OA17210A

OA17210A - Probes and primers for the detection of the BCR-ABL gene in duplex reaction.

Info

Publication number: OA17210A
Application number: OA1201500086
Authority: OA
Inventors: El Hassan Sefrioui; Amrani Manale El; Denise Kottwitz
Original assignee: Mascir (Moroccan Foundation For Advanced Science, Research And Innovation)
Priority date: 2012-09-13
Filing date: 2013-04-05
Publication date: 2016-04-05

Abstract

La présente invention concerne l'utilisation de nouvelles sondes, amorces, sets d'amorces, sets de sondes et amorces en qPCR pour la détection et la quantification de la translocation BCR-ABL et un gène contrôle en! réaction simplexe ou multiplexe. En quantifiant le gène BCR-ABL et le gène contrôle, la qPCR de la présente invention permettra la détection de la leucémie chronique myéloïde (LMC), le suivi du traitement ainsi que de la maladie résiduelle. The present invention relates to the use of novel probes, primers, sets of primers, sets of probes and primers in qPCR for the detection and quantification of the BCR-ABL translocation and a control gene in! simplex or multiplex reaction. By quantifying the BCR-ABL gene and the control gene, the qPCR of the present invention will allow the detection of chronic myeloid leukemia (CML), the monitoring of the treatment as well as the residual disease.

Description

Sondes et amorces pour la détection du gène BCR-ABL en réaction duplex.Probes and primers for the detection of the BCR-ABL gene in duplex reaction.

DOMAINE TECHNIQUETECHNICAL AREA

La présente invention concerne l'utilisation de nouvelles sondes, amorces, sets d'amorces, sets de sondes et amorces en qPCR pour la détection et la quantification de la translocation BCR-ABL et un gène contrôle en réaction simplexe ou multiplexe.The present invention relates to the use of novel probes, primers, sets of primers, sets of probes and primers in qPCR for the detection and quantification of the BCR-ABL translocation and of a control gene in a simplex or multiplex reaction.

En quantifiant le gène BCR-ABL et le gène contrôle, la qPCR de la présente invention permettra la détection de la leucémie chronique myéloïde (LMC), le suivi du traitement ainsi que de la maladie résiduelle.By quantifying the BCR-ABL gene and the control gene, the qPCR of the present invention will allow the detection of chronic myeloid leukemia (CML), the monitoring of the treatment as well as the residual disease.

ETAT DE LA TECHNIQUE ANTERIEURESTATE OF THE PRIOR ART

La leucémie myéloïde chronique (LMC) est une maladie caractérisée par la présence du chromosome de Philadelphie qui est le chromosome 22 raccourci sur son bras long par une translocation t(9,22}(q34 ;qll). Cet échange entre les bras longs des chromosomes 9 et 22 est constamment présent dans les cellules des patients atteint de LMC et il en résulte un gène de fusion appelé BCR-ABL fonctionnel qui sera transcrit en ARNm chimérique (Shtivelman, 1985. Nature 1985; 315:550-4) qui est traduit en protéines de fusion bcr-abl, responsable de la LMC.Chronic myelogenous leukemia (CML) is a disease characterized by the presence of the Philadelphia chromosome which is chromosome 22 shortened on its long arm by a t (9,22} (q34; qll) translocation. This exchange between the long arms of the chromosomes 9 and 22 are constantly present in the cells of patients with CML and a functional fusion gene called BCR-ABL results which will be transcribed into chimeric mRNA (Shtivelman, 1985. Nature 1985; 315: 550-4) which is translated into bcr-abl fusion proteins, responsible for CML.

La translocation BCR-ABL (t (9,22) (q34;qll)} est présente chez 90-95% des patients LMC et 20-25% chez les patients de la leucémie lymphoïde algue (LLA) (PrisL 1980; Blood 56:15-22). La majorité des translocations de la LMC frappe la région du 'major breakpoint cluster région* (M-bcr) au niveau du gène BCR et résulte en 2 transcrits qui sont b2a2 et b3a2 codant pour une protéine de fusion P210. La détection et la quantification des 2 derniers transcrits permettront de statuer sur l'évolution de la LMC. En effet, i'ARNm du gène BCRABL peut être détecté et quantifié spécifiquement et efficacement par la méthode RT-PCR parce que ce gène de fusion est spécifique à la LMC et peut être utilisé comme marqueur permettant d'identifier cette maladie.The BCR-ABL translocation (t (9,22) (q34; qll)} is present in 90-95% of CML patients and 20-25% in patients with lymphoid algal leukemia (ALL) (PrisL 1980; Blood 56 : 15-22). The majority of CML translocations strike the major breakpoint cluster region * (M-bcr) region at the BCR gene and results in 2 transcripts which are b2a2 and b3a2 encoding a P210 fusion protein The detection and quantification of the last 2 transcripts will make it possible to decide on the evolution of CML. Indeed, the mRNA of the BCRABL gene can be detected and quantified specifically and efficiently by the RT-PCR method because this fusion gene is specific to CML and can be used as a marker to identify this disease.

Le critère fondamental du diagnostic de la LMC ou LLA est la présence de gène de fusion BCR-ABL, qui peut être mis en évidence par des méthodes cytogénétiques actuelles comme celles du caryotype, la FISH (Fluorescent In situe hybridation) ou d'examens hématologiques. Cependant, ces méthodes manquent surtout d'essais quantitatifs et qualitatifs, elles sont moins spécifiques, utilisent des hybridations complexes ou des isotopes, prennent énormément de temps (plusieurs jours), peuvent être invasives (utilisation de la moelle osseuse), ou plus coûteuses. De plus, ces méthodes cytogénétiques peuvent détecter seulement une cellule LMC sur SOO cellules et donc ne peuvent pas être utilisées dans le cas du suivie de traitement de la LMC ni dans le cas de la maladie résiduelle qui nécessite une grande sensibilité (détection d'une cellule LMCsur 100000 cellules).The fundamental criterion for the diagnosis of CML or ALL is the presence of the BCR-ABL fusion gene, which can be demonstrated by current cytogenetic methods such as karyotyping, FISH (Fluorescent In situ hybridization) or hematological examinations. . However, these methods mainly lack quantitative and qualitative tests, they are less specific, use complex hybridizations or isotopes, take a very long time (several days), can be invasive (use of the bone marrow), or more expensive. In addition, these cytogenetic methods can detect only one CML cell on SOO cells and therefore cannot be used in the case of the follow-up of CML treatment nor in the case of the residual disease which requires high sensitivity (detection of a LMC cell over 100,000 cells).

C'est pour les raisons citées ci-dessus qu'il est préférable de chercher des méthodes de quantification de BCR-ABL avec plus de sensibilité et de fiabilité, de meilleures répétabilité quantitatives et qualitatives, moins coûteuses et pouvant facilement détecter la maladie résiduelle.It is for the reasons cited above that it is preferable to seek methods of quantification of BCR-ABL with more sensitivity and reliability, better quantitative and qualitative repeatability, less expensive and able to easily detect residual disease.

Une méthode alternative à l'art antérieur décrit ci-dessus est la PCR quantitative .en temps réel (qPCR) qui a été bien décrite auparavant pour l'amplification et la détection de différents gènes dont BCR-ABL (Fossev S et al; Mol Diagn, 2005;9(4):187-93; Gibson et al, 1996 Genomic Res 6:995-1001).An alternative method to the prior art described above is quantitative real-time PCR (qPCR) which has been well described previously for the amplification and detection of various genes including BCR-ABL (Fossev S et al; Mol; Mol; Diagn, 2005; 9 (4): 187-93; Gibson et al, 1996 Genomic Res 6: 995-1001).

Pour la quantification d'un gène cible, la qPCR utilise en parallèle un gène contrôle 'housekeeplng gene' exprimé de manière ubiquitaire dans toutes les cellules du corps et qui facilitera la normalisation et la quantification du gène ciblé. Dans le cas de BCR-ABL, plusieurs gènes contrôles ont été testés comme GAPDH, beta-actine, microglobiline, G6PDH (Glucose-6-Phosphate-Déshydrogénase) (Ullmannov. V, 2003; Folia Bîologica (Praha) 49, 211-216 (2003). Plus tard, une étude incluant 38 laboratoires Nord Américains a étudié certains gènes contrôles en parallèle pour quantifier BCR-ABL (Tong et al ; 2007 ; Journal of molecular Diagnostics, vol 9, N4: p 421-429). Dans cette étude, l'amplification et la détection de BCR-ABL et les gènes contrôles a été faite avec des séquences nucléotidiques spécifiques tout en utilisant la qPCR en format simplex. Avec cette méthode, la sensibilité et le cout reste raisonnables et meilleurs que l'art antérieur.For the quantification of a target gene, qPCR uses in parallel a control gene 'housekeeplng gene' expressed ubiquitously in all cells of the body and which will facilitate the normalization and quantification of the target gene. In the case of BCR-ABL, several control genes were tested such as GAPDH, beta-actin, microglobilin, G6PDH (Glucose-6-Phosphate-Dehydrogenase) (Ullmannov. V, 2003; Folia Bîologica (Praha) 49, 211-216 (2003). Later, a study including 38 North American laboratories studied certain control genes in parallel to quantify BCR-ABL (Tong et al; 2007; Journal of molecular Diagnostics, vol 9, N4: p 421-429). this study, the amplification and detection of BCR-ABL and control genes was done with specific nucleotide sequences while using qPCR in simplex format. With this method, the sensitivity and the cost remains reasonable and better than the prior art.

Il est souhaitable d'identifier une méthode de qPCR pour quantifier BCR-ABL qui peut être encore plus sensible et plus fiable mais surtout moins coûteuse que l'art antérieur décrit cidessus.It is desirable to identify a qPCR method for quantifying BCR-ABL which may be even more sensitive and more reliable but above all less expensive than the prior art described above.

EXPOSE DE L'INVENTIONDISCLOSURE OF THE INVENTION

La présente Invention préconise l'utilisation de nouveaux sets de sondes et d'amorces et d'un procédé de qPCR en réaction slmplexe ou multiplexe pour la détection et la quantification du gène BCR-ABL permettant le diagnostique de la LMC, le suivi de son traitement ainsi que la maladie résiduelle.The present invention recommends the use of new sets of probes and primers and of a method of qPCR in slmplex or multiplex reaction for the detection and the quantification of the BCR-ABL gene allowing the diagnosis of CML, the monitoring of its. treatment as well as residual disease.

Le procédé de la présente Invention (7) améliore les autres méthodes antérieurs citées cidessus et permet a) de gagner en sensibilité en utilisant des nouvelles sondes et amorces de BCR-ABL et ABL1 plus spécifiques et plus sensibles que ceux citées dans l'art antérieur b) une réduction en cout de consommables et en temps de réalisation ainsi qu’en fiabilité car l'amplification des gènes BCR-ABL et de ABL1 se fait simultanément dans le même puits de qPCR c) de détecter, à l'inverse des autres méthodes de l'art antérieur, les 2 variantes de la LMC b3a2 et b2a2, étant donné que les sondes et amorces de BCR-ABL de la présente Invention sont désignées de tel manière à détecter les 2 types de transcrits, ce qui permettra un gain en temps supplémentaire.The method of the present invention (7) improves the other prior methods cited above and allows a) to gain in sensitivity by using new probes and primers of BCR-ABL and ABL1 more specific and more sensitive than those cited in the prior art b) a reduction in the cost of consumables and production time as well as in reliability because the amplification of the BCR-ABL and ABL1 genes is carried out simultaneously in the same qPCR well c) to detect, unlike the others methods of the prior art, the 2 variants of LMC b3a2 and b2a2, given that the BCR-ABL probes and primers of the present invention are designated in such a way as to detect the 2 types of transcripts, which will allow a gain in overtime.

Selon une caractéristique de l'invention, la quantification des gènes cibles se fait par qPCR en différentes étapes a) synthèse des nouvelles séquences nucléotidique de sondes et amorces qui vont se fixer spécifiquement sur BCR-ABL ou à ABU (b) quantification de BCRABL sur le chromosome 22 en obtenant un nombre de copie de gène pour BCR-ABL c) quantification de ABU sur le chromosome 9 en obtenant un nombre de copie de gène pour ABU d) comparaison du nombre de copie de gène BCR-ABL1 à celui de ABL1 en obtenant un ratio nombre de copie de gène BCR-ABL1 par apport au nombre de copie du gène ABU (BCR-ABL/ABU) e) l'évolution de ce rapport après le traitement de la LMC, permet de savoir si un patient a bien répondu ou non au traitement. Une réduction du rapport BCR-ABL/ABU après traitement suggère une réponse positive f) en accordance avec (e), le rapport BCRABL/ABU permet aussi de détecter la maladie résiduelle, difficile à détecter avec les méthodes antérieurs, vue leur faible sensibilité de détection.According to one characteristic of the invention, the quantification of the target genes is carried out by qPCR in different steps a) synthesis of the new nucleotide sequences of probes and primers which will bind specifically to BCR-ABL or to ABU (b) quantification of BCRABL on chromosome 22 by obtaining a gene copy number for BCR-ABL c) quantification of ABU on chromosome 9 by obtaining a gene copy number for ABU d) comparison of the number of BCR-ABL1 gene copies to that of ABL1 by obtaining a ratio of number of BCR-ABL1 gene copies by contribution to the number of copies of the ABU gene (BCR-ABL / ABU) e) the evolution of this ratio after the treatment of CML, allows to know if a patient has responded well or not to treatment. A reduction in the BCR-ABL / ABU ratio after treatment suggests a positive response f) in accordance with (e), the BCRABL / ABU ratio also makes it possible to detect residual disease, difficult to detect with previous methods, given their low sensitivity of detection.

Selon une autre caractéristique de l'invention, a) les amorces permettant la détection du transcrit BCR-ABL dans un test échantillon ont des séquences d'oligonucleotides sélectionnées parmi un groupe de ; SEQ ID NO :1, SEQ ID NO :2, SEQ ID NO :3, et SEQ IDAccording to another characteristic of the invention, a) the primers allowing the detection of the BCR-ABL transcript in a sample test have oligonucleotide sequences selected from a group of; SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID

NO :4, b) les amorces pour détecter le gène contrôle ABL1 dans un test échantillon ont des séquences d'oligonucleotides sélectionnées parmi un groupe de : SEQ ID NO :5, SEQ ID NO :6, SEQ ID NO :7, et SEQ ID NO :8.NO: 4, b) the primers for detecting the ABL1 control gene in a sample test have oligonucleotide sequences selected from a group of: SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8.

En accord avec cette invention,In accordance with this invention,

a) la sonde pour détecter BCR-ABL dans un test échantillon a une séquence : SEQ ID :a) the probe for detecting BCR-ABL in a sample test has a sequence: SEQ ID:

9.9.

b) la sonde pour détecter ABL1 dans un test échantillon a une séquence SEQ ID : 10.b) the probe for detecting ABL1 in a sample test has a sequence SEQ ID: 10.

En accord aussi avec cette invention, les sets d'amorces pour amplifier BCR-ABL ou ABL1 dans un test échantillon inclusAlso in accordance with this invention, the primer sets for amplifying BCR-ABL or ABL1 in a sample assay included

a) au moins pour BCR-ABL une amorce forward ayant une séquence sélectionnée parmi le groupe : SEQ ID NO : 1, SEQ ID NO : 2, et une amorce reverse ayant une séquence sélectionnée parmi SEQ ID NO : 3, QEQ ID NO : 4a) at least for BCR-ABL a forward primer having a sequence selected from the group: SEQ ID NO: 1, SEQ ID NO: 2, and a reverse primer having a sequence selected from SEQ ID NO: 3, QEQ ID NO: 4

b) au moins pour ABU, une amorce forward ayant une séquence parmi le group : SEQ ID NO : 5, SEQ ID NO : 6, et une amorce reverse ayant une séquence sélectionnée parmi SEQIDNO :7, SEQ1DNO:8.b) at least for ABU, a forward primer having a sequence among the group: SEQ ID NO: 5, SEQ ID NO: 6, and a reverse primer having a sequence selected from SEQIDNO: 7, SEQ1DNO: 8.

La présente invention préconise aussi une méthode pour la détection de BCR-ABL ou ABL1 dans un test échantillon. Cette méthode est divisée en plusieurs étapes :The present invention also recommends a method for the detection of BCR-ABL or ABL1 in a sample test. This method is divided into several steps:

a) Pour BCR-ABL, mettre en contact un test échantillon avec au moins une amorce forward ayant une séquence sélectionnée parmi SEQID NO : 1 ou SEQ1D NO ; 2, et au moins une amorce reverse sélectionnée parmi SEQ ID NO : 3 ou SEQ ID NO : 4 dans des conditions d'amplification spécifiques pour générer une séquence cible.a) For BCR-ABL, contacting a sample test with at least one forward primer having a sequence selected from SEQID NO: 1 or SEQ1D NO; 2, and at least one reverse primer selected from SEQ ID NO: 3 or SEQ ID NO: 4 under specific amplification conditions to generate a target sequence.

b) Pour ABU, mettre en contact un test échantillon avec au moins une amorce forward ayant une séquence sélectionnée parmi SEQ iD NO : 5 ou SEQ ID NO : 6, et au moins une amorce reverse sélectionnée parmi SEQ ID NO : 7 ou SEQ ID NO : 8 dans des conditions d'amplification spécifiques pour générer une séquence cible; et c) détecter l'hybridation de la séquence cible et au moins une sonde pour Indiquer la présence de BCR-ABL ou ABL1 dans un test échantillon. Pour BCR-ABL, la sonde a une séquence SEQ ID NO : 9 et pour ABL1, la sonde a une séquence SEQ ID NO : 10.b) For ABU, contact a sample test with at least one forward primer having a sequence selected from SEQ iD NO: 5 or SEQ ID NO: 6, and at least one reverse primer selected from SEQ ID NO: 7 or SEQ ID NO: 8 under specific amplification conditions to generate a target sequence; and c) detecting hybridization of the target sequence and at least one probe to indicate the presence of BCR-ABL or ABL1 in a test sample. For BCR-ABL, the probe has a sequence SEQ ID NO: 9 and for ABL1, the probe has a sequence SEQ ID NO: 10.

En accord avec la méthode d'amplification de la présente Invention, le gène décrit cl dessus consiste à mettre le test échantillon dans une réaction d'amplification en présence de réactifs d'amplification. La réaction d'amplification peut Être au moins une PCR, qPCR ou RTPCR.In accordance with the amplification method of the present invention, the gene described above consists in putting the test sample into an amplification reaction in the presence of amplification reagents. The amplification reaction can be at least one PCR, qPCR or RTPCR.

Selon cette Invention et en accordance avec, au moins une sonde contient une unité fluorescente (reporter) attachée à la région 5' d'ADN. En plus au moins une sonde peut contenir une partie quencher à la région 3' D'ADN. La quantification de l'unité fluorescence permet la quantification du gène cible (0CR-ABL ou ABU).According to this invention and in accordance with, at least one probe contains a fluorescent unit (reporter) attached to the 5 'region of DNA. In addition at least one probe may contain a quencher portion at the 3 'region of DNA. The quantification of the fluorescence unit allows the quantification of the target gene (0CR-ABL or ABU).

Selon une autre caractéristique de l'invention, l'amplification de BCR-ABL et ABU par la qPCR de la présente Invention peuvent se faire en réaction simplexe ou multiplexe.According to another characteristic of the invention, the amplification of BCR-ABL and ABU by the qPCR of the present invention can be carried out in a simplex or multiplex reaction.

BREVE DESCRIPTION DES FIGURESBRIEF DESCRIPTION OF THE FIGURES

Figure la : Graphique Delta Rn-versus- cycle threshold (Ct) pour BCR-ABL en format simplexe. La lignée cellulaire leucémique K562 subissant une qPCR de la présente invention. 7 concentrations d'ADNc (4pg-25ng) ont été utilisées.Figure la: Delta Rn-versus-cycle threshold (Ct) graph for BCR-ABL in simplex format. The K562 leukemic cell line undergoing qPCR of the present invention. 7 concentrations of cDNA (4pg-25ng) were used.

Figure lb : Courbe standard Cycle threshold (Ct)-versus-log quantité ADNc pour BCR-ABL en format simplexe. La lignée cellulaire leucémique K562 subissant une qPCR de la présente Invention. 7 concentrations d'ADNc (4pg-25ng) ont été utilisées.Figure lb: Standard curve Cycle threshold (Ct) -versus-log cDNA quantity for BCR-ABL in simplex format. The K562 leukemic cell line undergoing qPCR of the present invention. 7 concentrations of cDNA (4pg-25ng) were used.

Figure 2 : Courbe standard Cycle threshold (Ct)-versus-log quantité ADNc pour BCR-ABL en format simplexe. La lignée cellulaire leucémique K562, un échantillon de sang d'un patient LMC et un autre d'un Individu control subissant une qPCR de la présente invention. 9 concentrations d'ADNc (O,16pg-25ng) ont été utilisées.Figure 2: Cycle threshold (Ct) -versus-log cDNA quantity standard curve for BCR-ABL in simplex format. Leukemia cell line K562, a blood sample from a CML patient and another from a control individual undergoing qPCR of the present invention. 9 concentrations of cDNA (0.16pg-25ng) were used.

Figure 3a : Courbe standard Cycle threshold (Ct)-versus-log quantité ADNc pour ABL en format multiplexe. La lignée cellulaire leucémique K562 subissant une qPCR de h présente Invention. 7 concentrations d'ADNc (20pg-25ng) on été utilisées. Les courbes des valeurs Ct des échantillons d'ADNc dans chaque puits du triplicata ainsi que la courbe moyenne sont montrées.Figure 3a: Cycle threshold (Ct) -versus-log cDNA quantity standard curve for ABL in multiplexed format. The leukemic cell line K562 undergoing qPCR of h present invention. 7 concentrations of cDNA (20pg-25ng) were used. The curves of the Ct values of the cDNA samples in each well of the triplicate as well as the average curve are shown.

Figure 3b : Courbe standard Cycle threshold (Ct)-versus-log quantité ADNc pour BCR-ABL en format multiplexe. La lignée cellulaire leucémique K562 subissant une qPCR de la présente invention. 7 concentrations d'ADNc (4pg-25ng) on été utilisées.Figure 3b: Cycle threshold (Ct) -versus-log cDNA quantity standard curve for BCR-ABL in multiplexed format. The K562 leukemic cell line undergoing qPCR of the present invention. 7 concentrations of cDNA (4pg-25ng) were used.

Les courbes des valeurs Ct des échantillons d'ADNc dans chaque puits du triplicata ainsi que la courbe moyenne sont montrées.The curves of the Ct values of the cDNA samples in each well of the triplicate as well as the average curve are shown.

Figure 4a : Courbe standard Cycle threshold (Ct)-versus-log quantité ADNc pour ABL en format simplexe et multiplexe. La lignée cellulaire leucémique K562 subissant une qPCR de la présente invention. 6 concentrations d'ADNc (20pg-25ng) on été utilisées. Les courbes moyennes des valeurs Q des échantillons d'ADNc du triplicata sont montrées.Figure 4a: Cycle threshold (Ct) -versus-log cDNA quantity standard curve for ABL in simplex and multiplex format. The K562 leukemic cell line undergoing qPCR of the present invention. 6 concentrations of cDNA (20pg-25ng) were used. The average curves of the Q values of the cDNA samples of the triplicate are shown.

Figure 4b ί Courbe standard Cyde threshold (Ct)-versus-log quantité ADNc pour BCR-ABL en format simplexe et multiplexe. La lignée cellulaire leucémique K562 subissant une qPCR de la présente invention. 7 concentrations d'ADNc (20pg-25ng) sont utilisées. Les courbes moyennes des valeurs Ct des échantillons d'ADNc du triplicata sont montrées.Figure 4b ί Cyde threshold (Ct) -versus-log cDNA quantity standard curve for BCR-ABL in simplex and multiplex format. The K562 leukemic cell line undergoing qPCR of the present invention. 7 concentrations of cDNA (20pg-25ng) are used. The average curves of the Ct values of the cDNA samples of the triplicate are shown.

EXPOSE DETAILLEDETAILED EXPOSURE

La présente invention concerne des sondes, amorces, set d'amorces, set de sondes et amorces qui peuvent être utilisés pour amplifier, détecter et quantifier le gène BCR-ABL ou le gène contrôle ABL1 dans un échantillon test.The present invention relates to probes, primers, set of primers, set of probes and primers that can be used to amplify, detect and quantify the BCR-ABL gene or the ABL1 control gene in a test sample.

La présente invention concerne aussi la méthode de détection de BCR-ABL et d'ABLl dans un échantillon test en utilisant les sets d'amorces et sondes cités ci-dessus. Les sets d'amorces et sondes de la présente invention permettent une meilleur sensibilité et spécificité pour détecter BCR-ABL et ABU.The present invention also relates to the method for detecting BCR-ABL and ABL1 in a test sample using the sets of primers and probes mentioned above. The primer sets and probes of the present invention allow improved sensitivity and specificity for detecting BCR-ABL and ABU.

Selon la présente Invention, l'amplification de BCR-ABL et du gène contrôle ABL1 se fait au moins en qPCR en format simplexe ou multiplexe permettant ainsi une meilleure quantification de BCR-ABL et un gain en temps et en cout.According to the present invention, the amplification of BCR-ABL and of the control gene ABL1 is carried out at least in qPCR in simplex or multiplex format, thus allowing better quantification of BCR-ABL and a saving in time and cost.

Selon une autre caractéristique de l'invention, la quantification plus sensible et plus spécifique de BCR-ABL permettra un meilleur suivi du traitement de la LMC ainsi que la maladie résiduelle.According to another characteristic of the invention, the more sensitive and more specific quantification of BCR-ABL will allow better monitoring of the treatment of CML as well as the residual disease.

Le mot 'BCR-ABL' ou t(9,22) décrit dans la présente invention est une translocation entre le gène ABU du chromosome 9 et le breakpoint cluster région (BCR) sur le chromosome 22.The word 'BCR-ABL' or t (9,22) described in the present invention is a translocation between the ABU gene of chromosome 9 and the breakpoint cluster region (BCR) on chromosome 22.

La détection et la quantification de BCR-ABL peut supporter le diagnostic clinique LMC, le suivi de son traitement et le suivi de la maladie résiduelle.Detection and quantification of BCR-ABL can support clinical CML diagnosis, monitoring of its treatment, and monitoring of residual disease.

Le mot 'gène' réfère à une séquence d'adde nudéique dans la molécule d'ADN qui occupe une région précise dans un chromosome et permet de coder les instructions pour la synthèse de l'ARN.The word 'gene' refers to a sequence of nudeic adde in the DNA molecule that occupies a specific region in a chromosome and is used to encode the instructions for the synthesis of RNA.

Le mot amplification de gène comme utilisé dans cette Invention réfère à une ou plusieurs méthodes capables de copier un acide nucléique permettant ainsi une augmentation du nombre de copie d'une séquence d'adde nucléique cible. La séquence amplifiée peut être un acide desoxyribonudéotide (ADN) ou un acide ribonudéotide (ARN).The word gene amplification as used in this invention refers to one or more methods capable of copying a nucleic acid thus allowing an increase in the number of copies of a target nucleic acid sequence. The amplified sequence can be a deoxyribonudeotide acid (DNA) or a ribonudeotide acid (RNA).

Le mot 'oligonucléotide' comme utilisé Ici est une séquence composée d'ADN ou d'ARN ou leur combinaison avec une longueur qui vari de 10 à 70 nucléotides. Les oligonudétldes peuvent être synthétisés avec différentes méthodes mais pas limitées à celle de la synthèse 5'-3' basée sur l'utilisation des groups protégeant beta-ctanoethyl phosphate (Rosenthal et al, Terahedron Letter 24:1691,1983; Gait et al, Nue Acids Res 4:1135,1977) ou la méthode des phosphochloridites (Matteucd J AM CHEM SOC 103:3185-91,1981).The word 'oligonucleotide' as used herein is a sequence composed of DNA or RNA or their combination with a length which varies from 10 to 70 nucleotides. Oligonudetides can be synthesized with different methods but not limited to that of 5'-3 'synthesis based on the use of groups protecting beta-ctanoethyl phosphate (Rosenthal et al, Terahedron Letter 24: 1691,1983; Gait et al, Nue Acids Res 4: 1135,1977) or the phosphochloridites method (Matteucd J AM CHEM SOC 103: 3185-91,1981).

Le mot 'amorce' représente une séquence d'oligonucléotides qui peut être synthétisée chimiquement ou naturellement. L'amorce est le point d'initiation de la synthèse d'ADN dans des conditions optimales de température et en présence de tampons, d'enzyme, de nucléotides et de séquences nucléotidiques complémentaires spécifiques.The word 'primer' represents an oligonucleotide sequence which can be synthesized chemically or naturally. The primer is the point of initiation of DNA synthesis under optimum temperature conditions and in the presence of specific buffers, enzymes, nucleotides and complementary nucleotide sequences.

Le mot 'sonde' représente une séquence nucléotidique qui forme une structure hybride avec une séquence cible dans une molécule d'un échantillon test.The word 'probe' represents a nucleotide sequence which forms a hybrid structure with a target sequence in a molecule of a test sample.

Le mot 'transcription inverse' comme utilisé dans cette invention réfère à une méthode permettant la synthèse d'ADN complémentaire (ADNc) à partir de molécule d'ARN. L'ADNc peut être utilisée dans la méthode PCR.The word 'reverse transcription' as used in this invention refers to a method allowing the synthesis of complementary DNA (cDNA) from an RNA molecule. CDNA can be used in the PCR method.

Le mot 'PCR' (polymerase chain réaction) de la présente invention réfère à une méthode dont un échantillon d'ADN ou ADNc est ajouté dans une solution en présence de 2 oligonucleotides amorces (forward et reverse) ; de nucléotides non attachés (exemple les dNTPs) ; et de l'enzyme ADN polymérase (préférablement la Taq polymérase qui résiste à la chaleur) qui catalyse la formation d'ADN à partir des 2 amorces et dNTPs. La solution est chauffée à 94-96 C pour dénaturer la molécule d'ADN et former 2 brins simples d'ADN. Les amorces vont ensuite se fixer spécifiquement sur l'ADN simple brin permettant ainsi à l'ADN polymérase de catalyser l'attachement des dNTPs aux amorces.The word "PCR" (polymerase chain reaction) of the present invention refers to a method in which a DNA or cDNA sample is added to a solution in the presence of 2 oligonucleotide primers (forward and reverse); unattached nucleotides (eg dNTPs); and the DNA polymerase enzyme (preferably Taq polymerase which is heat resistant) which catalyzes the formation of DNA from the 2 primers and dNTPs. The solution is heated to 94-96 C to denature the DNA molecule and form 2 single strands of DNA. The primers will then bind specifically to the single-stranded DNA thus allowing the DNA polymerase to catalyze the attachment of the dNTPs to the primers.

Le mot 'RT-PCR* (reverse transcrlptase-PCR) de la présente Invention représente une méthode de PCR dont le produit de départ n'est pas directement un ADN mais un ARN traduit en ADNc après transcription inverse.The word 'RT-PCR * (reverse transcription-PCR) of the present invention represents a PCR method the starting product of which is not directly a DNA but an RNA translated into cDNA after reverse transcription.

Le mot 'qPCR' (quantitative PCR ou real time RT-PCR) cité dans la présente invention réfère à une méthode de PCR permettant l'étude des produits de la réaction PCR durant les premières étapes d'amplification de l'ADN. La détection des produits de PCR se fait grâce à des sondes marquées à leur extrémité 5' par un fluorochrome émetteur (reporter), et à leur extrémité 3' par un fluorochrome suppresseur (quencher) fluorescent ou non, qui inhibe l'émission du reporter lorsqu'ils sont à proximité. De ce fait, l'intensité du signai de la fluorescence mesurée au cours la réaction d'amplification est proportionnelle au nombre de produits nouvellement formés (amplicons). La mesure en ADN ou ADNc se fait en logarithme. Pour déterminer la positivité d'une PCR et/ou quantifier un échantillon par qPCR, on détermine le nombre de cycles à partir duquel le produit PCR est détectable. Le moment d'apparition de ce signai seuil dénommé cycle seuil ou a (Cycle Threshold) est dépendant de la quantité de matrice initialement présente dans l'échantillon amplifié. Le Ct calculé est inversement proportionnel au logarithme décimal du nombre de copies Initiales.The word “qPCR” (quantitative PCR or real time RT-PCR) cited in the present invention refers to a PCR method allowing the study of the products of the PCR reaction during the first steps of DNA amplification. The PCR products are detected using probes labeled at their 5 'end with an emitting fluorochrome (reporter), and at their 3' end with a fluorescent or non-fluorescent suppressor fluorochrome (quencher), which inhibits the reporter emission. when they are nearby. Therefore, the intensity of the fluorescence signal measured during the amplification reaction is proportional to the number of newly formed products (amplicons). The measurement in DNA or cDNA is done in logarithm. To determine the positivity of a PCR and / or to quantify a sample by qPCR, the number of cycles from which the PCR product is detectable is determined. The moment of appearance of this threshold signal called threshold cycle or a (Cycle Threshold) depends on the quantity of matrix initially present in the amplified sample. The calculated Ct is inversely proportional to the decimal logarithm of the number of Initial copies.

Parmi les sondes les plus utilisées en qPCR on trouve les sondes TaqMan et moiecular beacons qui utilisent l'activité exonucléase 5 fluorogénique de l'enzyme Taq polymerase pour mesurer la quantité de la séquence d'ADN dans un échantillon test.Among the most widely used probes in qPCR are the TaqMan and moiecular beacons which use the fluorogenic exonuclease activity of the Taq polymerase enzyme to measure the amount of DNA sequence in a test sample.

Préférentiellement, dans la présente invention, la qPCR est réalisée en utilisant les sondes TaqMan avec un analyseur d'amplification comme ABI PRISM 7900HT 'sequence détection System' qui est un System de screening qui peut détecter et quantifier des acides nucléiques. La quantité de BCR-ABL et ABL1 est calculée par le logiciel Intégré dans le système ABI PRISM 7900HT en utilisant la méthode de la courbe standard. Selon une autre caractéristique de la présente invention, le reporteur de la sonde peut être FAM, JOE, ΥΑΚΥΕ (ΎΎ) et le quencher B BQ, BHQ1, ou TAMRA.Preferably, in the present invention, the qPCR is carried out using the TaqMan probes with an amplification analyzer such as ABI PRISM 7900HT 'sequence detection System' which is a screening system which can detect and quantify nucleic acids. The amount of BCR-ABL and ABL1 is calculated by the software Integrated into the ABI PRISM 7900HT system using the standard curve method. According to another characteristic of the present invention, the reporter of the probe can be FAM, JOE, ΥΑΚΥΕ (ΎΎ) and the quencher B BQ, BHQ1, or TAMRA.

Le mot 'gène contrôle' comme utilisé dans ou *housekeeplng gene' représente un gène exprimé en général da façon similaire par toutes les cellules d'un organisme. Parmi les gènes contrôle, on trouve le glyceraldehyd-3-phosphate dehydrogenase (GAPDH), l'albumine, la beta-actlne, et ABL1.The word 'control gene' as used in the 'housekeeplng gene' represents a gene generally expressed in a similar fashion by all cells of an organism. Among the control genes are glyceraldehyd-3-phosphate dehydrogenase (GAPDH), albumin, beta-actin, and ABL1.

Le mot simplexe de la présente invention réfère à un essai qui ne se déroule pas simultanément avec d'autres essais. Dans notre invention, la qPCR en simplexe reflète la détection de nombre de copies d'un seul gène dans un tube de réaction.The word simplex of the present invention refers to a test which does not run simultaneously with other tests. In our invention, simplex qPCR reflects the detection of copy number of a single gene in a reaction tube.

Le mot multiplexe de la présente invention réfère à un essai qui se déroule simultanément avec au moins un autre essai. La qPCR en multiplexe reflète la détection du nombre de copies d'au moins 2 gènes dans un même tube de réaction. Par exemple, dans la présente invention, les 2 gènes BCR-ABL et ABU sont détectés simultanément par qPCR.The word multiplex of the present invention refers to a test which takes place simultaneously with at least one other test. Multiplex qPCR reflects the detection of the copy number of at least 2 genes in a single reaction tube. For example, in the present invention, the 2 genes BCR-ABL and ABU are detected simultaneously by qPCR.

Le mot 'échantillon test* comme utilisé dans la présente invention réfère à un échantillon de sang, de moelle osseuse, de cellules primaires, lignées cellulaires ou autre tissues et où des cellules LMC ou LIA ou autres cellules leucémiques, exprimant la translocation BCR-ABL, peuvent résider. L'échantillon test de la présente Invention peut être d'origine humaine ou autre animal exprimant le gène MUC0L1 qui peut être amplifié en utilisant les amorces et $ sondes de la présente invention.The word 'test sample * as used in the present invention refers to a sample of blood, bone marrow, primary cells, cell lines or other tissues and where CML or LIA cells or other leukemia cells, expressing the BCR-ABL translocation , can reside. The test sample of the present invention can be of human or other animal origin expressing the MUC0L1 gene which can be amplified using the primers and probes of the present invention.

La qPCR de la présente invention permet de déterminer le nombre de copies du gène BCRABL dans des cellules humains en quantifiant le nombre de copies de BCR-ABL relative à un gène contrôle. Le gène contrôle ici est ABL1.The qPCR of the present invention makes it possible to determine the number of copies of the BCRABL gene in human cells by quantifying the number of copies of BCR-ABL relative to a control gene. The control gene here is ABL1.

L'exemple 1 décrit un protocole utilisé dans le test de qPCR de la présente Invention. Le protocole décrit l'étape d'extraction d'ARN, de synthèse ifADNc et de qPCR.Example 1 describes a protocol used in the qPCR assay of the present invention. The protocol describes the step of RNA extraction, cDNA synthesis and qPCR.

L'exemple 2 montre la performance de la qPCR de la présente invention pour détecter le gène BCR-ABL dans la lignée leucémique (LMC) humaine K562, dans le sang d'un patient LMC ainsi que dans le sang d'un individu control.Example 2 shows the performance of the qPCR of the present invention for detecting the BCR-ABL gene in the human leukemia line (LMC) K562, in the blood of a CML patient as well as in the blood of a control individual.

La performance de la qPCR de la présente Invention est suivant les normes IVD internationales (R2>0,95, slope entre -3,0 et 3,9 et efficacité proche de 100) avec des courbes standards (quantité d'ADNc de K562-vs-valeurs Ct) à efficacité de 100,02 et 100,44 et un R2 de 0,993 et 0,998 respectivement pour Figure lb et Figure 2. La courbe d'amplification cycle-vs-Delta Rn (Figure la) montre aussi une parfaite allure. Le patient ²⁵ LMC positif pour BCR-ABL par la méthode FISH est bien confirmé pour sa positivité dans la présente invention avec un Ct=32,S (cercle. Figure 2) alors que l'individu control est négatif pour BCR-ABL avec un Ct=40 (triangle. Figure 2).The performance of the qPCR of the present invention is according to the international IVD standards (R2> 0.95, slope between -3.0 and 3.9 and efficiency close to 100) with standard curves (quantity of cDNA of K562- vs-Ct values) at efficiency of 100.02 and 100.44 and an R2 of 0.993 and 0.998 respectively for Figure lb and Figure 2. The cycle-vs-Delta Rn amplification curve (Figure la) also shows a perfect appearance . The patient ²⁵ CML positive for BCR-ABL by the FISH method is well confirmed for his positivity in the present invention with a Ct = 32, S (circle. Figure 2) while the control individual is negative for BCR-ABL with a. Ct = 40 (triangle. Figure 2).

L'exemple 3 montre la qPCR de la présente Invention en format simplexe ou multiplexe permet la'détection séparée ou simultanée de BCR-ABL et ABL1 avec une grande précision. La lignée LMC K562 positive pour BCR-ABL a été utilisée.Example 3 shows the qPCR of the present invention in a simplex or multiplex format allows separate or simultaneous detection of BCR-ABL and ABL1 with high precision. The BCR-ABL positive LMC K562 line was used.

Les courbes standards (quantité d'ADNc de K562-vs-valeurs Ct) de la qPCR en format multiplexe pour ABL1 et BCR-ABL (Figures 3a & 3b) montrent des résultats suivant les normes internationales iVD (Efficacité = 92-101%, slope entre -3 et 3,9, et R2 = 0,99). Aussi une superposition parfaite des courbes des valeurs Ct pour ABLlet BCR-ABL et cela en réaction simplexe et multiplexe a été aussi observée (Figures 4a & 4b).The standard curves (quantity of cDNA of K562-vs-Ct values) of qPCR in multiplex format for ABL1 and BCR-ABL (Figures 3a & 3b) show results according to international iVD standards (Efficiency = 92-101%, slope between -3 and 3.9, and R2 = 0.99). Also a perfect superposition of the curves of the Ct values for ABLlet BCR-ABL and that in simplex and multiplex reaction was also observed (Figures 4a & 4b).

EXPERIENCESEXPERIENCES

Exemple 1 : Protocole de oPCR de la présente invention pour la détection deExample 1: oPCR protocol of the present invention for the detection of

BCR-ABL et ABL1BCR-ABL and ABL1

L'extraction de l'ARN cellulaire se fait avec RNeasy mini kit Qiagen suivant les recommandations du fournisseur Qiagen (Qiagen Inc). La qualité du test est dépendante de la qualité de l'ARN initiale. De ce fait, il est purifié sur électrophorèse en gel d'agarose ou sur Bioanalyzer (Agitant) avant l'analyse.The extraction of the cellular RNA is done with RNeasy mini kit Qiagen according to the recommendations of the supplier Qiagen (Qiagen Inc). The quality of the test is dependent on the quality of the initial RNA. Therefore, it is purified on agarose gel electrophoresis or on a Bioanalyzer (Shaking) before analysis.

L'ADNc est obtenue à partir d'ARN total extrait d'échantillon test. La synthèse d'ADNc est réalisée à l'aide du Thermocycleur (Applied Biosystems) en utilisant le kit RNA to cDNA Reverse Transcription suivant les recommandations du fournisseur Applied Biosystems.CDNA is obtained from total RNA extracted from test sample. The cDNA synthesis is carried out using the Thermocycler (Applied Biosystems) using the RNA to cDNA Reverse Transcription kit according to the recommendations of the supplier Applied Biosystems.

Le mastermix de la réaction qPCR contient les amorces et la sonde de BCR-ABL et les amorces et la sonde d'ABLl, est ajouté àSpl ADNc pour un volume final de 25μΙ.The mastermix of the qPCR reaction contains the primers and the BCR-ABL probe and the primers and the ABL1 probe, is added to Sp1 cDNA for a final volume of 25μΙ.

Pour ta réaction en simplexe, seulement la sonde et les amorces pour BCR-ABL ou ABL1 sont utilisés dans différent puits de qPCR alors que pour la réaction en multiplexe, les sondes et les amorces pour BCR-ABL et ABL1 sont utilisés simultanément dans le même puits de qPCR.For your simplex reaction, only the probe and primers for BCR-ABL or ABL1 are used in different wells of qPCR while for the multiplex reaction, the probes and primers for BCR-ABL and ABL1 are used simultaneously in the same. qPCR wells.

Le cycle thermal de la qPCR est fait dans les conditions suivantes : étape 1 à 95C* pendant 20 secondes; étape 2 (cycle de 50) à 95C* pendant 1 seconde,- et une étape 3 à 60*C pendant 30 secondes.The thermal cycle of the qPCR is carried out under the following conditions: step 1 at 95C * for 20 seconds; step 2 (cycle of 50) at 95C * for 1 second, - and step 3 at 60 * C for 30 seconds.

Pour la courbe standard de la qPCR, des séries de 7-9 dilutions d'ADNc sont utilisées. Les concentrations sont 0,16 pg, 4pg, 20pg, lOOpg, SOOpg, 2,5ng, 12,5ng, et 25ng. Pour cette courbe standard, une valeur R2>0,95 est acceptée par contre une valeur R2<0,95% est refusée et la qPCR doit être répétée.For the standard curve of qPCR, series of 7-9 dilutions of cDNA are used. The concentrations are 0.16 pg, 4pg, 20pg, 100pg, SOOpg, 2.5ng, 12.5ng, and 25ng. For this standard curve, an R2 value> 0.95 is accepted, on the other hand an R2 value <0.95% is refused and the qPCR must be repeated.

Exemple 2 ; la performance de l'essai qPCR pour détecter BCR-ABL dans la lignée leucémique K562 et dans un échantillon de sang de patient LMCau du contrôle sainExample 2; the performance of the qPCR assay for detecting BCR-ABL in the K562 leukemia line and in a blood sample from a healthy control CML patient

Les séquences des amorces et de la sonde BCR-ABL utilisées en Figures laThe sequences of the primers and of the BCR-ABL probe used in FIGS.

- Amorce Forward : 5'Tccgctgaccatcaataagg 3'(SEQ ID N* 1)- Forward primer: 5'Tccgctgaccatcaataagg 3 '(SEQ ID N * 1)

- Amorce reverse : 5'accctgaggctcaaagtcag 3' (SEQID N* 4)- Reverse primer: 5'accctgaggctcaaagtcag 3 '(SEQID N * 4)

- Sonde : 5' R-cccttcagcggccagtagca-Q 3’ (SEQ ID N*. 9)- Probe: 5 'R-cccttcagcggccagtagca-Q 3' (SEQ ID N *. 9)

Pour la sonde : R= FAM et Q=BBQFor the probe: R = FAM and Q = BBQ

Les séquences des amorces et de la sonde BCR-ABL utilisées en Figure lbThe sequences of the primers and of the BCR-ABL probe used in Figure lb

- Amorce Forward : 5' Actccagactgtccacagca 3' (SEQ ID N* 2)- Forward primer: 5 'Actccagactgtccacagca 3' (SEQ ID N * 2)

- Amorce reverse : 5'accctgaggctcaaagtcag 3' (SEQ ID N* 4)- Reverse primer: 5'accctgaggctcaaagtcag 3 '(SEQ ID N * 4)

- Sonde : 5' R-cccttcagcggccagtagca-Q 3' (SEQ ID N*. 9)- Probe: 5 'R-cccttcagcggccagtagca-Q 3' (SEQ ID N *. 9)

Pour la sonde : R= W et Q=BHQ1For the probe: R = W and Q = BHQ1

Les séquences des amorces de la sonde BCR-ABL utilisées en Figure 2The sequences of the primers of the BCR-ABL probe used in Figure 2

- Amorce Forward : 5'Actccagactgtccacagca 3' (SEQID N* 2)- Forward primer: 5'Actccagactgtccacagca 3 '(SEQID N * 2)

- Amorce reverse : 5'accctgaggctcaaagtcag3'(SEQID N* 4)- Reverse primer: 5'accctgaggctcaaagtcag3 '(SEQID N * 4)

- Sonde : 5' R-cccttcagcggccagtagca-Q 3' (SEQ ID N* 9)- Probe: 5 'R-cccttcagcggccagtagca-Q 3' (SEQ ID N * 9)

Pour la sonde :R=YY et Q=BHQ1For the probe: R = YY and Q = BHQ1

Exemple 3 : La performance de l'essai qPCR pour détecter BCR-ABL en format slmplexe et duplexe en utilisant la lignée leucémique K562 positive pour BCR-ABLExample 3: Performance of the qPCR Assay for Detecting BCR-ABL in Slmplex and Duplex Format Using the BCR-ABL Positive K562 Leukemia Line

Les séquences des amorces et de la sonde ABL1 utilisées en Figures 3a & 4aThe sequences of the primers and the ABL1 probe used in Figures 3a & 4a

- Amorce Forward : 5' ctgaccaactcgtgtgtgaa 3' (SEQ ID N* 5)- Forward primer: 5 'ctgaccaactcgtgtgtgaa 3' (SEQ ID N * 5)

- Amorce reverse : 5' ccctgaggctcaaagtcaga 3' (SEQ ID N* 7) • Sonde : 5' R-cccttcagcggccagtagca-Q 3' (SEQ ID N* 10)- Reverse primer: 5 'ccctgaggctcaaagtcaga 3' (SEQ ID N * 7) • Probe: 5 'R-cccttcagcggccagtagca-Q 3' (SEQ ID N * 10)

Pour la sonde : /?- JOE et Q-BBQFor the probe: /? - JOE and Q-BBQ

Les séquences des amorces et de la sonde BCR-ABL utilisées en Figures 3b & 4bThe sequences of the primers and of the BCR-ABL probe used in Figures 3b & 4b

- Amorce Forward ; 5'Tccgctgaccatc3ataagg 3' (SEQ ID N* 1)- Forward primer; 5'Tccgctgaccatc3ataagg 3 '(SEQ ID N * 1)

- Amorce reverse : 5'accctgaggctcaaagtcag 3' (SEQ 10 N* 4)- Reverse primer: 5'accctgaggctcaaagtcag 3 '(SEQ 10 N * 4)

- Sonde : S'R-cccttcagcggccagtagca-Q 3' (SEQ ID N* 9)- Probe: S'R-cccttcagcggccagtagca-Q 3 '(SEQ ID N * 9)

Pour la sonde : R= F AM et Q=BHQ1For the probe: R = F AM and Q = BHQ1

LISTE DES SEQUENCES NUCLEOTIDIQUESLIST OF NUCLEOTIDIC SEQUENCES

SEQ1D N* 1 : F-BCR-ABLSEQ1D N * 1: F-BCR-ABL

Longueur : 20Length: 20

Tccgctgaccatcaataagg (F3)Tccgctgaccatcaataagg (F3)

SEQ ID N’2 : F-BCR-ABLSEQ ID N’2: F-BCR-ABL

Longueur : 20Length: 20

Actccagactgtccacagca (F4)Actccagactgtccacagca (F4)

SEQID N* 3: R- BCR-ABLSEQID N * 3: R- BCR-ABL

Longueur : 20 ₁₅ Ccctgaggctcaaagtcaga (RI)Length: 20 ₁₅ Ccctgaggctcaaagtcaga (RI)

SEQID N* 4: R-BCR-ABLSEQID N * 4: R-BCR-ABL

Longueur : 20Length: 20

Accctgaggctcaaagtcag (R2)Accctgaggctcaaagtcag (R2)

SEQID NO*S: F-ABLl jq Gtggccagtggagataacac (Fl)SEQID NO * S: F-ABLl jq Gtggccagtggagataacac (Fl)

SEQID N* 6; F-ABLlSEQID N * 6; F-ABLl

Longueur : 31Length: 31

Tggagataacactctaagcataactaaaggt (F2) . SEQID N‘7: R-ABL1Tggagataacactctaagcataactaaaggt (F2). SEQID N‘7: R-ABL1

Longueur; 20 .Length; 20.

⁵ Tgttgactggcgtgatgtag (RI) ⁵ Tgttgactggcgtgatgtag (RI)

SEQID N‘8:R-ABL1 Longueur: 21 Gatgtagttgcttgggaccca (R2)SEQID N‘8: R-ABL1 Length: 21 Gatgtagttgcttgggaccca (R2)

SEQ ID N*9 ; S- BCR-ABLSEQ ID N * 9; S- BCR-ABL

Longueur : 20Length: 20

Cccttcagcggccagtagca (PI)Cccttcagcggccagtagca (PI)

SEQID N* 10:S-ABLlSEQID N * 10: S-ABLl

Longueur : 20Length: 20

Aaatggccaaggctgggtcc (PI)Aaatggccaaggctgggtcc (PI)

F - amorce forwardF - forward primer

R » amorce reverseR »reverse primer

S = sondeS = probe

Claims

Claims:

1. A method for the detection of the BCR-ABL (responsible for CML) and ABL1 genes in a test sample based on the use of real-time PCR, characterized in that the method comprises the following steps:

a) Extraction of RNA from a test sample

b) Test of purity and quantity of RNA by electrophoresis, nanodrop or bioanalyzer

c) Synthesis of complementary DNA (cDNA) from total RNA extracted from the test sample

d) Mixture of cDNA with a Mastermlx comprising, for the specific and simultaneous detection in multiplex of the two genes BCR-ABL and ABL1, a combination of primers consisting of:

(i) of a "forward" primer having sequences selected from the group of sequences [SEQ ID N * 1, SEQ ID N * 21, of a "reverse" primer selected from the group of sequences [SEQ ID N * 3, SEQ ID N * 4J and the detection probe SEQ ID N * 9 and, (ii) of a "forward" primer having sequences selected from the group of sequences [SEQ ID N '5, SEQ ID N * 6 ], of a “reverse” primer selected from the group of sequences [SEQ ID N * 7, SEQ ID N * 8] and the detection probe SEQ ID N * 10, for a final volume of at least 25μ1.

e) Application of the thermal cycle of qPCR

f) Measurement of gene amplification

2. Method according to claim 1, wherein two primers for amplifying the BCR-ABL gene in a test sample consist of a forward primer having a sequence selected from the group of sequences: SEQ ID N '1, SEQ ID N * 2 , and a reverse primer selected from the group of sequences: SEQ ID N '3, SEQ ID N * 4,

3. Method according to claim 1, wherein a probe for the detection of the BCR-ABL gene in a test sample has a sequence SEQ ID N’9.

4. Method according to claim 1, wherein two primers for amplifying the ABU gene. in a test sample consist of a forward primer having a sequence selected from the group of sequences: SEQID N * 5, SEQ ID N * 6, and a reverse primer selected from the group of sequences: SEQ ID N * 7, SEQ ID N'8.

5. Method according to claim 1, wherein a probe for the detection of the ABU gene in a test sample has a sequence SEQ ID N * 10.

6. Method according to claims 1 to 5, wherein the probes for detecting

BCR-ABL or ABU in qPCR are attached to fluorescent (reporters) and non-fluorescent (quenchers) entities. The reporter can be FAM, JOE or YY or the like, attached to the 5 'end and the quencher can be BBQ, BHQ1, or TAMRA or the like attached to the 3' end.

7. Method according to claims 1 to 6, wherein the detection of the BCR-ABL and ABL1 genes in a test sample is carried out separately (Simplex) or simultaneously (Multiplex) in the same qPCR well.

8. Method according to claims 1 to 7, wherein the probes and primers of the gene allows the simultaneous detection of the 2 BCR-ABL transcripts, namely b2a3 and b3a2.

9. Method according to claims 1 to 8, wherein the use of said method comprises at least one of PCR, real-time PCR (qPCR) or reverse transcriptase PCR (RT-PCR) techniques.

10. New application of the method of the preceding claims characterized in that it allows the diagnosis and monitoring of treatment of CML and residual disease.