! —K	D, 6	64	375.3 (M+l)⁺;	(DMSO-rf_d, 400 MHz): δ 10.77 (s, 1H), 9.039.02 (m, 1H), 7.70-7.60 (m, 4H), 7.55-7.45 (m, 3H), 7.16 (d, 7= 8.0 Hz, 2H),7.10(d,7 = 8.0 Hz, 2H), 4.38 (d, 7=6.0 Hz, 2H), 2.25 (s, 3H)
1165	yy_/	A, 6	65	417.4 (M+l)⁺;	(DMSO-7_tf, 400 MHz): δ 10.76 (brs, 1H), 9.02 (t, 7= 6.0 Hz, 1H), 7.71-7.60 (m, 4H), 7.557.43 (m, 3H), 7.32 (d, 7=8.4 Hz, 2H), 7.20 (d, 7= 8.4 Hz, 2H), 4.39 (d, 7 = 6.0 Hz, 2H), 1.24 (s, 9H);
1166	0	D, 6	48	429.4 (M+l)⁺;	(DMSO-7_d, 400 MHz): δ 10.77 (s, 1H), 9.17 (t, 7= 4.8 Hz, 1H), 7.72-7.67 (m, 3H), 7.64-7.59 (m, 6H), 7.577.43 (m, 2H), 4.52 (d,7=4.8 Hz, 2H);
1168	Q CQm V*/ >₄—-_χ v f·¹	A, 6	62	379.1 (M+l)⁺;	(DMSO-7_tf, 400 MHz): δ 10.77 (s, 1H), 9.11 (t, 7= 6.0 Hz, 1H), 7.72-7.62 (m, 4H), 7.55-7.44 (m, 3H), 7.36 (t, 7= 8.0 Hz, 1H), 7.13-7.04 (m, 3H), 4.45 (d, 7 = 6.0 Hz, 2H);

168

1169	ο	D, 6	56	367.3 (M+l)⁺;	(DMS0-<4 400 MHz): δ 10.75 (s, 1H), 8.46 (t, J= 6.0 Hz, 1H), 7.69-7.62 (m, 3H), 7.57-7.51 (m, 2H), 7.497.43 (m, 2H), 3.07-3.04 (m, 2H), 1.67-1.60 (m, 4H), 1.501.48 (m,2H), 1.17-1.12 (m, 3H), 0.93-0.87 (m, 2H);
1171	q ..--7:-. JM» [ C J-v, ' ^S ^^Z Π'Χ-ΟΙ,Η.	A, 6	40	329.1 (M+l)⁺;	(DMSO-dtf, 400 MHz): δ 10.76 (s, 1H), 8.58 (t, J= 6.8 Hz, 1H), 7.72-7.69 (m, 3H), 7.56-7.52 (m, 2H), 7.487.44 (m, 2H), 3.44-3.38 (m, 4H), 3.24 (s, 3H);
1172	ο ^AnH [j’’X-ΟΗ	D, 6	82	315 (M+l)⁺;	(DMSO-i/ÿ, 400 MHz): δ 10.73 (s, 1H), 8.43 (t, J= 4.8 Hz, 1H), 7.66-7.56 (m, 3H), 7.54-7.40 (m, 4H), 4.65 (t, J=4.8Hz, 1H), 3.46-3.41 (m, 2H), 3.25-3.23 (m, 2H);
1173	LX_si^y-C ai	D, 6	52	325.2 (M+l)⁺;	(DMSO-di, 400 MHz): δ 10.75 (s, 1H), 8.58 (t, J=4.8Hz, 1H), 7.69-7.59 (m, 4H), 7.57-7.55 (m, 3H), 7.537.43 (m, 2H), 3.10 (t,J= 6.4 Hz,2H), 1.010.97 (m, 1H), 0.43-0.38 (m, 2H), 0.21-0.19 (m, 2H);

169

1176

1177

A, 6

D, 6

339.1 (M+l)⁺;

403.1 (M+l)⁺

405.0 (M+l)⁺ (DMSO-cZ_à, 400 MHz): δ 10.75 (s, 1H), 8.488.46 (m, 1H), 7.69-7.63 (m, 3H), 7.57-7.43 (m, 4H), 3.263.23 (m, 2H), 2.50-2.49 (m, 1H), 1.97-1.91 (m, 2H), 1.821.76 (m,2H), 1.71-1.65 (m, 2H);

‘H NMR (400 MHz, DMSOd₆) δ 10.75 (s, 1H), 8.47 (t, J = 5.8 Hz, 1H),

7.64 (ddd, J = 24.5, 5.6,1.9

Hz, 3H), 7.56 — 7.39 (m, 4H), 7.27 (t, J =7.6 Hz, 2H), 7.18 (d, J = 7.3 Hz, 3H), 3.40 (ddt, J = 24.8,13.3, 6.4 Hz, 2H), 2.76 (dt, J= 11.9, 5.8 Hz, 1H), 1.72 (ddd, J = 13.0,

7.1.4.9 Hz, 1H), 1.52 (ddd, J =16.5,14.1,

7.7 Hz, 1H), 0.69 (t, J = 7.3 Hz, 3H).

‘H NMR (400 MHz, DMSOd₆) δ 10.75 (s, 1H), 9.19 (s, 1H), 8.32 (d, J = 8.2 Hz, 1H),

7.65 (dd, J = 18.8, 7.5 Hz,

3H), 7.49 (dt, J = 23.9, 8.6 Hz, 4H), 7.02 (t, J =

7.9 Hz, 1H), 6.60 (d, J = 7.6 Hz, 2H), 4.174.07 (m, 1H),

170

					2.76 (dd, J = 13.1,7.3 Hz, 1H), 2.56 (dd, J = 12.9, 6.7 Hz, 1H), 1.08 (d, J = 6.5 Hz,3H).
1182	0	A, 6	46	459.2 (M⁺+l);	(DMSO-d₅,500 MHz): δ 10.76 (s, 1H), 8.598.58 (m, 1H), 7.66 (d, 7=7.0 Hz, 1H), 7.62 (d, 7= 7.5 Hz, 2H), 7.51-7.42 (m, 4H), 7.32 (d, 7= 8.0 Hz, 2H), 7.24 (d,7 = 8.0 Hz, 2H), 3.43 (t, 7= 6.5 Hz, 2H), 2.82 (t, 7= 7.0 Hz, 2H);
1183		A, 6	43	389.2 (M+l)⁺;	(DMSO-A, 400 MHz): δ 10.76 (s, 1H), 9.04 (t, 7= 6.0 Hz, 1H), 7.71-7.61 (m, 4H), 7.55-7.43 (m, 3H), 7.18 (t, 7= 7.2 Hz, 1H), 7.08-7.03 (m, 3H), 4.40 (d,7 = 6.0 Hz, 2H), 2.72 (t, J = 6.0 Hz, 2H), 2.26 (s, 3H);
1184	0 (Tm	A, 6	43	389.2 (M+l)⁺;	(DMSO-7_i; 400 MHz): δ 10.77 (s, 1H), 8.588.57 (m, 1H), 7.69-7.63 (m, 3H), 7.55-7.45 (m, 4H), 7.097.07 (m, 4H), 3.44-3.39 (m, 2H), 2.75 (t, 7= 7.6 Hz, 2H), 2.24 (s, 3H);

171

1185		A, 6	42	403.2 (M+l)⁺;	(DMSO-<4 400 MHz): δ 10.76 (s, 1H), 8.588.57 (m, 1H), 7.67-7.61 (m, 3H), 7.53-7.41 (m, 4H), 7.107.08 (m, 4H), 3.42-3.37 (m, 2H), 2.74 (t,J= 7.2 Hz, 2H), 2.55-2.51 (m, 2H), 1.12 (t,J= 7.6 Hz, 3H);
1186	0 OC	A, 6	28	443.2 (Nf+1);	(DMS0-<7_d, 400 MHz): δ 10.78 (s, 1H), 8.59 (t, J= 5.6 Hz, 1H), 7.69-7.62 (m, 5H), 7.55-7.43 (m, 6H), 3.49 (q, 2H), 2.91 (t, J= 7.2 Hz, 2H);
1187	0 ^j_A-nh γΧ	D, 6	36	375.2 (M+l)⁺;	NMR(DMS0d_s,400 MHz): δ 10.75 (br s, 1H), 8.92 (br s, 1H), 7.72-7.65 (m, 4H), 7.537.45 (m, 3H), 7.19-7.14 (m, 4H), 4.42 (br s, 2H), 2.29 (s, 3H);
1188	0 ° Q	A, 6	56	389.1 (M+l)⁺;	(DMSO-<4,400 MHz): δ 10.76 (s, 1H), 9.02 (t, J= 6.0 Hz, 1H), 7.71-7.60 (m, 4H), 7.55-7.43 (m, 3H), 7.19 (d, J =8.0 Hz, 2H), 7.13 (d, J = 8.0 Hz, 2H), 4.39 (d, .7=6.0 Hz, 2H), 2.582.54 (m, 2H), 1.14 (t,J= 7.6 Hz, 3H);

172

1190	0	D, 6	52	381.1 (M+l)⁺;	(CDC1₃,400 MHz): δ 10.79 (s, 1H), 8.678.66 (m, 1H), 7.69-7.64 (m, 3H), 7.57-7.45 (m,4H), 7.31 (d, J =4.8 Hz, 1H), 6.94-6.89 (m, 2H), 3.483.46 (m, 2H), 3.04-3.01 (m, 2H);
1191	aJx Ή}	A, 6	46	383.2 (MXl);	(DMSO-rf_d, 400 MHz): δ 10.77 (s, 1H), 8.488.47 (m, 1H), 7.69-7.63 (m, 3H), 7.57-7.43 (m, 4H), 3.823.78 (m, 2H), 3.26-3.20 (m, 4H), 1.57 (d, J = 9.6 Hz, 2H), 1.45-1.40 (m, 3H), 1.18-1.09 (m,2H);
1193	0	A, 6	52	353.1 (MM);	(CDCI3,400 MHz): δ 10.75 (s, 1H), 8.508.49 (m, 1H), 7.69-7.63 (m, 3H), 7.57-7.43 (m, 4H), 3.14 (t, 7= 6.8 Hz, 2H), 2.13-2.06 (m, 1H), 1.66-1.60 (m, 2H), 1.561.45 (m,4H), 1.25-1.17 (m, 2H);
1194	0 ÆS\ \—Ç/t'⁵'·	A, 6	22	431.3 (M⁺+l);	(DMSO-rf_tf, 400 MHz): δ 10.78 (s, 1H), 8.618.60 (m, 1H), 7.69-7.63 (m, 3H), 7.56-7.53 (m, 2H), 7.517.45 (m, 2H), 7.29 (d, 7=8.0 Hz, 2H), 7.13 (d, 7= 8.4 Hz, 2H), 3.45-3.41

173

					(m, 2H), 2.782.74 (m, 2H), 1.24 (s, 9H);
1195		A, 6	58	443.7 (M+l)⁺	(DMSO-A, 500 MHz): δ 10.77 (s, 1H), 8.59 (t, J= 6.0 Hz, 1H), 7.67 (d, .7=7.5 Hz, 1H), 7.62 (d, .7= 8.0 Hz, 2H), 7.56-7.42 (m, 8H), 3.503.46 (m, 2H), 2.92-2.87 (m, 2H);
1196	q CQm ^ΊΧ	A, 6	43	377.0 (M+l)⁺;	(DMSO-A, 500 MHz): δ 10.78 (s, 1H), 9.26 (br s, 1H), 8.96 (t, J = 6.0 Hz, 1H), 7.72-7.64 (m, 4H), 7.56-7.44 (m, 3H), 7.08 (d, J =8.5 Hz, 2H), 6.66 (d, J = 8.5 Hz, 2H), 4.31-4.29 (m, 2H);
1197		A, 6	36	379.2 (M+l)⁺;	(DMSO-A, 400 MHz): δ 10.76 (s, 1H), 9.08 (t, J= 5.6 Hz, 1H), 7.71-7.61 (m, 4H), 7.55-7.43 (m, 3H), 7.32 (t, J= 6.0 Hz, 2H), 7.15-7.10 (m, 2H), 4.41 (d, J = 6.0 Hz, 2H);
1199	€λΛ,._Ό	A, 6	54	380.9 (M%1)	(DMSO-A, 500 MHz): δ 10.85 (s, 1H), 8.43 (t, J= 5.5 Hz, 1H), 8.02 (s, 1H), 7.78 (d, .7=8.5 Hz, 1H), 7.67 (d, J=7.5 Hz, 1H), 7.55-7.43 (m, 3H), 7.25 (d, J= 8.0 Hz, 1H), 3.25-3.21 (m, 2H), 1.69-

174

					1.57 (m,5H), 1.40-1.36 (m, 2H), 1.18-1.09 (m, 4H), 0.900.83 (m, 2H);
1201	Q CÊiS ^J \o=/ hn**\	A, 6	60	459.2 (K/f+l);	(DMSO-7_tf, 400 MHz): δ 10.76 (s, 1H), 8.598.58 (m, 1H), 7.69-7.64 (m, 3H), 7.53-7.38 (m, 5H), 7.267.16 (m,3H), 3.48-3.47 (m, 2H), 2.89-2.87 (m, 2H);
1202	q, h a ^xx^JL ^^-δΆίχ ^H ''J OH	A, 6	36	377.1 (M⁺+l);	(DMSO-îZî, 500 MHz): δ 10.79 (s, 1H), 9.29 (s, 1H), 9.03 (t, 7= 5.5 Hz, 1H), 7.72-7.62 (m, 4H), 7.55-7.45 (m, 3H), 7.08 (t, 7= 8.0 Hz, 1H), 6.68 (d, J= 12.0 Hz, 2H), 6.60 (d, 7=8.5 Hz, 1H), 4.35 (d, 7= 6.0 Hz, 2H);
1203	CCFj	A, 6	45	445.1 (M+l)⁺;	(DMSO-7₆, 400 MHz): δ 10.77 (s, 1H), 9.15 (t, 7= 4.8 Hz, 1H), 7.71-7.61 (m, 4H), 7.55-7.43 (m,4H), 7.31 (d, 7= 8.0 Hz, 1H), 7.23 (d, 7 = 8.4 Hz, 2H), 4.48 (d,7=6.0 Hz, 2H);
1204	c χΛ'>η	A,6	34	397.2 (M⁺+l);	(DMSO-7;, 400 MHz): δ 10.74 (s, 1H), 8.46 (t, 7= 6.0 Hz, 1H), 7.74-7.64 (m, 3H), 7.54-7.42 (m, 4H), 4.40 (d, 7= 5.2 Hz, 1H), 3.26-3.20

175

					(m,2H), 1.77 (d,J= 11.2 Hz, 2H), 1.68 (d, J = 11.2 Hz, 2H), 1.39-1.34 (m, 3H), 1.18-1.12 (m, 2H), 0.93- 0.84 (m, 2H);
1205		A, 156	50	459.2 (MM);	(DMSO-di, 400 MHz): δ 11.0511.04(m, 1H), 8.54-8.53 (m, 1H), 7.81-7.73 (m, 3H), 7.687.60 (m, 4H), 3.26-3.25 (m, 3H), 1.70-1.62 (m, 6H), 1.391.37 (m, 2H), 1.23-1.14 (m, 2H), 0.88-0.85 (m,2H);
1209		A, 6	56	369.1 (M*+l);	(DMSO-^, 400 MHz): δ 10.75 (s, 1H), 8.49 (t, J= 5.6 Hz, 1H), 7.69-7.63 (m, 3H), 7.56-7.45 (m, 4H), 3.773.70 (m, 2H), 3.59-3.54 (m, 1H), 3.26-3.24 (m, 2H), 1.981.90 (m, 1H), 1.83-1.76 (m, 2H), 1.69-1.63 (m, 2H), 1.431.34 (m, 1H);
1210	0 y-NH p	A, 6	56	362.4 (M⁺+l);	(DMSO-Jÿ, 500 MHz): δ 10.78 (s, 1H), 9.14 (t, J= 6.0 Hz, 1H), 8.49 (s, 1H), 7.74-7.65 (m, 5H), 7.55-7.44 (m, 3H), 7.287.23 (m, 2H), 4.53 (d, .7=5.5 Hz, 2H);

176

1211	0 Am ο	A, 6	66	362.1 (MM);		(DMSO-d_tf, 500 MHz): δ 10.76 (s, 1H), 9.12 (t, J= 6.0 Hz, 1H), 8.52 (s, 1H), 8.45-8.44 (m, 1H), 7.70 (d, J = 10.0 Hz, 1H), 7.67-7.60 (m, 4H), 7.55-7.44 (m, 3H), 7.33 (t, J= 6.5 Hz, 1H), 4.46 (d, 7=5.5 Hz, 2H);
1212				D, 6	44	389.1 (M+l)⁺		‘H NMR (400 MHz, DMSOd₆) δ 10.76 (s, 1H), 8.54 (t, J = 5.8 Hz, 1H), 7.71-7.58 (m, 3H), 7.48 (tt, J = 15.3,7.6 Hz, 4H), 7.23 (ddd, J = 25.3,16.4, 7.3 Hz, 5H), 3.45-3.26 (m, 2H), 3.01 (q, J = 7.1 Hz, 1H), 1.19 (d, J =6.9 Hz, 3H).
1213			D, 6	54	403.1 (M+l)⁺		‘H NMR (400 MHz, DMSOd₆) δ 10.74 (s, 1H), 8.28 (t, J = 6.4 Hz, 1H), 7.71-7.58 (m, 3H), 7.57-7.35 (m, 6H), 7.29 (t, J = 7.6 Hz, 2H), 7.17 (t, J = 7.3 Hz, 1H), 3.41 (d, J =6.3 Hz, 2H), 1.26 (s, 6H).
1214	0 il Ί X—% 0 ^w ”V0„_OE,	D, 6	60	419.5 (Mri-1);		NMR(DMSOd₆,400 MHz): δ 10.77 (s, 1H), 8.56 (t, 7=4.8 Hz, 1H), 7.697.63 (m, 3H), 7.55-7.43 (m, 4H), 7.10 (d, J = 8.8 Hz, 2H),

177

					6.81 (d, 7 = 8.4 Hz, 2H), 3.96 (q, 2H), 3.423.37 (m, 2H), 2.72 (t,J= 7.2 Hz, 2H), 1.301.23 (m, 3H);
1216	0 Μ·4ΙΙ P F cCow	A, 6	30	417.3 (M⁺+l);	(DMSO-iZ_dj 400 MHz): δ 10.76 (s, 1H), 8.47 (t, J= 5.6 Hz, 1H), 7.69-7.63 (m, 3H), 7.57-7.45 (m, 4H), 3.303.25 (m, 2H), 2.00-1.93 (m, 2H), 1.78-1.76 (m, 4H), 1.451.43 (m, 3H), 1.18-1.10 (m, 2H);
1218	q -¾ A-mi il ï Vrf, 0 J V4 HH-\ ' VSU;	A, 6	75	371.2 (M⁺+l);	(DMSO-7_tf, 400 MHz): δ 10.77 (s, 1H), 8.50 (t, J= 5.6 Hz, 1H), 7.69-7.63 (m, 3H), 7.58-7.43 (m, 4H), 3.403.37 (m, 2H), 3.28 (s, 2H), 1.10 (s, 9H);
1220	q OH	A, 6	74	391.4 (KT+1);	(DMSO-7₆,400 MHz): δ 10.77 (s, 1H), 8.53 (t, J= 6.8 Hz, 1H), 7.69-7.63 (m, 3H), 7.57-7.43 (m, 4H), 7.357.29 (m, 4H), 7.23 (t,J= 6.8 Hz, 1H), 5.46 (d, .7=4.8 Hz, 1H), 4.76-4.71 (m, 1H), 3.473.41 (m, 1H);
1221	ctbw OH	A, 6	62	329.1 (MM);	(DMSO-<4,400 MHz): δ 10.74 (s, 1H), 8.40 (t, J= 5.6 Hz, 1H), 7.69-7.43 (m, 7H), 4.68 (d, J = 4.8 Hz, 1H),

178

					3.77-3.71 (m, 1H), 3.16 (t, J= 6.0 Hz, 2H), 1.03 (d,J=6.4 Hz, 3H);
1222	0 <5h	A, 6	41	329.2 (MM);	(DMSO-d_tf, 400 MHz): δ 10.74 (s, 1H), 8.40 (t, J= 5.6 Hz, 1H), 7.69-7.58 (m, 4H), 7.55-7.45 (m, 3H), 4.68 (d, .7= 4.8 Hz, 1H), 3.77-3.71 (m, 1H), 3.16 (t, J= 6.0 Hz, 2H), 1.03 (d, .7=6.4 Hz, 3H);
1226	H i DH	A, 6	75	391.6 (M⁺+l);	(DMSO-φ, 400 MHz): δ 10.78 (s, 1H), 8.54 (t, J= 6.4 Hz, 1H), 7.69-7.63 (m, 3H), 7.57-7.43 (m, 4H), 7.357.29 (m, 4H), 7.23 (t, J= 7.2 Hz, 1H), 5.46 (d, .7= 4.8 Hz, 1H), 4.75-4.71 (m, 1H), 3.473.41 (m, 1H);
1227	0 ^CC^ⁱÙ	A, 6	83	404.4 (M⁺+l);	(DMSO-φ, 400 MHz): δ 10.77 (s, 1H), 8.97 (t, J= 6.0 Hz, 1H), 7.73 (s, 1H), 7.70-7.63 (m, 3H), 7.56-7.43 (m, 3H), 7.217.16 (m, 2H), 7.11 (d,J=7.6 Hz, 1H), 6.97 (t, .7= 7.2 Hz, 1H), 4.53 (d, J = 5.6 Hz, 2H), 2.64 (s, 6H);
1228	0 ^K ‘\	A, 6	27	376.4 QVT+1);	(DMSO-φ, 400 MHz): δ 10.80 (s, 1H), 9.49 (s, 1H), 7.75 (s, 1H), 7.73-7.70

179

					(m, 3H), 7.557.46 (m, 3H), 7.16 (t, .7= 7.6 Hz, 1H), 7.08 (d, J= 7.2 Hz, 1H), 6.95 (t, J = 7.6 Hz, 1H), 3.81 (s, 3H);
1232	C	D, 6	50	445.1 (M+l)⁺	‘H NMR (400 MHz, DMSOd₆) δ 10.79 (s, 1H), 9.08 (t, J = 5.9 Hz, 1H), 7.74-7.59 (m, 4H), 7.58-7.25 (m, 7H), 4.50 (d, J =5.7 Hz, 2H).
1233	•n - JL+ '•srèrM '? -	D, 6	83	363.1 (M+l)⁺	‘H NMR (400 MHz, DMSOd₆) δ 10.77 (s, 1H), 9.15 (t, J = 5.9 Hz, 1H), 9.07 (s, 1H), 8.73 (s, 2H), 7.72 - 7.40 (m, 7H), 4.46 (d, J = 5.7 Hz, 2H).
1234	O ^XjQm ^W'X)	A, 6	57	399.5 (MM);	(DMSO-d_tf, 400 MHz): δ 10.79 (brs, 1H), 8.45 (t, J= 5.6 Hz, 1H), 7.67-7.73 (m, 1H), 7.667.63 (m, 2H), 7.58-7.56 (m, 1H), 7.46-7.43 (m, 1H), 7.357.30 (m, 1H), 3.27- 3.22 (m, 2H), 1.70-1.58 (m, 5H), 1.411.35 (m,2H), 1.27- 1.09 (m, 4H), 0.95-0.83 (m,2H);
1237	o >-Vi 0	A, 6	71	382.3 (MN-1);	(DMSO-<4, 400 MHz): δ 11.04 (brs, 1H), 8.72 (s, 1H), 8.65 (d, J =4.8 Hz, 1H), 8.46 (t,J= 5.6

180

						Hz, 1H), 7.697.67 (m, 2H), 7.63-7.58 (m, 2H), 3.27-3.22 (m, 2H), 1.701.58 (m,4H), 1.41-1.35 (m, 2H), 1.27-1.14 (m, 4H), 0.930.83 (m, 3H); LC-MS: 93.50%; 382.3 (MM);
1240	0 ο \=s/ HM-\ M	A, 6	25	430.4 (MM);		(DMSO-A, 400 MHz): δ 10.77 (s, 1H), 8.92 (t, J= 5.2 Hz, 1H), 7.73 (s, 1H), 7.70-7.62 (m, 3H), 7.56-7.43 (m, 3H),7.12(t, 7= 7.6 Hz, 2H), 6.96 (d,7=8.0 Hz, 1H), 6.84 (t, 7= 6.8 Hz, 1H), 4.46 (d, 7 = 5.6 Hz, 2H), 3.10 (t, 7= 6.0 Hz, 4H), 1.87 (t,7= 6.0 Hz, 4H);
1241	0	A, 6	33	405.4 (MM);		(DMSO-A, 500 MHz): δ 10.75 (s, 1H), 8.58 (t, 7= 6.0 Hz, 1H), 7.67-7.45 (m, 7H), 7.26 (t, 7= 7.5 Hz, 2H), 6.91-6.89 (m, 3H), 3.99 (t, 7= 6.0 Hz, 2H), 3.41-3.30 (m, 2H), 1.94 (t, 7= 6.5 Hz, 2H);
1245		P ÿ-NH 0 S·»^		D, 6	54	368.1 (M+l)⁺	‘H NMR (400 MHz, DMSOd₆) δ 10.77 (s, 1H), 9.23 (t, J = 5.9 Hz, 1H), 8.95 (s, 1H), 7.79 (s, 1H), 7.71-7.40 (m, 7H), 4.64 (d, J

181

					= 5.8 Hz, 2H).
1246		A, 6	75	366.2 (JVT+1);	(DMS0-<4 400 MHz): δ 10.78 (s, 1H), 8.65 (t, J= 6.0 Hz, 1H), 8.21 (s, 1H), 7.69-7.64 (m, 3H), 7.54-7.43 (m,4H), 6.91 (s, 1H), 3.48 (q, 2H), 2.90 (t,J= 6.8 Hz, 2H);
1247	ο S-_	A, 6	40	382.2 (i^+i);	(DMSO-4₅,400 MHz): δ 10.79 (s, 1H), 8.90 (s, 1H), 8.69-8.68 (m, 1H), 7.687.65 (m, 4H), 7.56-7.45 (m, 4H), 3.47 (q, 2H), 3.09 (t,J= 6.8 Hz, 2H);
1248	0 η	A, 6	28	441.4 (MU-1);	(DMSO-cZî, 400 MHz): δ 10.77 (s, 1H), 8.60 (t, J= 6.4 Hz, 1H), 8.19 (s, 1H), 7.69-7.65 (m, 4H), 7.55-7.43 (m, 6H), 7.34 (d, J =7.6 Hz, 2H), 7.08 (s, 1H), 3.51-3.46 (m, 2H), 2.86 (t, J= 7.6 Hz, 2H);
1249	0 U1U _	A, 6	50	442.4 (ivr+l);	(DMSO-iZ_tf, 400 MHz): δ 10.78 (s, 1H), 9.22 (s, 1H), 8.62-8.61 (m, 1H), 8.20 (s, 1H), 7.75 (d, J= 8.4 Hz, 2H), 7.69-7.63 (m, 3H), 7.55-7.38 (m, 6H), 3.523.47 (m, 2H), 2.87 (t, <7= 6.0 Hz, 2H);

182

1251	0	A, 6	33	444.4 (ΆΤ+1);	(CDC1₃ + CD₃OD, 400 MHz): δ 7.71 (d, .7= 8.0 Hz, 1H), 7.56 (d, J = 8.0 Hz, 1H), 7.51-7.40 (m, 4H), 7.34-7.28 (m, 6H), 4.01 (dd, J= 13.2, 4.8 Hz, 1H), 3.70-3.66 (m, 1H), 3.60-3.55 (m, 1H), 2.852.78 (m, 2H), 2.63-2.50 (m, 2H), 1.83 (t,J= 6.4 Hz, 4H);
1253	οΟύλ t^A·	A, 6	34	418.3 (IVrt+l);	(DMSO-i7_d, 400 MHz): δ 10.76 (s, 1H), 9.69 (s,lH), 9.09 (t, J= 6.0 Hz, 1H), 7.72 (s, 1H), 7.68-7.66 (m, 2H),7.62 (d, J= 8.0 Hz, 1H), 7.55-7.51 (m, 2H), 7.50-7.43 (m, 2H), 7.257.20 (m, 2H), 7.10 (t, J= 7.2 Hz, 1H), 4.41 (d, .7= 5.6 Hz, 2H), 2.08 (s, 3H);
1256		A, 6	46	442.3 (KT+l);	(DMSO-iZtf, 400 MHz): δ 10.78 (brs, 1H), 8.62 (brs, 1H), 8.08 (brs, 2H), 7.92 (d, J= 7.2 Hz, 2H), 7.69-7.65 (m, 3H), 7.547.40 (m, 6H), 3.50-3.49 (m, 2H), 2.88-2.87 (m,2H);
1257	dt-CrVo	A, 6	22	381.9 (NT+1);	(DMSO-îZî, 400 MHz): δ 10.96 (s, 1H), 8.77 (s, 1H), 8.61 (d, J = 5.2 Hz, 1H),

183

					8.47 (t, 7= 5.2 Hz, 1H), 7.70 (s, 1H), 7.66 (d, 7= 8.0 Hz, 1H), 7.60-7.56 (m, 2H), 3.27-3.24 (m, 2H), 1.711.58 (m, 5H), 1.41-1.36 (m, 2H), 1.29-1.09 (m, 4H), 0.910.83 (m, 2H);
1258		A, 6	42	404.9 (M⁺+l);	(DMSO-A, 400 MHz): δ 10.75 (s, 1H), 8.45 (t, 7= 5.6 Hz, 1H), 7.68 (d, 7=7.2 Hz, 1H), 7.61 (d, 7= 8.0 Hz, 2H), 7.54-7.42 (m, 4H), 7.287.15 (m, 5H), 4.67 (t, 7= 5.2 Hz, 1H), 3.613.57 (m, 2H), 3.55-3.48 (m, 2H), 3.10-2.98 (m, 1H);
1259	h ; Όη	A, 6	34	404.9 (M++1);	(DMSO-rifl, 400 MHz): δ 10.74 (s, 1H), 8.43 (t, 7= 5.6 Hz, 1H), 7.67 (d, 7=6.0 Hz, 1H), 7.61 (d, 7= 8.0 Hz, 2H), 7.54-7.42 (m, 4H), 7.287.15 (m, 5H), 4.65 (t, 7= 5.2 Hz, 1H), 3.623.57 (m, 2H), 3.55-3.45 (m, 2H), 3.06-2.99 (m, 1H);
1260	0	A, 6	59	403.5 (MV1);	(CD₃OD + CDClj, 400 MHz): δ 7.73 (d, 7= 7.6 Hz, 1H), 7.62 (d, 7 = 8.0 Hz, 2H), 7.59-7.41 (m, 4H), 7.17 (t, 7= 7.2 Hz, 1H),

184

						7.03 (t,J= 7.6 Hz, 2H), 3.55 (t,J= 7.6 Hz, 2H), 2.86 (t, J= 7.6 Hz, 2H), 2.58 (q, 2H), 1.16 (t,J= 7.6 Hz, 3H);
1264		O / ^NH /9 CXs-X^/hv% <W		D, 6	73	352.1 (M+l)⁺	Ή NMR (400 MHz, DMSOd₆) δ 10.74 (s, 1H), 9.04 (t, J = 5.6 Hz, 1H), 8.24 (s, 1H), 7.68-7.59 (m, 3H), 7.56 (dd, J = 8.2,1.9 Hz, 1H), 7.53-7.38 (m, 3H), 7.00 (s, lH),4.47(d, J =5.5 Hz, 2H).
1266	0 LA -A4 «n	A, 6	41	442.5 (M⁺+l);		(DMSO-4_à, 400 MHz): δ 10.78 (s, 1H), 8.76 (s, 1H), 8.62 (t,J= 5.6 Hz, 1H), 7.94 (s, 1H), 7.80 (d,J=8.0 Hz, 2H), 7.697.63 (m, 3H), 7.55-7.42 (m, 6H), 3.51 (q, 2H), 2.90 (t,J= 6.8 Hz, 2H);
1267	û CQm	A, 6	43	442.5 (M++1);		(DMSO-di, 400 MHz): δ 10.80 (s, 1H), 9.10 (s, 2H), 8.63-8.61 (m, 1H), 7.747.57 (m, 6H), 7.56-7.36 (m, 5H), 3.52-3.46 (m, 2H), 2.912.89 (m, 2H);
1270	0 ZW ''H CQv '-’S	A, 6	41	365.3 (MM);		(DMSO-</_d, 400 MHz): δ 12.5012.36 (m, 1H), 10.77 (s, 1H), 8.60 (br s, 1H), 7.69-7.63 (m, 3H), 7.57-7.34 (m, 5H), 6.06

185

					(brs, 1H), 3.49- 3.44 (m, 2H), 2.82-2.78 (m, 2H);
1271	0 vCQm	A, P-42	28	411.8 (MX);	(DMSO-A 400 MHz): δ 10.59 (s, 1H), 8.43 (t, .7= 5.6 Hz, 1H), 7.65-7.59 (m, 3H), 7.55 (d, J = 8.4 Hz, 1H), 7.06 (s, 1H), 7.01 (d, .7=8.8 Hz, 1H), 3.80 (s, 3H), 3.263.23 (m, 2H), 1.71-1.58 (m, 5H), 1.41-1.36 (m, 2H), 1.291.23 (m, 1H), 1.19-1.09 (m, 3H), 0.91-0.83 (m, 2H);
1273		A, P-8	29	395.9 (MX);	(DMSO-A 400 MHz): δ 10.66 (brs, 1H), 8.43 (t, J= 5.6 Hz, 1H), 7.64-7.53 (m, 4H), 7.36 (s, 1H), 7.26 (d, J= 7.6 Hz, 1H), 3.26-3.21 (m, 2H), 2.30 (s, 3H), 1.70-1.58 (m, 5H), 1.411.35 (m, 2H), 1.28-1.14 (m, 4H), 0.91-0.83 (m,2H);
1274		A, P-51	55	395.5 (M⁺+l);	(DMSO-A 400 MHz): δ 10.70 (brs, 1H), 8.42 (t, J= 5.2 Hz, 1H), 7.62 (t,J= 5.6 Hz, 2H), 7.54 (d,J=7.2 Hz, 1H), 7.49 (s, lH),7.40(d, J= 7.6 Hz, 1H), 7.29 (d,J=7.6 Hz, 1H), 3.263.21 (m, 2H), 2.29 (s, 3H),

186

					1.70-1.62 (m, 5Η), 1.40-1.35 (m, 2Η), 1.26- 1.09 (m,4H), 0.95-0.83 (m, 2H);
1279	0 îl'^Vs/	Α, 135	50	418.8 (M*+l)	(DMSO-d_ft 500 MHz): δ 10.89 (s, 1H), 8.628.61 (m, 1H), 8.14 (s, 1H), 8.00 (s, 1H), 7.89 (d, 7=8.0 Hz, 1H), 7.75 (d, 7= 8.0 Hz, 1H), 7.66(d, 7 = 7.0 Hz, 2H), 7.55 (d,7=7.5 Hz, 2H), 7.297.26 (m, 2H), 7.22-7.17 (m, 3H), 3.47-3.43 (m, 2H), 2.80 (t, 7= 7.5 Hz, 2H);
1283	Ο,ΌιιΊΟ Et	Α, 6	35	389.5 (W+1);	(DMSO-A, 400 MHz): δ 10.77 (s, 1H), 9.04 (t, 7= 5.6 Hz, 1H), 7.71-7.61 (m, 4H), 7.55-7.43 (m, 3H), 7.21 (t, 7= 7.6 Hz, 1H), 7.12-7.08 (m, 3H), 4.41 (d,7 = 5.6 Hz, 2H), 2.59-2.55 (m, 2H), 1.15 (t, 7= 7.6 Hz, 3H);
1285	0 ^FY^?xt^nh	Α, 35	55	399.7 (MM);	(DMSO-4,400 MHz): δ 10.88 (s, 1H), 8.46 (t, 7= 6.8 Hz, 1H), 7.66-7.62 (m, 2H), 7.58-7.55 (m, 2H), 7.46 (d, 7= 7.2 Hz, 1H), 7.38 (t, 7= 7.2 Hz, 1H), 3.28- 3.24 (m, 2H), 1.74-1.56 (m, 5H), 1.421.38 (m,2H), 1.28- 1.26 (m,

187

						1H), 1.22-1.08 (m, 3H), 0.940.85 (m, 2H);
1290	0 wih 9 .. fAfA-A	A, 6	29	377.5 (lvT+1);		(DMSO-4, 500 MHz): δ 10.77 (s, 1H), 9.01 (s, 1H), 8.66 (s, 2H), 7.69-7.62 (m, 4H), 7.557.44 (m, 4H), 3.54-3.51 (m, 2H), 2.85 (t, 7= 5.6 Hz, 2H);
1291	0. wlH P HN«N OMuA XAsAJ h AJ	A, 6	60	442.6 (MA1);		(DMSO-7_d, 400 MHz): δ 15.01 (brs, 1H), 10.77 (s, 1H), 8.61 (t, 7=5.6 Hz, 1H), 8.25 (brs, 1H), 7.76 (d, 7= 8.0 Hz, 2H), 7.69-7.63 (m, 3H), 7.557.43 (m, 4H), 7.30 (d,7=8.4 Hz, 2H), 3.503.45 (m, 2H), 2.84 (t, 7= 7.2 Hz, 2H);
1160	0 / ^NH iï U^'S'V' H T^OMe	A, 6, 171 (a = solvent DMF: CH₂C1₂ 1:1)	52	391.3 (M*+l);	390.10 for C₂₂H₁₈N₂O ₃S	‘H-NMR DMS 400 MHz): δ 10.77 (s, 1H), 9.05 (t, 7= 5.6 Hz, 1H), 7.71-7.61 (m, 4H), 7.55-7.45 (m, 3H), 7.21 (t, 7= 8.0 Hz, 1H), 6.85-6.79 (m, 3H), 4.41 (d,7 = 5.6 Hz, 2H), 3.71 (s, 3H);
1162	0 /-f ^NH J ΑΑ^Ά' ^ocf₃	D, 6,172	55	445.4 (W+l)	444.08 for c₂₂h_I5f₃n 2θ3	‘H-NMR DMSO-7_d, 400 MHz): δ 10.78 (s, 1H), 9.13 (t, 7= 6.0 Hz, 1H), 7.72-7.61 (m, 4H), 7.55-7.39 (m, 5H), 7.30 (d, 7= 8.0 Hz, 2H), 4.46 (d, 7

188

						= 6.0 Hz, 2H);
1167	ο ί'Ύ . ο	A, 6,173	54	379.3 (MM);	378.08 for C21H15FN2 0₂S	‘H-NMR DMSO-A, 400 MHz): δ 10.76 (s, 1H), 9.079.04 (m, 1H), 7.71-7.61 (m, 4H), 7.55-7.43 (m, 3H), 7.347.27 (m, 2H), 7.19-7.12 (m, 2H), 4.47 (d, J = 4.8 Hz, 2H);
1170	Η	A, 6,174	63	433.3 (MM);	432.19 for C26H28N2O 2S	‘H-NMR DMSO-ifo 400 MHz): δ 10.77 (brs, 1H), 8.40 (t, .7= 4.8 Hz, 1H), 7.69-7.62 (m, 3H), 7.557.43 (m, 4H), 3.25-3.20 (m, 2H), 1.91-1.90 (m, 3H), 1.671.58 (m, 6H), 1.49-1.47 (m, 6H), 1.30-1.26 (m, 2H);
1189	0 ζ^Λ-νη ί 1 Ρ	A, 6,175	40	419.2 (MM);	418.17 for Ο2₅Η₂₆Ν₂Ο ₂s	‘H-NMR DMSO-<Z_à, 400 MHz): δ 10.74 (s, 1H), 8.29 (t, J= 6.0 Hz, 1H), 7.69-7.63 (m, 3H), 7.59-7.43 (m, 4H), 2.94 (d, J =6.4 Hz, 2H), 1.93-1.91 (m, 3H), 1.661.56 (m,6H), 1.46 (s, 6H);
1192	0 ζ^Ζ^ΝΗ ('λ /? ~~ n^M-OPh	A, 6,176	35	391.2 (MM);	390.10 for C₂2H₁₈N₂O 3S	‘H-NMR DMSO-rftf, 400 MHz): δ 10.77 (s, 1H), 8.74 (t, J= 6.0 Hz, 1H), 7.69-7.64 (m, 3H), 7.60-7.58 (m, 1H), 7.547.43 (m, 3H), 7.28 (t, J =8.4 Hz, 2H), 6.92

189

						(t, .7= 8.4 Hz, 3H), 4.07 (t,J= 6.0 Hz, 2H), 3.59 (q,2H);
1175	0 Q Rj H	D, 6,177	59	384.3 (MM);	383.13 for C20H21N3O ₃s	‘H-NMR DMSO<4, 400 MHz): δ 10.77 (s, 1H), 8.43 (t, J= 4.8 Hz, 1H), 7.69-7.64 (m, 3H), 7.56-7.43 (m, 4H), 3.553.53 (m, 4H), 3.35-3.33 (m, 2H), 2.50 (s, 2H), 2.44-2.38 (m, 4H);
1208	0 χ^ΛΝΗ \|[ ji 9 ^s \=/hn-\ °q	A, 6, 265	33	409.1 (M⁺+l);	408.09 for C22H17FN2 O₃S	‘H-NMR DMSO-<7_d, 400 MHz): δ 10.77 (s, 1H), 8.72 (t, .7= 5.2 Hz, 1H), 7.69-7.58 (m, 3H), 7.55 (s, 1H), 7.53-7.45 (m, 3H), 7.09 (t, J= 8.8 Hz, 2H), 6.96-6.93 (m, 2H), 4.06 (t,J= 5.2 Hz, 2H), 3.58 (d, .7=5.6 Hz, 2H);
1217	0	A, 6, 269	28	399.3 (MM);	398.15 for C22H23FN2 o₂s	‘H-NMR (DMSO-rf_tf, 400 MHz): δ 10.76 (s, 1H), 8.45 (t, J= 5.6 Hz, 1H), 7.65-7.63 (m, 3H), 7.56-7.45 (m, 4H), 4.844.72 (m, 1H), 3.30-3.29 (m, 2H), 1.87-1.78 (m, 3H), 1.541.51 (m, 2H), 1.42-1.41 (m, 4H), 1.21-1.18 (m, 2H);

190

1238	0 Ci JSv OMe	A, 6,273	37	371.2 (M⁺+l);	370.14 for C20H22N2O ₃s	‘H-NMR (DMSO-7_tf, 400 MHz): δ 10.74 (s, 1H), 8.41 (t, J= 5.6 Hz, 1H), 7.69-7.63 (m, 3H), 7.55-7.41 (m, 4H), 3.283.22 (m, 2H), 3.10 (s, 3H), 1.66 (t, 7=8.4 Hz, 2H), 1.11 (s, 6H);
1252	0 o	A, 6,277	22	458.4 (MX1);	457.18 for C₂₇H27N₃O ₂s	‘H-NMR (CDCI3 + CD3OD, 400 MHz): δ 7.73 (d, 7= 7.6 Hz, 1H), 7.61 (d, 8.0 Hz, 1H), 7.52 (d, 7= 8.4 Hz, 2H), 7.487.46 (m, 3H), 7.45-7.31 (m, 4H), 7.26 (d, 7 = 6.8 Hz, 1H), 3.31-3.30 (m, 1H), 3.25-3.17 (m, 1H), 3.063.00 (m, 1H), 2.68-2.67 (m, 2H), 2.44-2.42 (m, 2H), 2.362.28 (m, 1H), 2.13-2.04 (m, 1H), 1.78 (t, 7= 6.4 Hz, 4H);
1219	0 x^Xn^h Uk J^W ?^H	A, 6,178	59	376.9 (Nf+1)	C₂iH₁₆N₂O 3S 376.09	‘H-NMR (DMSO-7tf, 400 MHz): δ 10.75 (s, 1H), 9.50 (s, 1H), 8.91(1:, 7= 6.0Hz, 1H), 7.72-7.65 (m, 4H), 7.55-7.43 (m, 3H), 7.087.03 (m, 2H), 6.79 (d, 7=7.6 Hz, 1H), 6.72 (t, 7= 7.2 Hz, 1H), 4.3 8 (d, 7 = 5.6 Hz, 2H);

191

1223	ο	Α, 6,179	59	347.2 (Μ*+1);	C20H14N2O ₂S 346.08	‘H-NMR (DMSO-4,400 MHz): δ 10.80 (s, 1H),10.25 (s, 1H), 7.75-7.71 (m, 6H), 7.55 (brs, 1H), 7.49 (t, 7= 8.8 Hz, 2H), 7.32 (t, 7= 6.8Hz, 2H), 7.10 (t, 7=7.2 Hz, 1H);
1229	ο ΗΟ	D, 6,180	34	363.5 (ΝΤΜ)	C₂oH_I4N20 3S 362.07	‘H-NMR (DMS0-7_d, 400 MHz): δ 10.81 (s, 1H), 9.71 (br s, 1H), 9.51 (br s, 1H), 7.76 (s, 1H), 7.71 (s, 3H), 7.64 (d, 7 = 8.4 Hz, 1H), 7.57-7.45 (m, 3H), 7.02 (t, 7= 6.8 Hz, 1H), 6.90 (d, 7=7.2 Hz, 1H), 6.81 (t, 7= 8.0 Hz, 1H);
1230	0 Η ^Ν	Ε, 6,181	35	348.4 (ΚΤ+1)	Ci₉H₁₃N₃O 2S 347.07	‘H-NMR (DMS0-7_tf, 500 MHz): δ 10.8510.82 (m, 2H), 8.38 (brs, 1H), 8.14 (d, 7= 8.0 Hz, 1H), 7.837.67 (m, 5H), 7.57-7.47 (m, 3H), 7.16 (t, 7= 7.5 Hz, 1H);
1231	0 Η	Β, 6,182	61	348.2 (MM);	C₁₉Hi₃N₃O 2S 347.07	‘H-NMR (DMSO-7_d, 400 MHz): δ 10.85 (s, 1H), 10.48 (s, 1H), 8.88 (s, 1H), 8.31 (s, 1H), 8.15 (d, 7 = 8.4 Hz, 1H), 7.78-7.70 (m, 4H), 7.57-7.45 (m, 3H), 7.407.37 (m, 1H);

192

1242	0 if^i ^NH AcHN	A, 6,183	28	404.2 (MV1);	c₂₂h₁₇n₃o ₃S 403.10	‘h-nmr (DMSO-iZ_tf, 400 MHz): δ 10.85 (s, 1H), 9.85 (s, 1H), 9.61 (s, 1H), 7.76 -7.68 (m,4H), 7.57 (t, J= 6.8 Hz, 2H), 7.53-7.47 (m, 3H), 7.19 (t, J = 4.4 Hz, 2H), 2.05 (s, 3H);
1243	0 /W' NH H NHAc	A, 6,184	51	404.3 (M⁺+l);	C₂₂H[₇N₃O ₃S 403.10	‘H-NMR (DMSO-4,400 MHz): δ 10.82 (brs, 1H), 10.29 (br s, 1H), 9.95 (brs, 1H), 8.06 (s, 1H), 7.75-7.70 (m, 4H), 7.577.47 (m, 3H), 7.37 (d,J= 7.6 Hz, 1H), 7.32 (d, J= 7.2 Hz, 1H), 7.23 (t,J= 7.6 Hz, 1H), 2.03 (s, 3H);
1444	O /“^NH P r===\	A, 6,185	32	347.9 (M⁺+l);	Ci₉H_I3N₃O ₂S 347.07	‘H-NMR (DMSO-d_d, 400 MHz): δ 10.85 (s, 1H), 10.62 (s, 1H), 8.48 (d, J= 6.1 Hz, 2H), 7.79-7.69 (m, 6H), 7.60-7.45 (m, 3H);
1445	O -Jz-NH /? «SX ^N^-A	A, 6,186	25	423.1 (KU+1);	C₂eHi8N₂O ₂s 422.11	‘H-NMR (DMSO-d_d, 400 MHz): δ 10.85 (s, 1H), 10.36 (s, 1H), 8.078.04 (m, 1H), 7.80-7.70 (m, 5H), 7.65-7.61 (m, 2H), 7.57 (dd, .7=7.7,1.6 Hz, 1H), 7.547.35 (m, 7H);

193

1567	ο. / / ^NH /? ^SZ\ ovv	A, 6, 187	44	396.9 (M>1);	C19H16N4O 2S2 396.07	‘H-NMR (DMSO-^, 400 MHz): δ 10.79 (s, 1H), 8.72 (t, J= 5.3 Hz, 1H), 7.71-7.63 (m, 3H), 7.59-7.41 (m, 4H), 3.59 (q, 7= 6.3 Hz, 2H), 3.29-3.25 (m, 2H), 2.66 (s, 3H);
1568	o nh₂ /~^NH 9 ^SA	A, 6, 188	55	398.0 (Nf+l)	c_1sh₁₅n₅o ₂S₂ 397.07	‘H-NMR (DMS 0-7,5,400 MHz): δ 10.78 (s, 1H), 8.69 (t, 7= 5.4 Hz, 1H), 7.74-7.63 (m, 3H), 7.60-7.43 (m, 4H), 6.97 (s, 2H), 3.51 (q, 7= 6.6 Hz, 2H), 3.03 (t, 7= 6.7 Hz, 2H);
1582	0, / ^NH /9 o-/ fï ΠΑ-Α'^Ν	B, 6,189	63	456.1 (MM);	C20H17N5O 4S2 455.07	‘H-NMR (DMSO-7,5,400 MHz): δ 10.78 (s, 1H), 8.71 (t, 7= 5.4 Hz, 1H), 7.74-7.62 (m, 4H), 7.56-7.41 (m, 4H), 7.32 (brs, 1H), 3.99 (s, 2H), 3.58 (q, 7= 6.5 Hz, 2H), 3.06 (t, 7=6.6 Hz, 2H);
1569	0 / ^NH 1? \kJ / n-^^n-n H ^N	A, 6,190	75	377.1 (Nf+1)	C20H46N4O ₂S 376.10	‘H-NMR (DMSO-75,400 MHz): δ 10.76 (s, 1H), 9.07 (dd, 7=4.4,2.0 Hz, 1H), 8.64 (t, 7= 5.5 Hz, 1H), 7.71-7.41 (m, 9H), 3.683.62 (m, 2H), 3.14 (t, 7= 7.0 Hz, 2H);

194

1551	0 /? hn-λ	A, 6,191	22	366.0 (M⁺+l);	Ci₈H₁₅N₅O ₂S 365.09	‘H-NMR (DMS0-d_d, 400 MHz): δ 13.67 (brs, 1H), 10.77 (s, 1H), 8.64 (brs, 1H), 8.42 (br s, 0.4H), 7.82 (br s, 0.6H), 7.717.62 (m, 3H), 7.58-7.42 (m, 4H), 3.55 (q, J = 6.7 Hz, 2H), 3.00-2.82 (m, 2H);
1583	q. / /-NH P _HN_-Z ζΧ-Ο'Λ''^'	B^a, 6,192 (a=RT8h)	51	380.1 (M⁺+l);	Ci₉Hi₇N₅O ₂S 379.11	‘H-NMR (DMSO-di, 500 MHz): δ 13.24 (d, .7= 9.8 Hz, 1H), 10.77 (br s, 1H), 8.698.57 (m, 1H), 7.71-7.63 (m, 3H), 7.58-7.43 (m, 4H), 3.563.47 (m, 2H), 2.87 (t, .7=7.1 Hz, 1H), 2.76 (t, J=7.5 Hz, 1H), 2.31-2.16 (s, 3H);
1570	v -P COOt^'”	A, 6,193	46	432.0 (M⁺+l);	θ2₂Ηι₇Ν5θ ₃s 431.11	'H-NMR (DMSO-d_à, 400 MHz): δ 13.80 (brs, 1H), 10.77 (s, 1H), 8.69 (brs, 1H), 7.74 (brs, 1H), 7.70-7.65 (m, 2H), 7.64 (s, 1H), 7.58-7.43 (m, 4H), 6.84 (brs, 1H), 6.59 (brs, 1H), 3.623.55 (m, 2H), 3.00-2.91 (m, 2H);
1552	_JX^NH ο OsÎ^rÇS >r^N	A, 6,194	31	442.1 CVr+1);	C24H49N5O ₂s 441.13	‘H-NMR (DMSO-de, 400 MHz): δ 13.62 (brs, 1H), 10.75 (s, 1H), 9.01 (brs, 1H),

195

						8.38 (br s, 0.5H), 7.77 (br s, 0.5H), 7.717.62 (m, 3H), 7.60-7.42 (m, 4H), 7.37-7.32 (m,2H), 7.27 (t, J= 7.5 Hz, 2H), 7.22-7.17 (m, 1H), 5.47 (q, J = 7.7 Hz, 1H), 3.39-3.33 (m, 1H), 3.27-3.17 (m, 1H);
1571	0 ^NH /? Ck /Fp ^νύ^ν'_ΜH T^N	A, 6,195	86	369.0 (Mri-1);	c₁₇h₁₂n₄o ₂S₂ 368.04	‘H-NMR (DMSO-<7₆,400 MHz): δ 10.79 (s, 1H), 9.539.48 (m, 2H), 7.73-7.67 (m, 3H), 7.62 (dd, J = 8.0,1.8 Hz, 1H), 7.57-7.43 (m, 3H), 4.86 (d, J =5.9 Hz, 2H);
1584	O _ nh P Ovum S ^H N=/	A, 6,196	54	367.9 (MM);	c_I8h₁₃n₃o ₂s₂ 367.04	‘H-NMR (DMSO-ίήί, 400 MHz): δ 10.77 (s, 1H), 9.10 (t, J= 5.7 Hz, 1H), 9.04 (s, 1H), 7.74-7.62 (m, 4H), 7.57-7.42 (m, 4H), 4.58 (d, J=5.6Hz, 2H);
1599	0 z-J' ^NH /? fX Xt'n'Vn H _hT^n	A, 6,197	23	352.1 (M⁺+l);	Ci₇H₁₃N₅O ₂s 351.08	‘H-NMR (DMSO-cZ,;, 400 MHz): δ 13.77 (brs, 1H), 10.79 (br s, 1H), 9.06 (brs, 1H), 8.33 (brs, 1H), 7.74-7.60 (m, 4H), 7.577.42 (m, 3H), 4.51 (d,J=4.8 Hz, 2H);

196

1572	0	A, 6,198	50	361.9 (MV1);	C20H15N3O 2S 361.09	‘H-NMR (DMSO-rfi, 400 MHz): δ 10.78 (s, 1H), 9.16 (t, J= 5.9 Hz, 1H), 8.48 (d, J =5.9 Hz, 2H), 7.767.63 (m, 4H), 7.57-7.42 (m, 3H), 7.27 (d,7 = 5.5 Hz, 2H), 4.46 (d, 7=5.7 Hz, 2H);
1585	0 / ^NH /? UkAV n Ύ *1 X/ s H l^_N	A, 6,199	64	362.9 (M^+l);	C_I9H₁₄N₄O 2S 362.08	‘H-NMR (DMSO-J_à, 400 MHz): δ 10.79 (s, 1H), 9.22 (t, 7= 5.3 Hz, 1H), 9.09 (s, 1H), 8.71 (d, 7=5.2 Hz, 1H), 7.74 (s, 1H), 7.727.65 (m, 3H), 7.57-7.44 (m, 3H), 7.39 (d, J = 4.9 Hz, 1H), 4.52 (d, 7=5.9 Hz, 2H);
1586	O /A^NH /?	A, 6, 200	60	362.9 (MV-1);	C₁₉H₁₄N₄O 2S 362.08	‘H-NMR (DMS0-<4 400 MHz): δ 10.78 (s, 1H), 9.22 (t, 7= 5.7 Hz, 1H), 8.61 (s, 1H), 8.58- 8.56 (m, 1H), 8.54-8.51 (m, 1H), 7.73 (s, 1H), 7.717.63 (m, 3H), 7.57-7.43 (m, 3H), 4.59 (d, 7 = 5.7 Hz, 2H);
1587	0 _pNH /9 fX IYWs H 11 J	A, 6, 201	67	362.9 CVT+1);	Ci₉H_i4N₄O ₂s 362.08	‘H-NMR (DMSO-7,, 400 MHz): δ 10.80 (s, 1H), 9.10 (t, 7= 5.8 Hz, 1H), 8.74 (d,7=4.9 Hz, 2H), 7.73 (s, 1H), 7.717.65 (m, 3H), 7.57-7.43 (m, 3H), 7.38 (t, 7=

197

						4.9 Hz, 1H), 4.63 (d, .7=5.9 Hz, 2H);
1588	ο 'f-νη 9 CX ΧΧ^ΝΎ% Η Τ^Ν Me	A, 6, 202	71	381.9 (M⁺+l);	c₁₉h₁₅n₃o 2S2 381.06	*H-NMR (DMSO-cZ₅, 400 MHz): δ 10.77 (s, 1H), 9.17 (t, J= 5.7 Hz, 1H), 7.71-7.64 (m, 3H), 7.59-7.42 (m, 5H), 4.55 (d, 7=5.6 Hz, 2H), 2.57 (s, 3H);
1589	0 _JE-NH /? Γκ /Γ/ Η Τγ CI	A, 6, 203	72	401.9 (MM);	C₁₈H₁₂C1N ₃O₂S₂ 401.01	‘H-NMR (DMSO-d_6>400 MHz): δ 10.77 (s, 1H), 9.28 (t, J= 5.7 Hz, 1H), 7.72-7.64 (m, 3H), 7.61-7.42 (m, 5H), 4.55 (d, .7= 5.4 Hz, 2H);
1590	0 _Χ ΝΗ 0 xAs-U' H Ο	A, 6, 204	65	443.9 (NT+1);	C₂₄H₁₇N₃O ₂S₂ 443.08	‘H-NMR (DMSO-î4,400 MHz): δ 10.78 (s, 1H), 9.28 (t, .7= 5.7 Hz, 1H), 7.90-7.86 (m, 2H), 7.79 (s, 1H), 7.73-7.66 (m, 3H), 7.61 (dd, 7=8.2,1.8 Hz, 1H), 7.567.42 (m, 6H), 4.66 (d,7=5.6 Hz, 2H);
1600	ο Ζ'Χ-Νγ'νΧ ^Me	A, 6,205	28	382.0 (KT+i);	C₁₉H_I5N₃O ₂S₂ 381.06	‘H-NMR (DMSO-7₆ 400 MHz): δ 10.76 (s, 1H), 9.15 (t, 7= 5.7 Hz, 1H), 8.83 (s, 1H), 7.70-7.64 (m, 3H), 7.59-7.43 (m, 4H), 4.55 (d, 7= 5.7 Hz, 2H), 2.39 (s, 3H);

198

1605	p xY hX	A⁰, 6,206 ô=24hRT	32	443.9 (ΜΦ1);	C₂₄H_I7N₃O ₂s₂ 443.08	‘H NMR (DMSO-<Z₆,400 MHz): δ 10.78 (s, 1H), 9.34 (t, J= 5.5 Hz, 1H), 9.02 (s, 1H), 7.74-7.66 (m, 5H), 7.60 (dd, J = 8.1,1.8 Hz, 1H), 7.56-7.39 (m, 6H), 4.74 (d, <7=5.5 Hz, 2H);
1525	O_x NH 0 O-s'C' ^NHz	B, 6,133	73	270.8 (JVT+1);	C₁₄H₁₀N₂O ₂S 270.05	‘H-NMR (DMSO-d_fi, 400 MHz): δ 10.77 (s, 1H), 7.99 (br s, 1H), 7.727.58 (m, 4H), 7.56-7.43 (m, 4H);
1592	0 Υχ^{- N}y\--A	A, 6,207	23	354.9 (Μ*+1)	C19H18N2O ₃s 354.10	‘H-NMR (DMSO-φ, 400 MHz): δ 10.75 (brs, 1H), 8.55 (t, J= 5.4 Hz, 1H), 7.71-7.62 (m, 3H), 7.607.43 (m, 4H), 3.98-3.89 (m, 1H), 3.79-3.72 (m, 1H), 3.653.57 (m, 1H), 3.29-3.25 (m, 2H), 1.93-1.73 (m, 3H), 1.611.49 (m, 1H);
1606	0 ^NH P 0¼ *-ο	A, 6,208	23	354.9 (JVT+1);	C₁₉H_1SN₂O 3S 354.10	‘H-NMR (DMSO-φ, 400 MHz): δ 10.75 (brs, 1H), 8.60 (t, J= 5.5 Hz, 1H), 7.71-7.63 (m, 3H), 7.59 7.43 (m, 4H), 3.76-3.56 (m, 3H), 3.43 (dd, J = 8.5, 5.4 Hz, 1H), 3.26-3.14 (m, 2H), 2.472.38 (m, 1H), 1.96-1.86 (m, 1H), 1.63-1.51

199

						(m, 1H);
1607	0	A, 6,209	22	354.9 (MM);	C20H20N2O 3S 368.12	‘H-NMR (DMSO-A, 400 MHz): δ 10.75 (s, 1H), 8.51 (t, J= 5.6 Hz, 1H), 7.71-7.62 (m, 3H), 7.60-7.43 (m, 4H), 3.82 (dd, 7=11.2, 2.5 Hz, 2H), 3.27-3.20 (m, 2H), 3.12 (t, 7= 6.3 Hz, 2H), 1.81-1.69 (m, 1H), 1.61-1.51 (m, 2H), 1.241.10 (m,2H);
1578	0 ~~~ ^{s H}X-t?	A, 6,210	30	367.0 (MM);	C18H14N4O ₃s 366.08	‘H-NMR (DMSO-A, 400 MHz): δ 10.79 (s, 1H), 9.26 (t, 7= 5.7 Hz, 1H), 7.72-7.67 (m, 3H), 7.62 (dd, 7 = 7.9,1.8 Hz, 1H), 7.57-7.43 (m, 3H), 4.63 (d, 7= 5.6 Hz, 2H), 2.45 (s, 3H);
1603	°k\ / / ^NH /9 OM 0L_sJQX-^v	A, 6,283	70	381.0 (M%1);	Q9H16N4O 3S 380.09	‘H-NMR (DMSO-A, 400 MHz): δ 10.78 (s, 1H), 8.69 (t, 7= 5.7 Hz, 1H), 7.70-7.62 (m, 3H), 7.56-7.42 (m, 4H), 3.58 (q, 7= 6.6 Hz, 2H), 3.03 (t, 7= 6.8 Hz, 2H), 2.43 (s, 3H);
1604	0 >-nh /9 H Τγ Et	B, 6, 292	89	395.9 (MM);	c₂₀h₁₇n₃o 2S2 395.08	‘H-NMR (CDClj, 400 MHz): δ 10.77 (s, 1H), 9.18 (t, 7= 5.7 Hz, 1H), 7.71-7.64 (m, 3H), 7.60-7.43 (m, 5H), 4.56 (d, 7= 5.6 Hz,

200

						2H), 2.90 (q, J = 7.5 Hz, 2H), 1.24 (t, .7=7.5 Hz, 3H);
1611	0 ΝΠ 0 H	B, 6,298	73	410.0 (M*+i);	C21H49N3O 2S2 409.09	‘H NMR (DMSO-^,400 MHz): δ 10.77 (s, 1H), 9.18 (t, J= 5.7 Hz, 1H), 7.72-7.64 (m, 3H), 7.61-7.42 (m, 5H), 4.57 (d, J=5.6Hz, 2H), 3.22-3.15 (m, 1H), 1.27 (d, .7= 6.9 Hz, 6H);
1612	0 _y- nh o fx JP/ ^nXV\i OCH₃	B, 6,300	59	397.9 (NT+1);	C19H45N3O 3S2 397.06	‘H NMR (DMSO-îZ₆,400 MHz): δ 10.76 (s, 1H), 9.15 (t, J= 5.6 Hz, 1H), 7.71-7.63 (m, 3H), 7.60-7.42 (m, 4H), 7.06 (s, lH),4.44(d, .7= 5.6 Hz, 2H), 3.95 (s, 3H);
1613	0 _ JXnh /? H T^N nh₂	A, 6, 303	23	382.9 (KT+1);	C18H14N4O 2S2 382.06	‘H NMR (DMSO-4400 MHz): δ 10.76 (s, 1H), 9.00 (t, J= 5.5 Hz, 1H), 7.72-7.42 (m, 7H), 6.88 (brs, 2H), 6.81 (s, 1H), 4.35 (d, J = 5.5 Hz, 2H);
1638	O __Χνη_ο ^{s H}Pç» _ZNH	A, 6, 308	53	396.9 (Nf+l);	C₁₉H_i6N₄O 2S2 396.07	‘H NMR (DMSO-<4.500 MHz): δ 10.77 (s, 1H), 9.03 (t, .7= 5.6 Hz, 1H), 7.69-7.62 (m, 3H), 7.59-7.42 (m, 4H), 7.347.30 (m, 1H), 6.87 (s, 1H), 4.36 (d,J= 5.8 Hz, 2H), 2.72 (d, .7= 4.9 Hz, 3H);

201

1639	0 >-NH /? ^νΧν W-sXX H T^N N— /	A, 6,311	61	411.0 (MX);	C₂₀H₁₈N₄O ₂s₂ 410.09	‘H NMR (DMSO-A 400 MHz): δ 10.75 (s, 1H), 9.05 (t, J= 5.7 Hz, 1H), 7.72-7.62 (m, 3H), 7.59-7.42 (m, 4H), 6.99 (s, 1H), 4.41 (d, J=5.5Hz,2H), 2.95 (s, 6H);
1631	0 —N H 0 Et \ Jl νΧα. XsAW H T^N	A, 6,319	15	395.9 (MX);	C₂oH₁₇N₃0 ₂S₂ 395.08	‘H-NMR (DMSO-A 400 MHz): δ 10.78 (s, 1H), 8.69 (t, J= 5.7 Hz, 1H), 7.70-7.62 (m, 3H), 7.56-7.42 (m, 4H), 3.58 (q, J= 6.6 Hz, 2H), 3.03 (t,J= 6.8 Hz, 2H), 2.43 (s, 3H);
1614	0 _ XnH 0 X- H	A, 6,327 (Reaction time 24h)	27	409.9 (MX);	C_2IH₁₉N₃O 2S2 409.09	‘H NMR (DMSO-4400 MHz): δ 10.77 (s, 1H), 9.15 (t, J= 5.8 Hz, 1H), 8.84 (s, 1H), 7.70-7.64 (m, 3H), 7.59-7.42 (m, 4H), 4.58 (d, .7=5.9 Hz, 2H), 3.32-3.29 (m, 1H), 1.21 (d, .7= 6.8 Hz, 6H);
1632	0 _XnH /? ^Cl \ X. Λ ⁿXm XsAW H T JM	A, 6, 337	33	401.9 (MX);	C1₈H_I2C1N ₃O₂S2 401.01	‘H NMR (DMSO-A400 MHz): δ 10.77 (s, 1H), 9.31 (t, J= 5.5 Hz, 1H), 9.01 (s, 1H), 7.73-7.65 (m, 3H), 7.59 (dd, J = 7.9,1.8 Hz, 1H), 7.56-7.42 (m, 3H), 4.57 (d, .7= 5.7 Hz, 2H);

202

1640	0 / ^NH /? W^S'M H Uo	A, 6, 341 (Reaction time 12 h)	16	341.0 (Mf+1);	Ci₈Hi₆N₂O ₃s 340.09	‘H NMR (DMSO-J_d,400 MHz): δ 10.75 (s, 1H), 8.62 (t, J= 5.5 Hz, 1H), 7.70-7.63 (m, 3H), 7.59-7.43 (m, 4H), 4.60 (dd, .7=7.8, 6.0 Hz, 2H), 4.31 (t, J= 6.0 Hz, 2H), 3.50 (dd, J = 7.8, 6.0 Hz, 2H), 3.17-3.09 (m, 1H).
1235	0 Clx^xJ^NH θ ^sUvhn-_v_q	A, 14, 261	45	415.4 (M-+1);	C₂₂H₂₃C1N ₂O₂S 414.12	‘h-nmr (CDC1₃,400 MHz): δ 8.16 (brs, 1H), 7.81 (s, 1H), 7.61 (d, J= 8.0 Hz, 1H), 7.57 (s, 1H), 7.45-7.42 (m, 2H), 7.39-7.36 (m, 1H), 5.995.98 (m, 1H), 3.48-3.43 (m, 2H), 1.75-1.67 (m, 5H), 1.571.46 (m,2H), 1.34-1.31 (m, 1H), 1.27-1.16 (m, 3H), 0.980.92 (m, 2H);
1250	0 ^/'nk ⁸^=/ί»-χ)	A, 21, 261 (285 mg)	45	415.5 (κΓ+ΐ)	C₂₂H₂₃C1N ₂O₂S 414.12	‘H-NMR (CDC1₃,400 MHz): δ 8.70 (s, 1H), 7.77 (d, J= 8.4 Hz, 1H), 7.63-7.60 (m, 2H), 7.51 (s, 1H), 7.45 (d, J = 9.6 Hz, 1H), 7.35 (d,J= 10.0 Hz, 1H), 6.07 (t, J= 6.0 Hz, 1H), 3.483.43 (m, 2H), 1.73-1.45 (m, 8H), 1.30-1.14 (m, 3H), 1.000.91 (m, 2H);

203

1540	F if^l ^{NH 0 s} \=/ N N hr	A, 28, 212 (75 mg)	15	381.0 (MM);	C19H43FN4 o₂s 380.07	‘H NMR (DMSO-iZ_d, 400 MHz): δ 10.94 (brs, 1H), 9.20 (t, J= 5.7 Hz, 1H), 9.08 (s, 1H), 8.75 (s, 2H), 7.75-7.60 (m, 3H), 7.537.46 (m, 1H), 7.41 (dd, 7= 7.8, 0.9 Hz, 1H), 7.32-7.28 (m, 1H), 4.47 (d, 7= 5.6 Hz, 2H);
1541	F 0 ôr^NH ° ^S \=/ N-\ „ Al	A, 28,213	22	385.9 (MM);	C18H12FN3 O₂s₂ 385.04	‘H NMR (DMSO-7₆,400 MHz): δ 10.95 (s, 1H), 9.25 (t, 7= 5.7 Hz, 1H), 8.96 (s, 1H), 7.80 (s, 1H), 7.71-7.65 (m, 2H), 7.60 (dd,7 = 8.0,2.0 Hz, 1H), 7.52-7.46 (m, 1H), 7.40 (d, 7= 7.7 Hz, 1H), 7.34-7.28 (m, 1H), 4.65 (d, 7=5.7 Hz, 2H);
1542	F 0 ÂA~nh o ^S \=/ N^. „ M N	A, 28,214	31	370.0 (MM);	C18H12FN3 O3S 369.06	‘H NMR (DMSO-Jî, 400 MHz): δ 10.95 (s, 1H), 9.09 (t, 7= 5.4 Hz, 1H), 8.27 (s, 1H), 7.72-7.65 (m, 2H), 7.61 (dd, 7 = 8.0,1.9 Hz, 1H), 7.53-7.46 (m, 1H), 7.40 (d, 7= 7.2 Hz, 1H), 7.34-7.27 (m, 1H), 7.03 (s, 1H), 4.51(d, 7= 5.4 Hz, 2H);

204

1543	F ?\ l!^A_{s ν}	A, 28, 215	22	370.0 (^+1);	c₂₀hi₅fn₄ O₂S 394.09	‘H NMR (DMSO-de, 400 MHz): δ 10.96 (s, 1H), 9.01 (s, 1H), 8.69-8.60 (m, 3H), 7.66 (d, J =8.0 Hz, 1H), 7.62 (s, 1H), 7.51 (dd, J = 8.2.2.0 Hz, 1H), 7.49-7.46 (m, 1H), 7.40 (d,J=7.8Hz, 1H), 7.28-7.33 (m, 1H), 3.53 (q, .7= 6.4 Hz, 2H), 2.84 (t,J= 6.6 Hz, 2H);
1471	F 0 /ks/'NH ί'Ύ % —4 J N-⁷	A, 28, 216	22	393.9 (MN-i);	c₂₁h₁₆fn₃ O₂S 393.09	‘H NMR (DMSO-4,400 MHz): δ 10.96 (s, 1H), 8.63 (t, J= 5.5 Hz, 1H), 8.52-8.47 (m, 1H), 7.71-7.64 (m, 3H), 7.55 (dd,J=8.2,1.8 Hz, 1H), 7.517.49 (m, 1H), 7.40 (d, .7=7.4 Hz, 1H), 7.31 (t, .7=9.2 Hz, 1H), 7.25 (d, J = 7.7 Hz, 1H), 7.23-7.19 (m, lH),3.59(q,J = 6.8 Hz, 2H), 2.96 (t, J= 7.3 Hz, 2H);
1555	F O xAsG^-NH p	A, 28, 217	20	393.9 (MN-1);	C₂iH₁₆FN₃o₂s 393.09	Ή NMR (DMS0-<4 400 MHz): δ 10.97 (s, 1H), 8.64 (t, J= 5.5 Hz, 1H), 8.43 (s, 1H), 8.40 (dd,J= 4.8,1.6 Hz, 1H), 7.68-7.61 (m, 3H), 7.53 (dd, .7=8.0,2.0 Hz, 1H), 7.517.46 (m, 1H), 7.40 (d, .7=7.8,

205

						Hz, 1H), 7.347.27 (m, 2H), 3.49 (q, .7=7.0 Hz, 2H), 2.84 (t, 2= 7.0 Hz, 2H);
1490	F	A, 28,218	27	393.9 (M⁺+l);	c₂₀h₁₄fn₃ O₂S 379.08	‘H NMR (DMSO-2₀, 400 MHz): δ 10.96 (s, 1H), 9.15 (t, J= 5.7 Hz, 1H), 8.52 (s, 1H), 8.45 (dd,2= 4.7,1.4 Hz, 1H), 7.73-7.66 (m, 3H), 7.63 (dd, 2=8.2,1.8 Hz, 1H), 7.547.44 (m, 1H), 7.40 (d, J =7.3 Hz, 1H), 7.367.28 (m, 2H), 4.46 (d, 2=5.6 Hz, 2H);
1463	F Q\ \Knh /9	A, 28, 185	39	365.9 (M++1);	C₁₉H_i2FN₃ O₂S 365.06	*H NMR (DMSO-X, 400 MHz): δ 11.04 (s, 1H), 10.63 (s, 1H), 8.48 (d, 2= 6.0 Hz, 2H), 7.80-7.69 (m, 5H), 7.43 (d, 2 = 7.6 Hz, 2H), 7.33 (t, 2= 9.1 Hz, 1H);
1472	F 9\ Y/-nh P Cx /Υνλλ	A, 28,186	13	440.9 (Nf+i);	C₂₆H₁₇FN₂ O₂S 440.10	‘H NMR (DMSO-X 400 MHz): δ 11.04 (s, 1H), 10.38 (s, 1H), 8.078.04 (m, 1H), 7.82-7.72 (m, 4H), 7.67-7.61 (m, 2H), 7.557.30 (m, 8H);
1580	F R \/-NH P	A, 28, 347	9	384.0 (M*+i);	Ci9Hi₄FN₃ O₃S 383.07	‘H NMR (DMSO-d₆,400 MHz): δ 10.98 (s, 1H), 8.68 (t, 2= 5.6 Hz, 1H), 8.22 (s, 1H), 7.69-7.64 (m,

206

						2H), 7.55 (dd, J = 8.0,1.9 Hz, 1H), 7.53-7.46 (m, 1H), 7.40 (dd, .7=7.6, 0.9 Hz, 1H), 7.36- 7.28 (m, 1H), 6.92 (s, 1H), 3.49 (q, .7=6.2 Hz, 2H), 2.90 (t,J= 6.7 Hz, 2H);
1598	F Y/^NH /?	A, 28, 352	29	399.9 (M%1);	c_I9h₁₄fn₃ O2S2 399.05	‘H NMR (DMSO-î/î, 400 MHz): δ 10.98 (brs, 1H), 8.91 (s, 1H), 8.70 (t, J= 5.6 Hz, 1H), 7.68 (d,J=7.9 Hz, 3H), 7.57 (dd, .7=8.0,1.9 Hz, 1H), 7.53- 7.47 (m, 1H), 7.41 (d, .7=7.1 Hz, 1H), 7.357.29 (m, 1H), 3.48 (q,J=5.9 Hz, 2H), 3.10 (1,.7= 6.7 Hz, 2H);
1465	è^^NH °	A, 28, 219	30	469.0 (M⁺+l);	C28H21FN2 O₂S 468.13	‘H NMR (DMSO-rf₆,400 MHz): δ 10.97 (s, 1H), 8.66 (t, J= 5.3 Hz, 1H), 7.77-7.24 (m, 15H), 3.50 (q, J = 7.0 Hz, 2H), 2.86 (t, .7= 7.0 Hz, 2H);
1477	F R\ k / ^NH /? Ο Μχχ f^ysOjNlCHjh AJ / N \M\ //	A, 28,406	12	500.1 (Mkl);	C24H22FN3 O4S2 499.10	‘H NMR (DMSO-rk 400 MHz): δ 10.97 (s, 1H), 8.63 (t, J= 5.5 Hz, 1H), 7.69-7.61 (m, 4H), 7.54-7.46 (m, 4H), 7.40 (d, .7= 7.0 Hz, 1H), 7.34-7.28 (m, 1H), 3.563.46 (m, 2H), 2.93 (t, J =7.0

207

						Hz, 2H), 2.54 (s, 6H);
1308	0 θ ^S \=/ N-W	Α, 35,212	39	380.9 (MM);	C19H13FN4 O₂S 380.07	‘H-NMR (DMSO-A, 400 MHz): δ 10.89 (s, 1H), 9.16 (t, J= 5.6 Hz, 1H), 9.07 (s, 1H), 8.74 (s, 2H), 7.71-7.66 (m, 2H), 7.64-7.58 (m, 2H), 7.47 (dd,7=9.2,2.8 Hz, 1H), 7.37 (dt, 7=11.6, 3.2 Hz, 1H), 4.47 (d,7=5.6 Hz, 2H);
1309	0 _χο Ν	Β, 35, 213	21	385.9 (Μ⁺+1);	c₁₈h₁₂fn₃ O₂S₂ 385.04	‘H-NMR (DMSO-A, 400 MHz): δ 10.89 (brs, 1H), 9.24 (t, 7=5.6 Hz, 1H), 8.95 (brs, 1H), 7.80 (brs, 1H), 7.70-7.65 (m, 2H), 7.617.57 (m, 2H), 7.47 (d, 7=6.4 Hz, 1H), 7.397.37 (m, 1H), 4.64 (d,7=5.6 Hz, 2H);
1310	0 ^F\/A< ΝΗ s-OA-^-^Q	Α, 35,216	44	393.9 (W+1);	c₂₁h₁₆fn₃ O₂S 393.09	‘H-NMR (DMSO-A, 400 MHz): δ 10.89 (s, 1H), 8.62 (t, 7= 5.6 Hz, 1H), 8.47 (d,7=8.0 Hz, 1H), 7.707.61 (m, 3H), 7.59-7.54 (m, 2H), 7.48 (dd, 7 = 9.2,2.8 Hz, 1H), 7.36 (dt, J = 11.6, 3.2 Hz, 1H), 7.24 (d, 7 = 8.0 Hz, 1H), 7.22-7.19 (m, 1H), 3.61-3.50 (m, 2H), 2.96 (t, 7= 7.2 Hz, 2H);

208

1311	0 y~~C N	A, 35, 214	35	369.9 (Nf+l);	C₁₈H₁₂FN₃ O₃S 369.06	‘H-NMR (DMSO-7_tf, 400 MHz): δ 10.89 (brs, 1H), 9.07 (t, 7= 5.2 Hz, 1H), 8.27 (s, 1H), 7.70 (s, 1H), 7.66 (d, 7 = 8.0 Hz, 1H), 7.62-7.57 (m, 2H), 7.48 (dd, 7 = 9.2,2.8 Hz, 1H), 7.37 (dt, J = 11.6,3.2 Hz, 1H), 7.03 (s, 1H), 4.50 (d, 7 = 5.2 Hz, 2H);
1312	0 F-χΧ^Α-ΝΗ Il 1 V-x o /-\ h'^-O	A, 35,215	11	395.2 (M⁺+l);	C2oH₁₅FN₄ O₂S 394.09	‘H-NMR (DMSO-7_d, 400 MHz): δ 10.89 (brs, 1H), 9.01 (s, 1H), 8.658.62 (m, 3H), 7.65-7.35 (m, 6H), 3.52 (t, 7= 6.4 Hz, 2H), 2.84 (t, 7= 6.4 Hz, 2H);
1313	^FY^Î5q'^N\L· o H X-OH	A, 35,220	69	465.2 (M⁺+l);	C26H25FN2 O3S 464.16	‘H-NMR (DMS O-f/,;, 400 MHz): δ 10.88 (s, 1H), 8.72 (d, 7= 8.0 Hz, 1H), 7.70 (s, 1H), 7.66 (s, 2H), 7.62-7.58 (m, 1H), 7.47 (dd, 7 = 8.8,2.8 Hz, 1H), 7.37 (dt, 7 = 11.6,3.2 Hz, 1H), 7.32-7.25 (m, 4H), 5.01- 4.95 (m, 1H), 4.86 (t, 7= 6.0 Hz, 1H), 3.68- 3.57 (m, 2H), 1.24 (s, 9H);
1316	Cl	A, 35, 221	50	382.8 (Nf+l)	C20H12F2N ₂O₂S 382.06	‘H-NMR (DMSO-7_d) 400 MHz): δ 10.96 (s, 1H), 10.35 (s, 1H), 7.767.72 (m, 5H),

209

						7.63-7.60 (m, 1H), 7.50 (dd, J = 9.2,2.8 Hz, 1H), 7.41-7.36 (m, 1H), 7.19 (t, 7= 8.8 Hz, 2H);
1321	Ο /9 /==\ ri AXs-X·' H	A, 35, 222	51	398.9 (M*+l)	C20H12CIF N₂O₂S 398.03	‘H-NMR (DMSO-7_d, 400 MHz): δ 10.94 (s, 1H), 10.40 (s, 1H), 7.787.70 (m, 5H), 7.63-7.60 (m, 1H), 7.50 (dd, 7 = 9.2,3.2 Hz, 1H), 7.41-7.37 (m, 3H);
1320	0 Fx/JxZ~NH U_S^_(	A, 35, 359	7	471.0 (M*+l)	C26H19FN4 0₂s 470.12	‘H-NMR (DMSO-7₆,400 MHz): δ 10.90 (s, 1H), 9.15 (s, lH),9.11(s, 1H), 8.64 (t, 7= 5.2 Hz, 1H), 7.73 (d, 7=8.0 Hz, 2H), 7.677.61 (m, 2H), 7.59-7.55 (m, 2H), 7.48 (dd, 7 = 9.2,2.8 Hz, 1H), 7.40-7.34 (m, 2H), 3.50 (q, 2H),2.89(t, 7= 7.2 Hz, 2H);
1343	0 XsAV H	A, 35, 367	49	471.4 (MX1);	C26H19FN4 O₂S 470.12	‘H-NMR (DMSO-7_d, 400 MHz): δ 10.88 (s, 1H), 8.75 (s, 2H), 8.64 (t, 7= 6.0 Hz, 1H), 8.36-8.34 (m, 2H), 7.65-7.63 (m, 2H), 7.607.57 (m, 2H), 7.55-7.45 (m, 4H), 7.39-7.34 (m, 1H), 3.56 (q, 7= 6.4 Hz, 2H), 2.88 (t, 7= 6.8 Hz, 2H);

210

1314	Ο	A, 35, 372	13	457.0 (Mfl-l)	C25H17FN4 o₂s 456.11	‘H-NMR (DMS0-d_tf, 400 MHz): δ 10.91 (s, 1H), 9.20 (t, J= 6.0 Hz, 1H), 9.17 (s, 1H), 9.11 (s, 2H), 7.77-7.74 (m, 3H), 7.67 (s, 2H), 7.62-7.58 (m, 1H), 7.507.40 (m, 3H), 7.38 (td, J= 11.6, 3.2 Hz, 1H), 4.50 (d, J = 6.0 Hz, 2H);
1315	Ο AAsA=/ hA% Q	A, 35, 377	32	456.9 (M-+1);	C₂₅Hi₇FN4 O₂S 456.11	‘H-NMR (DMSO-d_d, 400 MHz): δ 10.89 (s, 1H), 9.17 (t, J= 5.6 Hz, 1H), 8.84 (s, 2H), 8.38-8.35 (m, 2H), 7.72 (s, 1H), 7.69-7.60 (m, 2H), 7.597.58 (m, 1H), 7.52-7.51 (m, 3H), 7.49-7.46 (m, 1H), 7.37 (td, J= 11.6, 2.8 Hz, 1H), 4.50 (d, .7=6.0 Hz, 2H);
1317	ο, ^F __^-ΝΗ Ο Η	A, 35, 223	30	382.9 (MXi);	C₂₀H_I2F₂N 2O2S 382.06	‘H-NMR (DMS0-<4, 400 MHz): δ 10.96 (s, 1H), 10.46 (s, 1H), 7.767.68 (m, 4H), 7.64-7.60 (m, 1H), 7.52-7.49 (m, 2H), 7.417.35 (m, 2H), 6.93 (dt, J= 10.0,1.6 Hz, 1H);
1334	0. F Αα-νη 9 %=χ _c, ^f'~CxXVn-O'	A, 35, 224	14	417.6 (MXl);	C₂₀H_nClF₂ N₂O₂S 416.02	‘H-NMR (DMSO-d_d, 400 MHz): δ 10.94 (s, 1H), 10.26 (s, 1H), 7.78 (s, 1H), 7.75-7.70

211

						(m, 2H), 7.64- 7.60 (m, 2H), 7.54-7.51 (m, 2H), 7.39 (dt,7 = 11.6,3.2 Hz, 1H), 7.31 (dd, J = 8.8,1.2 Hz, 1H);
1322	Q c _JZnh O H	A, 35, 225	15	382.9 (M⁺+l);	C₂oHi₂F₂N 2θ2^ 382.06	‘H-NMR (DMSO-7_tf, 400 MHz): δ 10.94 (s, 1H), 10.18 (s, 1H), 7.78 (s, 1H), 7.75-7.74 (m, 2H), 7.647.55 (m, 2H), 7.50 (dd, 7= 9.2, 2.8 Hz, 1H), 7.39 (dt, 7 = 8.8,2.8 Hz, 1H), 7.31-7.26 (m, 2H), 7.247.19 (m, 1H);
1323	o_x _Vnh o Cl	C, 35, 226	21	417.7 (tf+l)	C₂₀H_nClF₂ N₂O₂S 416.02	‘H-NMR (DMSO-7₅,400 MHz): δ 10.94 (s, 1H), 10.16 (s, 1H), 7.80 (s, 1H), 7.77-7.72 (m, 2H), 7.637.60 (m, 1H), 7.57-7.53 (m, 2H), 7.50 (dd, 7 = 9.2,2.8 Hz, 1H), 7.39 (td, 7 = 11.2,2.8 Hz, 1H), 7.27 (td, 7 = 11.2, 2.8 Hz, 1H);
1324	θν ^F J _p VA'S-'XZ h^>	A, 35, 227	7	419.2 (M*+l)	C₂oHioF₄N ₂O₂S 418.04	‘H-NMR (DMSO-7(î, 400 MHz): δ 10.98 (brs, 1H), 10.60 (br s, 1H), 7.77-7.66 (m, 5H), 7.637.60 (m, 1H), 7.51 (dd,7= 9.2, 2.8 Hz, 1H), 7.41-7.37 (m, 1H);

212

1318	A P Z~NH O r Ί	A, 35, 228	67	401.2 (MM),	c₂₀h_hf₃n 2O2S 400.05	‘H-NMR (DMSO-7_d, 400 MHz): δ 10.93 (s, 1H), 10.19 (s, 1H), 7.78 (s, 1H), 7.73 (s, 2H), 7.63-7.48 (m, 3H), 7.417.32 (m, 2H), 7.11 (t, 7=8.8 Hz, 1H);
1319	o. _>-NH 0 ^f'€a=Xj'n-V	A, 35,179	53	364.9 OVT+1);	C₂oHi₃FN₂0₂S 364.07	‘H-NMR (DMSO-7_d, 400 MHz): δ 10.95 (s, 1H), 10.29 (s, 1H), 7.76 (s, 1H), 7.73-7.72 (m, 4H), 7.647.60 (m, 1H), 7.51 (dd,7= 9.2,2.8 Hz, 1H), 7.40 (dd, 7 = 8.4,2.8 Hz, 1H), 7.37-7.32 (m, 2H), 7.10 (t, 7= 7.6 Hz, 1H);
1328	0 _/~nh o M	A, 35,229	5	366.9 (W+l),	C₁₈H_nFN₄ 0₂S 366.06	‘H-NMR (DMSO-7,, 400 MHz): δ 10.99 (s, 1H), 10.69 (s, 1H), 9.13 (s, 2H), 8.93 (s, 1H), 7.80 (s, 1H), 7.77 (s, 2H), 7.64-7.60 (m, 1H), 7.51 (dd,7= 9.2,3.2 Hz, 1H), 7.39 (dt, 7=11.2, 2.8 Hz, 1H);
1344	_c 7 n^._m ^fΆλ FM· J! P	C, 35,230	8	367.5 (Mf+1);	C_ISH_nFN₄ O₂S 366.06	‘H NMR (DMSO-7_d, 400 MHz): δ 11.29 (s, 1H), 10.94 (s, 1H), 8.95 (s, 1H), 8.72 (d, 7 = 5.8 Hz, 1H), 8.17 (d, 7= 5.7 Hz, 1H), 7.837.76 (m, 2H), 7.75-7.67 (m, 1H), 7.62 (dd, J = 8.5,5.1 Hz,

213

						1H), 7.51 (dd, J = 9.1,2.8 Hz, 1H), 7.39 (t,J= 8.0 Hz, 1H);
1329	Ο Vnh 0 H ^N	A, 35, 231	28	371.9 (M*+l)	C₁₇H₁₀FN₃ O2S2 371.02	*H-NMR (DMSO-dfo 400 MHz): δ 12.70 (br s, 1H), 10.98 (s, 1H), 7.87-7.86 (m, 2H), 7.72 (d, J = 8.4 Hz, 1H), 7.63-7.60 (m, 1H), 7.51 (dt,J = 9.2,2.8 Hz, 2H), 7.41-7.37 (m, 1H), 7.287.25 (m, 1H);
1335	0 /—nh p	A, 35, 380	17	371.8 (mM;	C17H10FN3 O₂S₂ 371.02	‘H-NMR (DMSO-iZ_d, 400 MHz): δ 11.79 (brs, 1H), 10.98 (s, 1H), 8.62 (s, 1H), 7.79-7.73 (m, 2H), 7.61-7.58 (m, 2H), 7.507.47 (m, 1H), 7.47 (d, J= 9.2, 2.8 Hz, 1H), 7.37(td,J= 11.2,3.2 Hz, 1H);
1353	0 /—NH p _ ύϊΓ iwç	A, 35, 232	4	355.8 (MU-1),	C₁₇H_I0FN₃ O₃S 355.04	‘H-NMR (DMSO-<4,400 MHz): δ 11.62 (brs, 1H), 10.94 (brs, 1H), 7.95-7.85 (m, 1H), 7.817.69 (m, 3H), 7.63-7.59 (m, 1H), 7.50 (d, J = 6.4 Hz, 1H), 7.40-7.37 (m, 1H), 7.20 (brs, 1H);
1330	0 >-NH p	C, 35,185	20	365.8 (M%1),	c_I9h₁₂fn₃O₂S 365.06	‘H-NMR (DMSO-<4 400 MHz): δ 10.97 (s, 1H), 10.63 (s, 1H), 8.48-

214

						8.47 (m, 2H), 7.77-7.73 (m, 5H), 7.64-7.60 (m, 1H), 7.51 (dd, 7= 9.2,2.8 Hz, 1H), 7.39 (td,7= 11.2, 2.8 Hz, 1H);
1336		C, 35,233	30	383.9 (M+l)⁺,	C_I9H11F₂n₃o₂s 383.05	‘H-NMR (DMSO-7_tf, 400 MHz): δ 10.98 (s, 1H), 10.93 (s, 1H), 8.398.35 (m, 1H), 8.17 (dd, 7= 9.2,4.0 Hz, 1H), 7.82-7.77 (m, 3H), 7.69 (d, 7= 8.0 Hz, 1H), 7.63-7.60 (m, 1H), 7.50 (dd,7=9.2,2.8 Hz, 1H), 7.38 (td, 7= 11.6, 3.2 Hz, 1H);
1337	0	B, 35, 234	14	383.9 (MU-1),	Ci₉H_nF₂N ₃o₂s 383.05	‘H-NMR (DMSO-A, 400 MHz): δ 10.98 (brs, 1H), 10.73 (brs, 1H), 8.74 (s, 1H), 8.34 (s, 1H), 8.16 (d, 7 = 9.2 Hz, 1H), 7.78 (s, 1H), 7.76 (s, 2H), 7.64-7.60 (m, 1H), 7.51 (dd, 7 = 9.2,3.2 Hz, 1H), 7.39 (dt, 7 = 11.6,3.2 Hz, 1H);
1338	ΧλυΛ'Ο'⁰¹	C, 35, 235	12	400.5 (M+l)⁺,	Ci₉H_hC1F n₃o₂s 399.02	‘H-NMR (DMSO-A, 400 MHz): δ 11.01 (brs, 2H), 8.43 (brs, 1H), 8.18 (d, 7= 8.8 Hz, 1H), 7.95 (d, 7 = 8.4 Hz, 1H), 7.80-7.77 (m, 2H), 7.69 (d, 7 = 7.6 Hz, 1H),

215

						7.61-7.60 (m, 1H), 7.50 (d,J = 9.2 Hz, 1H), 7.38 (t,J= 8.0 Hz, 1H);
1345	0 NH^C) i^N\	C, 35, 236	6	400.5 (NT+i),	C_I9H_hC1F n₃o₂s 399.02	‘H-NMR (DMSO-dg, 400 MHz): δ 10.97 (brs, 1H), 10.71 (brs, 1H), 8.82 (brs, 1H), 8.36 (d, J = 7.6 Hz, 2H), 7.78-7.76 (m, 3H), 7.62 (t,J= 7.6 Hz, 1H), 7.51 (d,J=8.0 Hz, 1H), 7.39 (t, J= 7.2 Hz, 1H);
1331	q. ,°~a	A, 35, 237	21	406.6 (KT+l),	c_2Ih₁₂fn₃ O₃S 405.06	‘H-NMR (DMSO-ds, 400 MHz): δ 10.97 (s, 1H), 10.55 (s, 1H), 8.68 (s, 1H), 8.31 (s, 1H), 7.79-7.75 (m, 4H), 7.607.61 (m, 2H), 7.51 (dd,J= 9.2,2.8 Hz, 1H), 7.39 (dt, J = 11.6,3.2 Hz, 1H);
1354		0^e, 35,238 (o= Et₃N, DMAP)	14	405.9 (Af+l),	C₂iH₁₂FN₃ O₃S 405.06	‘H-NMR DMSO-rf₆,400 MHz): δ 12.44 (brs, 1H), 10.94 (s, 1H), 7.92 (brs, 1H), 7.86-7.84 (m, 1H), 7.72 (d, J = 8.0 Hz, 1H), 7.62-7.60 (m, 2H), 7.55-7.49 (m, 2H), 7.407.30 (m, 3H);
1325	q, /^s~n	A, 35, 239	25	422.0 (M⁺+l);	c₂₁h₁₂fn₃ O₂S₂ 421.04	‘H-NMR (DMSO-d_tf, 400 MHz): δ 10.97 (s, 1H), 10.56 (s, 1H), 9.30 (s,

216

						1H), 8.65 (s, 1H), 8.05 (d, J = 8.8 Hz, 1H), 7.79-7.73 (m, 4H), 7.64-7.61 (m, 1H), 7.51 (dd, J= 9.2,2.8 Hz, 1H), 7.39 (dt, 7=11.2, 2.8 Hz, 1H);
1339	0 >-NH p ₅_/=φ xy» aP	A, 35,240	28	422.3 (ΜΦ1),	C21H12FN3 O2S2 421.04	‘H-NMR (DMSO-iZ_tf, 400 MHz): δ 12.09 (brs, 1H), 10.98 (s, 1H), 8.00 (d,7=8.0 Hz, 1H), 7.937.91 (m, 2H), 7.79-7.74 (m, 2H), 7.64-7.60 (m, 1H), 7.537.44 (m, 2H), 7.41-7.32 (m, 2H);
1332	Q. ΐ 7~NH 0 _/=V h ^N	C, 35, 241	13	439.9 (M+l)⁺,	czlHnFZN 3O2S2 439.03	‘H-NMR (DMSO-φ, 400 MHz): δ 12.91 (brs, 1H), 10.96 (s, 1H), 7.93-7.90 (m, 2H), 7.78 (d, J = 6.8 Hz, 1H), 7.68-7.59 (m, 3H), 7.50 (dd, J = 9.2,2.8 Hz, 1H), 7.38 (td, J = 11.6, 3.2 Hz, 1H), 7.23-7.17 (m, 1H);
1340	o. zCi T~^NH ,9 sVy M^s^V h ^N	C, 35, 242	5	455.9 (M*4-l)	C_2IH_hC1F N3O2S2 455.00	‘H-NMR (DMSO-φ, 400 MHz): δ 13.01 (brs, 1H), 11.00 (s, 1H), 8.16 (s, 1H), 7.91 (d,7=8.0 Hz, 2H), 7.797.70 (m, 2H), 7.64-7.60 (m, 1H), 7.53-7.47 (m, 2H), 7.39 (td, 7= 8.4,3.2

217

						Hz, 1H);
1326	0	A, 35, 243	46	441.5 (M⁺+l);	c₂₆h₁₇fn₂ O₂S 440.10	‘H-NMR (DMSO-7₆, 400 MHz): δ 10.96 (s, 1H), 10.39 (s, 1H), 7.84 (d, 7= 8.8 Hz, 2H), 7.78 (s, 1H), 7.74 (s, 2H), 7.68-7.61 (m, 4H), 7.51 (dd,7 = 9.2,2.8 Hz, 1H), 7.47-7.45 (m, 1H), 7.437.32 (m, 4H);
1333	_ Y^NH P 'ïIJtnV	A, 35, 186	46	441.4 (MM);	c₂₆h₁₇fn₂ O₂S 440.10	‘H NMR (400 MHz, DMSOd₆) δ 10.97 (s, 1H), 10.38 (s, 1H), 8.05 (s, 1H), 7.83-7.73 (m, 4H), 7.68 7.61 (m, 3H), 7.52 - 7.37 (m, 7H);
1376	O_x >~NH P r==\ ^FvYÎ JPj’n^^'Ç-n M'S'M' H	A, 35, 217	59	393.9 (M⁺+l);	c_2Ih₁₆fn₃ O₂S 393.09	‘H NMR (DMSO-A, 400 MHz): δ 10.91 (s, 1H), 8.62 (t, 7= 5.5 Hz, 1H), 8.44-8.38 (m, 2H), 7.67-7.57 (m, 4H), 7.54 (dd, 7=8.2,1.8 Hz, 1H), 7.48 (dd, 7=9.2,2.9 Hz, 1H), 7.37 (dt,7=8.5,2.9 Hz, 1H), 7.29 (dd, 7=7.7,4.8 Hz, 1H), 3.543.44 (m, 2H), 2.84 (t, 7= 7.0 Hz, 2H);
1417	0 _Xnh 0 ^F-n XY n-M? H ⁰	B, 35, 347	12	383.9 (M⁺+l);	C1₉H_I4FN₃ O₃S 383.07	‘H NMR (DMSO-A, 400 MHz): δ 10.90 (brs, 1H), 8.66 (t,7= 5.5 Hz, 1H), 8.21 (s, 1H), 7.68-7.63 (m, 2H), 7.60

218

						(dd, J= 8.6, 5.3 Hz, 1H), 7.55 (dd,/=8.2,1.7 Hz, 1H), 7.48 (dd, /= 9.2,2.9 Hz, 1H), 7.37 (dt,/=8.5,3.0 Hz, 1H), 6.92 (s, 1H), 3.49 (q, 2H), 2.90 (t,/= 6.7 Hz, 2H);
1418	0. r~NH .0 lAsAA	B, 35, 352	36	399.9 (M^+l);	Ci₉H₁₄FN₃ O₂S₂ 399.05	‘H NMR (DMSO-X 400 MHz): δ 10.92 (brs, 1H), 8.91 (brs, 1H), 8.70 (brs, 1H), 7.737.54 (m, 5H), 7.49 (d,/=7.2 Hz, 1H), 7.427.36 (m, 1H), 3.52-3.45 (m, 2H), 3.13-3.10 (m, 2H);
1364	'VAs-'U' hPA)	A, 35, 218	38	380.0 (M++1);	C20H14F N3O2S 379.08	1H NMR (400 MHz, DMSOd6): δ 10.89 (s, 1H), 9.15 (t, J = 5.4 Hz, 1H), 8.52 (s, 1H), 8.45 (dd, J = 4.8,1.5 Hz, 1H), Ί.Τ5-Ί.5Ί (m, 5H), 7.48 (dd, J = 9.2,2.9 Hz, 1H), 7.41- 7.36 (m, 1H), 7.34 (dd, J = 7.9,4.9 Hz, 1H), 4.46 (d, J = 5.9 Hz, 2H);
1370	o . z-y ^NH /? ) À X /	A, 35,219	31	469.7 (M++1);	C28H21F N2O2S 468.13	1HNMR (DMSO-d6,400 MHz): δ 10.91 (s, 1H), 8.65 (t, J = 5.4 Hz, 1H), 7.69-7.53 (m, 8H), 7.50-7.41 (m, 3H), 7.407.28 (m, 4H), 3.50 (q, J =6.7 Hz, 2H), 2.86 (t, J = 7.2 Hz,

219

						2H);
1384	q Κνη θ fW ru ryso₂N(CH₃)₂ WV H	A, 35,406	29	499.9 (M++1)	C24H22F N3O4S2 499.10	1HNMR (DMSO-d6,400 MHz): δ 10.91 (brs, 1H), 8.62 (t, J = 5.6 Hz, 1H), 7.67-7.62 (m, 4H), 7.59 (dd, J =8.6, 5.3 Hz, 1H), 7.53 (dd,J = 8.2,1.7 Hz, 1H), 7.517.46 (m, 3H), 7.37 (td, J =8.5, 3.0 Hz, 1H), 3.51 (q, J = 6.6 Hz, 2H), 2.93 (t, J =7.0 Hz, 2H), 2.54 (s, 6H);
1385	0 XP'sXP H^Xn	A, 35, 244	40	441.9 (M++1);	C25H16F N3O2S 441.09	Ή NMR (400 MHz, DMSOd₆): δ 10.98 (br s, 1H), 10.44 (s, 1H), 8.68 (d, J = 5.1 Hz, 1H), 8.50 (s, 1H), 7.94-7.89 (m, 2H), 7.87-7.84 (m, 1H), 7.837.77 (m, 3H), 7.76-7.72 (m, 1H), 7.63 (dd, J = 8.6,5.3 Hz, 1H), 7.52 (dd, J = 9.1,2.7 Hz, 1H), 7.47 (t, J = 7.9 Hz, 1H), 7.43-7.35 (m, 2H);
1400	O y^~y~^Ny^yX ^z <0	A, 35,245	21	441.9 (M++1);	C25H16F N3O2S 441.09	Ή NMR (400 MHz, DMSOde): δ 10.98 (s, 1H), 10.42 (s, 1H), 8.85 (brs, 1H), 8.59 (d, J = 3.7 Hz, 1H), 8.08 (s, 1H), 8.03 (d, J=8.0 Hz, 1H), 7.857.72 (m, 4H), 7.63 (dd, J = 8.5, 5.2 Hz,

220

						1H), 7.54-7.45 (m, 4H), 7.40 (td, J = 8.4,2.9 Hz, 1H);
1401	0 ^NH /?	A, 35, 246	33	442.0 (M++1);	C25H16F N3O2S 441.09	‘H NMR (400 MHz, DMSOde): δ 10.99 (s, 1H), 10.46 (s, 1H), 8.66 (d, J = 6.0 Hz, 2H), 8.18-8.16 (m, 1H), 7.85 (dt, J = 7.6,1.6 Hz, 1H), 7.81-7.78 (m, 1H), 7.777.74 (m, 2H), 7.68-7.61 (m, 3H), 7.56-7.49 (m, 3H), 7.40 (td, J =8.5,2.5 Hz, 1H);
1386	0 ^NH /? /====^ Aiⁿxa Xî^'s'X^ h ^yo V	A, 35,247	34	431.9 (MM);	c₂₃h_I4fn₃ O₃S 431.07	‘H NMR (400 MHz, DMSOd₆): δ 10.98 (s, 1H), 10.44 (s, 1H), 8.46 (s, 1H), 8.16 (s, 1H), 7.83-7.69 (m, 4H), 7.697.59 (m, 2H), 7.55-7.43 (m, 3H), 7.40 (td, J = 8.5,3.0 Hz, 1H);
1424	_f ^C02^Et VAsAA hAtx	F, 35, 248	32	452.0 (MM);	C₂₃H₁₈FN₃ O₄S 451.10	‘H NMR (400 MHz, DMSOd₆): 10.89 (s, 1H), 9.20 (d, J = 7.3 Hz, 1H), 8.57-8.54 (m, 1H), 7.84 (td, J = 7.7,1.8 Hz, 1H), 7.74 (s, 1H), 7.70-7.64 (m, 2H), 7.60 (dd, J= 8.6, 5.3 Hz, 1H), 7.53 (d, .7= 7.9 Hz, 1H), 7.48 (dd, J = 9.2,2.9 Hz, 1H), 7.43-7.33 (m, 2H), 5.77 (d, .7=7.3 Hz,

221

						1H), 4.16-4.09 (m, 2H), 1.14 (t, J= 7.1 Hz, 3H);
1405	F CO₂Et xX/¹	F, 35, 249	28	451.9 (MY1);	C23H48FN3 O₄S 451.10	‘H NMR (400 MHz, DMSOde): δ 10.90 (s, 1H), 9.38 (d, J = 7.5 Hz, 1H), 8.58 (d,J= 5.0 Hz, 2H), 7.73 (s, 1H), 7.717.65 (m, 2H), 7.61 (dd,J= 8.6, 5.2 Hz, 1H), 7.52-7.44 (m, 3H), 7.38 (td, J= 8.4,3.0 Hz, 1H), 5.71 (d, .7=7.4 Hz, 1H), 4.19-4.10 (m, 2H), 1.15 (t, .7=7.1 Hz, 3H);
1442	_c 7 N-N W^sAZ h ^s	F, 35, 250	31	372.8 (M⁺+l);	c₁₆h₉fn₄ O₂S₂ 372.02	‘H NMR (400 MHz, DMSOdfi): δ 10.91 (s, 1H), 8.87 (br s, 1H), 7.94 (s, 1H), 7.87 (dd, J = 8.0,1.7 Hz, 1H), 7.61 (d, J = 9.0 Hz, 1H), 7.59-7.56 (m, 1H), 7.48 (dd, J = 9.2,2.9 Hz, 1H), 7.35 (td, J = 8.5,3.0 Hz, 1H);
1537	c JÏ n-n ΥΊ -XX/' ⁿA?	F, 35, 251	16	357.0 (NT+1);	c₁₆h₉fn₄ O3S 356.04	‘H NMR (400 MHz, DMSOdû) δ 12.26 (br s, 1H), 10.97 (brs, 1H), 9.02 (s, 1H), 7.847.71 (m, 3H), 7.62 (dd, .7= 8.4, 5.3 Hz, 1H), 7.51 (dd,J = 9.2,2.7 Hz, 1H), 7.39 (td, J = 8.4,2.9 Hz, 1H);

222

1503	_c J « ϊλΧ/rV'⁰»	F^a, 35,252 (« = Microwave 100 °C temp, lh)	39	371.0 (M^l);	C₁₇HhFN₄ O₃S 370.05	‘H MMR (400 MHz, DMSOdg): δ 11.95 (br s, 1H), 10.97 (brs, 1H), 7.85- 7.70 (m, 3H), 7.62 (dd,7= 8.6, 5.2 Hz, 1H), 7.50 (dd, J = 9.2,2.8 Hz, 1H), 7.39 (td, J = 8.5,2.9 Hz, 1H), 2.45 (s, 3H);
1443	0 / ^NH /9 N UOH	F, 35,253	17	405.9 (M⁺+l);	C₁₇H₉C1F N3O2S2 404.98	‘HNMR (400 MHz, DMSOd₆): δ 12.97 (br s, 1H), 11.00 (brs, 1H), 7.86 (brs, 2H), 7.73 (d, 7= 8.2 Hz, 1H), 7.60 (brs, 2H), 7.51 (d, 7 = Ί.Ί Hz, 1H), 7.43-7.35 (m, 1H);
1440	0 / ^NH P /^=\ H	A, 35,383	34	443.0 (M⁺+l);	C₂₄H1₅FN₄ O₂S 442.09	‘HNMR (DMSO-7₆.400 MHz): δ 10.99 (s, 1H), 10.47 (s, 1H), 9.21 (s, 1H), 9.09 (s, 2H), 8.13-8.11 (m, 1H), 7.887.85 (m, 1H), 7.80 (s, 1H), 7.77-7.75 (m, 2H), 7.63 (dd,7 = 8.6, 5.3 Hz, 1H), 7.56-7.50 (m, 3H), 7.40 (td, 7= 8.5,3.0 Hz, 1H);
1451	0 V-mh 9	A, 35, 386	26	443.0 (M++1);	c₂₄h₁₅fn₄ O₂S 442.09	‘HNMR (400 MHz, DMSOdfi): δ 10.99 (s, 1H), 10.52 (s, 1H), 9.27 (s, 1H), 8.88 (d,7 = 5.3 Hz, 1H), 8.66-8.63 (m, 1H), 8.04 (dd, 7 = 5.4,1.3 Hz,

223

						1H), 7.98-7.91 (m, 2H), 7.837.73 (m, 3H), 7.63 (dd,7= 8.6, 5.3 Hz, 1H), 7.58-7.49 (m, 2H), 7.40 (td, 7= 8.5,3.0 Hz, 1H);
1441	0 ^F~fx ΧΑ Άλ	A, 35, 389	32	448.0 (MM);	c₂₃h_I4fn₃ O₂S₂ 447.05	‘H NMR (400 MHz, DMSOde): δ 10.99 (s, 1H), 10.42 (s, 1H), 9.10 (s, 1H), 8.27 (s, 1H), 8.06 -8.04 (m, 1H), 7.827.71 (m, 4H), 7.63 (dd, 7= 8.6, 5.2 Hz, 1H), 7.57-7.35 (m,4H);
1453	O _ /“NH /? /^X Al JVVO ^OH	B, 35,392	10	457.0 (MM);	c₂₆h₁₇fn₂0₃s 456.09	‘H NMR (DMSO-A.400 MHz): δ 10.99 (brs, 1H), 10.33 (s, 1H), 9.57 (s, 1H), 7.96 (s, 1H), 7.79 (s, 1H), 7.75-7.74 (m, 2H), 7.68 (d, 7 = 8.7 Hz, 1H), 7.63 (dd,7= 8.6, 5.3 Hz, 1H), 7.52 (dd, 7 = 9.2,2.9 Hz, 1H), 7.45 (d,7 = 8.7 Hz, 2H), 7.43-7.36 (m, 2H), 7.33-7.29 (m, 1H), 6.86 (d, 7= 8.7 Hz, 2H);
1480	0 / ^NH H ^f'Ca_sO^Ai <AsAJ	F*, 35,396 (Z> = EDC solvent)	32	432.4 (MM)	c₂₃h₁₄fn₃ O₃S 431.07	‘H NMR (400 MHz, DMSOd₆): δ 11.78(br s, 1H), 10.96 (brs, 1H), 7.907.45 (m, 10H), 7.44-7.33 (m, 2H);

224

1454	/? _N ^ΡΊί1 Γτ HÏ KAsAA h v	A, 35,429	37	471.0 (MAI);	c₂₃h₁₄fn₃0₃s 431.07	‘H NMR (DMSO-rftf, 400MHz): δ 10.98 (s, 1H), 10.37 (s, 1H), 8.02 (s, 1H), 7.83-7.70 (m, 4H), 7.63 (dd, 7 = 8.6, 5.3 Hz, 1H), 7.52 (dd, J = 9.2,2.9 Hz, 1H), 7.47-7.36 (m, 4H), 7.20 (d, 7= 7.8 Hz, 1H), 7.16-7.14 (m, 1H), 6.96 (dd, 7= 8.0, 2.2 Hz, 1H), 3.82 (s, 3H);
1481	0 Ah o	F^c, 35, 397 (c = CH₃CN solvent, Mw, 100 °C, 2h	43	448.4 (M*+l)	c₂₃h₁₄fn₃ O₂S₂ 447.05	‘H NMR (400 MHz, DMSOd₆): δ 12.82 (br s, 1H), 11.01 (s, 1H), 7.97 (s, 1H), 7.93-7.85 (m, 2H), 7.76- 7.71 (m, 1H), 7.68-7.60 (m, 3H), 7.52 (dd, J = 9.2,2.9 Hz, 1H), 7.47-7.37 (m, 3H), 7.35- 7.30 (m, 1H);
1397	0 FyAxH LA Αλα⁰ a^m% ^s<AA3	B, 35, 401 (Reaction time 5 h)	31	439.0 (ΝΓ+1)	c₂₂h_I9fn₄ O₃S 438.12	Ή NMR (DMSO-7_d, 400 MHz): δ 10.87 (s, 1H), 8.96 (s, 1H), 8.64 (s, 2H), 8.41 (d,7 = 8.7 Hz, 1H), 7.64 (d, 7= 8.0 Hz, 1H), 7.62 7.57 (m, 2H), 7.51 (dd,7= 8.1,1.8 Hz, 1H), 7.47 (dd, 7 = 9.1,3.0 Hz, 1H), 7.37 (dt, 7 = 8.5, 3.0 Hz, 1H), 4.42-4.29 (m, 1H), 3.43 (d, 7= 6.1 Hz, 2H), 3.28 (s,

225

						3H), 2.94 (dd, J = 14.0,4.1Hz, 1H), 2.74 (dd, J = 14.0,10.1, Hz, 1H);
1347	Ο /X/·' ΝΗ	Α, 42, 212	46	380.9 (ΐνΓ+ΐ)	C19H13FN4 0₂S 380.07	‘H NMR (DMSO-d_6>400 MHz): δ 10.81 (s, 1H), 9.17 (t, J= 5.6 Hz, 1H), 9.08 (s, 1H), 8.75 (s, 2H), 7.79-7.59 (m, 4H), 7.45 (dd, J = 8.5 Hz, 2.5 Hz, 1H), 7.32 (td,/=8.6,2.6 Hz, 1H), 4.48 (d,/=5.6 Hz, 2H);
1356	0 χΧΝΗ ρΛΑ^2Η° Ν	F, 42, 213	13	385.8 (Μ⁺+1)	Ci₈Hi₂FN3 O₂S₂ 385.04	‘H NMR (DMSO-A 400 MHz): δ 10.81 (s, 1H), 9.25 (t, /= 5.9 Hz, 1H), 8.96 (s, 1H), 7.80 (s, 1H), 7.75 (dd,/= 8.7, 5.9 Hz, 1H), 7.71-7.70 (m, 1H), 7.687.65 (m, 1H), 7.63-7.58 (m, 1H), 7.45 (dd,/ = 8.5,2.6 Hz, 1H), 7.32 (td,/ = 8.5,2.6 Hz, 1H), 4.65 (d,/ = 5.7 Hz, 2H);
1348	0 ΑΧ ΝΗ χΧΚ-ί ^F Ν-⁷	Α, 42, 216	41	394.6 (MX)	c₂₁h₁₆fn₃0₂S 393.09	‘H NMR (DMSO-Jÿ, 400 MHz): δ 10.81 (s, 1H), 8.62 (t, /=5.5 Hz, 1H), 8.49 (dd,/= 0.8,4.0 Hz, 1H), 7.75 (dd,/ = 8.7,6.0 Hz, 1H), 7.71-7.61 (m, 3H), 7.55 (dd,/= 1.8, 8.1 Hz, 1H), 7.45 (dd,/=8.5 Hz,

226

						2.6 Hz, 1H), 7.32 (dt, J= 8.5, 2.6 Hz, 1H), 7.25 (d, J = 7.8 Hz, 1H), 7.22-7.19 (m, 1H), 3.67-3.50 (m, 2H), 2.96 (t, J= 7.3 Hz, 2H);
1349	0 N	A, 42,214	47	369.9 (M+l)	C18H42FN3 O3S 369.06	‘H NMR (DMSO-d_d, 400 MHz): δ 10.79 (brs, 1H), 9.08 (t,J=5.5Hz, 1H), 8.27 (s, 1H), 7.91-7.89 (m, 1H), 7.75 (dd, J= 8.7, 6.0 Hz, 1H), 7.687.60 (m, 2H), 7.45 (dd,J= 8.5, 2.5 Hz, 1H), 7.32 (td, J = 8.5,2.6 Hz, 1H), 7.03 (s, 1H), 4.51 (d, J = 5.4 Hz, 2H);
1362	0 ^F '	A, 42, 215	26	395.0 (NT+i)	C20H15FN4 O₂S 394.09	‘H NMR (DMSO-îZî 400 MHz): δ 10.81 (s, 1H), 9.01 (s, 1H), 8.68-8.60 (m, 3H), 7.75 (dd, J= 8.7, 6.0 Hz, 1H), 7.677.59 (m, 2H), 7.52 (dd,J= 8.0,1.8 Hz, 1H), 7.44 (t,J= 6.4 Hz, 1H), 7.32 (dt,J= 8.5, 2.5 Hz, 1H), 3.52 (q,J = 6.4 Hz, 2H), 2.84 (t, J= 6.6 Hz, 2H);
1377	O _^y-NH J AZVVh^Vn F	A, 42, 217	34	393.9 (M+l)	C2iH_I6FN₃ O₂S 393.09	‘H NMR (DMSO-^,400 MHz): δ 10.82 (s, 1H), 8.62 (t, .7= 5.5 Hz, 1H), 8.43-8.42 (m, 1H), 8.40 (d, J

227

						= 5.0 Hz, 1H), 7.75 (t, J= 6.7 Hz, 1H), 7.68- 7.60 (m, 3H), 7.54 (dd,7= 8.0,1.8 Hz, 1H), 7.45 (dd, J = 8.6,2.6 Hz, 1H), 7.38-7.24 (m, 2H), 3.573.42 (m, 2H), 2.84 (t, J= 7.0 Hz, 2H);
1402	0 Jy-NH ο	A, 42, 347	23	383.9 (M*+l)	c₁₉h₁₄fn₃o₃s 383.07	‘H NMR (DMS0-7_d, 400MHz): δ 10.82 (s, 1H), 8.66 (t, J= 5.6 Hz, 1H), 8.21 (s, 1H), 7.75 (dd, 7= 8.7, 6.0 Hz, 1H), 7.697.62 (m, 2H), 7.55 (dd, 7= 8.1,1.7 Hz, 1H), 7.45 (dd, 7 = 8.5,2.5 Hz, 1H), 7.32 (td, 7 = 8.5, 2.5 Hz, 1H), 6.92 (s, 1H), 3.58-3.42 (m, 2H), 2.91 (t, 7= 6.7 Hz, 2H);
1403	ο ^NH 9 F	A, 42,352	14		c_I9h₁₄fn₃ O2S2 399.05	‘H NMR (DMS0-7_d, 400 MHz): δ 10.83 (s, 1H), 8.91 (s, 1H), 8.69 (t, 7= 5.4 Hz, 1H), 7.76 (dd,7= 8.6, 5.9 Hz, 1H), 7.71-7.63 (m, 3H), 7.58 (d, 7= 8.2 Hz, 1H), 7.45 (dd, 7 = 8.5, 2.5 Hz, 1H), 7.33 (td, 7 = 8.6,2.5 Hz, 1H), 3.48(q, 7 = 6.4 Hz, 2H), 3.10 (t, 7= 6.7 Hz, 2H);

228

1365	Ο >-ΝΗ χΧοF	0 ^η	A, 42,218	53	379.9 (M*+l)	C20H14FN3 O₂S 379.08	‘H NMR (DMSO-ik 400 MHz): δ 10.81 (s, 1H), 9.15 (t, J= 6.1 Hz, 1H), 8.56-8.49 (m, 1H), 8.45 (dd, J = 4.7,1.4 Hz, 1H), 7.78-7.60 (m, 5H), 7.45 (dd, .7=8.6,2.5 Hz, 1H), 7.397.27 (m, 2H), 4.47 (d, J = 5.7 Hz, 2H);
1371	0 F		A, 42,219	25	469.8 (W+1);	C28H21FN2 O₂S 468.13	‘H NMR (DMSO-î4, 400 MHz): δ 10.82 (s, 1H), 8.65 (t, J= 5.5 Hz, 1H), 7.76 (t,J= 6.9 Hz, 1H), 7.697.54 (m, 7H), 7.49-7.39 (m, 3H), 7.38-7.26 (m, 4H), 3.573.35 (m, 2H), 2.86 (t,J= 7.2 Hz, 2H);
1387	0 / ^ΝΗ /? Q lYR F	rVsOzNÎC^z AJ	A, 42, 406	23	499.9 (MN-1)	C24H22FN3 O4S2 499.10	‘H-NMR (DMSO-i7_d, 400 MHz): δ 10.82 (s, 1H), 8.62 (t, J= 5.6 Hz, 1H), 7.76 (dd,J= 8.7, 6.0 Hz, 1H), 7.66-7.62 (m, 4H), 7.557.43 (m, 4H), 7.33(td,J= 8.6, 2.6 Hz, 1H), 3.54-3.48 (m, 2H), 2.93 (t, J= 7.1 Hz, 2H), 2.57-2.52 (m, 6H);
1366	0 Vnh ίΧΧ> F	0__ Jl / n H	A, 42,185	24	365.9 (Mkl);	C19H12FN3 O₂S 365.06	‘H NMR (DMSO-rf₆,400 MHz): δ 10.89 (s, 1H), 10.64 (s, 1H), 8.48 (d, J= 5.2 Hz, 2H), 7.84-7.67 (m,

229

						6H), 7.48 (dd, J = 8.5,2.6 Hz, 1H), 7.34 (t, 7= 8.3 Hz, 1H);
1358	0 _/-nh /?	A, 42,186	46	441.6 (M+l)	C26H17FN2 0₂S 440.10	Ή NMR (DMS0-7_d, 400 MHz): δ 10.89 (s, 1H), 10.38 (s, 1H), 8.05 (s, 1H), 7.82-7.71 (m, 5H), 7.63 (d, 7= 7.2 Hz, 2H), 7.54-7.31 (m, 7H);
1398	0 )-NH 0 SO₂N(CH₃)2	A, 42,410	20	514.0 (M*+l);	C₂₅H24FN₃ O4S2 513.12	‘H NMR (DMSO-d₆,400 MHz): δ 10.81 (s, 1H), 8.55 (t, 7= 5.7 Hz, 1H), 7.76 (dd,7= 8.7, 6.0 Hz, 1H), 7.70-7.63 (m, 4H), 7.58 (dd, 7=8.0,1.7 Hz, 1H), 7.537.42 (m, 3H), 7.33 (td, 7= 8.6, 2.6 Hz, 1H), 3.28-3.23 (m, 2H), 2.72 (t, 7= 7.6 Hz, 2H), 2.57 (s, 6H), 1.99-1.78 (m, 2H);
1390	0 if^i ^{NH 0} ^F o	A, 50,212	61	380.9 (M“+l)	c_i9h₁₃fn₄0₂S 380.07	‘H NMR (DMSO-7_d, 400 MHz): δ 10.88 (s, 1H), 9.17 (t, 7= 5.7 Hz, 1H), 9.08 (s, 1H), 8.74 (s, 2H), 7.71 (dd,7= 4.9 Hz, 3.1 Hz, 2H), 7.67-7.59 (m, 1H), 7.547.43 (m, 3H), 4.47 (d,7=5.7 Hz, 2H);

230

1407	0	A, 50,213	30	385.9 (M+l)	C18H12FN3 O2S2 385.04	‘H NMR CDMSO-i/_tf, 400 MHz): δ 10.89 (s, 1H), 9.25 (t, J= 5.7 Hz, 1H), 8.96 (s, 1H), 7.80 (s, 1H), 7.71 (dd, J= 4.8, 3.1 Hz, 2H), 7.60 (dd, J = 8.1,1.8 Hz, 1H), 7.54-7.45 (m, 3H), 4.65 (d, 2= 5.6 Hz, 2H);
1408	0	A, 50,214	23	369.9 (M*+l)	C18H12FN3 O3S 369.06	‘H NMR (DMSO-2&400 MHz): δ 10.88 (s, 1H), 9.08 (t, 2= 5.5 Hz, 1H), 8.27 (s, 1H), 7.75-7.66 (m, 2H), 7.61 (dd, 2 = 8.0,1.5 Hz 1H), 7.54-7.44 (m, 3H), 7.03 (s, lH),4.51(d, 2= 5.3 Hz, 2H);
1409	O F h*X—-4. // ^M V-N	A, 50,215	29	395.8 (M++1);	C2oH₁₅FN₄ O₂S 394.09	‘H NMR (DMSO-2_d, 400 MHz): δ 10.89 (s, 1H), 9.01 (s, 1H), 8.68-8.61 (m, 3H), 7.69 (d, 2= 8.0 Hz, 1H), 7.63 (s, 1H), 7.55-7.45 (m, 4H), 3.553.49 (m, 2H), 2.84 (t, 2= 6.6 Hz, 2H);
1383	O x^szAnH f\| 1 À“\ P N*⁷	A, 50,216	30	393.9 (M+l)	C₂iH₁₆FN₃ O₂S 393.09	‘H NMR (DMSO-rftf, 400 MHz): δ 10.89 (s, 1H), 8.63 (t, 2= 5.3 Hz, 1H), 8.50-8.47 (m, 1H), 7.72-7.63 (m, 3H), 7.55 (dd, 2=8.1,1.8 Hz, 1H), 7.537.44 (m, 3H), 7.25 (d, 2=7.8

231

						Hz, 1H), 7.23- 7.18 (m, 1H), 3.62-3.55 (m, 2H), 2.96 (t,J= 7.3 Hz, 2H);
1391	0 ίι 1 p	A, 50,217	44	393.9 (My+l)	C₂iH₁₆FN₃ O₂S 393.09	‘H NMR (DMSO-ik 500 MHz): δ 10.88 (s, 1H), 8.61 (t, .7= 5.4 Hz, 1H), 8.44-8.36 (m, 2H), 7.67 (d, J = 8.1 Hz, 1H), 7.65-7.59 (m, 2H), 7.54-7.43 (m, 4H), 7.28 (dd, J= 7.4, 5.1 Hz, 1H), 3.47 (q, J= 6.7 Hz, 2H), 2.82 (t,J= 6.9 Hz, 2H);
1392	0 rr^NH ° ^F ~ Fp	A, 50,218	22	379.9 (KT+l);	C₂oH\|₄FN₃o₂s 379.08	‘H NMR (DMSO-dtf, 400 MHz): δ 10.88 (s, 1H), 9.15 (t, .7= 5.8 Hz, 1H), 8.56-8.49 (m, 1H), 8.45 (d,J = 5.2 Hz, 1H), 7.74-7.67 (m, 3H), 7.65-7.62 (m, 1H), 7.547.43 (m, 3H), 7.34 (dd,J= 7.7,4.9 Hz, 1H), 4.46 (d, J = 5.7 Hz, 2H);
1393	0 Vnh p (X jyvgⁿ F	A, 50,185	12	365.9 (Nf+1)	c₁₉h₁₂fn₃ O₂S 365.06	‘H NMR (DMSO-eZtf, 400 MHz): δ 10.97 (s, 1H), 10.63 (s, 1H), 8.48 (d, J= 5.3 Hz, 2H), 7.82-7.76 (m, 2H), 7.76-7.71 (m, 3H), 7.567.47 (m, 3H);
1410	O 'y- nh p «ssx ÇmPnP-X	A, 50,186	19	440.9 (M*+l)	c₂₆h_I7fn₂ O₂S 440.10	‘H NMR (DMSO-îA 400 MHz): δ 10.97 (s, 1H), 10.38 (s, 1H), 8.05 (s,

232

						1H), 7.85-7.70 (m, 4H), 7.63 (d, 7= 7.2 Hz, 2H), 7.57-7.36 (m, 8H);
1487	Ο	Α, 50, 347	22	383.9 GvT+i)	c_I9h₁₄fn₃ O₃S 383.07	‘H NMR (DMSO-7₀,500 MHz): 10.88 (s, 1H), 8.65 (t, 7= 5.5 Hz, 1H), 8.20 (s, 1H), 7.68 (d,7=8.1 Hz, 1H), 7.64 (s, 1H), 7.577.43 (m, 4H), 6.90 (s, 1H), 3.47 (q,7=6.7 Hz, 2H), 2.89 (t, 7= 6.8 Hz, 2H);
1528	0 ^ΝΗ ο	Α, 50, 352	43	399.8 (ΚΤ+1)	C₁₉H₁₄FN₃ O2S2 399.05	‘H NMR (DMSO-7_tf,400 MHz): δ 10.92 (brs, 1H), 8.91 (s, 1H), 8.71 (t, 7= 5.4 Hz, 1H), 7.74-7.67 (m, 3H), 7.57 (dd, 7 = 8.1,1.8 Hz, 1H), 7.54-7.44 (m, 3H), 3.48 (q, 7= 6.5 Hz, 2H), 3.10 (t,7= 6.7 Hz, 2H);
1466	ο	Α, 50,219	50	469.0 (Μ-+1)	C28H21FN2 O₂S 468.13	‘H NMR (DMSO-7_dj400 MHz): δ 10.90 (s, 1H), 8.66 (t, 7= 5.6 Hz, 1H), 7.72-7.67 (m, 2H), 7.65-7.61 (m, 2H), 7.607.56 (m, 3H), 7.54-7.42 (m, 5H), 7.36-7.29 (m, 3H), 3.49 (q, 7= 6.8 Hz, 2H), 2.86 (t, 7= 7.3 Hz, 2H);

233

1488	0 pA NH θ T ^s yA-so^lCHah * H	A, 50,406	34	500.0 (MAI)	C24H22FN3 O4S2 499.10	‘H NMR (DMSO-7₆, 400 MHz) δ 10.90 (s, 1H), 8.63 (t, 7= 5.6 Hz, 1H), 7.71-7.61 (m, 4H), 7.56-7.44 (m, 6H), 3.583.45 (m, 2H), 2.92 (t, 7= 7.0 Hz, 2H), 2.54 (s, 6H);
1428	0 ^nh >? O-^yy br	A, 55,212	23	381.0 (M*+l)	C₁₉H₁₃FN4 O₂S 380.07	Ή NMR (DMSO-7_tf400 MHz): δ 10.70 (s, 1H), 9.09 (s, 1H), 8.99(1,7= 5.1 Hz, 1H), 8.74 (s, 2H), 7.69 (d,7=6.5 Hz, 1H), 7.59 (d, 7= 9.5 Hz, 1H), 7.56-7.45 (m, 4H), 4.48 (d, 7= 5.6 Hz, 2H);
1429	0 ^NH J F II f N	A, 55, 213	30	385.8 (M⁺+i);	C1₈H₁₂FN₃O2S2 385.04	‘H NMR (DMSO-7₆.400 MHz): δ 10.71 (s, 1H), 9.03 (t, 7= 5.1 Hz, 1H), 8.98 (s, 1H), 7.79 (s, 1H), 7.69 (dd,7= 7.4,1.4 Hz, 1H), 7.58 (d, 7 = 9.5 Hz, 1H), 7.56-7.47 (m, 3H), 7.46-7.42 (m, 1H), 4.64 (d, 7= 5.7 Hz, 2H);
1430	0 z^Z ^NH /? OXC< ηΛα F ? N	A, 55,214	24	369.9 (M⁺+l);	c₁₈h₁₂fn₃ O₃S 369.06	‘H NMR (DMSO-7_tf,400 MHz): δ 10.71 (s, 1H), 8.89 (t, 7= 5.1 Hz, 1H), 8.29 (s, 1H), 7.69 (dd,7= 7.4,1.5 Hz, 1H), 7.58 (d, 7 = 9.4 Hz, 1H), 7.56-7.45 (m,

234

						3H), 7.43 (d, J = 6.5 Hz, 1H), 7.02 (s, 1H), 4.50 (d, .7=5.5 Hz, 2H);
1411	0 F	A, 55,215	37	394.9 (MM);	c₂₀h₁₅fn₄0₂S 394.09	‘H NMR (DMSO-<Z_d>400 MHz): δ 10.73 (s, 1H), 9.02 (s, 1H), 8.67 (s, 2H), 8.44 (t,J= 5.1 Hz, 1H), 7.69 (d, .7=6.9 Hz, 1H), 7.587.45 (m, 4H), 7.34 (d,J=6.5 Hz, 1H), 3.52 (q, 2H), 2.82 (t, J= 6.6 Hz, 2H);
1394	Ο ^Ny^\-A	A, 55, 216	44	393.9 (M%1)	C₂iH₁₆FN₃0₂S 393.09	‘H NMR (DMSO-d_s,400 MHz): δ 10.73 (brs, 1H), 8.538.46 (m, 1H), 8.45-8.39 (m, 1H), Ί.Ί2-Ί.6Ί (m, 2H), 7.577.45 (m, 4H), 7.40 (d, J = 6.6 Hz, 1H), 7.26 (d, J =7.7 Hz, 1H), 7.24-7.22 (m, 1H), 3.58 (q, 2H), 2.94 (t, J= 7.2 Hz, 2H);
1395	Ο /^λ~ ^Ny^\-A F	A, 55, 217	51	393.9 (M*+l)	c₂₁h₁₆fn₃ O₂S 393.09	‘H NMR (DMSO-di.400 MHz): δ 10.74 (s, 1H), 8.42 (d, J= 8.7 Hz, 3H), 7.69 (d, J =7.0 Hz, 1H), 7.64 (d, J =7.8 Hz, 1H), 7.60-7.44 (m, 4H), 7.36 (d, .7= 6.5 Hz, 1H), 7.30 (dd, J = 7.5,4.9 Hz, 1H), 3.48 (q, 2H), 2.81 (t, J= 6.8 Hz, 2H);

235

1396	0 NH 0 U-sAXJTp.	A, 55,218	46	379.9 (NT+l);	c₂₀h₁₄fn₃ O₂S 379.08	Ή NMR (DMSO-Jtf, 400 MHz): δ 10.70 (brs, 1H), 8.95 (t, 7= 5.1 Hz, 1H), 8.52 (s, 1H), 8.46 (d, 7 = 3.9 Hz, 1H), 7.75-7.64 (m, 2H), 7.59 (d, 7 = 9.5 Hz, 1H), 7.56-7.44 (m, 4H), 7.35 (dd, 7 = 7.7,4.9 Hz, 1H), 4.46 (d, 7 = 6.0 Hz, 2H);
1557	0 NH P	A, 55, 347	38	383.9 (MM)	C_I9Hi₄FN₃0₃s 383.07	‘H NMR (DMSO-7_d400 MHz): δ 10.73 (s, 1H), 8.46 (t, 7= 4.9 Hz, 1H), 8.22 (s, 1H), 7.71-7.67 (m, 1H), 7.58-7.45 (m, 4H), 7.39 (d, 7=6.5 Hz, 1H), 6.92 (s, 1H), 3.48(q, 7 = 6.6 Hz, 2H), 2.89 (t, 7=6.7 Hz, 2H);
1558	0 'f- NH P CUCtA^	A, 55,352	33	400.0 (MM)	c₁₉h₁₄fn₃ O₂S₂ 399.05	‘H NMR (DMSO-7_tf>400 MHz): δ 10.75 (s, 1H), 8.93 (s, 1H), 8.49 (t, 7= 4.5 Hz, 1H), 7.72-7.64 (brs, 2H), 7.59-7.44 (m, 4H), 7.41 (d, 7= 6.5 Hz, 1H), 3.47(q, 7 = 6.4 Hz, 2H), 3.08 (t, 7=6.6 Hz, 2H);
1491	0 F	A, 55, 219	87	469.0 (MM);	C₂8H₂iFN₂o₂s 468.13	‘H NMR (DMSO-A.400 MHz): δ 10.75 (s, 1H), 8.45 (t, 7= 4.5 Hz, 1H), 7.69 (dd,7= 7.4,1.3 Hz, 1H), 7.64(d, 7

236

						= 7.3 Hz, 2H), 7.61-7.42 (m, 8H), 7.40 (d, J = 6.5 Hz, 1H), 7.37-7.30 (m, 3H), 3.48 (q, J = 6.8 Hz, 2H), 2.84 (t,J= 7.2 Hz, 2H)
1507	0 / ^NH /? LTsAX. h ''XJ F	A, 55,406	47	499.9 (KT+1);	c₂₄h₂₂fn₃ O₄S₂ 499.10	‘HNMR (DMSO-di.400 MHz): δ 10.75 (s, 1H), 8.42 (t, J= 5.1 Hz, 1H), 7.71-7.63 (m, 3H), 7.57-7.45 (m, 6H), 7.35 (d, J= 6.5 Hz, lH),3.50(q, J = 6.7 Hz, 2H), 2.91 (t, J =6.9 Hz, 2H), 2.56 (s, 6H);
1508	0 ^S F ^H	A, 55,185	32	365.9 (M+l)	Ci₉H₁₂FN₃ O₂S 365.06	‘HNMR (DMSO-<4.400 MHz): δ 10.79 (s, 2H), 8.48 (d, J= 6.0 Hz, 2H), 7.73-7.66 (m, 2H), 7.62 (d, J = 6.3 Hz, 2H), 7.59-7.45 (m, 4H);
1509	0 ÏAnh /?	A, 55,186	53	441.0 (MM)	c₂₆h₁₇fn₂ O₂S 440.10	‘HNMR (DMSO-<7_di400 MHz): δ 10.79 (s, 1H), 10.51 (s, 1H), 7.98 (s, 1H), 7.71 (dd, J = 7.4,15 Hz, 1H), 7.68-7.59 (m, 4H), 7.587.44 (m, 6H), 7.43-7.35 (m, 3H);
1518	Q. F ^-nhJ 9 N^⁷	B, 62,212	39	398.9 (NT+1)	Ci₉H_I2F₂N ₄O₂S 398.06	‘HNMR (DMSO-d₆,400 MHz): δ 10.68 (s, 1H), 9.38 (t, J= 6.0 Hz, 1H), 9.10 (s, 1H), 8.73 (s, 2H),

237

						7.72-7.68 (m, 1H), 7.59-7.46 (m, 4H), 4.50 (d, .7= 5.9 Hz, 2H);
1545	Q. p hX^s> F < N	B, 62,213	25	403.9 (JvT+i)	C₁₈H_hF₂N 3O2S2 403.03	‘H NMR (DMSO-i/e, 400 MHz): δ 10.66 (s, 1H), 9.39 (t, J= 5.9 Hz, 1H), 9.00 (s, 1H), 7.79 (s, 1H), 7.72-7.68 (m, 1H), 7.59-7.45 (m, 4H), 4.66 (d, .7= 5.7 Hz, 2H);
1530	Q\ F ^NbJ j? xZsZsAhXt⁰, F L f N	B, 62, 214	30	387.9 (ΚΓ+1)	Ci₈H_hF₂N 3O3S 387.05	‘H NMR (DMSO-Jô, 400 MHz): δ 10.66 (s, 1H), 9.26 (t, J= 5.6 Hz, 1H), 8.31 (s, 1H), 7.73-7.66 (m, 1H), 7.58-7.46 (m, 4H), 7.02 (s, lH),4.51(d, J= 5.5 Hz, 2H);
1562	Q\ p z^î ^NiMxA ⁿ F	B, 62, 215	25	413.0 (ΝΓ+1)	C₂₀Hi₄F₂N ₄O₂S 412.08	‘H NMR (DMSO-<7₆,400 MHz): δ 10.66 (s, 1H), 9.03 (s, 1H), 8.80 (t,J= 5.9 Hz, 1H), 8.67 (s, 2H), 7.78-7.62 (m, 1H), 7.58-7.43 (m, 4H), 3.53 (q, 2H), 2.81 (t, J= 6.5 Hz, 2H);
1519	Q. f nh/o X^-S^\=A_f h ^x _n>	B, 62,216	25	411.9 (Nf+l)	C₂₁H_ISF₂N 3O2S 411.09	‘H NMR (DMSO-î7₆, 400 MHz): δ 10.64 (s, 1H), 8.78 (t, J= 5.5 Hz, 1H), 8.49 (d, .7=4.2 Hz, 1H), 7.777.62 (m, 2H), 7.59-7.41 (m, 4H), 7.35-7.13 (m, 2H), 3.58 (q, 2H), 2.92 (t,

238

						J= 7.2 Hz, 2H);
1531	Ο MM	B, 62,217	57	411.9 (MM)	C₂iH₁₅F₂N 3O2S 411.09	‘H NMR (DMSO-A,400 MHz): δ 10.66 (s, 1H), 8.80 (t, J= 5.6 Hz, 1H), 8.51-8.34 (m, 2H), 7.72-7.68 (m, 1H), 7.65 (td, J= 1.9, 7.8 Hz, 1H), 7.577.45 (m, 4H), 7.31 (dd, J= 7.7.4.8 Hz, 1H), 3.49 (q, 2H), 2.80 (t,J= 6.8 Hz, 2H);
1563	cWm	B, 62, 352	28	418.0 (MM)	c₁₉h₁₃f₂n 3O2S2 417.04	‘H NMR (DMSO-rf₆,400 MHz): δ 10.66 (s, 1H), 8.94 (s, 1H), 8.88 (t,J= 5.5 Hz, 1H), 7.72-7.69 (m, 1H), 7.68 (s, 1H), 7.58-7.46 (m, 4H), 3.48 (q, 2H),3.06(t, J= 6.6 Hz, 2H);
1546	Q\ F o	B, 62, 218	46	398.0 (MM)	C₂oH₁₃F₂N 3O2S 397.07	‘H NMR (DMSO-î/₆,400 MHz): δ 10.67 (s, 1H), 9.31 (t, J= 6.0 Hz, 1H), 8.52 (s, 1H), 8.48 (dd,J= 4.8,1.6 Hz, 1H), 7.74-7.64 (m, 2H), 7.587.46 (m, 4H), 7.39-7.36 (m, 1H), 4.48 (d, J = 5.9 Hz, 2H);
1497	θ' p ^S F	B, 62,219	15	487.0 (MM);	C₂₈H2oF₂N 2O2S 486.12	‘H NMR (DMSO-J_6i400 MHz): δ 10.63 (s, 1H), 8.81 (t, J= 5.9 Hz, 1H), 7.71-7.65 (m, 1H), 7.63- 7.60 (m, 2H), 7.58-

239

						7.50 (m, 3H), 7.50-7.40 (m, 5H), 7.35-7.28 (m, 3H), 3.46 (q, 2H), 2.80 (t, 7= 7.1 Hz, 2H);
1272	0	A, 70, 261	55	412.8 (NT+l);	C23H26N2O 3S 410.17	‘H-NMR (DMSO-d_tf, 400 MHz): δ 10.74 (s, 1H), 8.42 (t, J= 6.4 Hz, 1H), 7.64-7.60 (m, 2H), 7.54 (s, 1H), 7.43 (d, 7 = 8.8 Hz, 1H), 7.18 (s, 1H), 7.05 (d, 7=8.8 Hz, 1H), 3.76 (s, 3H), 3.243.21 (m, 2H), 1.70-1.58 (m, 5H), 1.40-1.35 (m,2H), 1.261.09 (m,4H), 0.91-0.83 (m, 2H);
1287	0 ^S ο ^H 1	A, 76, 261	46	411.9 (M+l);	C23H26N2O 3S 410.17	‘H-NMR (DMS0-<7_d, 400 MHz): δ 10.55 (s, 1H), 8.08 (t, 7= 5.6 Hz, 1H), 7.67 (t, 7= 5.6 Hz, 1H), 7.547.43 (m, 4H), 7.27 (s, 1H), 3.85 (s, 3H), 3.26-3.21 (m, 2H), 1.70-1.59 (m, 5H), 1.391.33 (m, 2H), 1.29-1.12 (m, 4H), 0.93-0.85 (m,2H);
1286	ο	A, 82, 261	20	395.6 (M+l)	C23H26N2O 2S 394.17	‘H-NMR (DMS0-rf_d, 400 MHz): δ 10.69 (s, 1H), 8.37 (t, 7= 5.6 Hz, 1H), 7.68-7.59 (m, 3H), 7.53-7.43 (m, 3H), 3.253.20 (m, 2H), 2.55 (s, 3H),

240

						1.70-1.58 (m, 5H), 1.40-1.35 (m, 2H), 1.261.14 (m,4H), 0.91-0.85 (m, 2H);
1275	0	A, 88,261	35	395.8 (M+l)	C23H26N2O ₂S 394.17	‘H-NMR (DMSO-J_d, 400 MHz): δ 10.66 (brs, 1H), 8.20 (brs, 1H), 7.66 (d, 7= 7.2 Hz, 1H), 7.53-7.44 (m,4H), 7.10 (s, 1H), 3.223.17 (m, 2H), 2.22 (s, 3H), 1.70-1.58 (m, 5H), 1.37-1.09 (m, 6H), 0.900.82 (m, 2H);
1641	0 nh o O^sOy' hX^_n V	A, 88, 212	61	377.3 (M*+l)	C20H16N4O ₂s 376.10	*HNMR (DMSO-7_d,400 MHz): δ 10.62 (s, 1H), 9.10 (s, 1H), 8.91 (t, 7= 5.7 Hz, 1H), 8.75 (s, 2H), 7.67 (dd,7= 1.6,7.4,1.6 Hz, 1H), Ί.5Ί-ΊΑ2 (m, 4H), 7.23 (s, 1H), 4.44 (d, 7= 5.9 Hz, 2H), 2.23 (s, 3H)
1642	0 ^NH /? iji, -Λ/Ν-Χ-s N	A, 88, 213	34	381.9 (M*+i)	C₁₉H_I5N₃O ₂s₂ 381.06	‘H NMR (DMSO-7_d,400 MHz): δ 10.63 (s, 1H), 9.008.95 (m, 2H), 7.79 (s, 1H), 7.66 (dd,7= 7.5,1.5 Hz, 1H), 7.54-7.41 (m, 4H), 7.15 (s, 1H), 4.61(d, 7= 5.7 Hz, 2H), 2.23 (s, 3H);

241

1643	0 __Λ“ΝΗ /9 CUOzi-γκ tr	A, 88,218	75	376.0 (M*+l)	C21H47N3O ₂S 375.10	‘H NMR (DMSO-d_à,400 MHz): δ 10.63 (s, 1H), 8.87 (t, J= 5.9 Hz, 1H), 8.53 (s, 1H), 8.47 (dd,J= 4.8,1.5 Hz, 1H), 7.74-7.65 (m, 2H), 7.567.41 (m, 4H), 7.36 (dd, J= 7.4, 5.1 Hz, 1H), 7.20 (s, 1H), 4.42 (d, J = 6.0 Hz, 2H), 2.23 (s, 3H)
1478	0 9 OuVn, N^⁷	A, 97, 212 (Reaction time 18 h)	45	376.9 (M^+l)	C20H16N4O ₂s 376.10	‘H NMR (DMSO-d₆,400 MHz): δ 10.24 (s, 1H), 9.09 (s, 1H), 8.93 (t, J= 5.9 Hz, 1H), 8.75 (s, 2H), 7.69-7.59 (m, 1H), 7.56-7.39 (m, 4H), 7.14 (d, .7= 7.9 Hz, 1H), 4.44 (d, J = 5.7 Hz, 2H), 2.26 (s, 3H);
1513	0 _/^nh/ 9 N	A, 97, 213	28	382.2 çmF+1)	Ci₉H₁₅N₃O ₂S₂ 381.06	'H NMR (DMSO-d_6>400 MHz): δ 10.23 (s, 1H), 9.01 (t, J= 5.9 Hz, 1H), 8.98 (s, 1H), 7.79 (s, 1H), 7.71-7.59 (m, 1H), 7.55-7.48 (m, 2H), ΊΑΊ7.40 (m, 2H), 7.06 (d,J=7.9 Hz, 1H), 4.61 (d, .7= 5.7 Hz, 2H), 2.27 (s, 3H);
1514	0 _/“ⁿh / 9 VAsAJ/ H^-q N	B, 97, 214	55	365.8 (MM)	C₁₉H₁₅N₃O ₃s 365.08	‘H NMR (DMSO-d₆,400 MHz): δ 10.21 (s, 1H), 8.83 (t, .7= 5.7 Hz, 1H), 8.26 (s, 1H),

242

						7.83-7.56 (m, 1H), 7.56-7.36 (m, 4H), 7.06 (d, 7= 7.9 Hz, 1H), 7.01 (s, 1H), 4.44 (d, 7 = 5.6 Hz, 2H), 2.24 (s, 3H);
1529	îTa. /?	A, 97,215	25	390.9 (M-+1)	c₂₁h_isn₄o ₂S 390.12	‘H NMR (DMSO-7₆.400 MHz): δ 10.20 (s, 1H), 9.03 (s, 1H), 8.68 (s, 2H), 8.38 (t, 7= 5.3 Hz, 1H), 7.69-7.60 (m, 1H), 7.53-7.39 (m, 4H), 6.96 (d, 7= 7.9 Hz, 1H), 3.51 (q, 2H), 2.81 (t, 7= 6.6 Hz, 2H), 2.13 (s, 3H);
1459	0 z^\ ^Νγ^χ-Λ VZ-s-AsV H Ά	A, 97,216	58	390.0 (M*+l)	C22H19N3O ₂S 389.12	‘H NMR (DMSO-7₆,400 MHz): δ 10.20 (s, 1H), 8.48 (d, 7= 4.0 Hz, 1H), 8.34 (br s, 1H), 7.76-7.58 (m, 2H), 7.55-7.35 (m, 4H), 7.26 (d, 7= 7.8 Hz, 1H), 7.23-7.18 (m, 1H), 7.00 (d, 7= 7.8 Hz, 1H), 3.55(d, 7 = 5.5 Hz, 2H), 2.93 (t, 7= 7.1 Hz, 2H), 2.19 (s, 3H);
1467	0 /λ~ ^ΝΥχ-Α	A, 97,217	29	390.0 (NT+i)	C₂₂H₁₉N₃O 2S 389.12	‘H NMR (DMSO-7₆,500 MHz): δ 10.20 (s, 1H), 8.468.39 (m, 2H), 8.36 (t, 7= 5.4 Hz, 1H), 7.65 (td, 7= 6.2,3.0 Hz, 2H), 7.587.38 (m, 4H), 7.31 (dd,7= 7.7,4.8 Hz,

243

						1H), 6.96 (d, J = 8.1 Hz, 1H), 3.47 (d,7=5.5 Hz, 2H), 2.80 (t, 7= 6.8 Hz, 2H), 2.15 (s, 3H);
1560	0 /-nh / 9	A, 97, 347	21	379.9 (M*+l)	C20H47N3O 3S 379.10	‘HNMR (DMSO-7₆40° MHz): δ 10.22 (s, 1H), 8.41 (t, 7= 5.7 Hz, 1H), 8.22 (s, 1H), 7.72- 7.58 (m, 1H), 7.56-7.35 (m, 4H), 7.01 (d, 7= 7.9 Hz, 1H), 6.92 (s, lH),3.45(d,7 = 6.2 Hz, 2H), 2.98-2.81 (m, 2H), 2.22 (s, 3H);
1561	0 _7~nh/ 9 OOM	A, 97,352	34	396.0 (MAI)	C20H17N3O 2S2 395.08	‘HNMR (DMSO-7₆₁400 MHz): δ 10.22 (s, 1H), 8.93 (s, 1H), 8.44 (t, 7= 5.9 Hz, 1H), 7.68 (s, 1H), 7.67-7.63 (m, 1H), 7.54-7.47 (m, 2H), 7.467.42 (m, 2H), 7.02 (d, 7= 7.9 Hz, 1H), 3.45 (q, 2H),3.07(t, 7= 6.6 Hz, 2H), 2.21 (s, 3H);
1515	0	A, 97,218	40	376.0 (Nf+l)	CziHnNjO 2S 375.10	‘HNMR (DMSO-7₆,400 MHz): δ 10.24 (s, 1H), 8.90 (t, 7= 6.1 Hz, 1H), 8.54-8.51 (m, 1H), 8.46 (d, 7 = 5.3 Hz, 1H), 7.70 (dt,7= 7.8,1.9 Hz, 1H), 7.67-7.63 (m, 1H), 7.547.40 (m, 4H), 7.36 (dd, 7=

244

						7.5, 5.1 Hz, 1H), 7.12 (d, J = 7.9 Hz, 1H), 4.42 (d,J= 6.0 Hz, 2H), 2.27 (s, 3H);
1495	0 Ca<τθ	A, 97, 219	41	465.0 (MA1)	C₂₉H₂₄N₂O ₂s 464.16	Ή NMR (DMSO-J_6i400 MHz): δ 10.20 (s, 1H), 8.37 (t, J= 5.1 Hz, 1H), 7.64 (d,J=7.2 Hz, 3H), 7.59 (d, .7= 8.0 Hz, 2H), 7.53-7.40 (m, 6H), 7.397.26 (m, 3H), 7.00 (d, .7=7.9 Hz, 1H), 3.48 (q, 2H),2.83(t, J= 6.9 Hz, 2H), 2.19 (s, 3H);
1516	0	B, 97,185	34	361.9 (MAI)	C20H15N3O 2S 361.09	‘H NMR (DMSO-J₆,400 MHz): δ 10.73 (brs, 1H), 10.34 (br s, 1H), 8.45 (d, J = 4.6 Hz, 2H), 7.71-7.53 (m, 5H), 7.50-7.44 (m, 2H), 7.26 (d, J =7.9 Hz, 1H), 2.34 (s, 3H);
1517	0 / ^NHJ /° H ïVv fV⁰» « /A A / N VA //	B, 97,406	50	496.0 (M+l)	C25H25N3O ₄S₂ 495.13	‘H NMR (DMSO-<4,400 MHz): δ 10.21 (s, 1H), 8.36 (t, J= 5.6 Hz, 1H), 7.69-7.62 (m, 3H), 7.57-7.40 (m, 6H), 6.96 (d, .7=7.9 Hz, 1H), 3.50 (d, J = 5.3 Hz, 2H), 2.90 (t, J= 6.7 Hz, 2H), 2.58 (s, 6H), 2.14 (s, 3H);

245

1496	Ο 'f- νη/ 9	Β, 97,186	37	437.0 (MX)	C27H20N2O ₂s 436.12	Ή NMR (DMSO-de 400 MHz): δ 10.42 (s, 1H), 10.31 (s, 1H), 8.00 (s, 1H), 7.70-7.63 (m, 2H), 7.627.53 (m, 4H), 7.51-7.43 (m, 4H), 7.43-7.35 (m, 3H), 7.26 (d,/=7.9 Hz, 1H), 2.37 (s, 3H);
1276	0 νη νη₂ η	Α, 135,261	40	424.8 (MX);	C2₃H2₅N₃O 3S 423.16	‘H-NMR (DMSO-A 500 MHz): δ 10.86 (brs, 1H), 8.458.44 (m, 1H), 8.14 (s, 1H), 8.00 (s, 1H), 7.89 (d,/=8.0 Hz, 1H), 7.75 (d,/=8.0Hz, 1H), 7.65 (d,/ = 8.5 Hz, 1H), 7.57 (d, /= 8.5 Hz, 2H), 3.243.23 (m, 2H), 1.70-1.58 (m, 5H), 1.37 (t,/= 6.5 Hz, 2H), 1.18-1.09 (m, 5H), 0.86 (t,/= 6.5 Hz, 2H);
1200	0. /ΐ ^ΝΗ __ ⁰ «0	Α, 140,211	73	375.1 (MX);	C22H18N2O 2S 374.11	‘H-NMR (DMSO-/_d, 400 MHz): δ 10.85 (s, 1H), 8.60 (t, /= 4.8 Hz, 1H), 8.01 (s, 1H), 7.78 (d,/=8.4 Hz, 1H), 7.69 (d,/=8.4Hz, 1H), 7.54-7.44 (m, 3H), 7.307.17 (m, 6H), 3.47-3.42 (m, 2H), 2.82 (t,/= 7.6 Hz, 2H);

246

1207	σ	A, 145, 3cyclohexylp ropanoic acid	35	381.1 (Μ*+1)	C22H24N2O ₂s 380.16	'H-NMR (DMSO-7_d, 400 MHz): δ 10.67 (s, 1H), 10.03 (s, 1H), 7.66 (d ,7= 7.2 Hz, 1H), 7.60 (s, 1H), 7.50-7.40 (m, 4H), 7.31 (d,7=8.4 Hz, 1H), 2.32-2.27 (m, 2H), 1.691.60 (m, 5H), 1.48-1.43 (m, 2H), 1.18-1.13 (m, 4H), 0.900.85 (m, 2H);
1644	0	A, 150,261	54	381.4 (MM)	C22H24N2O 2S 380.16	‘H-NMR (DMSO-7₀, 400 MHz): δ 10.77 (brs, 1H), 8.588.54 (m, 1H), 8.12 (s, 1H), 7.90 (d, 7=8.0 Hz, 1H), 7.627.56 (m, 2H), 7.38-7.34 (m, 1H), 7.23 (d, 7 = 8.0 Hz, 1H), 7.16 (t, 7= 6.8 Hz, 1H), 3.273.24 (m, 2H), 1.72-1.58 (m, 5H), 1.26-1.11 (m, 5H), 0.960.82 (m, 2H);
1645	ο	B, 155, 3cyclohexylp ropanoic acid	6	381.2 (M+l);	C22H24N2O ₂s 380.16	‘H-NMR (DMSO-7_d, 400 MHz): δ 10.64 (s, 1H), 10.08 (s, 1H), 7.95 (s, 1H), 7.68-7.65 (m, 1H), 7.53 (d, 7= 7.2 Hz, 1H), 7.43 (d,7 = 8.4 Hz, 1H), 7.34 (t, 7= 8.0 Hz, 1H), 7.22 (d, 7= 7.2 Hz, 1H), 7.13(1,7= 7.6 Hz, 1H), 2.32-2.27 (m, 2H), 1.69-1.60

247

						(m, 4H), 1.491.41 (m, 2H), 1.28-1.13 (m, 4H), 0.90-0.85 (m, 3H);
1373	0 ρΑ™ ° 0 Q	Α, 156,212 (Reaction time24 h)	21	378.9 (M%1)	C19H14N4O ₃s 378.08	‘H NMR (DMSO-7₆, 500 MHz): δ 11.03 (brs, 1H), 9.21 (t,7= 5.4 Hz, 1H), 9.06 (s, 1H), 8.73 (s, 2H), 7.88 (d, J = 8.1 Hz, 1H), 7.83-7.76 (m, 2H), 7.74-7.67 (m, 3H), 7.637.59 (m, 1H), 4.46 (d,7=4.9 Hz, 2H);
1388	0 ° - «Μ N	A, 156,213	21	383.9 (W+l)	C18H13N3O 3S2 383.04	‘H NMR (DMSO-i/e, 400MHz): δ 11.05 (s, 1H), 9.31 (t, 7=6.3 Hz, 1H), 8.96 (s, 1H), 7.887.60 (m, 8H), 4.65 (d, 7=5.6 Hz, 2H);
1381	0 ^ΝΗ ° J '=' Ν-Χ „ X;	A, 156,214	23	367.9 (M+l)	C18H43N3O ₄S 367.06	‘H NMR (DMSO-7₆,400 MHz): δ 11.05 (s, 1H), 9.14 (t, 7= 5.6 Hz, 1H), 8.27 (s, 1H), 7.88 (dd,7= 8.2,1.5 Hz, 1H), 7.84-7.78 (m, 2H), 7.767.67 (m, 3H), 7.63 (dd, 7= 7.7,1.0 Hz, 1H), 7.04 (s, 1H), 4.51 (d,7 = 5.5 Hz, 2H);
1423	ο χ^Υ-ΝΗ Η 1 V-X Ρ Yk_{s Ν} ο - γ-α	B, 156,215	32	393.0 (Nf+1)	C₂₀H₁₆N₄O 3S 392.09	Ή NMR (DMSO-d_6i400 MHz): δ 11.06 (s, 1H), 9.01 (s, 1H), 8.69 (t, 7= 5.6 Hz, 1H),

248

						8.66 (s, 2H), 7.84-7.77 (m, 3H), 7.74 (d, J = 7.0 Hz, 1H), 7.67 (d, 7=8.2 Hz, 1H), 7.657.60 (m, 2H), 3.53 (q, 7=6.3 Hz, 2H), 2.84 (t, 7= 6.6 Hz, 2H);
1374	Ο ί η ο Ν-⁷	Α, 156,216	44	391.9 (Nf+1)	C_2IH_I7N₃O ₃S 391.10	‘H NMR (DMSO-7_6j400 MHz): δ 11.06 (s, 1H), 8.69 (t, 7= 5.6 Hz, 1H), 8.51-8.47 (m, 1H), 7.85-7.78 (m, 3H), 7.74 (d, 7= 6.9 Hz, 1H), 7.71-7.60 (m, 4H), 7.25 (d, 7= 7.7 Hz, 1H), 7.23-7.18 (m, 1H), 3.59 (q, 7= 6.5 Hz, 2H), 2.96 (t, 7= 7.3 Hz, 2H);
1389	0 x^s/'NH ί jT . Ο ° ηΧ-Ο	Α, 156,217	21	391.9 (MAI)	C₂₁H₁₇N₃O ₃s 391.10	‘HNMR (DMSO-7_6>400 MHz): δ 11.06 (s, 1H), 8.69 (t, 7= 5.2 Hz, 1H), 8.44-8.37 (m, 2H), 7.84-7.72 (m, 4H), 7.707.60 (m, 4H), 7.29 (dd, 7= 7.5, 5.0 Hz, lH),3.49(q,7 = 6.5 Hz, 2H), 2.83 (t, 7= 7.0 Hz, 2H);
1382	0 η Ί ρ IÎjA Ζ=\ AA/MJ 0 Η	Α, 156,185	8	363.9 (Μ+1)	c₁₉h₁₃n₃o ₃S 363.07	‘HNMR (DMSO-7₆,400 MHz): δ 11.13 (brs, 1H), 10.69 (s, 1H), 8.53-8.43 (m, 2H), 7.99 (dd, 7 = 8.1,1.5 Hz, 1H), 7.86-7.75 (m, 5H), 7.75-

249

						7.70 (m, 2H), 7.67-7.62 (m, 1H);
1375	Ο	Α, 156,186	33	439.5 (Μ*+1)	C26H18N2O ₃S 438.10	‘H NMR (DMSO-J₆,400 MHz): δ 11.13 (s, 1H), 10.44 (s, 1H), 8.077.98 (m, 2H), 7.87-7.72 (m, 6H), 7.68-7.60 (m, 3H), 7.527.35 (m, 5H);
1427	0 ΝΗ Ρ kAsηΑγ^_ν 0 X-sJ	Α, 156,218	19	377.9 (MY1);	C20H45N3O 3S 377.08	Ή NMR (DMSO-d₆,400 MHz): δ 11.05 (s, 1H), 9.21 (t, .7=5.9 Hz, 1H), 8.53 (s, 1H), 8.45 (dd,J= 4.7,1.4 Hz, 1H), 7.90 (dd, J = 8.2,1.5 Hz, 1H), 7.85-7.68 (m, 6H), 7.63 (td, .7=7.5,1.3 Hz, 1H), 7.34 (dd, J= Ί.1, 4.8 Hz, 1H), 4.47 (d, .7= 5.2 Hz, 2H);
1485	0 _/~^ΝΗ Ρ 0θ0Λ^ξ> ό	Α, 156,347	18	381.9 (Μ%1)	CiçHijNsO ₄S 381.08	‘H NMR (DMSO-<4,400 MHz): δ 11.06 (s, 1H), 8.73 (t, J= 5.6 Hz, 1H), 8.21 (s, 1H), 7.85 -7.78 (m, 3H), 7.74 (dd, J = 9.5,2.7 Hz, 1H), 7.68 (d, J = 8.4 Hz, 2H), 7.63 (td, .7= 10.1,1.1 Hz, 1H), 6.92 (s, 1H), 3.53-3.46 (m, 2H), 2.90 (t, J= 6.7 Hz, 2H);
1527	0 _/-ΝΗ 0 CmOR^ II ° 0	Α, 156,352	24	397.8 (κΓ+ΐ)	C₁₉H_isN₃O ₃S₂ 397.06	‘H NMR (DMSO-tZ₆,400 MHz): δ 11.07 (brs, 1H), 8.90

250

						(s, 1H), 8.76 (t, 2= 5.5 Hz, 1H), 7.877.78 (m, 3H), 7.75 (d, 2 = 7.3 Hz, 1H), 7.71-7.67 (m, 3H), 7.66-7.60 (m, 1H), 3.523.45 (m, 2H), 3.10(1,2=6.7 Hz, 2H);
1476	δ	A, 156,219	29	467.0 (MM)	C28H22N2O 3S 466.14	‘H NMR (DMSO-2_6j400 MHz): δ 11.07 (s, 1H), 8.72 (t, 2= 5.4 Hz, 1H), 7.87-7.78 (m, 3H), 7.76-7.73 (m, 1H), 7.717.67 (m, 2H), 7.65-7.60 (m, 3H), 7.58 (d, 2 = 8.2 Hz, 2H), 7.47-7.41 (m, 2H), 7.36-7.29 (m, 3H), 3.50 (q, 2= 6.7 Hz, 2H), 2.86 (t, 2= 7.2 Hz, 2H);
1486	0 NH 0 Γχ II 0	A, 156,406	17	498.0 (M*+l)	C24H23N3O 5S2 497.11	‘H NMR (DMSO-X.400 MHz): δ 11.06 (s, 1H), 8.68 (t, 2= 5.5 Hz, 1H), 7.85-7.77 (m, 3H), 7.76-7.73 (m, 1H), 7.687.61 (m, 5H), 7.48 (d,2=8.4 Hz, 2H), 3.613.45 (m, 2H), 2.92 (t, 2= 7.0 Hz, 2H), 2.53 (s, 6H);
1575	0, N H P Q_s^ N^H2 II 0	B, 156,133	48	286.8 (M-+1)	Ci₄H₁₀N₂O 3S 286.04	‘H-NMR DMSO-2₆,400 MHz): δ 11.05 (brs, 1H), 8.06 (brs, 1H), 7.937.58 (m, 7H), 7.52 (brs, 1H);

251

1446	0 ΝΗ P 0 0 < hr	A, 159,212	38	395.0 (M*+l)	C19H14N4O 4S 394.07	‘H NMR (DMSO-<7₆,400 MHz): δ 11.51 (s, 1H), 9.34 (t, J= 5.8 Hz, 1H), 9.08 (s, 1H), 8.76 (s, 2H), 8.06 (d,J=8.2 Hz, 1H), 8.017.95 (m, 2H), 7.92-7.80 (m, 4H), 4.50 (d, J = 5.6 Hz, 2H);
1455	0 -Χ^- NH P pxppPh^\'^s _xào y	A, 159,213	27	399.9 (Nf+1)	C₁₈H_I3N₃O 4S2 399.03	‘H NMR (DMSO-tA 400 MHz): δ 11.50 (s, 1H), 9.42 (t, .7= 5.9 Hz, 1H), 8.97 (s, 1H), 8.05 (d,J=8.3 Hz, 1H), 7.98 (td, .7=7.4,1.1 Hz, 2H), 7.90 (td, J =7.5,1.4 Hz, 1H), 7.877.77 (m, 4H), 4.67 (d, .7=5.6 Hz, 2H);
1456	0 VPsr'PP' hPt°\ â'o < υ u	A, 159,214	23	384.0 (ivrt+i)	C_1SH₁₃N₃O 5S 383.06	‘H NMR (DMSO-<7₆,400 MHz): δ 11.51 (brs, 1H), 9.26 (t, J= 5.6 Hz, 1H), 8.29 (s, 1H), 8.05 (d, J = 8.3 Hz, 1H), 8.01-7.95 (m, 2H), 7.90 (td, J = 7.5,1.5 Hz, 1H), 7.88-7.78 (m, 3H), 7.06 (s, 1H), 4.53(d, J= 5.3 Hz, 2H);
1457	PPPPF^PLn 'zx' 0 0	A, 159,215	32	409.0 (mU-1)	C20H16N4O ₄S 408.09	‘H NMR (DMSO-îZ₆, 400 MHz): δ 11.51 (s, 1H), 9.01 (s, 1H), 8.80 (t,J= 5.7 Hz, 1H), 8.67 (s, 2H), 8.03 (d, J= 8.2 Hz, 1H), 8.017.96 (m, 2H),

252

						7.94-7.82 (m, 2H), 7.76 (s, 1H), 7.71 (dd,J = 8.3,1.6 Hz, 1H), 3.55 (q, J = 6.3 Hz, 2H), 2.86 (t,J= 6.6 Hz, 2H);
1447	0 Ο 0	A,159,216	30	408.0 (MM)	C21H17N3O ₄S 407.09	Ή NMR (DMSO-îZ₆, 400 MHz): δ 11.51 (s, 1H), 8.80 (t, J= 5.5 Hz, 1H), 8.51-8.48 (m, 1H), 8.03 (d, J = 8.3 Hz, 1H), 8.00-7.96 (m, 2H), 7.93-7.83 (m, 2H), 7.797.78 (m, 1H), 7.74 (dd,J= 8.3,1.6 Hz, 1H), 7.69 (td, J = 7.7,1.8 Hz, 1H), 7.26 (d, J = 7.7 Hz, 1H), 7.23-7.19 (m, 1H), 3.64-3.57 (m, 2H), 2.97 (t, J= 7.3 Hz, 2H);
1448	0 _/-νη 9 VAs'A^'h^-'V-n 2>\' 0 0	A, 159,217	22	407.9 (MM)	C^lHnNjO ₄S 407.09	‘H NMR (DMSO-î?₆, 400 MHz): δ 11.52 (s, 1H), 8.81 (t, J =5.6 Hz, 1H), 8.48-8.36 (m, 2H), 8.03 (d, J = 8.3 Hz, 1H), 8.01-7.95 (m, 2H), 7.93-7.83 (m, 2H), 7.797.78 (m, 1H), 7.73 (dd,J= 8.3,1.5 Hz, 1H), 7.64 (d, J = 7.8 Hz, 1H), 7.29 (dd, .7= 7.8,4.7 Hz, 1H), 3.51 (q, J = 6.5 Hz, 2H), 2.85 (t, J= 7.0 Hz, 2H);

253

1449	0 _/“NH /? 0 0 \ J hr	A,159,218	15	393.9 (M*+l)	C20H15N3O ₄S 393.08	Ή NMR (DMSO-d₆,400 MHz): δ 11.49 (brs, 1H), 9.33 (t, 7= 5.5 Hz, 1H), 8.60-8.39 (m, 2H), 8.05 (d, 7= 8.2 Hz, 1H), 8.02-7.94 (m, 2H), 7.937.81 (m, 4H), 7.70 (d, 7=7.7 Hz, 1H), 7.34 (dd,7=7.6,4.8 Hz, 1H), 4.49 (d, 7= 5.5 Hz, 2H);
1462	0 H 0 0	A, 159,185	15	379.9 (M*+l)	c_I9h_I3n₃o ₄S 379.06	‘H NMR (DMSO-φ, 400 MHz): δ 11.60 (s, 1H), 10.80 (s, 1H), 8.50 (d, 7= 6.1 Hz, 2H), 8.13 (d, 7= 8.2 Hz, 1H), 8.01 (td, 7=7.9,1.0 Hz, 2H), 7.967.84 (m, 4H), 7.73 (d, 7=6.3 Hz, 2H);
1458	0 ^NH /? ζΓ/Ν-χΙ VVV H oo θ	A, 159,186	33	455.0 (ΜΑ-l)	C26H18N2O ₄S 454.10	‘H NMR (DMSO-d₆,400 MHz): δ 11.57 (s, 1H), 10.53 (s, 1H), 8.10 (d, 7= 8.2 Hz, 1H), 8.04- 7.96 (m, 3H), 7.95-7.82 (m, 4H), 7.73 (d, 7= 7.6 Hz, 1H), 7.66-7.56 (m, 2H), 7.507.33 (m, 5H);
1616	0 / ^NH /9 (Xda^On fj 'k 0 0	A, 159, 347	9	398.0 (MAI)	c₁₉h_I5n₃o 5S 397.07	‘H NMR (DMSO-7₀,400 MHz): δ 11.52 (s, 1H), 8.84 (t, 7= 5.7 Hz, 1H), 8.22 (s, 1H), 8.04 (d, 7=8.2 Hz, 1H), 8.007.96 (m, 2H), 7.91 (dd,7=

254

						7.4,1.5 Hz, 1H), 7.89-7.79 (m, 2H), 7.74 (dd, 7=8.3,1.5 Hz, 1H), 6.92 (s, 1H), 3.51 (q, 7= 6.5 Hz, 2H), 2.92 (t, 7= 6.8 Hz, 2H).
1617	0 >-ΝΗ 0 0 0	A, 159,352	44	414.0 (M*+l)	c₁₉h₁₅n₃o 4S2 413.05	‘H NMR (DMSO-7_d,400 MHz): δ 11.53 (s, 1H), 8.91 (s, 1H), 8.87 (t, 7= 5.5 Hz, 1H), 8.05 (d,7=8.3 Hz, 1H), 8.017.96 (m, 2H), 7.92-7.83 (m, 2H), 7.81 (s, 1H), 7.76 (dd, 7 = 8.3,1.4 Hz, 1H), 7.69 (s, lH),3.50(q,7 = 6.0 Hz, 2H), 3.11 (t, 7= 6.6 Hz, 2H);
1618	H 0 0	B, 159,219 ( Reaction time 24 h)	50	481.1 (MM)	C28H22N2O ₄S 482.13	‘H NMR (DMSO-7_d>400 MHz): δ 11.49 (brs, 1H), 8.83 (t, 7= 5.4 Hz, 1H), 8.04 (d, 7 = 8.3 Hz, 1H), 8.00-7.95 (m, 2H), 7.93-7.80 (m, 3H), 7.76 (dd,7=8.3,1.4 Hz, 1H), 7.647.61 (m, 2H), 7.58 (d, 7= 8.3 Hz, 2H) 7.44 (t, 7= 7.6 Hz, 2H), 7.36-7.30 (m, 3H), 3.52 (q, 7 = 6.5,2H), 2.87 (t, 7= 7.1 Hz, 2H);
1619	0 / ^NH /? η H Ά 0 0	A, 159,406	25	514.0 (Μ*+1)	C₂₄H₂₃N₃O 6¾ 513.10	‘H NMR (DMSO-7_d,400 MHz): δ 11.52 (brs, 1H), 8.80 (t, 7= 5.2 Hz,

255

						1H), 8.03 (d, J = 8.2 Hz, 1H), 8.01-7.96 (m, 2H), 7.93-7.82 (m, 2H), 7.77 (s, lH),7.72(d, J= 8.2 Hz, 1H), 7.65 (d, 7=8.2 Hz, 2H), 7.49 (d, 7= 8.2 Hz, 2H), 3.59-3.49 (m, 2H), 2.94 (t, 7= 6.8 Hz, 2H), 2.54 (s, 6H).
1620	0 ^NH /? ^{0 0}	A, 159, 254	39	392.9 (MM)	C₂₁H_i6N₂O ₄S 392.08	‘H NMR (DMSO-A.400 MHz): δ 11.44 (brs, 1H), 9.27 (t,7=5.9 Hz, 1H), 8.05 (d, 7 = 8.2 Hz, 1H), 7.98 (td, 7= 7.7,1.4, Hz, 2H), 7.93-7.82 (m, 4H), 7.357.28 (m, 4H), 7.27-7.21 (m, 1H), 4.47 (d, 7 = 6.1 Hz, 2H);
1621	0 NH /? ^{0 0} \-/	A, 159,255	42	406.9 (MM)	C₂₂H₁₈N₂O ₄S 406.10	‘H NMR (DMSO-7i,400 MHz): δ 11.45 (brs, 1 H), 9.24 (t, 7= 5.9 Hz, 1H), 8.05 (d, 7 = 8.2 Hz, 1H), 7.98 (td,7= 7.7,1.1 Hz, 2H), 7.93-7.81 (m, 4H), 7.227.18 (m, 1H), 7.13-7.04 (m, 3H), 4.43 (d, J = 5.6 Hz, 2H), 2.27 (s, 3H);
1622	O V-NH o O O < J	A, 159,256	29	411.0 (MM)	C₂iHi5FN₂ O₄S 410.07	‘H NMR (DMSO-<4400 MHz): δ 11.26 (brs, 1H), 9.31 (t, 7= 6.0 Hz, 1H), 8.06 (d, 7 = 8.2 Hz, 1H), 7.98 (td, 7=

256

						7.8,1.3 Hz, 2H), 7.93-7.83 (m, 4H), 7.36 (td, .7=7.8, 6.3 Hz, 1H), 7.167.04 (m, 3H), 4.48 (d, .7=6.0 Hz, 2H);
1623	0 P ^{0 0} \=S=Z F	A, 159,257	43	411.0 (M*+l)	c_2Ih₁₅fn₂o₄s 410.07	‘H NMR (DMSO-^,400 MHz): δ 11.49 (brs, 1H), 9.26 (t, J= 5.9 Hz, 1H), 8.04 (d,J = 8.3 Hz, 1H), 8.00-7.94 (m, 2H), 7.92-7.78 (m, 4H), 7.34 (dd, J= 8.7, 5.6 Hz, 2H), 7.187.10 (m, 2H), 4.44 (d, .7=5.9 Hz, 2H);
1624	0 /Ί~^ΝχΧ hAtMocf₃ ^{0 0} Xssy	A, 159,258	21	476.9 (M*+l)	c₂₂h₁₅f₃n ₂OsS 476.07	‘H NMR (DMSO-rf_d, 400 MHz): δ Π.52 (s, 1H), 9.34 (t, J= 5.9 Hz, 1H), 8.07 (d, .7=8.2 Hz, 1H), 8.017.96 (m, 2H), 7.93-7.82 (m, 4H), 7.46 (t,J= 7.9 Hz, 1H), 7.33 (d, .7=7.7 Hz, 1H), 7.307.22 (m, 2H), 4.51 (d,J=5.9 Hz, 2H)
1634	0 / ^NH /9 ς XA'sAA H N 0 0	G, 159,231	11	385.8 (MM)	C₁₇H_nN₃O ₄S₂ 385.02	‘H NMR (DMSO-A.400 MHz): δ 12.90 (brs, 1H), 11.61 (s, 1H), 8.12-7.98 (m, 5H), 7.96-7.84 (m, 2H), 7.58 (d, .7= 3.7 Hz, 1H), 7.31 (d,J = 3.0 Hz, 1H);

257

1635	Ο _/-ΝΗ /? ο Ο \ —/ Ό	A, 159, 377	32	471.0 (IVT+l)	C₂₅H_I8N₄O ₄S 470.10	‘HNMR (DMSO-iZ_d,500 MHz): δ 11.51 (s, 1H), 9.35 (t, J= 5.7 Hz, 1H), 8.85 (s, 2H), 8.39-8.35 (m, 2H), 8.06 (d, J = 8.2 Hz, 1H), 8.01-7.95 (m, 2H), 7.92-7.81 (m, 4H), 7.547.49 (m, 3H), 4.53 (d, .7=5.5 Hz, 2H);
1646	J’ 9°²'^β%=\ ΑΟΛ-Η) //V 0 0	A, 159,259	36	505.3 (M-l)⁺	C₂₇H₂₆N₂O ₆S 506.15	‘HNMR (DMSO-d_d,4°⁰MHz): δ 11.52 (s, 1H), 8.99 (br s, 1H), 8.05 (d, J= 8.5 Hz, 1H), 8.01-7.96 (m, 2H), 7.93-7.83 (m, 2H), 7.797.73 (m, 2H), 7.26 (d, .7=4.8 Hz, 4H), 7.217.16 (m, 1H), 4.54 (brs, 1H), 3.14-2.98 (m, 2H), 1.34 (s, 9H);
1625	0 _Jr- ΝΗ ο d'b θ	A, 159,176	18	423.0 (M*+l)	C₂₂Hi₈N₂O ₅S 422.09	‘HNMR (DMSO-d_tf ,400 MHz): δ 11.48 (brs, 1H), 8.94 (t, 7= 5.4 Hz, 1H), 8.04 (d, J = 8.3 Hz, 1H), 8.01-7.95 (m, 2H), 7.93-7.78 (m,4H), 7.317.24 (m, 2H), 6.97-6.89 (m, 3H), 4.10 (t, 7= 5.7 Hz, 2H), 3.63 (q,7=5.6 Hz, 2H);
1647	0 _Jr-^NH P Q_s^^o. °°	A, 159,265	29	440.9 (M+l)	C₂₂H]₇FN₂ O₅S 440.08	‘HNMR (DMSO-7_d,400 MHz): δ 1’1.51 (s, 1H), 8.92 (s, 1H), 8.04 (d,7

258

						= 8.2 Hz, 1H), 7.98 (td, J= 7.5, 0.9 Hz, 2H), 7.93-7.77 (m,4H), 7.10 (t, J= 9.3 Hz, 2H), 7.00-6.91 (m, 2H), 4.08 (t, 7= 5.5 Hz, 2H), 3.61 (q, 7=5.6 Hz, 2H);
1648	ο. /~NH ,9 ς Z^CI CQOAA 0 0	A, 159, 253	18	419.8 (M*+l)	c₁₇h₁₀cin 3O4S2 418.98	‘H NMR (DMSO-7_d400 MHz): δ 13.19 (brs, 1H), 11.62 (s, 1H), 8.10 (d, 7= 8.2 Hz, 1H), 8.077.97 (m, 4H), 7.95-7.85 (m, 2H), 7.63 (s, 1H);
1627	0 _/“NH /? QsjOÎrQ ry tx	A, 159, 372	16	471.0 (M+l)	C₂₅H_1SN₄O ₄S 470.10	‘hnmr (DMSO-7_d 400 MHz): δ 11.52 (s, 1H), 9.34 (t, J= 5.9 Hz, 1H), 9.17 (s, 1H), 9.12 (s, 2H), 8.07 (d,7=8.2 Hz, 1H), 7.99 (td, 7=7.8,1.1 Hz, 2H), 7.947.83 (m, 4H), 7.77 (d, 7=8.3 Hz, 2H), 7.46 (d, 7= 8.2 Hz, 2H), 4.53 (d, 7 = 5.7 Hz, 2H);
1637	Q. c >-NH P rx .xyMjG 0 0	H, 159, 241	47	453.9 (M+l)	C₂₁H₁₂FN₃ C>4S₂ 453.03	‘HNMR (DMSO-7_d>400 MHz): δ 13.22 (brs, 1H), 11.63 (s, 1H), 8.15-8.08 (m, 2H), 8.06-7.98 (m, 3H), 7.987.84 (m, 3H), 7.79 (dd, 7= 7.9,4.8 Hz, 1H), 7.33 (td,7 = 8.9,2.4 Hz,

259

						1H);
1649	ΧΧχχΡ rv^ci XX, -Ajn Xi-® 0 0	C, 159, 235	27	413.8 (JVf+l)	C_I9Hi₂C1N 3O4S 413.02	Ή NMR (DMSO-îÎ5,400 MHz): δ 11.56 (brs, 1H), 11.26 (brs, 1H), 8.46 (brs, 1H), 8.20 (d, J = 8.7 Hz, 1H), 8.10-7.83 (m, 8H);
1628	0 _/- NH o (X --O*Xa /^c°^2CH3db ^H θ	A, 159, 519	32	513.0 (nT+i)	C₂₈H₂₀N₂O ₆S 512.10	‘H NMR (DMSO-7_tf,400 MHz): δ 1’1.57 (brs, 1H), 10.54 (s, 1H), 8.11 (d, 7=8.3 Hz, 1H), 8.00 (td, 7=9.0,1.0 Hz, 2H), 7.957.84 (m, 4H), 7.76- 7.72 (m, 3H), 7.64 (td, 7 = 9.1,1.5 Hz, 1H), 7.50 (td, 7 = 7.6,1.3 Hz, 1H), 7.46- 7.39 (m, 2H), 7.087.03 (m, 1H), 3.61 (s, 3H);
1629	0 ^NXxf /⁵⁵^ ^z Λ ^h^<3ⁿ	A, 159,246 (Reaction time RT-18 h)	31	455.9 (Nf+1)	C_2SH_I7N3O ₄S 455.09	‘H NMR (DMSO-7_s,400 MHz): δ 1’1.60 (s, 1H), 10.60 (s, 1H), 8.86 (br s, 1H), 8.60 (d, 7= 3.7 Hz, 1H), 8.13 (d, 7=8.3 Hz, 1H), 8.08 (s, 1H), 8.067.98 (m, 3H), 7.97-7.85 (m, 4H), 7.81 (d,7 = 6.7 Hz, 1H), 7.55-7.48 (m, 3H);
1520	0 _Ρ“ΝΗ /9 CXXuηΛ^_νch₃	A, 164,212	25	360.2 (Kf+1)	C₂oH_I7N₅0 2 359.14	‘H NMR (DMSO-7₆,400 MHz): δ 10.28 (s, 1H), 9.07 (s, 1H), 9.01 (t, 7= 5.7 Hz, 1H),

260

						8.74 (s, 2H), 7.66-7.60 (m, 2H), 7.56 (s, 1H), 7.53-7.47 (m, 1H), 7.26 (d, 7= 8.6 Hz, 1H), 7.20 (d,7 = 8.0 Hz, 1H), 7.10 (t, 7= 7.2 Hz, 1H), 4.47 (d, 7= 5.6 Hz, 2H), 3.29 (s, 3H);
1581	0 h~At^s\ Au O ϋΠ3	A,164,213	10	365.0 (ΝΓ+1)	CijHieNiO ₂s 364.10	'HNMR (DMSO-7_6>500 MHz): δ 10.26 (s, 1H), 9.05 (t, 7= 5.7 Hz, 1H), 8.93 (s, 1H), 7.77 (s, 1H), 7.66-7.44 (m, 4H), 7.20 (dd, 7 = 18.1, 8.2 Hz, 2H), 7.08 (t, 7= 7.4 Hz, 1H), 4.62 (d,7=5.6 Hz, 2H), 3.28 (s, 3H);
1547	0 ^Z A	A, 164,214	25	348.9 (&Γ+1)	C₁₉H₁₆N₄O 3 348.12	); ‘HNMR (DMSO-7₆,400 MHz): δ 10.28 (s, 1H), 8.90 (t, 7= 5.6 Hz, 1H), 8.27 (s, 1H), 7.66-7.59 (m, 2H), 7.55 (s, 1H), 7.52-7.47 (m, 1H), 7.24 (d, 7= 8.5 Hz, 1H), 7.20 (d, 7 = 7.9 Hz, 1H), 7.10 (t, 7= 7.5 Hz, 1H), 7.02 (s, lH),4.50(d, 7= 5.3 Hz, 2H), 3.30 (s, 3H);
1548	MpAA h ch₃	A, 164,215	29	374.0 (MX1)	C₂iH₁₉N₅O 2 373.15	‘HNMR (DMSO-<7₆,400 MHz): δ 10.28 (s, 1H), 9.01 (s, 1H), 8.65 (s, 2H), 8.46 (t,7= 5.7 Hz, 1H),

261

						7.63 (dd,7= 7.7.1.6 Hz, 1H), 7.53-7.47 (m, 3H), 7.21 (dd, 7=11.2, 8.3 Hz, 2H), 7.10 (t, 7= 7.5 Hz, 1H), 3.52 (q, 7= 6.4 Hz, 2H), 3.29 (s, 3H), 2.85 (t, 7= 6.6 Hz, 2H);
1498	0 NH 0 N H _NX ch₃	A, 164, 216	21	373.0 (Nf+1)	C₂₂H₂₀N₄O 2 372.16	‘H NMR (DMSO-7<5,4°0 MHz): δ 10.29 (s, 1H), 8.50 (d, 7= 4.0 Hz, 1H), 8.46 (t, 7= 5.4 Hz, 1H), 7.69 (td, 7=7.6,1.9 Hz, 1H), 7.64 (dd, 7=7.7,1.7 Hz, 1H), 7.577.47 (m, 3H), 7.27-7.18 (m, 4H), 7.10 (t, 7= 7.2 Hz, 1H), 3.57 (q, 7=7.0 Hz, 2H), 3.30 (s, 3H), 2.96 (t, J= 7.3 Hz, 2H);
1549	0 0	A, 164,217	27	373.0 (M*+l)	C₂₂H₂₀N₄O 2 372.16	‘H NMR (DMSO-7₆,400 MHz): δ 10.29 (s, 1H), 8.488.42 (m, 2H), 8.40 (dd, 7= 4.7,1.5 Hz, 1H), 7.63 (dd, 7 = 7.7,1.6 Hz, 2H), 7.57 -7.45 (m, 3H), 7.29 (dd,7=7.7,4.8 Hz, 1H), 7.21 (dd,7=11.0, 8.4 Hz, 2H), 7.10 (t, 7= 7.4 Hz, 1H), 3.48 (q, 7=7.1 Hz, 2H), 3.30 (s, 3H), 2.84 (t, 7= 7.0 Hz, 2H);

262

1532	Ο ✓-U'^ΝΗ /? Ci ch₃	A, 164,352	24	378.0 (MY1);	c₂₀h₁₈n₄o ₂S 378.12	‘H NMR (DMSO-îZ_6>400 MHz): δ 10.30 (s, 1H), 8.91 (s, 1H), 8.53 (t,J= 5.7 Hz, 1H), 7.69 (s, 1H), 7.64 (dd, J= 7.7.1.7 Hz, 1H), 7.57 (dd, J = 8.4,2.0 Hz, 1H), 7.54-7.47 (m, 2H), 7.22 (dd, .7=16.5, 8.1 Hz, 2H), 7.10 (t, J= 7.1 Hz, 1H), 3.47 (q, J— 6.8 Hz, 2H), 3.31 (s, 3H),3.10(t,J= 6.7 Hz, 2H);
1499	0 ™₃ v	A, 164,218	30	358.9 (M*+l)	c_2Ih₁₈n₄o 2 358.14	‘H NMR (DMSO-6/₆,400 MHz): δ 10.29 (s, 1H), 8.98 (t, J= 5.8 Hz, 1H), 8.51 (s, 1H), 8.44 (dd,J= 4.8,1.6 Hz, 1H), 7.68 (tt, J = 7.9,1.9 Hz, 1H), 7.63 (tt, J = 8.0,1.9 Hz, 2H), 7.57 (s, 1H), 7.53-7.47 (m, 1H), 7.34 (dd, J= 7.3,4.8 Hz, 1H), 7.25 (d, .7=8.5 Hz, lH),7.20(d,J = 8.0 Hz, 1H), 7.10 (t,J= 7.1 Hz, 1H), 4.46 (d, .7=5.9 Hz, 2H), 3.30 (s, 3H);
1521	cz^~ ch₃	A, 164,219	36	448.1 (M*+i)	0₂₉Η₂₅Ν₃Ο ₂ 447.19	‘H NMR (DMSO-d₆,500 MHz): δ 10.28 (s, 1H), 8.47 (t, J= 5.4 Hz, 1H), 7.65-7.54 (m, 6H), 7.52 (s,

263

						1H), 7.48 (t, 7= 7.8 Hz, 1H), 7.43 (t,7=7.7 Hz, 2H), 7.357.28 (m, 3H), 7.20 (dd, 7= 16.8, 8.4 Hz, 2H), 7.08 (t, 7= 7.5 Hz, 1H), 3.47 (q, 7=6.4 Hz, 2H), 3.28 (s, 3H), 2.84 (t, 7= 7.2 Hz, 2H);
1533	ο CAnPJ/ ηΑγ^_ν	A^c, 167,212 (c = Reaction Time 12 hRT)	19	373.9 (M'Ai);	c₂₁h₁₉n₅o 2 373.15	‘H NMR (DMSO-7_6>400 MHz): δ 10.29 (s, 1H), 9.07 (s, 1H), 9.02 (t,7= 5.7 Hz, 1H), 8.74 (s, 2H), 7.65-7.55 (m, 3H), 7.52-7.46 (m, 1H), 7.25 (d, J =8.5 Hz, 1H), 7.20 (d, J = 8.2 Hz, 1H), 7.11 (t, .7=7.4 Hz, 1H), 4.46 (d, 7= 5.6 Hz, 2H), 3.83-3.75 (m, 2H), 1.12 (t, J= 6.9 Hz, 3H);
1534	0 _/-νη /? à	A^e, 167,213	22	378.9 (MAi)	C20H18N4O 2S 378.12	‘H NMR (DMSO-7_6j400 MHz): δ 10.29 (s, 1H), 9.07 (t, 7= 5.9 Hz, 1H), 8.95 (s, 1H), 7.79 (s, 1H), 7.63-7.54 (m, 3H), 7.52-7.46 (m, 1H), 7.24 (d, 7= 8.5 Hz, 1H), 7.20 (d, 7 = 8.0 Hz, 1H), 7.10 (t, 7= 7.2 Hz, 1H), 4.64 (d, 7= 5.7 Hz, 2H), 3.84-3.75 (m, 2H), 1.12 (t, 7= 7.0 Hz, 3H);

264

1564	0 /? à V	A^c, 167,214	31	363.0 (M%1)	C20H18N4O 3 362.14	‘HNMR (DMSO-d_6i400 MHz): δ 10.29 (s, 1H), 8.90 (t, J= 5.6 Hz, 1H), 8.27 (s, 1H), 7.63-7.55 (m, 3H), 7.52-7.47 (m, 1H), 7.24 (d, J =8.5 Hz, 1H), 7.20 (d,7 = 8.2 Hz, 1H), 7.11 (t, 7=7.3 Hz, 1H), 7.01 (s, 1H), 4.50 (d, 7= 5.4 Hz, 2H), 3.83-3.76 (m, 2H), 1.12 (t, 7= 7.0 Hz, 3H);
1565	Èt	A^c, 167, 215	36	388.0 (M⁺+l)	C22H21N5O 2 387.17	‘HNMR (DMSO-7₆,500 MHz): δ 10.27 (s, 1H), 8.99 (s, 1H), 8.64 (s, 2H), 8.44 (t, 7= 5.4 Hz, 1H), 7.58 (d,7=6.7 Hz, 1H), 7.527.45 (m, 3H), 7.19 (dd, 7= 14.6, 8.2 Hz, 2H), 7.08(1,7= 7.5 Hz, 1H), 3.81-3.72 (m, 2H), 3.50 (q, 7 = 6.1 Hz, 2H), 2.83 (t, 7= 6.7 Hz, 2H), 1.10 (t,7= 6.9 Hz, 3H);
1522	0 CXm-C/ü'^O Et	A^c, 167,216	29	387.0 (MM)	C23H22N4O 2 386.17	'HNMR (DMSO-7₆,400 MHz): δ 10.29 (s, 1H), 8.49 (d, 7= 4.1 Hz, 1H), 8.45 (t, 7= 5.3 Hz, 1H), 7.69 (td, 7=7.7,1.8 Hz, 1H), 7.60 (dd, 7= 7.7,1.6 Hz, 1H), 7.577.47 (m, 3H), 7.27-7.18 (m,

265

						4H), 7.10(1,/= 7.4 Hz, 1H), 3.83-3.74 (m, 2H),3.57(q,/ = 6.9 Hz, 2H), 2.96 (t,/= 7.3 Hz, 2H), 1.12 (t,/= 6.9 Hz, 3H);
1523	Ο ^ΝΗ ^χ έΛ^-χ-Q	A^e, 167,217	36	387.0 (MX)	C23H22N4O 2 386.17	‘H NMR (DMSO-/₆,500 MHz): δ 10.28 (s, 1H), 8.478.34 (m, 3H), 7.65-7.56 (m, 2H), 7.54-7.45 (m, 3H), 7.28 (dd, /= 7.5,4.9 Hz, 1H), 7.19 (dd,/= 13.7, 8.2 Hz, 2H), 7.09 (t,/=7.2 Hz, 1H), 3.76 (brs, 2H), 3.46 (q,/=6.7Hz, 2H), 2.82(1,/= 7.1Hz, 2H), 1.10(1,/=6.9 Hz, 3H);
1566	ο / ^ΝΗ /? ΓΧ ΧνΧ Η Et	A^c, 167,352	36	393.1 (MX)	C₂₁H₂₀N₄O ₂s 392.13	‘H NMR (DMSO-/₆,500 MHz): δ 10.29 (s, 1H), 8.89 (s, 1H), 8.51 (t,/= 5.4 Hz, 1H), 7.67 (s, 1H), 7.61-7.43 (m, 4H), 7.22 (d,/ = 8.4 Hz, 1H), 7.18 (d,/= 8.1 Hz, 1H), 7.09 (t,/= 7.4 Hz, 1H), 3.82-3.74 (m, 2H), 3.45 (q,/= 6.5 Hz, 2H), 3.08 (t,/= 6.7 Hz, 2H), 1.11(1,/=6.8 Hz, 3H);

266

1550	0 /? ^ει V	A^c, 167,218	30	373.1 CvT+1)	C22H20N4O 2 372.16	'HNMR (DMSO-de 400 MHz): δ 10.29 (s, 1H), 8.98 (t, 7= 5.9 Hz, 1H), 8.52 (s, 1H), 8.44 (dd,7= 4.7,1.6 Hz, 1H), 7.68 (dt, J = 7.9,1.8 Hz, 1H), 7.65-7.56 (m, 3H), 7.49 (td, 7= 7.7,1.7 Hz, 1H), 7.367.32 (m, 1H), 7.25 (d,7=8.5 Hz, 1H), 7.20 (d, 7= 7.9 Hz, 1H), 7.10 (td, 7 = 7.5, 0.8 Hz, 1H), 4.46 (d, 7 = 5.7 Hz, 2H), 3.82-3.75 (m, 2H), 1.12 (t, 7= 7.0 Hz, 3H);
1524	cz^^- Et	A^c, 167,219	15	462.1 (M*+l)	C30H27N3O 2 461.21	‘HNMR (DMSO-rf_fii400 MHz): δ 10.30 (s, 1H), 8.48 (t, 7= 5.5 Hz, 1H), 7.68-7.41 (m, 10H), 7.36-7.29 (m, 3H), 7.21 (dd, 7= 13.5, 8.3 Hz, 2H), 7.10 (t, 7= 7.5 Hz, 1H), 3.823.75 (m, 2H), 3.48 (q,7=6.9 Hz, 2H), 2.86 (t,7= 7.2 Hz, 2H), 1.12 (t, 7= 6.9 Hz, 3H);
1482	O ^NH J W'nAt'nJp_Nέη V	A, 170,212	36	436.1 (Nf+1)	C₂₆H₂₁N₅O 2 435.17	‘HNMR (DMSO-7₆ 500 MHz): δ 10.36 (s, 1H), 9.06 (s, 1H), 8.97 (t, 7= 5.8 Hz, 1H), 8.72 (s, 2H), 7.61 (dd,7= 7.7,1.3 Hz, 1H), 7.57-7.51

267

						(m, 2H), 7.47- 7.39 (m, 3H), 7.33 (d, .7=8.4 Hz, 1H), 7.30- 7.23 (m, 3H), 7.15 (t, .7= 7.8 Hz, 1H), 7.08 (t, J= 7.4 Hz, 1H), 5.03 (s, 2H), 4.44 (d,J = 5.5 Hz, 2H);
1510	0 h^)T^s\ έ„ y	A, 170, 213	20	441.1 (mM)	c₂₃h₂₀n₄o ₂s 440.13	Ή NMR (DMSO-d₆,400 MHz): δ 10.37 (s, 1H), 9.04 (t, J= 5.8 Hz, 1H), 8.94 (s, 1H), 7.77 (s, 1H), 7.61 (dd,J= 7.7,1.6 Hz, 1H), 7.56 (s, 1H), 7.50 (dd, J = 8.5,1.9 Hz, 1H), 7.47-7.39 (m, 3H), 7.32 (d, .7= 8.6 Hz, 1H), 7.29-7.22 (m, 3H), 7.14 (t, J= 7.2 Hz, 1H), 7.08 (t,J= 7.3 Hz, 1H), 5.03 (s, 2H), 4.61 (d, J= 5.6 Hz, 2H);
1492	O V^N-Âss^iTArQ If	A, 170,214	35	425.1 (MM)	C₂sH₂oN₄0 3 424.15	‘H NMR (DMSO-d₆,400 MHz): δ 10.37 (s, 1H), 8.87 (t, J= 5.6 Hz, 1H), 8.25 (s, 1H), 7.61 (dd, J= 7.7,1.6 Hz, 1H), 7.55 (s, 1H), 7.51 (dd, J = 8.4,2.0 Hz, 1H), 7.47-7.39 (m, 3H), 7.32 (d, .7= 8.5 Hz, 1H), 7.30-7.23 (m, 3H), 7.177.12 (m, 1H), 7.08 (t,J= 7.2 Hz, 1H), 7.00 (s, 1H), 5.03 (s,

268

						2H), 4.47 (d, J = 5.4 Hz, 2H);
1464	0 μη P _N A A A/ ⁿ'vX 1 Bn	A, 170,215	16	450.1 (MM)	C27H23N5O 2 449.19	‘H NMR (DMSO-2_6>400 MHz): δ 10.36 (s, 1H), 9.01 (s, 1H), 8.64 (s, 2H), 8.42 (t, 2= 5.5 Hz, 1H), 7.60 (dd, 2= 7.7,1.6 Hz, 1H), 7.49-7.38 (m, 5H), 7.337.21 (m, 4H), 7.15 (t, 2= 7.1 Hz, 1H), 7.08 (t, 2= 7.4 Hz, 1H), 5.02 (s, 2H), 3.49 (q, J = 6.4 Hz, 2H), 2.82 (t, 2= 6.7 Hz, 2H);
1474	0 ^NH P CanXjSi^^O Bn	A, 170,216	38	449.1 (ivT+i)	C2₈H₂4N₄O 2 448.19	Ή NMR (DMSO-2₆.500 MHz): δ 10.35 (s, 1H), 8.47 (d, 2= 3.8 Hz, 1H), 8.41 (t, 2=5.4 Hz, 1H), 7.687.64 (m, 1H), 7.59 (d, 2= 7.8 Hz, 1H), 7.527.49 (m, 1H), 7.47-7.37 (m, 4H), 7.31-7.17 (m, 6H), 7.167.11 (m, 1H), 7.07 (t, 2= 7.2 Hz, 1H), 5.01 (s, 2H), 3.53 (q, 2= 6.7 Hz, 2H), 2.92 (t, 2= 7.2 Hz, 2H);
1475	0 Bn h\—Q	A, 170, 217	38	449.1 (IVC+l)	C₂₈H24N₄O 2 448.19	‘H NMR (DMSO-2_6i500 MHz): δ 10.36 (s, 1H), 8.438.39 (m, 2H), 8.37 (dd,2= 4.6,1.2 Hz, 1H), 7.75-7.54 (m, 2H), 7.49 (s, 1H), 7.46-

269

						7.36 (m, 4H), 7.33-7.21 (m, 5H), 7.18-7.10 (m, 1H), 7.06 (t, 7= 7.4 Hz, 1H), 5.01 (s,2H), 3.47-3.41 (m, 2H), 2.80 (t, 7= 6.9 Hz, 2H);
1559	ο CL ΧΎΆ-Π ΖΖ ίΖ H 'rZ Bn	A, 170,347	20	439.1 (M⁺+l)	C26H22N4O 3 438.17	‘HNMR (DMSO-î4,4°0 MHz): δ 10.37 (s, 1H), 8.47 (t, 7= 5.6 Hz, 1H), 8.20 (s, 1H), 7.61 (dd,7= 7.7,1.6 Hz, 1H), 7.51 (s 1H), 7.47-7.40 (m, 4H), 7.337.23 (m, 4H), 7.18-7.12 (m, 1H), 7.08 (t, 7= 7.4 Hz, 1H), 6.90 (s, 1H), 3.46 (q, 7=6.6 Hz, 2H), 2.88 (t,7= 6.8 Hz, 2H);
1511	0 5^NH /? cl Vn^x Z^J H '-'S- Bn	A, 170, 352	32	455.0 (M+l)	C26H22N4O 2S 454.15	‘HNMR (DMSO-7₆,500 MHz): δ 10.37 (s, 1H), 8.89 (s, 1H), 8.49 (t, 7= 5.5 Hz, 1H), 7.66 (s, 1H), 7.60 (dd, 7= 7.7,1.3 Hz, 1H), 7.52 (s, 1H), 7.49-7.38 (m, 4H), 7.31 (d, 7= 8.7 Hz, 1H), 7.28-7.22 (m, 3H), 7.14 (t, 7= 7.2 Hz, 1H), 7.07 (t, 7= 7.4 Hz, 1H), 5.02 (s, 2H), 3.43 (q, 7= 6.5 Hz, 2H), 3.06 (t, 7= 6.7 Hz, 2H);

270

1493	0 X-nh P _Bn	A, 170,218	16	434.1 (M*+l)	C27H22N4O 2 434.17	‘H NMR (DMSO-7_6j400 MHz): δ 10.37 (s, 1H), 8.95 (t, 7= 5.9 Hz, 1H), 8.51-8.49 (m, 1H), 8.43 (dd, 7 = 4.8,1.6 Hz, 1H), 7.66 (td, 7 = 7.5,1.7 Hz, 1H), 7.61 (dd, 7 = 7.7,1.7 Hz, 1H), 7.58-7.52 (m, 2H), 7.477.38 (m, 3H), 7.35-7.22 (m, 5H), 7.18-7.12 (m, 1H), 7.08 (t, 7= 7.1 Hz, 1H), 5.03 (s, 2H), 4.43 (d, 7= 5.7 Hz, 2H);
1483	0 lAnX 1 Bn	A, 170,219	20	524.3 (MM)	C35H29N3O 2 523.23	‘H NMR (DMSO-7₆.500 MHz): δ 10.38 (s, 1H), 8.45 (t, 7= 5.5 Hz, 1H), 7.66-7.52 (m, 6H), 7.51-7.39 (m, 6H), 7.377.23 (m, 7H), 7.18-7.13 (m, 1H), 7.08 (t, 7= 7.4 Hz, 1H), 5.03 (s, 2H), 3.49-3.43 (m, 2H), 2.84 (t, 7= 7.2 Hz, 2H);
1494	0 N H Bn	A, 170,185	16	421.1 (MM)	C₂₆H₂₀N₄O 2 420.16	); ‘H NMR (DMSO-A.400 MHz): δ 10.45 (d, 7= 4.4 Hz, 2H), 8.53-8.38 (m, 2H), 7.747.70 (m, 2H), 7.67-7.62 (m, 3H), 7.50-7.39 (m,4H), 7.31 (d, 7= 8.0 Hz, 1H), 7.27 (t, 7= 7.6 Hz, 2H), 7.20-7.08 (m, 2H), 5.07 (s,

271

						2H);
1512	0 ^NH B O AWW \ A J! N \__k UNM h U 1 Bn	A, 170,406	18	555.1 (tf+1)	c₃₁h₃₀n₄o 4S 554.20	Ή NMR (DMSO-J₆,400 MHz): δ 10.35 (s, 1H), 8.40 (t, 7= 5.6 Hz, 1H), 7.68-7.53 (m, 3H), 7.52-7.36 (m, 7H), 7.317.18 (m,4H), 7.13 (t, 7=7.3 Hz, 1H), 7.06 (t, 7= 7.4 Hz, 1H), 5.00 (s, 2H), 3.49-3.41 (m, 2H), 2.88 (t, 7= 7.0 Hz, 2H), 2.51 (s, 6H);
1484	0 __Y^NH /? Λ=^\ ^H rx Bn \ j	A, 170,186	7	496.2 (M*+l)	C₃₃H₂₅N₃O 2 495.19	‘H NMR (DMSO-7_6>400 MHz): δ 10.44 (s, 1H), 10.20 (s, 1H), 8.058.03 (m, 1H), 7.75 (d, 7=8.4 Hz, 1H), 7.697.58 (m, 5H), 7.51-7.35 (m, 9H), 7.34-7.24 (m, 3H),7.17(t, 7= 7.7 Hz, 1H), 7.11 (t,7=7.5 Hz, 1H), 5.07 (s, 2H);
1468	0 / ^NH /9 /^=\ ΤλΙηΛΐ ^{s H} Xv°^h	A, 35,413	15	456.9 (MM)	c₂₆h₁₇fn₂0₃S 456.09	‘H NMR (400 MHz, DMSOdfi): δ 10.97 (s, 1H), 10.36 (s, 1H), 9.53 (s, 1H), 8.03-8.01 (m, 1H), 7.81 7.71 (m, 4H), 7.63 (dd,7= 8.6, 5.3 Hz, 1H), 7.51 (dd,7 = 9.2,2.9 Hz, 1H), 7.45-7.36 (m, 2H), 7.357.32 (m, 1H), 7.26 (t, 7= 7.8 Hz, 1H), 7.067.00 (m, 2H), 6.79- 6.75 (m,

272

						1H);
1452	0 'Φνη /? /^\ ^{S Η} ^^AVoMe	Α, 35,412	37	471.0 (Μ*+1)	C27H19FN2 o₃s 470.11	‘Η NMR (DMSO-Jî, 400MHz): δ 10.98 (s, 1H), 10.37 (s, 1H), 8.02 (s, 1H), 7.83-7.70 (m, 4H), 7.63 (dd, J = 8.6, 5.3 Hz, 1H), 7.52 (dd, J = 9.2,2.9 Hz, 1H), 7.47-7.36 (m, 4H), 7.20 (d, 7= 7.8 Hz, 1H), 7.16-7.14 (m, 1H), 6.96 (dd, 7= 8.0, 2.2 Hz, 1H), 3.82 (s, 3H);
1636	0 VXsjAYfAA/ '/χ' ο ο	Α, 159,415	50	400.9 (Nf+l)	C20H20N2O 5S 400.11	‘H NMR (DMSO-7_d>400 MHz): δ 11.50 (s, 1H), 8.69 (t, 7= 5.4 Hz, 1H), 8.03 (d, 7=8.3 Hz, 1H), 8.017.96 (m, 2H), 7.93-7.82 (m, 2H), 7.80 - 7.76 (m, 2H), 3.813.71 (m, 2H), 3.61-3.54 (m, 1H), 3.45-3.40 (m, 1H). 3.293.25 (m, 1H), 2.00-1.90 (m, 1H), 1.86-1.73 (m, 2H), 1.68 (q, 7= 7.0 Hz, 2H), 1.46-1.35 (m, 1H);
1626	0 / ^ΝΗ /? ^Ν=\ (Γη Κ’Ά ZV^N’- <? ! Λ Λ / ^ν^Α\ // Ν UXV Η W 0 0	Α, 159,421	14	474.0 (M+l)	c₂₄h_I9n₅o ₄S 473.12	‘H NMR (DMSO-7_6i400 MHz): δ 11.52 (s, 1H), 8.81 (t, 7= 5.5 Hz, 1H), 8.09 (s, 2H), 8.04 (d,7=8.3 Hz, 1H), 8.007.82 (m, 6H), 7.80-7.72 (m, 2H), 7.42 (d, 7

273

						= 8.6 Hz, 2H), 3.57-3.49 (m, 2H), 2.90 (t, J= 7.0 Hz, 2H);
1650	0 / ^NH ? /N Y\A CÇo WJW A NHCbz 0 0	A, 159,427	51	628.1 (M*+l)	c₃₄h₃₃n₃o ₇S 627.20	‘H NMR (DMSO-7_tf,400 MHz): δ 11.52 (s, 1H), 8.76 (t, 7= 5.5 Hz, 1H), 8.03 (d,7=8.3 Hz, 1H), 8.007.96 (m, 2H), 7.92-7.83 (m, 2H), 7.79 (s, 1H), 7.75 (dd, J = 8.2,1.4 Hz, 1H), 7.44-7.22 (m,6H), 7.11 (d, 7=8.6 Hz, 2H), 6.82 (d, J = 8.5 Hz, 2H), 5.00 (s, 2H), 3.90 (t, 7= 6.2 Hz, 2H), 3.43 (q, 7= 6.7 Hz, 2H), 3.04 (q, J = 6.7 Hz, 2H), 2.74 (t, 7= 7.3 Hz, 2H), 1.711.63 (m, 2H), 1.58-1.49 (m, 2H);

274

Example 27: Synthesis of Compounds 1268 and 1269

Synthesis of methyl 2-cyano-2-phenylacetate (432): To a stirred solution of sodium hydride (60%,

2.5 g, 63.82 mmol) in anhydrous toluene (50 mL) under argon atmosphère was added 2-phenyl acetonitrile 430 (5 g, 42.55 mmol) at 0 °C and stiired for 30 min. To this dimethyl carbonate 431 (5.74 g, 63.82 mmol) in anhydrous toluene (30 mL) was added drop wise for 10 min and stirred at 0

O

C for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with saturated ammonium chloride (20 mL) and extracted with EtOAc (2 x 50 mL). The combined organic extracts were washed with brine (50 mL), dried over sodium sulphate, 10 filtered and concentrated in vacuo to obtain the crude. The crude compound was purifîed through silica gel column chromatography using 20% EtOAc/ hexanes to afford compound 432 (4.8 g, 64%) as colorless syrup. TLC: 30% EtOAc/hexanes (Rf. 0.7);¹ H-NMR (CDC1₃, 400 MHz): δ 7.47-7.39 (m, 5H), 4.74 (s, 1H), 3.81 (s, 3H).

275

Synthesis of methyl 3-amino-2-phenyIpropanoate (433): To a stirred solution of compound 432 (1 g, 5.71 mmol) in MeOH (50 mL) under argon atmosphère were added Boc-anhydride (2.49 g, 11.42 mmol), nickel dichloride hexahydrate (135 mg, 0.57 mmol) and sodium borohydride (1.5 g, 39.99 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with MeOH (30 mL), filtered through celite and the filtrate was concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 30% EtOAc/ Hexanes to afford racemic compound 433 (550 mg, 36%) as an off white solid. TLC: 20% EtOAc/ hexanes (Rf. 0.4); 'H-NMR (DMSO-i/ÿ, 500 MHz): δ 7.34 (t, J= 7.0 Hz, 2H), 7.30-7.25 (m, 3H), 6.93 (t, J= 6.0 Hz, 1H), 3.85 (t, J= 7.5 Hz, 1H), 3.60 (s, 3H), 3.28-3.23 (m,lH), 1.34 (s, 9H). The racemic compound 433 was purified through chiral préparative HPLC to afford compound 434 Fr-I (120 mg) and compound 435 Fr-II (90 mg) as off-white solids.

Compound 434 Fr-I analytical data:

Chiral HPLC: 99.27%, R_t= 9.58 min (Chiralcel AD-H, 250 x 4.6 mm, 5 pm); mobile phase (A) 0.1% DEA in w-Hexane (B) EtOH (A: B: 98: 2); Flow Rate: 1.0 mL/min).

Compound 435 Fr-II analytical data:

Chiral HPLC: 99.29%, R_t=10.87 min (Chiralcel AD-H, 250 x 4.6 mm, 5 pm); mobile phase (A) 0.1% DEA in n-Hexane (B) EtOH (A: B: 98: 2); Flow Rate: 1.0 mL/min).

Synthesis of methyl (2?)-2-phenyl-3-((2, 2, 2-trifluoroacetyl)-X⁴-azanyl) propanoate (436): To a stirred solution of compound 434 (Fr-I) (50 mg, 0.17 mmol) in CH2CI2 (2 mL) under inert atmosphère was added trifluoroacetic acid (0.026 mL, 0.35 mmol) at 0 C; warmed to RT and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude compound 436 (20 mg, TFA sait) as off-white solid. TLC: 70% EtOAc/ hexanes (Rf. 0.2); ‘H-NMR (DMSO-î/₆, 400 MHz): δ 8.10 (br s, 2H), 7.41-7.28 (m, 5H), 4.03 (t, 7= 6.0 Hz, 1H), 3.63 (s, 3H), 3.48 (t, J= 9.2 Hz, 1H), 3.12-3.08 (m, 1H).

Synthesis of methyl (Æ)-3-(ll-oxo-10,11-dihydrodibenzo \b, f[ [1, 4] thiazepine-8carboxamido)-2-phenylpropanoate (437): To a stirred solution of compound 6 (70 mg, 0.25 mmol) in DMF (5 mL) under argon atmosphère were added EDCI.HC1 (73.9 mg, 0.38 mmol), HOBt (30 mg, 0.38 mmol), compound 436 (70 mg, 0.38 mmol), diisopropyl ethyl amine (0.09 mL, 0.51 276 ο

mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted with EtOAc (2x10 mL). The combined organic extracts were dried over sodium sulphate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 90% EtOAc/ Hexanes to afford compound 437 (70 mg, 63%) as colorless syrup. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.5);¹ H-NMR (DMS0-7₆ 400 MHz): δ 10.75 (s, 1H), 8.65 (t, 7= 5.6 Hz, 1H), 7.68 (d, J= 7.2 Hz, 2H), 7.67-7.60 (m, 4H), 7.54-7.49 (m, 2H), 7.49-7.44 (m, 3H), 7.35-7.25 (m, 1H), 4.02 (t, 7= 7.2 Hz, 1H), 3.80-3.73 (m, 1H), 3.55 (t, 7= 6.4 Hz, 1H), 3.47 (s, 3H).

Synthesis of (Z?)-3-(ll-oxo-10,11-dihydrodibenzo [b,j\ [1, 4] thiazepine-8-carboxamido)-2phenylpropanoic acid (1268): To a stirred solution of compound 437 (40 mg, 0.092 mmol) in THF: H₂O (4: 1, 2.5 mL) was added LiOH.H₂O (7.7 mg, 0.18 mmol) at 0 C; warmed to RT and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, diluted with water (5 mL), pH was adjusted to ~ 6 using 1 N HCl and extracted with EtOAc (2x10 mL). The combined organic extracts were dried over sodium sulphate, filtered and concentrated in vacuo to afford 1268 (25 mg, 65%) as white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.5); ¹ H-NMR (DMSO-ri_fi, 400 MHz): δ 12.49 (br s, 1H), 10.76 (s, 1H), 8.62 (t, 7= 5.6 Hz, 1H), 7.68 (d, 7= 7.2 Hz, 1H), 7.66-7.61 (m, 2H), 7.54-7.42 (m, 4H), 7.34-7.23 (m, 5H), 3.92 (t, 7= 7.6 Hz, 1H), 3.77-3.72 (m, 1H), 3.57-3.50 (m, 1H); LC-MS: 90.53%; 419.4 (M^+l); (column; X-bridge C-18, (50 x 3.0 mm, 3.5 pm); RT 3.76 min. 0.05% TFA (Aq) : ACN; 0.8 mL/min); UPLC (purity): 93.78%; (column : Acquity BEH C-18 (50 x 2.1 mm, 1.7 μ); RT 2.04 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

Synthesis of methyl (5)-2-plienyl-3-((2, 2, 2-trifluoroacetyl)-X⁴-azanyl) propanoate (438): To a stirred solution of compound 435 (Fr-II) (90 mg, 0.32 mmol) in CH₂C1₂ (3 mL) under inert atmosphère was added trifluoroacetic acid (0.073 mL, 0.64 mmol) at 0 C; warmed to RT and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude compound 438 (90 mg, TFA sait) as an off-white solid. TLC: 70% EtOAc/ Hexanes (Rf. 0.2); *H-NMR (DMSO-J₆, 400 MHz): δ 8.10 (br s, 2H), 7.41-7.28 (m, 5H), 4.03 (t, 7= 6.0 Hz, 1H), 3.63 (s, 3H), 3.48 (t, 7= 9.2 Hz, 1H), 3.12-3.08 (m, 1H).

Synthesis of methyl (5)-3-(1 l-oxo-10,11-dihydrodibenzo [b,j\ [1, 4] thiazepine-8carboxamido)-2-phenylpropanoate (439): To a stirred solution of compound 6 (70 mg, 0.25 mmol) in DMF (5 mL) under argon atmosphère were added EDCI.HC1 (73.9 mg, 0.38 mmol), HOBt 277 (52 mg, 0.38 mmol), compound 438 (70 mg, 0.38 mmol), diisopropyl ethyl amine (0.09 mL, 0.51 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted with EtOAc (2x10 mL). The combined organic extracts were dried over sodium sulphate, filtered and concentrated in vacuo to obtain the crude. The crude was purifîed through silica gel column chromatography using 80% EtOAc/ hexanes to afford compound 439 (70mg, 63%) as an off-white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.5); *H-NMR (DMSO-î/₆, 400 MHz): δ 10.77 (s, 1H), 8.65 (t, J= 5.6 Hz, 1H), 7.69 (d, 7.2 Hz, 1H), 7.65-7.61 (m, 2H), 7.55-7.45 (m, 4H), 7.37-7.34 (m,

2H), 7.31-7.27 (m, 3H), 4.02 (t, J= 7.2 Hz, 1H), 3.80-3.74 (m, 1H), 3.59 (s, 3H), 3.56-3.53 (m,lH).

Synthesis of (5)-3-(ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8-carboxamido)-2phenylpropanoic acid (1269): To a stirred solution of compound 439 (40 mg, 0.09 mmol) in THF : H₂O (4: 1, 2.5 mL) was added lithium hydroxide monohydrate (7.7 mg, 0.18 mmol) at 0 C; warmed to RT and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, diluted with water (5 mL), the pH was adjusted to ~ 6 using 1 N HCl and extracted with EtOAc (2 x 10 mL). The combined organic extracts were dried over sodium sulphate, filtered and concentrated in vacuo to afford 1269 (25 mg, 65%) as white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.3); ^-NMR (DMSO-t/ô, 400 MHz): δ 12.51 (br s, 1H), 10.76 (s, 1H), 8.62 (t, J= 5.6 Hz, 1H), 7.68 (d, J =7.2 Hz, 1H), 7.66-7.61 (m, 2H), 7.54-7.43 (m, 4H), 7.34-7.23 (m, 5H), 3.92 (t, J= 7.6 Hz, 1H), 3.77-3.72 (m, 1H), 3.57-3.50 (m, 1H); LC-MS: 96.04%; 417.8 (M-l)⁺; (column; X-select C-18, (50 x 3.0 mm,

3.5 pm); RT 2.38 min. 5.0 mMNRiOAc : ACN; 0.8 mL/min); UPLC (purity): 96.12%; (column : Acquity BEH C-18 (50 x 2.1 mm, 1.7 p); RT 2.03 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

278

Example 28: Synthesis of Compound 1239

Synthesis of te/ï-butyl (2-cyanophenyI) carbamate (441): To a stirred solution of 2aminobenzonitrile 440 (1 g, 8.47 mmol) in CH2CI2 (15 mL) under argon atmosphère were added

Boc-anhydride (1.84 g, 4.76 mmol) and triethyl amine (0.83 mL, 5.96 mmol), DMAP (0.1 mg, catalytic amount) at 0 C; warmed to RT and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 30% EtOAc/ hexanes to afford compound 441 (500 mg, 28%) as white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.8); Tl-NMR (DMSO-4, 400 MHz): δ 9.25 (br s, 1H), 7.85 (d, J= 7.6 Hz, 1H), 7.73 (t, J= 7.6 Hz, 1H), 7.53 (d, J = 8.0 Hz, 1H), 7.45 (t, J= 7.6 Hz, 1H), 1.35 (br s, 9H).

Synthesis of teri-butyl (2-cyanophenyl) (methyl) carbamate (442): To a stirred solution of compound 441 (500 mg, 2.29 mmol) in DMF (10 mL) under argon atmosphère were added sodium hydride (60%, 55 mg, 2.29 mmol), methyl iodide (325 mg, 2.29 mmol) at 0 C; warmed to RT and 15 stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with ice cold water (10 mL), extracted with EtOAc (2 x 20 mL). The combined organic extracts were dried over sodium sulphate, fîltered and concentrated in vacuo to

279 obtain the crude. The crude was purified through silica gel column chromatography using 40% EtOAc/ hexanes to afford compound 442 (480 mg, 88%) as white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.5); 'H-NMR (DMSO-7_d, 400 MHz): δ 7.85 (d, J= 7.6 Hz, 1H), 7.73 (t, 7= 7.6 Hz, 1H), 7.53 (d, J= 7.6 Hz, 1H), 7.45 (t, J= 7.6 Hz, 1H), 3.18 (s, 3H), 1.35 (br s, 9H).

Synthesis of teri-butyl (2-(aminomethyl) phenyl) (methyl) carbamate (443): To a stirred solution of compound 442 (50 mg, 0.21 mmol) in MeOH (3 mL) under argon atmosphère was added Raney Nickel (20 mg), methanolic ammonia (1.5 mL) at RT and stirred under hydrogen atmosphère (balloon pressure) for 6 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite, washed with MeOH (2x5 mL) and the fîltrate was concentrated in vacuo to obtain the crude. The crude was washed with diethyl ether (2x10 mL) and dried in vacuo to afford compound 443 (40 mg, 80%) as white solid. TLC: 50% EtOAc/ hexanes (Rf. 0.2); 'H-NMR (DMSO-7_tf, 400 MHz): δ 7.52 (d, 7= 7.2 Hz, 1H), 7.28-7.20 (m, 2H), 7.12 (t, 7=

5.6 Hz, 1H), 3.60-3.57 (m, 2H), 3.14 (br s, 3H), 1.25 (s, 9H).

Synthesis of tert-butyl methyl (2-((ll-oxo-10,11-dihydrodibenzo [b,f\ [1, 4] thiazepine-8carboxamido) methyl) phenyl) carbamate (444): To a stirred solution of compound 6 (40 mg, 0.14 mmol) in DMF (3 mL) under argon atmosphère were added EDCI.HC1 (42 mg, 0.22 mmol), HOBt (30 mg, 0.22 mmol), compound 443 (37.6 mg, 0.16 mmol), diisopropyl ethyl amine (0.05 mL, 0.29 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice-cold water (20 mL). The precipitate was filtered and the obtained solid was dried in vacuo to afford compound 444 (40 mg, 55%) as white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.5); LC-MS: 93.49%; 390.3 (M^+l) (DesBoc).

Synthesis of 7V-(2-(inethylainino) benzyl)-ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-

8-carboxamide (1239): A stirred solution of compound 444 (40 mg, 0.08 mmol) in 4 N HCl in 1, 4dioxane (2 mL) under argon atmosphère at 0-5 C was stirred for 1 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with saturated NaHCO₃solution (20 mL) and extracted with EtOAc (2 x 20 mL). The combined organic extracts were washed with water (15 mL), dried over sodium sulphate, filtered and concentrated in vacuo to afford 1239 (10 mg, 32%) as white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.4); 'H-NMR (DMSO-7₆, 400 ΜΗζ):δ 10.74 (s, 1H), 8.96 (t, 7= 6.0 Hz, 1H), 7.72-7.60 (m, 4H), 7.55-7.43 (m, 3H), 7.08 (t, 7= 280

7.6 Hz, 1H ), 7.02 (d, J= 7.2 Hz, 1H), 6.53 (t, J= 7.2 Hz, 2H), 5.38-5.37 (m, 1H), 4.29 (d, J= 7.2 Hz, 2H), 2.72 (d, J= 4.8 Hz, 3H); LC-MS: 93.74%; 390.3 (MM); (column; X-select CSH C-18, (50 x 3.0 mm, 3.5 pm); RT 3.44 min. 0.05% TFA (Aq) : ACN; 0.8 mL/min); UPLC (purity): 94.35%; (column : Acquity UPLC BEH C-18 (2.1 x 50 mm, 1.7 μ); RT 1.87 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

Example 29: Synthesis of Compound 1244

Synthesis of tert-butyl 4-(cyanomethylene) piperidine-l-carboxylate (447): To a stirred solution of diethyl (cyanomethyl) phosphonate 445 (978 mg, 5.52 mmol) in anhydrous THF (10 mL) under argon atmosphère was added LiHMDS (1 mL, 5.52 mmol, IM in THF) was added drop wise for 10 min at -78 °C. To this was added ZerAbutyl 4-oxopiperidine-l-carboxylate 446 (1 g, 5.01 mmol) in THF (2 mL) dropwise for 10 min and stirred for 3 h at the same température. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with saturated ammonium chloride solution (30 mL) and extracted with EtOAc (2 x 50 mL). The combined organic extracts were washed with brine (30 mL), dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 15% EtOAc/ hexanes to afford compound 447 (900 mg, 82%) as white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.5); ^JH NMR (CDCl₃,400 MHz) δ 5.19 (s, 1H), 3.54-3.49 (m, 4H), 2.56 (t, J= 5.8 Hz, 2H), 2.33 (t, J= 5.6 Hz, 2H), 1.48 (s, 9H);

Synthesis of to'Z-butyl 4-(2-aminoethyl) piperidine-l-carboxylate (448): To a stirred solution of 447 (100 mg, 0.45 mmol) in AcOH (5 mL) under argon atmosphère was added 10% Pd/C (50 mg) at

281

RT and stirred under hydrogen atmosphère (balloon pressure) for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mass was fîltered through celite and washed with EtOAc (3x15 mL) and the volatiles were removed in vacuo to afford compound 448 (70 mg, mixture of isomers) as pale brown syrup. TLC: 6% MeOH/ CH₂C1₂ (Rf. 0.2); ’H-NMR (DMSO-îZ₆, 400 MHz): δ 3.89 (d, J= 12.4 Hz, 2H), 2.70-2.68 (m, 2H), 1.68-1.65 (m, 2H), 1.59 (d, J= 12.0 Hz, 1H), 1.38 (s, 9H), 1.33-1.28 (m, 4H), 0.99-0.89 (m, 2H).

Synthesis of ter/-butyl 4-(2-(1 l-oxo-10,11-dihydrodibenzo \b, f\ [1, 4] thiazepine-8carboxamido) ethyl) piperidine-l-carboxylate (449): To a stirred solution of compound 6 (40 mg, 0.14 mmol) in DMF (3 mL) under argon atmosphère were added EDCI.HC1 (42 mg, 0.22 mmol), HOBt (30 mg, 0.22 mmol), compound 448 (40 mg, 0.17 mmol), diisopropyl ethyl amine (0.05 mL, 0.29 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was triturated with EtOAc: H₂O (1: 5, 12 mL), fîltered and the precipitate was dried in vacuo to afford compound 449 (36 mg, 51%) as white solid. TLC: 7% MeOH/ CH₂C1₂ (Rf. 0.7); ’H-NMR (DMSOd₆, 400 MHz): δ 10.76 (s, 1H), 8.47 (br s, 1H), 7.69-7.63 (m, 3H), 7.57-7.53 (m, 2H), 7.47 (t, J= 8.8 Hz, 2H), 3.89 (d, J= 10.8 Hz, 2H), 3.26-3.25 (m, 2H), 2.67 (s, 3H), 1.64 (d, J= 10.8 Hz, 2H), 1.42-1.41 (m, 2H), 1.37 (s, 9H), 0.97-0.95 (m, 2H).

Synthesis of ll-oxo-7V-(2-(piperidin-4-yI) ethyl)-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8carboxamide (1244): To a stirred solution of compound 449 (36 mg, 0.07 mmol) in CH₂C1₂ (3 mL) under argon atmosphère was added trifluoro acetic acid (0.03 mL, 0.37 mmol) at 0 C; warmed to RT and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was neutralized with 10% NaHCO₃solution (15 mL) and extracted with EtOAc (3x15 mL). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to afford 1244 (15 mg, 53%) as an off-white solid. TLC: 7% MeOH/ CH₂C1₂ (Rf. 0.2); *H-NMR (DMSO-r/₆, 400 MHz): δ 10.77 (br s, 1H), 8.48 (t, J= 5.6 Hz, 1H), 7.69-7.64 (m, 3H), 7.57-7.43 (m, 4H), 3.26-3.25 (m, 3H), 3.16-3.12 (m, 2H), 2.68 (t, J= 10.0 Hz, 2H), 1.77-1.74 (m, 2H), 1.44 (t, J= 6.8 Hz, 3H); 1.23-1.13 (m, 2H); LC-MS: 90.01%; 382.4 (MP'+l); (column; X-select CSH C-18, (50 x 3.0 mm, 3.5 pm); RT 2.97 min. 0.05% TFA (Aq) : ACN; 0.8 mL/min); UPLC (purity): 92.90%; (column : Acquity UPLC BEH C-18 (2.1 x 50 mm, 1.7 p); RT 1.60 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

282

Example 30: Synthesis of Compounds 1651 and 1652

Synthesis of A-methoxy-IV-methylthiazole-5-carboxamide (451): To a stirred solution of thiazole5-carboxylic acid 378 (1.5 g, 11.61 mmol) in CH2CI2 (30 mL) under argon atmosphère were added

EDCI.HC1 (2.45 g, 12.78 mmol), HOBt (785 mg, 135.13 mmol), 7V,O-dimethyl hydroxylamine

O hydrochloride 450 (1.36 g, 97.6 mmol) and diisopropyl ethyl amine (10 mL, 58.09 mmol) at 0 C;

warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (50 mL) and extracted with CH₂C1₂ (3 x 50 mL). The combined organic extracts were washed with 1 N HCl (20 mL), saturated NaHCO₃ solution (30 mL), brine (50 mL) and dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through combi flash chromatography using 30-40% EtOAc/ hexanes to afford compound 451 (1.2 g, 60%) as colorless syrup. TLC: 5% MeOH/ CH₂C1₂(Rf. 0.6); *H NMR (DMSO-rf₆,400 MHz): 9.32 (s, 1H), 8.52 (s, 1H), 3.77 (s, 3H), 3.30 (s, 3H).

Synthesis of l-(thiazol-5-yl) ethan-l-one (452): To a stirred solution of compound 451 (1.2 g, 6.97 15 mmol) in THF (20 mL) under argon atmosphère was added methyl magnésium bromide (3.2

283 mL,10.46 mmol, 3 M solution in Et20) dropwise for 10 min at -10 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with saturated ammonium chloride (30 mL) and extracted with EtOAc (2 x 50 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through combi flash chromatography using 25-30% EtOAc/ hexanes to afford compound 452 (800 mg, 90%) as white solid. TLC: 50% EtOAc/ hexanes (Rf. 0.6); 'HNMR (DMSO-<Z_d,400 MHz): δ 9.40 (s, 1H), 8.71 (s, 1H), 2.60 (s, 3H).

Synthesis of l-(thiazol-5-yl) ethan-l-one oxime (453): To a stirred solution of compound 452 (800 mg, 6.29 mmol) in MeOH (20 mL) under inert atmosphère was added hydroxyl amine

O hydrochloride (875 mg, 12.59 mmol) and pyridine (2 mL) dropwise for 5 min at 0 C warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo diluted with water (50 mL) and stirred for 30 min. The precipitated solid was filtered dried in vacuo to afford compound 453 (800 mg, 90%) as white solid. TLC: 40% EtOAc/ hexanes (Rf. 0.4, 0.6); ^JH NMR (DMSO-<Z_tf> 400 MHz) (Mixture of E/Z isomers): δ 11.86 (s, 1H), 11.41 (s, 0.6 H), 9.19 (s, 1H), 9.01 (s, 0.56 H), 8.35 (s, 1H), 8.15 (s, 0.65 H), 2.31 (s, 3H), 2.21 (s, 2H).

Synthesis of l-(thiazol-5-yl) ethan-l-amine (454): To a stirred solution of compound 453 (800 mg, 5.63 mmol) in MeOH: acetic acid (1: 1, 20 mL) under inert atmosphère were zinc powder (2.2 g, 33.80 mmol) at RT; heated at 50 °C and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite washed with MeOH (3 x 10 mL). The fîltrate were removed in vacuo, the residue was diluted with water (20 mL), basified with aqueous ammonia (15 mL) and extracted with EtOAc (3 x 50 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude compound 454 (racemic) (700 mg, 92%) as brown syrup. TLC: 5% MeOH/ CH2CI2 (Rf. 0.4, 0.6); ^XH NMR (DMSO-^,400 MHz): δ 8.90 (s, 1H), 7.71 (s, 1H), 4.33-4.28 (m, 1H), 3.38 (t, J= 6.4 Hz, 1H), 1.87 (s, 3H).

Synthesis of ll-oxo-A’-(l-(thiazol-5-yl) ethyl)-10,11-dihydrodibenzo [b, f\ [1, 4] thiazepine-8carboxamide (455 Racemic): Using Procedure A the title compound was prepared with DBT-Acid (150 mg, 0.55 mmol) and compound 454 racemic (109 mg, 0.66) to afford compound 455 (Racemic) (100 mg, 48%); TLC: 5% MeOH/ CH₂C1₂ (Rf 0.5); 'H NMR (DMSO-/Z_d, 400 MHz): δ

284

10.87 (br s, 1H), 9.14 (d, J= 8.0 Hz, 1H), 8.95 (s, 1H), 7.79 (d, J= 3.6 Hz, 2H), 7.70-7.58 (m, 3H), 7.56-7.42 (m, 3H), 5.48-5.41 (m, 1H), 1.60 (s, 3H); LC-MS: 98.31%; 381.9 (M*+l); (column; Ascentis Express Cl8, (50 x 3.0 mm, 2.7 pm); RT 2.03 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min); HPLC (purity): 97.68%; (colunrn; Eclipse XDB C-18 (150 x

4.6 mm, 5.0 pm); RT 7.58 min. ACN : 0.05% TFA (Aq); 1.0 mL/min) (IP14012554); Chiral HPLC: 35.10%, R_t= 9.01 min (Chiralpak-IA, 250 x 4.6 mm, 5 pm); mobile phase (A) 0.1% DEA in π-Hexane (B) CH₂C1₂: MeOH (50: 50) (A: B:: 63: 35); Flow Rate: 1.0 mL/min).

The racemic compound 455 (100 mg) was separated by préparative HPLC using a CHIRALPAK-IC column (250 x 20 mm x 5 pm) (10 mg loading; mobile phase (A) 0.1% DEA in zz-Hexane (B) CH₂C1₂: MeOH: DMF (65: 35: 05) (A: B:: 75: 25) to afford 1651 (10 mg) and 1652 (15 mg) as an off-white solids.

Analytical Data of 1651:

TLC: 5% MeOH/ CH₂C1₂ (Rf 0.5); *H NMR (DMSO-A, 400 MHz): δ 10.75 (s, 1H), 9.02 (d, J= 7.8 Hz, 1H), 8.95 (s, 1H), 7.79 (s, 1H), 7.72-7.64 (m, 3H), 7.62-7.58 (m, 1H), 7.56-7.41 (m, 3H), 5.45 (t, J= 7.0 Hz, 1H), 1.57 (d, J= 6.8 Hz, 3H); LC-MS: 96.06%; 381.8 (NTT!); (column; Ascentis Express C18, (50 x 3.0 mm, 2.7 pm); RT 2.03 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min); HPLC (purity): 95.02%; (column; Zorbax SB C-18 (150 x 4.6 mm, 3.5 pm); RT 7.79 min. ACN : 0.05% TFA (Aq); 1.0 mL/min) (IP15010530); Chiral HPLC: 96.24%, R_t- 14.33 min (Chiralpak-IA, 250 x 4.6 mm, 5 pm); mobile phase (A) 0.1% DEA in nHexane (B) CH₂C1₂: MeOH: DMF (65: 35: 05) (A: B:: 75: 25); Flow Rate: 1.0 mL/min). Note: Altematively the racemic compound 454 was resolved and one fraction had led to 1651.

Analytical Data of 1652:

TLC: 5% MeOH/ CH₂C1₂ (Rf 0.5); *H NMR (DMSO-</₆,400 MHz): δ 10.75 (s, 1H), 9.03 (d, J= 8.3 Hz, 1H), 8.95 (s, 1H), 7.79 (s, 1H), 7.71-7.63 (m, 3H), 7.62-7.58 (m, 1H), 7.56-7.42 (m, 3H), 5.48-5.47(m, 1H), 1.57 (d, J= 6.9 Hz, 3H); LC-MS: 96.65%; 381.9 (M⁺+l); (column; Ascentis Express C18, (50 x 3.0 mm, 2.7 pm); RT 2.68 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min); HPLC (purity): 98.53%; (column; Zorbax SB C-18 (150 x 4.6 mm, 3.5 pm); RT 7.76 min. ACN : 0.05% TFA (Aq); 1.0 mL/min) (IP15010229). Chiral HPLC:

285

99.87%, R_t= 16.90 min (Chiralpak-IA, 250 x 4.6 mm, 5 pm); mobile phase (A) 0.1% DEA in nHexane (B) CH₂C1₂: MeOH: DMF (65: 35: 05) (A: B:: 75: 25); Flow Rate: 1.0 mL/min).

Example 31: Synthesis of Compounds 1653 and 1633

Synthesis of teri-butyl 2-((ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8-carboxamido) methyl) pyrrolidine-l-carboxylate (457): Using Procedure A the title compound was prepared with compound 6 (300 mg, 1.10 mmol), fôrAbutyl 2-(aminomethyl) pyrrolidine-l-carboxylate 456 (0.24 mL, 1.21 mmol) and was obtained in 50% yield as an off-white solid; TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.7); *H NMR (DMSO-d<i,400 MHz): δ 10.76 (br s, 1H), 8.53 (t, J= 5.5 Hz, 1H), 7.717.63 (m, 3H), 7.56-7.43 (m, 4H), 3.95-3.79 (m, 1H), 3.52-3.35 (m, 1H), 3.26-3.19 (m, 3H), 1.861.71 (m, 4H), 1.38 (s, 9H).

Synthesis of ll-oxo-7V-(pyrrolidin-2-ylmethyl)-10,11-dihydrodibenzo [/>,/] [1,4] thiazepine-8carboxamide hydrochloride (1633): To a stirred solution of compound 457 (250 mg, 0.55 mmol) in CH₂C1₂ (5 mL) under argon atmosphère was added 4 N HCl in 1, 4-dioxane (1 mL) at 0 C; warmed to RT and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to afford compound 1633 (150 mg, 77%; HCl sait) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.1); *H NMR (DMSO-d₆,400 MHz): δ 10.82 (br s, 1H), 8.88 (br s, 3H), 7.74-7.62 (m, 4H), 7.56-7.43 (m, 3H), 3.67-3.57 (m, 1H), 3.56-3.46 (m, 2H), 3.24-3.07 (m, 2H), 2.07-1.95 (m, 1H), 1.95-1.78 (m, 2H), 1.68-1.59 (m, 1H); LC-MS: 96.49%; 354.0 (Mf+1) (-HC1); (column; Ascentis Express C18, (50 x 3.0 mm, 2.7 pm); RT 1.64 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min); HPLC (purity):

286

96.28%; (column; Zorbax SB C-18 (150 x 4.6 mm, 3.5 pm); RT 6.64 min. ACN : 0.05% TFA (Aq); 1.0 mL/min).

Synthesis of A-((l-acetylpyrrolidin-2-yl) methyl)-ll-oxo-10,11-dihydrodibenzo [b,j\ [1, 4] thiazepine-8-carboxamide (1653): To a stirred solution of compound 1633 (100 mg, 0.25 mmol) in CH2CI2 (5 mL) under argon atmosphère were added triethylamine (0.12 mL, 0.77 mmol), acetyl chloride (0.02 mL, 0.30 mmol) at 0 C; warmed to RT, stirred for 12 h. The reaction was monitored by TLC; after completion the reaction, the reaction the volatiles were removed in vacuo', the residue was basified with saturated NaHCO₃ solution and extracted with CH2CI2 (2 x 50 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 5% MeOH/ CH2CI2 to afford 1653 (20 mg, 20%) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.6); ^NMRtDMSO-AdOO MHz): δ 10.84-10.73 (m, 1H), 8.87-8.55 (m, 1H), 7.72-7.63 (m, 3H),

7.60-7.43 (m, 4H), 4.17-3.94 (m, 1H), 3.53-3.33 (m, 3H), 3.32-3.30 (m, 0.5H), 3.20-3.09 (m, 0.5H), 2.08-1.92 (m, 3H), 1.88-1.70 (m, 4H); LC-MS: 99.36%; 396.4 (MA1); (column; X-Select C-18, (50 x 3.0 mm, 3.5 pm); RT 3.34 min, 0.77 min. 5 mM Aq.NHfiOAc: ACN 0.8 mL/min). HPLC (purity): 98.67%; (column; Eclipse XDB C-18 (150 x 4.6 mm, 5.0 pm); RT 7.28 min. ACN: 5 mM Aq. NH₄OAc; 1.0 mL/min).

Example 32: Synthesis of Compounds 1615 and 1608

Synthesis of tert-butyl 3-((1 l-oxo-10,11-dihydrodibenzo [b,f] [1, 4] thiazepine-8-carboxamido) methyl) pyrrolidine-l-carboxylate (459): Using Procedure A the title compound was prepared

287 with 6 (300 mg, 1.10 mmol), iert-butyl 3-(aminomethyl) pyrrolidine-l-carboxylate 458 (0.24 mL, 1.21 mmol) and was obtained in 60% yield as an off-white solid; TLC: 10% MeOH/ CH2CI2 (Rf. 0.5); ^XH NMR (DMSO-î/₆,400 MHz): δ 10.76 (s, 1H), 8.61 (t, J= 5.0 Hz, 1H), 7.72-7.63 (m, 3H),

7.60- 7.42 (m, 4H), 3.34-3.18 (m, 1H), 3.28-3.13 (m, 4H), 2.99-2.92 (m, 1H), 2.42-2.34 (m, 1H), 1.94-1.82 (m, 1H), 1.64-1.50 (m, 1H), 1.37 (s, 9H).

Synthesis of ll-oxo-7V-(pyrroIidin-3-ylmethyl)-10,11-dihydrodibenzo [b, J] [1, 4] thiazepine-8carboxamide hydrochloride (1608): To a stirred solution of compound 459 (300 mg, 0.66 mmol) in CH2CI2 (5 mL) under argon atmosphère was added 4 N HCl in 1, 4-dioxane (1 mL) at 0 C; warmed to RT and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to afford compound 1608 (200 mg, 78%; HCl sait) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.1); ‘H-NMR (DMSO-J₆, 400 MHz): δ 10.78 (s, 1H), 8.88 (br s, 2H), 8.70 (t, J= 5.7 Hz, 1H), 7.71-7.65 (m, 3H), 7.59 (dd, J= 8.2, 2.0 Hz, 1H), 7.56-7.43 (m, 3H), 3.27-3.15 (m, 5H), 3.15-3.04 (m, 1H), 2.94-2.80 (m, 1H), 2.04-1.92 (m, 1H), 1.69-1.56 (m, 1H); LC-MS: 98.04%; 353.9 (M⁺+l) (-HC1); (column; Ascentis Express C18, (50 x 3.0 mm, 2.7 pm); RT 1.64 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min); UPLC (purity): 97.21%; (column; Acquity UPLC BEH C-18 (50 x 2.1 mm, 1.7 p); RT 1.55 min. ACN : 0.025% TFA (Aq); 0.5 mL/min) (IP14120205).

Synthesis of 7V-((l-acetyIpyrrolidin-3-yl) methyl)-ll-oxo-10,11-dihydrodibenzo [b,f\ [1, 4] thiazepine-8-carboxamide (1615): To a stirred solution of compound 1608 (100 mg, 0.28 mmol) in CH2CI2 (5 mL) under argon atmosphère were added triethylamine (0.12 mL, 0.84 mmol), acetyl chloride (0.02 mL, 0.33 mmol) at 0 C; warmed to RT, stirred for 12 h. The reaction was monitored by TLC; after completion the reaction, the reaction the volatiles were removed in vacuo', the residue was basified with saturated NaHCO3 solution and extracted with CH2CI2 (2x30 mL). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 5% MeOH/ CH2CI2 to afford 1615 (30 mg, 26%) as an off-white solid. TLC: 10% MeOH/ CH2CI2 (Rf. 0.6); 'HNMR (DMSO-<Z₆,400 MHz): δ 10.71 (m, 1H), 8.69 -8.58 (m, 1H), 7.72-7.63 (m, 3H),

7.61- 7.41 (m, 4H), 3.55-3.34 (m, 3H), 3.29-3.19 (m, 2H), 3.17-3.13 (m, 0.5H), 3.00 (dd, J= 11.8, 7.3 Hz, 0.5H), 2.41-2.34 (m, 1H), 2.02-1.84 (m, 4H), 1.73-1.49 (m, 1H); LC-MS: 95.89%; 396.0 (M^+l); (column; Ascentis Express C18, (50 x 3.0 mm, 2.7 pm); RT 1.87 min. 0.025% Aq. TFA +

288

5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min); HPLC (purity): 97.29%; (column; Eclipse

XDB C-18 (150 x 4.6 mm, 5.0 pm); RT 7.05 min. ACN: 5 mM Aq. NH₄OAc; 1.0 mL/min).

Example 33: Synthesis of Compound 1654

Synthesis of toŸ-butyl 3-((ll-oxo-10,11-dihydrodibenzo \b, f\ [1, 4] thiazepine-8-carboxamido) methyl) azetidine-l-carboxylate (461): To a stirred solution of compound 6 (600 mg, 2.21 mmol) in DMF (5 mL) under argon atmosphère were added EDCI.HC1 (634 mg, 3.32 mmol), HOBt (435 mg, 3.32 mmol), tert-butyl 3-(aminomethyl) azetidine-l-carboxylate 460 (453 mg, 2.43 mmol) and diisopropyl ethyl amine (1.14 mL, 6.64 mmol) at RT and stirred for 12 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (25 mL) and extracted with EtOAc (2 x 50 mL). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 5% MeOH/ CH2CI2 to afford compound 461 (600 mg, 61%) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.6); ’HNMR (DMSO-î/₆,400 MHz): δ 10.76 (s, 1H), 8.64 (t, J= 5.6 Hz, 1H), 7.71-7.64 (m, 3H), 7.59-7.43 (m, 4H), 3.84 (t, J= 7.0 Hz, 2H), 3.663.50 (m, 2H), 3.41 (t, J= 6.3 Hz, 2H), 2.72-2.64 (m, 1H), 1.33 (s, 9H).

Synthesis of ll-oxo-7V-((l-(2, 2, 2-trifluoroacetyl)-114-azetidin-3-yl) methyl)-10,11dihydrodibenzo \b,f\ [1, 4] thiazepine-8-carboxamide (1654): To a stirred solution of 461 (350 mg, 0.79 mmol) in CH2CI2 (10 mL) under argon atmosphère were added BF₃.Et₂O (0.18 mL, 1.59 mmol), molecular sieves (20 mg) at 0 °C; warmed to RT and stirred for 1 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (25

289 mL) and extracted with CH2CI2 (2 x 25 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified using préparative HPLC purification to afford compound 1654 (20 mg, 7%) as an off-white solid. TLC: 10% MeOH/ CH2CI2 (Rf. 0.6); *H NMR (DMSO-<Z_à,400 MHz): δ 10.79 (s, 1H), 8.70 (t, J= 5.6 Hz, 1H), 8.62-8.39 (m, 1H), 7.73-7.66 (m, 3H), 7.59 (dd, J= 8.1, 1.7 Hz, 1H), 7.57-7.43 (m, 3H), 3.993.88 (m, 2H), 3.80-3.69 (m, 2H), 3.45 (t, J= 6.1 Hz, 2H), 3.04-2.94 (m, 1H); LC-MS: 99.41%; 339.9 (M⁺+l); (column; Ascentis Express Cl8, (50 x 3.0 mm, 2.7 pm); RT 1.70 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min); HPLC (purity): 98.60%; (column; Zorbax SB C-18 (150 x 4.6 mm, 3.5 pm); RT 6.54 min. ACN : 0.05% TFA (Aq); 1.0 mL/min).

Synthesis of tert-butyl 4-((ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8-carboxamido) methyl) piperidine-l-carboxylate (463): Using Procedure A the title compound was prepared with compound 6 (200 mg, 0.73 mmol), teri-butyl 4-(aminomethyl) piperidine-l-carboxylate 462 (0.17 mL, 0.81 mmol) and was obtained in 86% yield as pale brown solid; TLC: 5% MeOH/ CH2CI2 (Rf. 0.5); ^JH NMR (DMSO-<Z₆,400 MHz): δ 10.75 (br s, 1H), 8.52 (t, J= 5.6 Hz, 1H), 7.72-7.61 (m, 3H), 7.60-7.42 (m, 4H), 3.93-3.88 (m, 2H), 3.12 (t, J= 6.0 Hz, 2H), 2.71-2.59 (m, 2H), 1.74-1.57 (m, 3H), 1.38 (s, 9H), 1.06-0.92 (m, 2H)

Synthesis of ll-oxo-/V-(piperidin-4-ylmethyl)-10,11-dihydrodibenzo \b, f\ [1,4] thiazepine-8carboxamide hydrochloride (1609): To a stirred solution of compound 463 (300 mg, 0.64 mmol)

290 in CH2CI2 (5 mL) under argon atmosphère was added 4 N HCl in 1, 4-dioxane (1 mL) at 0 C; warmed to RT and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to afford compound 1609 (200 mg, 85%; HCl sait) as pale brown solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.2); ’ïï-NMR (DMSO-îZ* 400 MHz): δ 10.77 (s, 1H), 8.67-8.58 (m, 2H), 8.32 (br s, 1H), 7.71 -7.64 (m, 3H), 7.61-7.43 (m, 4H), 3.27-3.20 (m, 2H), 3.18-3.12 (m, 2H), 2.89-2.76 (m, 2H), 1.82-1.72 (m, 3H), 1.38-1.23 (m, 2H); LC-MS: 98.23%; 368.0 (M⁺+l) (-HC1); (column; Ascentis Express C18, (50 x 3.0 mm, 2.7 pm); RT 1.67 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min); UPLC (purity): 97.67%; (column; Acquity UPLC BEH C-18 (50 x 2.1 mm, 1.7 p); RT 1.59 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

Synthesis of 7V-((l-acetylpiperidin-4-yl) methyl)-ll-oxo-10,11-dihydrodibenzo [b,j\ [1, 4] thiazepine-8-carboxamide (1601): To a stirred solution of compound 1609 (100 mg, 0.24 mmol) in CH2CI2 (5 mL) under argon atmosphère were added triethylamine (0.1 mL, 0.74 mmol), acetyl chloride (0.02 mL, 0.29 mmol) at 0 C; warmed to RT, stirred for 12 h. The reaction was monitored by TLC; after completion the reaction, the reaction the volatiles were removed in vacuo', the residue was basifîed with saturated NaHCO₃ solution and extracted with CH2CI2 (2x15 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purifîed through silica gel column chromatography using 1% MeOH/ CH2CI2 to afford 1601 (20 mg, 20%) as an off-white solid. TLC: 10% MeOH/ CH2CI2 (Rf. 0.5); ^-NMR (DMSO-^, 400 MHz): δ 10.75 (s, 1H), 8.53 (t, J= 5.5 Hz, 1H), 7.71-7.63 (m, 3H),

7.61-7.43 (m, 4H), 4.36-4.29 (m, 1H), 3.81-3.73 (m, 1H), 3.19-3.06 (m, 2H), 3.00-2.91 (m, 1H), 2.53-2.46 (m, 1H), 1.96 (s, 3H), 1.82-1.58 (m, 3H), 1.14-0.89 (m, 2H); LC-MS: 99.33%; 410.0 (M⁺+l); (column; Ascentis Express Cl8, (50 x 3.0 mm, 2.7 pm); RT 1.99 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min); UPLC (purity): 99.57%; (column; Acquity UPLC BEH C-18 (50 x 2.1 mm, 1.7 p); RT 1.79 min. ACN: 0.025% TFA (Aq); 0.5 mL/min).

291

Example 35: Synthesis of Compounds 1357,1655, and 1367

Synthesis of methyl ll-oxo-10,11-dihydrodibenzo \b,f] [1, 4] thiazepine-8-carboxylate (474): To a stirred solution of compound 6 (500 mg, 1.84 mmol) in MeOH: CH2CI2 (1: 1, 20 mL) under argon atmosphère was added CH2N2 (insitu prepared using N-nitrosomethyl urea (0.95 g, 9.2 mmol) + KOH (0.51 g, 9.22 mmol) ) at 0 °C; warmed to RT and stirred for 1 h. The reaction was monitored by TLC; afiter completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 20% EtOAc/ hexanes to afford compound 474 (450 mg, 86%) as white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.5);¹ H-NMR (DMSO-rf_tf, 500 MHz): δ 10.82 (s, 1H), 7.82 (s, 1H), 7.75-7.69 (m, 3H), 7.58-7.63 (m, 3H), 3.82 (s, 3H).

Synthesis of 8-(hydroxymethyl) dibenzo \b,f\ [1, 4] thiazepin-ll(10//)-one (474-A): To a stirred solution of compound 474 (500 mg, 1.75 mmol) in dry THF (3 mL) under argon atmosphère was added diisobutylaluminium hydride (1 M sol. in Toluene, 5 mL, 5.26 mmol) dropwise for 5 min at 15 25 °C; warmed to RT and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was cooled to 0 °C, quenched with saturated sodium potassium tartrate solution (10 mL) and extracted with EtOAc (2 x 20 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude, which was titurated with MeOH: diethyl ether (1: 4, 5 mL) to afford 474-A (300 mg, 66%) as an off-white

292 solid. TLC: 70% EtOAc/ hexanes (Rf. 0.4); *H NMR (DMSO-7₆, 400 MHz): δ 10.66 (s, 1H), 7.67 (dd, 7= 7.5,1.6 Hz, 1H), 7.55-7.38 (m, 4H), 7.19 (s, 1H), 7.07 (dd, 7= 7.9, 1.7 Hz, 1H), 5.26 (t, 7= 5.7 Hz, 1H), 4.44 (d, 7= 5.6 Hz, 2H); LC-MS: 97.26%; 257.8 (M*+l); (column; Ascentis Express C18, (50 x 3.0 mm, 2.7 pm); RT 1.94 min. 0.025% Aq. TFA + 5% ACN: ACN +; 5% 0.025% Aq. TFA, 1.2 mL/min); UPLC (purity): 96.65%; (column; Acquity BEH C-18 (50 x 2.1 mm, 1.7 μ); RT 1.80 min. ACN: 0.025% TFA (Aq); 0.5 mL/min).

Synthesis of ll-oxo-10,11-dihydrodibenzo \h, f\ [1, 4] thiazepine-8-carbaldehyde (475): To a stirred solution of compound 474-A (60 mg, 0.23 mmol) in CH2CI2 (5 mL) under argon atmosphère was added Dess-Martin periodinane (300 mg, 0.70 mmol) at 0 C; warmed to RT and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with CH2CI2 (50 mL) and washed with saturated hypo solution (20 mL). The organic extract was dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified using silicagel column chromatography using 30% EtOAc/ hexanes to afford compound 475 (41 mg, 68%) as an off-white solid. TLC: 70% EtOAc/ hexanes (Rf. 0.8); *H NMR (DMSO-Tî, 400 MHz): δ 10.89 (s, 1H), 9.96 (s, 1H), 7.81 (d, 7= 7.6 Hz, 1H), 7.73-7.66 (m, 3H), 7.59-7.45 (m, 3H).

Synthesis of 8-((phenethylamino) methyl) dibenzo [b,f\ [1, 4] thiazepin-ll(10/7)-°ne (1357): To a stirred solution of compound 475 (100 mg, 0.39 mmol) in MeOH (4 mL) under argon atmosphère were added 2-phenylethan-l-amine 211 (57 mg, 0.47 mmol) and acetic acid (1 mL) at RT and

O stirred for 1 h. To this was added sodium cyanoborohydride (72 mg, 1.16 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water with EtOAc (100 mL), washed with saturated sodium bicarbonate solution (20 mL) and water (20 mL). The organic extract was dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified using silicagel column chromatography using 2% MeOH/ CH2CI2 to afford compound 1357 (25 mg, 18%) as an off-white solid. TLC: 100% EtOAc (Rf. 0.3); ^JH NMR (DMSO-7₆, 400 MHz): δ 10.65 (s, 1H), 7.67 (dd, 7= 7.4, 1.6 Hz, 1H), 7.54-7.39 (m, 4H), 7.28-7.23 (m, 2H), 7.21-7.14 (m, 4H), 7.10 (d, 7= 7.2 Hz, 1H), 3.70 (br s, 2H), 2.72 (br s, 4H); LC-MS: 95.70%; 361.0 (M*+l); (column; X-select CSH C18, (50 x 3.0 mm, 3.5 pm); RT 2.65 min. 0.05% Aq. TFA: ACN; 0.8

293 mL/min); UPLC (purity): 95.01%; (column; Acquity BEH C-18 (50 x 2.1 mm, 1.7 μ); RT 1.87 min. ACN: 0.025% TFA (Aq); 0.5 mL/min).

Synthesis of7V-((ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepin-8-yl) methyl)-2V-phenethyl acetamide (1367): To a stirred solution of compound 1357 (40 mg, 0.11 mmol) in CH2CI2 (2 mL) under argon atmosphère were added pyridine (0.013 mL, 0.16 mmol), acetic anhydride (0.011 mL, 0.12 mmol) at 0-5 C; warmed to RT and stirred for 2 h. The reaction was monitored by TLC; after completion the reaction, the reaction mixture was diluted with CH2CI2 (20 mL) washed with 1 N HCl (5 mL) and brine (10 mL). The organic extract was dried over sodium sulfate, fïltered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 5% EtOAc/ hexanes to afford 1367 (25 mg, 57%) as an off-white solid.

TLC: 70% EtOAc/ hexanes (Rf. 0.8); ^JH NMR (DMSO-îZ₆, 500 MHz): δ 10.62-10.60 (m, 1H), 7.67-7.64 (m, 1H), 7.57-7.38 (m, 4H), 7.29-6.94 (m, 7H), 4.45 (d, J= 9.8 Hz, 2H), 3.41-3.35 (m, 2H), 2.82-2.66 (m, 2H), 1.97-1.87 (m, 3H); LC-MS: 92.67%; 403.5 (VT+l); (column; X-select CSH C18, (50 x 3.0 mm, 3.5 pm); RT 4.37 min. 5 mM AqJSffifiOAc: ACN; 0.8 mL/min); UPLC (purity): 93.63%; (column; Acquity BEH C-18 (50 x 2.1 mm, 1.7 μ); RT 2.41 min. ACN: 0.025% TFA (Aq); 0.5 mL/min).

Example 36: Synthesis of Compound 1501

294

Synthesis of 8-(hydroxymethyl)-10-(4-methoxybenzyl) dibenzo [b,f\ [1,4] thiazepin-ll(lOH)one (476): To a stirred solution of 1655 (1 g, 3.89 mmol) in THF (50 mL) were added Benzyltriéthylammonium chloride (88 mg, 0.38 mmol), 50% aqueous sodium hydroxide solution (4 mL) at 0-5 C and stirred for 20 min. To this was added 4-methoxybenzy chloride (0.52 mL, 3.89

O mmol) at 0-5 C and heated to reflux for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice water (40 mL) and extracted with EtOAc (2 x 100 mL). The combined organic extracts was dried over sodium sulfate, fiitered and concentrated in vacuo to obtain the crude. The crude was purified using silicagel column chromatography using 2% MeOH/ CH2CI2 to afford compound 476 (800 mg, 57%) as white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.6); *H NMR (DMSO-î/₆, 500 MHz): δ 7.64-7.59 (m, 1H), 7.53 (s, 1H), 7.51-7.44 (m, 2H), 7.41-7.35 (m, 2H), 7.22 (d, J= 8.7 Hz, 2H), 7.06 (d, 7.8 Hz, 1H), 6.81 (d, J= 8.7 Hz, 2H), 5.67 (d, J= 15.3 Hz, 1H), 5.21 ( br s, 1H), 4.85 (d, J= 15.3 Hz, 1H), 4.41 (s, 2H), 3.68 (s, 3H).

Synthesis of 8-(bromomethyl)-10-(4-methoxybenzyl) dibenzo \b,f\ [1,4] thiazepin-l Î (10Z/)-one (477): To a stirred solution of compound 476 (800 mg, 2.12 mmol) in CH2CI2 (20 mL) under argon

O atmosphère were added triphenyl phosphine (1.1 g, 4.24 mmol), CBr4 (0.3 mL, 3.18 mmol) at 0 C; warmed to RT and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 50% EtOAc/ hexanes to afford compound 477 (600 mg, 66%) as an off-white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.8); *H NMR (DMSO-J₆, 500 MHz): δ 7.73 (s, 1H), 7.63 (dd, J= 7.1, 1.9 Hz, 1H), 7.53-7.44 (m, 2H), 7.43-7.36 (m, 2H), 7.22-7.15 (m, 3H), 6.79 (d, J= 8.7 Hz, 2H), 5.77-5.71 (m, 1H), 4.80 (d, J= 15.0 Hz, 1H), 4.60 (s, 2H), 3.67 (s, 3H).

Synthesis of 10-(4-methoxybenzyl)-8-(phenethoxymethyl)dibenzo \b,f\ [1,4] thiazepinll(10H)-one (479): To a stirred solution of 2-phenylethan-l-ol 477 (100 mg, 0.81 mmol) in THF (10 mL) inert atmosphère was added was added sodium hydride (60%, 49 mg, 2.5 mmol) under portion wise for 5 min at 0 °C; warmed to RT and stirred for 2 h. To this was added compound 478 (359 mg, 0.81 mmol) at RT; heated to 65 °C and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice-cold water (20 mL) and extracted with EtOAc (2 x 50 mL). The combined organic extracts were dried over sodium

295 sulfate, filtered and concentrated in vacuo to obtain the crude compound 479 (150 mg) as yellow solid. TLC: 70% EtOAc/ hexanes (Rf. 0.5); LC-MS: 58.75%; 482.0 (NL+l); (column; Ascentis Express C18, (50 x 3.0 mm, 2.7 pm); RT 3.25 min. 0.025% Aq. TFA + 5% ACN: ACN +; 5% 0.025% Aq. TFA, 1.2 mL/min).

Synthesis of 8-(phenethoxymethyl) dibenzo \b,f\ [1, 4] thiazepin-l l(10//)-one (1501): A mixture of compound 479 (140 mg, crude) and trifluoro acetic acid (2 mL) under inert atmosphère at RT was heated to 80 C and stirred for 6 h in a sealed tube. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo, the residue was quenched with 20% aqueous sodium bicarbonate solution (10 mL) and extracted with EtOAc (2 x 20 mL). The combined organic extracts was dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified using silicagel column chromatography using 70% EtOAc/ hexanes to afford compound 1501 (35 mg, 33%) as white solid. TLC: 70% EtOAc/ hexanes (Rf. 0.4); *H NMR (DMSO-J₆, 400 MHz): δ 10.65 (s, 1H), 7.67 (dd, J= 7.5, 1.6 Hz, 1H), 7.54-7.40 (m, 4H), 7.29-7.13 (m, 6H), 7.04 (dd, J= 7.9, 1.7 Hz, 1H), 4.44 (s, 2H), 3.63 (t, J= 6.9 Hz, 2H), 2.84 (t, J= 6.9 Hz, 2H); LC-MS: 96.49%; 361.9 (WT+l); (column; Ascentis Express C18, (50 x 3.0 mm, 2.7 pm); RT 2.79 min. 0.025% Aq. TFA + 5% ACN: ACN +; 5% 0.025% Aq. TFA, 1.2 mL/min); HPLC (purity): 96.59%; (column; Eclipse XDB-C-18 (150 x 4.6 mm, 5.0 pm); RT 10.25 min. ACN: 0.025% TFA (Aq); 1.0 mL/min).

Example 37: Synthesis of lO-methyl-ll-oxo-10,11-dihydrodibenzo [Z>, /1 fl, 41 thiazepine-8carboxylic acid (486) - a common intermediate

To a stirred solution of compound 6 (500 mg, 1.84 mmol) in DMF (10 mL) was added sodium hydride (60%, 442 mg, 18.45 mmol) under inert atmosphère at 0 °C and stirred for 1 h. To this was methyl iodide (1.14 mL, 18.45 mmol) at 0-5 °C, warmed to RT and stirred for 1.5 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and washed with EtOAc (2 x 20 mL). The aqueous layer was separated and the pH was adjusted to ~2 with 4 N HCl. The precipitated solid was filtered, washed with n-hexane (10 mL) and 296 dried in vacuo to obtain the compound 486 (400 mg, 76%) a white solid. TLC: 10% MeOH/ CH2CI2 (Rf. 0.2); ’H-NMR (DMSO-J₆, 500 MHz): δ 13.31 (br s, 1H), 7.99 (s, 1H), 7.75-7.68 (m, 2H), 7.65-7.61 (m, 1H), 7.54-7.49 (m, 1H), 7.44-7.39 (m, 2H), 3.53 (s, 3H).

Example 38: Synthesis of compounds from compound 486 and various commercially available amines

Compound 486 was converted to final products using commercially available amines or by employing Procedure A and the results are captured in the Table 2:

Table 2: Synthesis of compounds from compound 486 and various commercially available amines

,/ΑΚαα'·' AnoA Z’s.'f'AU·/':'·:¹:î	Structure _{} s} ; ·. / ? - -·^:ί ·Τ^ί< ' ·*	: Procedure,;· ; : .......- ...-À!: Intermediate, Amine	LRx. j Yield (%) -'.J.*·; i.J.ïî·.,'	IVIass ·,. Spec. Found	'Mass-Spéc/λ Calculated	' /. ifHrNMR·'‘t’;;' zyzz-.L'y
1573	M ?	A, 486, 213	36	382.0 (Mf+1)	381.06 for C₁₉H₁₅N₃O₂s₂	^lH-NMR (DMSO-J_tf, 400 MHz): δ 9.27 (t, J= 5.7 Hz, 1H), 8.96 (s, 1H), 7.96 (s, 1H), 7.82 (s, 1H), 7.74-7.70 (m, 1H), 7.68-7.61 (m, 2H), 7.547.49 (m, 1H), 7.45-7.38 (m, 2H), 4.67 (t,J= 5.4 Hz, 2H), 3.54 (s, 3H);
1553	°W ' r\ n P H	A,486,218	30	376.1 (Mf+l)	375.10 for C₂]Hi7N₃O₂S	‘H-NMR (DMSO-iZ_d, 400 MHz): δ 9.16 (t, J= 5.7 Hz, 1H), 8.54 (s, 1H), 8.45 (dd,J= 4.6,1.3 Hz, 1H), 7.98 (s, 1H), 7.75-7.61

297

						(m, 4H), 7.557.49 (m, 1H), 7.46-7.38 (m, 2H), 7.33 (dd, J = 7.3,4.8 Hz, 1H), 4.55-4.41 (m, 2H), 3.55 (s, 3H);
1574		A, 486,212	36	376.9 (MAI);	376.10 for C₂₀H₁₆N₄O₂S	‘H-NMR (DMSO-<7_d, 400 MHz): δ 9.19 (t, J= 5.7 Hz, 1H), 9.08 (s, 1H), 8.76 (s, 2H), 7.98 (s, 1H), 7.73 (d, .7=8.4 Hz, 1H), 7.687.60 (m, 2H), 7.55-7.49 (m, 1H), 7.46-7.38 (m, 2H), 4.57 4.39 (m, 2H), 3.55 (s, 3H);
1133	ο / _Q OH	D, 486	70	405.127 2	405.1273 for C₂₃H₂₁N₂O3 S	‘H NMR (400 MHz, DMSOd₆) δ 9.25 (s, 1H), 8.63 (t,J = 5.6 Hz, 1H), 7.88 (d, J= 1.8 Hz, 1H), 7.73 - 7.56 (m, 3H), 7.55-7.47 (m, 1H), 7.47-7.36 (m, 2H), 7.05 (t, J =7.7 Hz, 1H), 6.60 (td, J =9.2, 7.1 Hz, 3H), 3.53 (s, 3H), 3.46-3.38 (m, 2H), 2.71 (t, J = 7.4 Hz, 2H).

298

Example 39: Synthesis of Compounds 1342 and 1361

Synthesis of methyl (Z)-2-((tert-butoxycarbonyl) amino)-3-(pyrimidin-5-yl) acrylate (507): To a stirred solution of methyl 2-((tert-butoxycarbonyl) amino)-2-(dimethoxyphosphoryl) acetate 506 (3.3 g, 11.11 mmol) in CH2CI2 (15 mL) under inert atmosphère was added potassium Abutoxide (13.8 mL, 13.88 mmol, IM solution in THF), portion wise for 15 min at -30 °C. To this was added o pyrimidine-5-carbaldehyde 505 (1 g, 9.25 mmol) in CH2CI2 (5 mL) drop wise for 10 min at -30 C, stirred for 2 h; warmed to 0 °C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (50 mL) and extracted with

CH2CI2 (2 x 100 mL). The combined organic extracts were washed with water (100 mL), dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 50% EtOAc/ hexanes to afford compound 507 (1.8 g, 72%) as an off-white solid. TLC: 70% EtOAc/ hexanes (Rf. 0.8); ^XH NMR (500MHz, DMSOd₆): δ 9.11 (s, 1H), 9.02 (brs, 1H), 8.98 (s, 2H), 6.46 (s, 1H), 3.76 (s, 3H), 1.42-1.38 (m, 9H).

Synthesis of methyl 2-((terAbutoxycarbonyl) amino)-3-(pyrimidin-5-yl) propanoate (508): To a stirred solution of compound 507 (1.8 g, 6.45 mmol) in MeOH (25 mL) under inert atmosphère was added 5% Pd/C (500 mg) at RT and stirred under hydrogen atmosphère (at 100 psi) for 16 h in a steel bomb. The reaction was monitored by TLC; after completion of the reaction, the reaction

299 mixture was filtered through celite and washed with 10% MeOH/ CH2CI2 (2 x 50 mL). The filtrate was concentrated in vacuo to obtain the crude compound 508 (1.3 g, 72%) as colorless syrup. TLC: 5% MeOH/ CH2CI2 (Rf. 0.5); 'H NMR (DMSO-</_d, 500 MHz): δ 9.03 (s, 1H), 8.68 (s, 2H), 7.40 (d, J= 7.8 Hz, 1H), 4.33-4.25 (m, 1H), 3.65 (s, 3H), 3.09 (dd, J= 14.4, 4.4 Hz, 1H), 2.89-2.81 (m, 1H), 1.33-1.22 (m, 9H).

Synthesis of methyl 2-amino-3-(pyrimidin-5-yl) propanoate hydrochloride (509): To a stirred solution of compound 508 (1.3 g, 4.62 mmol) in CH2CI2 (5 mL) under argon atmosphère was added 4 N HCl in 1, 4-dioxane (5 mL) at 0 °C; warmed to RT and stirred for 3.5 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to afford compound 509 (850 mg) as an off-white solid. TLC: 5% MeOH/ CH2CI2 (Rf. 0.2); 'H NMR (DMSO-rf_d, 400 MHz): δ 9.15-9.08 (m, 1H), 8.75 (s, 4H), 4.45-4.44 (m, 1H), 3.73 (s, 3H), 3.22 (dd, J =6.6, 2.4 Hz, 2H).

Synthesis of methyl 2-(2-fluoro-ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8carboxamido)-3-(pyrimidin-5-yl) propanoate (1342): Using Procedure B the title compound was prepared with compound 35 (200 mg, 0.69 mmol), compound 509 (165 mg, 0.76 mmol) and was obtained in 67% yield as an off-white solid; TLC: 5% MeOH/ CH2CI2 (Rf 0.5); ^JH NMR (DMSOrf₆,500 MHz): δ 10.89 (s, 1H), 8.99 (t, J= 4.0 Hz, 2H), 8.69 (s, 2H), 7.66 (d, J= 8.1 Hz, 1H), 7.617.56 (m, 2H), 7.52 (dd, J= 8.1, 1.4 Hz, 1H), 7.46 (dd, J= 9.1, 2.7 Hz, 1H), 7.36 (td, J= 8.4, 2.9 Hz, 1H), 4.81-4.70 (m, 1H), 3.64 (s, 3H), 3.22 (dd, J= 14.2, 4.9 Hz, 1H), 3.05 (dd, J= 14.0, 10.6 Hz, 1H); LC-MS: 98.59%; 453.4 (M⁺+l); (column; X-select CSH C18, (50 x 3.0 mm, 3.5 pm); RT 3.45 min. 0.05% Aq. TFA: ACN; 0.8 mL/min); UPLC (purity): 99.40%; (column; Acquity BEH C-18 (50 x 2.1 mm, 1.7 p); RT 1.89 min. ACN: 0.025% TFA (Aq); 0.5 mL/min).

Synthesis of 2-fluoro-7V-(l-hydroxy-3-(pyrimidin-5-yl) propan-2-yl)-ll-oxo-10,11dihydrodibenzo [Λ,./] [1,4] thiazepine-8-carboxamide (1361): To a stirred solution of 1342 (200 mg, 0.44 mmol) in MeOH (5 mL) under inert atmosphère was added sodium borohydride (65 mg, 1.76 mmol) at 0 °C; warmed to RT and stirred for 6 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was quenched with ice cold water (25 mL) and extracted with 5% MeOH/ CH2CI2 (5 x 25 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 8% MeOH/ CH2CI2 to afford compound 1361 (140 300 mg, 75%) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.4); ²H NMR (DMSO-</₆,400 MHz): δ 10.87 (s, 1H), 8.96 (s, 1H), 8.64 (s, 2H), 8.30 (d, J= 8.7 Hz, 1H), 7.66-7.63 (m, 1H), 7.617.57 (m, 2H), 7.53 (dd, J= 8.1, 1.8 Hz, 1H), 7.47 (dd, J= 9.2, 2.9 Hz, 1H), 7.37 (td, J= 8.5, 3.0 Hz, 1H), 4.93 (t, J= 5.6 Hz, 1H), 4.22-4.11 (m, 1H), 3.53-3.40 (m, 2H), 2.98 (dd, J= 13.9, 4.2 Hz, 1H), 2.73 (dd, J= 14.0, 10.1 Hz, 1H); LC-MS: 99.82%; 425.4 (M*+l); (column; X-select CSH Cl8, (50 x 3.0 mm, 3.5 pm); RT 3.68 min. 0.05% Aq. TFA: ACN; 0.8 mL/min); UPLC (purity): 99.77%;

(column; Acquity BEH C-18 (50 x 2.1 mm, 1.7 p); RT 1.65 min. ACN: 0.025% TFA (Aq.); 0.5 mL/min).

Example 40: Synthesis of Compound 1346

Synthesis of 2-(2-fluoro-ll-oxo-10,11-dihydrodibenzo [b,j\ [1,4] thiazepine-8-carboxamido)3-(pyrimidin-5-yl) propanoic acid (510): To a stirred solution of compound 1342 (150 mg, 0.33 mmol) in a mixture of THF: H₂O (4: 1,5 mL) was added lithium hydroxide monohydrate (35 mg, 0.82 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (3 mL) and the pH was adjusted to ~5 with 1 N HCl. The precipitated solid was filtered and dried in vacuo to afford compound 510 (75 mg, 52%) as white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.2); ¹H NMR (DMSO ¢(¢,400 MHz): δ 10.90 (s, 1H), 8.98 (s, 1H), 8.78 (d, J= 7.6 Hz, 1H), 8.68 (s, 2H), 7.66 (d, J= 8.0 Hz, 1H), 7.62-7.57 (m, 2H), 7.53 (dd, J= 8.1, 1.7 Hz, 1H), 7.47 (dd, J= 9.2, 2.9 Hz, 1H), 7.37 (dt, J= 8.5, 2.9 Hz, 1H), 7.40-7.34 (m, 1H), 4.69-4.58 (m, 1H), 3.23 (dd, J= 14.1, 4.6 Hz, 1H), 3.03 (dd, J= 14.0, 10.3 Hz, 1H).

301

Synthesis of teri-butyl 2-(2-fluoro-ll-oxo-10,11-dihydrodibenzo [b,f\ [1, 4] thiazepine-8carboxamido)-3-(pyrimidin-5-yl) propanoate (1346): To a stirred solution of compound 510 (70 mg, 0.15 mmol) in Abutanol (4 mL) under inert atmosphère were added Boc-anhydride (0.11 mL, 0.47 mmol) and DMAP (30 mg, 0.03 mmol) at 5 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (10 mL) and extracted with CH2CI2 (2 x 25 mL). The combined organic extracts were dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through préparative TLC (50% EtOAc/ hexanes) to afford 1346 (25 mg, 32%) as an offwhite solid. TLC: 70% EtOAc/ hexanes (Rf. 0.4); ^JH NMR (DMSO-^, 400 MHz): δ 10.91 (s, 1H),

9.01 (s, 1H), 8.89 (d, J= 7.8 Hz, 1H), 8.71 (s, 2H), 7.67 (d, J= 8.0 Hz, 1H), 7.64-7.58 (m, 2H), 7.55 (dd, J= 8.0, 1.9 Hz, 1H), 7.48 (dd, J= 9.2, 2.9 Hz, 1H), 7.38 (td, J= 8.5, 2.9 Hz, 1H), 4.65-4.59 (m, 1H), 3.21-3.13 (m, 1H), 3.09-2.99 (m, 1H), 1.39-1.31 (m, 9H); LC-MS: 98.60%; 495.6 (MM); (column; X-select CSH C18, (50 x 3.0 mm, 3.5 pm); RT 3.91 min. 0.05% Aq. TFA: CAN; 0.8 mL/min); UPLC (purity): 98.29%; (column; Acquity BEH C-18 (50 x 2.1 mm, 1.7 p); RT 2.15 min. CAN: 0.025% TFA (Aq); 0.5 mL/min).

302

Example 41: Synthesis of Compounds 1420 and 1419

Synthesis of methyl 3'-nitro-[l, l'-biphenyI]-4-carboxylate (512): To a stirred solution of methyl 4-bromobenzoate 511 (2.5 g, 14.97 mmol) and (3-nitrophenyl) boronic acid 382 (3.8 g, 17.96 mmol) in Toluene (20 mL) under inert atmosphère were added sodium carbonate (3.17 g, 29.96 mmol in 25 mL of H2O) at RT and purged under argon atmosphère for 20 min. To this was added Pd(PPh₃)4 (691 mg, 0.59 mmol) and heated to 80 C for 5 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with EtOAc (200 mL). The organic extract was dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 10% EtOAc/ hexanes to afford compound 512 (800 mg, 21%) as yellow liquid. TLC: 15% EtOAc/ hexanes (Rf. 0.5); ¹H NMR (400 MHz, CD3OD): δ 8.54-8.52 (m, 1H), 8.29-8.26 (m, 1H), 8.15 (d, J= 8.7 Hz, 2H), 8.12-8.09 (m, 1H), 7.84 (d, J= 8.6 Hz, 2H), 7.74 (t, J= 8.0 Hz, 1H), 3.94 (s, 3H).

Synthesis of methyl 3'-amino-[l, l'-biphenyl]-4-carboxylate (513): To a stirred solution of compound 512 (800 mg, 3.11 mmol) in EtOH (50 mL) under inert atmosphère was added 10% Pd/C (500 mg, wet) under argon atmosphère and stirred under H2 atmosphère (balloon pressure) for 5 h.

303

After completion of the reaction, the reaction mixture was fïltered through celite, washed with 50% MeOH/ CH2CI2 (150 mL). The filtrate was concentrated in vacuo to obtain the crude which was purified through silicagel column chromatography in 5% MeOH/ CH2CI2 to afford compound 513 (600 mg, 67%) as an off-white solid. The crude was carried for next step without further purification. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.4).

Synthesis of methyl 3'-(2-fluoro-ll-oxo-10,11-dihydrodibenzo [b,j\ [1,4] thiazepine-8carboxamido)-[l, l'-biphenyl]-4-carboxylate (1420): Using Procedure A the title compound was prepared with 35 (50 mg, 0.17 mmol), compound 513 (43 mg, 0.19 mmol) and was obtained in 58% yield as white solid; TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.5); ^JH NMR (DMSO-7₆,400 MHz): δ 10.99 (s, 1H), 10.43 (s, 1H), 8.14 (s, 1H), 8.07 (d, J= 7.9 Hz, 2H), 7.85-7.72 (m, 6H), 7.63 (dd, J= 8.6, 5.3 Hz, 1H), 7.54-7.45 (m, 3H), 7.40 (td, J= 8.5, 3.0 Hz, 1H), 3.88 (s, 3H); LC-MS: 98.86%; 498.1 (M*+l); (column; X-select CSH C18, (50 x 3.0 mm, 3.5 pm); RT 4.15 min. 0.05% Aq. TFA: ACN; 0.8 mL/min); UPLC (purity): 95.09%; (column; Acquity BEH C-18 (50 x 2.1 mm, 1.7 p); RT 2.75 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

Synthesis of 3'-(2-fIuoro-ll-oxo-10,11-dihydrodibenzo [b,f\ [1,4] thiazepine-8-carboxamido)[1, l’-biphenyl]-4-carboxylic acid (1419): To a stirred solution of 1420 (50 mg, 0.10 mmol) in MeOH: H₂O (3:1,8 mL) was added potassium hydroxide (56 mg, 1.00 mmol) at RT in a sealed tube and heated to 90 °C and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the pH of the reaction mixture was acidified with 4 N HCl to pH ~2. The obtained solid was fïltered, triturated with 10% EtOAc/ hexanes (10 mL) and dried in vacuo and to afford compound 1419 (20 mg, 41%) as an off-white solid. TLC: 70% EtOAc/ hexanes (Rf. 0.2); ’H NMR (400 MHz, DMSO-dô): δ 12.98 (brs, 1H), 11.00 (s, 1H), 10.51 (s, 1H), 8.15 (s, 1H), 8.04 (d, J= 8.4 Hz, 2H), 7.87-7.70 (m, 6H), 7.63 (dd, J= 8.6, 5.3 Hz, 1H), 7.54-7.46 (m, 3H), 7.40 (td, J= 8.5,2.9 Hz, 1H); LC-MS: 91.15%; 485.0 (M⁺+l); (column; Ascentis Express C18, (50 x 3.0 mm, 2.7 pm); RT 2.48 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min); UPLC (purity): 93.75%; (column; Acquity BEH C-18 (50 x 2.1 mm, 1.7 p); RT 2.43 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

304

Example 42: Synthesis of Compounds 1422 and 1421

Synthesis of methyl 3'-nitro-[l, l'-biphenyl]-3-carboxylate (515): To a stirred solution of methyl 3-bromobenzoate 514 (2.5 g, 14.99 mmol) and (3-nitrophenyl) boronic acid 382 (3.8 g, 17.99 mmol) in toluene (20 mL) under inert atmosphère were added sodium carbonate (3.17 g, 29.99 mmol in 20 mL of H₂O) at RT and purged under argon atmosphère for 20 min. To this was added Pd(PPh₃)4 (693 mg, 0.59 mmol) and heated to 80 C for 5 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with EtOAc (200 mL). The organic extract was dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 10% EtOAc/ hexanes to afford compound 515 (1 g, 26%) as yellow liquid. TLC: 15% EtOAc/ hexanes (Rf. 0.5); *H NMR (400 MHz, DMSO-rf₆): δ 8.48-8.46 (m, 1H), 8.30-8.25 (m, 2H), 8.22-8.18 (m, 1H), 8.11-8.07 (m, 1H), 8.04 (dt, J= 7.8, 1.3 Hz, 1H), 7.80 (t, J= 8.0 Hz, 1H), 7.69 (t, J= 7.8 Hz, 1H), 3.91 (s, 3H).

Synthesis of methyl 3'-amino-[l, l'-biphenyl]-3-carboxy!ate (516): To a stirred solution of compound 515 (1 g, 3.89 mmol) in EtOH (100 mL) under inert atmosphère was added 10% Pd/C (600 mg, wet) under argon atmosphère and stirred under H₂ atmosphère (balloon pressure) for 16 h. After completion of the reaction, the reaction mixture was filtered through celite and the celite pad

305 was washed with 50% MeOH/ CH2CI2 (150 mL). The fïltrate was evaporated in vacuo to obtain the crude which was purified through silicagel column chromatography in 20% EtOAc/ hexanes to afford compound 516 (600 mg, 67%) as an off-white solid. TLC: 40% EtOAc/ hexanes (Rf. 0.3); 'H NMR (400 MHz, DMSO-7₆): δ 8.15- 8.08 (m, 1H), 7.92 (d, J= 7.7 Hz, 1H), 7.84 (d, 7= 8.2 Hz, 1H), 7.59 (t, 7= 7.7 Hz, 1H), 7.13 (t, 7= 7.8 Hz, 1H), 6.90-6.87 (m, 1H), 6.81 (d, 7= 7.6 Hz, 1H), 6.60 (dd, 7= 8.0, 1.4 Hz, 1H), 5.22 (s, 2H), 3.32 (s, 3H).

Synthesis of methyl 3'-(2-fluoro-ll-oxo-10,11-dihydrodibenzo [b, J\ [1, 4] thiazepine-8carboxamido)-[l, l'-biphenyl]-3-carboxylate (1422): Using Procedure A the title compound was prepared with compound 35 (70 mg, 0.24 mmol), compound 516 (55 mg, 0.24 mmol) and was obtained in 41% yield as white solid; TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.5); *H NMR (400 MHz, DMSO-7_tf): δ 10.99 (s, 1H), 10.43 (s, 1H), 8.12-8.19 (m, 1H), 8.10-8.08 (m, 1H), 7.96 (dd, 7= 12.8, 7.9 Hz, 2H), 7.85 (dt, 7= 7.1, 1.8 Hz, 1H), 7.81-7.73 (m, 3H), 7.69-7.59 (m, 2H), 7.54-7.45 (m, 3H), 7.40 (td, 7= 8.5, 2.9 Hz, 1H), 3.90 (s, 3H); LC-MS: 99.82%; 499.0 (M+l)⁺; (column; X-select CSH C18, (50 x 3.0 mm, 3.5 pm); RT 4.10 min. 0.05% Aq. TFA: ACN; 0.8 mL/min); UPLC (purity): 98.72%; (column; Acquity BEH C-18 (50 x 2.1 mm, 1.7 μ); RT 2.78 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

Synthesis of 3'-(2-fIuoro-ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8-carboxamido)[1, l'-biphenyl]-3-carboxylic acid (1421): To a stirred solution of 1422 (35 mg, 0.07 mmol) in MeOH: H₂O (3:1,5 mL) under inert atmosphère was added potassium hydroxide (40 mg, 0.70 mmol) at RT in a sealed tube and heated to 80 °C and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the pH of the reaction mixture was acidified with 4 N HCl to pH ~2 and extracted with EtOAc (2x10 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The obtained solid was filtered, dried in vacuo and triturated with 10% EtOAc/ hexanes (10 mL) to afford compound 1421 (20 mg, 58%) as white solid. TLC: 70% EtOAc/ hexanes (Rf. 0.2); *H NMR (400 MHz, DMSOd₆): δ 12.99 (br s, 1H), 10.98 (s, 1H), 10.43 (s, 1H), 8.21-8.19 (m, 1H), 8.11-8.09 (m, 1H), 7.96 (d, J = 7.7 Hz, 1H), 7.87 (dd, 7= 19.5, 7.3 Hz, 2H), 7.82-7.73 (m, 3H), 7.66-7.58 (m, 2H), 7.54-7.44 (m, 3H), 7.40 (td,7= 8.5, 2.9 Hz, 1H); LC-MS: 99.07%; 484.9 (MT+1); (column; X-select CSH C18, (50 x 3.0 mm, 3.5 pm); RT 3.73 min. 0.05% Aq. TFA: ACN; 0.8 mL/min); UPLC (purity):

306

96.90%; (column; Acquity BEH C-18 (50 x 2.1 mm, 1.7 μ); RT 2.46 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

Example 43: Synthesis of Compounds 1436 and 1435

Synthesis of methyl 3’-nitro-[l, l'-biphenyl]-2-carboxylate (518): To a stirred solution of methyl 2-bromobenzoate 517 (2.5 g, 14.97 mmol) and (3-nitrophenyl) boronic acid 382 (3.8 g, 17.96 mmol) in toluene (20 mL) under inert atmosphère were added sodium carbonate (3.17 g, 29.94 mmol in 20 mL of H₂O) at RT and purged under argon atmosphère for 20 min. To this was added Pd(PPh₃)4 (691 mg, 0.59 mmol) and heated to 80 °C for 6 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with EtOAc (200 mL). The organic extract was dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 15% EtOAc/ hexanes to afford compound 518 (600 mg, 17%) as yellow solid. TLC: 30% EtOAc/ hexanes (Rf 0.6); ¹H NMR (400 MHz, DMSO-iZtf): δ 8.27-8.23 (m, 1H), 8.11-8.09 (m, 1H), 7.89 (dd, 7= 7.7, 1.3 Hz, 1H), 7.79-7.67 (m, 3H), 7.59 (td, J= 7.6, 1.1 Hz, 1H), 7.52 (dd, J= 7.6, 0.6 Hz, 1H), 3.31 (s, 3H).

Synthesis of methyl 3'-amino-[l, l'-biphenyl]-2-carboxylate (519): To a stirred solution of compound 518 (600 mg, 2.33 mmol) in EtOH (50 mL) under inert atmosphère was added 10% Pd/C

307 (300 mg, wet) under argon atmosphère and stirred under H₂ atmosphère (balloon pressure) for 16 h. After completion of the reaction, the reaction mixture was filtered through celite and the celite pad was washed with 50% MeOH/ CH2CI2 (100 mL). The filtrate was evaporated in vacuo to afford compound 519 (500 mg, 87%) as an off-white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.6); *H NMR (400 MHz, DMSO-d₆): δ 7.63 (dd, J= Ί.Ί, 1.0 Hz, 1H), 7.56 (td, J= 9.0, 1.8 Hz, 1H), 7.43 (td, J= Ί.6,1.1 Hz, 1H), 7.37 (dd, J= 7.7, 0.8 Hz, 1H), 7.03 (t, J= 7.7 Hz, 1H), 6.57-6.52 (m, 1H), 6.526.49 (m, 1H), 6.39 (d, J= 7.5 Hz, 1H), 5.14 (br s, 2H), 3.59 (s, 3H).

Synthesis of methyl 3'-(2-fluoro-ll-oxo-10,11-dihydrodibenzo \b.f\ [1, 4] thiazepine-8carboxamido)-[l, l'-biphenyl]-2-carboxylate (1436): Using Procedure A the title compound was prepared with compound 35 (100 mg, 0.34 mmol), compound 519 (78 mg, 0.34 mmol) and was obtained in 35% yield as white solid; TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.5); Tl NMR (400 MHz, DMSO-^): δ 10.97 (s, 1H), 10.37 (s, 1H), 7.78-7.72 (m, 6H), 7.66-7.60 (m, 2H), 7.54-7.48 (m, 2H), 7.46-7.36 (m, 3H), 7.04 (d, J= 7.3 Hz, 1H), 3.61 (s, 3H); LC-MS: 93.05%; 499.0 (M/^-t-l); (column; Ascentis Express Cl8, (50 x 3.0 mm, 2.7 pm); RT 2.74 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min); UPLC (purity): 91.54%; (column; Acquity BEH C-18 (50 x 2.1 mm, 1.7 p); RT 2.72 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

Synthesis of 3'-(2-fluoro-ll-oxo-10,11-dihydrodibenzo \b,j\ [1, 4] thiazepine-8-carboxamido)[1, l'-biphenyl]-2-carboxy!ic acid (1435): To a stirred solution of 1436 (35 mg, 0.07 mmol) in MeOH: H2O (3:1,8 mL) was added potassium hydroxide (40 mg, 0.70 mmol) at RT in a sealed tube and heated to 80 °C and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the pH of the reaction mixture was acidified with 4 N HCl to pH ~2 and extracted with EtOAc (2x10 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The obtained solid was filtered, triturated with 10% EtOAc/ hexanes (5 mL) and dried in vacuo to afford compound 1435 (20 mg, 58%) as white solid.

TLC: 70% EtOAc/ hexanes (Rf. 0.2); *H NMR (400 MHz, DMSO-d₆): δ 11.00 (br s, 1H), 10.36 (s, 1H), 7.81-7.69 (m, 5H), 7.67-7.59 (m, 2H), 7.54-7.48 (m, 2H), 7.44-7.31 (m, 4H), 7.07 (d, J= 7.8 Hz, 1H); LC-MS: 91.40%; 484.9 (ΜΤΤ); (column; Ascentis Express C18, (50 x 3.0 mm, 2.7 pm); RT 2.49 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min); UPLC (purity): 92.47%; (column; Acquity BEH C-18 (50 x 2.1 mm, 1.7 p); RT 2.36 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

308

Example 44: Synthesis of ll-oxo-10,11-dihydrodibenzo [b, f\ [1, 41 thiazepine-8-suIfonamide

To a stirred solution of compound 491 (80 mg, 0.26 mmol) in DMSO (1.5 mL) under inert atmosphère were added potassium metabisulfate (116 mg, 0.52 mmol), tetraethyl ammonium bromide (60 mg, 0.28 mmol), sodium formate (40 mg, 0.57 mmol), palladium acetate (18 mg, 0.026 mmol) and 1, 10-phenanthroline (14 mg, 0.078 mmol) at RT in a microwave vial and purged under argon atmosphère for 10 min; heated to 90 °C for 4 h. The reaction was monitored by TLC; after completion of the reaction, the crude compound was carried forward to next step. TLC: 30% EtOAc/ hexanes (Rf. 0.4).

The above crude compound and commercially available amines were converted to corresponding sulfonamide employing the Procedure L and the results are captured in the Table 3.

Procedure L:

To a stirred solution of above crude compound (100 mg, crude) in THF (2 mL) under argon atmosphère were added piperidine 521 (0.05 mL, 0.54 mmol) in THF (1 mL), 7V-bromosuccinimide (96 mg, 0.54 mmol) in THF (1 mL) at 0 °C; warmed to RT and stirred for 12 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with brine (20 mT,) and extracted with EtOAc (2 x 50 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purifîed through silica gel column chromatography to afford the desired compound.

309

Commercially available amines used for the préparation of compounds:

Ό		“0	HN-\ kz~^0H	HN—i A
521	522	275	523	524
h₂n^	...x>		OL/NH₂	η₂νΆΗ
			254	257
525	179	221
	h₂n s-^
212	213

Table 3: Synthesis of compounds from compound 520 and various commercially available amines

No.	. Structure . :	Procedure, Intermediate, Amine '	Rx. Yîeld (%)	Mass Spec. Found	Mass Spec/ Calculated·	'll-NMR . i ’ - 1
1399	₀ H °< *° XPo	L, 521 (RT 18 h)	15	374.9 (M+l)	374.08 for C₁₈H₁₈N₂O ₃s₂	‘HNMR (DMSO-iZe, 400 MHz): δ 10.86 (s, 1H), 7.80 (d, 7=8.0 Hz, 1H), 7.72 (dd, 7=7.6,1.4 Hz, 1H), 7.597.55 (m, 2H), 7.54-7.43 (m, 3H), 2.93-2.84 (m, 4H), 1.571.48 (m, 4H), 1.42-1.31 (m, 2H);
1431	M	L, 522	19	390.9 (M*+l)	390.07 for C[₈Hi₈N₂O 4S2	‘HNMR (DMSO-7_d, 400 MHz): δ 10.87 (s, 1H), 7.81 (d, 7=8.2 Hz, 1H), 7.72 (dd,7=7.4,1.4 Hz, 1H), 7.607.53 (m, 3H), 7.52-7.45 (m,

310

						2H), 4.66 (d, J = 4.0 Hz, 1H), 3.53-3.49 (m, 1H), 3.19-3.12 (m, 2H), 2.762.69 (m, 2H), 1.77-1.68 (m, 2H), 1.49-1.35 (m,2H);
1432	₀ H %'/° ,S. ΛΠυ v/^s	L, 275	20	360.8 (M*+l)	360.06 for c₁₇h₁₆n₂o 3S2	‘H NMR (DMSO-φ, 400 MHz): δ 10.85 (s, 1H), 7.79 (d, 7=8.0 Hz, 1H), 7.747.70 (m, 1H), 7.63 (s, 1H), 7.60-7.45 (m, 4H), 3.16-3.11 (m, 4H), 1.751.56 (m,4H);
1433	/ ΥΎ n-\ /=\ A> C^^0HVjA^s	L, 523	19	376.9 (ΝΓ+1)	376.06 for C₁₇H₁₆N₂O 4S2	‘H NMR (DMSO-φ, 400 MHz): δ 10.83 (s, 1H), 7.78 (d, 7= 8.0 Hz, 1H), 7.747.68 (m, 1H), 7.63 (s, 1H), 7.59-7.45 (m, 4H), 4.86 (d, 7 = 3.4 Hz, 1H), 4.17-4.14 (m, 1H), 3.27-3.18 (m, 3H), 3.102.93 (m, 1H), 1.81-1.69 (m, 1H), 1.68-1.58 (m, 1H);
1434	x XJ U OH	L, 524	20	362.8 (JVF+l)	362.04 for Ci₆H_I4N₂O 4S2	‘H NMR (DMSO-di, 400 MHz): δ 10.90 (s, 1H), 7.86 (d, 7= 8.2 Hz, 1H), 7.73 (dd,7=7.5,1.5 Hz, 1H), 7.647.62 (m, 1H), 7.60-7.47 (m, 4H), 5.71 (d, 7 = 6.3 Hz, 1H), 4.30-4.22 (m, 1H), 3.89 (dd, 7

311

						= 8.5, 6.8 Hz, 2H), 3.40-3.34 (m, 2H);
1450	0 H d-Ax	L, 525	16	348.9 (M*+l)	348.06 for C^Hie^O 3S2	‘HNMR (DMSO-7_d, 400 MHz): δ 10.89 (s, 1H), 7.77 (d, 7=8.2 Hz, 1H), 7.737.68 (m, 2H), 7.65-7.63 (m, 1H), 7.57-7.44 (m, 4H), 3.273.16 (m, 1H), 0.94 (d, J =6.5 Hz, 6H);
1412	O^^s	L, 179	15	382.9 (Nf+1)	382.04 for C19H44N2O 3S2	‘HNMR (DMSO-7_d, 400 MHz): δ 10.90 (s, 1H), 10.42 (s, 1H), 7.73 (d,7=8.2 Hz, 1H), 7.68 (dd, 7=6.9,15. Hz, 1H), 7.657.63 (m, 1H), 7.55-7.43 (m, 4H), 7.24-7.18 (m, 2H), 7.087.04 (m, 2H), 7.01 (t, 7=7.7 Hz, 1H);
1413	0. H 0 „0 y^y_F V^NYV 'nAJ	L, 221	23	400.9 (M%1)	400.04 for C₁₉H_I3FN₂ O3S2	‘HNMR (DMS0-<4 400 MHz): 10.90 (s, 1H), 10.37 (s, 1H), 7.74 (d,7=8.3 Hz, 1H), 7.69 (dd,7=6.9,1.5 Hz, 1H), 7.607.56 (m, 1H), 7.55-7.45 (m, 3H), 7.43 (dd, J = 8.2,2.0 Hz, 1H), 7.09-7.04 (m,4H);
1414	Afro W~~^s	L, 254	23	396.9 (M⁺+l)	396.06 for C₂oH₁₆N₂0 3S2	‘HNMR (DMSO-7_d, 400 MHz): δ 10.83 (s, 1H), 8.28 (t, 7= 6.3

312

						Hz, 1H), 7.74 (dd,7= 6.8,1.5 Hz, 1H), 7.69 (d, J= 8.2 Hz, 1H), 7.59-7.49 (m, 4H), 7.47 (dd, 7= 8.2,2.0 Hz, 1H), 7.157.10 (m, 2H), 7.06 (t, 7=7.4 Hz, 2H), 7.026.96 (m, 1H), 3.99 (d, 7= 6.3 Hz, 2H);
1415	jvIm θ'^^ΧΧ O~^{s x}	L, 257	22	414.9 (κΓ+i)	414.05 for C20H15FN2 O₃S2	‘HNMR (DMSO-iZtf, 400 MHz): δ 10.86 (s, 1H), 8.28 (t, 7= 6.2 Hz, 1H), 7.767.67 (m, 2H), 7.63-7.60 (m, 1H), 7.58-7.44 (m, 4H), 7.18 (dd,7=8.6, 5.6 Hz, 2H), 6.92 (t,7= 8.9 Hz, 2H), 4.04-3.92 (m, 2H);
1473	A ΥΎ Ad O~^{5 x}	L, 212	19	399.0 (M*+l)	398.05 for C₁₈H₁₄N₄O 3S2	‘HNMR (DMSO-rZg, 400 MHz): δ 10.86 (s, 1H), 8.76 (s, 1H), 8.59 (s, 2H), 8.43 (brs, 1H), 7.78-7.70 (m, 2H), 7.60-7.54 (m, 3H), 7.547.48 (m, 2H), 4.07 (s, 2H);

313

Synthesis of 8-(benzylthio) dibenzo [b,j\ [1,4] thiazepin-ll(10H)-one (527): To a stirred solution of compound 491 (1 g, 3.26 mmol) in 1, 4-dioxane (20 mL) under argon atmosphère were added phenylmethanethiol 526 (0.4 mL, 3.59 mmol), CS2CO3 (921 mg, 3.92 mmol) at RT, purged under argon atmosphère for 20 min. To this were added Pd2(dba)3 (75 mg, 0.081 mmol), Xantphos (94 mg, 1.06 mmol) at RT and heated to 110-120 C and stirred for 12 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered and the fîltrate was removed in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 5-40% EtOAc/ hexanes to afford compound 527 (700 mg, 61 %) as pale yellow solid. TLC: 30% EtOAc/ hexanes (Rf. 0.4); ^XH NMR (DMSO-^, 400 MHz): δ 10.63 (s, 1H), 7.68-7.65 (m, 1H), 7.53-7.41 (m, 4H), 7.39-7.34 (m, 2H), 7.32-7.20 (m, 3H), 7.17 (s, 1H), 7.10 (dd, J= 8.2, 2.1 Hz, 1H), 4.24 (s, 2H).

Synthesis of ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8-sulfonyl chloride (520): To a stirred solution of 527 (700 mg, 2.00 mmol) in acetic acid: H2O (3: 1, 16 mL) under was addedNchlorosuccinimide (668 mg, 5.61 mmol) at 0 °C; warmed to RT and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (100 mL) and extracted with diethyl ether (2 x 100 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to afford crude compound 520 (700 mg) as yellow solid. The crude compound was carried forward for next step without further purification. TLC: 20% EtOAc/ hexanes (Rf. 0.6); LC-MS: 68.55%; 325.9 (NC+l); column; Ascentis Express

314

C18, (50 x 3.0 mm, 2.7 gm); RT 2.51 min. 0.025% Aq. TFA + 5% ACN: ACN +; 5% 0.025% Aq. TFA, 1.2 mL/min).

Example 45: Synthesis of compounds from compound 520 and various commercîally available amines

Compound 520 and commercially available amines were converted to corresponding sulfonamides employing Procedure M and the results are captured in Table 4.

Procedure M:

To a stirred solution of 2, 4-difluoroaniline 228 (100 mg, 0.77 mmol) in CH2CI2 (5 mL) under argon 10 atmosphère were added compound 6 (252 mg, crude), pyridine (3.87 mL, 5.26 mmol) at 0 C;

warmed to RT and stirred for 12 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted with CH2CI2 (2 x 50 mT,). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography to 15 afford the desired compound.

Commercially available amines used for the synthesis of compounds

Table 4: Synthesis of compounds from compound 520 and various commercially available amines

No.'i

Structure ^v : ·: - .y ·> 1 *·’

Procedure, Intermediate, 'Amine Il 1

Rx. Yield (%)

Mass Spec. Found , i

T MaskSpe'c^· Calculated

'! Tl-NMR I J i

315

1526	°κ Η °v° ZV^FΡ ΪΥη Γ O^^{s χ F}	Μ, 520,228	8	418.8 (Μ%1)	418.03 for C19H12F2N2 O₃S₂	Ή NMR (DMSO-i/g, 400 MHz): δ 10.89 (s, 1H), 10.25 (s, 1H), 7.77 (d, .7= 8.2 Hz, 1H), 7.70 (dd,J=7.5,1.2 Hz, 1H), 7.587.45 (m, 4H), 7.43 (dd,J= 8.2, 2.0 Hz, 1H), 7.25-7.17 (m, 2H), 7.066.98 (m, 1H)
1544	y^jp'⁰¹	Μ, 520, 224	10	435.1 (MUl)	434.00 for C₁₉H₁₂C1F n₂o₃s₂	‘H NMR (DMSO-/4, 400 MHz): δ 10.90 (s, 1H), 10.43 (s, 1H), 7.77 (d, J= 8.2 Hz, 1H), 7.70 (d, J =7.0 Hz, 1H), 7.61-7.43 (m, 5H), 7.427.37 (m, 1H), 7.26-7.18 (m, 2H);
1505	CX^{s χ}	Μ, 520, 229	6	385.1 (ΜΕί)	384.04 for C₁₇H₁₂N₄O 382	‘H NMR (DMSO-rftf, 400 MHz): δ 11.02 (brs, 1H), 10.90 (s, 1H), 8.90 (s, 1H), 8.52 (s, 2H), 7.78 (d, J = 8.2 Hz, 1H), 7.71-7.64 (m, 2H), 7.57-7.44 (m,4H);
1506	0 ΝΗ Ο₍ ιι ν *ζ 0	Μ, 520,229 (excess equiv. ofNCS)	6	400.8 (NC+1)	400.03 for c₁₇h₁₂n₄o ₄s₂	‘H NMR (DMSO-rf₆, 400 MHz): δ 11.15 (s, 1H), 11.08 (brs, 1H), 8.91 (s, 1H), 8.52 (s, 2H), 7.86-7.77 (m, 4H), 7.73 (d, .7= 7.0 Hz, 1H), 7.68 (s, 1H), 7.66-7.61

316

						(m, 1H);
1556	VyAAj” /=/ IH h s-^	M, 520,213	9	403.9 (MM)	403.01 for C₁₇H₁₃N3O 3S3	‘H NMR (DMSO-iZ_tf, 400 MHz): δ 10.86 (s, 1H), 8.76 (s, 1H), 8.44 (t, 2= 6.0 Hz, 1H), 7.76 (d, 2= 8.2 Hz, 1H), 7.74-7.71 (m, 1H), 7.66 (s, 1H), 7.62 (s, 1H), 7.59-7.47 (m, 4H), 4.25 (d, 2= 5.9 Hz, 2H);
1597	T ji j N	M, 520,215	5	412.9 (M*+l)	412.07 for C₁₉H_i6N₄O 3S2	‘H NMR (DMSO-2₆, 400 MHz): δ 10.87 (brs, 1H), 8.91 (s, 1H), 8.59 (s, 2H), 7.90-7.85 (m, 1H), 7.787.70 (m, 2H), 7.61-7.44 (m, 5H), 3.10-3.03 (m, 2H), 2.762.63 (m, 2H);

317

Synthesis of 4-chloro-7V-(2-cyclohexylethyl)-3-nitrobenzenesuIfonamide (529): To a stirred solution of 2-cyclohexylethan-l-amine 261 (500 mg, 3.93 mmol) in CH2CI2 (10 mL) under inert atmosphère were added pyridine (0.9 mL), 4-chloro-3-nitrobenzenesulfonyl chloride 528 (1 g, 3.93 mmol) at 0 °C; warmed to RT and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted with CH2CI2 (2x30 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 15% EtOAc/ hexanes to afford compound 529 (1.36 g, 52%) as yellow solid. TLC: 30% EtOAc/ hexanes (Rf. 0.6); ’H-NMR (CDCI3, 400 MHz): δ 8.33 (s, 1H), 7.97 (d, J= 8.4 Hz, 1H), 7.71 (d, J= 8.4 Hz, 1H), 4.52 (t, J= 5.6 Hz, 1H), 3.03 (q, 2H), 1.69-1.56 (m, 4H), 1.401.35 (m, 2H), 1.28-1.08 (m, 5H), 0.89-0.83 (m, 2H).

Synthesis of methyl 2-((4-(ZV-(2-cyclohexylethyl) sulfamoyl)-2-nitrophenyI) thio) benzoate (530): To a stirred solution of compound 529 (200 mg, 0.57 mmol) in DMF (4 mL) under inert atmosphère was added césium carbonate (281 mg, 0.86 mmol) at RT; heated to 40 C, then added methyl thio salicylate (106 mg, 0.63 mmol) and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted

318 with EtOAc (2 x 30 mL). The combined organic extracts were washed with water (20 mL), dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 20% EtOAc/ hexanes to afford compound 530 (210 mg, 76%) as yellow syrup. TLC: 30% EtOAc/ hexanes (Rf. 0.4); ’H-NMR (CDC1₃, 400 MHz): δ 8.67 (s, 1H), 7.99-7.97 (m, 1H), 7.73 (d, J= 8.4 Hz, 1H), 7.65-7.59 (m, 3H), 6.97 (d, J= 8.8 Hz, 1H), 4.44 (t, J= 6.0 Hz, 1H), 3.81 (s, 3H), 3.03-2.98 (m, 2H), 1.67-1.58 (m, 5H), 1.42-1.33 (m, 3H), 1.29-1.09 (m, 3H), 0.91-0.87 (m, 2H).

Synthesis of methyl 2-((2-ainino-4-(A-(2-cyclohexylethyl) sulfamoyl) phenyl) thio) benzoate (531): To a stirred solution of compound 530 (200 mg, 0.41 mmol) in MeOH (10 mL) under inert atmosphère was added 10% Pd/ C (60 mg) at RT and stirred under hydrogen atmosphère (balloon pressure) for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite and the fîltrate was concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 10% EtOAc/ Hexanes to afford compound 531 (120 mg, 64%) as an off-white solid. TLC: 30% EtOAc/ Hexanes (Rf. 0.3); *H-NMR (CDC1₃, 400 MHz): δ 8.03 (d, J= 7.6 Hz, 1H), 7.59 (d, J= 8.4 Hz, 1H), 7.307.29 (m, 2H), 7.21-7.16 (m, 2H), 6.71 (d, J= 8.0 Hz, 1H), 4.36 (br s, 1H), 3.97 (s, 3H), 3.04 (t, J=

6.4 Hz, 2H), 1.68-1.61 (m, 5H), 1.39-1.35 (m, 2H), 1.29-1.13 (m, 4H), 0.90-0.84 (m, 2H).

Synthesis of 2-((2-amino-4-(ZV-(2-cycIohexylethyl) sulfamoyl) phenyl) thio) benzoic acid (532): To a stirred solution of compound 531 (110 mg, 0.24 mmol) in THF: H₂O (2: 1,6 mL) was added lithium hydroxide monohydrate (20 mg, 0.49 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (15 mL), acidified with dil. HCl. The obtained precipitate was filtered, washed with ether (2x5 mL) and dried in vacuo to afford compound 532 (85 mg, 80%) as white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.2); ’H-NMR (DMSO-î/ô, 400 MHz): δ 13.19 (br s, 1H), 7.94 (d, J= 7.6 Hz, 1H), 7.50-7.47 (m, 2H), 7.34 (t, J= 7.2 Hz, 1H), 7.24-7.18 (m, 2H), 6.94 (d, 8.0 Hz, 1H), 6.61 (d, J= 8.0 Hz, 1H), 5.82 (br s, 2H), 2.85-2.80 (m, 2H), 1.59-1.52 (m, 5H),

1.27-1.23 (m, 3H), 1.16-1.11 (m, 3H), 0.83-0.78 (m, 2H).

Synthesis of/V-(2-cyclohexyIethyl)-ll-oxo-10,11-dihydrodibenzo [A,./] [1,4] thiazepine-8sulfonamide (1228): To a stirred solution of compound 532 (80 mg, 0.18 mmol) in THF (5 mL) under inert atmosphère was added CDI (89 mg, 0.55 mmol) at 0 C; warmed to RT and stirred for 16

319

h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (20 mL), acidified with dil.HCl. The obtained precipitate was filtered, washed with ether (2x5 mL) and dried in vacuo to afford 1228 (35 mg, 46%) as white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.6); ’H-NMR (DMSO-^, 400 MHz): δ 10.89 (s, 1H), 7.77 (d, J= 8.0 Hz, 1H), 7.71-7.69 (m, 1H), 7.64-7.62 (m, 2H), 7.56-7.45 (m, 4H), 2.782.73 (m, 2H), 1.48-1.42 (m, 5H), 1.19-1.07 (m, 6H), 0.71-0.66 (m, 2H); LC-MS: 98.00%; 417.6 (M⁺+l); (column; X-Select CSH C-18, (50 x 3.0 mm, 3.5 pm); RT 4.76 min. 0.05% TFA (Aq) : ACN; 0.8 mL/min); UPLC (purity): 95.34%; (column : Acquity BEH C-18 (50 x 2.1 mm, 1.7 μ); RT 2.74 min. ACN : 0.025% TFA (Aq.); 0.5 mL/min).

Example 47: Synthesis of Compound 1289

Synthesis of 4-chloro-3-nitro-7V-phenethyIbenzenesulfonamide (533): To a stirred solution of 2phenylethan-1-amine 211 (250 mg, 2.06 mmol) in CH₂C1₂ (5 mL) under inert atmosphère were added 4-chloro-3-nitrobenzenesulfonyl chloride 528 (528 mg, 2.06 mmol), pyridine (0.5 mL) at 0 15 °C; warmed to RT and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL) and extracted with CH₂C1₂ (2 x 30 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 320

15% EtOAc/ hexanes to afford compound 533 (410 mg, 58%) as colorless syrup. TLC: 30% EtOAc/ hexanes (Rf. 0.6); ’H-NMR (CDC1_3j400 MHz): δ 8.21 (s, 1H), 7.85 (d, 8.4 Hz, 1H),

7.64 (d, J= 8.4 Hz, 1H), 7.27 (s, 1H), 7.25-7.22 (m, 2H), 7.08 (d, J= 8.0 Hz, 2H), 4.59 (t, J= 6.0 Hz, 1H), 3.32 (q, 2H), 2.81 (t, J= 6.8 Hz, 2H).

Synthesis of methyl 2-((2-nitro-4-(A^?-phenethylsulfamoyl) phenyl) thio) benzoate (534): To a stirred solution of compound 533 (100 mg, 0.29 mmol) in DMF (3 mL) under inert atmosphère were added methyl thio salicylate (54 mg, 0.32 mmol), césium carbonate (143 mg, 0.44 mmol) at RT; heated to 40 °C and stirred for 2 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (15 mL) and extracted with EtOAc (2 x 20 mL). The combined organic extracts were washed with water (20 mL), dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purifîed through silica gel column chromatography using 20% EtOAc/ hexanes to afford compound 534 (90 mg, 65%) as yellow solid. TLC: 30% EtOAc/ hexanes (Rf. 0.4);¹ H-NMR (CDC1₃, 400 MHz): δ 8.56 (s, 1H), 7.98 (t, J= 6.8 Hz, 1H), 7.64-7.60 (m, 4H), 7.23-7.20 (m, 3H), 7.07 (d, 8.4 Hz, 2H), 6.91 (d, J=

8.4 Hz, 1H), 4.50 (t, 6.0 Hz, 1H), 3.80 (s, 3H), 3.28 (q, 2H), 2.79 (t, J= 6.8 Hz, 2H).

Synthesis of methyl 2-((2-amino-4-(7V-phenethylsulfamoyl) phenyl) thio) benzoate (535): To a stirred solution of compound 534 (330 mg, 0.69 mmol) in MeOH (15 mL) under inert atmosphère was added 10% Pd/ C (100 mg) at RT and stirred under hydrogen atmosphère (balloon pressure) for 12 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was filtered through celite, washed with CH2CI2 (2x5 mL) and the filtrate was concentrated in vacuo to obtain the crude. The crude was purifîed through silica gel column chromatography using 15% EtOAc/ hexanes to afford compound 535 (210 mg, 68%) as an off-white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.3); *H-NMR (CDC1₃, 400 MHz): δ 8.03 (d, J= 8.0 Hz, 1H), 7.56 (d, J= 8.0 Hz, 1H), 7.28 (d, J= 8.0 Hz, 3H), 7.25-7.23 (m, 1H), 7.19-7.11 (m, 5H), 6.69 (d, J= 8.0 Hz, 1H), 4.37 (t, J=

6.4 Hz, 1H), 4.12 (q, 1H), 3.97 (s, 3H), 3.31 (q, 2H), 2.81 (t, J= 6.8 Hz, 2H), 2.04 (s, 1H).

Synthesis of 2-((2-amino-4-(/V-phenethylsulfamoyl) phenyl) thio) benzoic acid (536): To a stirred solution of compound 535 (200 mg, 0.45 mmol) in THF: H2O (2: 1,6 mL) was added lithium hydroxide monohydrate (38 mg, 0.90 mmol) at RT and stirred for 16 h; heated to 40 C and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (15 mL), acidified with dil. HCl. The

321 obtained precipitate was filtered, washed with ether (2x5 mL) and dried in vacuo to afford compound 536 (130 mg, 67%) as white solid. TLC: 40% EtOAc/ hexanes (Rf. 0.2); ’H-NMR (DMSO-î/₆, 400 MHz): δ 7.93 (d, J= 7.6 Hz, 1H), 7.68 (t, J= 6.0 Hz, 1H), 7.47 (d, J= 8.0 Hz, 1H), 7.32-7.25 (m, 4H), 7.21-7.16 (m, 4H), 6.95 (d, J= 8.0 Hz, 1H), 6.60 (d, J= 8.4 Hz, 1H), 5.81 (br s,

2H), 3.03 (q, 2H), 2.70 (t, J= 8.0 Hz, 2H).

Synthesis of ll-oxo-A-phenethyl-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8-sulfonamide (1289): To a stirred solution of compound 536 (100 mg, 0.23 mmol) in THF (5 mL) under inert atmosphère was added CDI (113 mg, 0.70 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (20 mL), acidified with IN HCl. The obtained precipitate was filtered, washed with ether (2x5 mL) and dried in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 3-5% MeOH/ CH2CI2 to afford 1289 (35 mg, 37%) as white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.6); ’H-NMR (DMSO-d_tf, 400 MHz): δ 10.86 (s, 1H), 7.81 (br s, 1H), 7.73 (d, J= 8.0 Hz, 2H), 7.71 (s, 1H), 7.59-7.45 (m, 4H), 7.18-7.14 (m, 2H), 7.11-7.07 (m, 3H), 2.97 (q, 2H), 2.64 (t, J= 7.6 Hz, 2H); LC-MS: 97.83%; 411.5 (M*+l);

(column; X-Select CSH C-18, (50 x 3.0 mm, 3.5 pm); RT 4.33 min. 0.05% TFA (Aq): ACN; 0.8 mL/min); UPLC (purity): 98.00%; (column: Acquity BEH C-18 (50 x 2.1 mm, 1.7 μ); RT 2.43 min. ACN: 0.025% TFA (Aq); 0.5 mL/min).

322

Example 48: Synthesis of Compounds 1277 and 1282

Synthesis of 3-(methoxycarbonyl)-ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8carboxylic acid (537): To a stirred solution of dimethyl 2-((2-amino-4-(tert-butoxycarbonyl) phenyl) thio) terephthalate 130 (200 mg, 0.47 mmol) in 1, 2-dichloro ethane (10 mL) under inert atmosphère was added trifluoro acetic acid (1.09 g, 9.59 mmol) at RT; heated to 80 °C and stirred for 24 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 6% MeOH/ CH2CI2 to afford compound 537 (60 mg, 38%) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.3); ’H-NMR (DMSO-d₆, 400 MHz): δ 13.17 (br s, 1H), 10.99 (s, 1H), 8.02 (s, 1H), 7.97 (d, J= 8.0 Hz, 1H), 7.82 (d, J= 8.0 Hz, 1H), 7.79 (s, 1H), 7.70-7.65 (m, 2H), 3.86 (s, 3H).

Synthesis of methyl 8-((2-cyclohexyIethyl) carbamoyl)-ll-oxo-10,11-dihydrodibenzo \b,f\ [1,

4] thiazepine-3-carboxylate (538): To a stirred solution of compound 537 (60 mg, 0.18 mmol) in

DMF (2.4 mL) under inert atmosphère were added 2-cyclohexylethan-l-amine 261 (28 mg, 0.21 mmol), HOBt (37 mg, 0.27 mmol), EDCI. HCl (52 mg, 0.27 mmol), diisopropyl ethyl amine (0.08 mL, 0.36 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (20 mL). The obtained solid was filtered 323 and dried in vacuo to afford compound 538 (45 mg, 56%) as an off-white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.6); ’H-NMR (DMSO-X 400 MHz): δ 10.94 (s, 1H), 8.46-8.45 (m, 1H), 8.02 (s, 1H), 7.97 (d, 7= 8.0 Hz, 1H), 7.81 (d, 7= 8.0 Hz, 1H), 7.68 (d, 7= 7.6 Hz, 2H), 7.57 (d, 7= 8.4 Hz, 1H), 3.87 (s, 3H), 3.26-3.21 (m, 2H), 1.70-1.62 (m, 5H), 1.40-1.35 (m, 2H), 1.26-1.09 (m, 4H), 0.91-0.83 (m,2H).

Synthesis of 8-((2-cyclohexylethyI) carbamoyl)-ll-oxo-10,11-dihydrodibenzo {b,f\ [1, 4] thiazepine-3-carboxylic acid (1282): To a stirred solution of compound 538 (125 mg, 0.28 mmol) in THF: H₂O (4: 1, 5 mL) was added lithium hydroxide monohydrate (59.9 mg, 1.42 mmol) at RT and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude. The crude was diluted with water (20 mL), neutralized with HCl, the obtained solid was filtered and dried in vacuo to afford 1282 (90 mg, 74%) as white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.3); ’H-NMR (DMSO-7_tf, 400 MHz): δ 13.44 (br s, 1H), 10.92 (s, 1H), 8.45 (t, 7= 5.6 Hz, 1H), 8.00 (s, 1H), 7.95 (d, 7= 8.0 Hz, 1H), 7.79 (d, 7= 8.0 Hz, 1H), 7.68-7.66 (m, 2H), 7.58-7.56 (m, 1H), 3.26-3.21 (m, 2H), 1.70-1.58 (m, 5H), 1.40-1.35 (m, 2H), 1.30-1.22 (m, 4H), 0.91-0.83 (m, 2H). LC-MS: 99.29%; 425.9 (M*+l); (column; X-Select CSH C-18, (50 x 3.0 mm, 3.5 pm); RT 4.40 min. 0.05% TFA (Aq) : ACN; 0.8 mL/min); UPLC (purity): 98.94%; (column : Acquity BEH C-18 (50 x 2.1 mm, 1.7 p); RT 2.32 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

Synthesis of A^z8-(2-cyclohexylethyl)-A^-methyl-ll-oxo-10,11-dihydrodibenzo [b, J] [1,4] thiazepine-3, 8-dicarboxamide (1277): To a stirred solution of 1282 (30 mg, 0.07 mmol) in DMF (1.2 mL) under inert atmosphère were added methyl amine 306 (2 M in THF, 0.07 mL, 0.14 mmol), HATU (54.7 mg, 0.14 mmol), diisopropyl ethyl amine (0.05 mL, 0.28 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice water (10 mL). The obtained solid was filtered, washed with EtOAc (2x5 mL) and dried in vacuo to afford 1277 (11 mg, 35%) as white solid. TLC: 7% MeOH/ CH2C12 (Rf. 0.8); ¹H-NMR (DMSO-76, 400 MHz): δ 10.86 (s, 1H), 8.63-8.62 (m, 1H), 8.44 (t, 7= 5.2 Hz, 1H), 7.95 (s, 1H), 7.85 (d, 7= 8.0 Hz, 1H), 7.75 (d, 7= 8.4 Hz, 1H), 7.65 (d, 7= 8.4 Hz, 2H), 7.58-7.55 (m, 1H), 3.26-3.21 (m, 2H), 2.77 (s, 3H), 1.70-1.58 (m, 5H), 1.40-1.35 (m, 2H), 1.26-1.14 (m, 4H), 0.91-0.83 (m, 2H); LC-MS: 94.12%; 438.8 (MM); (column; X-Select CSH C18, (50 x 3.0 mm, 3.5 pm); RT 4.05 min. 0.05% TFA (Aq) : ACN; 0.8 mL/min); UPLC (purity):

324

98.69%; (column : Acquity BEH C-18 (50 x 2.1 mm, 1.7 μ); RT 2.28 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

Example 49: Synthesis of Compound 1278

Synthesis of7V⁸-(2-cyclohexylethyl)-7V³,7V³-dimethyl-ll-oxo-10,11-dihydrodibenzo \b,j\ [1, 4] thiazepine-3, 8-dicarboxamide (1278): To a stirred solution of 1282 (40 mg, 0.09 mmol) in DMF (2 mL) under inert atmosphère were added dimethylamine hydrochloride (23 mg, 0.28 mmol), HATU (73 mg, 0.18 mmol), diisopropyl ethyl amine (0.09 mL, 0.47 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (15 mL). The obtained solid was filtered, triturated with EtOAc (2x5 mL) and dried in vacuo to afford 1278 (19 mg, 48%) as an off-white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.6); 'H-NMR (DMSO-4, 400 MHz): δ 10.84 (s, 1H), 8.44 (t, 7= 5.2 Hz, 1H), 7.72 (d, 7= 8.0 Hz, 1H), 7.67-7.63 (m, 2H), 7.58-7.47 (m, 2H), 7.45 (d, 7= 8.0 Hz, 1H), 3.27-3.22 (m, 2H), 2.96 (s, 3H), 2.88 (s, 3H), 1.70-1.58 (m, 5H), 1.41-1.35 (m, 2H), 1.28-1.26 (m, 1H), 1.2515 1.14 (m, 3H), 0.91-0.83 (m, 2H); LC-MS: 98.41%; 452.7 (MM); (column; X-Select CSH C-18, (50 x 3.0 mm, 3.5 pm); RT 4.11 min. 0.05% TFA (Aq) : ACN; 0.8 mL/min); UPLC (purity): 99.60%; (column : Acquity BEH C-18 (50 x 2.1 mm, 1.7 p); RT 2.33 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

325

Example 50: Synthesis of Compounds 1280 and 1281

Synthesis of methyl ll-oxo-8-(phenethylcarbamoyl)-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-3-carboxylate (539): To a stirred solution of compound 537 (75 mg, 0.22 mmol) in

DMF (3 mL) under inert atmosphère were added 2-phenylethan-l -amine 211 (30 mg, 0.25 mmol), HOBt (46 mg, 0.34 mmol), EDCI. HCl (65 mg, 0.34 mmol), diisopropyl ethyl amine (0.08 mL, 0.45 mmol) at 0 °C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice water (20 mL). The obtained solid was filtered, washed with 20% EtOAc/ Hexanes (2x5 mL) and dried in vacuo to afford compound 539 (80 mg, 81%) as white solid. TLC: 7% MeOH/ CH2CI2 (Rf. 0.8); ’H-NMR (DMSOd₆, 400 MHz): δ 10.96 (s, 1H), 8.61 (t, J= 5.6 Hz, 1H), 8.02 (s, 1H), 7.97 (d, J= 8.0 Hz, 1H), 7.82 (d, J= 8.4 Hz, 1H), 7.68 (d, J= 8.0 Hz, 2H), 7.57-7.54 (m, 1H), 7.29-7.25 (m, 2H), 7.22-7.16 (m, 3H), 3.87 (s, 3H), 3.47-3.42 (m, 2H), 2.80 (t, J= 7.2 Hz, 2H).

Synthesis of ll-oxo-8-(phenethylcarbamoyl)-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-315 carboxylic acid (540): To a stirred solution of compound 539 (80 mg, 0.18 mmol) in THF: H2O (4: 1, 3 mL) was added lithium hydroxide monohydrate (39 mg, 0.92 mmol) at RT and stirred for 5 h.

The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (15 mL), acidified with HCl, the obtained solid was

326 filtered, washed with 20% EtOAc/ hexanes (2x5 mL) and dried in vacuo to afford compound 540 (65 mg, 84%) as white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.2); ’H-NMR (DMSO-J_tf, 400 MHz): δ 13.44 (br s, 1H), 10.94 (s, 1H), 8.62 (t, J= 5.6 Hz, 1H), 8.00 (s, 1H), 7.95 (d, J= 8.0 Hz, 1H), 7.79 (d, J= 8.0 Hz, 1H), 7.68 (d, J= 8.0 Hz, 2H), 7.57-7.54 (m, 1H), 7.29-7.25 (m, 2H), 7.227.16 (m, 3H), 3.47-3.42 (m, 2H), 2.80 (t, J= 7.2 Hz, 2H).

Synthesis of A^-inethyl-ll-oxo-A^-phenethyl-lO, 11-dihydrodibenzo \b,f\ [1, 4] thiazepine-3, 8dicarboxamide (1280): To a stirred solution of compound 540 (35 mg, 0.08 mmol) in DMF (2 mL) under inert atmosphère were added methyl amine (2 M in THF, 0.24 mL, 0.50 mmol), HATU (130 mg, 0.32 mmol), diisopropyl ethyl amine (0.10 mL, 0.50 mmol) at 0 °C; warmed to RT and stirred for 44 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with ice water (15 mL). The obtained solid was filtered, washed with EtOAc (2x5 mL) and dried in vacuo to afford 1280 (12 mg, 28%) as white solid. TLC: 10% MeOH/ CH₂C1₂ (Rf. 0.4); ’H-NMR (DMSO-î/_s, 400 MHz): δ 10.89 (s, 1H), 8.63-8.60 (m, 2H), 7.96 (s, 1H), 7.85 (d, J= 8.0 Hz, 1H), 7.76 (d, J= 8.0 Hz, 1H), 7.66-7.65 (m, 2H), 7.56-7.54 (m, 1H), 7.29-7.26 (m, 2H), 7.227.16 (m, 3H), 3.47-3.42 (m, 2H), 2.88-2.73 (m, 5H); LC-MS: 95.22%; 432.6 (M⁺+l); (column; XSelect CSH C-18, (50 x 3.0 mm, 3.5 pm); RT 3.61 min. 0.05% TFA (Aq) : ACN; 0.8 mL/min); UPLC (purity): 94.66%; (column : Acquity BEH C-18 (50 x 2.1 mm, 1.7 pm); RT 1.97 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

Synthesis of N³, A^-diniethyl-l l-oxo-'X-phenethyl-lO, 11-dihydrodibenzo \b,f\ [1, 4] thiazepine-3, 8-dicarboxamide (1281): To a stirred solution of 540 (30 mg, 0.07 mmol) in DMF (2 mL) under inert atmosphère were added dimethyl amine hydrochloride 310 (17.5 mg, 0.21 mmol), HATU (55.5 mg, 0.14 mmol), diisopropyl ethyl amine (0.07 mL, 0.35 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (10 mL). The obtained solid was filtered, washed with EtOAc (2x5 mL) and dried in vacuo to afford 1281 (17 mg, 53%) as an off-white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.6); *H-NMR (DMSO-^, 400 MHz): δ 10.86 (s, 1H), 8.61 (t, 5.2 Hz, 1H),

7.72 (d, J= 8.0 Hz, 1H), 7.67-7.64 (m, 2H), 7.57-7.53 (m, 2H), 7.46 (d, J= 8.0 Hz, 1H), 7.29-7.26 (m, 2H), 7.20-7.16 (m, 3H), 3.48-3.43 (m, 2H), 2.96 (s, 3H), 2.86 (s, 3H), 2.82-2.79 (m, 2H); LCMS: 97.11%; 446.7 (M⁺+l); (column; X-Select CSH C-18, (50 x 3.0 mm, 3.5 pm); RT 3.68 min.

327

0.05% TFA (Aq) : ACN; 0.8 mL/min); UPLC (purity): 98.02%; (column : Acquity BEH C-18 (50 x 2.1 mm, 1.7 μ); RT 2.03 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

Example 51: Synthesis of Compounds 1225 and 1224

Synthesis of phenyl (ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepin-8-yl) carbamate (542):

To a stirred solution of compound 145 (40 mg, 0.16 mmol) in CH2CI2 (3 mL) under inert atmosphère were added diisopropyl ethyl amine (0.06 mL, 0.33 mmol), phenyl carbonochloridate 541 (28 mg, 0.18 mmol) at 0 °C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (15 mL) and extracted with CH2CI2 (2 x 25 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was triturated with 15% EtOAc/ hexanes to afford compound 542 (50 mg, 83%) as an off-white solid. TLC: 70% EtOAc/ Hexanes (Rf. 0.8); 'H-NMR (DMSO-4, 400 MHz): δ 10.73 (s, 1H), 10.45 (s, 1H), 7.68-7.65 (m, 1H), 7.527.40 (m, 7H), 7.28-7.24 (m, 2H), 7.21 (d, J = 7.6 Hz, 2H).

Synthesis of l-(2-cycIohexylethyI)-3-(ll-oxo-10,11-dihydrodibenzo \b,f\ [1,4] thiazepin-8-yl) urea (1225): To a stirred solution of compound 542 (50 mg, 0.13 mmol) in DMSO (3 mL) under inert atmosphère were added 2-cyclohexylethan-l-amine 161 (21 mg, 0.16 mmol), triethyl amine (0.04 mL, 0.27 mmol) at 0 °C; warmed to RT and stirred for 5 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (15 mL). The obtained solid was filtered, washed with EtOAc (2x5 mL) and dried in vacuo to afford 1225 (17

328 mg, 31%) as white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.5); ’H-NMR (DMSO-rf₆, 500 MHz): δ 10.58 (s, 1H), 8.58 (s, 1H), 7.64 (d, J= 7.5 Hz, 1H), 7.48-7.40 (m, 3H), 7.34 (d, J= 7.5 Hz, 2H), 7.13-7.11 (m, 1H), 6.10-6.07 (m, 1H), 3.08-3.04 (m, 2H), 1.67-1.57 (m, 5H), 1.31-1.11 (m, 6H), 0.86-0.84 (m, 2H); LC-MS: 95.28%; 396.4 (M^+l); (column; X-Bridge C-18, (50 x 3.0 mm, 3.5 pm); RT 3.76 min. 0.05% TFA (Aq) : ACN; 0.8 mL/min); UPLC (purity): 96.65%; (column : Acquity UPLC BEH C-18 (2.1 x 50 mm, 1.7 p); RT 2.65 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

In a similar manner 1224 (l-(ll-oxo-10,ll-dihydrodibenzo[b,f][l,4]thiazepin-8-yl)-3phenethylurea) was prepared. Yield: 27% LC-MS: 390.3 (M^+l); *H-NMR (DMSO-ifo 400

MHz): δ 10.59 (s, 1H), 8.69 (s, 1H), 7.65 (d, J= 7.2 Hz, 1H), 7.49-7.41 (m, 3H), 7.35 (d, J= 7.6 Hz,

2H), 7.29 (d, J= 7.2 Hz, 2H), 7.22-7.13 (m, 4H), 6.14 (t, J= 6.0 Hz, 1H), 3.30 (s, 2H), 2.73 (t, J= 6.8 Hz, 2H).

Example 52: Synthesis of Compounds 1535 and 1536

The racemic compound of 1388 (18 mg) was separated using a CHIRALPAK-IC column (250 x 20 mm x 5 pm) (10 mg loading; 0.1% DEA in n-hexane: CH₂C1₂: MeOH (50: 50) (A: B = 25: 75) as mobile phase) HPLC to afford 1535 (2.5 mg) and 1536 (2.5 mg) as off-white solids.

Compound 1535 analytical data (Fr-I):

LC-MS: 99.81%; 383.9 (M⁺+l); (column; Ascentis Express C-18, (50 x 3.0 mm, 2.7 pm); RT 1.69 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min). UPLC (purity):

329

96.76%; (column; Acquity UPLC BEH C-18 (50 x 2.1 mm, 1.7 μ); RT 1.49 min. ACN: 0.025% TFA (Aq); 0.5 mL/min). Chiral HPLC: 99.16%, R_t= 99.16 min (Chiralpak-IC, 250 x 4.6 mm, 5 pm); mobile phase (A) 0.1% DEA in n-Hexane (B) CH2CI2: MeOH (50: 50) (A: B:: 25: 75); Flow Rate: 1.0 mL/min).

Compound 1536 analytical data (Fr-II):

LC-MS: 99.39%; 383.9 (MU-l); (column; Ascentis Express C-18, (50 x 3.0 mm, 2.7 pm); RT 1.70 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min). UPLC (purity): 99.56%; (column; Acquity UPLC BEH C-18 (50 x 2.1 mm, 1.7 μ); RT 1.49 min. ACN: 0.025% TFA (Aq); 0.5 mL/min). Chiral HPLC: 98.30%, R_t= 13.33 min (Chiralpak-IC, 250 x 4.6 mm, 5 pm); mobile phase (A) 0.1% DEA in n-Hexane (B) CH₂C1₂: MeOH (50: 50) (A: B:: 25: 75); Flow Rate: 1.0 mL/min).

Example 53: Synthesis of Compound 1206

Synthesis of A-(2-cyclohexylethyl)-ll-oxo-10,11-dihydrodibenzo [b,f\ [1,4] thiazepine-8carboxamide (545): To a stirred solution of 6 (100 mg, 0.36 mmol) in DMF (6 mL) under argon atmosphère were added EDCI.HCI (105 mg, 0.54 mmol), HOBt (74 mg, 0.54 mmol), 2cyclohexylethan-1-amine 261 (56 mg, 0.44 mmol), and diisopropyl ethyl amine (95 mg, 0.73 mmol) at 0-5 °C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo. The residue was diluted with water (20 mL), filtered and washed with water (2x5 mL) to obtain the crude. The crude was triturated with EtOAc (2x5 mL) to afford 545 (70 mg, 50%) as white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.5); 'H-NMR (DMSO-îZî, 400 MHz): δ 10.75 (s, 1H), 8.43 (t, J= 5.6 Hz, 1H), 7.69-7.62 (m, 3H), 7.56-7.43 (m,

330

4H), 3.26-3.21 (m, 2H), 1.70-1.58 (m, 5H), 1.40-1.35 (m, 2H), 1.28-1.09 (m, 4H), 0.91-0.83 (m, 2H).

Synthesis of 2V-(2-cyclohexyIethyl)-ll-oxo-10,11-dihydrodibenzo [b,f\ [1,4] thiazepine-8carboxamide 5, 5-dioxide (1206): To a stirred solution of 545 (40 mg, 0.10 mmol) in chloroform (20 mL) under inert atmosphère was added m-chloro perbenzoic acid (36.3 mg, 0.21 mmol) at RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with saturated sodium bicarbonate solution (15 mL) and extracted with CH2CI2 (2 x 20 mL). The combined organic extracts were washed with water (20 mL), dried over sodium sulfate, fîltered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 30% EtOAc/ hexanes to afford 1206 (16 mg, 37%) as white solid. TLC: 5% MeOH/ CH₂C1₂ (Rf. 0.4); ’ïï-NMR (DMSO-rf_tf, 400 MHz): δ 11.49 (s, 1H), 8.63 (t, J= 4.8 Hz, 1H), 8.04-7.96 (m, 3H), 7.91-7.83 (m, 2H), 7.77 (t, J= 6.4 Hz, 2H), 3.253.24 (m, 2H), 1.71-1.58 (m, 5H), 1.42-1.37 (m, 2H), 1.28-1.14 (m, 4H), 0.92-0.84 (m, 2H); LC-MS: 97.31%; 413.2 (MAI); (column; X-bridge C-18, (50 x 3.0 mm, 3.5 pm); RT 3.78 min. 0.05% TFA in water: ACN; 0.8 mL/min); UPLC (purity): 96.73%; (column : Acquity UPLC BEH C-18 (2.1 x 50 mm, 1.7 p); RT 2.52 min. ACN : 0.025% TFA (Aq); 0.5 mL/min).

331

Example 54: Synthesis of Compound 1656

Synthesis of tert-butyl (4-bromophenethyl) carbamate (547): To a stirred solution of 2-(4bromophenyl) ethan-l-amine 546 (500 mg, 2.50 mmol) in CH2CI2 (5 mL) under argon atmosphère were added Boc-anhydride (594 mg, 2.75 mmol), diisopropyl ethyl amine (1 mL, 7.50 mmol) at RT and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (25 mL) and extracted with CH2CI2 (2x35 mL). The combined organic extracts were washed with water (25 mL), dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude was purified through silica gel column chromatography using 5-8% EtOAc/ hexanes to afford compound 547 (500 mg, 65%) as white solid. TLC: 10% EtOAc/ hexanes (Rf. 0.5); ’H-NMR (DMSO-7₆, 400 MHz): δ 7.46 (d, J= 8.0 Hz, 2H), 7.12 (d, J= 8.0 Hz, 2H), 6.86-6.82 (m, 1H), 3.12-3.08 (m, 2H), 2.68-2.64 (m, 2H), 1.32 (s, 9H).

Synthesis of terAbutyl (4-((trimethylsilyl) ethynyl) phenethyl) carbamate (548): To a stirred solution of compound 547 (500 mg, 1.66 mmol) in DMF (10 mL) under argon atmosphère were

332 added ethynyltrimethylsilane (1.8 mL, 16.66 mmol), triethyl amine (2.32 mL, 16.66 mmol) and purged under argon for 15 min. To this were added Pd(PPh3)2C12 (118 mg, 0.16 mmol), copper iodide (33 mg, 0.16 mmol) and purged under argon for 15 min; heated to 70 C and stirred for 48 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude which was purified through silica gel column chromatography using 10% EtOAc/ hexanes to afford compound 548 (500 mg, 95%) as brown syrup. TLC: 10% EtOAc/ hexanes (Rf. 0.6); ¹ H-NMR (DMSO-d₆,400 MHz): δ 7.38 (d, J= 8.0 Hz, 2H), 7.18 (d, J= 8.0 Hz, 2H), 6.85 (t, 7= 7.2 Hz, 1H), 3.16-3.11 (m, 2H), 2.70-2.66 (m, 2H), 1.34 (s, 9H), 0.23 (s, 9H).

Synthesis of tert-butyl (4-ethynylphenethyl) carbamate (549): To a stirred solution of compound 548 (500 mg, 1.70 mmol) in THF (5 mL) under argon atmosphère was added TBAF (2.08 mL, 2.08 mmol) in THF (3 mL) at RT and stirred for 4 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude which was purified through silica gel column chromatography using 5-10% EtOAc/ hexanes to afford compound 549 (450 mg, 95%) as brown syrup. TLC: 10% EtOAc/ hexanes (Rf. 0.4); ¹H-NMR (DMSO-di, 500 MHz): δ 7.39 (d, J= 7.5 Hz, 2H), 7.20 (d, J= 7.5 Hz, 2H), 6.87-6.85 (m, 1H), 4.10 (s, 1H), 3.15-3.12 (m, 2H), 2.71-2.69 (m, 2H), 1.30 (s, 9H).

Synthesis of tert-butyl (4-(l-benzyl-17/-l, 2, 3-triazol-5-yl) phenethyl) carbamate (551): To a stirred solution of compound 549 (200 mg, 0.82 mmol) in MeOH: DMF (1: 1, 20 mL) under argon atmosphère were added (azidomethyl) benzene 550 (410 mg, 3.06 mmol), copper iodide (202 mg, 1.02 mmol) at RT; heated to reflux and stirred for 18 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude which was purified through silica gel column chromatography using 30% EtOAc/ hexanes to afford compound 551 (200 mg, 68%) as white solid. TLC: 30% EtOAc/ hexanes (Rf. 0.3); *H-NMR (DMSO-4 500 MHz): δ 8.59 (s, 1H), 7.75 (d, J= 8.5 Hz, 2H), 7.41-7.34 (m, 5H), 7.25 (d, J= 8.0 Hz, 2H), 6.906.88 (m, 1H), 5.64 (s, 2H), 3.17-3.13 (m, 2H), 2.70 (t, J= 7.5 Hz, 2H), 1.36 (s, 9H).

Synthesis of 2-(4-(l-benzyl-LH^r-l, 2, 3-triazol-5-yl) phenyl) ethan-l-amine (552): To a stirred solution of compound 551 (190 mg, 0.50 mmol) in CH₂C1₂ (4 mL) under argon atmosphère was added trifluoro acetic acid (1 mL) at RT and stirred for 3 h. The reaction was monitored by TLC; after completion of the reaction, the volatiles were removed in vacuo to obtain the crude to obtain compound 552 (180 mg, crude) as dark brown syrup which was carried to the next step without any 333 purification. TLC: 100% EtOAc (Rf. 0.2); ’H-NMR (DMSO-î/₆, 400 MHz): δ 8.61 (s, 1H), 7.81 (d, J= 8.0 Hz, 2H), 7.78-7.76 (m, 3H), 7.39-7.32 (m, 6H), 5.64 (s, 2H), 3.09-3.04 (m, 2H), 2.87 (t, J= 7.6 Hz, 2H).

Synthesis of 7V-(4-(l-benzyl-LH^r-l, 2,3-triazol-5-yl) phenethyl)-ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8-carboxamide 5, 5-dioxide (553): To a stirred solution compound 552 (200 mg, 0.66 mmol) in DMF (10 mL) under argon atmosphère were added EDCI. HCl (189 mg, 0.98 mmol), HOBt (189 mg, 0.98 mmol), compound 6 (297 mg, 0.79 mmol), diisopropyl ethyl amine (0.35 mL, 1.98 mmol) at 0 C; warmed to RT and stirred for 16 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with EtOAc (2 x 50 mL) washed with water (50 mL), brine, dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude compound was purified through column chromatography using 2% MeOH/ CH2CI2 to afford compound 553 (180 mg, 49%) as an off-white solid. TLC: 5% MeOH/ CH2CI2 (Rf 0.5); *H NMR (DMSO-^400 MHz): δ 11.46 (br s, 1H), 8.80 (t, J= 5.5 Hz, 1H), 8.56 (s, 1H), 8.03 (d, J= 8.3 Hz, 1H), 8.00-7.95 (m, 2H), 7.92-7.83 (m, 2H), 7.79 (s, 1H), 7.75 (d, J= 8.2 Hz, 3H), 7.42-7.31 (m, 5H), 7.29 (d, J= 8.3 Hz, 2H), 5.63 (s, 2H), 3.50 (q, J= 6.8 Hz, 2H), 2.85 (t, J= 7.2 Hz, 2H).

Synthesis of 2ν-(4-(1Η-1, 2, 3-triazol-5-yl) phenethyl)-ll-oxo-10,11-dihydrodibenzo \b,f\ [1, 4] thiazepine-8-carboxamide 5, 5-dioxide (1656): To a stirred solution of compound 553 (180 mg, 0.31 mmol) in DMSO (10 mL) under argon atmosphère was added potassium tertiary butoxide (1 M in THF, 2.5 mL, 2.55 mmol) at RT. The reaction mixture was stirred under oxygen atmosphère (balloon pressure) for 24 h. The reaction was monitored by TLC; after completion of the reaction, the reaction mixture was diluted with water (5 mL) and extracted with EtOAc (3 x 50 mL). The combined organic extracts were dried over sodium sulfate, filtered and concentrated in vacuo to obtain the crude. The crude compound was purified through column chromatography using 2% MeOH/ CH2CI2, lyophilized and washed EtOAc (5 mL), filtered, washed with n-pentane (5 mL)and dried in vacuo to afford 1656 (20 mg, 13%) as white solid. TLC: 5% MeOH/ CH2CI2 (Rf. 0.3); ^XH NMR (DMSO-Jî, 400 MHz): δ 14.91 (br s, 1H), 11.52 (br s, 1H), 8.81 (t, J= 5.5 Hz, 1H), 8.21 (br s, 1H), 8.04 (d, J= 8.3 Hz, 1H), 8.01-7.95 (m, 2H), 7.92-7.85 (m, 2H), 7.82-7.73 (m, 4H), 7.31 (d, J = 7.9 Hz, 2H), 3.51 (q, J= 6.6 Hz, 2H), 2.86 (t, J= 7.1 Hz, 2H); LC-MS: 96.04%; 473.9 QVf+l); (column; Ascentis Express C-18, (50 x 3.0 mm, 2.7 pm); RT 2.01 min. 0.025% Aq. TFA + 5%

334

ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min). HPLC (purity): 95.54%; (column; Zorbax SB C-18 (150 x 4.6 mm, 3.5 pm); RT 7.59 min. ACN: 0.05% TFA (Aq); 1.0 mL/min).

Example 55: Synthesis of compounds from compound 575 using various commercially available amines

Readily available acids similar to 575, 576 and 577 were converted to the desired compounds using commercially available amines employing Procedures A and B and the results are captured in Tables 5 and 6.

Carbon bridged compounds:

Table 5: Synthesis of compounds from compound 575 using various commercially available amines

• f/·· / •V A'	• Structure	Procedure, Intermediate, Amine	Rx. Yield '(%)	Mass Spec. . Found ·	Mass Spec.: Calculatèd - t	V Tl-NMR _t 1
1591		A, 575,218 (RT 12 h)	44	343.9 (M+l)	343.13 for C_2IH₁₇N₃O 2	‘H-NMR (DMSO-d_ft400 MHz): δ 9.27 (t, J= 5.7 Hz, 1H), 8.96 (s, 1H), 7.96 (s, 1H), 7.82 (s, 1H), 7.74-7.70 (m, 1H), 7.687.61 (m, 2H), 7.54-7.49 (m, 1H), 7.45-7.38 (m, 2H), 4.67 (t, 2= 5.4 Hz, 2H), 3.54 (s, 3H);
1198	0 λΑνΙΙ	A, 575	64	363.2 (MX1);		(DMSO-X 400 MHz): δ 10.51 (s, 1H), 8.30-8.29 (m, 1H), 7.70 (d, 2 = 8.0 Hz, 1H),

335

						7.56 (s, 1H), 7.51-7.46 (m, 2H), 7.41-7.31 (m, 3H), 3.94 (s, 2H), 3.23 (d, J= 6.4 Hz, 2H), 1.70-1.62 (m, 5H), 1.391.37 (m,2H), 1.26-1.14 (m, 4H), 0.91-0.86 (m,2H);
1576	0 /? (Μην, V	A, 575,212 (RT 12 h)	44	344.9 (M*+l)	344.13 for C20H16N4O 2	‘H-NMR (DMSO-î/î, 400 MHz): δ 10.52 (s, 1H), 9.10-9.01 (m, 2H), 8.74 (s, 2H), 7.70 (d,J = 7.5 Hz, 1H), 7.62 (s, 1H), 7.57 (d,J=7.9 Hz, 1H), 7.517.43 (m, 2H), 7.38 (d, J =7.3 Hz, 1H), 7.33 (t, J= 7.5 Ηζ,ΙΗ), 4.46 (d, J =5.5 Hz, 2H), 3.96 (s, 2H);
1577	0 < à N	A, 575,213	26	350.0 (M%1)	349.09 for Ci₉H₁₅N₃O ₂s	'H-NMR (DMSO-ίή,, 400 MHz): δ 10.52 (s, 1H), 9.10 (t, J= 5.8 Hz, 1H), 8.95 (s, lH),7.79(s, 1H), 7.70 (dd, J = 7.7,1.1 Hz, 1H), 7.61 (s, 1H), 7.54 (dd, J = 7.9,1.6 Hz, 1H), 7.48 (td, J = 8.8,1.8 Hz, 1H), 7.43 (d,J = 7.9 Hz, 1H), 7.38 (d, J =6.9 Hz, 1H), 7.33 (td, .7=7.6,1.6 Hz, 1H), 4.64 (d, J =5.7 Hz, 2H), 3.96 (s,

336

2H);

Oxygen-bridged compounds:

Table 6: Synthesis of compounds from compound 576 and various commercially available amines

No. t t	Structure	Procedure, Intermediate, Amine	Rx. Yield (%)	Mass Spec. Found.	Mass Spec. Calculated,	) ¹¹ ‘H-NMR '
1593	o _ NH P / !J\ _R N	B, 576, 213	38	351.9 (M⁺+l)	351.07 for c₁₈h₁₃n₃o₃ S	‘H-NMR (DMSO-7_d, 400 MHz): δ 10.63 (s, 1H), 9.17 (t, 7=5.8 Hz, 1H), 8.96 (s, 1H), 7.827.76 (m, 2H), 7.68 (s, 1H), 7.66-7.59 (m, 2H), 7.42 (d, J = 8.4 Hz, 1H), 7.38-7.31 (m, 2H), 4.65 (d, J = 5.6 Hz, 2H)
1594	0 NH o	A, 576,218	55	345.9 (MM)	345.11 for C₂₀H₁₅N₃O₃	‘H-NMR (DMSO-7_d, 400 MHz): δ 10.62 (s, 1H), 9.07 (t, 7=5.8 Hz, 1H), 8.53 (s, 1H), 8.45 (d, 7= 4.1 Hz, 1H), 7.78 (dd, J = 7.7,1.6 Hz, 1H), 7.72-7.60 (m, 4H), 7.43 (d, 7= 8.4 Hz, 1H), 7.39-7.31 (m, 3H), 4.47 (d,7=5.7 Hz, 2H)

337

346.9 (Μ*+1)

346.11 for

C19IL4N4O3

Ή-NMR (DMS0-7_d, 400 MHz): δ 10.62 (s, 1H), 9.13-9.05 (m, 2H), 8.75 (s, 2H), 7.78 (dd, J = 7.7,1.6 Hz, 1H), 7.68 (s, 1H), 7.66-7.60 (m, 2H), 7.43 (d, 7=8.4 Hz, 1H), 7.39-7.30 (m, 2H), 4.48 (d, 7= 5.6 Hz, 2H)

Nitrogen-bridged compounds:

Synthesis of ll-oxo-jV-(thiazol-5-ylmethyl)-10, ll-dihydro-SH-dibenzo {b, e] [1, 4] diazepine-85 carboxamide (1602): Using Procedure A the title compound was prepared using compound 577 (35 mg, 0.13 mmol) and thiazol-5-ylmethanamine hydrochloride 213 (20 mg, 0.13 mmol) and diisopropyl ethyl amine (0.05 mL, 0.27 mmol) and was obtained in 31% yield as an off-white solid; TLC: 5% MeOH/ CH₂C1₂ (Rf 0.5); ’H-NMR (DMSO-7_d, 400 MHz): δ 9.89 (s, 1H), 8.99-8.94 (m, 2H), 8.15 (s, 1H), 7.79 (s, 1H), 7.69 (dd, 7= 7.8, 1.3 Hz, 1H), 7.50 -7.42 (m, 2H), 7.38-7.32 (m,

1H), 7.00 (dd, 7= 10.9, 8.3 Hz, 2H), 6.91 (t, 7= 7.4 Hz, 1H), 4.63 (d, 7= 5.6 Hz, 2H); LC-MS:

93.15%; 351.0 (M^+l); column; Ascentis Express C18, (50 x 3.0 mm, 2.7 pm); RT 1.76 min. 0.025% Aq. TFA + 5% ACN: ACN + 5% 0.025% Aq. TFA, 1.2 mL/min); UPLC (purity): 93.21%; (column; Acquity BEH C-18 (50 x 2.1 mm, 1.7 p); RT 1.57 min. ACN: 0.025% TFA (Aq); 0.5 mL/min).

Example 56: Assay Measuring Activity of Compounds on Viral Production in and on Viability of AD38 Cells

338

AD38 cells grown in a 175 cm flask with “Growth Medium” (DMEM/F12 (1:1) (cat# SH30023.01, Hyclone, IX Pen/step (cat#: 30-002-CL, Mediatech, Inc), 10% FBS (cat#: 101, Tissue Culture Biologics), 250 pg/mL G418 (cat#: 30-234-CR, Mediatech, Inc), 1 pg/mL Tétracycline (cat#: T3325, Teknova)) were detached with 0.25% trypsin. Tetracycline-free “treatment medium” (15 mL DMEM/F12 (1:1) (cat# SH30023.01, Hyclone, lx Pen/step (cat#: 30-002-CL, Mediatech, Inc), with 2% FBS, Tet-system approved (cat#: 631106, Clontech) were then added to mix and spun at 1300 rpm for 5 min. Pelleted cells were then re-suspended/washed with 50 mL of IX PBS 2 times and 10 mL Treatment Medium one time. AD38 cells were then re-suspended with 10 mL of Treatment Medium and counted. Wells of a collagen coated 96-well NUNC microtiter plate were seeded at 50,000/well in 180 pL of Treatment Medium, and 20 pL of in treatment media with either 10% DMSO (Control) or a 10X solution of compound in 10% DMSO was added. Plates were incubated for 6 days at 37 °C.

Viral load production was assayed by quantitative PCR of the core sequence. Briefly, 5 pL of clarified supematant was added to a PCR reaction mixture that contained forward primers HBV-f 5'CTGTGCCTTGGGTGGCTTT-3', Reverse primers HBV-r 5’AAGGAAAGAAGTCAGAAGGCAAAA-3' and Fluorescent TaqMan™ Probes HBV-probe 5FAM/AGCTCCAAA/ZEN/TTCTTTATAAGGGTCGATGTCCATG/3IABkFQ -3' in Quanta Biosciences PerfeCTa® qPCR Toughmix®, and was subsequently on an Applied Biosystems VIIA7 in a final volume of 20 pL. The PCR mixture was incubated at 45 °C for 5 minutes, then 95 °C for 10 min, followed by 40 cycles of 10 seconds at 95 °C and 20 seconds at 60 °C. Viral load was quantitated against known standards by using ViiA™ 7 Software. Viral load in the supematant from wells with treated cells were compared against viral load in supematant from DMSO control wells (> 3 per plate).

At the end of compound treatment period cell viability was assessed using a Promega CellTiter-Glo protocol. Ail supematant was removed the previously treated 96-well microtiter plate, and 50 pL Tetracycline-free treatment medium (DMEM/F12 (1:1), lx Pen/step (cat#: 30-002-CL, Mediatech, Inc), with 2% FBS, Tet-system approved (cat#: 631106, Clontech), and 1% DMSO was added back to each well. Another 50 pL of CellTiter-Glo reagent solution (Promega, G7573) was then added at room température and the contents mixed for 2 minutes on an orbital shaker to induce cell lysis. This was followed by incubation at room température for 10 minutes to stabilize the luminescent

339 signal. The luminescence was recorded for 0.2 seconds per well on a Tecan multimode platereader (Infinité Ml 000 pro). The luminescent signal from each well was normalized against that of untreated (DMSO) control wells. Ail results were reported percent viability (with controls being 100%).

Table 7

J J Compound No.	AD38 Viral Load (CpAM/DMSO %) àt 10 pM	AD38 Viability Normalized Resuit * (CPAM/DMSO %) at 10 ,pM
1101	15	107
1102	1	100
1103	2	87
1104	1	85
1105	1	101
1107	2	106
1108	1	105
1109	6	99
1110	2	119
1111	2	89
1112	4	73
1113	1	99
1114	1	104
1115	1	106
1117	67	108
1118	61	95
1120	7	94
1121	6	109
1122	21	86
1123	62	95
1124	80	99

340

1125	20	108
1127	22	94
1130	2	101
1133	94	99
1149	5	118
1150	1	22
1151	1	50
1152	1	45
1154	90	50
1155	18	103
1156	16	106
1157	1	48
1158	37	120
1159	8	92
1160	2	105
1161	1	99
1162	61	99
1163	3	104
1164	27	103
1165	5	82
1166	10	119
1167	57	124
1168	10	117
1169	39	107
1170	1	95
1171	49	103
1172	51	107
1173	39	105

341

1174	35	109
1175	30	123
1176	2	104
1177	47	118
1182	13	55
1183	2	36
1184	1	0
1185	1	0
1186	1	39
1187	1	73
1188	4	83
1189	1	85
1190	1	70
1191	14	121
1192	3	81
1193	4	90
1194	1	45
1195	0	48
1196	2	95
1197	1	88
1198	3	60
1199	19	109
1200	18	125
1201	1	50
1202	7	107
1203	3	89
1204	2	97
1205	2	89

342

1206	10	106
1207	24	99
1208	11	103
1209	1	102
1210	25	116
1211	1	106
1212	1	72
1213	2	55
1214	2	94
1216	1	125
1217	1	37
1218	12	104
1219	5	100
1220	2	94
1221	19	106
1222	32	100
1223	2	28
1224	3	65
1225	10	87
1226	1	80
1227	10	92
1228	22	101
1229	45	76
1230	46	102
1231	12	93
1232	42	94
1233	1	93
1234	3	79

343

1235	6	61
1237	4	66
1238	26	104
1239	33	106
1240	26	92
1241	12	86
1242	91	78
1243	20	118
1244	14	103
1245	1	101
1246	6	96
1247	8	103
1248	3	106
1249	34	108
1250	14	113
1251	8	99
1252	14	94
1253	15	103
1256	1	102
1257	26	113
1258	12	105
1259	11	84
1260	8	100
1264	8	104
1266	1	74
1267	77	93
1268	77	106
1269	63	107

344

1270	1	94
1271	6	100
1272	24	102
1273	6	96
1274	11	88
1275	3	93
1276	24	89
1277	43	89
1278	3	88
1279	55	84
1280	74	94
1281	29	86
1282	102	105
1283	1	97
1285	3	108
1286	36	114
1287	11	96
1288	5	49
1289	40	96
1290	33	94
1291	1	102
1293	95	97
1308	1	99
1309	1	107
1310	1	89
1311	8	95
1312	5	83
1313	17	108

345

1314	69	101
1315	4	103
1316	32	89
1317	50	95
1318	14	70
1319	16	83
1320	43	93
1321	15	74
1322	28	94
1323	96	60
1324	10	24
1325	26	90
1326	23	95
1328	54	105
1329	62	109
1330	41	109
1331	43	88
1332	70	103
1333	20	73
1334	33	83
1335	87	104
1336	70	90
1337	77	91
1338	70	118
1339	113	70
1340	64	116
1342	113	95
1343	⁸	91

346

1344	96	102
1345	115	93
1346	105	97
1347	3	94
1348	0	107
1349	12	102
1353	50	97
1354	98	70
1356	3	101
1357	39	115
1358	15	72
1361	79	113
1362	19	98
1364	1	102
1365	2	105
1366	12	93
1367	33	88
1370	5	94
1371	6	94
1372	60	103
1373	10	100
1374	1	98
1375	11	89
1376	3	63
1377	5	65
1381	40	93
1382	47	117
1383	1	87

347

1384	4	79
1385	26	51
1386	61	95
1387	2	78
1388	5	71
1389	15	89
1390	2	92
1391	2	71
1392	2	85
1393	41	87
1394	55	94
1395	64	79
1396	63	95
1397	73	95
1398	5	60
1399	105	92
1400	34	105
1401	31	79
1402	12	81
1403	15	82
1405	14	94
1407	3	103
1408	17	94
1409	4	83
1410	35	50
1411	66	91
1412	48	87
1413	92	78

348

1414	39	89
1415	27	77
1417	11	75
1418	12	73
1419	113	89
1420	29	86
1421	78	95
1422	64	95
1423	37	91
1424	65	96
1427	7	85
1428	28	93
1429	38	90
1430	56	92
1431	115	92
1432	79	91
1433	82	94
1434	85	96
1435	77	99
1436	10	104
1440	71	91
1441	28	90
1442	65	99
1443	64	95
1444	6	65
1445	24	38
1446	3	84
1447	1	85

349

1448	3	85
1449	2	86
1450	73	94
1451	30	92
1452	15	62
1453	48	97
1454	27	95
1455	3	89
1456	15	101
1457	28	92
1458	12	49
1459	4	92
1462	35	99
1463	31	97
1464	49	98
1465	39	106
1466	7	88
1467	1	92
1468	76	97
1471	16	97
1472	37	95
1473	81	97
1474	51	101
1475	47	107
1476	1	86
1477	67	16
1478	2	94
1480	72	95

350

1481	46	100
1482	46	98
1483	65	98
1484	26	100
1485	30	96
1486	53	94
1487	15	96
1488	84	97
1490	7	79
1491	39	80
1492	39	79
1493	51	80
1494	115	60
1495	9	77
1496	2	18
1497	9	49
1498	1	82
1499	2	84
1501	37	71
1503	40	87
1505	81	85
1506	72	85
1507	11	96
1508	31	81
1509	15	29
1510	62	82
1511	38	85
1512	27	99

351

1513	2	82
1514	13	84
1515	2	82
1516	30	82
1517	2	78
1518	67	85
1519	73	81
1520	1	81
1521	1	22
1522	1	82
1523	1	70
1524	2	18
1525	78	85
1526	57	92
1527	19	116
1528	4	85
1529	12	111
1530	70	93
1531	53	96
1532	17	112
1533	2	105
1534	5	109
1535	108	85
1536	2	120
1537	36	98
1540	12	87
1541	11	117
1542	34	95

352

1543	72	90
1544	40	97
1545	59	88
1546	65	89
1547	16	90
1548	28	85
1549	7	109
1550	1	87
1551	51	91
1552	64	93
1553	86	93
1555	36	81
1556	67	86
1557	54	86
1558	51	88
1559	68	92
1560	13	92
1561	8	118
1562	25	89
1563	41	93
1564	10	119
1565	4	103
1566	31	91
1567	1	109
1568	1	100
1569	1	114
1570	2	115
1571	35	117

353

1572	5	116
1573	46	126
1574	78	109
1575	90	108
1576	8	108
1577	6	120
1578	33	100
1580	59	89
1581	3	97
1582	8	112
1583	41	121
1584	52	95
1585	66	87
1586	23	112
1587	78	92
1588	0	98
1589	1	85
1590	1	96
1591	13	111
1592	50	102
1593	3	133
1594	4	109
1595	3	108
1597	64	87
1598	61	93
1599	72	101
1600	12	108
1601	62	106

354

1602	38	116
1603	6	91
1604	0	105
1605	25	106
1606	7	104
1607	14	93
1608	63	103
1609	68	99
1611	0	130
1612	0	112
1613	0	122
1614	2	45
1615	32	123
1616	5	115
1617	1	118
1618	0	44
1619	12	122
1620	3	111
1621	1	117
1622	0	120
1623	1	128
1624	1	136
1625	2	111
1626	0	118
1627	5	115
1628	17	138
1629	3	95
1631	9	112

355

1632	2	122
1633	66	124
1634	45	125
1635	1	93
1636	0	111
1637	32	123

INCORPORATION BY REFERENCE

Ail publications and patents mentioned herein, including those items listed below, are hereby incorporated by reference in their entirety for ail purposes as if each individual publication or patent 5 was specifically and individually incorporated by reference. In case of conflict, the présent application, including any définitions herein, will control.

EQUIVALENTS

While spécifie embodiments of the subject invention hâve been discussed, the above spécification is illustrative and not restrictive. Many variations of the invention will become apparent to those skilled in the art upon review of this spécification. The fu.ll scope of the invention should be determined by reference to the daims, along with their full scope of équivalents, and the spécification, along with such variations.

Unless otherwise indicated, ail numbers expressing quantifies of ingrédients, reaction conditions, and so forth used in the spécification and daims are to be understood as being modified in ail instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in this spécification and attached daims are approximations that may vary depending upon the desired properties sought to be obtained by the présent invention.

Claims

Claims

1. A compound represented by:

Formula 1 wherein:

T is selected from the group consisting of-C(O)-, -CH2-C(O)-, -N(C(O)-CH₃)-, -NH-, -O-, and -S(O)_Z-, where z is 0, 1 or 2;

Y is C(Rⁿ)2 , S(O)_y, NRy and O wherein y is 0, 1, or 2;

Ry is selected from the group consisting of H, methyl, ethyl, propyl, phenyl and benzyl;

Rl is selected from the group consisting of H, methyl, and -C(O)-Ci.₃alkyl;

L is a bond or Cm straight chain alkylene optionally substituted by one or two substituents each independently selected from the group consisting of methyl (optionally substituted by halogen or hydroxyl), ethenyl, hydroxyl, NR’R”, phenyl, heterocycle, and halogen and wherein the Cm straight chain alkylene may be interrupted by an -O-;

R² is selected from the group consisting of H, phenyl or naphthyl (wherein the phenyl or naphthyl may be optionally substituted with one, two , three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci-ôalkyl, C₂-6alkenyl, C₂.6alkynyl, Ci.galkoxy, NR’R”, -C(O)-NR’R”, -C(O)-Ci_ ₆alkyl, -C(O)-Ci-6alkoxy, phenyl (optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, cyano, Ci„6alkyl, C2. ₆alkenyl, C₂.₆alkynyl, Ci_₆alkoxy,NR’R”, C(O)-NR’R”, -C(O)-Ci_₆alkyl, -C(O)-Ci_₆alkoxy, StOXv-CMôalkyl (where w is 1, 2 or 3), S(O)_W-NR’R” (where w is 1, 2 or 3),-NR’-S(O)_w, and S(O)_W-NR’R”(where w is 1, 2 or 3)), heteroaryl (optionally substituted by one, two or three

357 substituents each independently selected from the group consisting of halogen, hydroxyl, Ci_6alkyl, C₂.₆alkenyl, C₂.₆alkynyl, Ci_₆alkoxy, NR’R”, C(O)-NR’R”, -C(O)-Ci_₆alkyl, -C(O)-Ci_₆alkoxy, S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), NR’-S(O)_W, and -S(O)_w-NR’R”(where w is 1, 2 or 3)), C₃_ ôcycloalkyl, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), -S(O)_W-NR’R” (where w is 1, 2 or 3), and NR’-S(O)_W, (where w is 1, 2 or 3)),

5-6 membered heteroaryl having one, two, or three heteroatoms each independently selected from O, N and S (wherein the 5-6 membered heteroaryl may be optionally substituted on a carbon with one, two , three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, C₂_6alkenyl, C₂_6alkynyl, Ci-ôalkoxy, phenyl (optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci-galkyl, C₂_6alkenyl, C₂_6alkynyl, Ci-6alkoxy, NR’R”, C(O)- NR’R”, -C(O)-Ci_6alkyl, C(O)-OH, -C(O)-Ci_6alkoxy, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), -NR’-S(O)_W, and -S(O)_WNR’R”(where w is 1, 2 or 3)), heteroaryl, heterocycle, NR’R”, -C(O)- NR’R”, -C(O)-Ci_6alkyl, C(O)-Ci-6alkoxy, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), -NR’-S(O)_W, and -S(O)_W-NR’R”(where w is 1, 2 or 3), and on a nitrogen by R’),

Ci-ôalkyl, Cj-éalkoxy, C₂_6alkenyl, C₃_iocycloalkyl (optionally substituted with one, two , three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, NR’R”, -C(O)- NR’R”, =CNR’, Ci_₆alkyl, Ci_₆alkoxy, -C(O)-Ci_₆alkyl, and -C(O)-Ci_ ôalkoxy, and wherein the C₃_iocycloalkyl may optionally be a bridged cycloalkyl)), and a 4-6 membered heterocycloalkyl having one or two heteroatoms each independently selected from O, N and S (wherein the 4-6 membered heterocycloalkyl may be optionally substituted with one, two , three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, NR’R”, -C(O)- NR’R”, Cj.₆alkyl, Ci_6alkoxy, -C(O)-Ci_6alkyl, and -C(O)-Ci_₆alkoxy);

R’ is selected, independently for each occurrence, from H, methyl, ethyl, propyl, phenyl, and benzyl;

R” is selected, independently for each occurrence, from H, methyl, ethyl, propyl, butyl, carboxybenzyl, -C(O)-methyl and -C(O)-ethyl, or R’ and R” taken together may form a 4-6 membered heterocycle;

358 each of moieties R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, R¹⁰, and R¹¹ are independently selected for each occurrence from the group consisting of hydrogen, Ci_6alkyl, C2-6alkenyl, C2-6alkynyl, halogen, hydroxyl, nitro, cyano, NR’R”, -C(O)- NR’R”, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), -NR’S(O)_Wj and -S(O)_W-NR’R”(where w is 0, 1 or 2), Ci_6alkoxy,-C(O)-OH, -C(O)-Ci-6alkyl, and C(O)-Ci-6alkoxy;

wherein for each occurrence, Ci_6alkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, C2-6alkenyl, C₂-6alkynyl, Ci_6alkoxy, phenyl, NR’R”, -C(O)- NR’R”, S(O)_w-methyl (where w is 1, 2 or 3), -NR’-S(O)_W; and S(O)_W-NR’R”(where w is 0, 1 or 2); Ci_6alkoxy may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, phenyl, NR’R”, -C(O)-NR’R”, S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), -NR’-S(O)_Wj and S(O)_W-NR’R” (where w is 0, 1 or 2); and C₃_6cycloalkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Cj-ealkyl, Ci_6alkoxy, -C(O)-Ci^alkyl, -C(O)-Ci_6alkoxy, andNR’R”; and pharmaceutically acceptable salts thereof.
2. The compound of claim 1, wherein L is -CH2-.
3. The compound of claim 1, wherein L is C2-₃alkylene.
4. The compound of claim 1, wherein L is selected from the group consisting of-CH₂-CH2-, -

CH₂(CH₂)-CH₂-, -CH₂-CH₂(OH)-, -CH2-CH₂(CH₃OH)-, and-CH₂-CH₂(OH)-CH₂-.
5. The compound of claim 1, wherein L is a bond.
6. The compound of claim 1, wherein L is - C2-3alkylene-O-.
7. The compound of claim 1, wherein L is -O-.
8. The compound of any one of daims 1-7, wherein Y is S(O)_y or NRy.
9. The compound of any one of daims 1-8, wherein Y is S(O)_y.
10. The compound of any one of daims 1-9, wherein Y is S.
11. The compound of any one of daims 1-10, wherein R² is phenyl or 5-6 membered heteroaryl.

359
12. The compound of any one of claims 1-11, wherein R² is phenyl.
13. The compound of any one of claims 1-12, wherein R² is phenyl substituted by one or two substituents each selected from the group consisting of fluorine, chlorine, Ci^alkyl (optionally substituted by one, two or three fluorines), Ci_6alkoxy (optionally substituted by

5 one, two or three fluorines), hydroxyl, NR’R”, -S(O)2-NR’R”, heteroaryl, and phenyl (optionally substituted by halogen or hydroxyl).
14. The compound of claim 12, wherein R² is phenyl substituted by an 5-6 membered heteroaryl selected from the group consisting of:

10
15. The compound of claim 14, wherein R² is phenyl substituted by
16. The compound of any one of claims 1-11, wherein R² is a 5-6 membered heteroaryl.
17. The compound of claim 16, wherein R² is selected from the group consisting of:

360

J. ^N

R' >C-N

R'
18. The compound of claim 16 or 17 wherein R² is selected from the group consisting of:

R³², and wherein

R³² is selected from the group consisting of H, halogen, phenyl, and Ci_6alkyl (optionally substituted by one, two or three halogens);

R⁵² is selected from the group consisting of H, halogen, phenyl, and Cj^alkyl (optionally substituted by one, two or three halogens);

R⁴² is selected from the group consisting of H, halogen, phenyl, CAalkyl (optionally substituted by one, two or three halogens), Ci_6alkoxy (optionally substituted by one, two or three halogens), NH₂, -OCH₃, NHCH₃, and N(CH₃)₂.
19. The compound of claim 18, wherein R⁴² is independently selected for each occurrence from the group consisting of H, methyl, ethyl, propyl, -CF₃, -CH₂CH₃, Cl, F, phenyl, -NH₂, OCH₃, NHCH₃, andN(CH₃)₂.
20. The compound of claim 17 or 18, wherein R² is optionally substituted on a carbon by a substitutent selected from the group consisting of fluorine, chlorine, phenyl, -NH_2;NH Cj. ₆alkyl, and N(Ci.₆alkyl)_2; C^alkyl, and Ci_6alkoxy.

361
21. The compound of any one of claims 1-10, wherein R² is a 4-6 membered heterocycloalkyl or C4_6cycloalkyl.
22. The compound of claim 21, wherein R² is selected from the group of: tetrahydropyranyl, tetrahydrofuran, cyclopentane, cyclohexane, and cyclobutane.
23. The compound of claim 22, wherein R² is selected from the group consisting of:
24. The compound of claim 1, represented by:

Y is S(O)_y, wherein y is 0, 1,2;

L is a bond or Cy straight chain alkylene optionally substituted by one or two substituents each independently selected from the group consisting of methyl (optionally substituted by halogen or hydroxyl), hydroxyl and halogen;

R² is selected from phenyl optionally substituted with one, two , three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci_6alkyl, C₂. ealkenyl, C₂.₆alkynyl, Ci.₆alkoxy, NR’R”, -C(O)- NR’R”, -C(O)-Ci_₆alkyl, -C(O)-Ci_₆alkoxy, phenyl (optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Cj-ôalkyl, C₂-6alkenyl, C₂_6alkynyl, Ci-6alkoxy, NR’R”, C(O)- NR’R”, -C(O)-Ci.6alkyl, -C(O)-Ci_6alkoxy, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), NR’S(O)_W, and -S(O)_w-NR’R”(where w is 1, 2 or 3)), 5-6 membered heteroaryl having one, two, or three heteroatoms each independently selected from O, N and S (optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci_₆alkyl, C₂.₆alkenyl, C₂.₆alkynyl, Ci.₆alkoxy, NR’R”, C(O)- NR’R”, -C(O)-C!^alkyl, -C(O)-Cj.

362 ôalkoxy, -S(O)_w-Ci_ôalkyl (where w is 1, 2 or 3), -NR’-S(O)_W, and -S(O)_w-NR’R”(where w is 1, 2 or 3)), C3.6cycloalkyl, -S(O)_w-Ci_ôalkyl (where w is 1, 2 or 3), S(O)_W-NR’R” (where w is 1, 2 or 3),and -NR’-S(O)_W, (where w is 1, 2 or 3)), and a 5-6 membered heteroaryl having one, two, or three heteroatoms each independently selected from O, N and S (wherein the 5-6 membered heteroaryl may be optionally substituted on a carbon with one, two , three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, C2-6alkenyl, C2-6alkynyl, Ci-6alkoxy, phenyl (optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci^alkyl, C2-ealkenyl, C2-6alkynyl, Ci. ôalkoxy, NR’R”, C(O)- NR’R”, -C(O)-Ci.₆alkyl, -C(O)-Cj.₆alkoxy, -S(O)_w-Ci_₆alkyl (where w is 1, 2 or 3), S(O)_W-NR’R” (where w is 1, 2 or 3),-NR’-S(O)_w, and -S(O)_W-NR’R”(where w is 1, 2 or 3)), heteroaryl, heterocycle, NR’R”, -C(O)-NR’R”, -C(O)-Ci.₆alkyl, -C(O)-Ci.₆alkoxy, -S(O)_w-Ci_ ôalkyl (where w is 1, 2 or 3),-NR’-S(O)_w, and -S(O)_w-NR’R”(where w is 1, 2 or 3), and on a nitrogen by R’);

R’ is selected, independently for each occurrence, from H, methyl, ethyl, and propyl,

R” is selected, independently for each occurrence, from H, methyl, ethyl, propyl, butyl, — C(O)-methyl and -C(O)-ethyl, or R’ and R’ ’ taken together may form a 4-6 membered heterocycle;

each of moieties R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, R¹⁰, and R¹¹ are independently selected for each occurrence from the group consisting of hydrogen, Ci-ôalkyl, C2-6alkenyl, C2-6alkynyl, halogen, hydroxyl, nitro, cyano, NR’R”, -C(O)- NR’R”, -S(O)_w-Ci-ôalkyl (where w is 1, 2 or 3), NR’-S(O)_Wjand S(O)_w-NR’R”(where w is 0, 1 or 2), Cj.ôalkoxy,-C(O)-OH, -C(O)-Ci-6alkyl, and -C(O)-Ci_ ôalkoxy;

wherein for each occurrence, Ci^alkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, C₂-ôalkenyl, C₂-ôalkynyl, Ci.₆alkoxy, phenyl, NR’R”, -C(O)- NR’R”, S(O)_w-methyl (where w is 1, 2 or 3), -NR’-S(O)_W; and S(O)_W-NR’R”(where w is 0, 1 or 2); Ci_ôalkoxy may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, phenyl, NR’R”, -C(O)- NR’R”, S(O)_w-C₁_₆alkyl (where w is 1, 2 or 3), -NR’-S(O)_Wj and S(O)_W-NR’R” (where w is 0, 1 or 2); and C₃.₆cycloalkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of

363 halogen, hydroxyl, nitro, cyano, carboxy, Cj-galkyl, Ci_6alkoxy, -C(O)-Ci_6aIkyl, -C(O)-Ci_6alkoxy, and NR’R”.
25. The compound of any one of daims 1-24, wherein R⁷ is selected from H and F.
26. The compound of any one of daims 1-25, wherein R⁶ is selected from H and F.
27. The compound of any one of daims 1-26, wherein R⁵ is selected from H and F.
28. The compound of any one of daims 1-27, wherein R¹⁰ is selected from the group consisting of H, methyl and F.
29. The compound of any one of daims 1-28, wherein each of R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, R¹⁰, and R¹¹ are H.
30. A compound represented by:

wherein

R^m’ and R^m are each independently selected from the group consisting of H, halogen, Ci. galkyl (optionally substituted by one, two or three substituents each independently selected from halogen and hydroxyl), NR’R”, and hydroxyl;

R²² is selected for each occurrence from the group consisting of H, halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, C₂.6alkenyl, C₂_6alkynyl, Ci.galkoxy, NR’R”, -C(O)-Cj^alkyl, -C(O)-Ci_ ôalkoxy, phenyl, heteroaryl, C3_6cycloalkyl, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), -S(O)_W-NR’R” (where w is 1, 2 or 3), and -NR’-S(O)_W, (where w is 1, 2 or 3));

R’ is selected, independently for each occurrence, from H, methyl, ethyl, and propyl;

R” is selected, independently for each occurrence, from H, methyl, ethyl, propyl, butyl, C(O)-methyl and -C(O)-ethyl, or R’ and R” taken together with the nitrogen to which they are attached may form a 4-6 membered heterocycle;

364 each of moieties R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, and R¹⁰ is independently selected for each occurrence from the group consisting ofhydrogen, Ci.6alkyl, C2-6alkynyl, C₂.galkenyl, halogen, hydroxyl, nitro, cyano, andNR’R”;

wherein for each occurrence, Ci-6alkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, C₂.6alkenyl, C₂.6alkynyl, Ci_6alkoxy, NR’R”, -NR’-S(O)_W> and S(O)_W-NR’R”; Ci_6alkoxy may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci-ôalkyl, NR’R”, -NR’-S(O)_W; and S(O)_W-NR’R”; C₃_ ôcycloalkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci.6alkyl, Cj.ôalkoxy, -C(O)-Ci_6alkyl, -C(O)-Ci_6alkoxy, and NR’R’ ’ ; phenyl may be optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci^alkyl, C₂.₆alkenyl, C₂.₆alkynyl, Ci_₆alkoxy, NR’R”, C(O)- NR’R”, -C(O)-Ci_₆alkyl, -C(O)-Ci_₆alkoxy, S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), NR’-S(O)_W, and -S(O)_W-NR’R”(where w is 1, 2 or 3), and heteroaryl may be optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci-ôalkyl, C₂_6alkenyl, C₃_6cycloalkyl, C₂. ₆alkynyl, Ci.₆alkoxy, NR’R”, C(O)- NR’R”, -C(O)-Ci_₆alkyl, -C(O)-C_walkoxy, -S(O)_w-C_walkyl (where w is 1, 2 or 3), NR’-S(O)_W, and -S(O)_W-NR’R”(where w is 1, 2 or 3)), C₃_6cycloalkyl; and pharmaceutically acceptable salts thereof.
31. The compound of claim 30, wherein R⁷ is selected from H and F.
32. The compound of claim 30 and 31, wherein R⁶ is selected from H and F.
33. The compound of any one of claims 30-32, wherein R⁵ is selected from H and F.
34. The compound of any one of claims 30-33, wherein R¹⁰ is selected from the group consisting of H, methyl and F.
35. The compound of any one of claims 30-34 wherein each of R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, R¹⁰, and

R¹¹ are H.
36. The compound of claim 30, wherein the compound is represented by:

365
37. The compound of claim 30, wherein the compound is represented by:
38. The compound of any one of daims 30-37, wherein R²² is selected from the group consisting of:

O>

and
39. The compound of any one of daims 30-38, wherein R²² is phenyl.
40. A compound represented by:

wherein

366

Y is C(R^U)₂ , S(O)_y, NRy and O wherein y is 0, 1, or 2;

Ry is selected from the group consisting of H, methyl, ethyl, propyl, phenyl and benzyl;

R^m and R^m are each independently selected from the group consisting of H, halogen, Cjôalkyl (optionally substituted by one, two or three substituents each independently selected from halogen and hydroxyl), C₂.6alkenyl (optionally substituted by one, two or three substituents each independently selected from halogen and hydroxyl), NR’R”, and hydroxyl;

R is selected for each occurrence from the group consisting of H, halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, C₂_6alkenyl, C₂_6alkynyl, Ci_6alkoxy, NR’R”, -C(O)-Ci^alkyl, -C(O)-Cj. ôalkoxy, phenyl, heteroaryl, C₃.gcycloalkyl, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), -S(O)_W-NR’R” (where w is 1, 2 or 3), and -NR’-S(O)_W, (where w is 1, 2 or 3));

R’ is selected, independently for each occurrence, from H, methyl, ethyl, and propyl;

R” is selected, independently for each occurrence, from H, methyl, ethyl, propyl, butyl, C(O)-methyl and -C(O)-ethyl, or R’ and R’ ’ taken together with the nitrogen to which they are attached may form a 4-6 membered heterocycle;

each of moieties R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, and R¹⁰ is independently selected for each occurrence from the group consisting of hydrogen, Ci^alkyl, C₂_6alkynyl, CMalkenyl, halogen, hydroxyl, nitro, cyano, and NR’R’ ’ ;

wherein for each occurrence, Ci^alkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, C₂_6alkenyl, C₂_6alkynyl, Ci-ôalkoxy, NR’R”, -NR’-S(O)_W, and S(O)_W-NR’R”; Ci.₆alkoxy may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, NR’R”, -NR’-S(O)_W; and S(O)_W-NR’R”; C₃. ôcycloalkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, Ci_6alkoxy, -C(O)-Ci_6alkyl, -C(O)-Ci_6alkoxy, and NR’R”; phenyl may be optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci-ôalkyl, C₂.6alkenyl, C₂_6alkynyl, Ci_6alkoxy, NR’R”, C(O)- NR’R”, -C(O)-Ci-6alkyl, -C(O)-Ci_6alkoxy, S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), NR’-S(O)_W, and -S(O)_W-NR’R”(where w is 1, 2 or 3), and

367 heteroaryl may be optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci^alkyl, C₂.6alkenyl, C₂.6alkynyl, Ci. ôalkoxy, NR’R”, C(O)- NR’R”, -C(O)-Ci_6alkyl, -C(O)-Ci_6alkoxy, -S(O)_w-Ci-6alkyl (where w is 1, 2 or 3), NR’-S(O)_W, and -S(O)_w-NR’R”(where w is 1, 2 or 3)), and C3-6cycloalkyl; and pharmaceutically acceptable salts thereof.
41. The compound of claim 40, wherein R⁷ is selected from H and F.
42. The compound of claim 40 or 41, wherein R⁶ is selected from H and F.
43. The compound of any one of claims 40-42, wherein R⁵ is selected from H and F.
44. The compound of any one of claims 40-43, wherein R¹⁰ is selected from the group consisting of H, methyl and F.
45. The compound of any one of claims 40-44 wherein each of R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, R¹⁰, and R¹¹ are H.
46. The compound of any one of claims 40-45, wherein Y is S.
47. A compound represented by:

wherein

Y is C(R^U)₂ , S(O)_y, NRy and O wherein y is 0, 1, or 2;

R_Y is selected from the group consisting of H, methyl, ethyl, propyl, phenyl and benzyl;

R^m’ and R^m are each independently selected from the group consisting of H, halogen, Ci. ôalkyl (optionally substituted by one, two or three substituents each independently selected from halogen and hydroxyl), C₂.6alkenyl (optionally substituted by one, two or three substituents each independently selected from halogen and hydroxyl), NR’R”, and hydroxyl;

368

R^c is H or Ci_₆alkyl;

R is selected for each occurrence from the group consisting of H, halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, C2-6alkenyl, C2_6alkynyl, Ci.6alkoxy, NR’R”, -C(O)-Ci^alkyl, -C(O)-Ci. ôalkoxy, phenyl, heteroaryl, C₃_6cycloalkyl, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), -S(O)_W-NR’R” (where w is 1, 2 or 3), and -NR’-S(O)_W, (where w is 1, 2 or 3));

R’ is selected, independently for each occurrence, from H, methyl, ethyl, and propyl;

R” is selected, independently for each occurrence, from H, methyl, ethyl, propyl, butyl, C(O)-methyl and -C(O)-ethyl, or R’ and R” taken together with the nitrogen to which they are attached may form a 4-6 membered heterocycle;

each of moieties R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, and R¹⁰ is independently selected for each occurrence from the group consisting of hydrogen, Ci^alkyl, C2-6alkynyl, C2-6alkenyl, halogen, hydroxyl, nitro, cyano, and NR’R’ ’ ;

wherein for each occurrence, Ci^alkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, C₂_6alkenyl, C₂-6alkynyl, Ci_6alkoxy, NR’R”, -NR’-S(O)_W) and S(O)_W-NR’R”; Ci_6alkoxy may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci^alkyl, NR’R”, -NR’-S(O)_W; and S(O)_W-NR’R”; C₃. ôcycloalkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Ci_6alkyl, Ci_6alkoxy, -C(O)-Ci_6alkyl, -C(O)-C!_6alkoxy, and NR’R”; phenyl may be optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci^alkyl, C₂.₆alkenyl, C₂.₆alkynyl, Ci_₆alkoxy, NR’R”, C(O)-NR’R”, -C(O)-Ci_₆alkyl, -C(O)-Ci_₆alkoxy, S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), NR’-S(O)_W, and -S(O)_w-NR’R”(where w is 1, 2 or 3), and heteroaryl may be optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci^alkyl, C2-6alkenyl, C2-6alkynyl, Cj. ôalkoxy, NR’R”, C(O)- NR’R”, -C(O)-Ci_₆alkyl, -C(O)-Cj.6alkoxy, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), NR’-S(O)_W, -S(O)_W-NR’R”(where w is 1, 2 or 3)), and C₃_6cycloalkyl, and pharmaceutically acceptable salts thereof.

369
48. The compound of claim 47, wherein R^c is H or methyl.
49. The compound of claim 47 or 48, wherein R^c is H.
50. The compound of any one of claims 47-49, wherein R⁷ is selected from H and F.
51. The compound of any one of claims 47-50, wherein R⁶ is selected from H and F.
52. The compound of any one of claims 47-51, wherein R⁵ is selected from H and F.
53. The compound of any one of claims 47-52, wherein R¹⁰ is selected from the group consisting of H, methyl and F.
54. The compound of any one of claims 47-53 wherein each of R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, R¹⁰, and R¹¹ are H.
55. The compound of any one of claims 47-54, wherein Y is S.
56. A compound represented by:

wherein

Y is C(R^H)₂ , S(O)_y, NRy and O wherein y is 0, 1, or 2;

Ry is selected from the group consisting of H, methyl, ethyl, propyl, phenyl and benzyl;

R^m’ and R^m are each independently selected from the group consisting of H, halogen, Ci_ ôalkyl (optionally substituted by one, two or three substituents each independently selected from halogen and hydroxyl), C₂-6alkenyl (optionally substituted by one, two or three substituents each independently selected from halogen and hydroxyl), NR’R’ ’, and hydroxyl;

R^c is H or Ci-6alkyl;

R⁷⁸ is selected from the group consisting of H, halogen, hydroxyl, nitro, cyano, carboxy, Ci. ôalkyl, C₂.₆alkenyl, C₂.₆alkynyl, Ci_₆alkoxy, NR’R”, -C(O)-Ci.₆alkyl, -C(O)-Ci.₆alkoxy, phenyl,

370 heteroaryl, C₃_ôcycloalkyl, -S(O)_w-Ci_6alkyl (where w is 1, 2 or 3), -S(O)_W-NR’R” (where w is 1,2 or 3), and -NR’-S(O)_W, (where w is 1, 2 or 3));

R⁷⁹ is selected from the group consisting of H, halogen, hydroxyl, nitro, cyano, carboxy, Cp ôalkyl, C2-ôalkenyl, C2-ôalkynyl, Cpôalkoxy, NR’R”, -C(O)-Cpôalkyl, -C(O)-Cpôalkoxy, phenyl, heteroaryl, C₃.ôcycloalkyl, -S(O)_w-Cpôalkyl (where w is 1, 2 or 3), -S(O)_W-NR’R” (where w is 1,2 or 3), and -NR’-S(O)_W, (where w is 1, 2 or 3));

R’ is selected, independently for each occurrence, from H, methyl, ethyl, and propyl;

R’ ’ is selected, independently for each occurrence, from H, methyl, ethyl, propyl, butyl, C(O)-methyl and -C(O)-ethyl, or R’ and R” taken together with the nitrogen to which they are attached may form a 4-6 membered heterocycle;

each of moieties R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, and R¹⁰ is independently selected for each occurrence from the group consisting of hydrogen, Cpôalkyl, C₂-ôalkynyl, C₂.6alkenyl, halogen, hydroxyl, nitro, cyano, and NR’R”;

wherein for each occurrence, Cpôalkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, C2.6alkenyl, C₂-6alkynyl, Cp₆alkoxy, NR’R”, -NR’-S(O)_W; and S(O)_W-NR’R”; Cp₆alkoxy may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Cpôalkyl, NR’R”, -NR’-S(O)_W; and S(O)_W-NR’R”; C₃. ôcycloalkyl may be optionally substituted with one, two, three or more substituents selected from the group consisting of halogen, hydroxyl, nitro, cyano, carboxy, Cp₆alkyl, Ci.6alkoxy, -C(O)-Cpôalkyl, -C(O)-Ci-6alkoxy, and NR’R”; phenyl may be optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Ci^alkyl, C₂.₆alkenyl, C₂.₆alkynyl, Cp₆alkoxy, NR’R”, C(O)- NR’R”, -C(O)-Cp₆alkyl, -C(O)-Cp₆alkoxy, S(O)_w-Ci-6alkyl (where w is 1, 2 or 3), NR’-S(O)_W, and -S(O)_w-NR’R”(where w is 1, 2 or 3), and heteroaryl may be optionally substituted by one, two or three substituents each independently selected from the group consisting of halogen, hydroxyl, Cpôalkyl, C2-6alkenyl, C₂-ôalkynyl, C₃. ôcycloalkyl, Cp₆alkoxy, NR’R”, C(O)-NR’R”, -C(O)-Cp₆alkyl, -C(O)-Cp₆alkoxy, -S(O)_w-Cp ôalkyl (where w is 1, 2 or 3), NR’-S(O)_W, and -S(O)_W-NR’R”(where w is 1, 2 or 3), and pharmaceutically acceptable salts thereof.

371
57. The compound of claim 56, wherein R° is H or methyl.
58. The compound of claim 56 or 57, wherein R^c is H.
59. The compound of any one of daims 56-58, wherein R⁷ is selected from H and F.
60. The compound of any one of daims 56-59, wherein R⁶ is selected from H and F.
61. The compound of any one of daims 56-60, wherein R⁵ is selected from H and F.
62. The compound of any one of daims 56-61, wherein R¹⁰ is selected from the group consisting of H, methyl and F.
63. The compound of any one of daims 56-62 wherein each of R⁴, R⁵, R⁶, R⁷, R⁸, R⁹, R¹⁰, and R¹¹ are H.
64. A compound selected from the group consisting of compounds in Table 1, 2, 3, 4, 5, and 6, and pharmaceutically acceptable salts thereof.
65. A pharmaceutically acceptable composition comprising a compound of any one of daims 164, and a pharmaceutically acceptable excipient.
66. A method of treating a hepatitis B infection in a patient in need thereof, comprising administering an effective amount of a compound of any one of daims 1-64.
67. A method of treating a hepatitis B infection in a patient in need thereof, comprising administering a first compound selected from a compound of daims 1-64, and optionally administering a one or more additional compounds each selected from a compound of daims 1-63.
68. A method of treating a hepatitis B infection in a patient in need thereof, comprising administering an amount of a compound of any one of daims 1-64, and administering another HBV capsid assembly promoter.
69. A method of treating a hepatitis B infection in a patient in need thereof, comprising administering a first compound selected from any one of daims 1-64, and one or more other HBV agent each selected from the group consisting of HBV capsid assembly promoters, HBF viral polymerase interfering nucleosides, viral entry inhibitors, HBsAg sécrétion inhibitors, disruptors of nucleocapsid formation, cccDNA formation inhibitors, antiviral core

372 protein mutant, HBc directed transbodies, RNAi targeting HBV RNA, immunostimulants, TLR-7/9 agonists, cyclophilin inhibitors, HBV vaccines, SMAC mimetics, epigenetic modulators, kinase inhibitors, and STING agonists.