OA17327A

OA17327A - Use of telomerase inhibitors for the treatment of myeloproliferative disorders and myeloproliferative neoplasms.

Info

Publication number: OA17327A
Application number: OA1201500210
Authority: OA
Inventors: Monic J. Stuart; Stephen Kelsey
Original assignee: Geron Corporation
Priority date: 2012-12-07
Filing date: 2013-11-15
Publication date: 2016-05-23

Abstract

Provided herein are methods for reducing neoplastic progenitor cell proliferation and alleviating symptoms associated in individuals diagnosed with or thought to have myeloproliferative disorders, such as Essential Thrombocythemia (ET). Also provided herein are methods for using telomerase inhibitors for maintaining blood platelet counts at relatively normal ranges in the blood of individuals diagnosed with or suspected of having myeloproliferative disorders, such as ET.

Description

USE OF TELOMERASE INHIBITORS FOR THE TREATMENT OF

MYELOPROLIFERATIVE DISORDERS AND MYELOPROLIFERATIVE

NEOPLASMS

CROSS-REFERENCE TO RELATED APPLICATIONS

This application daims priority to U.S. Provisional Patent Application No. 61/734,941, filed December 7,2012, U.S. Provisional Patent Application No. 61/799,069, filed March 15,2013, U.S. Patent Application No. 13/841,711, filed March 15,2013, and U.S. Provisional Patent Application No. 61/900,347 filed November 5,2013, the disclosures of which are incorporated 10 by reference herein in their entireties.

FIELD OF THE INVENTION

This invention relates to methods for using telomerase înhibitor compounds to treat or prevent symptoms assocîated with myeloproliferative disorders or neoplasms such as Essential Thrombocythemia (ET).

BACKGROUND

Hématologie malignancies are forms of cancer that begin in the cells of blood-forming tissue, such as the bone marrow, or in the cells of the immune System. Examples of hématologie cancer are acute and chronic leukemias, lymphomas, multiple myeloma and myelodysplastic syndromes.

Myeloproliferative neoplasms, or MPNs, are hématologie neoplasms that arise from neoplastic hematopoietic myeloid progenitor cells in the bone marrow, such as the precursor cells of red cells, platelets and granulocytes. Prolifération of neoplastic progenitor cells leads to an overproduction of any combination of whîte cells, red cells and/or platelets, depending on the disease. These overproduced cells may also be abnormal, leading to additional clinical complications. There are various types of chronic myeloproliferative disorders. Included in the

MPN disease spectrum are Essential Thrombocythemia (ET), Polycythemia vera (PV), ChronicMyelogenous Leukemia (CML), myelofibrosis (MF), chronic neutrophilie leukemia, chronic éosinophilie leukemia and acute myelogenous leukemia (AML). A myelodysplastic syndrome (MDS) is a group of symptoms that includes cancer of the blood and bone marrow.

Myelodysplastic syndromes (MDS) includes diseases such as, refractory anémia, refractory anémia with excess blasts, refractory cytopenia with multilineage dysplasia, refractory cytopenia with unilineage dysplasia, and chronic myelomonocytic leukemia (CMML).

Essential Thrombocythemia

Circulating blood platelets are anucleate, although they retain small amounts of megakaryocytederived mRNAs and a fully functional protein bïosynthetic capacîty (Gnatenko et aL, Blood 101, 2285-2293 (2003)). Essential Thrombocythemia (ET) is a myeloproliferative disorder subtype, characterized by increased neoplastic prolifération of megakaryocytes, elevated numbers of circulating platelets, and considérable thrombohemorrhagic events, not infrequently neurological (Nimer, Blood 93,415-416 (1999)). ET is seen with equal frequency in males and females, although an additional female incidence peak at âge 30 may explain the apparent higher disease prevalence in females after this âge. The molecular basis of ET remains to be established, although historically it has been considered a “clonal” disorder (El-Kassar et al., Blood 89,128 (1997); “Evidence that ET is a clonal disorder with origin in a multipotent stem cell” PJ Fialkow, Blood 1981 58: 916-919). Other lhan the exaggerated platelet volume évident in subsets of ET platelets, the cells remain morphologically indistinguishable from their normal counterparts. No functional or diagnostic test is currently available for ET, and it remains to be diagnosed by exclusion of other potential hematological disorders Incidence estimâtes of 2-3 cases per 100,000 per year are consistent with other types of leukemia, but prevalence rates are at least ten times higher due to the low mortality rates associated with ET.

Current thérapies for ET focus primarily on prévention of thrombotic/hemorrhagîc occurrence and involve non-specific réduction ofblood platelet Ievels. However, none of these existing thérapies focus specifically on the neoplastic progenïtor cells driving the malignancy responsible for the disease state. For example, treatment of ET with cytotoxic chemotherapy debulks neoplastic cells while leaving residual progenïtor cells in place. This results in new neoplastic cells arising from the progenïtor cells and continuation of the disease state. Additionally, many individuals with ET develop résistance to front-line treatments such as hydroxyurea or discontinue use of these drugs altogether due to adverse side effects.

Pofycythemia Vera

Patients with Polycythemia Vera (PV) hâve marked increases of red blood cell production. Treatment is directed at reducing the excessive numbers of red blood cells. PV can develop a phase late in their course that resembles primary myelofibrosis with cytopenias and marrow hypoplasia and fibrosis. The Janus Kinase 2 gene (JAK2) gene mutation on chromosome 9 which causes increased prolifération and survival of hematopoietic precursors in vitro has been identified in most patients with PV. Patients with PV hâve an increased risk of cardiovascular and thrombotic events and transformation to acute myelogenous leukemia or primary myelofibrosis. The treatment for PV includes intermittent chronic phlebotomy to maintain the hematocrit below 45% in men and 40% in women. Other possible treatments includee hydroxyurea, interferon-alpha, and low-dose aspirin.

Myelofibrosis

Myelofibrosis or MF, or primary myelofibrosis is a myeloproliferatîve neoplasm in the same spectrum of dîseases as ET. Patients with MF ofien carry the JAK2 V617F mutation in their bone marrow. Occasionally ET evolves into MF. JAK2 inhibition is currently considered a standard of 15 care for MF in countries where ruxolitinib (Jakafi®), a janus kinase inhibitor, is approved. There is no evidence that JAK2 inhîbitors, such as Jakafi®, selectively inhibit prolifération of the leukemic clone responsible for the disease and thus, they may not be “disease modifying”.

Acute Myelogenous Leukemia

Acute Myelogenous Leukemia (AML) is a cancer of the myeloid line of blood cells. AML is the 20 most common acute leukemia affecting adults. Patients with AML hâve a rapid growth of abnormal white blood cells that accu mulate in the bone marrow and interfère with the production of normal blood cells. Replacement of normal bone marrow with leukemic cells causes a drop in red blood cells, platelets, and normal white blood cells. The symptoms of AML include fatigue, shortness of breath, easy bruising and bleeding, and increased risk of infection.

As an acute leukemia, AML progresses rapidly and is typically fatal wîthin weeks or months if left untreated. The standard of care for AML is treatment with chemotherapy aimed at inducing a rémission; patients may go on to receive a hematopoietic stem cell transplant.

Myelodysplastic syndrome

A myelodysplastic syndrome (MDS) is a group of symptoms that includes cancer of the blood and bone marrow. Myelodysplastic syndromes (MDS) includes diseases such as, refractory anémia, refractory anémia with excess blasts, refractory cytopenia with multilîneage dysplasia, refractory cytopenia with unilineage dysplasia, and chronic myelomonocytic leukemia. The immature blood stem cells (blasts) do not become healthy red blood cells, white blood cells or platelets. The blast die in the bone marrow or soon after they travel to the blood. This leaves less room for healthy white cells, red cells and/or platelets to form in the bone marrow.

The myelodysplastic syndromes (MDS) are a collection of hematological medical conditions that involve ineffective production of the myeloid class of blood cells. Patients with MDS often develop severe anémia and require frequent blood transfusions. Bleeding and risk of infections also occur due to low or dysfunctional platelets and neutrophils, respectively. In some cases the disease worsens and the patient develops cytopenias (low blood counts) caused by progressive bone marrow failure. In some cases the disease transforms into acute myelogenous leukemia (AML). If the overall percentage of bone marrow myeloblasts rises over a particular cutofif (20% for WHO and 30% for FAB), then transformation to acute myelogenous leukemia (AML) is said to hâve occurred.

What is needed, therefore, are new treatments for myelodysplastic proliférative disorders or neoplasm such as ET, PV, MF, CML and AML, and for myelodysplastic syndrome which target the neoplastic progenitor cells responsable for the dtsease’s malignant phenotype, particularly in individuals who are résistant to or expérience adverse events as a resuit of taking commonly prescribed front-line thérapies for this dîsorder.

Throughout this spécification, various patents, patent applications and other types of publications (e.g., journal articles) are referenced. The disclosure of ail patents, patent applications, and publications cited herein are hereby incorporated by reference in their entirety for ail purposes.

SUMMARY OFTHE INVENTION

The invention provided herein discloses, inter alia, methods for using telomerase inhibitor compounds to treat and alleviate symptoms associated with myeloproliferative neoplasms such as Essential Thrombocythemia (ET), Polycythemia Vera (PV), Myelofibrosîs (MF), and Acute Myelogenous Leukemia (AML) by targeting the neoplastic progenitor cells characteristic of these diseases. The invention provided herein also discloses, inter alia, methods for using telomerase inhibitor compounds to treat and alleviate symptoms associated with myelodysplastic syndromes (MDS) such as, for example, refractory anémia, refractory anémia with excess blasts, refractory cytopenia with multilineage dysplasia, refractory cytopenia with unilineage dysplasia, and chronic myelomonocytic leukemia by targeting the neoplastic progenitor cells responsible for producing the abnormally high numbers of cells characteristic of these diseases.

Accordingly, in one aspect, provided herein are methods for alleviating at least one symptom associated with myeloproliferative neoplasms in an individual in need thereof, the method comprising: administering a clinically effective amount of a telomerase inhibitor to the individual, wherein administration of the telomerase inhibitor alleviates at least one symptom associated with myeloproliferative neoplasms. In some embodiments, the symptom comprises headache, dizziness or lightheadedness, chest pain, weakness, fainting, vision changes, numbness or tingling of extremities, redness, throbbing or buming pain in extremities (erythromelalgia), enlarged spleen, nosebleeds, bruising, bleeding from mouth or gums, bloody stool, or stroke. In some embodiments the myeloproliferative neoplasms are, for example, Essential Thrombocythemia (ET), Polycythemia Vera (PV), Myelofibrosis (MF), and Acute Myelogenous Leukemia (AML). In some embodiments of any of the embodiments herein, the telomerase inhibitor comprises an oligonucleotide. In some embodiments, the oligonucleotide is complementary to the RNA component of telomerase. In some embodiments, the oligonucleotide is 10-20 base pairs in length. In some embodiments, the oligonucleotide comprises the sequence TAGGGTTAGACAA. In some embodiments of any of the embodiments herein, the oligonucleotide comprises at least one N3*-> P5’ thîophosphoramïdate internucleoside linkage. In some embodiments of any of the embodiments herein, oligonucleotide comprises N3’-> P5’ thiophosphoramidate internucleoside Iinkages. In some embodiments of any of the embodiments herein, the oligonucleotide further comprises a lipid moiety linked to the 5’ and/or 3’ end of the oligonucleotide. In some embodiments of any of the embodiments herein, the lipid moiety is linked to the 5’ and/or 3’ end of the oligonucleotide via a linker. In some embodiments, the linker is a glycerol or aminoglycerol linker. In some embodiments of any of the embodiments herein, the lipid moiety is a palmitoyl (C16) moiety. In some embodiments of any of the embodiments herein, the telomerase inhibitor is îmetelstat In some embodiments of any of the embodiments herein, the telomerase inhibitor is administered with a pharmaceutically acceptable excipient. In some embodiments of any of the embodiments herein, the telomerase inhibitor is formulated for oral, intravenous, subcutaneous, intramuscular, topîcal, intraperitoneal, intranasal, inhalation, or intraocular administration. In some embodiments of any of the embodiments herein, administration of the therapeutically effective amount of the telomerase inhibitor comprises contacting one or more neoplastic progenitor cells with the telomerase inhibitor. In some embodiments of any of the embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.3 mg/kg. In some embodiments of any of the embodiments herein, the effective amount of a telomerase inhibitor is 9.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 6.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.4 mg/kg. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor does not inhibit cytokinedependent megakaryocyte growth. In some embodiments of any of the embodiments herein, the individual carries a V617F gain of function mutation in the Janus kinase 2 (JAK2) gene. In some embodiments, administration of the telomerase inhibitor decreases the percentage of JAK2 V617F allelic burden in the individual. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor inhibits cytokine-independent megakaryocyte growth. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor inhibits CFU-mega. In some embodiments, inhibition of CFU-Mega is independent of réduction in JAK2 allelic burden. In some embodiments, the individual is résistant or intolérant to a prior non- telomerase inhibitor-based therapy. In some embodiments, the individual is a human.

Accordingly, in one aspect, provided herein are methods for alleviating at least one symptom associated with essential thrombocythemia in an individual in need thereof, the method comprising: administering a clinically effective amount of a telomerase inhibitor to the individual, wherein administration of the telomerase inhibitor alleviates at least one symptom associated with essential thrombocythemia. In some embodiments, the symptom comprises headache, dizziness or lightheadedness, chest pain, weakness, faînttng, vision changes, numbness or tingling of extremities, redness, throbbing or buming pain in extremitîes (erythromelalgia), enlarged spleen, nosebleeds, bruising, bleeding from mouth or gums, bloody stool, or stroke. In some embodiments ofany of the embodiments herein, the telomerase inhibitor comprises an oligonucleotide. In some embodiments, the oligonucleotide is complementary to the RNA component of telomerase. In some embodîments, the oligonucleotide is 10-20 base pairs in length. In some embodîments, the oligonucleotide comprises the sequence TAGGGTTAGACAA. In some embodîments of any ofthe embodîments herein, the oligonucleotide comprises at least one N3'-> P5’ thiophosphoramidate intemucleoside lînkage. In some embodîments of any of the embodîments herein, oligonucleotide comprises N3^,_^ P5’ thiophosphoramidate intemucleoside linkages. In some embodîments of any of the embodîments herein, the oligonucleotide forther comprises a lipid moiety linked to the 5’ and/or 3' end of the oligonucleotide. In some embodîments of any of the embodîments herein, the lipid moiety is linked to the 5’ and/or 3* end of the oligonucleotide via a linker. In some embodîments, the linker is a glycerol or aminoglycerol linker. In some embodîments of any of the embodîments herein, the lipid moiety is a palmitoyl (C16) moiety. In some embodîments of any of the embodîments herein, the telomerase inhibitor is imetelstaL In some embodîments of any of the embodîments herein, the telomerase inhibitor is administered with a pharmaceutically acceptable excipient. In some embodîments of any of the embodîments herein, the telomerase inhibitor is formulated for oral, intravenous, subcutaneous, intramuscular, topical, intraperitoneal, intranasal, inhalation, or intraocular administration. In some embodîments of any of the embodîments herein, administration of the therapeutically effective amount of the telomerase inhibitor comprises contacting one or more neoplastic progenitor cells with the telomerase inhibitor. In some embodîments of any of the embodîments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.3 mg/kg. In some embodîments of any of the embodîments herein, the effective amount of a telomerase inhibitor is 9.5 mg/kg to 11.7 mg/kg. In some embodîments herein, the effective amount of a telomerase inhibitor is 6.5 mg/kg to 11.7 mg/kg. In some embodîments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 11.7 mg/kg. In some embodîments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.4 mg/kg. In some embodîments of any of the embodîments herein, administration of the telomerase inhibitor does not inhibit cytokinedependent megakaryocyte growth. In some embodîments of any of the embodîments herein, the individual carries a V617F gain of fonction mutation in the Janus kinase 2 (JAK2) gene. In some embodîments, administration of the telomerase inhibitor decreases the percentage of JAK2 V617F aile lie burden in the individual. In some embodîments of any of the embodîments herein, administration of the telomerase inhibitor inhibits cytokine-independent megakaryocyte growth. In some embodîments of any of the embodîments herein, administration of the telomerase inhibitor inhibits CFU-mega. In some embodîments, inhibition of CFU-Mega is independent of réduction in JAK2 allelic burden. In some embodiments, the individual is résistant or intolérant to a prior non- telomerase inhîbitor-based therapy. In some embodiments, the prior nontelomerase inhibitor-based therapy is hydroxyurea, anagrelide, or Interferon a-2B. In some embodiments, the individual is a human.

In another aspect, provided herein are methods for reducing neoplastic progenitor cell prolifération in an individual diagnosed with or suspected of having myeloproliferative neoplasms or myelodysplastic syndrome, the method comprising: administering a clinically effective amount of a telomerase inhibitor to the individual, wherein administration of the telomerase inhibitor reduces neoplastic progenitor cell prolifération in the individual. In some embodiments the myeloproliferative neoplasms are, for example, Essential Thrombocythemia (ET), Polycythemia Vera (PV), Myelofibrosis (MF), and Acute Myelogenous Leukemia (AML). In some embodiments,for ET reduced neoplastic progenitor cell prolifération results in platelet counts of less than about 600 x 10’ / pL in the blood of the individual. In some embodiments, reduced neoplastic progenitor cell prolifération results in platelet counts of less than about 400 x 10’ / pL in the blood of the individual. In some embodiments of any of the embodiment herein, the individual does not expérience a thromboembolie event. In some embodiments of any of the embodiment herein, reduced neoplastic cell prolifération resulting in platelet counts of less than about 400 x 10’ ! pL in the blood of the individual occurs within 2 months or less following initiation of telomerase inhibitor administration. In some embodiments of any of the embodiment herein, reduced neoplastic cell prolifération resulting in platelet counts of less than about 400 x 10³ / pL in the blood of the individual occurs within 1 month or less following initiation of telomerase inhibitor administration. In some embodiments, the individual is résistant or intolérant to a prior non- telomerase inhibitor-based therapy. In some embodiments, such as for MF, reduced neoplastic progenitor cell prolifération results in platelet counts of greater than about 100 x 10’ / L in the blood of the individual. In some embodiments, such as for MF, reduced neoplastic progenitor cell prolifération results in modified hemoglobin level of at least 90g/L, or lOOg/L or 1 lOg/L or 120g/L. In some embodiments, such as for MF, reduced neoplastic progenitor cell prolifération results in modified absolute neutrophil count of at least 1.0 x 10⁹/L or at least 2.0 x 10⁹/L. In some embodiments of any ofthe embodiments herein, the telomerase inhibitor comprises an oligonucleotide. In some embodiments, the oligonucleotide is complementary to the RNA component of telomerase. In some embodiments, the oligonucleotide is 10-20 base pairs in length. In some embodiments, the oligonucleotide comprises the sequence TAGGGTTAGACAA. In some embodiments of any of the embodiments herein, the oligonucleotide comprises at least one N3’-> P5* thiophosphoramidate intemucleoside linkage. In some embodiments of any of the embodiments herein, oligonucleotide comprises N3’-> P5’ thiophosphoramidate intemucleoside linkages. In some 5 embodiments of any of the embodiments herein, the oligonucleotide forther comprises a lipid moiety linked to the 5’ and/or 3’ end of the oligonucleotide. In some embodiments of any of the embodiments herein, the lipid moiety is linked to the 5’ and/or 3’ end of the oligonucleotide via a linker. In some embodiments, the linker is a glycerol or aminoglycerol linker. In some embodiments of any ofthe embodiments herein, the lipid moiety is a palmitoyl (Cl6) moiety. In 10 some embodiments of any of the embodiments herein, the telomerase inhibitor is imetelstat. In some embodiments of any of the embodiments herein, the telomerase inhibitor is administered with a pharmaceutically acceptable excipient. In some embodiments of any of the embodiments herein, the telomerase inhibitor is formulated for oral, intravenous, subcutaneous, intramuscular, topical, intraperitoneal, intranasal, inhalation, or întraocular administration. In some embodiments of any of the embodiments herein, administration of the therapeutically effective amount of the telomerase inhibitor comprises contacting one or more neoplastic progenitor cells with the telomerase inhibitor. In some embodiments of any of the embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.3 mg/kg. In some embodiments of • any of the embodiments herein, the effective amount of a telomerase inhibitor is 9.5 mg/kg to 20 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 6.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.4 mg/kg. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor does not inhibit cytokine25 dépendent megakaryocyte growth. In some embodiments of any of the embodiments herein, the individual carries a V617F gain of fonction mutation in the Janus kinase 2 (JAK2) gene. In some embodiments, administration of the telomerase inhibitor decreases the percentage of JAK2 V6I7F allelic burden in the individual. In some embodiments ofany ofthe embodiments herein, administration of the telomerase inhibitor inhibit s cytokine-independcnt megakaryocyte growth.

In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor inhibits CFU-mega. In some embodiments, inhibition ofCFU-Mega is independent of réduction in JAK2 allelic burden. In some embodiments, the individual is a human.

ίο

In another aspect, provided herein are methods for reducing neoplastic progenitor cell prolifération in an individual diagnosed with or suspected of havîng essential thrombocythemia, the method comprising: administering a clinically effective amount of a telomerase inhibitor to the individual, wherein administration of the telomerase inhibitor reduces neoplastic progenitor cell prolifération in the individual. In some embodiments, reduced neoplastic progenitor cell prolifération results in platelet counts of less than about 600 x 10³ / pL in the blood of the individual In some embodiments, reduced neoplastic progenitor cel! prolifération results in platelet counts of less than about 400 x 10³ / pL in the blood of the individual. In some embodiments of any of the embodiment herein, the individual does not expérience a thromboembolie event. In some embodiments of any of the embodiment herein, reduced neoplastic cell prolifération resulting in platelet counts of less than about 400 x 10³ / pL in the blood of the individual occurs within 2 months or less following initiation of telomerase inhibitor administration. In some embodiments of any of the embodiment herein, reduced neoplastic cell prolifération resulting in platelet counts of less than about 400 x 10³ / pL in the blood of the individual occurs within 1 month or less following initiation of telomerase inhibitor administration. In some embodiments, the individual is résistant or intolérant to a prior nontelomerase inhibitor-based therapy. In some embodiments, the prior non- telomerase inhibitorbased therapy is hydroxyurea, anagrelide, or Interferon a-2B. In some embodiments of any of the embodiments herein, the telomerase inhibitor comprises an oligonucleotide. In some embodiments, the oligonucleotide is complementary to the RNA component of telomerase. In some embodiments, the oligonucleotide is 10-20 base pairs in length. In some embodiments, the oligonucleotide comprises the sequence TAGGGTTAGACAA. In some embodiments of any of the embodiments herein, the oligonucleotide comprises at least one N3’·^ P5’ thiophosphoramidate intemucleoside linkage. In some embodiments of any of the embodiments herein, oligonucleotide comprises N3’-^ P5’ thiophosphoramidate intemucleoside linkages. In some embodiments of any of the embodiments herein, the oligonucleotide further comprises a lipid moiety linked to the 5’ and/or 3’ end of the oligonucleotide. In some embodiments of any of the embodiments herein, the lipid moiety is linked to the 5’ and/or 3’ end of the oligonucleotide via a linker. In some embodiments, the linker is a glycerol or aminoglycerol linker. In some embodiments of any of the embodiments herein, the lipid moiety is a palmitoyl (C16) moiety. In some embodiments of any of the embodiments herein, the telomerase inhibitor is imetelstat. In some embodiments of any of the embodiments herein, the telomerase inhibitor is administered with a pharmaceutically acceptable excipient. In some embodiments of any of the embodiments herein, the telomerase inhibitor is formulated for oral, intravenous, subcutaneous, intramuscular, topical, intraperitoneal, intranasal, inhalation, or întraocular administration. In some embodiments of any of the embodiments herein, administration of the therapeutically effective amount of the telomerase inhibitor comprises contacting one or more neoplastic progenitor cells with the telomerase inhibitor. In some embodiments of any of the embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.3 mg/kg. In some embodiments of any of the embodiments herein, the effective amount of a telomerase inhibitor is 9.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 6.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.4 mg/kg. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor does not înhibit cytokine-dependent megakaryocyte growth. In some embodiments of any of the embodiments herein, the individual carries a V617F gain of function mutation in the Janus kinase 2 (JAK2) gene. In some embodiments, administration of the telomerase inhibitor decreases the percentage of JAK2 V617F allelîc burden in the individual. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor inhibits cytokine-independent megakaryocyte growth. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor inhibits CFU-mega. In some embodiments, inhibition of CFU-Mega is independent of réduction in JAK2 allelîc burden. In some embodiments, the individual is a human.

In another aspect, provided herein are methods for maintaîning blood platelet counts of less than about 400 x 10³ / pL in the blood of an individual diagnosed with or suspected of having essential thrombocythemia, the method comprising: administering a clinically effective amount 25 of a telomerase inhibitor to the individual, wherein administration of the telomerase inhibitor maîntains blood platelet counts of less than about 400 x 10³ / pL in the individual. In some aspects, the telomerase inhibitor is administered no more than once every two weeks. In other aspects, the telomerase inhibitor is administered to maintain blood platelet counts of between about 150 x 10³ / pL to about 400 x 10³ / pL in the blood of an individual In some embodiments of any of the embodiments herein, the telomerase inhibitor comprises an oligonucleotide. In some embodiments, the oligonucleotide is complementary to the RNA component of telomerase. In some embodiments, the oligonucleotide is 10-20 base pairs in length. In some embodiments, the oligonucleotide comprises the sequence TAGGGTTAGACAA. In some embodiments ofany ofthe embodiments herein, the oligonucleotide comprises at least one N3*-? P5’ thiophosphoramidate intemucleosîde linkage. In some embodiments of any of the embodiments herein, oligonucleotide comprises N3’-> P5’ thiophosphoramidate intemucleoside lînkages. In some embodiments of any of the embodiments herein, the oligonucleotide further comprises a lipid moiety linked to the 5’ and/or 3’ end of the oligonucleotide. In some embodiments of any of the embodiments herein, the lipid moiety is linked to the 5’ and/or 3’ end of the oligonucleotide via a linker. In some embodiments, the linker is a glycerol or aminoglycerol linker. In some embodiments ofany of the embodiments herein, the lipid moiety is a palmitoyl (Cl6) moiety. In some embodiments of any of the embodiments herein, the telomerase înhibitor is imetelstat. In some embodiments of any of the embodiments herein, the telomerase inhibîtor is administered with a pharmaceutically acceptable excipient. In some embodiments of any of the embodiments herein, the telomerase înhibitor is formulated for oral, intravenous, subcutaneous, intramuscular, topical, intraperitoneal, intranasal, inhalation, or intraocular administration. In some embodiments of any of the embodiments herein, administration of the therapeutically effective amount of the telomerase inhibitor comprises contacting one or more neoplastic progenitor cells with the telomerase inhibitor. In some embodiments of any of the embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.3 mg/kg. In some embodiments of any of the embodiments herein, the effective amount of a telomerase inhibitor is 9.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 6.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.4 mg/kg. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor does not inhibit cytokîne-dependent megakaryocyte growth. In some embodiments of any of the embodiments herein, the individual carries a V617F gain of function mutation in the Janus kinase 2 (JAK2) gene. In some embodiments, administration of the telomerase inhibitor decreases the percentage of JAK2 V617F allelic burden in the individual. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor inhibits cytokine-independent megakaryocyte growth. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor inhibits CFU-mega. In some embodiments, inhibition of CFU-Mega is independent of réduction in JAK2 allelic burden. In some embodiments, the individual is résistant or intolérant to a prior non- telomerase inhibitor-based therapy. In some embodiments, the prior nontelomerase inhibitor-based therapy is hydroxyurea, anagrelide, or Interferon σ-2Β. In some embodiments, the individual is a human.

Accordingly, in one aspect, provided herein are methods for alleviating at least one symptom associated with polycythemia vera (PV) in an individual in need thereof, the method comprising: administering a clinically effective amount of a telomerase inhibitor to the individual, wherein administration of the telomerase inhibitor alleviates at least one symptom associated with polycythemia vera. In some embodiments, the symptom comprises headache, dizziness or lîghtheadedness, chest pain, weakness, fainting, vision changes, numbness ortingling of extremities, shortness of breath, weakness or feeling tired, enlarged spleen, nosebleeds, bruising, bleeding from mouth or gums, or bloody stooL In some embodiments of any of the embodiments herein, the telomerase inhibitor comprises an oligonucleotide. In some embodiments, the oligonucleotide is complementary to the RNA component of telomerase. In some embodiments, the oligonucleotide is 10-20 base pairs in length. In some embodiments, the oligonucleotide comprises the sequence TAGGGTTAGACAA. In some embodiments of any of the embodiments herein, the oligonucleotide comprises at least one N3’-^ P5* thiophosphoramidate intemucleosîde linkage. In some embodiments of any of the embodiments herein, oligonucleotide comprises N3’·^ P5’ thiophosphoramidate intemucleosîde linkages. In some embodiments of any of the embodiments herein, the oligonucleotide further comprises a lipid moiety linked to the 5’ and/or 3’ end of the oligonucleotide. In some embodiments of any of the embodiments herein, the lipid moiety is linked to the 5’ and/or 3’ end of the oligonucleotide via a linker. In some embodiments, the linker is a glycerol or aminoglycerol linker. In some embodiments of any of the embodiments herein, the lipid moiety is a palmitoyl (Cl6) moiety. In some embodiments of any of the embodiments herein, the telomerase inhibitor is imetelstat. In some embodiments of any of the embodiments herein, the telomerase inhibitor is administered with a pharmaceutically acceptable excipient. In some embodiments of any of the embodiments herein, the telomerase inhibitor is formulated for oral, intravenous, subcutaneous, intramuscular, topical, intraperitoneal, intranasal, inhalation, or intraocular administration. In some embodiments of any ofthe embodiments herein, administration of the therapeutîcally effective amount of the telomerase inhibitor comprises contacting one or more neoplastic progenitor cells with the telomerase inhibitor. In some embodiments of any of the embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.3 mg/kg. In some embodiments of any of the embodiments herein, the effective amount of a telomerase inhibitor is 9.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 6.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 75 mg/kg to 9.4 mg/kg. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor inhibits erythroid growth. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor inhibits CFU-erythroid.. In some embodiments of any of the embodiments herein, the indivîdual carries a V617F gain of fonction mutation in the Janus kinase 2 (JAK2) gene. In some embodiments, administration of the telomerase inhibitor decreases the percentage of JAK2 V617F allelic burden in the indivîdual. In some embodiments, the individual is résistant or intolérant to a prior non- telomerase înhibitor-based therapy. In some embodiments, the individual is a human.

Accordingly, in one aspect, provided herein are methods for alleviating at least one symptom associated with myelofibrosis in an individual in need thereof, the method comprising: administering a clinically effective amount of a telomerase inhibitor to the individual wherein administration of the telomerase inhibitor allevîates at least one symptom associated with myelofibrosis. In some embodiments, the symptom comprises enlarged spleen and splenic pain, early satiety, anémia, bone pain, fatigue, fever, night sweats, wcight loss, weakness, faintîng, nosebleeds, bruising, bleeding from mouth or gums, bloody stool, or stroke. In some embodiments of any of the embodiments herein, the telomerase inhibitor comprises an oligonucleotide. In some embodiments, the oligonucleotide is complementary to the RNA component of telomerase. In some embodiments, the oligonucleotide is 10-20 base pairs in tength. In some embodiments, the oligonucleotide comprises the sequence

TAGGGTTAGACAA. In some embodiments ofanyofthe embodiments herein, the oligonucleotide comprises at least one N3’-> P5’ thiophosphoramidate intemucleoside linkage. In some embodiments of any of the embodiments herein, oligonucleotide comprises N3’-> P5’ thiophosphoramidate intemucleoside linkages. In some embodiments of any of the embodiments herein, the oligonucleotide forther comprises a lipid moiety linked to the 5’ and/or

3’ end of the oligonucleotide. In some embodiments of any of the embodiments herein, the lipid moiety is linked to the 5’ and/or 3’ end of the oligonucleotide via a linker. In some embodiments, the linker is a glycerol or aminoglycerol linker. In some embodiments of any of the embodiments herein, the lipid moiety is a palmitoyl (Cl6) moiety. In some embodiments of any of the embodiments herein, the telomerase înhîbitor is imetelstat. In some embodiments of any of the embodiments herein, the telomerase inhibitor is administered with a pharmaceutically acceptable excipient. In some embodiments of any of the embodiments herein, the telomerase inhibitor is formulated for oral, intravenous, subcutaneous, intramuscular, topical, intraperitoneal, intranasal, inhalation, or intraocular administration. In some embodiments of any of the embodiments herein, administration of the therapeutically effective amount of the telomerase inhibitor comprises contacting one or more neoplastic progenitor cells with the telomerase inhibitor. In some embodiments of any of the embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.3 mg/kg. In some embodiments of any of the embodiments herein, the effective amount of a telomerase inhibitor is 9.5 mg/kg to 11.7 mg/kg.

In some embodiments herein, the effective amount of a telomerase inhibitor is 6.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.4 mg/kg. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor does not inhibît cytokine-dependent megakaryocyte growth. In some embodiments of any of the embodiments herein, the îndividual carries a V617F gain of function mutation in the Janus kinase 2 (JAK2) gene. In some embodiments, administration of the telomerase inhibitor decreases the percentage of JAK2 V617F allelic burden in the îndividual. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor inhibits cytokine-independent megakaryocyte growth. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor inhibits CFU-mega. In some embodiments, inhibition of CFU-Mega is independent of réduction in JAK2 allelic burden. In some embodiments, the îndividual is résistant or intolérant to a prior non- telomerase inhibitor-based therapy. In some embodiments, the îndividual is a human.

In another aspect provided herein are methods for reducing bone marrow fibrosis in an îndividual diagnosed with or suspected of having a myeloproliferative neoplasm or myelodysplastic syndrome, the method comprising administering a clinically effective amount 30 of a telomerase inhibitor to the îndividual, wherein administration of the telomerase inhibitor reduces bone marrow fibrosis in the îndividual. In another aspect, provided herein are methods in patients with MF for maintaining platelet counts of greater than about 100 x 10⁹ / L in the blood of the indîvidual the method comprising administering a clinically effective amount of a telomerase inhibitor to the indîvidual, wherein administration of the telomerase inhibitor increases platelet counts. In another aspect, provided herein are methods in patients with MF for maintaîning hemoglobin level of at least 90g/L, or lOOg/Lor 1 lOg/Lor 120g/L the method comprising administering a clinically effective amount of a telomerase inhibitor to the indîvidual, wherein administration of the telomerase inhibitor increases hemoglobin tevels. In another aspect, provided herein are methods in patients with MF for maintaîning absolute neutrophi) count of at least 1.0 x Ιθ’/L or at least 2.0 x 10⁹/L the method comprising administering a clinically effective amount of a telomerase inhibitor to the indîvidual, wherein administration of the telomerase inhibitor increases neutrophil counts. In some aspects, the telomerase inhibitor is admînistered no more than once every two weeks. In other aspects, the telomerase inhibitor is admînistered to maintain blood platelet counts of between about 150 x I O³ / pL to about 400 x 10³ / pL in the blood of an indîvidual In some embodiments of any of the embodiments herein, the telomerase inhibitor comprises an oligonucleotide. In some embodiments, the oligonucleotide is complementary to the RNA component of telomerase. In some embodiments, the oligonucleotide is 10-20 base pairs in length. In some embodiments, the oligonucleotide comprises the sequence TAGGGTTAGACAA. In some embodiments of any of the embodiments herein, the oligonucleotide comprises at least one N3’-> P5’ thiophosphoramidate intemucleoside linkage. In some embodiments of any of the embodiments herein, oligonucleotide comprises N3’-> P5’ thiophosphoramidate intemucleoside linkages. In some embodiments of any of the embodiments herein, the oligonucleotide further comprises a lipid moiety linked to the 5’ and/or 3’ end of the oligonucleotide. In some embodiments of any of the embodiments herein, the lipid moiety is linked to the 5’ and/or 3’ end of the oligonucleotide via a linker. In some embodiments, the tinker is a glycerol or aminoglycerol linker. In some embodiments of any ofthe embodiments herein, the lipid moiety is a palmitoyl (C16) moiety. In some embodiments of any of the embodiments herein, the telomerase inhibitor is imetelstat. In some embodiments of any of the embodiments herein, the telomerase inhibitor is admînistered with a pharmaceutically acceptable excipient. In some embodiments of any of the embodiments herein, the telomerase inhibitor is formulated for oral intravenous, subcutaneous, intramuscular, topical, intraperitoneal, intranasal, inhalation, or intraocular administration. In some embodiments of any of the embodiments herein, administration ofthe therapeutically effective amount of the telomerase inhibitor comprises contacting one or more neoplastic progenitor cells with the telomerase inhibitor. In some embodiments of any of the embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.3 mg/kg. In sonie embodiments of any of the embodiments herein, the effective amount of a telomerase inhibitor is 9.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount ofa telomerase inhibitor is 6.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.4 mg/kg.

Accordingly, in one aspect, provided herein are methods for alleviating at least one symptom associated with acute myeloid leukemîa in an individual in need thereof, the method comprising: administering a clinically effective amount of a telomerase inhibitor to the individual, wherein administration of the telomerase inhibitor alleviates at least one symptom associated with acute myeloid leukemîa. In some embodiments, the symptoms comprise enlarged spleen and splenîc pain, anémia, bone pain, fatigue, fever, night sweats, weight loss, weakness, faînting, nosebleeds, bruising, bleeding from mouth or gums, bloody stool, or stroke. In some embodiments of any of the embodiments herein, the telomerase inhibitor comprises an oligonucleotide. In some embodiments, the oligonucleotide is complementary to the RNA component of telomerase. In some embodiments, the oligonucleotide is 10-20 base pairs in length. In some embodiments, the oligonucleotide comprises the sequence TAGGGTTAGACAA. In some embodiments of any of the embodiments herein, the oligonucleotide comprises at least one N3’-> P5’ thîophosphoramidate intemucleoside linkage. In some embodiments of any of the embodiments herein, oligonucleotide comprises N3’-> P5’ thîophosphoramidate intemucleoside linkages. In some embodiments of any of the embodiments herein, the oligonucleotide further comprises a lipid moiety linked to the 5’ and/or 3* end of the oligonucleotide. In some embodiments of any of the embodiments herein, the lipid moiety is linked to the 5* and/or 3’ end of the oligonucleotide via a linker. In some embodiments, the linker is a glycerol or aminoglycerol linker. In some embodiments of any of the embodiments herein, the lipid moiety is a palmîtoyl (Cl6) moiety. In some embodiments of any of the embodiments herein, the telomerase inhibitor is imetelstat. In some embodiments of any of the embodiments herein, the telomerase inhibitor is administered with a pharmaceutically acceptable excipient. In some embodiments of any of the embodiments herein, the telomerase inhibitor is formulated for oral, intravenous, subcutaneous, intramuscular, topical, intraperitoneal, intranasal, inhalation, or intraocular administration. In some embodiments of any of the embodiments herein, administration of the therapeutically effective amount of the telomerase inhibitor comprises contacting one or more neoplastic progenitor cells with the telomerase inhibitor. In some embodiments of any of the embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.3 mg/kg. In some embodiments of any of the embodiments herein, the effective amount of a telomerase inhibitor is 9.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 6.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.4 mg/kg. In some embodiments herein, administration of the telomerase inhibitor does not inhibit cytokine-dependent megakaryocyte growth. In some embodiments herein, the indivîdual carries a V617F gain of fonction mutation in the Janus kinase 2 (JAK2) gene. In some embodiments, administration ofthe telomerase inhibitor decreases the percentage of JAK2 V617F allelic burden in the individual. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor inhibits cytokineindependent megakaryocyte growth. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor inhibits CFU-mega. In some embodiments, inhibition of CFU-Mega is independent of réduction in JAK2 allelic burden. In some embodiments, the individual is résistant or intolérant to a prior non- telomerase inhibitor-based therapy. In some embodiments, the individual is a human.

Accordingly, in one aspect, provided herein are methods for alleviating at least one symptom associated with myelodysplastic syndrome, such as, for example, refractory anémia, refractory anémia with excess blasts, refractory cytopenia with multilineage dysplasia, refractory cytopenia with unilineage dysplasia, and chronic myelomonocytic leukemia. in an individual in need thereof, the method comprising: administering a clinically effective amount of a telomerase inhibitor to the individual, wherein administration of the telomerase inhibitor allevîates at least one symptom associated with myelodysplastic syndrome. In some embodiments, the symptoms comprise shortness of breath, fatigue, weakness, faîntîng, nosebleeds, bruising, bleeding from mouth or gums, bloody stool, petechiae, or stroke. In some embodiments of any of the embodiments herein, the telomerase inhibitor comprises an oligonucleotide. In some embodiments, the oligonucleotide is complementary to the RNA component of telomerase. In some embodiments, the oligonucleotide is 10-20 base pairs in length. In some embodiments, the oligonucleotide comprises the sequence TAGGGTTAGACAA. In some embodiments of any of the embodiments herein, the oligonucleotide comprises at least one N3’-> P5* thiophosphoramidate intemucleoside linkage. In some embodiments of any of the embodiments herein, oligonucleotide comprises N3’-> P5’ thiophosphoramidate intemucleoside linkages. In some embodiments of any of the embodiments herein, the oligonucleotide further comprises a lipid moiety linked to the 5’ and/or 3’ end of the oligonucleotide. In some embodiments of any of the embodiments herein, the lipid moiety is linked to the 5’ and/or 3’ end of the oligonucleotide via a linker. In some embodiments, the linker is a glycerol or aminoglycerol linker. In some embodiments of any of the embodiments herein, the lipid moiety is a palmitoyl (Cl6) moiety. In some embodiments ofany of the embodiments herein, the telomerase inhibitor îs imetelstat. In some embodiments of any of the embodiments herein, the telomerase inhibitor is admînistered with a pharmaceutically acceptable excipient. In some embodiments of any of the embodiments herein, the telomerase inhibitor is formulated for oral, intravenous, subcutaneous, intramuscular, topical, intraperitoneal, intranasal, inhalation, or intraocular administration. In some embodiments of any of the embodiments herein, administration of the therapeutically effective amount of the telomerase inhibitor comprises contacting one or more neoplastic progenitor cells with the telomerase inhibitor. In some embodiments of any of the embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.3 mg/kg. In some embodiments of any of the embodiments herein, the effective amount of a telomerase inhibitor is 9.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 6.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.4 mg/kg. In some embodiments of any of the embodiments herein, administration of the telomerase inhibitor tnhibits cytokineindependent megakaryocyte growth. In some embodiments, the individual is résistant or intolérant to a prior non- telomerase inhibitor-based therapy. In some embodiments, the individual is a human.

DESCRIPTION OF THE DRAWINGS

Figures IA and IB depict Imetelstat effect on megakaryocyte growth and différentiation.

Figure 2 depicts colony-forming unit megakaryocytes (CFU-Mega) dose response curves.

Figure 3 depicts results for the primary study endpoint (hématologie response) from the Phase II

Trial to Evaluate the Activity of Imetelstat (GRN163L) in Patients with Essential

Thrombocythemia Who Require Cytoreduction and Hâve Failed or Are Intolérant to Previous

Therapy, or Who Refuse Standard Therapy (Phase II Imetelstat ET Study). CR, complété response; PR, partial response. The time to the first occurrence of platelet count <400 x lû’/pL is represented by diamond shapes, while the time to complété response is indicated by circles.

Figures 4A and 4B depict the Phase II Imetelstat ET Study results for the secondary study endpoint (JAK2 V617F Allelic Burden). PR, partial response. Figure 4A depicts the JAK2 V617F % allelic burden as a fonction of time in months from the baseline timepoint. Figure 4B describes the médian allelic burden (%) as a fonction of time from the baseline timepoint.

Figure 5 depicts the Phase II Imetelstat ET Study results for the exploratory endpoint (CFUMega).

Figure 6 depicts the percentage of cell growth in culture after in vitro treatment with Imetelstat of CD34+ cells obtained from a healthy donor and CD34+ cells from an AML patient at day 5, day 7 and day 9.

Figure 7 depicts imetelstat effects on megakaryocyte growth and différentiation from a patient with primary myelofibrosis.

DETAILED DESCRIPTION OFTHE INVENTION

This invention provides, inter alia, methods for reducing neoplastic progenitor cell prolifération and alleviating symptoms in îndividuals. The invention provided herein discloses, inter alia, methods for using telomerase inhibitor compounds to treat and alleviate symptoms associated with myeloprolîferative neoplasms (MPN) such as Essential Thrombocythemia (ET), Polycythemia Vera, Myelofibrosis, and Acute Myelogenous leukemia by targeting the neoplastic progenitor cells characteristic of these diseases. The invention provided herein also discloses, inter alia, methods for using telomerase inhibitor compounds to treat and alleviate symptoms associated with myelodysplastic syndromes (MDS) such as, for exampïe, refractory anémia, refractory anémia with excess blasts, refractory cytopenia with multiïineage dysplasia, refractory cytopenia with unilineage dysplasia, and chronîc myelomonocytic leukemia by targeting the neoplastic progenitor cells responsable for producing the abnormally high numbers of cells characteristic of these diseases. The inventors hâve made the surprising discovery that telomerase inhibitors (such as imetelstat) can effectively reduce circulating blood platelet Ievels in îndividuals with MPN and MDS. Additionally, this réduction in platelet Ievels is seen independently of the common ET-associated mutation in the Janus kinase 2 gene (JAK2; seen in approximately 50% of ET cases) and is effective in individuals who were previously résistant to treatment with hydroxyurea, which is a common front-line therapy for ET. Also provided herein are methods for using telomerase inhibitors (for example, îmetelstat) for maintaining blood platelet counts at relatively normal ranges in the blood of individuals diagnosed with or suspected of having ET. Without beïng bound to theory and unlike other common treatments for MPN and MDS, the telomerase inhibitor compounds used in the methods of the présent invention appear to specifically inhibit the neoplastic progenitor cells driving the malignancy responsible for this condition.

General Techniques

The practice of the invention will employ, unless otherwise indicated, conventional techniques in nucleic acid chemistry, molecular biology, microbiology, cell biology, biochemistry, and immunology, which are well known to those skilled in the art. Such techniques are explained fully in the literature, such as, Molecular Cloning: A Laboratory Manual, second édition (Sambrook et al., 1989) and Molecular Cloning: A Laboratory Manual, third édition (Sambrook and Russel, 2001), (jointly referred to herein as “Sambrook”); Current Protocols in Molecular Biology (F.M. Ausubel et al., eds., 1987, including suppléments through 2001); PCR: The Polymerase Chain Reaction, (Mullis et al., eds., 1994). Nucleic acids can be synthesized in vitro by well-known chemical synthesis techniques, as described in, e.g., Carruthers (1982) Cold Spring HarborSymp. Quant. Biol. 47:411-418; Adams (1983) J. Am. Chem.Soc. 105:661; Belousov (1997) Nucleic Acids Res. 5 25:3440-3444; Frenkel (1995) Free Radie. Biol. Med. 19:373-380; Blommers (1994) Biochemistry 33:7886-7896; Narang (1979) Meth. Enzymol. 68:90; Brown (1979) Meth. Enzymol. 68:109; Beaucage (1981) Tetra. Lett. 22:1859; Komberg and Baker, DNA Réplication, 2nd Ed. (Freeman, San Francisco, 1992); Scheit, Nucléotide Analogs (John Wiley, New York, 1980); Uhlmann and Peyman, Chemical Reviens, 90:543-584, 1990.

IL Définitions

The term “nucleoside” refers to a moiety having the general structure represented below, where B represents a nucleobase and the 2' carbon can be substituted as described below. When încorporated into an oligomer or polymer, the 3' carbon is further linked to an oxygen or nitrogen atom.

This structure includes 2'-deoxy and 2’-hydroxyl (i.e. deoxyribose and ribose) forms, and analogs. Less commonly, a 5'-NH group can be substituted for the 5-oxygen. “Analogs” in référencé to nucleosides, includes synthetic nucleosides having modified nucleobase moieties (see définition of “nucleobase below) and/or modified sugar moieties, such as 2’-fluoro sugars, and further analogs, Such analogs are typically designed to affect binding properties, e.g., stability, specificity, or the like. The term nucleoside includes the naturel nucleosides, încluding 2'-deoxy and 2’-hydroxyI forms, e.g., as described in Komberg and Baker, DNA Réplication, 2nd Ed. (Freeman, San Francisco, 1992), and analogs. “Analogs”, in référencé to nucleosides, includes synthetic nucleosides having modified nucleobase moieties (see définition of “nucleobase,” infra} and/or modified sugar moieties, e.g., described generally by Scheit, Nucléotide Analogs (John Wiley, New York, 1980). Such analogs include synthetic nucleosides designed to enhance binding properties, e.g., stability, specificity, or the like, such as disclosed by Uhlmann and Peyman, Chemical Reviews 90:543-584, 1990). An oligonucleotide containing such nucleosides, and whîch typically contains synthetic nuclease-resistant intemucleoside linkages, may itself be referred to as an “analog”.

A “polynucleotide” or “oligonucleotide refers to a ribose and/or deoxyribose nucleoside subunit polymer or oligomer having between about 2 and about 200 contiguous subunits. The nucleoside subunits can be joined by a variety of intersubunit linkages, încluding, but not limited to, phosphodîester, phosphotriester, methylphosphonate, P3'->N5' phosphoramidate, N3'->P5‘ phosphoramidate, N3->P5‘ thiophosphoramidate, and phosphorothioate linkages. The term also includes such polymers or oligomers having modifications, known to one skîlled in the art, to the sugar (e.g., 2' substitutions), the base (see the définition of “nucleoside, supra}, and the 3' and 5’ termini. In embodiments where the oligonucleotide moiety includes a plurality of intersubunit linkages, each linkage may be formed using the same chemistry, or a mixture of tinkage chemistries may be used. When an oligonucleotide is represented by a sequence of letters, such as “ATGUCCTG,” it will be understood that the nucléotides are in 5'->3* order from left to right.

L·

Représentation of the base sequence of the oligonucleotide in this manner does not împly the use of any particular type of intemucleosîde subunit in the oligonucleotide.

A “nucleobase” includes (i) native DNA and RNA nucleobases (uracil, thymine, adenine, guanine, and cytosine), (ii) modified nucleobases or nucleobase analogs (e.g., 5-methylcytosine, 5-bromouraciI, or inosine) and (iii) nucleobase analogs. A nucleobase analog is a compound whose molecular structure mimics that of a typical DNA or RNA base.

The term “lipid is used broadly herein to encompass substances that are soluble in organic solvents, but sparingly soluble, if at ail, in water. The term lipid includes, but is not limited to, hydrocarbons, oils, fats (such as fatty acids and glycerides), sterols, steroids and dérivative forms of these compounds. In some embodiments, lipïds are fatty acids and their dérivatives, hydrocarbons and their dérivatives, and sterols, such as cholestérol. Fatty acids usually contain even numbers of carbon atoms in a straight chain (commonly 12-24 carbons) and may be saturated or unsaturated, and can contain, or be modified to contain, a variety of substituent groups. For simplicity, the term “fatty acid” also encompasses fatty acid dérivatives, such as fatty or esters. In some embodiments, the term “lipid” also includes amphipathic compounds containing both lipid and hydrophilic moieties.

A “telomerase inhibîtor” is a compound which is capable of reducing or inhibiting the activity of telomerase reverse transcriptase enzyme in a mammalian celL Such an inhibitor may be a small molécule compound, such as described herein, or an hTR template inhibitor including an oligonucleotide, such as described herein. In one aspect, the telomerase inhibitor is Imetelstat or Imetelstat sodium. In another aspect, the telomerase inhibitor is GRN163L.

An “hTR template inhibitor” is a compound that blocks the template région of the RNA component of human telomerase, lhereby inhibiting the activity of the enzyme. The inhibitor is typically an oligonucleotide that is able to hybridize to this région. In some embodiments, the oligonucleotide includes a sequence effective to hybridize to a more spécifie portion of this région, having sequence 5'-CUAACCCUAAC-3'.

A compound is said to “inhibit the prolifération of cells” if the prolifération of cells in the presence of the compound is less than that observed in the absence of the compound. That is, prolifération of the cells is either slowed or halted in the presence of the compound. Inhibition of cancer-cell prolifération may be evidenced, for example, by réduction in the number of cells or rate of expansion of cells, réduction in tumor mass or the rate of tumor growth, or increase in survival rate of a subject being treated.

An oligonucleotide having “nuclease-resistant linkages” refers to one whose backbone has subunit linkages that are substantially résistant to nuclease cleavage, in non-hybridized or hybridized form, by common extracellular and intracellular nucleases in the body, that is, the oligonucleotide shows little or no nuclease cleavage under normal nuclease conditions in the body to which the oligonucleotide is exposed. The N3'-^P5‘ phosphoramidate (NP) or N3'->P5' thiophosphoramidate (NPS) linkages described below are nuclease résistant.

An “individual” can be a mammal, such as any common laboratory model organism. Mammals include, but are not limited to, humans and non-human primates, farm animais, sport animais, pets, mice, rats, and other rodents. In some embodiments, an individual is a human.

An “effective amount” or “therapeutically effective amount” or “clinically effective amount” refers to an amount of therapeutic compound, such as telomerase inhibitor, administered to a mammalian subject, either as a single dose or as part of a sériés of doses, which is effective to produce a desîred therapeutic effect.

As used herein, “neoplastic cells” refer to cells which exhibit relatively autonomous growth, so that they exhibit an aberrant growth phenotype characterized by a signîficant loss of control of cell prolifération. Neoplastic cells comprise cells which may he actively replicating or in a temporaiy non-replicative resting state <Gi or Go); similarly, neoplastic cells may comprise cells which hâve a well-differentiated phenotype, a poorly-differentiated phenotype, or a mixture of both type of cells. Thus, not ail neoplastic cells are necessarîly replicating cells at a gîven timepoint. “Neoplastic cells” encompass such cells in benign neoplasms and cells in malignant neoplasms.

As used herein, “neoplastic progenitor cells refers to cells of a cellular composition that possess the ability to become neoplastic.

As used herein, the term “neoplasm” or “neoplasîa” or “neoplastic” refers to abnormal new cell growth. Unlike hyperplasia, neoplastic prolifération persists even in the absence of an original stimulus.

As used herein, the singular form “a”, “an”, and “the” includes plural référencés unless indicated otherwise.

It is understood that aspects and embodiments of the invention described herein include “comprising,” “consisting,” and “consîsting essentially of ’ aspects and embodiments.

It is intended that every maximum numerica! limitation given throughout this spécification includes every lower numerical limitation, as if such lower numerical limitations were expressly written herein. Every minimum numerical limitation given throughout this spécification will include every higher numerical limitation, as if such higher numerical limitations were expressly written herein. Every numerical range given throughout this spécification will include every narrower numerical range that faits within such broader numerical range, as if such narrower numerical ranges were ail expressly written herein.

ΙΠ. Telomerase inhibitor compounds

Telomerase is a ribonucleoprotein that catalyzes the addition of telomeric repeat sequences (having the sequence 5’-TTAGGG-3' in humans) to chromosome ends. See e.g. Blackbum, 1992, Ann. Rev. Biochem. 61:113-129. The enzyme is expressed in most cancer cells but not in mature somatic cells. Loss of telomeric DNA may play a rôle in triggering cellular senescence; see Harley, 1991, Mutation Research 256:271-282. A variety of cancer cells hâve been shown to be telomerase-positive, including cells from cancer of the skin, connective tissue, adipose, breast, lung, stomach, pancréas, ovary, cervix, utérus, kidney, bladder, colon, prostate, central nervous system (CNS), retina and hématologie tumors (such as myeloma, leukemia and lymphoma). Targeting of telomerase can be effective in providing treatments that discriminate between malignant and normal cells to a high degree, avoiding many of the deleterious side effects that can accompany chemotherapeutic regimens which target dividing cells indiscriminately.

Inhibitors of telomerase identified to date include oligonucleotides (for example, oligonucleotides having nuclease résistant linkages) as well as small molécule compounds. Further information regarding telomerase inhibitor compounds can be found in U.S. Patent No. 7,998,938, the disclosure of which is incorporated by référencé herein in its entirety.

Small Molecttle Compounds

Small molécule inhibitors of telomerase include, for example, BRACO19 ((9-(4-(N,Ndimethylamino)phenylamino)-3,6-bis(3-pyrrolodino propionamidojacridine (see Mol. PharmacoL 61(5):1154-62,2002); DODC (dîethyloxadicarbocyanine), and telomestatin. These compounds may act as G-quad stabilizers, which promote the formation of an inactive G-quad configuration in the RNA component of telomerase. Other small molécule inhibitors of telomerase include BIBR1532 (2-[(E)-3-naphthen-2-yl but-2-enoylaminoJbenzoic acid) (see Ward & Autexier, Mol. PharmacoL 68:779-786,2005; also J. Biol. Chem. 277(18):15566-72, 2002); AZT and other nucleoside analogs, such as ddG and ara-G (see, for example, U.S. Pat. Nos. 5,695,932 and 6,368,789), and certain thiopyridine, benzo[b]thiophene, and pyrido[b]thiophene dérivatives, described by Gaeta et aL in U.S. Pat. Nos. 5,767,278,5,770,613, 5,863,936,5,656,638 and 5,760,062, the disclosures of which are incorporated by référencé herein. Another example is 3-chlorobenzo[b]thiophene-2-carboxy-2'-[(2,5-dichlorophenyl amino)thia]hydrazine, described in U.S. Pat. No. 5,760,062 and which is incorporated by référencé herein.

B. Oligonucleotide-Baied Telomerase Inhibitors: Sequence and Composition

The genes encoding both the protein and RNA components of human telomerase hâve been cloned and sequenced (see U.S. Pat. Nos. 6,261,836 and 5,583,016, respectively, bothof which are incorporated herein by référencé). Oligonucleotides can be targeted against the mRNA encoding the telomerase protein component (the human form of which is known as human telomerase reverse transcriptase, or hTERT) or the RNA component of the telomerase holoenzyme (the human form of which is known as human telomerase RNA, or hTR).

The nucléotide sequence of the RNA component of human telomerase (hTR) is shown in the Sequence Listing below (SEQID NO: 1), in the 5'-^ 3' direction. The sequence is shown using the standard abbreviations for ribonucleotides; those of skill in the art wîll recognize that the sequence also represents the sequence of the cDNA, in which the ribonucleotides are replaced by deoxyrîbonucleotides, with uridine (U) beîng replaced by thymidine (T). The template sequence of the RNA component is located within the région defined by nucléotides 46-56 (5'CUAACCCUAAC-3'), which is complementary to a telomeric sequence composed of about one-and-two-thirds telomeric repeat units. The template région functions to specify the sequence of the telomeric repeats that telomerase adds to the chromosome ends and is essential to the activity of the telomerase enzyme (see e.g. Chen et al, Cell 100:503-514,2000; Kim et al.,

Proc. Natl. Acad. Sci. USA 98 (14):7982-7987,2001). The design of antisense, ribozyme or small interfering RNA (siRNA) agents to inhibit or cause the destruction of mRNAs is well known (see, for example, Lebedeva, I, et al. Annual Review of Pharmacology and Toxicology, Vol. 41:403-419, April 2001; Macejak, D, et ai. Journal ofVirology, Vol 73 (9): 7745-7751, September 1999, and Zeng, Y. et al, PNAS Vol. 100 (17) p. 9779-9784, Aug. 19,2003) and such agents may be designed to target the hTERT mRNA and thereby inhibit production of hTERT protein in a target cell, such as a cancer cell (see, for example, U.S. Pat. Nos. 6,444,650 and 6,331,399).

Oligonucleotides targeting hTR (that is, the RNA component of the enzyme) act as inhibitors of telomerase enzyme activity by blocking or otherwise interfering with the interaction of hTR with the hTERT protein, which interaction is necessary for telomerase function (see, for example, Villeponteau et al., U.S. Pat. No. 6,548,298).

A preferred target région of hTR is the template région, spanning nucléotides 30-67 of SEQID NO: 1 (GGGUUGCGGAGGGUGGGCCUGGGAGGGGUGGUGGCCAUUU UUUGUCUAACCCUAACUGAGAAGGGCGUAGGCGCCGUGCUUUUGCUCCCC GCGCGCUGUUUUUCUCGCUGACUUUCAGCGGGCGGAAAAGCCUCGGCCUG CCGCCUUCCACCGUUCAUUCUAGAGCAAACAAAAAAUGUCAGCUGCUGGC CCGUUCGCCUCCCGGGGACCUGCGGCGGGUCGCCUGCCCAGCCCCCGAAC CCCGCCUGGAGCCGCGGUCGGCCCGGGGCUUCUCCGGAGGCACCCACUGC CACCGCGAAGAGUUGGGCUCUGUCAGCCGCGGGUCUCUCGGGGGCGAGGG CGAGGUUCACCGUUUCAGGCCGCAGGAAGAGGAACGGAGCGAGUCCCGCC GCGGCGCGAUUCCCUGAGCUGUGGGACGUGCACCCAGGACUCGGCUCACA CAUGCAGUUCGCUUUCCUGUUGGUGGGGGGAACGCCGAUCGUGCGCAUCC GUCACCCCUCGCCGGCAGUGGGGGCUUGUGAACCCCCAAACCUGACUGAC UGGGCCAGUGUGCU). Oligonucleotides targeting this région are referred to herein as ‘‘hTR template inhibitors” (see e.g. Herbert et al, Oncogene 21 (4):638-42 (2002).) Preferably, such an oligonucleotide includes a sequence which is complementary or near-complementary to some portion of the 11-nucléotide région having the sequence 5’-CUAACCCUAAC-3' (SEQ ID NO:23).

Another preferred target région is the région spanning nucléotides 137-179 of hTR (see Pruzan et al, Nucl. Acids Research, 30:559-568,2002). Within this région, the sequence spanning 14117327

153 is a preferred target. PCT publication WO 98/28442 describes the use of oligonucleotides of at least 7 nucléotides in length to inhibit telomerase, where the oligonucleotides are designed to be complementary to accessible portions of the hTR sequence outsîde of the template région, including nucléotides 137-196,290-319, and 350-380 of hTR. Preferred hTR targeting sequence are given below, and identified by SEQID NOS: 2-22.

The région of the therapeutic oligonucleotide that is targeted to the hTR sequence is preferably exactly complementary to the corresponding hTR sequence. While mismatches may be tolerated in certain instances, they are expected to decrease the specificity and activity of the résultant oligonucleotide conjugale. In particular embodîments, the base sequence of the oligonucleotide is thus selected to include a sequence of at least 5 nucléotides exactly complementary to the hTR target, and enhanced telomerase inhibition may be obtained if increasing lengths of complementary sequence are employed, such as at least 8, at least 10, at least 12, at least 13 or at least 15 nucléotides exactly complementary to the hTR target. In other embodîments, the sequence of the oligonucleotide includes a sequence of from at least 5 to 20, from at least 8 to 20, from at least 10 to 20 or from at least 10 to 15 nucléotides exactly complementary to the hTR target sequence.

Optimal telomerase inhibitory activity may be obtained when the full length of the oligonucleotide is selected to be complementary to the hTR target sequence. However, it is not necessary that the full length of the oligonucleotide is exactly complementary to the target sequence, and the oligonucleotide sequence may include régions that are not complementary to the target sequence. Such régions may be added, for example, to confier other properties on the compound, such as sequences that facilitate purification. Altematîvely, an oligonucleotide may include multiple repeats of a sequence complementary to an hTR target sequence.

If the oligonucleotide is to include régions that are not complementary to the target sequence, such régions are typically positioned at one or both of the 5’ or 3' termini. Exemplary sequences targeting human telomerase RNA (hTR) include the following:

TiTR Tergexlnq Sequence	F»gieai af SSJ JD KO: 1	5F0 IC t»:
ΛΓΑΤΤΤ77ΤαΤΤΤΟΖΤνΤΛ=	160-17»	3
	117-146	1
GTQCACOCQQCAGC	117-111	4
osÂAœcoocAoa	117.145	5
CTOSAAOJOCXA	115*151	6
CTOÎSAMCCa	141*151	7
^ΰατα].ν>οααΜ	141-151	B
	142-154	9
AACSGTncîAAancocr	141-11«	10
ΑΤΐ»ΑΓη5ττ:=Μ>0ππΧϊ	144-15«	11
7ÀIZX7T7ACACÂA	42-54	12
CAcTTAcnsttÀc;	44-54	11
7AOCC77AOACS.	42*51	14
7AOCCT7AÛ1.C	42*52	15
<JT7AOXnrX3	44-54	16
CTTAoxrrTxs’.e	44*54	17
CT7 ΑΓΓ.Π7 rA CAC AA	42-54	10
cecttAtur	44-57	10
CACTCA0C2	5Û-55	2Û
eecTwceAnre	54*66	21
œccCTTcrcAja	54-67	22

The intemucleoside linkages in the oligonucleotide may include any of the available oligonucleotide chemistries, e.g. phosphodiester, phosphotriester, methylphosphonate, P3'-^N5’ phosphoramidate, N3'~)P5' phosphoramidate, N3'*)P5’ thiophosphoramidate, and phosphorothioate. Typically, but not necessarily, ail of the intemucleoside linkages within the oligonucleotide will be of the same type, although the oligonucleotide component may be synthesized using a mixture of different linkages.

In some embodiments, the oligonucleotide has at least one N3’*^P5' phosphoramidate (NP) or N3'-)P5‘ thiophosphoramidate (NPS) linkage, which linkage may be represented by the structure: 3'-(-NH—P(=:O)(--XR)—O-)-5', wherein X is O or S and R is selected from the group

L· consisting of hydrogen, alkyl, and aryl; and pharmaceutically acceptable salts thereof, when XR is OH or SH. In other embodiments, the oligonucleotide includes ail NP or, în some embodiments, ail NPS linkages.

In one embodiment, the sequence for an hTR template inhibitor oligonucleotide is the sequence complementary to nucléotides 42-54 of SEQID NO; 1 supra. The oligonucleotide having this sequence (TAGGGTTAGACAA; SEQ ID NO:12) and N3'->P5' thiophosphoramidate (NPS) linkages is designated herein as GRN163. See, for example, Asai et a!., Cancer Research 63:3931-3939 (2003) and Gryaznov et al, Nucleosides Nucléotides Nucleic Acids 22(5-8):57781 (2003).

The oligonucleotide GRN163 administered alone has shown inhibitory activity in vitro in cell culture, including epidermoid carcinoma, breast epithelium, rénal carcinoma, rénal adenocarcinoma, pancreatic, brain, colon, prostate, leukemia, lymphoma, myeloma, epidermal, cervical, ovarian and liver cancer cells.

The oligonucleotide GRN163 has also been tested and shown to be therapeutically effective in a variety of animal tumor models, including ovarian and lung, both small cell and non-small cell (see, e.g., U.S. Patent No. 7,998,938, the disclosure of which is încorporated by référencé).

C. Lipid-OIieonucleotide Conjugates

In some aspects, the oligonucleotide-based telomerase inhibitors dîsclosed herein includes at least one covalently linked lipid group (see U.S. Pub. No. 2005/0113325, which is încorporated herein by référencé). This modification provides superior cellular uptake properties, such that an équivalent biological effect may be obtained using smaller amounts of the conjugated oligonucleotide compared to the unmodîfied form. When applied to the human therapeutic setting, this may translate to reduced toxicity risks, and cost savings.

The lipid group L is typically an aliphatîc hydrocarbon or fatty acid, including dérivatives of hydrocarbons and fatty acids, with examples being saturated straight chain compounds having 14-20 carbons, such as myristic (tetradecanoic) acid, palmitic (hexadecanoîc) acid, and stearic (octadeacanoic) acid, and their corresponding aliphatîc hydrocarbon forms, tetradecane, hexadecane and octadecane. Examples of other suitable lipid groups that may be employed are sterols, such as cholestérol, and substituted fatty acids and hydrocarbons, particularly

3l polyfluorinated forms of these groups. The scope of the lipid group L includes dérivatives such as amine, amide, ester and carbamate dérivatives. The type of dérivative is often determined by the mode of linkage to the oligonucleotide, as exempiified below:

HO,

NH when—R is —(CHîJhCHj (palmitoyl). This compound is designated herein as GRN163L (imetelstat).

In one exemplary structure, the lipid moiety is palmitoyl amide (derived from palmitic acid), conjugated through an aminoglycerol linker to the 5’ thiophosphate group of an NPS-linked oligonucleotide. The NPS oligonucleotide havîng the sequence shown for GRN163 and conjugated in this manner (as shown below) is designated GRN163L (Imetelstat) herein. In a second exemplary structure, the lipid, as a palmitoyl amide, is conjugated through the terminal 3' amino group of an NPS oligonucleotide.

D. Pharmaceutical compositions

In some aspects of the présent invention, when employed as pharmaceuticals, the telomerase inhibitor compounds disclosed herein can be formulated with a pharmaceutically acceptable excipient or carrier to be formulated into a pharmaceutical composition.

When employed as pharmaceuticals, the telomerase inhibitor compounds can be administered in the form of pharmaceutical compositions. These compounds can be administered by a variety of routes including oral, rectal, transdermal, subcutaneous, intravenous, intramuscular, and intranasal. These compounds are effective as both injectable and oral compositions. Such compositions are prepared in a manner well known in the pharmaceutical art and comprise at least one active compound. When employed as oral compositions, the telomerase inhibitor compounds disclosed herein are protected from acid digestion in the stomach by a pharmaceutically acceptable protectant.

Thîs invention also includes pharmaceutical compositions which contain, as the active ingrédient, a telomerase inhibitor compound associated with one or more pharmaceutically acceptable excipients or carriers. In making the compositions of thîs invention, the active ingrédient is usually mixed with an excipient or carrier, diluted by an excipient or carrier or enclosed within such an excipient or carrier which can be in the form of a capsule, sachet, paper orother container. When the excipient or carrier serves as a diluent, it can be a solid, semi-solid, or liquid material, which acts as a vehicle, carrier or medium for the active ingrédient. Thus, the compositions can be in the form of tablets, pills, powders, lozenges, sachets, cachets, élixirs, suspensions, émulsions, solutions, syrups, aérosols (as a solid or in a liquid medium), ointments containing, for example, up to 10% by weight of the active compound, soft and hard gelatin capsules, suppositories, stérile injectable solutions, and stérile packaged powders.

In preparing a formulation, it may be necessary to mill the active lyophilized compound to provide the appropriate particle size prior to combining with the other ingrédients. If the active compound is substantially insoluble, it ordinarily is milled to a particle size of less than 200 mesh. If the active compound is substantially water soluble, the particle size is normally adjusted by millîng to provide a substantially uniform distribution in the formulation, e.g. about 40 mesh.

It may be convenient or désirable to préparé, purify, and/or handle a corresponding sait of the active compound, for example, a pharmaceutically-acceptable sait. Examples of pharmaceutically acceptable salts are discussed in Berge et al., 1977, “Pharmaceutically Acceptable Salts,” J. Pharm. Sci., Vol. 66, pp. 1-19. For example, if the compound is anionic, or has a functional group which may be anionic (e.g., -COOH may be -COO1, then a sait may be formed with a suitable cation. Examples of suitable inorganic cations include, but are not limited to, Na⁺. Examples of suitable organic cations include, but are not limited to, ammonium ion (Le., NHZ) and substituted ammonium ions (e.g., NH₃R⁺, NHiRj, NHR/, NRZ).

Some examples of suitable excipients or carriers include lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, stérile water, syrup, and methyl cellulose. The formulations can additionally include: lubricating agents such as talc, magnésium stéarate, and minerai oil; wetting agents; emulsifying and suspending agents; preserving agents such as methyl- and propylhydroxy-benzoates; sweetening agents; and flavoring agents. The compositions of the invention can be formulated so as to provide quick.

sustained or delayed release of the active ingrédient after administration to the patient by employing procedures known in the art.

The compositions can be formulated in a unit dosage form, each dosage containing from about 5 mg to about 100 mg or more, such as any of about 1 mg to about 5 mg, 1 mg to about 10 mg, about I mg to about 20 mg, about 1 mg to about 30 mg, about 1 mg to about 40 mg, about 1 mg to about 50 mg, about 1 mg to about 60 mg, about 1 mg to about 70 mg, about l mg to about 80 mg, or about 1 mg to about 90 mg, inclusive, including any range in between these values, of the active ingrédient. The term “unit dosage forms refers to physically discrète units suitable as unitary dosages for individuals, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, in association with a suitable pharmaceutical excipient or carrier.

The telomerase inhibitor compounds are effective over a wide dosage range and are generally administered in a therapeutically effective amount. It will be understood, however, that the amount of the telomerase inhibitor compounds actually administered will be determined by a physicîan, in the lîght of the relevant circumstances, including the condition to be treated, the chosen route of administration, the actual compound administered, the âge, weight, and response of the individual patient, the severity of the patient's symptoms, and the like.

For preparing solid compositions such as tablets, the principal active ingrédient telomerase inhibitor compound is mixed with a pharmaceutical excipient or carrier to form a solid preformulation composition containing a homogeneous mixture of a compound of the présent invention. When referring to these preformulation compositions as homogeneous, it is meant that the active ingrédient is dispersed evenly throughout the composition so that the composition can be readily subdivided into equally effective unit dosage forms such as tablets, pills and capsules.

The tablets or pills of the présent invention can be coated or otherwise compounded to provide a dosage form affording the advantage of prolonged action and to protect the telomerase inhibitor compounds from acid hydrolysis in the stomach. For example, the tablet or pill can comprise an inner dosage and an outer dosage component, the latter being in the form of an envelope over the former. The two components can be separated by an enteric layer which serves to resist disintegration in the stomach and permit the inner component to pass intact into the duodénum or to be delayed in release. A variety of materials can be used for such enteric layers or coatings, such materials including a number of polymeric acids and mixtures of polymeric acids with such materials as shellac, cetyl alcohol, and cellulose acetate.

The liquid forms in which the novel compositions of the présent invention can be incorporated for administration orally or by injection include aqueous solutions, suîtably flavored syrups, aqueous or oil suspensions, and flavored émulsions with edible oils such as corn oil, cottonseed oil, sesame oil, coconut oil, or peanut oil, as well as élixirs and similar pharmaceutical vehicles.

Compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable, aqueous or organic solvents, or mixtures thereof, and powders. The liquid or solid compositions can contain suitable pharmaceutically acceptable excipients as described supra. The compositions can be admînistered by the oral or nasal respiratory route for local or systemic effect. Compositions in pharmaceutically acceptable solvents can be nebulized by use of inert gases. Nebulized solutions can be inhaled directly from the nebulizing device or the nebulizing device can be attached to a face mask tent, or intermittent positive pressure breathing machine. Solution, suspension, or powder compositions can also be admînistered, orally or nasally, from devices which deliver the formulation in an appropriate manner.

IV. Methods of the Invention

The telomerase inhibitor compounds (such as in pharmaceutical compositions) provided herein are useful for modulating disease states.. In some embodiments, the cell proliférative disorder is associated with increased expression or activity of telomerase or cellular growth (such as neoplastic progenitor cells associated with the abnormal production of platelets in Essential Thrombocythemia (ET)), or both.

In some aspects, methods for alleviating at least one symptom associated with MPN in an indîvidual in need thereof are provided herein. In some aspects, methods for alleviating at least one symptom associated with MDS in an indîvidual in need thereof are provided herein. Also provided herein are methods for reducing neoplastic progenitor cell prolifération in patients with MPN or MDS, as well as methods for maintaîning blood platelet concentrations and/ or red blood cell concentrations and/or white blood cell conentrations at normal levels in individuals diagnosed with or suspected of having an MPN or an MDS.

Myeloprolîferative neoplasms, or MPNs, are hématologie cancers that arise from malignant hematopoietic myeloid progenitor cells in the bone marrow, such as the precursor cells of red cells, platelets and granulocytes. Prolifération of malignant progenitor cells leads to an overproduction of any combination of white cells, red cells and/or platelets, depending on the disease. These overproduced cells may also be abnormal, leading to additional clinical complications. There are various types of chronic myeloprolîferative disorders. Included in the MPN disease spectrum are Essential Thrombocythemia (ET), Polycythemia vera (PV), and chronic myelogenous leukemîa (CML), myelofibrosis (MF), chronic neutrophilie leukemîa, chronic éosinophilie leukemîa and acute myelomgenous leukemîa (AML).

A myelodysplastic syndrome (MDS) is a group of symptoms that includes cancer of the blood and bone marrow. Myelodysplastic syndromes (MDS) includes diseases such as, refractory anémia, refractory anémia with excess blasts, refractory cytopenia with multîlineage dysplasia, refractory cytopenia with unilineage dysplasia, and chronic myelomonocytic leukemîa. The immature blood stem cells (blasts) do not become healthy red blood cells, white blood cells or platelets. The blast die in the bone marrow or soon after they travel to the blood. This leaves less room for healthy white cells, red cells and/or platelets to form in the bone marrow.

Essential Thrombocythemia

The megakaryocyte is a bone marrow cell responsible for the production of blood thrombocytes (platelets), which are necessary for normal blood clotting. Megakaryocytes normally account for 1 out of 10,000 bone marrow cells but can increase in number nearly 10-fold during the course of certain diseases.

Megakaryocytes are derived from hematopoietic stem cell precursor cells in the bone marrow. Once the cell has completed différentiation and become a mature megakaryocyte, it begins the process of producing platelets. While many cytokines are suspected to play a rôle in stimulating megakaryocytes to produce platelets, it is the cytokine thrombopoietin that induces the megakaryocyte to form small proto-platelet processes. Platelets are held within these internai membranes within the cytoplasm of megakaryocytes. Each of these proto-platelet processes can gîve rise to 2000-5000 new platelets upon breakup. Overall, 2/3 of these newly-produced platelets will remain in circulation while 1/3 will be sequestered by the spleen.

Essential Thrombocythemia (ET) is a chronic disorder associated with increased or abnormal production of blood platelets. Formation of platelets in ET occurs in a cytokine-independent fashion, with the megakaryocyte producing platelets in an unregulated manner. As platelets are involved in blood clotting, abnormal production can resuit in the inappropriate formation of 5 blood clots or in bleeding, resulting in increased risk of gastrointestinal bleeding, heart attack and stroke.

Often, many patients with ET are asymptomatic; diagnosis typically occurs after blood counts as part of a routine check-up reveal a high platelet count. When ET symptoms are présent, they may include fatigue, or may be related to small or large vesset disturbances or bleeding. Small 10 vessel disturbances (often considered vasomotor in nature) can lead to: headache, vision disturbances or silent migraines, dizziness or Iightheadedness, coldness or blueness of fingers or toes, or buming, redness, and pain in the hands and feet (www.mpnresearchfoundation.org/ Essential-Thrombocythemia). Thrombotic complications can be quite serious, leading to: stroke, transient ischémie attack (TIA), heart attack, deep vein thrombosis or pulmonary embolus (blood 15 clôt in the lung). Bleeding can manifest as easy bruising, nosebleeds, heavy periods, gastrointestinal bleeding or blood in the urine (www.mpnresearchfoundation.org/EssentialThrombocythemia). A small minority of people with ET may later develop acute leukemia or myelofibrosis, both of which can be life-threatening. Acute myelogenous leukemia is a type of blood and bone marrow cancer that progresses rapidly. Myelofibrosis is a progressive bone marrow disorder that resuïts in bone marrow scarring, severe anémia, and enlargement of the liver and spleen.

According to the World Health Organization, diagnosis of ET requires that criteria Al through A4 be met: (Al) a sustained platelet count of > 450 x Ιθ’/L; (A2) bone marrow showing increased numbers of enlarged, mature megakaryocytes and no significant increase of left-shift 25 of granulopoiesîs or erythropoiesîs; (A3) not meeting WHO criteria for polycythemia, primary myelofibrosis, chronic myeloid leukemia, myelodysplastic syndrome, or other myeloid neoplasm; and (A4) having an acquired mutation or clonal marker or no reactive cause for thrombocytosis (Swedlow, et al., (2008) WHO Classification o/Tumours of Haematopoietic and Lymphoid Tissues, Lyon, IARC Press). When diagnosing ET, some clinicians use the British 30 Committee for Standards in Haematology criteria (published in 2010), which are similar to the

2008 WHO criteria but differ in several significant respects (Beer, et aL, (2010) Blood 117(5): 1472-1482).

Tests which may be done to diagnose ET include: (1) blood tests to exclude other causes of a high platelet count, including tests for iron deficiency and indicators of inflammation (other mimicking blood diseases are ruled out as well); (2) tests for JAK2 gene mutations (occurring in approxïmately 50% of cases) or MPL (occurring in up to 5% of cases); (3) bone marrow biopsies to look for classical signs of ET, including an increase in platelet precursors. Further information related to diagnosing ET can be found in U.S. Patent Application Publication No. 2006/0166221, which is incorporated by reference herein.

ET is generally treated through the use of: the modification ofcardiovascular risk factors, antîplatelet therapy, and cytoreductive therapy (Beer, et al., Blood 117(5): 1472-1482; hereinafter (Beer et al., 2010). With respect to cardiovascular risk factors, patients are screened for the presence of hypertension, diabètes, smoking, hypercholesterolemia and obesity, and treated where indicated according to proper guidelines for those conditions (Beer et al., 2010). Antîplatelet therapy includes, but is not limited to: aspirin unless contraindicated and antîplatelet agents such as clopidogrel. ET patients may be stratified on the basîs of thrombotic risk; high risk patients are over 60 years of âge, hâve prior thrombotic events, or a platelet count greater than 1500 x 10⁹/L; these high-risk patients will likely benefit from cytoreductive therapy (Beer et aL, 2010).

Despite a possible increased risk of leukemic transformation when ET patients are treated with hydroxycarbamide (hydroxyurea), it remains the front-line therapy for most patients requirîng treatment (Beer et al, 2010). Other treatments include but are not limited to interferon, anagrelide, pipobroman, busulphan, and irradiation with radioactive phosphorus.

Current drug therapy for ET is not curative and there is little evidence to suggest a favorable effect on survival. None of these current strategies addresses or directly targets either the malignant clonal cells responsîble for the disease, the évolution of the disease, or the symptoms suffered by patients that affect quality of life. The goal of current therapy in ET is to prevent thrombohemorrhagic complications. Major progress in elucidating ET pathogenesis was made with the description, in 2005, of the JAK2 somatic mutation (V617F), which is présent in 5060% of ET patients (James, et aL (2005) Nature 434: 1144-1148; Kralovics, et aL (2005) N Engl J Med 352: 1779-90; Baxter, et aL (2005) Lancet 365: 1054-61; Levine, et aL (2005) Cancer Cell 7: 387-97). Besides presence and allele burden of JAK2/V617F mutation, baseline leukocytosis has been recently recognized as a ne w disease-related risk factor in ET (Ziakas PD.

(2008) Haematologica 93: 1412-1414; Carobbio et al., (2007) Blood 109: 2310-2313). Evidence also indîcates that leukocytosis has a prognostic significance and may be considered causative of vascular events (Barbui, et al., (2009) Blood 114:759-63).

B. Polycythemia Vera

Patients with Polycythemia Vera (PV) hâve marked increases of red blood cell production. Treatment is directed at reducing the excessive numbers of red blood cells. PV can develop a phase late in their course that resembles primary myelofibrosis with cytopenîas and marrow hypoplasia and fibrosis. The Janus Kinase 2 gene (JAK2) gene mutation on chromosome 9 which causes increased prolifération and survival of hematopoîetîc precursors in vitro has been identified in most patients with PV. Patients with PV hâve an increased risk of cardiovascular and thrombotic events and transformation to acute myelogenous leukemia or primary myelofibrosis. The treatment for PV includes intermittent chronîc phlebotomy to maintain the hematocrit below 45% in men and 40% in women. Other possible treatments includee hydroxyurea, interferon-alpha, and low-dose aspirin.

C. __________Myelofibrosis

Myelofibrosis or MF, is a myeloproliferative neoplasm in the same spectrum of diseases as ET. Patients with MF often carry the JAK2 V617F mutation in their bone marrow. Occasionally ET evolves into MF. JAK2 inhibition is currently considered a standard of care for MF in countries where ruxolitinib (Jakafi®), a janus kinase inhibitor, is approved. There is no évidence that JAK2 inhibitors, such as Jakafi®, selectively inhibit prolifération of the leukemic clone responsible for the disease and thus, they may not be “disease modifying”.

D. Acute Myelogenous Leukemia

Acute Myelogenous Leukemia (AML) is a cancer of the myeloid line of blood cells. AML is the most common acute leukemia affecting adults. Patients with AML hâve a rapid growth of abnormal white blood cells that accumulate in the bone marrow and interfère with the production of normal blood cells. Replacement of normal bone marrow with leukemic cells causes a drop in red blood cells, platelets, and normal white blood cells. The symptoms of AML include fatigue, shortness of breath, easy bruising and bleeding, and increased risk of infection. As an acute leukemia, AML progresses rapidly and is typically fatal within weeks or months if left untreated. The standard of care for AML is treatment with chemotherapy aimed at inducing a remission; patients may go on to receive a hematopoietîc stem cell transplant.

E. Myelodysplastic syndrome

A myelodysplastic syndrome (MDS) is a group of symptoms that includes cancer of the gblood and bone marrow. The immature blood stem cells (blasts) do not become healthy red blood cells, white blood cells or platelets. The blast die in the bone marrow or soon after they travel to the blood. This leaves les s room for healthy white cells, red cells and/or platelets to form in the bone marrow.

The myelodysplastic syndromes (MDS) are a collection of hematological medical conditions that involve ineffective production of the myeloid class of blood cells. Patients with MDS often develop severe anémia and require frequent blood transfusions. In some cases the disease worsens and the patient develops cytopenias (low blood counts) caused by progressive bone marrow failure. In some cases the disease transforms into acute myelogenous leukemia (AML). If the overall percentage of bone marrow myeloblasts rises over a particular cutoff (20% for WHO and 30% for FAB), lhen transformation to acute myelogenous leukemia (AML) is said to hâve occurred.

F. Methods for treatine MPN or MDS usine telomerase inhibitors

Provided herein are methods for reducing neoplastic progenitor cell prolifération and alleviating symptoms associated in individuals diagnosed with or thought to hâve MPN or MDS via administration of telomerase inhibitors (such as any of the telomerase inhibitors disclosed herein..

The methods can be practiced in an adjuvant setting. “Adjuvant setting” refers to a clinical setting in which an individual has had a history of a proliférative disease and generally (but not necessarily) been responsive to therapy, which includes, but is not limited to, surgery (such as surgîcal resection), radiotherapy, and chemotherapy. However, because of their history of the proliférative disease, these individuals are consîdered at risk of development of the disease. Treatment or administration in the “adjuvant setting refers to a subséquent mode of treatment. The degree of risk (r.e., when an individual in the adjuvant setting is consîdered as “high risk” or “low risk”) dépends upon several factors, most usually the extent of disease when first treated.

The methods provided herein can also be practiced in a “neoadjuvant setting,” i.e., the method can be carried out before the primary/definitive therapy. In some embodiments, the individual has previously been treated. In some embodiments, the individual has not previously been treated. In some embodiments, the treatment is a fîrst line therapy.

Methods for alleviating symptoms of Myeloproliferative N copia sms and Myelodysplastic Syndroms

In some aspects, the présent invention is directed to methods for inhibiting the symptoms or conditions (disabilities, impairments) associated with Myeloproliferative Neoplasms as described in detail above. As such, it is not required that ail effects of the condition be entirely prevented or reversed, although the effects of the presently disclosed methods likely extend to a signifïcant therapeutic benefit for the patient. As such, a therapeutic benefit is not necessarily a complété prévention or cure for a particular condition resulting from Myeloproliferative Neoplasm, but rather, can encompass a resuit whîch includes reducing or preventing the symptoms that resuit from a cell proliférative disorder, reducing or preventing the occurrence of such symptoms (either quantitatively or qualitatively), reducing the severity of such symptoms or physiological effects thereof, and/or enhancing the recovery of the individual after experiencing Myeloproliferative Neoplasm symptoms.

In some aspects, the présent invention is directed to methods for inhibiting the symptoms or conditions (disabilities, impairments) associated with Myelodysplastic Syndrome (MDS) as described in detail above. As such, it is not required that ail effects of the condition be entirely prevented or reversed, although the effects of the presently disclosed methods likely extend to a signifïcant therapeutic benefit for the patient. As such, a therapeutic benefit is not necessarily a complété prévention or cure for a particular condition resulting from Myelodysplastic Syndrome, but rather, can encompass a resuit which includes reducing or preventing the symptoms that resuit from a cell proliférative disorder, reducing or preventing the occurrence of such symptoms (either quantitatively or qualitatively), reducing the severity of such symptoms or physiological effects thereof, and/or enhancing the recovery of the individual after experiencing Myelodysplastic Syndrome symptoms.

As used herein, the phrase “alleviating at least one symptom associated with a disorder, disease, or condition (such as MPN or MDS) dénotés reversing, inhibiting the progress of, or preventing the disorder or condition to which such term applies, or reversing, inhibiting the progress of, or preventing one or more symptoms of the disorder or condition to which such term applies. Specifically, a composition of the présent invention (such as any of the telomerase inhibitor compounds disclosed herein), when administered to an individual, can treat or prevent one or more of the symptoms or conditions associated with MPN or MDS and/or reduce or alleviate symptoms of or conditions associated with this disorder. As such, protecting an individual from the effects or symptoms resulting from MPN or MDS includes both preventing or reducing the occurrence and/or severity of the effects of the disorder and treating a patient in which the effects of the disorder are already occuning or beginning to occur. A bénéficiai effect can easily be assessed by one of ordinary skill in the art and/or by a trained clinician who is treating the patient. Preferably, there is a positive or bénéficiai différence in the severity or occurrence of at least one clinical or biologîcal score, value, or measure used to evaluate such patients in those who hâve been treated with the methods of the présent invention as compared to those that hâve not.

Accordingly, in some aspects, provided herein are methods for alleviating at least one symptom associated with MPN or MDS in an individual in need thereof, the method comprising: administering a clinically effective amount of a telomerase inhibitor to the individual wherein administration of the telomerase inhibitor alleviates at least one symptom associated with MPN or MDS. In some embodiments, the symptom comprises headache, dizziness or lightheadedness, chest pain, weakness, fainting, vision changes, numbness or tingling of extremities, redness, throbbing or buming pain in extremities (erythromelalgia), enlarged spleen, nosebleeds, bruising, bleeding from mouth or gums, bloody stool, heart attack (myocardial infarction) or stroke. In some embodiments, the telomerase inhibitor comprises an oligonucleotide which can be complementary to the RNA component of telomerase and in some instances can be between 10-20 base pairs in length. In one embodiment, the oligonucleotide comprises the sequence TAGGGTTAGACAA. In other embodiments, the oligonucleotide comprises N3’-> P5’ thiophosphoramidate intemucleoside linkages. The oligonucleotide can also be conjugated to a lipid moiety on either its 5’ or 3’ end, optionally via a linker (such as a glycerol or amino glycerol linker). In some embodiments, the lipid moiety is a palmitoyl (C16) moiety. In yet another embodiment, the telomerase inhibitor is imetelstat. In some embodiments, administration of the telomerase inhibitor does not inhibit cytokine-dependent megakaryocyte growth. In other embodiments, administration of the telomerase inhibitor inhibits cytokine-independent megakaryocyte growth. In some embodiments, administration of the telomerase inhibitor inhibits CFU-mega. In yet other embodiments, inhibition of CFU-Mega is independent of réduction in JAK2 V617F allelic burden. In some embodiments, the individual can be résistant or intolérant to a prior non- telomerase inhibitor-based therapy (including, but not limited to hydroxyurea, anagrelide, or Interferon a-2B). In another embodîment, the individual is a human.

In some aspects, the effective amount of a telomerase inhibitor administered to the patient is 7.5 mg/kg to 9.3 mg/kg. In other aspects, the effective amount of a telomerase inhibitor is 9.5 mg/kg to 11.7 mg/kg. In another aspect, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 6.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.4 mg/kg. In some embodiments, the effective amount of a telomerase inhibitor includes at least about any of 6.5 mg/kg, 6.6 mg/kg, 6.7 mg/kg, 6.8 mg/kg, 6.9 mg/kg, 7 mg/kg, 7.1 mg/kg, 7.2 mg/kg, 7.3 mg/kg, 7.4 mg/kg, 7.5 mg/kg, 7.6 mg/kg, 7.7 mg/kg, 7.8 mg/kg, 7.9 mg/kg, 8 mg/kg, 8.1 mg/kg, 8.2 mg/kg, 8.3 mg/kg, 8.4 mg/kg, 8.5 mg/kg, 8.6 mg/kg, 8.7 mg/kg, 8.8 mg/kg, 8.9 mg/kg, 9 mg/kg, 9.1 mg/kg, 9.2 mg/kg, 9.3 mg/kg, 9.4 mg/kg, 9.5 mg/kg, 9.6 mg/kg, 9.7 mg/kg, 9.8 mg/kg, 9.9 mg/kg, 10 mg/kg, 10.1 mg/kg, 10.2 mg/kg, 10.3 mg/kg, 10.4 mg/kg, 10.5 mg/kg, 10.6 mg/kg, 10.7 mg/kg, 10.8 mg/kg, 10.9 mg/kg, 11 mg/kg, 11.1 mg/kg, 11.2 mg/kg, 11.3 mg/kg, 11.4 mg/kg, 11.5 mg/kg, 11.6 mg/kg, 11.7 mg/kg, 11.8 mg/kg, 11.9 mg/kg, 12 mg/kg, 12.1 mg/kg, 12.2 mg/kg, 12.3 mg/kg, 12.4 mg/kg, 12.5 mg/kg, 12.6 mg/kg, 12.7 mg/kg, 12.8 mg/kg, 12.9 mg/kg, or 13 mg/kg. In some embodiments, the effective amount of a telomerase inhibitor administered to the individual is not 9.4 mg/kg.

In some aspects, the individual diagnosed with or thought to hâve MPN carries a V617F gain of function mutation in the Janus kinase 2 (JAK2) gene. Methods for determining whether an individual carries this mutation as well as determining allelic burden, are many and well known in the art (see, e.g., U.S. Patent Application Nos. 2009/0162849,2007/0224598, and 2009/0162849, the disclosures of each of which are incorporated by référencé. In some embodiments, administration of the telomerase inhibitor decreases the percentage of JAK2 V617F allelic burden in the individual.

Methods for reducing neoplastic cell prolifération

In another aspect, provided herein are methods for reducîng neoplastic progenitor cell prolifération in an individual diagnosed with or suspected of having essential thrombocythemîa, the method comprising: administering a clinically effective amount of a telomerase inhibitor to the individual, wherein administration of the telomerase inhibitor reduces neoplastic progenitor 5 cell prolifération in the individual. In some embodiments, the telomerase inhibitor comprises an oligonucleotide which can be complementary to the RNA component of telomerase and in some instances can be between 10-20 base pairs in length. In one embodiment, the oligonucleotide comprises the sequence TAGGGTTAGACAA In other embodiments, the oligonucleotide comprises N3'-> P5’ thiophosphoramidate intemucleoside linkages. The oligonucleotide can 10 also be conjugated to a lipid moiety on either its 5' or 3’ end, optionally via a linker (such as a glycerol or amino glycerol linker). In some embodiments, the lipid moiety is a palmitoyl (C16) moiety. In yet another embodiment, the telomerase inhibitor is imetelstat. In some embodiments, administration of the telomerase inhibitor does not inhibit cytokine-dependent megakaryocyte growth. In other embodiments, administration of the telomerase inhibitor inhibits cytokine-independent megakaryocyte growth. In some embodiments, administration of the telomerase inhibitor inhibits CFU-mega. In yet other embodiments, inhibition of CFU-Mega is independent of réduction in JAK2 V617F allelic burden. In some embodiments, the individual can be résistant or intolérant to a prior non- telomerase inhibitor-based therapy (including, but not-limited to hydroxyurea, anagrelide, or Interferon a-2B). In another embodiment, the individual is a human.

In some aspects, reduced neoplastic progenitor cell prolifération results in platelet counts of less than any of about 600 x 10³ / pL, 575 x 10³ / pL, 550 x 10³ / pL, 525 x 10³ / pL, 500 x 10³ / pL, 475x 10³/pL,450x 10³/pL,425x 10³/pL,400x 10³/pL,375x 10³/pL,350x Ιθ’/pLx 10³/pL, 325 x 10³/pL,300x Ιθ’/pL, 275 x 10³/pL,250 x Ιθ’/pL,225 x 10³/pL, 200x 25 1 0³ / pL, 175 x 10³ / pL, or 150 x 10³ / pL in the blood of the individual, inclusive, including values in between these numbers. In other aspects, reduced neoplastic cell prolifération results in reduced platelet counts (such as any of the platelet counts described above) in the blood of the individual within any of about 24 weeks, 23 weeks, 22 weeks, 21 weeks, 20 weeks, 19 weeks, IS weeks, 17 weeks, 16 weeks, 15 weeks, 14 weeks, 13 weeks, 12 weeks, 11 weeks, 10 weeks, 9 30 weeks, 8 weeks, 7 weeks, 6 weeks, 5 weeks, 4 weeks, 3 weeks, or 2 weeks or less following initiation of telomerase inhibitor administration.

In some aspects, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.3 mg/kg. In other aspects, the effective amount of a telomerase inhibitor is 9.5 mg/kg to 11.7 mg/kg. In another aspect, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 6.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.4 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 6.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.4 mg/kg. In some embodiments, the effective amount of a telomerase inhibitor includes at least about any of 6.5 mg/kg, 6.6 mg/kg, 6.7 mg/kg, 6.8 mg/kg, 6.9 mg/kg, 7 mg/kg, 7.1 mg/kg, 7.2 mg/kg, 7.3 mg/kg, 7.4 mg/kg, 7.5 mg/kg, 7.6 mg/kg, 7.7 mg/kg, 7.8 mg/kg, 7.9 mg/kg, 8 mg/kg, 8.1 mg/kg, 8.2 mg/kg, 8.3 mg/kg, 8.4 mg/kg, 8.5 mg/kg, 8.6 mg/kg, 8.7 mg/kg, 8.8 mg/kg, 8.9 mg/kg, 9 mg/kg, 9.1 mg/kg, 9.2 mg/kg, 9.3 mg/kg, 9.4 mg/kg 9.5 mg/kg, 9.6 mg/kg, 9.7 mg/kg, 9.8 mg/kg, 9.9 mg/kg, 10 mg/kg, 10.1 mg/kg, 10.2 mg/kg, 10.3 mg/kg, 10.4 mg/kg, 10.5 mg/kg, 10.6 mg/kg, 10.7 mg/kg, 10.8 mg/kg, 10.9 mg/kg, 11 mg/kg,

11.1 mg/kg, 11.2 mg/kg, 11.3 mg/kg, 11.4 mg/kg, 11.5 mg/kg, 11.6 mg/kg, 11.7 mg/kg, 11.8 mg/kg, 11.9 mg/kg, 12 mg/kg, 12.1 mg/kg, 12.2 mg/kg, 12.3 mg/kg, 12.4 mg/kg, 12.5 mg/kg,

12.6 mg/kg, 12.7 mg/kg, 12.8 mg/kg, 12.9 mg/kg, or 13 mg/kg. In some embodiments, the effective amount of a telomerase inhibitor administered to the individual is not 9.4 mg/kg.

In some aspects, the individual diagnosed with or thought to hâve ET cames a V617F gain of fonction mutation in the Janus kinase 2 (JAK2) gene. In some embodiments, administration of the telomerase inhibitor decreases the percentage of JAK2 V617F allelic burden in the individual.

Mcthods for malntaining normal levels of clrculating platelets

In other aspects, provided herein for maintaining blood platelet counts of between less than about 400 x 10³ / pL in the blood of an individual diagnosed with or suspected of having essential thrombocythemia, the method comprising: admînistering a clinically effective amount of a telomerase inhibitor to the individual, wherein administration of the telomerase inhibitor maintains blood platelet counts of less than about 400 x 10³ / pL în the individual. In some embodiments, the telomerase inhibitor comprises an oligonucleotide which can be complementary to the RNA component of telomerase and in some instances can be between 1020 base pairs in length. In one embodiment, the oligonucleotide comprises the sequence

TAGGGTTAGACAA. In other embodîments, the oligonucleotide comprises N3’-> P5* thiophosphoramidate intemucleoside linkages. The oligonucleotide can also be conjugated to a lipid moiety on either its 5’ or 3’ end, optionally via a linker (such as a glycerol or amino glycerol linker). In some embodîments, the lipid moiety is a palmitoyl (Cl6) moiety. In yet another embodiment, the telomerase inhîbitor is imetelstat. In some embodîments, administration of the telomerase inhibitor does not inhibit cytokine-dependent megakaryocyte growth. In other embodîments, administration of the telomerase inhibitor inhibits cytokineindependent megakaryocyte growth. In some embodîments, administration of the telomerase inhibitor inhibits CFU-mega. In yet other embodîments, inhibition of CFU-Mega is independent of réduction in JAK2 V617F allelic burden. In some embodîments, the individual can be résistant or intolérant to a prior non- telomerase inhibitor-based therapy (including, but not limited to hydroxyurea, anagrelide, or Interferon a-2B). In another embodiment, the individual is a human.

In some aspects, administration of the telomerase inhibitors (such as any of the telomerase inhibitors described herein) maintains platelet counts at physiologically normal levels. In some embodîments, administration of the telomerase inhibitors maintains platelet counts of less than any of about 600 x 10³/pL, 575 x 10³/pL, 550 x 10³/pL, 525 x 10³ / pL, 500 x 10³ /pL,475 x 10³/pL,450 x 10³/pL,425 x 10³/pL,400 x 10³/pL, 375 x 10³/pL, 350x l0³/pLx 10³/ pL, 325 x 10³ /pL, 300 x ÎO³ / pL, 275 x 10³ ! pL, 250 x I0³ / pL, 225 x 10³ / pL, 200 x 10³ / pL, 175 x 10³ / pL, or 150 x 10³ / pL in the blood of the individual, inclusive, including values in between these numbers. In other aspects, administration of the telomerase inhibitors maintains platelet counts ofbetween any of about 100-400 x 10³/pL, 150-200x 10³/pL, 150250x 10³/pL, 150-300x Ιθ’/pL, 150-350x 10³/pL, 150-400x I0³/pL, 200-250 x lO’/pL, 200-300 x I0³/pL, 200-350 x 10³/pL, 200-400 x 10³/pL, 250-300 x 10³ /pL, 250-350 x 10³/ pL, 250-400 x I0³ / pL, 300-350 x 10³ / pL, 300-400 x 10³ / pL, or 350 to 400 x 10³ / pL in the blood of the individual

In yet other aspects, maintaining blood platelet counts at physiologically normal levels requires administration of the telomerase inhibitor no more than once every day, every other day, every three days, every week, every 11 days, every two weeks, every three weeks, every month, every six weeks, every two months, or longer, inclusive, including lime periods in between these.

In some aspects, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.3 mg/kg. In other aspects, the effective amount of a telomerase inhibitor is 9.5 mg/kg to 11.7 mg/kg. In another aspect, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 11.7 mg/kg. In some embodiments, the effective amount of a telomerase inhibitor includes at least about any of 6.5 mg/kg, 6.6 mg/kg, 6.7 mg/kg, 6.8 mg/kg, 6.9 mg/kg, 7 mg/kg, 7.1 mg/kg, 7.2 mg/kg, 7.3 mg/kg, 7.4 mg/kg, 7.5 mg/kg, 7.6 mg/kg, 7.7 mg/kg, 7.8 mg/kg, 7.9 mg/kg, 8 mg/kg, 8.1 mg/kg, 8.2 mg/kg, 8.3 mg/kg, 8.4 mg/kg, 8.5 mg/kg, 8.6 mg/kg, 8.7 mg/kg, 8.8 mg/kg, 8.9 mg/kg, 9 mg/kg, 9.1 mg/kg, 9.2 mg/kg, 9.3 mg/kg, 9.4 mg/kg, 9.5 mg/kg, 9.6 mg/kg, 9.7 mg/kg, 9.8 mg/kg, 9.9 mg/kg, 10 mg/kg, 10.1 mg/kg, 10.2 mg/kg, 10.3 mg/kg, 10.4 mg/kg, 10.5 mg/kg,

10.6 mg/kg, 10.7 mg/kg, 10.8 mg/kg, 10.9 mg/kg, 11 mg/kg, 11.1 mg/kg, 11.2 mg/kg, 11.3 mg/kg, 11.4 mg/kg, 11.5 mg/kg, 11.6 mg/kg, 11.7 mg/kg, 11.8 mg/kg, 11.9 mg/kg, 12 mg/kg,

12.1 mg/kg, 12.2 mg/kg, 12.3 mg/kg, 12.4 mg/kg, 12.5 mg/kg, 12.6 mg/kg, 12.7 mg/kg, 12.8 mg/kg, 12.9 mg/kg, or 13 mg/kg. In some embodiments, the effective amount of a telomerase inhibitor administered to the individual is not 9.4 mg/kg.

In some aspects, the individual diagnosed with or thought to hâve ET carries a V617F gain of function mutation in the Janus kinase 2 (JAK2) gene. In some embodiments, administration of the telomerase inhibitor decreases the percentage of JAK2 V617F allelic burden in the individuaL

G. Administration of telomerase inhibitors

In some embodiments, the telomerase inhibitor (such as any of the telomerase inhibitor compounds disclosed herein) is administered in the form of an injection. The injection can comprise the compound in combination with an aqueous injectable excipient or carrier. Nonlimiting examples of suitable aqueous injectable excipients or carriers are well known to persons of ordinary skill in the art, and they, and the methods of formulâting the formulations, may be found in such standard references as Alfonso AR: Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton Pa., 1985. Suitable aqueous injectable excipients or carriers include water, aqueous saline solution, aqueous dextrose solution, and the like, optionally containing dissolution enhancers such as 10% mannitol or other sugars, 10% glycine, or other amino acids. The composition can be injected subcutaneously, intraperitoneally, or intravenously.

In some embodiments, intravenous administration is used, and it can be continuous intravenous infusion over a period of a few minutes to an hour or more, such as around fifteen minutes. The amount admînistered can vary widely depending on the type of the telomerase inhibitor, size of a unit dosage, kind of excipients or carriers, and other factors well known to those of ordinary skill in the art. The telomerase inhibitor can comprise, for example, from about 0.001% to about 10% (w/w), from about 0.01% to about 1%, from about 0.1% to about 0.8%, or any range therein, with the remainder comprising the excipient(s) or carrier(s).

For oral administration, the telomerase inhibitor can take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients or carriers such as binding agents; fillers; lubricants; dis intégrants; or wetting agents. Liquid préparations for oral administration can take the form of, for example, solutions, syrups or suspensions, or they can be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid préparations can be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose dérivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithîn or acacia); non-aqueous vehicles (e.g., ationd oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p- hydroxybenzoates or sorbic acid). The préparations can also contain buffer salts, flavoring, and coloring as appropriate.

In some embodiments, the telomerase inhibitor can be admînistered by inhalation through an aérosol spray or a nebulizer that can include a suitable propellant such as, for example, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxîde, or a combination thereof. In one non-limiting example, a dosage unit for a pressurized aérosol can be delivered through a metering valve. In another embodiment, capsules and cartridges of gelât in, for example, can be used in an inhaler and can be formulât ed to contain a powderized mix of the compound with a suitable powder base such as, for example, starch or lactose.

In some embodiments, the amount of telomerase inhibitor admînistered to the indîvidual is included in any of the following ranges: about 0.5 to about 5 mg, about 5 to about 10 mg, about 10 to about 15 mg, about 15 to about 20 mg, about 20 to about 25 mg, about 20 to about 50 mg, about 25 to about 50 mg, about 50 to about 75 mg, about 50 to about 100 mg, about 75 to about 100 mg, about 100 to about 125 mg, about 125 to about 150 mg, about 150 to about 175 mg, about 175 to about 200 mg, about 200 to about 225 mg, about 225 to about 250 mg, about 250 to about 300 mg, about 300 to about 350 mg, about 350 to about 400 mg, about 400 to about 450 mg, or about 450 to about 500 mg. In some embodiments, the amount of a telomerase inhibitor in the effective amount administered to the individual (e.g., a unit dosage form) is in the range of about 5 mg to about 500 mg, such as about 30 mg to about 300 mg or about 50 mg to about 200 mg. In some embodiments, the concentration of the telomerase inhibitor administered to the individual is dilute (about 0.1 mg/ml) or concentrated (about 180 mg/ml), including for example any of about 0.1 to about 200 mg/ml, about 0.1 to about 180 mg/ml, about 0.1 to about 160 mg/ml, about 0.1 to about 140 mg/ml, about 0.1 to about 120 mg/ml, about 0.1 to about 100 mg/ml, about 0.1 to about 80 mg/ml, about 0.1 to about 60 mg/ml, about 0.1 to about 40 mg/ml, about 0.1 to about 20 mg/ml, about 0.1 to about 10 mg/ml about 2 to about 40 mg/ml, about 4 to about 35 mg/ml, about 6 to about 30 mg/ml, about 8 to about 25 mg/ml, about 10 to about 20 mg/ml, about 12 to about 15 mg/ml, or any of about 0.1 mg/ml, 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 0.7 mg/ml, 0.8 mg/ml, 0.9 mg/ml, 1 mg/ml, 1.1 mg/ml, 1.2 mg/ml, 1.3 mg/ml, 1.4 mg/ml, 1.5 mg/ml, 1.6 mg/ml, 1.7 mg/ml, 1.8 mg/ml, 1.9 mg/ml, 2 mg/ml, 2.1 mg/ml, 2.2 mg/ml, 2.3 mg/ml, 2.4 mg/ml, or 2.5 mg/ml. In some embodiments, the concentration of the telomerase inhibitor is at least about any of 0.1 mg/ml, 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 1.3 mg/ml, 1.5 mg/ml, 2 mg/ml, 3 mg/ml, 4 mg/ml, 5 mg/ml, 6 mg/ml, 7 mg/ml, 8 mg/ml, 9 mg/ml, 10 mg/ml, 11 mg/ml, 12 mg/ml, 13 mg/ml, 14 mg/ml, 15 mg/ml, 16 mg/ml, 17 mg/ml, 18 mg/ml, 19 mg/ml, 20 mg/ml. 21 mg/ml, 22 mg/ml, 23 mg/ml, 24 mg/ml, 25 mg/ml, 26 mg/ml, 27 mg/ml, 28 mg/ml, 29 mg/ml, 30 mg/ml, 31 mg/ml, 32 mg/ml, 33 mg/ml, 33.3 mg/ml, 34 mg/ml, 35 mg/ml, 36 mg/ml, 37 mg/ml, 38 mg/ml, 39 mg/ml, 40 mg/ml, 50 mg/ml, 60 mg/ml, 70 mg/ml, 80 mg/ml, 90 mg/ml, 100 mg/ml, 110 mg/ml, 120 mg/ml, 130 mg/ml, 140 mg/ml, 150 mg/ml, 160 mg/ml, 170 mg/ml, 180 mg/ml, 190 mg/ml, 200 mg/ml, 210 mg/ml, 220 mg/ml, 230 mg/ml, 240 mg/ml, or 250 mg/ml.

Exemplary effective amounts of a telomerase inhibitor administered to the individual include, but are not limited to, at least about any of 25 mg/m²,30 mg/m²,50 mg/m²,60 mg/m²,75 mg/m²,80 mg/m²,90 mg/m², 100 mg/m²,120 mg/m²,125 mg/m²,150 mg/m², 160 mg/m²,175 mg/m²,180 mg/m²,200 mg/m²,210 mg/m²,220 mg/m²,250 mg/m²,260 mg/m²,300 mg/m². 350 mg/m²,400 mg/m²,500 mg/m²,540 mg/m²,750 mg/m², 1000 mg/m², or 1080 mg/m². In various embodiments, the amount of telomerase inhibitor administered to the individual includes less than about any of 350 mg/m²,300 mg/m²,250 mg/m²,200 mg/m², 150 mg/m², 120 mg/m², 100 mg/m²,90 mg/m²,50 mg/m², or 30 mg/m² of a telomerase inhibitor. In some embodiments, the amount of the telomerase inhibitor per administration is less than about any of 25 mg/m²,22 mg/m²,20 mg/m²,18 mg/m²,15 mg/m²,14 mg/m²,13 mg/m²,12 mg/m²,11 mg/m²,10 mg/m², 9 mg/m²,8 mg/m²,7 mg/m²,6 mg/m²,5 mg/m²,4 mg/m²,3 mg/m²,2 mg/m², or 1 mg/m². In some embodiments, the effective amount of a telomerase inhibitor administered to the individual 5 is included in any of the following ranges: about 1 to about 5 mg/m², about 5 to about 10 mg/m², about 10 to about 25 mg/m², about 25 to about 50 mg/m², about 50 to about 75 mg/m², about 75 to about 100 mg/m², about 100 to about 125 mg/m², about 125 to about 150 mg/m², about 150 to about 175 mg/m², about 175 to about 200 mg/m², about 200 to about 225 mg/m², about 225 to about 250 mg/m², about 250 to about 300 mg/m², about 300 to about 350 mg/m², or about 350 to 10 about 400 mg/m². In some embodiments, the effective amount of a telomerase inhibitor administered to the individual is about 5 to about 300 mg/m², such as about 20 to about 300 mg/m², about 50 to about 250 mg/m², about 100 to about 150 mg/m², about 120 mg/m², about 130 mg/m², or about 140 mg/m², or about 260 mg/m².

In some embodiments of any of the above aspects, the effective amount of a telomerase inhibitor 15 administered to the individual includes at least about any of 1 mg/kg, 2.5 mg/kg, 3.5 mg/kg, 5 mg/kg, 6.5 mg/kg, 7.5 mg/kg, 9.4mg/kg, 10 mg/kg, 15 mg/kg, or 20 mg/kg. In various embodiments, the effective amount of a telomerase inhibitor administered to the individual includes less than about any of 350 mg/kg, 300 mg/kg, 250 mg/kg, 200 mg/kg, 150 mg/kg, 100 mg/kg, 50 mg/kg, 30 mg/kg, 25 mg/kg, 20 mg/kg, 10 mg/kg, 7.5 mg/kg, 6.5 mg/kg, 5 mg/kg, 3.5 20 mg/kg, 2.5 mg/kg, or 1 mg/kg of a telomerase inhibitor. In other embodiments of any of the above aspects, the effective amount of a telomerase inhibitor administered to the individual includes at least about any of 6.5 mg/kg, 6.6 mg/kg, 6.7 mg/kg, 6.8 mg/kg, 6.9 mg/kg, 7 mg/kg,

7.1 mg/kg, 7.2 mg/kg, 7.3 mg/kg, 7.4 mg/kg, 7.5 mg/kg, 7.6 mg/kg, 7.7 mg/kg, 7.8 mg/kg, 7.9 mg/kg, 8 mg/kg, 8.1 mg/kg, 8.2 mg/kg, 8.3 mg/kg, 8.4 mg/kg, 8.5 mg/kg, 8.6 mg/kg, 8.7 mg/kg, 25 8.8 mg/kg, 8.9 mg/kg, 9 mg/kg, 9.1 mg/kg, 9.2 mg/kg, 9.3 mg/kg, 9.4 mg/kg, 9.5 mg/kg, 9.6 mg/kg, 9.7 mg/kg, 9.8 mg/kg, 9.9 mg/kg, 10 mg/kg, 10.1 mg/kg, 10.2 mg/kg, 10.3 mg/kg, 10.4 mg/kg, 10.5 mg/kg, 10.6 mg/kg, 10.7 mg/kg, 10.8 mg/kg, 10.9 mg/kg, 11 mg/kg, 11.1 mg/kg, 11.2 mg/kg, 11.3 mg/kg, 11.4 mg/kg, 11.5 mg/kg, 11.6 mg/kg, 11.7 mg/kg, 11.8 mg/kg, 11.9 mg/kg, 12 mg/kg, 12.1 mg/kg, 12.2 mg/kg, 12.3 mg/kg, 12.4 mg/kg, 12.5 mg/kg, 12.6 mg/kg,

12.7 mg/kg, 12.8 mg/kg, 12.9 mg/kg, or 13 mg/kg. In some embodiments, the effective amount of a telomerase inhibitor administered to the individual is not 9.4 mg/kg. In other embodiments, the effective amount of a telomerase inhibitor administered to the individual is 7.5 mg/kg to 9.3 mg/kg. In another embodiment, the effective amount of a telomerase inhibitor is 7.5 mg/kg to

11.7 mg/kg. In yet other embodiments, the effective amount of a telomerase inhibitor is 9.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 6.5 mg/kg to 11.7 mg/kg. In some embodiments herein, the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.4 mg/kg.

Exemplary dosing frequencies for the pharmaceutical compositions (such as a pharmaceutical composition contaîning any of the telomerase inhibitors dîsclosed herein) include, but are not limited to, daily; every other day; twice per week; three times per week; weekly without break; weekly, three out of four weeks; once every three weeks; once every two weeks; weekly, two out of three weeks. In some embodiments, the pharmaceutical composition is administered about once every week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 6 weeks, or once every 8 weeks. In some embodiments, the composition is administered at least about any of Ix, 2x, 3x, 4x, 5x, 6x, or 7x (i.e., daily) a week, or three times daily, two times daily. In some embodiments, the intervals between each administration are less than about any of 6 months, 3 months, 1 month, 20 days, 15 days, 12 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, or 1 day. In some embodiments, the intervals between each administration are more than about any of 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 8 months, or 12 months. In some embodiments, there is no break in the dosing schedule. In some embodiments, the interval between each administration is no more than about a week.

In other aspects, the pharmaceutical composition (such as a pharmaceutical composition contaîning any of the telomerase inhibitors dîsclosed herein) is administered to maintain blood platelet counts ofbetween about 150 x 10³ / pL to 400 x 10³ / pL in the blood of an individual diagnosed with or suspected of having Essential Thrombocythemia. Under these conditions, the intervals between each administration can be weekly, every 2 weeks, every 3 weeks, or every 4 weeks or more. In some embodiments, the intervals for administration of the telomerase inhibitor can be decreased over time if platelet counts in the individual remain < 400 x I0³ / pL în the blood ofthe individual In some aspects, there is provided a method for determinîng the frequency of administration of the telomerase inhibitor for the treatment of ET comprising a) measuring an individual’s blood platelet count by any means known in the art and b) admînistering the telomerase inhibitor if platelet counts in the individual are greater than 400 x 10³/pL·

5l

The administration of the pharmaceutical composition (such as a pharmaceutical composition containing any of the telomerase inhibitors disclosed herein) can be extended over an extended period of lime (such as during maintenance therapy), such as from about a month up to about seven years. In some embodiments, the composition is administered over a period of at least about any of 2,3,4,5,6,7,8,9,10, 11,12, 18,24,30,36,48,60,72, or 84 months. Inother embodiments, the composition is administered for the rest of the individual’s lifetime.

EXAMPLES

Example 1: Préparation and Lîpïd Conjugation of Oligonucleotide N3'-^P5' Phosphoramidates (NPI or N3'->P5* Thiophosphoramidates (NPS)

This example shows how to synthesize lipid conjugated Oligonucleotide N3'->P5' Phosphoramidates (NP) or N3’->P5’ Thiophosphoramidates (NPS).

Materials and Methods

Startine Compounds

These compounds may be prepared as described, for example, in McCurdy et aL, Tetrahedron Letters 38:207-210 (1997) or Pongracz & Gryaznov, Tetrahedron Letters 49:7661-7664 (1999). The starling 3’-amino nucleoside monomers may be prepared as described in Nelson et aL, J. Org. Chem. 62: 7278-7287 (1997) or by the methods described in Gryaznov et al., US Application Publication No. 2006/0009636.

Lipid Attachment

A variety of synthetic approaches can be used to conjugale a lipid moiety L to the oligonucleotide, depending on the nature of the linkage selected; see, for example, Mishra et al., Biochim. et Biophys. Acta 1264:229-237 (1995), Shea et al, Nucleic Acids Res. 18:3777-3783 (1995), or Rump et al., Bioconj. Chem. 9: 341-349 (1995). Typically, conjugation is achieved through the use of a suitable functional group at an oligonucleotide terminus. For example, the 3'-amino group présent at the 3’-terminus of the NP and NPS oligonucleotides can be reacted with carboxylic acids, acid chlorides, anhydrides and active esters, using suitable coupling catalysts, to form an amide linkage. Thiol groups are also suitable as functional groups (see Kupihar et al., Bioorg. Med. Chem. 9: 1241-1247 (2001)). Various amino-and thiol17327 functionalized modifiers of different chain lengths are commercially available for oligonucleotide synthesis.

Spécifie approaches for attaching lipid groups to a terminus of an NP or NPS oligonucleotide include those described in US Application Publication No. 2005/0113325, which is incorporated herein in its entirety by référencé. In addition to the amide linkages noted above, for example, lipids may also be attached to the oligonucleotide chain using a phosphoramidite dérivative of the lipid, to produce a phosphoramidate or thîophosphoramidate linkage connecting the lipid and the oligonucleotide. The free 3’-amino of the fully protected support-bound oligonucleotide may also be reacted with a suitable lipid aldéhyde, folio wed by réduction with sodium cyanoborohydride, which produces an amine linkage.

For attachment of a lipid to the 5* terminus, as also described in US Application Publication No. 2005/0113325, the oligonucleotide can be synthesized using a modîfied, lipid-containing solid support. Reaction of 3*-amino-l,2-propanediol with a fatty acylchloride (RC(O)CI), followed by dimethoxytritylation of the primary alcohol and succinylation of the secondary alcohol, provides an intermediate which is then coupled, via the free succinyl carboxyl group, to the solid support. An example of a modîfied support is shown below, where S—represents a long chain alkyl amine CPG support, and R represents a lipid.

ODSiT

NH

This procedure is followed by synthesis of the oligonucleotide in the 5' to 3' direction, as described, for example, in Pongracz & Gryaznov (1999), starting with deprotection and phosphitylation of the -ODMT group. This is effective to produce, for example, the following structure, after cleavage from the solid support:

Ο

The structure above, when—R is —(CHiluCHî (palmitoyl), is designated herein as GRN163L (Imetelstat or Imetelstat sodium).

FlashPlate™ Assay

This assay was carried out essentially as described in Asai et al., Cancer Research 63: 39313939 (2003). Briefly, the assay detects and/or measures telomerase activity by measuring the addition of TTAGGG telomeric repeats to a biotinylated telomerase substrate primer. The biotinylated products are captures on streptavidin-coated microtiter plates, and an oligonucleotide probe complementary to 3.5 telomere repeats, labeled with 33P, is used for measuring telomerase products. Unbound probe is removed by washing, and the amount of probe annealing to the captured telomerase products is determined by scintillation counting.

Example 2: Imetelstat Inhibits the Spontaneous Growth of CFU-Meg In Vitro From Essential Thrombocythemia Patients and Myelofivrosis Patients but Not From Healthy Individuals

This example demonstrates a dose-dépendent suppression of colony-forming unît megakaryocytes (CFU-Mega) by imetelstat in patients with essential hrombocythemia or Myelofibrosis independent of the JAKV617F mutational status or cytoreductive therapy, suggesting a specificity of imetelstat for malignant megakaryocytic cells.

Materials and Methods

For determining imetelstat effect on megakaryocyte growth and différentiation the following methods were used: (1) cord blood (CB) cells were enriched for CD34+ expressing cells using a négative cell séparation System; (2) cells were incubated with imetelstat (1-15 pM) în serum-free liquîd medium, StemSpan® SFEM, containing a cytokine formulation designed for the development of megakaryocyte progenitor cells; (3) cord blood cells were cultured for a total of days; and (4) at various time points, cells were enumerated and assessed by flow cytometry for différentiation markers (CD41 ) and for telomerase activity by TRAP assay.

For determining CFU-Mega dose response curves, mononuclear cells (MNC) from 3 healthy îndividuals and from 11 ET patients and one myelfibrotic (MF) patient (determined using WHO

2009 criteria) were isolated from peripheral blood and suspended in IMDM or plated into collagen ± cytokines (TPO, IL3, IL6, SCF, EPO) and treated with 0,0.1,1 and 10 μΜ imetelstat or a mismatch control, and incubated for several hours (cell suspensions) or 10-12 days (collagen plus 5% CO2) at 37°C. Megakaryocytes were stained and the number of CFU-Meg was scored. The dose-response analysis utilized a 4 parameter log-logistic model for Logio (colony count) by dose. Telomerase activity was measured in MNC by TRAP assay.

Results

Figures 1A and IB show imetelstat does not inhibit megakaryocyte growth or différentiation in healthy donors.

Table 1 shows spontaneous growth of CFU-Mega and inhibition by imetelstat.

Table 1: CFU-Mega % in Patients with Essential Thrombocythemia
Patient ID	0 μΜ [%]	0.1 μΜ [%] ± SD [%]	1 μΜ [%] ±SD [%]	10 μΜ I%] ± SD [%]
1*	100	138 ±5.7	119 ± 3.8	46 ±1.9
2*	100	106 ±4.3	48 ±4.3	39 ±4.3
3*	100	104 + 5.7	96 ± 11.3	44 ±5.7
4*	100	77 + -	3±-	14±-
5	100	138 ±33.7	81 ±23.6	52 ±6.7
6	100	117 ±4.9	52±-	45 ±45.6
7	100	33 ±5.9	29 ±0.0	13 ±2.9
8*	100	141 ±9.6	49 ± 13.4	14 ±-
9*	100	80+14.1	40 ±7.1	40 ±-
10	100	130 ± 1.6	66 ±8.1	3 ±0.4
11*	100	114 ± 0	95 ±34.4	49 ±7.6
N= 11	100	107 ± 8.6	79 ±11.8	33 ±9.4

* JAK2 V617F-positive

Table 2 shows cytokine-stimulated growth of CFU-Mega and no inhibition by imetelstat

Table 2: CFU-Meg (%) in Healthy Individuals
DonorID	OpM[%]C+	0.1 pM [%] ± SD [%1 C+	1 pM [%] ±SD [%] C+	10 pM [%] ±SD [%I C+
1	100	93 ±10	96±5	86 ±10
2	100	109 + 58	109±51	173 ± 13
3	100	111 ±47	122 ±20	78 ±16
N=3	100	104 ±38	109 ±25	112 ± 13

Figure 7 shows that imetelstat inhibits megakaryocyte growth or différentiation in a myelofibrosis patient.

The dose response curves in Figure 2 and the results in Figure 7 show imetelstat reduces neoplastic progenitor prolifération. CFU-Mega from peripheral blood indicates imetelstat inhibits neoplastic (spontaneous) megakaryocyte growth from patients with ET and MF, but does not inhibit normal (cytokine-dependent) megakaryocyte growth from healthy individuals.

This dose-dependent suppression of CFU-Mega formation by imetelstat in patients with ET is independent of the JAKV617F mutational status or cytoreductive therapy.

Example 3: Phase II Trial to Evaluate the Activity of Imetelstat (GRN163L3 in Patients with Essential Thrombocythemia Who Require Cytoreduction and Hâve Failed or Are Intolérant to Previous Therapy. or Who Refuse Standard Therapy (Phase II Imetelstat ET Study)

This example demonstrates imetelstat rapidly induces and maintains substantial hématologie and molecular responses in patients with essential thrombocythemia (ET) who were refractory to or intolérant to prîor therapy.

L·

Matériels and Methods

Clinical Trial Design

Patients with ET who had failed or were intolérant to at least one prior therapy (or who had refused standard therapy) and required cytoreduction were induced with 7.5 — 11.7 mg/kg

Imetelstat given as a 2 hour intravenous infusion weekly, with doses titrated to platelet response. When a platelet count of250-300xl0³/pL was achîeved, maintenance dosing with imetelstat was then initiât ed with doses increased or decreased based upon platelet response and toxicity, with a goalof less frequent dosing in the maintenance phase.

ET-specific patient inclusion criteria were: (1) a confirmed diagnosis of ET by World Health

Organization (WHO) criteria; (2) the patient with ET required cytoreduction and had failed or was intolérant to at least one prior therapy (or had refused standard therapy). Laboratory criteria (within 14 days of first study drug administration) were: (1) platelets > 600,000/ pL; (2) ANC > 1500/ pL; (3) hemoglobin > 10g/dL.

General criteria for ail patients were: (1) willing and able to sign an informed consent form; (2) 15 male or female, aged 18 years or older; (3) ECOG performance status of 0-2. Laboratory criteria for ail patients were (within 14 days of first study drug administration): (1) INR (or PT) and aPTT < 1.5 x the upper limit of normal (ULN); (2) sérum creatine < 2 mg/dL; (3) sérum bilirubin < 2.0 mg/dL (patients with Gilbert’s syndrome: sérum bilirubin < 3 x ULN); (4) AST (SGOT) and ALT (SGPT) < 2.5 x ULN; (5) alkaline phosphatase < 2.5 ULN; (6) any clinîcally signifïcant toxicity from previous cancer treatments and/or major surgery must hâve recovered to Grade 0-1 prior to initiation of study treatment.

Patients who met any of the following criteria were exciuded from screening and study entry: (1) women who were prégnant or breast feeding; (2) prior stem cell transplantation; (3) investigational therapy within 4 weeks prior to first study drug administration; (4) clinîcally signifïcant cardiovascular disease or condition încluding: (a) uncontrolled congestive heart failure (CHF); (b) need for antîarrhythmic therapy for a ventricular arrhythmia; (c) clinîcally signifïcant severe conduction disturbance per the Investigator’s discrétion; (d) ongoing angïna pectorïs requîring therapy; (e) New York Heart Association (NYHA) Class II, ΙΠ, or IV cardiovascular disease; (f) known positive serology for human immunodeficiency virus (HIV);

(g) serious co-morbid medical conditions, încluding active or chronîcally récurrent bleeding.

clinîcally relevant active infection, cirrhosis, and chronic obstructive or chronic restrictive pulmonary discase per the Investigator’s discrétion; or (h) any other severe, acute, or chronic medical or psychiatrie condition, laboratory abnormality, or difficulty complying with protocol requirements that may increase the risk associated with study participation or study drug administration or may interfère with the interprétation of study results and, in the judgment of the Investigator, would make the patient inappropriate for the study.

The primary ou tco me measure was the best overall hématologie response rate (RR) (complété response (CR) + partial response (PR)). The time frame was from time of the first dose (cycle 1 day 1) through the end of the study (12 months after last participant is dosed).

The secondary endpoint objectives were to détermine the duration of hématologie response, to détermine the molecular response (JAK2 V617F / MPL W515^ml patients), and to examine safety and tolerability by monîtoring number of patients with hematological toxicities, non-heme Grade 3 and 4 adverse events (AEs), and hémorrhagie events. The time frame was from the time of the first dose (cycle 1 day 1) through the end of the study (12 months after the last participant was dosed). The exploratory objective was CFU-Mega spontaneous growth (selected sites only).

Table 3 sets forth the response définitions for the study. European Leukemia Net Response Criteria were adapted from Barosi et al., Blood (2009). Heme response was counted as the latest of the 4 weeks.

Table 3: Response Définitions
Hématologie Response Grade	Définition
Complété Response (CR)	Normalization of platelets (< 400 x 10^J/pL) maintained for at least 4 consecutive weeks, in the absence of thromboembolie events.
Partial Response (PR)	Platelets (< 600 x 10^J/pL) or a 50% réduction in platelets maintained for at least 4 consecutive weeks, in the absence of thromboembolie events.
Molecular Response Grade	Définition
Complété Response (CR)	Réduction of any spécifie molecular abnormality to undetectable levels.

L·

Partial Response (PR)* *Applies only to patients with a baseline value of mutant allele burden > 10%	1) A réduction of > 50% from baseline value in patients with < 50% mutant allele burden at baseline OR 2) A réduction of > 25% from baseline value in patients with > 50% mutant allele burden at baseline.
No Response (NR)	Any response that does not satisfy complété or partial response.

Patient demographics are provided in Table 4 below.

Table 4: Patient Demographics
Characteristic Médian (Range)	Total (N « 14)
Age	59.5 years (21-83)
Years Since Initial Diagnosis	5.8 (0.3-24.9)
Médian Baseline Platelet Count	787.5 x 10^J/pL (521 -1359)
Médian Baseline WBC Count	6.6 x 10^J/pL (3.0-14.6)
Pts with JAK2 V617F	7 (50%)
Pts withMPL515^mt	2(14.3%)
More than one prior therapy (anagrelide +/- IFN)* *A1114 patients received prior hydroxyurea (6 résistant, 8 intolérant)	9 (64%)
Résistant to at least one prior therapy	7 (50%)
Intolérant of or refused at least one prior therapy	11 (71%)

Results

Figure 3 shows a 100% overall hématologie response was achïeved în ail 14 patients with ET who had failed or were intolérant to conventional thérapies. A complété response was achieved in 13 of 14 patients (92.9%) and a partial response in 1 of 14 patients (7.1%). Ail patients who attained a hématologie CR remain on treatment. The data indicated that the time to a first occurrence of platelet count < 400 x 10³/pL (marked for each patient with a diamond) had a médian value of 3.1 weeks (2.1 to 23.1 weeks), while the time to complété response had a médian value of 6.1 weeks (5.1 to 14.1 weeks) (Figure 3).

L·

Data on dosing firequency for the 13 patients who had a hématologie complété response and began maintenance therapy are provided in Table 5 below. Maintenance dosing frequency generally decreased with time (range was weekly to Q7 weeks) with the majority (84.6% or 11/14) of patients receiving imetelstat every 2 weeks or less frequently (based on the médian). 85.7% of patients (6/7) who were eligible to remain on therapy after 1 year hâve continued maintenance therapy.

Table 5: Dosing Frequency in Maintenance
Médian frequency of therapy	N = 13
Weekly	2(15.4%)
Every 2 weeks	3(23.1%)
Every 3 weeks	2(15.4%)
> Every 3 weeks	6(46.1%)

As shown in Figure 4A, the % JAK2 V617F allelîc burden decreased over time in ail patients, while Figure 4B shows molecular responses (PR) were reached in 6/7 (85.7%) patients tested with JAPK2 V617F within a 3-6 month range.

Table 6 shows the results regarding the exploratory endpoint (CFU-Mega). Reduced spontaneous growth of CFU-Mega ex-vivo was demonstrated in the two patients tested (93% and 96% réduction from baseline, respectively), confirming prior ex vivo data.

Table 6: Results for Exploratory Endpoint - CFU-Mega
Patient #	Baseline	1 month
4	22.7	1.7
8	8.0	0.3

Figure 5 shows spontaneous growth of CFU-Mega did not correspond with the réduction in JAK2 allelic burden in one patient (patient #4).

The data suggest that imetelstat has a relatively sélective inhibitory effect on the growth of the neoplastic clone(s) which drive myeloproliferative neoplasms (MPNs) such as essential thrombocythemia and has the potential to modify the underlyîng biology of the disease.

Table 7 shows the clïnîcally significant frequent non-hematologic adverse events.

L·

Table 7: Safety - Clinically Significant Frequent Non-Hematologic Adverse Events
Frequent Non-Hematologic Adverse Events	Ail Grades (N=14)	Grade3(N=14)
GI Events (Nausea/Diarrhea/Constipation)	14 (100%)	0
Infections	12(85.7%)	1*(7.1%)
Fatigue	9 (64.3%)	1 (7.1%)
Musculoskeletal Disorders	9 (64.3%)	0
Bleeding Events	8 (57.1%)	l**(7.1%)
Headache	7 (50%)	1 (7.1%)
Cough	7 (50%)	0
Decreased Appetite	7 (50%)	0
Dizziness	6(42.9%)
Infusion Reactions	4 (28.6%)	1***(7.1%)

One Grade 4 adverse event: imetelstat unrelated neck fracture. No Grade 5 adverse events and no thromboembolie events were reported.
♦Grade 3 cellulitis/wound infection
**Grade 3 post-operative hémorrhagie anémia
***Grade 3 syncope; patient remains on treatment

Table 8 shows the laboratory abnormalîties:

Table 8: Safety - Laboratory Abnormalîties
Laboratory Parameter	Ail Grades (N=14)	Grade 3 (N=14)	Grade 4
ALT/AST (change from baseline grade)	13 (92.9%)	2 (14.3%)	0
Neutropenia	Il (78.6%)	4 (28.6%)	2 (14.3%)
Anémia (change from baseline grade)	9 (64.3%)	1 (7.1%)*	0
Thrombocytopenia	6 (42.9%)	0	0

No cases of febrile neutropenia reported.
*Post-operative hémorrhagie anémia

Example 4: A Pilot open label study of the efficacv and safetyof ïmetelstat (GRN163L) in Patients with DÏPSS plus Intermediate-2 or High Risk Primary Myelofibrosis (PMF), postpolycythemia Vera Myelofibrosis foost-PV MF) or Post-Essential Thrombocythemîa Myelofibrosis (post -ET MF)

Materials and Methods

Clinical Trial Design

Patients with DÏPSS plus Intermediate-2 or High Risk Prtmary Myelofibrosis (PMF), postpolycythemia Vera Myelofibrosis (post-PV MF) or Post-Essential Thrombocythemîa Myelofibrosis (post -ET MF) who were not on active standard therapy were induced with 9.4 mg/kg ïmetelstat given as a 2 hour intravenous infusion once every 21 days (cohort A). Alternatively, patients were dosed with 2 hour infusion (9.4 mg/kg) weekly for 3 weeks followed by once every 21 days (cohort B). Patients may receive treatment for a maximum of 9 cycles. Patients may continue therapy beyond 9 cycles.

PMF-specific patient inclusion criteria were: (1) a confirmed diagnosis of ET by World Health Organization (WHO) criteria; (2) megakaryocyte prolifération with atypia accompanied by either reticulin and/or collagen fibrosis or (4) not meeting WHO criteria for CML, PV, MDS or other myeloid neoplasm or (5) no evidence of reactive marrow fibrosis.

Post-PV MF -spécifie patient inclusion criteria were: (1) a confirmed diagnosis of PV by World Health Organization (WHO) criteria; (2) bone marrow fibrosis grade 2-3 (on a 0-3 scale) or grade 3-4 (on a 0-4 scale) and (3) two or more of (a) anémia or sustained Ioss of requirement for phlebotomy in the absence of cytoreductive therapy or (b) leukoerythroblastic peripheral blood picture or (c) increasing splenomegaly defined as either an increase in palpable splenomegaly of >5 cm or the appearance of a newiy palpable splenomegaly or (d) development of >1 of the three constitutional symptoms: .10% weight Ioss in 6 months, night sweats, unexplained fever (.37.5’0..

Post -ET MF -spécifie patient inclusion criteria were: (1) a confirmed diagnosis of ET by World Health Organization (WHO) criteria; (2) bone marrow fibrosis grade 2-3 (on a 0-3 scale) or grade 3-4 (on a 0-4 scale) and (3) two or more of (a) anémia and a >2g/dL decrease from baseline hemoglobin level or (b) leukoerythroblastic peripheral blood picture or (c) increasing splenomegaly defined as either an increase in palpable splenomegaly of >5 cm or the appearance of a newly palpable splenomegaly or (d) increased castate dehydrogenase or (e) development of>l of the three constitutional symptoms: .10% weight loss in 6 months, night sweats, unexplained fever (.37.5°C).

General criteria for ail patients were: (1) willing and able to sign an informed consent form; (2) male or female, aged 18 years or older; (3) ECOG performance status of 0-2. Laboratory criteria for ail patients were (within 14 days of first study drug administration): (1 AST (SGOT) and ALT (SGPT) < 2.5 x ULN; (2) creatine < 3 mg/dL; (3) absolute neutrophil count > 1000/pL; (4) platelet count > 50,000/ pL; (5) absence of active treatment with systemic anticoagulation and a baseline PT and aPTT that does not exceed 1.5 x UNL.

Patients who met any of the following criteria were excluded from screening and study entry: (1) women who were prégnant or breast feeding; (2) any chemotherapy immunomodulatory drug therapy, immunosuppressive therapy, corticosteroids .10 mg/day prednisone or équivalent, growth factor treatment or JAK inhibitor therapy < 14 days prior to registration; (4) subjects with another active malignancy. (5) known positive status for HIV (6) any unresolved toxicity greater tor equal to Grade 2 from previous anticancer therapy (6) incomplète recovery from any prior surgical procedures (7) presence of acute active infection requiring antibiotics (8) uncontrolled intercurrent illness or any concurrent condition that would jeopardize the safety of the patient or compliance with the protocol

The primary outcome measure was the best overall response rate (RR) (clinical improvement (CI) or complété response (CR) or partial response (PR)). The time trame was from time of the first dose (cycle 1 day 1) through the first 9 cycles of treatment.

The secondary endpoint objectives were to détermine the (a) adverse events, (b) the spleen response: defined as either a minimum 50% réduction in palpable splenomegaly of a spleen that is at least 10 cm at baseline or a spleen that is palpable at more than 5 cm ab baseline (c) transfusion-independence: where transfusion dependency is defined as a history of at least 2 units of red blood cell transfusions in the last month for a hemoglobin level of less than 85 g/L that was not associated with clinically overt bleeding. The time frame was from the time of the first dose (cycle 1 day 1) through the end of the study. The exploratory objective was (a) bone marrow histology assessment of reversai of bone marrow fibrosis to a lower grade and (b) portion of patients with baseline leukocytosis and thrombocytosis who achieve at least 50% réduction in their counts at the end of cycles 3,6 and 9.

Table 9 sets forth the response définitions for the study. Intenational Working Group (TWG) consensus criteria for treatment response in myelofibrosis with myeloid metaplasia were used.

Table 9: Response Définitions
	Définition
Complété Remission (CR)	Complété resolution of disease-related symptoms and signs including palpable hepatosplenomegaly Peripheral blood count remission defined as hemoglobin level at least 110 g/L, platelet count at least 100 x 10⁹/L, and ' absolute neutrophil count at least 1.0 x 10⁹/L. In addition, ail 3 blood counts should be no higher than the upper normal limit Normal leukocyte differential including disappearance of nucleated red blood cells, blasts and immature myeloid cells in the peripheral smear, in the absence of splenectomy Bone marrow histologie remission defined as the presence of age-adjusted normocellularity, no more than 5% myeloblasts and an osteomyelofibrosis grade no higher than 1.
Partial Remission (PR)	requires ail of the above criteria for CR except the requirement for bone marrow histologie remission. However, a repeat bone marrow bïopsy is requïred in the assessment of PR and may or may not show favorable changes that do not however fullfil criteria for CR.
Clinical Improvement (CI)	Requires one of the following in the absence of both disease progression and CR/PR assignment 1. a minimum 20 g/L increase in hemoglobin level or becoming transfusion independent (applicable only for patients with baseline pretransfusion hemoglobin level of lOOg/L 2. either minimum 50% réduction in palpable splenomegaly of

L·

	a spleen that is at least 10 cm at baseline or a spleen that is palpable at more than 5 cm at baseline becomes not palpable 3. a minimum 100% increase in platelet count and an absolute platelet count of at least 50,000 x Ιθ’/L (applicable only for patients with baseline platelet count below 50 x 10⁹/L 4. a minimum 100% increase in ANC and an ANC of at least 0.5 x 10⁹/L(applicable only for patients with baseline neutrophil count below 1 x 10⁹/L).
Progressive Disease (PD))	Requires one of the following: 1. Progressive splenomegaly that is defined by the appearance of a previously absent splenomegaly that is palpable at greater than 5 cm below the left costal margin or a minimum 100% increase in palpable distance for baseline splenomegaly of 5 10 cm or a minimum 50% increase in palpable distance for baseline splenomegaly of greater than 10 cm 2. Leukemic transformation confïrmed by a bone marrow blast count of at least 20% 3. An increase in peripheral blood blast percentage of at least 20% that lasts for at least 8 weeks.
Stable Disease	None of the above
Relapse	Loss of CR, PR or CI

Resulls

Clinical benefit has been observed in patients enrolled in the study. Thirty-three patients were accrued; the first 18 patients enrolled and followed for a minimum of 3 months or discontinued 5 are presented: 11 patients in cohort A and 7 patients in cohort B; 44% PMF, 33% post-PV MF and 22% post-ET MF. Médian âge was 68 years and baseline risk was hîgh in 56% and intermediate-2 in 44%. Seven patients were transfusion-dependent. Médian spleen size was 13 cm and 11 patients had constitutional symptoms. Karyotype was abnormal in 7 patients and 89% were JAK2-mutated. Fifteen (83%) patients were previously treated including 7 with a JAK 10 inhibitor and 3 with pomalidomide.

Toxicity

L·

At a médian follow-up of 3.2 months, 16 (89%) patients remain on treatment; the two discontinuations were from unrelated death and disease progression. In cohort A, there were no grade-4 treatment-related adverse events; grade-3 events were limited to thrombocytopenia in 27% and anémia in 9%. In cohort B, two (29%) patients experienced grade-4 thrombocytopenia; grade-3 events were limited to thrombocytopenia, neutropenia and anémia in one patient each. Dose réduction was necessary in only two (11%) patients because of grade 3 or 4 myelosuppression.

Efficacy

Overall response rate was 44%. This included five (28%) patients who met the BM and peripheral blood morphologie criteria for complété response (CR) (n=4) or partial response (PR) (n=l) and 3 patients with clinical improvement, pending validation of response duration and résolution of drug-induced grade-1 thrombocytopenia. The four (22%) CR patients experienced reversai of bone marrow (BM) fîbrosis and recovery of normal megakaryocyte morphology. Two CR patients were transfusion-dependent at baseline and became transfusion-independent. Complété molecular responses were documented in 2 CR patients: one had 10% JAK2V617F and the other 50% JAK2V617F. Among 13 patients with Ieukocytosîs, 10 (77%) normalized their count or had >50% réduction. Eleven (61%) patients had complété or partial resolution of leukoerythroblastosis.

A later and more complété analysis of 22 patients enrolled in Arm A and Arm B was conducted. Table 10 shows the results.

Table 10: Primary Endpoint: Summary ofOverall Response by 2013IWG-MRT Criteria: Ail Eligible Patients in Arms A and B
	Arm A (N = 11)	Arm B (N = 11)	Total (N = 22)
Best Response by IWG-MRT	N(%)	N(%)	N(%)
Overall Response (CR+PR+CI)	4 (36.4%)	6 (54.5%)	10 (45.5%) (95% Confidence Interval: 24.4%-67.8%)
Remission (CR+PR)	2(18.2%)	3 (27.3%)	5 (22.7%)
Complété Remission	2(18.2%)*	1 (9.1%)	3 (13.6%)
Partial Remission		2(18.2%)	2(9.1%)
PR with BM Remissions		1 (9.1%)	1 (4.5%)

L·

Table 10: Primary Endpoint: Summary of Overall Response by 2013 IWG-MRT Criteria: Ail Eligible Patients in Arms A and B
	Arm A (N-11)	Arm B (N =11)	Total (N = 22)
Best Response by IWG-MRT	N (%)	N (%)	N(%)
PR without BM Remissions		1 (9.1%)	1 (4.5%)
Clinical Improvement	2(18.2%)	3 (27.3%)	5 (22.7%)
Cl-by Anémia Response	1 (9.1%)	1 (9.1%)	2(9.1%)
Cl-by Liver Response		1 (9.1%)®	1 (43%)
Cl-by Spleen Response	1 (9.1%)	1 (9.1%)	2(9.1%)
Spleen Response Only	1 (9.1%)		1 (4.5%)
Stable Disease	6 (543%)’	5 (453%)’	11 (50%)

* Two patients are pending 12-week durability assessment * Two patients whose best response were SD had developed progressive disease and discontinued from study, one due to transformation to CNÎML (Arm A) and the other due to the development of splenomegaly (Arm B).

Time to initial response (médian) for CR/PR/CI is 2.4 months.

Time to initial response (médian) for CR/PR is 2.8 months.

Example 5: Imetelstat Inhibits the Spontaneous Growth of CD344- cells In Vitro From Acute Myeloid Leukemia Patients but Not From Healthv Individuals

This example demonstrates a dose-dependent suppression of CD34+ cells by imetelstat in patients with acute myeloid leukemia, suggesting a specificity of imetelstat for malignant CD34+ cells.

Materials and Methods

For determining imetelstat effect the following methods were used: (1) bone marrow cells were incubated with imetelstat (0.1-10 μΜ) in a colony forming assay and in liquid culture for a total of 14 days and at various time points, cells were enumerated and assessed.

For determining CFU dose response curves, bone marrow cells from 4 healthy individuals or firom5 AML patients were isolated from peripheral blood plated and treated with 0,0.1,1 and 10 pM imetelstat or a mismatch control. The CFU-GM (colony forming unit - granulocyte, macrophage) and BFU-E (burst-forming unit - erythroid) were stained and the number of CFUGM and BFU-E were scored.

Restilts

Imetelstat did not reduce CFU from the bone marrow of a healthy donor in a 14 day CFU assay.

Réduction of CFU of bone marrow cells from an AML patient was observed upon treatment with imetelstat in a 14 day CFU assay.

Imtelstat reduced cell growth from bone marrow cells of newjy diagnosed AML patients in a 14 day liquid culture assay.

Imetelstat reduced the growth of CD34+ cells derived from an AML patient’s bone marrow cells but not from a normal patient’s bone marrow. Figure 6 depict the percentage of cell growth in culture after in vitro treatment with Imetelstat of CD34+ cells obtained from a healthy donor and CD34+ cells from an AML patient at day 5, day 7 and day 9.

The examples, which are intended to be purely exemplary of the invention and should therefore not be considered to limit the invention in any way, also describe and detail aspects and embodiments of the invention discussed above. The foregoing examples and detailed description are offered by way of illustration and not by way of limitation. Ail publications, patent applications, and patents cited in this spécification are herein incorporated by référencé as if each individual publication, patent application, or patent were specifically and individually indicated to be incorporated by référencé. In particular, ail publications cited herein are expressly incorporated herein by référencé for the purpose of describing and disclosing compositions and méthodologies which might be used in connection with the invention. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

Claims

What is claimed is:

1. A method for aile viating at least one symptom associated with myeloproliferative neoplasms or myelodysplastic syndrome in an îndividual in need thereof, the method comprising: admînistering a clinically effective amount of a telomerase inhibitor to the îndividual, wherein administration of the telomerase inhibitor alleviates at least one symptom associated with myeloproliferative neoplasms or myelodysplastic syndrome.
2. The method of claim 1 wherein the myeloproliferative neoplasm is selected from the group consisting of Essential Thrombocythemia (ET), Polycythemia vera (PV), ChronicMyelogenous Leukemia (CML), myelofibrosis (MF), chronic neutrophilie leukemia, chronic éosinophilie leukemia and acute myelogenous leukemia (AML).
3. The method of claim 2, wherein the symptom comprises headache, dizziness or üghtheadedness, chest pain, weakness, fainting, vision changes, numbness or tingling of extremities, redness, throbbing or buming pain in extremities (erythromelalgia), enïarged spleen, nosebleeds, bruising, bleeding from mouth or gums, bloody stool, or stroke.
4. The method of claim 2 wherein the the myeloproliferative neoplasm (MPN) is Essential Thrombocythemia (ET) or Polycythemia vera (PV).
5. The method of claim 2 wherein the myeloproliferative neoplasm (MPN) is myelofibrosis (MF).
6. The method of claim 2 wherein the myeloproliferative neoplasm (MPN) is acute myelogenous leukemia (AML).
7. The method of claim 1 wherein the myelodysplastic syndrome is selected from the group consisting of refractory anémia, refractory anémia with excess blasts, refractory cytopenia with multilineage dysplasia, refractory cytopenia with unîlineage dysplasia, and chronic myelomonocytic leukemia (CMML).
8. The method of claim 7 wherein the myelodysplastic syndrome (MDS) is chronic myelomonocytic leukemia (CMML).
9. A method for reducing neoplastic progenitor cell prolifération in an îndividual diagnosed with or suspected of having a myeloproliferative neoplasm or myelodysplastic syndrome, the method comprising: administering a clinically effective amount of a telomerase inhibitor to the individual, wherein administration of the telomerase inhibitor reduces neoplastic progenitor cell prolifération in the individual
10. The method ofclaim 9 wherein the myeloproliferative neoplasm is selected from the group consisting of Essential Thrombocythemia (ET), Polycythemia vera (PV), ChronicMyelogenous Leukemia (CML), myelofibrosis (MF), chronic neutrophilie leukemia, chronic éosinophilie leukemia and acute myelogenous leukemia (AML).
11. The method of claim 10 wherein the myeloproliferative neoplasm (MPN) is Essential Thrombocythemia (ET) or Polycythemia vera (PV).
12. The method of claim 10 wherein the myeloproliferative neoplasm (MPN) is myelofibrosis (MF).
13. The method of claim 10 wherein the myeloproliferative neoplasm (MPN) is acute myelogenous leukemia (AML).
14. The method of claim 9 wherein the myelodysplastic syndrome is selected from the group consisting of refractory anémia, refractory anémia with excess blasts, refractory cytopenia with multilineage dysplasia, refractory cytopenia with unilineage dysplasia, . and chronic myelomonocytic leukemia (CMML).
15. The method of claim 11 wherein reduced neoplastic progenitor cell prolifération results in platelet counts of less than about 600 x 10³ / pL in the blood of the individual
16. The method of claim 9, wherein the individual is résistant or intolérant to a prior nontelomerase inhibitor-based therapy.
17. A method for maintaining blood platelet counts of between less than about 400 x 10 / pL in the blood of an individual diagnosed with or suspected of having essential thrombocythemia, the method comprising: administering a clinically effective amount of a telomerase inhibitor to the individual, wherein administration of the telomerase inhibitor maintains blood platelet counts of less than about 400 x 10³ / pL in the individual.
18. The method of claim 17, wherein the telomerase inhibitor is administered no more than once every two weeks.
19. A method for reducing bone marrow fibrosîs in an individual diagnosed with or suspected of having a myeloproliferative neoplasm or myelodysplastic syndrome, the method comprising: administering a clinically effective amount of a telomerase inhibitor to the individual, wherein administration of the telomerase inhibitor reduces bone marrow fibrosis in the individual.
20. The method of claim 9, wherein the telomerase inhibitor comprises an oligonucleotide.
21. The method of claim 13, wherein the oligonucleotide is complementary to the RNA component of telomerase.
22. The method of claim 14, wherein the oligonucleotide is 10-20 base pairs in length.
23. The method of claim 15, wherein the oligonucleotide comprises the sequence TAGGGTTAGACAA.
24. The method of daims 20, wherein the oligonucleotide comprises at least one N3’-> P5’ thiophosphoramidate intemucleoside linkage.
25. The method of daims 24, wherein the oligonucleotide comprises N3'-> P5’ thiophosphoramidate intemucleoside linkages.
26. The method of claim 20, wherein the oligonucleotide further comprises a lipid moiety linked to the 5’ and/or 3* end of the oligonucleotide.
27. The method of daims 26, wherein the lipid moiety is linked to the 5’ and/or 3’ end of the oligonucleotide via a linker.
28. The method of claim 27, wherein the linker is a glycerol or aminoglycerol linker.
29. The method of claim27, wherein the lipid moiety is a palmitoyl (Cl6) moiety.
30. The method of any one of daims 9, wherein the telomerase inhibitor is îmetelstat.
31. The method of daim 9, wherein the telomerase inhibitor is administered with a pharmaceutically acceptable excipient.
32. The method of daims 9, wherein the telomerase inhibitor is formulated for oral, intravenous, subcutaneous, intramuscular, topical, intraperitoneal, intranasal, inhalation, or intraocular administration.
33. The method of claims 9, wherein administration of the therapeutically effective amount of the telomerase inhibitor comprises contacting one or more neoplastic progenitor cells with the telomerase inhibitor.
34. The method of claims 30, wherein the effective amount of a telomerase inhibitor is 7.5 mg/kg to 9.3 mg/kg.
35. The method of claim 30, wherein the effective amount of a telomerase inhibitor is 9.5 mg/kg to 11.7 mg/kg.
36. The method of claim 9, wherein administration of the telomerase inhibitor does not inhibit cytokine-dependent megakaryocyte growth.
37. The method of claim 9, wherein the individual carries a V617F gain of fonction mutation in the Janus kinase 2 (JAK2) gene.
38. The method of claim 37, wherein administration of the telomerase inhibitor decreases the percentage of JAK2 V617F allelic burden in the individual.
39. The method of claim 9, wherein administration of the telomerase inhibitor inhibits cytokine-independent megakaryocyte growth.
40. The method of claims 9, wherein administration of the telomerase inhibitor inhibits CFUmega.
41. The method of claim 40, wherein inhibition of CFU-Mega is independent of réduction in JAK2 allelic burden.