OA17400A - Tools and method for the detection and quantification of genetically diverse HIV-1, SIVcpz and SIVgor viruses. - Google Patents

Abstract

The invention relates to the oligonucleotide of sequence SEQ ID N°1: 5'CTAGAGATCCCTCAGA - 3 ', and the complementary sequence thereof of sequence SEQ ID N° 2: 5 TCTGAGGGATCTCT AG - 3' useful as probes to detect and quantify all HlV-1 circulating forms and their precursors SIVcpz/SIVgor.

Description

Tools and method for the détection and quantification of genetically diverse HIV-1, STVcpz and SlVgor viruses

The invention relates to the détection and quantification of genetically diverse HIV-1, SIVcpz and SlVgor viruses.

It particularly relates to tools and a method for real-time RT-PCR assay (reverse transcription polymerase chain reaction) of high sensitivity to detect and quantify ail circulating strains.

In 2009, about 5.2 million people in low- and middle-income countries were receiving antirétroviral therapy (ART) (UNAIDS, 2010) (1). Programs to scale-up ART in resource-limited countries hâve increased the number of people receiving treatment (i.e. +30% between 2008 and 2009). Nevertheless, viral load (VL) monitoring for patients on ART or for early viral détection in children is only rarely available in resource-limited settings.

Scale-up of laboratory monitoring such as VL measurement in low-income countries is a priority and has been defined as a recommendation by UNAIDS in 2010 to improve the efficiency and quality of HIV antirétroviral treatment and care. Actually, the need of an effective viral load monitoring is justified by different observations.

First, if virological failure is detected early, the spread of drug résistant strains in the general population will decrease.

Second, if a better health intervention and follow-up to patients is provided, their adhérence will be increased and possible unnecessary switches to more expensive second line regimens will decrease.

Third, false négative results for ‘unusual’ strains can lead to inaccurate diagnosis and hâve adverse conséquences.

Lastly, viral load measurement is the best way for early diagnosis of périnatal infection in children (1) (UNAIDS, 2010).

Today, different viral load assays are available and use different techniques of molecular biology such as real-time RT-PCR, NASBA (Nucleic acid sequence based amplification), or bDNA (branched-chain DNA signal amplification) (reviewed in (2)).

If HIV quantification assays are rarely présent or only in reference laboratories of resource-limited countries, it is mainly due to their high cost between 50 and 100 dollars (the cost of monitoring is higher than the cost of ART) and their need for spécifie instruments. Cheaper alternatives to classical molecular based methods hâve been proposed, but still need further improvement and/or évaluation.

The high genetic diversity of HTV-1 is a major challenge for the development of new, efficient, and sensitive assays.

Ail commercial quantitative tests were primarily designed on subtype B viruses and, even if they are now more and more adapted to a broad range of variants (some for example include HTV-1 group O), they still do not quantify correctly ail circulating variants.

This drawback is particularly an issue for sub-Saharan Africa where non-B strains predominate, and where many andhighly diverse HTV-1 variants co-circulate.

Due to globalization, this heterogeneity can also be found in different géographie régions in which the common viral load assays may not be able to detect these ‘unusual’ strains.

Furthermore, highly divergent viruses, such as HTV-1 groups O, N, and P which also circulate and hâve a clinical course similar to HIV-1 group M, need appropriate monitoring tools that are not often available.

Thus, HIV diversity and molecular epidemiology still impacts on the management and monitoring of HIV infected patients.

The main limit of the majority of the developed ‘in-house’ or generic tests is that they were not designed to detect ail circulating strains.

For example, the Biocentric Generic HIV-1 Viral Load assay and the “in-house” assay developed by Drosten et al effectively quantily HIV-1 group M but not HIV-1 group O and HIV-1 O and N, respectively ( 4, 5), because their primers and probe do not correctly match with these divergent strains. On the other hand, a real-time PCR assay developed by Gueudin et al specifically quantifies HIV-1 group O, but does not detect HIV-1 group M strains (6 ).

This observation is also true for new zoonotic SIV/HIV viruses emerging from SIVs naturally infecting chimpanzees and gorillas (such as HIV-1 group P identified in 2009 emerging from SlVgor (3)).

Besides, recent studies hâve shown that SIVcpz, ancestors of HIV-1, can be pathogenic for their naturel host and previous studies of the inventors hâve shown how difficult it can be to follow such viral infection in plasma and fecal samples.

To monitor SIV infection in naturally infected apes, a new tool should be available to detect SIV RNA in fecal samples and to quantify SIV viral load in plasma over the course of infection.

Furthermore, there is still a risk for SIV emergence from infected apes to humans. It will then be important to be able to detect with this same test any hypothetic new emerging SIVcpz or SlVgor viruses in the human population.

Finally, a détection and quantification test would be useful to monitor SIV infection in great apes from both fecal and plasma samples, to understand better the course of SIVcpz and SlVgor infections in their natural hosts, réservoir of the ancestors of HIV-1.

The inventors hâve searched for new means to overcome the above drawbacks and focused on the design of new tools and a new RT-qPCR assay, relatively inexpensive and at least equal to generic or ‘in-house’ tests regarding technical characteristics and performance, but with the capacity to virtually detect and quantify ail HIV-1 circulating strains and their precursors STVcpz/SIVgor.

The object of the invention is then to provide tools and a method for detecting and quantifying genetically diverse HIV-1, SIVcpz and SlVgor viruses in a test sample with a high sensitivity.

According to another object, the invention provides a single quantitative viral load assay based on the real time RT-PCT technology, satisfying the above mentioned different goals.

The invention thus relates to an oligonucleotide of sequence

SEQ ID N°1: 5’-CTAGAGATCCCTCAGA-3’, and the complementary sequence thereof, of sequence SEQ ID N°2:

5’- TCTGAGGGATCTCTAG - 3’

useful as probes to detect and quantify ail HIV-1 circulating forms and their precursors SIVcpz/SIVgor.

Preferably, said probe is a Taqman probe carrying a 5’ reporter dye and a 3’minor groove binding-non fluorescent quencher. The reporter dye is for example a fluorochrome dye such as FAM (6-carboxy fluorescein). The quencher is for example MGB (dihydrocyclopyrroindole tripeptide minor groove binder).

Particularly, the invention relates to a primers/probe set wherein the probe is as above defined and the primers comprise two oligonucleotides able to amplify a HIV-1 circulating forms and their precursors SIVcpz/SIVgor target sequence in a test sample.

More particularly the forward primer has sequence

SEQ ID N°3; 5’- SSCTCAATAAAGCTTGCC-3’ wherein S represents G or C, and the reverse primer has sequence

SEQ ID N°4: 5’-AAAATCTCTAGCAGTGGCGCC-3’ or the complementary sequence thereof of sequence SEQ ID N°5:

’ - GGCGCCACTGCTAGAGATTTT - 5 ’

The target sequence to be amplified by said primers is contained in a test sample which is anything suspected of containing a target sequence such as above defined.

It can be or can be derived from any biological source, such as example blood, biological fluids, plasma, feeces, and tissues. The test sample can be used directly or after a pre-treatment.

The spécifie design of the probe, particularly of the set of primers and probe enables to practically detect ail variants of the HIV-l/SIVcpz/SIVgor lineage with a very high specifîcity of practically 100%.

L

The invention also relates to a method for detecting and quantifying in a test sample HIV-1 circulating forms and their precursors SIVcpz/SIVgor, said method comprising the steps of forming a reaction mixture comprising a primers/probe set such as above defined and a test sample containing a HIV-1, or precursors thereof SIVcpz/SIVgor target sequence, placing the reaction mixture under amplification conditions to form an amplification product and detecting the product/probe hybrid as an indication of the presence of said viruses in sample.

The reaction mixture advantageously comprises reagents which are well known for use in nucleic acid amplification reactions.

Such a real-time RT-PCR assay is relatively inexpensive and able to detect and quantify strains from the HIV-1/SIVcpz/SIVgor lineage, including a wide diversity of group M strains and HIV-1 O.

As illustrated by the Examples, the mean PCR efficiency on HIV-1 M plasma, CRF and URF tested was 99%.

Such an assay can therefore be useful in geographical areas of high HIV diversity and at risk for emergence of new HIV variants. Viral load monitoring for patients receiving anti-retroviral therapy or early viral détection in children can be performed by using the invention.

f.

λ

The invention also relates to kits wherein the above defined primers/probe set is packaged in suitable containers and provided with additional reagents, such as amplification reagents.

Other characteristics and advantages of the invention are given in the following Examples. In said Examples it is referred to Figures l-3 which illustrate, respectively

- Fig. 1, the relationships in pol and env small régions between HIV-1 group O strains tested of Table 1 and HTV-1 group O reference alignment: the left panel is a phylogenetic tree from a pol région (reverse transcriptase; 689 bp) and the tree on the right is derived from a small env région (gp41; 394 bp). Arrows highlight strains from the panel used in the invention; some strains were not sequenced because of material limitations (small plasma volumes available, low plasma viral load). Other group O sequences used as references are from the HIV database (http://www.hiv.lanl.gov/):

- Fig.2, the phylogenetic relationships between SIVcpz and SlVgor viruses tested to evaluate the RT-qPCR assay of the invention: the tree is derived from a small env région (gp41 ; 248 bp), constructed by BioNJ (64). White arrows highlight strains from the fecal sample panel used (except from CR4112 amplified in pol région only and CR6278, 6466, 6495, 6534, 6682 amplified in a small 195 bp région of gp41) and black (idem) highlight strains from plasma samples. These sequences and others used as references are from the HIV database (http://www.hiv.lanl.gov/): and

- Fig. 3A and 3B, the HTV-1 group M RNA viral load quantifiedby the Generic HIV1 viral load Biocentric kit and the RT-qPCR assay according to the invention:

A - in total, 185 samples detected with both techniques were plotted on this linearity plot. The solid line represents the fitted régression. Pearson corrélation r, 0.95 (p<0.0001).

The 2.50 loglO copies/ml limit of détection is represented by grey dashed lines.

B - the 185 samples detected with both techniques were plotted on this Bland-Altman

différence plot. In vertical axis, the différence between Biocentric and new RT-qPCR assay viral load, against the mean viral load between the two techniques, in horizontal axis. The mean bias on the différence (solid line, 0=0.023 log_]0 copies/ml) and limits of agreement (dashed lines) are shown on the graphie. On the right vertical axis are represented two main limits: the +/- 0.5 log₁₀ copies/ml limit and the CI95 interval (-0.027 to 0.072 log_l0 copies/ml).

Materials and Methods

HIV négative plasma samples

For négative control and specifîcity détermination, 72 HIV négative plasma samples from patients attending a hospital in Yaoundé, Cameroon, for a HIV test were available. The negativity of these samples was determined by diverse HIV serological tests (ICE HIV-1.0.2 (Murex Biotech Limited, Dartford, UK), Wellcozyme HIV Recombinant (Murex), Détermine HIV-1/2 (Abbott Laboratories, Tokyo, Japan)).

H1V-1 group M plasma samples

A total of 190 HTV-1 group M RNA extracts from plasma samples were available for viral quantification. Said samples are identified in Table 1 hereinafter. ΛΓ

TABLE 1

Subtype/CRF	Burundi	Cameroon	DRC	Togo	France	Total
A	2	-	6		-	8
B	-	-	-		14	14
C	16	1	3			20
D'		3	-			3
F2		3	-			3
G		-	2	3		5
H		-	3	-		3
J		-	3	-		3
U		-	1	-		1
CRF01		2	1	-		3
CRF02		34	3	25		62
CRF06		2	-	3		5
CRF11		3	1			4
CRF13		-	1			1
CRF14		1	-			1
CRF18		1	-			1
CRF22		8	-			8
CRF37		-	1			1
URF		3	12	6		21
Unknown/Not
done	-	4	2	17	-	23
Total	18	65	39	54	14	190

The 190 samples were detected (possibly below the quantification threshold) by

Generic HIV-1 viral load Biocentric kit and tested with the method of the invention.

Samples were from four different countries in Africa and from France. The subtypes or CRFs of these HIV-1 group M were determined by pol région genotyping analyses.

Twenty-three samples remained unknown since pol région was not amplified for phylogenetic analyses because VL were below 1000 copies/ml (détection limit of the inhouse drug résistance assay with a 200UL volume of plasma as input).

Ail of the samples were previously analytically detected with the Generic HTV-1 viral load Biocentric kit (4) for clinical studies and conserved at -80°C. Their VL ranged between 1.68 and 7.78 logio copies/ml, with 12 out the 190 plasma samples being analytically detected (PCR amplification) but under the threshold of quantification determined by Biocentric (Biocentric quantification threshold, 2.5 logio copies/ml) (5). The remaining 178 plasma samples were clinically positives as quantified by the Biocentric technique (above 2.5 logio copies/ml).

For 167/190 HTV-1 group M positive plasma samples that had a VL superior to 3 logio copies/ml, a région of approximately 1,865 bp in pol (protease and reverse transcriptase régions) was amplified and sequenced as previously described, primarily to détermine the drug résistance profile and génotypes for previous studies.

The different subtypes and CRFs are shown in Table 1. The évaluation included plasma samples from four different countries of Africa with different HTV-1 subtypes/CRFs distribution: 18 from Burundi and 54 from Togo with a relatively low genotypic heterogeneity (mainly subtype C and CRF02, respectively), 65 from Cameroon and 39 from DRC with highly diverse subtypes and CRFs. 14 plasma samples with HTV-1 subtype B strains from the hospital of Montpellier, France (34) were also included.

The panel covered the heterogeneity of subtypes and CRFs of HIV-1 group M circulating strains: ail subtypes, with the exception of subtype K, were represented, major CRFs were also présent, and 21 URFs were included This panel also comprised 23 samples (qualified as “Unknown/Not done” in table 1 from which genotyping was not possible or not performed due to their low viral loads (< 3 logio copies/ml).

HIV-1 group Q plasma samples

The détection and quantification results obtained by RT-qPCR are given in Table

2 below.

TABLE 2

Sample ID VL (Real Abbott) ^VL(nwqm^PCR^

YD1396	2.28	2.43	-0.15
C1/378/LIMA	2.47	2.11	0.37
YD1431	2.53	4.22	-1.69
CM2080	3.04	3.38	-0.35
03/096/A66	3.12	3.84	-0.72
YD656	3.14	4.32	-1.19
CI973	3.18	3.21	-0.03
CM 1070	3.29	3.51	-0.22
C1/251/NKPI	3.65	3.70	-0.06
2778/07	3.68	3.61	0.07
MR140		3.64	New + / Abbott -
HJ2464		3.16	New + / Abbott -
HJ2653		2.18	New + / Abbott -
HJ2656		3.25	New + / Abbott -
YD593
YD594
YD603
1689/09
2634/08
CI706
up0041
HJ2722
	DNA aampte		ΐ-.Λλ
HJ020		3.64
HJ036		4.46
HJ100		4.00
HJ162		3.92
HJ736		-
MI159		4.72
PA206		3.60
SKPI4077		3.32
SKPI1015		5.22

Table 2 is divided in two main parts: the upper part for plasma samples, to test

HIV-1 group O détection and quantification; the lower part for DNA samples, to test for

HIV-1 group O détection. Sample identifications are given. For each sample, the viral loads (VL in logio copies/ml) obtained from both techniques are given if it could be detected (the négative signs in VL columns reflect undetection of samples) and the différence between them is calculated (d = VL(Abbott) - VL(new RT-qPCR) ; in logio copies/ml). “invention assay + / Abbott shows that only the assay of the invention could detect and quantify the corresponding strains.

For HTV-1 group O positive samples, a small région in env (gp41) of approximately 450 bp and/or a région in pol (reverse transcriptase) of approximately 1,800 bp were amplified and sequenced when enough material was available (14/31 samples).

The group O strains sequenced and tested in this study covered the HTV-1 group O genetic diversity as depicted on Figure 1 .

STVcpz plasma samples from chimpanzees

Plasma samples from three previously described STVcpz infected chimpanzees and one non-infected chimpanzee as a négative control were tested.

Two SIVcpz⁺ chimpanzees (Gab2 and Ch-Go) are from the Pan troglodytes troglodytes subspecies and were infected with SIVcpzPzz-Gab2 and STVcpzPzzCaml55, respectively.

These strains cluster in the SIVcpzPff/HJV-lM/HTV-lN lineage close to other SIVcpzPzz infecting chimpanzees from Cameroon and Gabon (Figure 2).

Ch-No, the third STVcpz positive chimpanzee, is from the P.t.schwemfurthii subspecies and was infected with STVcpzPZi-ant that clusters in the monophyletic lineage of SIVcpzPzs strains, out of the SIVcpzPzz/SIVgor/HIV-l lineage (8,9).

Sequential plasma samples were available for Ch-Go (two time points seven years apart) and for Ch-No (four time points between October 1989 and January 1991).

The results are given in Table 3 below.

TABLE 3

Chimpanzee ID subspecles	SIVcpz	Plasma Sample ID	RNA extraction date	Serology	Détection Quantification (log,, coples/ml)
Ch-Go P.t.troglodytes	SlVcpzPttCam155	CAM155-01.05.04 CAM155-31.03.11	26.02.09 01.04.11’	+ +	+ 5.12 + 4.64* + 4.92*
Gab2 P.ttroglodytes	SlVcpzPttGab2	GAB2-01.04.88-1 GAB2-01.04.88-2	12.04.11 12.04.11	+ +	+ 3.26 + 3.29
Ch-No P. tschwelnfurthll	SlVcpzPtsANT	NOAH-29.09.89 NOAH-27.10.89 NOAH-14.04.90 NOAH-08.01.91	12.04.11 12.04.11 12.04.11 12.04.11	+ + + +	+ 2.68 + 3.98*
Ch-NI P.t.schweinfurthii	Négative	NIKO-O7.11.89 NIKO-O7.11.89	12.04.11 12.04.11

HTV7SIV RNA extraction from plasma samples

HIV and SIV RNA were extracted from 200 μΐ of plasma, conserved at -80°C, using QIAamp Viral RNA Mini kit (Qiagen, Courtabeuf, France) and eluted with 60 μΐ of elution buffer. Standards and the reproductive control, provided by Generic HIV-1 viral load Biocentric kit (Biocentric, Bandol, France), were culture supematants of HTV15 1 subtype B and were extracted with the same protocol.

Fecal samples from wild living chimpanzees and gorillas infected with SIV fecal samples, conserved in -RNAlater™, from chimpanzees (n=24) and gorillas (n=54) from Cameroon previously described to hâve HTV-1 cross-reactive antibodies (10, 11).

In these previous studies, fragments in pol and/or gp41 viral régions from five chimpanzee samples (5/24) and from fifteen gorilla samples (15/54) were amplified and sequenced after two to ten independent RNA extractions and subséquent RT-PCR attempts.

These strains represented the genetic diversity of SIVcpzPtt and SlVgor viruses Here, total RNA was extracted from 1.5 ml of each ape’s fecal sample, using the NucliSens Magnetic Extraction kit (Biomérieux, Craponne, France) as previously described (11 ), to obtain a final RNA extract volume of 50 μΐ.

The results obtained are given in Table 4 below.

TABLE 4

Fecal samples	Individua 1	RT-PCR amplification after multiple attempts on various RNA extracts a	RT-PCR amplification on the given RNA extractb	Real-time RTPCR détection on the given RNA extractc	VL if detected d
SFvfopzZYfinfecI	ed chimpanzees		S •
Caml55-1	Ch-Go	-	-
Caml55-4		-	-	-
Caml55-2		Pos	Pos	Pos	1.9
Caml55-3		Pos	Pos	Pos	2.56
CR4891	BYc-IDl	Pos		Pos	1.63
CR3261	DJc-DDl	Pos
CR6369	DJc-ID3	-
CR5137	MBc-ID4	-
CR5138		-
CR6232	MBc-ID8	-
CR6233		Pos	Pos
CR6234
CR6235
CR6236
CR6386
CR6387				Pos	2,75*
CR6388				Pos	2.71
CR6254	MBc-ID9			-
CR6405	MBc- ID11	-	-	Pos	2,45*
CR6406		-	-	-
CR6407		-	-	Pos	2.34

CR6413		-	-		-
CR6414		-	-		Pos	2.46
CR6411	MBc- ID10	-	-	-
			ïtedgôriBes -,	o 1®	ïamMK	jZ iftfflsfc*'
CR6684	CPg-ID?	-		-
CR3428	CPg- ID01	Pos	-		-
CR3428		Pos	-		Pos	1.66
CR6101	CPg- ID02	-	-	-
CR6435	CPg- ID04	-	-		-
CR6437					-
CR6438					-
CR6451					-
CR6473					-
CR6477					-
CR6481					Pos	2.55
CR6485					-
CR6486					-
CR6495		Pos			-
CR6640		-			-
CR6641		-			Pos	2.57
CR6682		Pos			-
CR5752	CPg- ID05	-	-		-
CR5803		-	-		-
CR5804		-	-		-

CR5849		-		-
CR6442		-		Pos	1.56
CR6453		-		-
CR6465		-		Pos	2.17
CR6466		Pos		-
CR6476				-
CR6478				Pos	2.21
CR6488				-
CR6489				-
CR6685				-
CR2744	CPg- ID11	-	-	-
CR2749		-	-	-
CR3018	CPg- ID13	-	-	-
CR3403	CPg- ID30	Pos	-	Pos	1.65
CR3411	CPg- ID31	Pos	-	-
CR6631	CPg- ID37	-	-	-
CR6635		-	-	-
CR4763	CPg- ID38	Pos	Pos	-
CR5832	CPg- ID60	-	-	-
CR5816	CPg- ID65	-	-	-
CR6484		-	-	-

CR6534	CPg- ID66	Pos	-	-
CR6555		-	-	-
CR5810	CPg- ID67	-	-	-
CR6688	CPg- ID72	-	-	-
CR6090	CPgmixed	Pos	Pos	Pos	1.66
CR6091		Pos	Pos	-
CR3795	DJg-IDl	Pos	-	-
CR4099b	DJg-ID2	Pos	-	Pos	1.64
CR5265	DJg-ID3	-	-	Pos	1.66
CR4112	DJg-ID4	Pos	-	-
CR6259	DJg-Idx	-	-	Pos	2,84*
CR6278		Pos	Pos	Pos	2,76*
CR6279		-	-	Pos	2.59
Total	20	7	21

Development of a real-time RT-qPCR assay for détection and quantification of viral strains from the HIV-l/SIVcpz/SIVgor lineage

The following primera and probe were designed designed using an alignment of sequences from various HIV-1 strains from ail four groups (M, N, O, and P), SIVcpzPtt and SIVcpzPts, and SlVgor viruses. The LTR région was firstly explored for its low variability between strains and located the best positions for the primera and the probe.

The forward primer (HXB2 position 523-539) of sequence SEQ ID N°3: 5’SSCTCAATAAAGCTTGCC-3’) was designed and the reverse primer (HXB2 position

622-642) of sequence SEQ ID N°4: 5’-AAAATCTCTAGCAGTGGCGCC-3’ was as Rouet et al. 2007 (15).

They amplified a small fragment of 120 bp. These primera were set to amplify HIV-1 groups M, N, O, and P, SIVcpzPtt, SIVcpzPts, and SlVgor viruses, since they matched ail sequences with 100 %homology.

The new probe (HXB2 position 588-603) of sequence SEQ ID N°l: 5’-CTAGAGATCCCTCAGA-3’was a reverse internai TaqMan probe carrying a 5’ F AM reporter and a 3’ minor groove binding - non-fluorescent quencher (Applied Biosystems, Foster City, CA).

The sequence of the probe was designed to bind with ail HIV-1 groups ( tested sequences) SIVcpzPtt, and SlVgor viruses. Of note one mismatched nucléotide residue at the 3’-end was observed for three SIVcpzPts strains (SIVcpzPtsTANl, 2, 3).

Ail runs were performed in a 20 μΐ reaction volume containîng 10 μΐ of RNA extract, the primera and the probe at 500 nM, IX of TaqMan Fast Virus 1-step Master Mix (Applied Biosystems) and RNase-free water to the final volume.

Thermal cycling conditions were as follows: reverse transcription at 50°C for 5 min, RT inactivation and initial dénaturation at 95°C for 20 sec, and amplification with 50 cycles at 95°C for 3 sec and 58°C for 30 sec (total duration ~ 70 min).

Cycling and data acquisition were carried out using the 7500 Real Time PCR system (Applied Biosystems).

Five standards were used: from the Optiquant™ HIV-1 RNA Quantification Panel (2.78, 3.78, 4.78, 5.78, 6.78 logio copies/ml) and the Optiquant™ HIV-1 RNA lowpositive control (3.78 logio copies/ml) (Biocentric).

The maximum lower-limit at which a sample can be correctly quantified was assessed by diluting the 3.78 logio copies/ml standard to two low concentrations (2.50 and 1.78 logio copies/ml). They were tested in eight replicates.

RT-qPCR reference techniques

The Generic HTV-1 viral load Biocentric assay was used as a reference for group M détection and quantification, following the manufacturées instructions. This Biocentric assay was previously validated as compared to Versant bDNA HIV RNA kit v3.0 (Siemens Healthcare Diagnostics Inc., Deerfîeld, IL) and Amplicor HIV-1 Monitor standard RT-PCR assay vl.5 (Roche Molecular Systems, Pleasanton, CA) 5,7) in view of its capacity to detect a wide diversity of HIV-1 group M subtypes and CRFs.

Using 200 μΐ of plasma, the threshold of the Biocentric assay was set at 2.50 logio copies/ml. The total duration of the amplification was ~ 120-140 min.

Cycling and data acquisition were carried out using the ABI Prism 7000 Sequence Détection System or the 7500 Real Time PCR System (Applied Biosystems).

The Abbott m2000rt RealTime™ HTV-1 assay (Abbott Molecular Inc., Des Plaines, IL) was used as a reference for group O détection and quantification, since it was previously validated for HIV-1 group O sample quantification. The technique was performed in the 1MPM/1RD laboratory in Yaoundé, Cameroon, according to the manufacturées instructions.

Statistical analyses

The STATA software package version 10.1 (Stata Corp., College Station, Texas) was used for ail statistical analyses described. The standards and the low-positive control were tested in ten independent runs to détermine the reproducibility, the linearity, and the between-run variability of our RT-qPCR technique. Within-run variability was assessed by testing six different samples (fîve standards and the low-reproductivev control) in eight replicates in the same run. The specifîcity ofthe assay was calculated as the number of négative samples out of the total number of tested samples from uninfected individuals. The analytical sensitivity for HIV-1 M RNA was calculated as the number of samples detected with the technique according to the invention divided by the number of samples detected with the Biocentric generic assay, including samples under the quantification threshold. Corrélation between results from Generic Biocentric test and the RT-qPCR assay of the invention were measured by a Pearson corrélation coefficient and by a Spearman rank corrélation coefficient for results from each country. A Bland-Altman différence plot for bias and agreement measurements was generated, including limits of agreement (12).

Results

Reproducibility. and variations between and within runs.

The inter-assay reproducibility of the standard curve with the RT-qPCR method of the invention was assessed on ten independent assays. In ail cases, there was a strong linear corrélation between the cycle threshold values found in each experiment and the viral load (logio copies/ml) with a médian corrélation coefficient of 1.00 (range, 0.99 to 1.00). The mean slope of the standard curve was -3.33 (range, -3.44 to -3.15), correspondîng to a mean amplification efïiciency of 99.2 %. The standard with the lowest concentration (2.78 logio copies/ml) was always detected and amplified. The diluted sample at 2.50 logio copies/ml was always detected and quantified with a low coefficient of variation (inferior to 15%), whereas the diluted sample at 1.78 logio copies/ml was detected in six out of eight replicates. Thus, our RT-qPCR assay has a quantification threshold inferior to 2.50 logio copies/ml using an input volume of 200 μΐ of plasma (limit included in the 1.78-2.50 logio copies/ml interval). The low-positive control at 3.78 logio copies/ml was added to each test and was used to further assess the reproducibility and détermine the between-run variation. The mean value of this positive control was 3.83 logio copies/ml (SD, +/- 0.19) with a coefficient of variation of 4.8 %. 0

These data are highly similar to what has been determined for the Generic HIV viral load Biocentric assay, confirming a good inter-run reproducibility.

To assess the within-run variation, the standards (n=5) and the low-positive control were each replicated eight times in the same experiment. The low-positive control and the standards were always detected and correctly quantified with a mean coefficient of variation of4.0 % (SD, +/- 0.2).

The analyses of HIV-1 group M and HIV négative samples show that the assay has a good sensitivity and specificity.

For the analytical évaluation, a total of 190 HTV-1 group M positive plasma samples were detected by Generic HIV viral load Biocentric assay and tested with the new RT-qPCR test (VL range, 1.68 to 7.78 logio copies/ml).

Out of them, 185 plasma samples were effectively detected with the technique of the invention (VL range, 2.14 to 8.07 logio copies/ml).

The analytical sensitivity of the assay according to the invention could be estimated at 97.4% (CI95,94.0 to 99.1%).

Five samples, with a Biocentric viral load between 2.18 and 3.04 logio copies/ml, were not detected with our assay, including three under the Biocentric quantification threshold (2.5 logio copies/ml).

Two samples had a viral load superior to the quantification threshold: one from Cameroon (VL(Biocentric), 3.04 logio copies/ml) from which no génotype could be obtained despite two amplification attempts in the conserved pol région, and one from DRC (VL, 2.94 logio copies/ml) with no genotyping available.

The specificity of the test was assessed with 72 HIV négative samples from Cameroon. Ail samples yielded négative results with our test. Thus, the specificity of the assay was 100% (CI95,95.9 to 100%).

Excellent corrélation between the test according to the invention and the reference Biocentric assay for the quantification of HIV-1 group M, irrespective of the génotype.

Biocentric HIV viral load results and the RT-qPCR assay viral load measures according to the invention were both available for 185 HTV-1 group M plasma samples.

An excellent corrélation was found between the results of both assays (Pearson corrélation coefficient r=0.95; p<0.0001).

Considering the quantification threshold of 2.5 logio copies/ml, the Biocentric assay and the RT-qPCR test ofthe invention quantifïed 178 and 179 samples above this limit, respectively.

Three samples were under the threshold with both techniques, while four and three samples were under the threshold with Biocentric and the assay of the invention, respectively.

The agreement between the two assays was determined by the Bland-Altman différence plot (Figure 3B) (12). The mean viral load différence between the two tests was of 0.02 logio copies/ml and was not significantly different from 0 (p=0.37). Importantly, the différence between both assays did not increase at low or high viral loads (no corrélation between the différence and the mean of both assays’ viral loads, r=0.09; p=0.24). Standard déviation was of 0.34 logio copies/ml and the confidence interval 95% was ranging from -0.03 to 0.07, included in the +/- 0.50 logio copies/ml limits (45). In total, 95.1% of the 185 quantifîed samples were inside the limits of agreement (mean+/-1.96 SD).

Two samples, subtype H and CRF02, had higher viral load with the Biocentric technique (Table 1)

However, seven samples: one subtype B, one CRF22, one CRF37, two CRF02, and two with unknown génotype had higher viral load with our new RT-qPCR method with a mean différence of -0.92 logio copies/ml.

The tested panel of HIV-1 group M samples was very diverse and covered the genetic diversity of HIV-1 group M subtypes and CRFs. Each subtype or CRF was represented by one to 62 samples. Samples for this study came from four different countries of Africa with very distinct HIV-1 molecular epidemiology and from one hospital in France to détermine if these different molecular epidemiological situations would impact negatively on the quantitative assay according to the invention, an assessment of the corrélation between Biocentric and the technique of the invention was performed for each studied country.

It was found that for each African country the Spearman corrélation coefficient between the two techniques was superior to 0.95 (p<0.0001), irrespective of the molecular epidemiological situation (i.e. the panel from Burundi had samples mostly from subtype C, whereas the panel from DRC harbored a high genetic diversity with 11 different subtypes or CRFs, 12 URFs and 2 from unknown génotype. The test of the invention thus showed very good capacity to quantify the viral load of HIV-1 group M plasma samples, irrespective of the molecular epidemiological situation and the HIV-1 group M génotype.

Détection and quantification of HTV-1 group O strains

HIV-1 group O samples were tested for viral détection with the RT-qPCR assay according to the invention, 22 were plasma samples previously tested with Abbott

RealTime™ kit and nine were DNA extracts with HIV-1 group O sequence confirmation (Table 2).

With the method of the invention, ail ten HIV-1 group O plasma samples that were previously detected with the Abbott kit were detected, showing that the assay of the invention can readily detect HIV-1 group O viruses.

A comparison was then carried out between Viral loads of each plasma sample assessed with the technique of the invention and with Abbott RealTime™ assay.

For seven out of ten HIV-1 group O samples, a good corrélation was found with a mean viral load différence of -0,05 logio copies/ml (range of d VL(Abbott) - VL(new qRT-PCR), -0.35 to 0.37 logio copies/ml).

Three samples were quantified with a signifîcantly higher viral load than Abbott technique (ô, -0.72, -1.19, and -1.69 logio copies/ml).

Importantly, four additional HIV-1 group O strains that were undetected by the reference method could be detected. The viral loads of these four samples ranged from 2.18 to 3.64 logio/ml.

Thus, the technique of the invention allowed to detect and quantify more HIV-1 group O viral RNA than the reference method (higher analytical sensitivity, 64% vs 45%) and some samples detected by both methods had higher viral loads with the method of the invention.

As shown by the phylogenetic trees in pol and env régions (Fig. 1 ) the strains from the panel covered the HIV-1 group O diversity in these régions. Jf

These data clearly show that the technique of the invention provides a better quantification ofHIV-1 group O viruses than gold-standard commercial test, irrespective of the genetic diversity.

SIVcpzPzz and SIVcpzPZs RNA détection and quantification

The SIVcpz strains from the three infected chimpanzees were readily detected with the assay of the invention, while the two plasma samples from Ch-Ni, the SIV négative chimpanzee, were négative (Table 3), showing that the RT-qPCR assay of the invention was able to specifically detect both SIVcpzPts and SIVcpzPtt strains.

Plasma samples from Caml55 were ail detected and quantified and had viral loads of approximately 5 logio copies/ml (Table 3).

Previously, the quantification of the plasmatic SIVcpzPzzCaml55 RNA concentration was also carried out with the bDNA assay in 2004 (Versant HTV-1 RNA 3.0) and the Abbott RealTime™ test in 2011. In 2004, the VL(Versant) was 5.09 logio copies/ml, not signifïcantly different from the viral load found with the RT-qPCR assay of the invention. However, a viral load of 3.76 logio copies/ml was found with the Abbott test in 2011, which was signifïcantly lower than with the technique of the invention (d, -1.02 logio copies/ml).

The assay of the invention allowed to detect and quantify SIVcpzPzzGab2 from a plasma sample of chimpanzee Gab2 drawn in April 1988. Two independent RNA extractions and quantifications were performed and similar viral loads around 3 logio copies/ml (Table 3) were found. The strain infecting Ch-No is from the SIVcpzPzs lineage, a clade more divergent from HTV-1 than SIVcpzPzz. However, the test of the invention was still able to detect and quantify this divergent variant. For Ch-No, four sequential blood samples taken between September 1989 and January 1991 were used: the first two at the end of 1989 had an undetectable viral load and the last two in April

1990 and Januaiy 1991 had détectable viral loads of 2.68 and 3.98 logio copies/ml, respectively.

Previously, Kestens and colleagues observed a fluctuating pattern with the measurement of viral titers in plasma varying from undetected to 1,000 TCID/ml. From the end of 1997 to 2001 (i.e. dates after the panel of the invention), Ondoa et al. quantifîed viral RNA from Ch-No plasma samples with a spécifie in-house assay and values varied from 3.93 to 5.80 logio copies/ml (13,14) in the range of the viral loads found according to the invention.

Therefore, despite the high genetic distances between SIVcpz strains, the assay according to the invention was able to detect and quantify the SIVcpzPZZ and SIVcpzPzs RNA from chimpanzee plasma samples.

SIVcpz and SlVgor détection from fecal samples

Here, the détection of SIVcpzF’ZZ and SlVgor viral RNA from fecal samples was tested (i) to détermine if the real-time RT-PCR assay of the invention was able to detect both types of viruses, direct ancestors of ail HIV-1 groups, and (ii) to test whether this assay was enough sensitive for viral détection in fecal samples.

fecal samples from nine different P.t.troglodytes chimpanzees were tested by serology, to be infected with SIVcpzF’ZZ. Since these chimpanzees were from four different locations in south Cameroon and because of the phylogeographic clustering of SIVcpzPzz, the viruses tested were expected to hâve high genetic distances between them, which could be confirmed for four of them.

Here, from a unique RNA extract, SIVcpzPzz could be amplified from only three fecal samples (corresponding to two individuals) with the conventional RT-PCR, while

SIVcpzRtt could be detected from eight fecal samples (corresponding to four individuals) with the real-time RT-PCR assay (Table 4).

Sequence analyses confîrmed that the amplifîed LTR fragments were corresponding to SIVcpzPtZ. It is thus possible to detect SIVcpzPH in fecal samples using this real-time RT-PCR system. The sensitivity of the assay according to the invention is better than with conventional RT-PCR.

In addition, 54 fecal samples from 22 G.g.gorilla individuals from Cameroon previously shown, by serology, to be infected with SlVgor were tested.

In previous studies of the inventors, SlVgor small fragments were amplifîed and sequenced with a conventional RT-PCR in only 15 samples after multiple extractions and amplification attempts.

Here, on a unique RNA extract, SlVgor viruses from only four fecal samples (corresponding to three infected gorillas) could be amplifîed with the conventional RTPCR, while SlVgor viruses could be detected in 13 fecal samples (corresponding to eight individuals) with the real-time RT-PCR assay of the invention (Table 4).

By LTR sequencing analyses, it was confîrmed that the amplifîed fragments were corresponding to SlVgor.

The above results clearly establish that the method of the invention is thus able to detect SlVgor viruses in fecal samples.

After one attempt, the real-time assay of the invention was able to detect SlVgor strains on 24% of the samples, compared to only 7% with the conventional method.

As shown by the above results, the tools and real-time RT-PCR assay of the invention allow to detect and quantify a wide range of HIV-1 variants and their progenitors SIVcpz and SlVgor, infecting chimpanzees and gorillas respectively .The cost per reaction was comparable to costs of other generic or ‘in-house’ assays and most importantly, highly inferior to commercial tests around 50-100 $ per reaction.

Advantageously, the assay of the invention has a high PCR effîciency with low variations between and within runs (coefficients of variation, 4.8% and 4.0%, respectively). The quantification threshold was inferior to 2.50 logio copies/ml (range, 1.68 to 2.50) with an input volume of 200 μΐ, which is comparable with commercial assays with the same input volume. These technical characteristics are also similar to those reported for other generic or ‘in-house’ assays.

The specifîcity of the test according to the invention was 100% (CI95, 95.9 100%). This parameter is essential for a good viral load assay since a false positive resuit could hâve adverse conséquences for a patient on ART with a normally undetectable viral load. The analytical sensitivity of this new real-time assay, 97.4% (CI95, 94.0 to 99.1%), was calculated on 190 HIV-1 group M positive samples previously tested with the Generic Biocentric kit (VL range, 1.68 to 7.78 logio copies/ml). Eight samples with a viral load between 2.5 and 3 logio copies/ml were effectively detected and seven others with a viral load inferior to 2.5 logio copies/ml according to the Biocentric assay could be detected by using the test of the invention.

The Generic Biocentric assay and the RT-qPCR test according to the invention are highly correlated (r=0.95, p<0.0001) with no signifîcant différence between their mean viral load (p=0.37) as tested on 185 HIV-1 group M samples (range, 1.68 to 7.78 logio copies/ml), and 95.1% of quantified samples were within the limits of agreement between the two methods (mean +/- 1.96 SD) (12). Seven samples from various subtypes were significantly better quantified with the method of the invention (ô > +/17400

0.5 logio copies/ml). Importantly, three of them had viral loads under the Biocentric threshold but were quantified with the assay of the invention above the 2.5 logio copies/ml limit.

The panel used according to the invention included HIV-1 group M samples from five different countries (four in Africa and one in Europe) with very diverse HTV-1 subtype/CRF distribution , including 39 samples from DRC and 65 from Cameroun, two countries with an extensive genetic diversity. For each country, an excellent corrélation was found between both VL methods’ results, showing that HTV-1 group M diversity did not impact negatively on the viral quantification performed according to the invention. This aspect is of major importance, and VL assays should always be validated and further evaluated in different countries with different molecular epidemiological features, as it has been done for previous ‘in-house’ assays developed for resourcelimited settings.

Unlike previously described ‘in-house’ tests, the RT-qPCR assay of the invention was also able to detect and quantify HIV-1 group O viruses from plasma samples. Importantly, out of 22 group O samples, four samples that were not detected by the Abbott Real-tiwe™ assay were detected and quantified by carrying out the assay of the invention and higher viral loads were measured in three samples (d, -1.69 to -0.72), showing that the method of the invention is more sensitive than the commercial assay.

In the experiments carried out according to the invention, a significantly high number of HIV-1 group O strains (22 plasma samples and nine DNA extracts representing 31 different HTV-1 O strains) was tested. Importantly, the group O panel covered HTV-1 group O genetic diversity, reflecting that the high genetic diversity of this group did not impact on the détection. The new assay has then the capacity to detect highly divergent strains (HTV-1 groups N and P) as found in only few cases in humans, since it can detect genetically distant STVcpz and STVgor strains.

Because of the ongoing risk of cross-species transmissions of SIVs from apes to humans and the necessity to follow SIVcpz and STVgor infection in their naturel hosts to better understand the pathogenicity of these HIV-1 progenitors in their naturel hosts, the assay was also develop with the goal to detect and quantify ail viruses from the HIV1/SIVcpz/SIVgor clade.

As shown by the results given above, the assay of the invention is particularly useful to detect and quantify SIVcpzPzz and STVcpzPzs viruses in plasma samples from western and eastem central African chimpanzees. Plasmatic SIVcpz viral loads found in naturally infected chimpanzees appear to be in the range of HIV-1 viral loads in humans. Besides, SIVcpzPzz was detected from 33% of SIV séropositive chimpanzee fecal samples with the real-time assay of the invention, versus an amplification success (at first attempt) of 13% on the same panel with a basic RT-PCR in pol or env small fragments. The test was also able to detect SlVgor viruses, precursors of HIV-1 group P and probable ancestors of HIV-1 group O.

STVgor strains were amplified from 24% of 54 SIV séropositive gorilla fecal samples versus 7% of amplification success on the same panel at first attempt with a conventional RT-PCR using SJVgor spécifie primera targeting a gp41 small fragment.

The new assay can be a good complément to basic RT-PCR to confîrm viral presence in séropositive samples. The results also confîrm that SIVcpz and SlVgor viral loads are very low in fecal samples. Interestingly, SIVcpzPzz viral loads from both plasma and fecal samples could be tested for Ch-Go, and a more than 100-fold différence between both compartments (Tables 3 and 4, first lines) was found. The amplification of such divergent variants, SIVcpz and SlVgor, was not possible with the

Biocentric technique, and SIVcpz quantification seemed suboptimal with Abbott Real·

assay. Therefore, the real-time RT-PCR test of the invention is a new

opportunity to detect possible new emerging simian immunodeficiency viruses from apes to humans.

Tn conclusion, the invention provides a relatively low-cost real-time RT-PCR assay able to detect and quantify ail viral strains from the HTV-l/SIVcpz/SIVgor clade, meaning that HIV-1 diversity is covered and that HTV-1 precursors can also be monitored. This new test is thus a breakthrough in the field of viral load quantification since it could monitor any HIV-1 strains currently circulating in humans but could also detect new SIV émergences of SIVcpz/SIVgor in humans.

References

1. Lambert, J. S., D. R. Harris, E. R. Stiehm, J. Moye, Jr., M. G. Fowler, W. A. Meyer, 3rd, J. Bethel, andL. M. Mofenson. 2003. Performance characteristics of HIV-1 culture and HIV-1 DNA and RNA amplification assays for early diagnosis of périnatal HIV-1 infection. J Acquir Immune Défie Syndr 34:512519.

2. Fiscus, S. A., B. Cheng, S. M. Crowe, L. Demeter, C. Jennings, V. Miller, R. Respess, and W. Stevens. 2006. HIV-1 viral load assays for resource-limited settings. PLoS medicine 3:e417.

Plantier, J. C., M. Leoz, J. E. Dickerson, F. De Oliveira, F. Cordonnier, V. Lemee, F. Damond, D. L. Robertson, and F. Simon. 2009. A new human immunodefîciency virus derived from gorillas. Nature medicine 15:871-872.

4. Drosten, C., M. Panning, J. F. Drexler, F. Hansel, C. Pedroso, J. Yeats, L. K. de Souza Luna, M. Samuel, B. Liedigk, U. Lippert, M. Sturmer, H. W. Doerr, C. Brites, and W. Preiser. 2006. Ultrasensitive monitoring of HIV-1 viral load by a low-cost real-time reverse transcription-PCR assay with internai control for the 5' long terminal repeat domain. Clinical chemistiy 52:1258-1266.

5. Rouet, F., D. K. Ekouevi, M. L. Chaix, M. Burgard, A. Inwoley, T. D. Tony, C. Danel, X. Anglaret, V. Leroy, P. Msellati, F. Dabis, and C. Rouzioux. 2005. Transfer and évaluation of an automated, low-cost real-time reverse transcription-PCR test for diagnosis and monitoring of human immunodefîciency virus type 1 infection in a West African resource-limited setting. J Clin Microbiol 43:2709-2717.

6. Gueudin, M., J. C. Plantier, F. Damond, P. Roques, P. Mauclere, and F. Simon. 2003. Plasma viral RNA assay in HIV-1 group O infection by real-time PCR. Journal of virological methods 113:43-49.

7. Rouet, F., M. L. Chaix, E. Nerrienet, N. Ngo-Giang-Huong, J. C. Plantier, M. Burgard, M. Peeters, F. Damond, D. K. Ekouevi, P. Msellati, L. Ferradini, S. Rukobo, V. Maréchal, N. Schvachsa, L. Wakrim, C. Rafalimanana, B. Rakotoambinina, J. P. Viard, J. M. Seigneurin, and C. Rouzioux. 2007. Impact of HIV-1 genetic diversity on plasma HTV-1 RNA Quantification: usefiilness ofthe Agence Nationale de Recherches sur le SIDA second-generation long terminal repeat-based real-time reverse transcriptase polymerase chain reaction test. J Acquir Immune Défie Syndr 45:380-388.

8. Peeters, Μ., K. Fransen, E. Delaporte, M. Van den Haesevelde, G. M. GershyDamet, L. Kestens, G. van der Groen, and P. Piot. 1992. Isolation and characterization of a new chimpanzee lentivirus (simian immunodefîciency virus isolate cpz-ant) from a wild-captured chimpanzee. AIDS 6:447-451.

9. Vanden Haesevelde, Μ. Μ., M. Peeters, G. Jannes, W. Janssens, G. van der Groen, P. M. Sharp, and E. Saman. 1996. Sequence analysis of a highly divergent HTV-1-related lentivirus isolated from a wild captured chimpanzee. Virology 221:346-350.

10. Neel, C., L. Etienne, Y. Li, J. Takehisa, R. S. Rudicell, I. N. Bass, J. Moudindo, A. Mebenga, A. Esteban, F. Van Heuverswyn, F. Liégeois, P. J. Kranzusch, P. D. Walsh, C. M. Sanz, D. B. Morgan, J. B. Ndjango, J. C. Plantier, S. Locatelli, M. K. Gonder, F. H. Leendertz, C. Boesch, A. Todd, E. Delaporte, E. MpoudiNgole, B. H. Hahn, and M. Peeters. 2010. Molecular epidemiology of simian immunodefîciency virus infection in wild-Iiving gorillas. Journal of virology 84:1464-1476. (i

11. Etienne, L., S. Locatelli, A. Ayouba, A. Esteban, C. Butel, F. Liégeois, A. Aghokeng, E. Delaporte, E. Mpoudi Ngole, and M. Peeters. 2012. Non-invasive follow-up of simian immunodeficiency virus infection in wild-living nonhabituated western lowland gorillas in Cameroon. Journal of virology.

12. Bland, J. M., and D. G. Altman. 1999. Measuring agreement in method comparison studies. Statistical methods in medical research 8:135-160.

13. Ondoa, P., L. Kestens, D. Davis, C. Vereecken, B. Willems, K. Fransen, J. Vingerhoets, G. Zissis, P. ten Haaft, J. Heeney, and G. van der Groen. 2001. Longitudinal comparison of virus load parameters and CD8 T-cell suppressive capacity in two SIVcpz-infected chimpanzees. Journal of medical primatology 30:243-253.

14. Ondoa, P., D. Davis, B. Willems, L. Heyndrickx, L. Kestens, I. van der Berg, S. Coppens, W. Janssens, J. Heeney, and G. van der Groen. 2001. Genetic variability of the VI and V2 env domains of SIVcpz-ant and neutralization pattern of plasma viruses in a chimpanzee infected naturally. Journal of medical virology 65:765-776.

15.. Rouet, F., H. Menan, J. Viljoen, N. Ngo-Giang-Huong, K. Mandaliya, D. Valea, T. X. Lien, S. Danaviah, D. Rousset, A. Ganon, and E. Nerrienet. 2008. In-house HIV-1 RNA real-time RT-PCR assays: principle, available tests and usefulness in developing countries. Expert review of molecular diagnostics 8:635-650.

!1 1 MAI 2015

Cajmnet Cazenave Sari

UÀ Propriété Industrielle

BR500 Yaoundé (Cameroun) Tél.. (237) 222132 89-Fa*: (237) 22 2^414 E-mail : cabtoetC8zenave@hotfMJI.fr

Claims (5)

1. CLAIMS l - Oligonucleotide of sequence SEQ ID N°1 :

   5’- CTAGAGATCCCTCAGA - 3’, and the complementary sequence thereof of sequence SEQ ID N° 2:

   5’- TCTGAGGGATCTCTAG - 3’ useful as probes to detect and quantify ail HIV-1 circulating forms and their precursors SIVcpz/SIVgor.
2. 2- The probe of claim 1 consisting in a Taqman probe with a fluorescent marker at the 5’position and a quencher at the 3'position.
3. 3 - Primers/probe set wherein the primers consist of a forward primer of sequence SEQ IDN°3.·

   5’- SSCTCAATAAAGCTTGCC-3’ wherein S represents G or C and a reverse primer of sequence SEQ ID N°4:

   5’-AAAATCTCTAGCAGTGGCGCC-3’ or the complementary sequence thereof of sequence SEQ ID N°5:

   5’ - GGCGCCACTGCTAGAGATTTT - 3’ and the probe of said set is according to claim 1 or 2.
4. 4 - A method for detecting and quantifying in a test sample HTV-1 circulating forms and their precursors SIVcpz/SIVgor, said method comprising the steps of forming a reaction mixture comprising a primers/probe set such as defined in claim 3 and a test sample containing a HTV-1, or precursors thereof SIVcpz/SIVgor target sequence,Æ

   Ν' placing the reaction mixture under amplification conditions to form an amplification product and detecting the product/probe hybrid as an indication ofthe presence of said viruses in sample forming an hybrid between the amplification product and a probe
5. 5 - detecting the hybrid as an indication of the presence of HIV-

   1/SIVcpz/SIVgor in the test sample.

   5 - Kits for detecting and quantifying in a test sample HIV-1 circulating forms and their precursors STVcpz/SIVgor, comprising primers/probe set as defined in claim 3 in 10 suitable containers and provided with additional reagents, such as amplification reagents.A