OA16804A

OA16804A - Constitutively active ABA receptor mutants.

Info

Publication number: OA16804A
Application number: OA1201300551
Authority: OA
Inventors: Sean R.; CUTLER; Assaf MOSQUNA
Original assignee: The Regents Of The University Of California
Priority date: 2011-07-01
Filing date: 2012-06-19
Publication date: 2016-01-04

Abstract

The present invention provides for compositions comprising mutated PYR/PYL receptor polypeptides that bind to a type 2 protein phosphatase in the absence of abscisic acid. The present invention further provides for methods of making and using the mutated PYR/PYL receptor polypeptides.

Description

CONSTITUTIVELY ACTIVE ΑΒΑ RECEPTOR MUTANTS

CROSS-REFERENCE TO RELATED APPLICATIONS

The présent patent application daims benefit of priority to U.S. Provisional Patent Application No. 61/503,816, filed July 1, 2011, and to U.S. Provisional Patent Application No. 61/512,280, filed July 27, 2011, the contents of each of which is incorporated by reference herein for ail purposes.

STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

This invention was made with government support under Grant Number IOS0820508, awarded by the National Science Foundation. The Government has certain rights in this invention.

BACKGROUND OF THE INVENTION

Abscisic acid (ABA) is a plant hormone that régulâtes signal transduction associated with abiotic stress responses (Cutler et al., 2010). The ABA signaling pathway has been exploited to improve plant stress response and associated yield traits via numerous approaches (Yang et al., 2010). The direct application of ABA to plants improves their water use efficiency (Raedmacher et al., 1987); for this reason, the discovery of ABA agonists (Park et al., 2009; Melcher et al., 2010) has received increasing attention, as such molécules may be bénéficiai for improving crop yield (Notman et al., 2009). A complementary approach to activating the ABA pathway involves increasing a plant's sensitivity to ABA via genetic methods. For example, conditional antisense of farnesyl transferase beta subunit gene, which increases a plant's ABA sensitivity, improves yield under moderate drought in both canola and Arabidopsis (Wang étal., 2005). Thus, the manipulation of ABA signaling to improve traits contributing to yield is now well established.

It has recently been discovered that ABA elicits many of its cellular responses by binding to a soluble family of receptors called PYR/PYL proteins. PYR/PYL proteins belong to a large family of ligand-bînding proteins named the START superfamily (lyer ef al., 2001); Ponting et al., 1999). These proteins contain a conserved three-dimensional architecture consisting of seven anti-parallel beta sheets, which surround a central alpha hélix to form a helix-grip motif; together, these structural éléments form a ligand-binding pocket for binding ABA or other agonists.

Structural and functional studies hâve uncovered a sortes of conformational changes and critical contacts between PYR/PYL receptors and type II C protein phosphatases (PP2Cs) that are necessary for ABA-mediated PP2C inhibition by receptors. For example, when ABA or another agonist binds within the ligand-binding pockets of PYR/PYL proteins, it stabilizes a conformational change that allows the receptors to bind and inhibit a family of PP2Cs that normally repress ABA signaling (Weiner et a/., 2010). In particular, ABA binding leads to a large rearrangement in a flexible gâte loop that flanks the ligand-binding pocket. Upon ABA binding, the gâte loop adopts a closed conformation that is stabilized by several direct contacts between the loop and ABA. This agonist-bound, closed form of the gâte allows PYR/PYL proteins to dock into, and inhibit, the active site of PP2Cs. The resulting inhibition in turn allows activation of downstream kinases in the SnRK2 class, which are responsible for the régulation of the activity of transcription factors, ion channels and other proteins involved in ABA responses (Weiner et al., 2010). Thus, the stabilization of a closed gâte conformation of the receptors is critical to their activation and PYR/PYL receptors are molecular switches at the apex of a signaling cascade that régulâtes diverse ABA responses.

In addition to the important rôle that gâte closure plays in receptor activation, other structural rearrangements are critical as well. For example, PYR1, PYL1, and PYL2 are homodimers in solution, but bind to PP2Cs as monomers. The homodimer interface overlaps with the PP2C binding interface and therefore an intact receptor homodimer cannot bind to and inhibit the PP2C. Thus, dimer formation is antagonistic to ABA signaling and receptor dimer-breaking is a necessary step in receptor activation. Additionally, a récognition module containing a central conserved tryptophan lock residue located on the PP2C inserts into a small pore formed in the ABA-bound receptors. Mutation of the tryptophan lock residue abolishes receptor-mediated inactivation of PP2C activity, demonstrating the importance of the lock residue's insertion into the receptor's pore.

BRIEF SUMMARY OF THE INVENTION

In one aspect, the présent invention provides for isolated nucleic acids comprising a polynucleotide encoding a mutated PYR/PYL receptor polypeptide. In some embodiments, the polynucleotide encodes a mutated PYR/PYL receptor polypeptide comprising one or more amino acid substitutions in a ligand-binding pocket and/or a type protein phosphatase (PP2C) binding interface as compared to a wild-type PYR/PYL receptor polypeptide, wherein the mutated PYR/PYL receptor binds to PP2C in the absence of abscisic acid.

In some embodiments, the mutated PYR/PYL receptor polypeptide comprises one or more amino acid substitutions in the ligand-binding pocket In some embodiments, the mutated PYR/PYL receptor polypeptide comprises one or more amino acid substitutions corresponding to the amino acid substitutions H60P/G/R/A/W/I/K/V/M, V83F/L/P, L87F, A89W or F159V/A in PYR1 as set forth in SEQ ID NO:1. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises one or more amino acid substitutions corresponding to the amino acid substitutions H60P/G, V83F, A89W or F159V in PYR1 as set forth in SEQ ID NO:1.

ln some embodiments, the mutated PYR/PYL receptor polypeptide comprises one or more amino acid substitutions in the PP2C binding interface. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises one or more amino acid substitutions corresponding to the amino acid substitutions H60P/G/R/A/W/I/K/V/M, I84Q/E/P/H/K, L87F, A89W, M158T/C/V/I, F159V/A, T162F, L166Y/F, or K170W ln PYR1 as set forth in SEQ ID NO:1. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises one or more amino acid substitutions corresponding to the amino acid substitutions H60P/G, I84Q, A89W, M158T/C, F159V, or K170W in PYR1 as set forth in SEQ ID NO:1.

ln some embodiments, the mutated PYR/PYL receptor polypeptide comprises one or more amino acid substitutions in the ligand-binding pocket and one or more amino acid substitutions in the PP2C binding interface.

In some embodiments, the mutated PYR/PYL receptor polypeptide comprises amino acid substitutions corresponding to the amino acid substitutions H60P, V83F, and F159V in PYR1 as set forth in SEQ ID NO:1. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises amino acid substitutions corresponding to the amino acid substitutions H60P, V83F, M158I, and F159V in PYR1 as set forth in SEQ ID NO:1. ln some embodiments, the mutated PYR/PYL receptor polypeptide comprises amino acid substitutions corresponding to the amino acid substitutions H60P, A89W, M158I, and F159V in PYR1 as set forth in SEQ ID NO:1. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises amino acid substitutions corresponding to the amino acid substitutions V83F, M158I, F159V, and K170W in PYR1 as set forth in SEQ ID NO:1.

In some embodiments, the mutated PYR/PYL receptor polypeptide significantly inhibits the activity of the PP2C in a phosphatase assay in the absence of abscisic acid.

ln some embodiments, the mutated PYR/PYL receptor polypeptide inhibits the activity of the PP2C by at least 50% in the absence of abscîsic acid as compared to the level of PP2C activity of a PP2C that is contacted with a wild-type PYR/PYL receptor polypeptide ln the absence of abscisic acid.

ln some embodiments, the mutated PYR/PYL receptor polypeptide is substantially identical (e.g., has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91 %, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% amino acid sequence identity) to any of SEQ ID NOs: 1-155. In some embodiments, the mutated PYR/PYL receptor polypeptide is any of SEQ ID NOs:120-155.

ln some embodiments, the PP2C is HAB1 (Homology to ABU), ABU (Abscisic acid insensitive 1), or ABI2 (Abscisic acid insensitive 2). ln some embodiments, the PP2C is HAB1.

ln another aspect, the présent invention provides for expression cassettes comprising a promoter operably linked to a polynucleotide encoding a mutated PYR/PYL receptor polypeptide of the invention (e.g., as described herein), wherein introduction of the expression cassette into a plant results in the plant having a PYR/PYL receptor that binds to a type 2 protein phosphatase (PP2C) in the absence of abscisic acid, ln some embodiments, the promoter is heterologous to the polynucleotide. ln some embodiments, the promoter is inducible. ln some embodiments, the promoter is a stress-inducible promoter, e.g., a drought-inducible promoter and/or a salinity-inducible promoter. ln some embodiments, the promoter is tissue-specific.

ln some embodiments, introduction of the expression cassette into a plant results in the plant having signîficantly inhibited PP2C activity in the absence of abscisic acid as compared to a plant lacking the expression cassette. In some embodiments, introduction of the expression cassette into the plant results in the plant having PP2C activity that is inhibited by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80% or more in the absence of ABA as compared to a plant lacking the expression cassette.

ln another aspect, the présent invention provides for expression vectors comprising an expression cassette of the invention (e.g., as described herein).

ln yet another aspect, the présent invention provides for plants (or a plant cell, seed, flower, leaf, fruit, or other plant part from such plants or processed food or food ingrédient from such plants) comprising an expression cassette comprising a promoter operably lînked to a polynucleotide encoding a mutated PYR/PYL receptor polypeptide of the invention (e.g., as described herein). In some embodiments, the plant has significantly inhibited PP2C activity in the absence of abscisic acid.

In still another aspect, the présent invention provides for methods of producing a plant having significantly inhibited activity of a type 2 protein phosphatase (PP2C) in the absence of abscisic acid. In some embodiments, the method comprises:

introducing an expression cassette comprising a promoter operably linked to a polynucleotide encoding a mutated PYR/PYL receptor polypeptide of the invention (e.g., as described herein) into a plurality of plants; and selecting a plant that expresses the polynucleotide from the plurality of plants.

In yet another aspect, the présent invention provides for methods of producing a plant having enhanced stress tolérance. In some embodiments, the method comprises:

introducing into a plurality of plants an expression cassette comprising a promoter operably linked to a polynucleotide encoding a mutated PYR/PYL receptor polypeptide of the invention comprising one or more amino acid substitutions in a ligand-binding pocket and/or a type 2 protein phosphatase (PP2C) binding interface as compared to a wild-type PYR/PYL receptor polypeptide, wherein the mutated PYR/PYL receptor binds to PP2C in the absence of abscisic acid; and selecting a plant that expresses the polynucleotide from the plurality of plants.

The mutated PYR/PYL receptor polypeptide to be introduced into the plurality of plants can be any PYR/PYL polypeptide as decscribed herein. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises one or more amino acid substitutions corresponding to the amino acid substitutions H60P/G/R/A/W/I/K/V/M, V83F/L/P, I84Q/E/P/H/K, L87F, A89W, M158T/C/V/1, F159V/A, T162F, L166Y/F, or K170W in PYR1 as set forth in SEQ ID NO:1. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises amino acid substitutions corresponding to the amino acid substitutions H60P, V83F, and F159V in PYR1 as set forth in SEQ ID NO:1. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises amino acid substitutions corresponding to the amino acid substitutions H60P, V83F, M158I, and F159V in PYR1 as set forth in SEQ ID NO:1. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises amino acid substitutions corresponding to the amino acid substitutions H60P, A89W, M158I, and F159V in PYR1 as setforth in SEQ ID NO:1. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises amino acid substitutions corresponding to the amino acid substitutions V83F, M158I, F159V, and K170W in PYR1 as setforth in SEQ ID NO:1.

For expressing the mutated PYR/PYL receptor polypeptide in a plant according to the methods of the présent invention, in some embodiments, the polynucleotide encoding the mutated PYR/PYL receptor polypeptide is operably linked to a heterologous promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is a stress-inducible promoter, e.g, a droughtinducible promoter and/or a salinity-inducible promoter. In some embodiments, the promoter is RD29A. In some embodiments, the promoter is tissue-specîfic.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1. PYR1 ligand binding and PP2C-interaction residues are highly conserved within the PYR/PYL receptor family. Shown are the residues selected for mutagenesis in PYR1 and the corresponding amino acid position and residue for each selected residue in other members of the Arabidopsis PYR/PYL receptor family, as well as two PYR1 homologs from the moss Physcomitrella patens (GenBank Accession No. XP_001778048)and the monocot Zea mays (GenBank Accession No. ACR34816). Columns with an indicate those residues where constitutive mutations were identified from saturation mutagenesis studies. Contiguous peptides = SEQ ID NOs:156172.

Figure 2. Characterization of constitutively active mutants. In the absence of ABA, PYR1 does not bind HAB1 in the yeast two-hybrid assay, but addition of 10 μΜ ΑΒΑ promotes a strong interaction between them (bottom of upper left panel). 29 of 741 PYR1 mutants constructed, located in 10 different residues, increase the interaction between PYR1 and HAB1 in the absence of ABA, as measured using the yeast two hybrid assay (upper left panel). Expression of a subset of mutant proteins at 8 of the 10 sites identified (H60P, V83F, I84Q, A89W, M158I, F159V, T162F, and K170W) demonstrated that the mutants ail increase basal activity of receptors, as measured by the abiiity of receptor to inhibit HAB1 phosphatase activity in the absence of ABA. Each graph includes control wild-type PYR1 protein tested in the absence (diamonds) and presence (squares) of 10 μΜ ABA. Spécifie mutant proteins (triangles) were tested in the absence of ABA. Ail displayed partial constitutive receptor activation, as measured by inhibition of PP2C activity in the absence of activating ligand. Plotted in each graph is

PP2C activity, expressed as % of contrai, which is the PP2C activity measured in the absence of ABA or receptor protein.

Figure 3. Engineering strong PYR1 CA alleles by combining partial CA mutations. Combinations of partial constitutively active (CA) alleles identified by saturation mutagenesis were made as described in the text and tested for their ability to inhibit PP2C activity in the absence of ABA, utilizing the PP2Cs HAB1 (top panel), ABU (middle panel), and ABI2 (bottom panel). Each graph includes contrai wild-type PYR1 protein tested in the absence (diamonds) and presence (squares) of 10 μΜ ABA with the particular PP2C (identified at left). CA mutants (PYR1^CA3 represented by triangles and PYR1^CA4 represented by crosses(x)) were tested in the absence of ABA. Plotted in each graph is PP2C activity, expressed as % of control, which is the PP2C activity measured in the absence of ABA or receptor protein.

Figure 4. Engineering strong PYL2 and PYL9 CA alleles. The CA mutations of PYR1 were introduced into PYL2 (A) and PYL9 (B) to generate the mutants PYL2^CA3(H65P, V87F, F169V), PYL2^CA4 (H65P, V87F, F169V, M164I) and PYL9^CA4 (V85F, Y160I, F161V). Recombinant proteins were used in in vitro PP2C assays at the stoichiometry shown ([PP2C] = 600 nM) using recombinant proteins for HAB1, ABU, and ABI2 (HAB1, top panel; ABU, middle panel; ABI2, bottom panel). As observed with PYR1 CA alleles, the PYL2 and PYL9 CA alleles are show a high level of ligandindependent inhibition of PP2Cs and are active on multiple PP2Cs.

Figure 5. pyi_2^CA3 overexpression induces hyperdormancy in seeds. Columbia (Col), 35S::PYL2 and two independent 35S::PYL2^CA3 seed samples were divided into two portions; one portion was stratified on 1/3 MS plates for 6 days at 4°C and the second portion was plated six days later on 1/3 MS plates. Both samples were then transferred to room température (23°C) and incubated in darkness, then germination was scored at 24 hour intervals after imbibition. The top panel shows a photograph taken 6 days after imbibition (line 1 of 35S::PYL2^CA3 is shown). The bottom graphs show germination data over a 10 day period.

Figure 6. PYL2^CA3 overexpression affects ABA-regulated gene expression in seeds. Seeds of Col, 35S;:PYL2 and two independent 35S:: PYL2^CA3 transgenic lines were imbibed for 32 hours in eîther water or 5 μΜ ABA at room température under continuous illumination, after which total RNA was used in qRT-PCR reactions using primers for Em6, LEA and Rd29b. Biological duplicates with triple technical replicate measurements were conducted and gene expression levels were determined. Data are normalized to the levels observed in wild type seeds treated with 5 uM ABA.

Figure 7. pyl2^CA3 overexpression suppresses an aba2 phenotype. To test the ability of PYL2^CA3 to activate ABA signaling in vivo, we examined this allele's ability to suppress an aba2 phenotype. Wild-type Col, aba2-1, aba2-1;35S::PYL2 and two independent aba2-1; 35S::PYL2^CM transgenic lines were germinated on different concentration of placlobutrazole, which aba2 mutants are résistant to due to defects in ABA-induced seed dormancy. PYL2^CA3 overexpression restores paclobutrazole sensitivity to aba2~1 mutant seeds.

Figure 8. Site-Saturation Mutagenesis of PYR1 Identifies Partial Activation Mutants. (A) Sites selected for saturation mutagenesis. 39 residues involved in agonist (LIG) or PP2C (PPI) contacts were selected based on structure coordinates and subjected to site-saturation mutagenesis creating 741 PYR1 mutants; the alignment shows the identity and amino acid numbering of homologous residues in ali Arabidopsis PYLs as well as maize and physcomitrella PYR1 orthologs. Contiguous peptides = SEQ ID NOs: 156-172. (B) Activating mutations identified by site saturation mutagenesis. Of the 741 mutants constructed, 29 promoted interactions with HAB1 in the absence of ABA as measured using an established yeast two hybrid assay; the locations of activating mutations are mapped onto the PYR1-ABA-HAB1 structure. The top panel shows the gâte residues (red), while the bottom panel shows the C-terminal hélix residues (green); H60 is shown in cyan. Inset are images of X-gal stained yeast colonies for the subset of PYR1 mutants that bind HAB1 in the absence of ABA. For reference, the wild type PYR1-HAB1 interaction in the yeast two hybrid is shown in the presence and absence of 10 ΠΜ ABA.

Figure 9. Combining Partial Activation Mutants Leads to Constitutively Active PYR1, Triple and quadruple mutant combinations of partial activation mutants were made as described in the text (see Figure 17 for a complété list of ail mutants characterized). Recombinant 6xHis- PYR1 (wt”), PYR1^CA3(A), PYR1^CA4(B), and PYR1^CA4B (C) were expressed in E. coli, purified and utilized in PP2C assays with GSTHAB1. Reactions contain 600 nM GST-HAB1 and varying concentrations of receptor (0, 600, 1200, 2400 or 4800 nM receptor). PP2C activity is expressed as %-control, i.e. activity of PP2C in the absence of receptor and ABA, but otherwise identical reaction conditions. For comparison to the degree activation elicited by ABA on wild type receptor, each graph shows wild type PYR1 reactions run with either 0 (diamonds) or 10 □M ABA (squares); mutant proteins are represented by triangles and were assayed in the absence of ABA. The image at right shows the locations of the mutations mapped onto the crystal structure of PYR1-ABA-HAB1; the side chains for residues mutated are shown in stick form; red corresponds to gâte mutation, green to C-terminal hélix mutations and cyan to H60 mutations.

Figure 10. The CA3 and CA4 Mutations Function in the Context of Other

Receptor Backbones. The CA3 mutations from PYR1 were introduced into homologous positions in PYL2 and PYL9 (triangles), and the CA4 mutations from PYR1 were introduced into homologous positions in PYL2 (filled circles). Recombinant receptors were assayed for activity on GST-HAB1, 6x-His-Sumo-ABI1 and 6x-His-Sumo-ABI2. Reactions contain 600 nM PP2C and varying concentrations of receptor (0, 600, 1200, 2400 or 4800 nM receptor). PP2C activity is expressed as %-control, /.e., activity of PP2C in the absence of receptor and ABA; each graph shows wild type receptors in reactions run with elther 0 (diamonds) or 10 ΠΜ ABA (squares).

[0001] Figure 11. Overexpression of PYL2^CAÎ Induces Seed Hyper-Dormancy.

Seeds of the wild type Columbia (Col), 35S::GFP-PYL2 or two independent 35S;:GFPPYL2^CA3 lines were either stratified (squares) for 6 days at 4 °C or unstratified (diamonds) and then their germination monitored at 24 hour intervals post-imbibition. The image at right shows représentative images at 48 hours post imbibition for Columbia, 35S::GFPPYL2 or two independent 35S::GFP-PYL2^CA3(line 1).

Figure 12. Expression of PYL2^CA3 Elevâtes Levels of ABA-Regulated mRNAs.

Seeds of the wild type Columbia (Col), 35S::GFP-PYL2 or two independent 35S::GFPPYL2^CA3 were imbibed for 32 hours at room température, RNA prepared and qRT-PCR reactions performed using primers for the Em6 (left), LEA (middle) or Rd29b (right) as described in the methods; wild type Columbia seeds were treated with either 0 or 5 DM ABA. The fold-induction with respect to wild type expression (arbitrarily set to a value of î using is shown BioRad’s CFX Manager software); note that the Y-axis is displayed in log-scale.

Figure 13. PYL2^CA3 Suppresses Phenotypes Caused by ABA deficiency.

Seeds of the wild type Columbia (Col), aba2-1, aba2~1 ;35S::GFP-PYL2 or aba21;35S::GFP-PYL2^CA3 génotypes were stratified for 4 days at 4°C on agar media containing different concentrations of paclobutrazol or sodium chloride and germination scored after 72 hours post-imbibition. The experiment was conducted in triplicate and standard déviation is shown on graph points. The image at left shows représentative images at 72 hours post imbibition for control, 50 DM paclobutrazol or 250 mM NaCI. Values plotted in graphs are the average of three independent measurements and error bars show standard déviation. WT (diamonds), aba2-1 (triangles), aba2-1;35S::GFPPYL2 (squares), aba2-1;35S::GFP-PYL2^CA3 (filled circles).

Figure 14. PYL6 and PYL10 Do Not Possess Full Constitutive Activity.

Recombinant wild type 6x-His-PYL6 or 6x-His-PYL10 were prepared as described in the methods and assessed in in vitro PP2C assays using 600 nM GST-HAB1 and varying concentrations of receptor (0, 600, 1200, 2400 or 4800 nM receptor). PP2C activity is expressed as %-control, i.e., activity of PP2C in the absence of receptor and ABA, but otherwise identical reaction conditions. Graphs show reactions run with either 0 (diamonds) or 10 OM ABA (squares).

Figure 15. Mutations Identifîed by Site-Saturation Mutagenesis Increase PYRI’s Basal Activity. Recombinant wild type 6x-His-PYR1 or mutants were prepared as described in the methods and assessed in in vitro PP2C assays using 600 nM GSTHAB1 and varying concentrations of receptor (0, 600, 1200, 2400 or 4800 nM receptor). PP2C activity is expressed as % of control, i.e., activity of PP2C in the absence of receptor and ABA, but otherwise identical reaction conditions. For comparison to the degree activation elîcited by ABA on wild type receptor, each graph shows wild type PYR1 reactions run with either 0 (diamonds) or 10 DM ABA (squares); mutant proteins are represented by triangles and were assayed in the absence of ABA.

Figure 16. The CA4C Allele Activâtes Multiple Receptors. Recombinant wild type or mutant 6x-His-receptors were prepared as described in the methods and assessed in in vitro PP2C assays using 600 nM GST-HAB1 and varying concentrations of receptor (0, 600, 1200, 2400 or 4800 nM receptor). PP2C activity is expressed as %control, i.e., activity of PP2C in the absence of receptor and ABA, but otherwise identical reaction conditions. For comparison to the degree activation elîcited by ABA on wild type receptor, each graph shows wild type PYR1 reactions run with either 0 (diamonds) or 10 □ M ABA (squares); mutant proteins are represented by triangles and were assayed in the absence of ABA. Values plotted in graphs are the average of three independent measurements and error bars show standard déviation.

Figure 17. Summary of PP2C activity for single and multiple receptor mutations. Summary of experimental data showing the effects of wild-type control PYR/PYL proteins (in the absence or presence of ABA) and various PYR1, PYL2, and PYL9 single-mutation or multiple-mutation proteins (in the absence of added ABA) on HAB1, ABU, and/or ABI2 activity.

Figure 18. The Rd29A::GFP-PYL2^CA4 transgene causes a modes! germination delay. Seeds of the wild type Columbia (Col-0), Rd29A::GFP-PYL2 or two independent Rd29A::GFP-PYL2^CA4 fines were either stratified (red square) for 5 days at 4°C or unstratified (blue diamond) and then their germination, indicated by radical emergence, monitored at 24 hour intervals post-imbibition. Graphs plot the averages of values from three biological replicates and error bars show one standard déviation.

Figure 19. Plants containing an RD29A-driven PYL2^CA4 transgene are phenotypically similar to wild type. From left to right, wild type, RD29A::GFP-PYL2, 10 and two independent RD29A::GFP-PYL2^CA4 transgenîc lines. Plants shown are fourweek-old plants grown in jiffy pots under long day light conditions (16 light/ 8 dark).

[0002] Figure 20. The RD29A::GFP-PYL2CA4 transgene does not substantially reduce Arabidopsis fertility. Siliques of wild type Columbia (Col-0), RD29A::GFPPYL2 or two independent RD29A::GFP-PYL2^CA4 transgenîc Unes were characterized by two parameters: silique length (blue diamond) and number of siliques (red square). For silique length, five dry mature siliques located were measured. Total silique number on the main stem were counted from seven individual plants. Graphs plot the averages of values and error bars show one standard déviation.

Figure 21. The RD29A::GFP-PYL2CA4 transgene drives PYL2 expression in response to drought. Protein was isolated from RD29A::GFP-PYL2 and from two independent RD29A::GFP-PYL2^CA4 transgenîc lines, from leaves of three-week-old plants (-) or leaves that were detached and dried for four hours (+). Western blot analyses were performed on 20 pg SDS-PAGE separated total proteins probed with either a 1/10,000 dilution of a GFP monoclonal antibody (Clontech, USA) or a 1/10,000 dilution of an α-Tubulin antibody (Sigma, USA), followed by 1/10,000 secondary HRPconjugated anti-mouse IgG antibody (Sigma, USA) and detected by enhanced chemiluminescence (GE Healthcare, USA).

[0003] Figure 22. Plants containing the RD29A::GFP-PYL2CA4 transgene possess increased salinity résistance. Week-old seedlings of the wild-type Columbia (Col-0), RD29A::GFP-PYR1, RD29A:GFP-PYL2, or two independent RD29A::GFPPYR1^CA4 or RD29A::GFP-PYL2^CA4 transgenîc lines were subjected to 100mM NaCI for 16 hours, then the seedlings were transferred to 250mM NaCI for additional two weeks, after which survival rate was scored as follows: completely white seedlings were scored dead and seedlings retaining pigment were scored as alive. Then survival rates was calculated as a % of total seedling (N=99). (A) Représentative image of seedlings after two weeks in 250 mM NaCI, (B) Quantification of PYR1 transgenîc lines' survival rates, (C) Quantification of PYL2 transgenîc lines' survival rates. Error bars show one standard déviation.

Figure 23. The RD29A::GFP-PYL2CA4 transgene elevates levels of ABAregulated mRNAs in response to 100 mM NaCI. Seedlings of the wild-type Columbia (Col), RD29A::GFP-PYL2, or two independent RD29A::GFP-PYL2^CA4 lines were subjected to 100mM NaCI for 0, 3 or 6 hours. RNA was prepared and qRT-PCR reactions were performed using primers for the RD29B (upper) or RAB18 (lower) gene as described in the Examples section. The fold induction plotted was calculated with respect to wild-type expression (arbitrarily set to a value of 1 using BioRad CFX Manager software). Graphs plot average values from three technical replicates, and error bars show 1 SD; the same trends in gene expression were seen in three separate biological replicates.

[0004] Figure 24. The RD29A::GFP-PYL2CA4 transgene împroves water use efficacy. Six-week-old plants from the wild-type Columbia (Col), RD29A:GFP-PYL2, or two independent RD29A::GFP-PYL2^CA4 fines were prepared for drought conditions by covering the pot to prevent water loss not attributed to transpiration. Water was then deprived for two weeks, during which time plants were photographed and weighed. Water rétention was calculated as percent of initial water content. (A) Représentative images of water-deprived plants after one or two weeks (upper panel) and controls which had continuous water supply. The numbers underneath the photos represent the fraction of plants where at least one leaf collapsed due to lack of water. (B) Statistical One-way Anova test of Water Rétention. Plot îndicate the Means with 95% Confidence Intervals.

Figure 25. The RD29A::GFP-PYL2CA4 transgene does not affect Arabidopsis dry mass accumulation. Plants used in the water use efficacy experiment described in Figure 24 (n=~32) and controls (n=10) were dried out and weighed. Graphs plot the averages of values and error bars show one standard déviation.

Figure 26. The RD29A::GFP-PYL2CA4 transgene affects stomatal aperture after recovery from desiccation. Leaves from four-week-old plants of wild-type Columbia (Col-0), RD29A::GFP-PYL2, or two independent RD29A::GFP-PYL2^CMtransgenic fines were severed and dried under light for one hour, then plants were rehydrated for 90 minutes. Controls were grown for 24 hours under high humidity. Stomatal morphologies of 4 leaves per génotype were captured by molding as described in the example. The aperture of -100 stomata per génotype was measured and One-way Anova statistical analysis was performed on the resulting measurements. Plots îndicate the stomatal aperture means (in pm) with 95% confidence intervals plotted on the error bars.

DEFINITIONS

The term PYR/PYL receptor polypeptide refers to a protein characterized in part by the presence of one or more or ail of a polyketide cyclase domain 2 (PF10604), a polyketide cyclase domain 1 (PF03364), and a Bet V I domain (PF03364), which in wildtype form médiates abscisic acid (ABA) and ABA analog signaling. A wide variety of PYR/PYL receptor polypeptide sequences are known in the art. In some embodiments, a PYR/PYL receptor polypeptide comprises a polypeptide that is substantially identical to PYR1 (SEQ ID NO:1), PYL1 (SEQ ID NO:2), PYL2 (SEQ ID NO:3), PYL3 (SEQ ID

NO:4), PYL4 (SEQ ID NO:5), PYL5 (SEQ ID NO:6), PYL6 (SEQ ID NO:7), PYL7 (SEQ ID NO:8), PYL8 (SEQ ID NO:9), PYL9 (SEQ ID NO:10), PYL10 (SEQ ID NO:11), PYL11 (SEQ ID NO:12), PYL12 (SEQ ID NO:13), or PYL13 (SEQ ID NO:14), or to any of SEQ ID NOs:15-155.

The term ligand-binding pocket refers to an amino acid residue of a PYR/PYL receptor polypeptide which is located within 5Â of the ligand ABA, or a water molécule that hydrogen bonds to ABA, when ABA is bound to the PYR/PYL receptor polypeptide. Proximity of an amino acid residue to ABA when ABA is bound to a PYR/PYL receptor can be determined, e.g., by protein crystallography.

The term type 2 protein phosphatase binding interface or PP2C binding interface refers to an amino acid residue of a PYR/PYL receptor polypeptide which is located within 5À of PP2C when ABA, the PYR/PYL receptor polypeptide, and the PP2C are bound in a ternary complex. Proximity of an amino acid residue to PP2C when the PP2C is bound to a PYR/PYL receptor can be determined, e.g., by protein crystallography.

A wild-type PYR/PYL receptor polypeptide refers to a naturally occurring PYR/PYL receptor polypeptide that médiates abscisic acid (ABA) and ABA analog signaling.

A mutated PYR/PYL receptor polypeptide refers to a PYR/PYL receptor polypeptide that is a variant from a naturally-occurring (i.e., wild-type) PYR/PYL receptor polypeptide. As used herein, a mutated PYR/PYL receptor polypeptide comprises one, two, three, four, or more amino acid substitutions relative to a corresponding wild-type PYR/PYL receptor polypeptide. In this context, a mutated polypeptide can be generated by any method for generating non-wild type nucléotide sequences. In some embodiments, a mutated PYR/PYL receptor polypeptide is constitutively active. As used herein, constitutively active refers to a PYR/PYL receptor that can bind to a type 2 protein phosphatase (PP2C) in the absence of ABA and/or inhibit the activity of the PP2C in the absence of ABA.

The phrase significantly inhibits the activity of a type 2 protein phosphatase (PP2C), as used herein, means that the activity level of a PP2C that is contacted with a mutated PYR/PYL receptor polypeptide in the absence of abscisic acid is substantially decreased relative to the activity level of a PP2C in the absence of abscisic acid. In some embodiments, the activity level of a PP2C that is contacted with a mutated PYR/PYL receptor polypeptide in the absence of abscisic acid is substantially decreased when it is decreased by at least about 10%, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more relative to the activity level of a PP2C in the absence of abscisic acid.

In some embodiments, a constitutively active PYR/PYL receptor of the présent invention significantly inhîbits PP2C activity (e.g., ïnhibits at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of PP2C activity) at a receptor/PP2C molar ratio of about 1:1, about 1:2, about 1:3, or about 1:4.

An amino acid substitution refers to replacing the naturally occurring amino acid residue in a given position (e.g., the naturally occurring amino acid residue that occurs in a wild-type PYR/PYL receptor polypeptide) with an amino acid residue other than the naturally-occurring residue. For example, the naturally occurring amino acid residue at position 60 of the wild-type PYR1 receptor polypeptide sequence (SEQ ID NO:1) is histidine (H60); accordingly, an amino acid substitution at H60 refers to replacing the naturally occurring histidine with any amino acid residue other than histidine.

An amino acid residue corresponding to an amino acid residue [X] in [specified sequence, or an amino acid substitution corresponding to an amino acid substitution [X] in [specified sequence] refers to an amino acid in a polypeptide of interest that aligns with the équivalent amino acid of a specified sequence. Generally, as described herein, the amino acid corresponding to a position of a specified PYR/PYL receptor polypeptide sequence can be determined using an alignment algorithm such as BLAST. In some embodiments of the présent invention, correspondence of amino acid positions is determined by aligning to a région of the PYR/PYL receptor polypeptide comprising SEQ ID NO:1, as discussed further herein. When a PYR/PYL receptor polypeptide sequence differs from SEQ ID NO:1 (e.g., by changes in amino acids or addition or délétion of amino acids), it may be that a particular mutation associated with constitutive activity of the PYR/PYL receptor will not be in the same position number as it is in SEQ ID NO:1, For example, amino acid position V87 of PYL2 (SEQ ID NO:3) aligns with amino acid position V83 of PYR1 (SEQ ID NO:1 ), as can be readily illustrated in an alignment of the two sequences. In this example, amino acid position 87 in SEQ ID NO:3 corresponds to position 83 in SEQ ID NO:1. Examples of corresponding positions are shown in Figure 1.

Two nucleic acid sequences or polypeptides are said to be identical if the sequence of nucléotides or amino acid residues, respectively, in the two sequences is the same when aligned for maximum correspondence as described below. The terms identical or percent identity, in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or hâve a specified percentage of amino acid residues or nucléotides that are the same, when compared and aligned for maximum correspondence over a comparison window, as measured using one of the following sequence comparison algorithms or by manual alignment and Visual inspection. When percentage of sequence identity is used in référencé to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions, where amino acids residues are substituted for other amino acid residues with simîlar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molécule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zéro, a conservative substitution is given a score between zéro and 1. The scoring of conservative substitutions is calculated according to, e.g., the algorithm of Meyers & Miller, Computer Applic. Biol. Sci. 4:11-17 (1988) e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California, USA).

The phrase substantial identity or substantially identical, used in the context of two nucieic acids or polypeptides, refers to a sequence that has at least 70% sequence identity with a référencé sequence. Alternativeiy, percent identity can be any integer from 70% to 100%. In some embodiments, a sequence is substantially identical to a référencé sequence if the sequence has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the référencé sequence as determined using the methods described herein; preferably BLAST using standard parameters, as described below. Embodiments of the présent invention provide for nucieic acids encoding polypeptides that are substantially identical to any of SEQ ID NO:1-155.

For sequence comparison, typically one sequence acts as a référencé sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and référencé sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculâtes the percent sequence identities for the test sequences relative to the référencé sequence, based on the program parameters.

A comparison window, as used herein, includes référencé to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a référencé sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of

I5 sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appt. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'I. Acad. Sci. USA 85:2444 (1988), by computerized implémentations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wl), or by manual alignment and Visual inspection.

Algorithms that are suitable for determîning percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1990) J. Mol. Biol, 215: 403-410 and Altschul et al. (1977) Nucleic Acids Res. 25: 3389-3402, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (NCBI) web site. The algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, supra). These initial neighborhood word hits acts as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucléotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score faits off by the quantity X from its maximum achieved value; the cumulative score goes to zéro or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X détermine the sensitivity and speed of the alignment. The BLASTN program (for nucléotide sequences) uses as defaults a word size (W) of 28, an expectation (E) of 10, M=1, N=-2, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word size (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)).

The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'I. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probabîlity (P(N)), which provides an indication of the probability by which a match between two nucléotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.01, more preferably less than about 10‘⁵, and most preferably less than about ΙΟ'²⁰.

The term promoter, as used herein, refers to a polynucleotide sequence capable of driving transcription of a coding sequence in a cell. Thus, promoters used in the polynucleotide constructs of the invention include cis-acting transcriptional control éléments and regulatory sequences that are involved in regulating or modulating the timing and/or rate of transcription of a gene. For example, a promoter can be a cisacting transcriptional control element, including an enhancer, a promoter, a transcription terminator, an origin of réplication, a chromosomal intégration sequence, 5' and 3' untranslated régions, or an intronic sequence, which are involved in transcriptional régulation. These cis-acting sequences typically interact with proteins or other biomolecules to carry out (turn on/off, regulate, modulate, etc.) gene transcription. A plant promoter is a promoter capable of înitiating transcription in plant cells. A constitutive promoter is one that is capable of înitiating transcription in nearly ali tissue types, whereas a tissue-specific promoter initiâtes transcription only in one or a few particular tissue types.

A polynucleotide sequence is heterologous to an organism or a second polynucleotide sequence if it originates from a foreign species, or, if from the same species, is modified from its original form. For example, when a promoter is said to be operably linked to a heterologous coding sequence, it means that the coding sequence is derived from one species whereas the promoter sequence is derived another, different species; or, if both are derived from the same species, the coding sequence is not naturally associated with the promoter (e.g., is a genetically engineered coding sequence, e.g., from a different gene in the same species, or an allele from a different ecotype or variety).

An expression cassette refers to a nucleic acid construct that, when introduced into a host cell, results in transcription and/or translation of an RNA or polypeptide, respectively. Antisense or sense constructs that are not or cannot be translated are expressly included by this définition. In the case of both expression of transgenes and suppression of endogenous genes (e.g., by antisense, or sense suppression) one of skill will recognize that the inserted polynucleotide sequence need not be identical, but may be only substantially identical to a sequence of the gene from which it was derived. As explained herein, these substantially identical variants are specifically covered by reference to a spécifie nucleic acid sequence.

The term plant includes whole plants, shoot végétative organs and/or structures (e.g., leaves, stems and tubers), roots, flowers and floral organs (e.g., bracts, sepals, petals, stamens, carpels, anthers), ovules (includîng egg and central cells), seed (includîng zygote, embryo, endosperm, and seed coat), fruit (e.g., the mature ovary), seedlings, plant tissue (e.g., vascular tissue, ground tissue, and the like), cells (e.g., guard cells, egg cells, trichomes and the like), and progeny of same. The class of plants that can be used in the method of the invention is generally as broad as the class of higher and lower plants amenable to transformation techniques, includîng angiosperms (monocotyledonous and dicotyledonous plants), gymnosperms, ferns, and multicellular algae. It includes plants of a variety of ploidy levels, includîng aneuploid, polyploid, diploid, haploid, and hemizygous.

DETAILED DESCRIPTION OF THE INVENTION

Introduction

The présent invention is based, in part, on the discovery that combinations of mutations in PYR/PYL receptor polypeptides resuit in constitutively active forms of the PYR/PYL receptor. PYR/PYL receptor can be classified into three classes on the basis of sequence similarity, ABA sensitivity, oligomeric state, and level of basal activation. PYR1, PYL1, PYL2, PYL3, and PYL4 are dimeric in solution, display low basal activation, and require higher levels of ABA to elicit complété PP2C inhibition in comparison to other PYLs. PYL5, PYL6, PYL7, PYL8, and PYL9 are monomeric in solution, require lower ABA concentrations to inhibit PP2C activity, and possess elevated basal activity in comparison to PYR1-PYL4. PYL10, PYL11, PYL12, and PYL13 are also monomeric in solution, but display much higher basal activation than PYR1-PYL9. Dimeric PYR/PYL receptor proteins do not substantially inhibit type 2 protein phosphatase (PP2C) activity in the absence of abscisic acid (ABA), as ABA is needed to stabilize the receptor in a form that allows high-affinity binding to the PP2C.

In principle, receptor mutations that allow high affinity binding to and inhibition of the PP2Cs in the absence of an agonist should activate the ABA signaling pathway in an ABA-independent form. These forms of mutant receptors are referred to as constitutively active forms. However, although some PYL proteins, such as PYL10, hâve been reported to hâve higher basal activation in comparison to PYR1, no receptor or variant has previously been reported that shows full constitutively active activity. The présent invention surprisingly demonstrates PYR/PYL receptors that possess full constitutively active properties and demonstrates their utility for activating ABA signaling and stress tolérance in transgenic plants.

I8 [0005] Constitutively active PYR/PYL receptor mutations are bénéficiai in comparison to generic chemical agonists (such as ABA) because constitutively active mutations allow single receptors to be activated selectively. Because the PYR/PYL receptors résidé in a relatively large gene family (14 members in Arabidopsis), sélective activation of single receptors by constitutively active mutations can allow responses controlled by distinct family members to be specifically controlled, in contrast to general activation of signaling by ABA or general agonists, which activate a wider range of receptors. Sélective action of PYR/PYL receptors may avoid the undesirable side effects of general activation, such as chlorosis, and may enable the myriad désirable and undesirable side effects to be disentangled and controlled with specificity.

Constitutively Active PYR/PYL Receptor Polypeptides

In one aspect, the présent invention provides for PYR/PYL receptor polypeptides comprising one or more amino acid substitutions in a ligand-binding pocket and/or a type 2 protein phosphatase (PP2C) binding interface, wherein the PYR/PYL receptor binds to PP2C in the absence of abscisic acid, as well as polynucleotides encoding PYR/PYL receptor polypeptides comprising one or more amino acid substitutions wherein the PYR/PYL receptor binds to PP2C in the absence of abscisic acid; expression cassettes and expression vectors comprising polynucleotides encoding PYR/PYL receptor polypeptides comprising one or more amino acid substitutions wherein the PYR/PYL receptor binds to PP2C in the absence of abscisic acid; plants comprising PYR/PYL receptor polypeptides comprising one or more amino acid substitutions wherein the PYR/PYL receptor binds to PP2C in the absence of abscisic acid; methods of making plants comprising PYR/PYL receptor polypeptides comprising one or more amino acid substitutions wherein the PYR/PYL receptor binds to PP2C in the absence of abscisic acid.

[0006] In some embodiments, the constitutively active PYR/PYL receptor comprises mutations that resuit in the mutated receptor binding to a PP2C in the absence of ABA. As used herein, a mutated PYR/PYL receptor binds a PP2C in the absence of ABA if the mutated PYR/PYL receptor (e.g., a mutated PYR1 receptor) has a higher binding affinity for the PP2C in the absence of ABA than the basal affinity of the corresponding wild-type PYR/PYL receptor (e.g., a wild-type PYR1 as shown in SEQ ID NO:1) for the PP2C in the absence of ABA. In some embodiments, the constitutively active PYR/PYL receptor comprises mutations that resuit in the mutated receptor significantly inhibiting the activity of the PP2C in a phosphatase assay in the absence of ABA. In some embodiments, the mutated receptor inhibits the activity of the PP2C by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80% or more in the absence of ABA as compared to a wild-type PYR/PYL receptor in the absence of ABA.

A wide variety of wild-type (naturally occurring) PYR/PYL polypeptide sequences are known in the art. Although PYR1 was originally identified as an abscisic acid (ABA) receptor in Arabidopsis, in fact PYR1 is a member of a group of at least 14 proteins (PYR/PYL proteins) in the same protein family in Arabidopsis that also médiate ABA signaling. This protein family is also présent in other plants (see, e.g., SEQUENCE LISTING) and is characterized in part by the presence of one or more or ail of a polyketide cyclase domain 2 (PF10604), a polyketide cyclase domain 1 (PF03364), and a Bet V I domain (PF03364). START / Bet v 1 superfamily domain are described in, for example, Radauer, BMC Evol. Biol. 8:286 (2008). ln some embodiments, a wild-type PYR/PYL receptor polypeptide comprises any of SEQ ID NOs: 1-119. ln some embodiments, a wild-type PYR/PYL receptor polypeptide is substantially identical to (e.g., at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94% 95%, 96%, 97%, 98%, or 99% identical to)anyof SEQ ID NOs: 1-119.

Constitutively active PYR/PYL receptor polypeptides are variants from naturally occurring (i.e., wild-type) PYR/PYL receptor polypeptides, wherein the variant PYR/PYL receptor polypeptide is able to bind to and/or inhibit the activity of a PP2C in the absence of abscisic acid. Constitutively active PYR/PYL receptor polypeptides of the présent invention comprise one or more amino acid substitutions in a ligand-binding pocket and/or a type 2 protein phosphatase (PP2C) binding interface of the PYR/PYL receptor polypeptide, ln some embodiments, a constitutively active PYR/PYL receptor polypeptide is substantially identical to (e.g., at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94% 95%, 96%, 97%, 98%, or 99% identical to) any of SEQ ID NO:1,2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18. 19, 20, 21, 22, 23, 24, 25. 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,42, 43, 44, 45, 46, 47, 48, 49. 50, 51, 52,

53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75,

76, 77, 78, 79, 80, 81,82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98,

99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116,

117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131,132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153,154, or 155 and comprises 1, 2, 3, 4, or more mutations (e.g., amino acid substitutions) as described herein in the ligand-binding pocket and/or the PP2C binding interface, wherein the mutated PYR/PYL receptor polypeptide binds to and/or înhibits the activity of a type 2 protein phosphatase (PP2C) in the absence of abscisic acid, ln some embodiments, the constitutively active PYR/PYL receptor polypeptide comprises one or more amino acid substitutions in the ligand-binding pocket, ln some embodiments, the constitutively active PYR/PYL receptor polypeptide comprises one or more amino acid substitutions in the PP2C binding interface. In some embodiments, the constitutively active PYR/PYL receptor polypeptide comprises one or more amino acid substitutions in each of the ligand-binding pocket and the PP2C binding interface. In some embodiments, the constitutively active PYR/PYL receptor polypeptide has the amino acid sequence of any of SEQ ID NOs: 120-155 (i.e., any of SEQ ID NO: 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, or 155),

Ligand-binding pocket mutations

PYR/PYL receptor proteins hâve a conserved START-domain ligand-binding pocket flanked by two loops called the gâte and the latch (Melcher, K. et al., Nature 462 (2009)). ABA binds to a PYR/PYL receptor protein at the ligand-binding pocket and ABA binding induces closure of the loops to seal ABA inside the ligand-binding pocket. The ligand-binding pocket of a PYR/PYL receptor polypeptide comprises amino acid residues that are in close proximity (e.g., within about 5A) to a PYR/PYL ligand (e.g., ABA) or a ligand-contacting water molécule when the ligand is bound to the PYR/PYL receptor. Table 1 in the Examples section lists the residues that make up the ligandbinding pocket tn PYR1; in total, there are 25 residues that make up the PYR1 ligandbinding pocket. The residues of the ligand-binding pocket are also highly conserved among other PYR/PYL family members.

In some embodiments, a mutated PYR/PYL receptor polypeptide of the présent invention comprises one or more (e.g., one, two, three, four, five, six, seven, eight, or more) amino acid substitutions in the ligand-binding pocket. In some embodiments, the one or more amino acid substitutions are selected from the amino acid substitutions H60P/G/R/A/W/I/K/V/M, V83F/L/P, L87F, A89W or F159V/A, wherein the amino acid substitutions correspond to positions H60, V83, L87, A89, and F159 in PYR1 as set forth in SEQ ID NO:1. ln some embodiments, the one or more amino acid substitutions are selected from H60G/R/A/W/I/K/V/M, V83F/P, L87F, A89W or F159V/A, wherein the amino acid substitutions correspond to positions H60, V83, L87, A89, and F159 in PYR1 as set forth in SEQ ID NO:1. ln some embodiments, the one or more amino acid substitutions comprise two amino acid substitutions selected from H60P/G/R/A/W/I/K/V/M and V83F/L/P, wherein the amino acid substitutions correspond to positions H60 and V83 in PYR1 as set forth in SEQ ID NO:1. In some embodiments, the one or more amino acid substitutions comprise two amino acid substitutions selected from the amino acid substitutions H60P/G/R/A/W/I/K/V/M and F159V/A, wherein the amino acid substitutions correspond to positions H60 and F159 in PYR1 as set forth in SEQ ID NO:1. In some embodiments, the one or more amino acid substitutions comprise three amino acid substitutions selected from the amino acid substitutions H60P/G/R/A/W/I/K/V/M, V83F/L/P, and F159V/A, wherein the amino acid substitutions correspond to positions H60, V83, and F159 in PYR1 as set forth in SEQ ID NO:1. In some embodiments, the one or more amino acid substitutions comprise three amino acid 5 substitutions selected from H60P/G/R/A/W/I/K/V/M, V83F/L/P, and A89W, wherein the amino acid substitutions correspond to positions H60, V83, and A89 in PYR1 as set forth in SEQ ID N0:1. In some embodiments, the one or more amino acid substitutions comprise three amino acid substitutions selected from H60P/G/R/A/W/I/K/V/M, A89W, and F159V/A, wherein the amino acid substitutions correspond to positions H60, A89, 10 and F159 in PYR1 as set forth in SEQ ID NO:1.

Any of the mutations described herein can be made in the polypeptides of any of SEQ ID NOs:1-155 or in polypeptides substantially identical to any of SEQ ID NOs:1155. One of skill in the art will recognize that analogous amino acid substitutions can be made, for example, in PYR/PYL receptors other than PYR1 by aligning the PYR/PYL 15 receptor polypeptide sequence to be mutated with the PYR1 receptor polypeptide sequence as set forth in SEQ ID NO:1. As a non-limiting example, an amino acid substitution in PYL2 that is analogous to the amino acid substitution V83F in PYR1 as set forth in SEQ ID NO:1 can be determined by aligning the amino acid sequences of PYL2 (SEQ ID NO:3) and PYR1 (SEQ ID NO:1) and identifying position V87 in PYL2 as 20 aligning with amino acid position V83 of PYR1 (SEQ ID NO:1 ). Analogous amino acid positions in PYR/PYL receptors are shown in Figures 1 and 8.

In some embodiments, the one or more amino acid substitutions in the ligandbinding pocket resuit in the mutated PYR/PYL receptor being able to bind to PP2C in the absence of abscisic acid. In some embodiments, the amino acid substitution(s) in the 25 ligand-binding pocket resuit in the mutated PYR/PYL receptor being able to significantly inhibit the activity of the PP2C in a phosphatase assay in the absence of abscisic acid. In some embodiments, the amino acid substitution(s) in the ligand-binding pocket resuit in the mutated PYR/PYL receptor polypeptide being able to inhibit the activity of the PP2C by at least 50% in the absence of abscisic acid as compared to the level of PP2C 30 activity of a PP2C that is contacted with a wild-type PYR/PYL receptor polypeptide in the absence of abscisic acid. In some embodiments, the amino acid substitution(s) in the ligand-binding pocket resuit in the mutated PYR/PYL receptor polypeptide being able to inhibit the activity of the PP2C by at least 50% in the absence of abscisic acid and at a receptor:PP2C molar ratio of about 1:1, about 1:2, about 1:3, or about 1:4.

The extent to which one or more amino acid substitutions in the ligand-binding pocket activâtes PYR/PYL receptor activity in the absence of ABA (i.e., inhibîts PP2C activity) can be quantitatively measured, for example by assaying phosphatase activity in 22 the presence of the PYR/PYL receptor comprising one or more amino acid substitutions and comparing the phosphatase activity to that of a wild-type PYR/PYL receptor. In some embodiments, an activating mutation in the ligand-binding pocket is any mutation (e.g., amino acid substitution) that results in at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or greater inhibition of PP2C activity. In some embodiments, an activating mutation in the ligand-binding pocket is any mutation (e.g,, amino acid substitution) that results in at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or greater inhibition of PP2C activity at a receptor/PP2C molar ratio of about 1:1, about 1:2, about 1:3, or about 1:4.

In some embodiments, a mutated PYR/PYL receptor polypeptide of the présent invention comprises one or more (e.g., one, two, three or four) amino acid substitutions in the ligand-binding pocket selected from the group consisting of H60P/G, V83F, A89W or F159V, wherein the amino acid substitutions correspond to positions H60, V83, A89, and F159 in PYR1 as set forth in SEQ ID NO:1. As shown in Table 1 below, amino acid substitutions at these positions strongly activate the PYR/PYL receptor in the absence of ABA. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises an amino acid substitution at H60P. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises an amino acid substitution at H60G. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises an amino acid substitution at V83F. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises an amino acid substitution at A89W. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises an amino acid substitution at F159V. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises two, three, four, or more of the amino acid substitutions described above.

PP2C binding interface mutations

PYR/PYL receptor proteins directly bind to type 2 protein phosphatases (PP2Cs) and thus also contain a PP2C binding interface. The PP2C binding interface of a PYR/PYL receptor polypeptide comprises amino acid residues that are in close proximity (e.g., within about 5Â) to PP2C when PP2C, the PYR/PYL receptor, and ABA are ail bound together in a ternary complex. Table 1 in the Examples section lists the residues that make up the PP2C binding interface in PYR1 ; in total, there are 25 residues that make up the PYR1 PP2C binding interface. The residues of the PP2C binding interface are also highly conserved among other PYR/PYL family members.

In some embodiments, a mutated PYR/PYL receptor polypeptide of the présent invention comprises one or more (e.g., one, two, three, four, five, six, seven, eight, nine or more) amino acid substitutions in the PP2C binding interface. In some embodiments, the one or more amino acid substitutions are selected from the amino acid substitutions H60P/G/R/A/W/I/K/V/M, I84Q/E/P/H/K, L87F, A89W, M158T/C/V/I, F159V/A, T162F, L166Y/F, or K170W, wherein the amino acid substitutions correspond to positions H60, I84, L87, A89, M158, F159, T162, L166, and K170 in PYR1 as setforth in SEQ ID NO:1. In some embodiments, the one or more (e.g., one, two, three, four, five, six, seven, eight, nine or more) amino acid substitutions are selected from the amino acid substitutions H60/G/R/A/W/I/K/V/M, I84Q/E/P/H, L87F, A89W, M158T/CA//I, F159V/A, T162F, L166Y/F, or K170W, wherein the amino acid substitutions correspond to positions H60, I84, L87, A89, M158, F159.T162, L166, and K170in PYR1 as setforth in SEQ ID NO:1. In some embodiments, the one or more amino acid substitutions comprise three amino acid substitutions selected from H60P/G/R/A/W/I/K/V/M, M158T/C/V/I, and F159V/A, wherein the amino acid substitutions correspond to positions H60, M158, and F159 in PYR1 as setforth in SEQ ID NO:1. In some embodiments, the one or more amino acid substitutions comprise three amino acid substitutions selected from the amino acid substitutions H60P/G/R/A/W/I/K/V/M, A89W, and F159V/A, wherein the amino acid substitutions correspond to positions H60, A89, and F159 in PYR1 as set forth in SEQ ID NO:1. In some embodiments, the one or more amino acid substitutions comprise four amino acid substitutions selected from H60P/G/R/A/W/I/K/V/M, A89W, M158T/C/V/I, or F159V/A, wherein the amino acid substitutions correspond to positions H60, A89, M158, and F159 in PYR1 as setforth in SEQ ID NO:1.

Any of mutations described herein can be made in the polypeptides of any of SEQ ID NOs:1-155 or in polypeptides substantially identical toany ofSÊQ ID NOs:1-155. The residues of the PP2C binding interface are highly conserved among the PYR/PYL family members, and thus one of skill in the art will recognize that analogous amino acid substitutions to those described herein for PYR1 can be made in PYR/PYL receptors other than PYR1.

In some embodiments, the one or more amino acid substitutions in the PP2C binding interface resuit in the mutated PYR/PYL receptor being able to bind to PP2C in the absence of abscisic acid. In some embodiments, the amino acid substitution(s) in the PP2C binding interface resuit in the mutated PYR/PYL receptor being able to significantly inhibit the activity of the PP2C in a phosphatase assay in the absence of abscisic acid. In some embodiments, the amino acid substitution(s) in the PP2C binding interface resuit in the mutated PYR/PYL receptor polypeptide being able to inhibit the activity of the PP2C by at least 50% in the absence of abscisic acid as compared to the level of PP2C activity of a PP2C that is contacted with a wild-type PYR/PYL receptor polypeptide in the absence of abscisic acid. In some embodiments, the amino acid substitution(s) in the PP2C binding interface resuit in the mutated PYR/PYL receptor polypeptide being able to inhibit the activity of the PP2C by at least 50% in the absence of abscisicacid and ata receptor:PP2Cmolarratioof about 1:1, about 1:2, about 1:3, or about 1:4.

The extent to which one or more amino acid substitutions in the PP2C binding interface activate PYR/PYL receptor activity in the absence of ABA (Le., inhibits PP2C activity) can be quantitatively measured, for example by assaying phosphatase activity in the presence of the PYR/PYL receptor comprising one or more amino acid substitutions and comparing the phosphatase activity to that of a wild-type PYR/PYL receptor. In some embodiments, an activating mutation in the PP2C binding interface is any mutation (e.g., amino acid substitution) that results in at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or greater inhibition of PP2C activity. In some embodiments, an activating mutation in the PP2C binding interface is any mutation (e.g., amino acid substitution) that results in at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or greater inhibition of PP2C activity at a receptor/PP2C molar ratio of about 1:1, about 1:2, about 1:3, or about 1:4.

In some embodiments, a mutated PYR/PYL receptor polypeptide of the présent invention comprises one or more amino (e.g., one, two, three, four, five, or six) acid substitutions in the PP2C binding interface selected from the group consisting of H60P/G, I84Q, A89W, M158T/C, F159V, or K170W, wherein the amino acid substitutions correspond to positions H60,184, A89, M158, F159, and K170 in PYR1 as set forth in SEQ ID NO:1. As shown in Table 1 below, amino acid substitutions at these positions strongly activate the PYR/PYL receptor in the absence of ABA. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises an amino acid substitution at H60P. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises an amino acid substitution at H60G. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises an amino acid substitution at I84Q. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises an amino acid substitution at A89W. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises an amino acid substitution at M158T. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises an amino acid substitution at M158C. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises an amino acid substitution at F159V. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises an amino acid substitution at K170W. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises two, three, four, or more of the amino acid substitutions described above.

In some embodiments, a mutated PYR/PYL receptor polypeptide of the présent invention comprises one or more (e.g., one, two, three, four, or five) amino acid substitutions in the PP2C binding interface selected from the group consisting of H60P, A89W, M158I, F159V, or K170W, wherein the amino acid substitutions correspond to positions H60, A89, M158, F159, and K170 in PYR1 as set forth in SEQ ID NO:1. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises two, three, four, or five of the amino acid substitutions described above. For example, in some embodiments, the mutated PYR/PYL receptor polypeptide comprises two amino acid substitutions corresponding to H60P and F159V, or H60P and A89W, or A89W and F159V. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises three amino acid substitutions corresponding to H60P, A89W and F159V, or H60P, M158I and F159V. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises four amino acid substitutions corresponding to H60P, A89W, M158I and F159V.

Combinations of ligand-binding pocket and PP2C binding interface mutations

In some embodiments, a mutated PYR/PYL receptor polypeptide of the présent invention comprises one or more amino acid substitutions in each of the ligand-binding pocket and the PP2C binding interface. In some embodiments, the one or more amino acid substitutions in each of the ligand-pocket and the PP2C binding interface are selected from H60P/G/R/A/W/I/K/V/M, V83F/L/P, I84Q/E/P/H/K, L87F, A89W, M158T/C/V/I, F159V/A, T162F, L166Y/F, and K170W, wherein the amino acid substitutions correspond to positions H60, V83,184, L87, A89, M158, F159, T162, L166, and K170 in PYR1 as set forth in SEQ ID NO:1. In some embodiments, the mutated PYR/PYL receptor polypeptide comprises two, three, four, or more amino acid substitutions selected from H60P/G/R/A/W/I/K/V/M, V83F/L/P, I84Q/E/P/H/K, L87F, A89W, M158T/C/V/I, F159V/A, T162F, L166Y/F, and K170W, wherein the amino acid substitutions correspond to positions H60, V83, I84, L87, A89, M158, F159, T162, L166, and K170 in PYR1 as set forth in SEQ ID NO:1. Any of mutations described herein can be made in the polypeptides of any of SEQ ID NOs: 1-155 or in polypeptides substantially identical to any of SEQ ID NOs: 1-155. The residues of the ligand-binding pocket and the PP2C binding interface are highly conserved among the PYR/PYL family members, and thus one of skill in the art will recognize that analogous amino acid substitutions to those described herein for PYR1 can be made in PYR/PYL receptors other than PYR1.

In some embodiments, an amino acid substitution made in the ligand-binding pocket can be the same amino acid substitution as the amino acid substitution made in the PP2C binding interface, as some amino acid residues in PYR/PYL are able to contact both ABA and a PP2C when the ABA, PP2C, and PYR/PYL receptor are complexed together. Table 1 below lists amino acid residues of PYR/PYL, numbered with respect to PYR1, that make contact with both the ligand-binding pocket and the PP2C binding interface. Thus, in some embodiments, a mutated PYR/PYL receptor polypeptide of the présent invention comprises one or more amino acid substitutions in each of the ligand-binding pocket and the PP2C binding interface, wherein the one or more amino acid substitutions are selected from the amino acid substitutions H60P/G/R/A/W/I/K/V/M, L87F, A89W, and F159V/A, wherein the amino acid substitutions correspond to positions H60, L87, A89, and F159 in PYR1 as set forth in SEQ ID NO:1.

[0007] In some embodiments, a mutated PYR/PYL receptor polypeptide of the présent invention comprises three mutations selected from H60P, V83F, A89W, M158I, F159V, T162F, and/or K170W, wherein the amino acid substitutions correspond to positions H60, V83, I84, A89, M158, F159, T162, and/or K170 in PYR1 as set forth in SEQ ID NO:1. ln some embodiments, the three mutations are selected from amino acid substitutions corresponding to positions (i) H60P, V83F, and A89W; (ii) H60P, V83F, and F159V; (iii) H60P, A89W, and F159V; (iv) H60P, V83F, and M158I; and (v) H60P, M158I, and F159V of SEQ ID NO:1.

ln some embodiments, a mutated PYR/PYL receptor polypeptide of the présent invention comprises four mutations selected from H60P, V83F, A89W, M158I, F159V, T162F, and/or K170W, wherein the amino acid substitutions correspond to positions H60, V83, I84, A89, M158, F159, T162, and/or K170 in PYR1 as set forth in SEQ ID NO:1. ln some embodiments, the four mutations are selected from amino acid substitutions corresponding to positions (i) H60P, V83F, A89W, and F159V; (ii) H60P, V83F, M158I, and F159V; (iii) H60P, A89W, M158I, and F159V; (iv) H60P, V83F, F159V, and K170W; (v) H60P, V83F, M158I, and K170W;and (vi) V83F, M158I, F159V, and K170W of SEQ ID NO:1. Examples of exemplary mutations are shown in Figure 17.

Embodiments of the présent invention provide for use of the above proteins and/or nucleic acid sequences, encoding such polypeptides, in the methods and compositions (e.g., expression cassettes, plants, etc.) of the présent invention. The isolation of a polynucleotide sequence encoding a plant wild-type PYR/PYL receptor (e.g., from plants where PYR/PYL sequences hâve not yet been identified) may be accomplished by a number of techniques. For instance, oligonucleotide probes based on the PYR/PYL coding sequences disclosed (e.g., as listed in the SEQUENCE LISTING) here can be used to identify the desired wild-type PYR/PYL gene in a cDNA or genomic DNA library. To construct genomic libraries, large segments of genomic DNA are generated by random fragmentation, e.g., using restriction endonucleases, and are ligated with vector DNA to form concatemers that can be packaged înto the appropriate vector. To préparé a cDNA library, mRNA is isolated from the desired tissue, such as a leaf from a particular plant species, and a cDNA library containing the gene transcript of interest is prepared from the mRNA. Alternativeiy, cDNA may be prepared from mRNA extracted from other tissues in which PYR/PYL gene is expressed.

The cDNA or genomic library can then be screened using a probe based upon the sequence of a PYR/PYL gene disclosed here. Probes may be used to hybridize with genomic DNA or cDNA sequences to isolate homologous genes in the same or different plant species. Alternativeiy, antibodies raised against a polypeptide can be used to screen an mRNA expression library.

[0008] Alternativeiy, the nucieic acids encoding PYR/PYL can be amplified from nucieic acid samples using amplification techniques. For instance, polymerase chain reaction (PCR) technology can be used to amplify the coding sequences of PYR/PYL directly from genomic DNA, from cDNA, from genomic libraries or cDNA libraries. PCR and other in vitro amplification methods may also be useful, for example, to clone polynucleotide sequences encoding PYR/PYL to be expressed, to make nucieic acids to use as probes for detecting the presence of the desired mRNA in samples, for nucieic acid sequencing, or for other purposes. For a general overview of PCR see PCR Protocols: A Guide to Methods and Applications (Innis, M., Gelfand, D., Sninsky, J. and White, T„ eds.), Academie Press, San Diego (1990). Appropriate primera and probes for identifying sequences from plant tissues are generated from compensons of the sequences provided here with other related genes.

In some embodiments, the partial or entire genome of a number of plants has been sequenced and open reading frames identified. By a BLAST search, one can identify the coding sequence for wild-type PYR/PYL in various plants.

Methods of Making Constitutively Active PYR/PYL Receptor Polypeptides

In another aspect, the présent invention provides for methods of making PYR/PYL receptor polypeptides comprising one or more amino acid substitutions in a ligandbinding pocket and/or a type 2 protein phosphatase (PP2C) binding interface, wherein the PYR/PYL receptor binds to PP2C in the absence of abscisic acid. In some embodiments, the method comprises mutagenizing a wild-type PYR/PYL receptor and determining whether the mutagenized PYR/PYL receptor significantly inhibits the activity of a PP2C in a phosphatase assay in the absence of abscisic acid.

Mutated PYR/PYL receptor polypeptides can be constructed by mutating the DNA sequences that encode the corresponding wild-type PYR/PYL receptor polypeptide (e.g., a wild-type PYR/PYL polypeptide of any of SEQ ID NOs:1-119 or a corresponding variant from which the mutant PYR/PYL receptor polypeptide of the invention is derived), such as by using techniques commonly referred to as site-directed mutagenesis. Nucleic acid molécules encoding the wild-type PYR/PYL receptor polypeptide can be mutated by a variety of polymerase chain reaction (PCR) techniques well-known to one of ordinary skill in the art. (See, e.g., PCR Strategies (M. A. Innis, D. H. Gelfand, and J. J. Sninsky eds., 1995, Academie Press, San Diego, CA) at Chapter 14; PCR Protocols : A Guide to Methods and Applications (M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White eds., Academie Press, NY, 1990).

As a non-limiting example, mutagenesis may be accomplished using site-directed mutagenesis, in which point mutations, insertions, or délétions are made to a DNA template. Kits for site-directed mutagenesis are commercially avaîlable, such as the QuikChange Site-Directed Mutagenesis Kit (Stratagene). Briefly, a DNA template to be mutagenized is amplified by PCR according to the manufacturées instructions using a high-fidelîty DNA polymerase (e.g., Pfu Turbo™) and oligonucleotide primers containing the desired mutation. Incorporation of the oligonucleotides generates a mutated plasmid, which can then be transformed into suitable cells (e.g., bacterial or yeast cells) for subséquent screening to confirm mutagenesis of the DNA.

As another non-limiting example, mutagenesis may be accomplished by means of error-prone PCR amplification (ePCR), which modifies PCR reaction conditions (e.g., using error-prone polymerases, varying magnésium or manganèse concentration, or providing unbalanced dNTP ratios) in order to promote increased rates of error in DNA réplication. Kits for ePCR mutagenesis are commercially avaîlable, such as the GeneMorph® PCR Mutagenesis kit (Stratagene) and Diversify® PCR Random Mutagenesis Kit (Clontech). Briefly, DNA polymerase (e.g., Taq polymerase), sait (e.g., MgCI2, MgSO4, or MnSO4), dNTPs in unbalanced ratios, reaction buffer, and DNA template are combined and subjected to standard PCR amplification according to manufacturées instructions. Following ePCR amplification, the reaction products are cloned into a suitable vector to construct a mutagenized library, which can then be transformed into suitable cells (e.g., yeast cells) for subséquent screening (e.g., via a two-hybrid screen) as described below.

Alternatively, mutagenesis can be accomplished by recombination (i.e. DNA shuffling), Briefly, a shuffled mutant library is generated through DNA shuffling using in vitro homologous recombination by random fragmentation of a parent DNA followed by reassembly using PCR, resulting in randomly introduced point mutations. Methods of performing DNA shuffling are known in the art (see, e.g., Stebel, S.C. et al., Methods Mol 6/0/352:167-190 (2007)).

Optionally, multiple rounds of mutagenesis may be performed in order to improve the efficiency of mutant proteins isolated. Thus, in some embodiments, PYR/PYL mutants isolated from ePCR and subséquent screening may be pooled and used as templates for later rounds of mutagenesis.

Screening for Constitutively Active PYR/PYL Receptor Polypeptides

In some embodiments, mutated PYR/PYL receptor polypeptides are screened to détermine whether the mutated PYR/PYL receptor is activated in the absence of ABA. In some embodiments, whether a mutated PYR/PYL receptor is activated in the absence of ABA is determined by measuring whether the mutated receptor significantly inhibits the activity of a PP2C in a phosphatase assay in the absence of ABA. In some embodiments, a mutated receptor is said to be activated in the absence of ABA (i.e., constitutively active) if the mutated receptor inhibits the activity of the PP2C by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80% or more in the absence of ABA as compared to a wild-type PYR/PYL receptor in the absence of ABA. In some embodiments, a mutated receptor is activated in the absence of ABA (i.e., constitutively active) if the mutated receptor inhibits the activity of the PP2C by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80% or more in the absence of ABA as compared to a wild-type PYR/PYL receptor in the absence of ABA when the receptor and PP2C are présent at a receptor/PP2C molar ratio of about 1:1, about 1:2, about 1:3, or about 1:4.

A number of different screening protocols can be used to screen for constitutively active PYR/PYL receptors. Screening can take place using isolated, purified or partially purified reagents. In some embodiments, purified or partially purified PYR/PYL polypeptide can be used.

Alternatively, cell-based or plant-based methods of screening can be used. For example, cells that naturally express a wild-type PYR/PYL receptor polypeptide or that recombinantly express a wild-type or mutated PYR/PYL receptor polypeptide can be used. In some embodiments, the cells used are plant cells, animal cells, bacterial cells, fungal cells, including but not limited to yeast cells, insect cells, or mammalian cells. In general terms, the screening methods involve comparing the activity of a mutated PYR/PYL receptor polypeptide to the activity of a wild-type PYR/PYL receptor polypeptide in the absence of ABA, e.g., by comparing ABA-regulated gene expression in the wild-type and mutant PYR/PYL receptor-expressing cells or plants. In some embodiments, the PYR/PYL receptor polypeptide can be expressed in a cell or a plant that is déficient for ABA signaling (e.g., the aba2 mutant, which is déficient for aldéhyde oxidase, an enzyme necessary for ABA biosynthesis), and the level of expression of genes downstream of ABA can be compared to the level of expression of the same genes in a wild-type cell or plant expressing the PYR/PYL receptor polypeptide. In some 5 embodiments, the PYR/PYL receptor polypeptide can be expressed in a cell or a plant that is déficient for ABA signaling and the plant evaluated for any phenotype that results from reduced ABA levels (including but not limited to wiltiness, increased sensitivity to multiple abiotic stresses, and non-dormant seeds), then the phenotype can be compared to the phenotype of a wild-type cell or plant expressing the PYR/PYL receptor polypeptide.

One exemplary assay involves testing whether a mutated PYR/PYL receptor can bind to a type 2 protein phosphatase (PP2C) (e.g., Homology to ABU (HAB1)) in the absence of ABA. Binding assays can involve contacting a mutated PYR/PYI receptor polypeptide with a PP2C and allowing sufficient time for the PYR/PYL receptor and

PP2C to form a binding complex. Any binding complexes formed can be detected using any of a number of established analytical techniques. Protein binding assays include, but are not limited to, methods that measure co-precipitation or co-migration on nondenaturing SDS-polyacrylamide gels, and co-migration on Western blots (see, e.g., Bennet, J.P. and Yamamura, H.l. (1985) Neurotransmitter, Hormone or Drug Receptor

Binding Methods, in Neurotransmitter Receptor Binding (Yamamura, H. I., et al., eds.), pp. 61-89. Other binding assays involve the use of mass spectrometry or NMR techniques to identify molécules bound to the PYR/PYL polypeptide. The PYR/PYL polypeptide protein utilized in such assays can be naturally expressed, cloned or synthesized.

In some embodiments, mammalian or yeast two-hybrid approaches (see, e.g.,

Bartel, P.L. et al. Methods Enzymol, 254:241 (1995)) can be used to identify polypeptides or other molécules that interact or bind when expressed together in a cell.

In some embodiments, a constitutively active PYR/PYL polypeptide is identified in a twohybrid assay between a PYR/PYL polypeptide and a PP2C polypeptide, wherein the

PYR/PYL polypeptide and the PP2C bind in the absence of ABA. A wild-type PYR/PYL polypeptide, which does not bind PP2C in the absence of ABA, can be used as a control.

In another exemplary assay, the level of basal activity of a mutated PYR/PYL receptor polypeptide (i.e., level of activity in the absence of ABA) can be determined using an enzymatic phosphatase assay, in which the PYR/PYL receptor and PP2C are 35 incubated in the absence of ABA. In this type of assay, a decrease in phosphatase activity in the absence of ABA is indicative of an activated (constitutively active) PYR/PYL receptor. A decrease in phosphatase activity can be determined and quantified using any détection reagent known in the art, e.g., a colorimétrie détection reagent such as para-nitrophenylphosphate.

Constitutively active PYR/PYL receptor polypeptides that are initially identified by any of the foregoing screening methods can be further tested to validate the apparent activity and/or détermine other biological effects of the constitutively active PYR/PYL receptor polypeptide. In some cases, the PYR/PYL receptor polypeptide is tested for the ability to affect plant stress (e.g., drought tolérance and/or high sait tolérance), seed germination, or another phenotype affected by ABA. A number of such assays and phenotypes are known in the art and can be employed according to the methods of the invention.

Recombinant Expression Vectors

Once a polynucleotide encoding a mutated PYR/PYL receptor polypeptide is obtained, it can also be used to préparé an expression cassette for expressing the mutated PYR/PYL receptor polypeptide in a transgenic plant, directed by a heterologous promoter. Increased expression of mutated PYR/PYL polynucleotide is useful, for example, to produce plants that selectively activate PYR/PYL receptors, thus enhancing stress tolérance.

Any of a number of means well known in the art can be used to drive mutated PYR/PYL activity or expression in plants. Any organ can be targeted, such as shoot végétative organs/structures (e.g. leaves, stems and tubers), roots, flowers and floral organs/structures (e.g. bracts, sepals, petals, stamens, carpels, anthers and ovules), seed (including embryo, endosperm, and seed coat) and fruit. Altematively, the mutated PYR/PYL polynucleotide can be expressed specifically in certain cell and/or tissue types within one or more organs (e.g., guard cells in leaves using a guard cell-specific promoter). Altematively, the mutated PYR/PYL polynucleotide can be expressed constitutively (e.g., using the CaMV 35S promoter).

To use a polynucleotide sequence for a mutated PYR/PYL receptor polypeptide in the above techniques, recombinant DNA vectors suitable for transformation of plant cells are prepared. Techniques for transforming a wide variety of higher plant species are well known and described in the technical and scientific literature. See, e.g., Weising et al. Ann. Rev. Genet. 22:421-477 (1988). A DNA sequence coding for the mutated PYR/PYL receptor polypeptide preferably will be combined with transcriptional and translational initiation regulatory sequences which will direct the transcription of the sequence from the gene in the intended tissues of the transformed plant.

For example, a plant promoter fragment may be employed to direct expression of the mutated PYR/PYL polynucleotide in all tissues of a regenerated plant. Such promoters are referred to herein as constitutive promoters and are active under most envîronmental conditions and states of development or cell différentiation. Examples of constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcription initiation région, the T- or 2’- promoter derived from T-DNA of Agrobacterium tumafaclens, and other transcription initiation régions from various plant genes known to those of skill.

Alternatively, the plant promoter may direct expression of the mutated PYR/PYL receptor protein in a spécifie tissue (tissue-specific promoters) or may be otherwise under more précisé envîronmental control (inducible promoters). Examples of tissuespecific promoters under developmental control include promoters that înitîate transcription only in certain tissues, such as leaves or guard cells (including but not limited to those described in WO 2005/085449; U.S. Patent No. 6,653,535; Lî et al., Sel China C Life Soi. 2005 Apr;48(2): 181 -6; Husebye, étal., Plant Physiol, April 2002, Vol. 128, pp. 1180-1188; and Plesch, étal., Gene, Volume 249, Number 1,16 May 2000, pp. 83-89(7)). Examples of envîronmental conditions that may affect transcription by inducible promoters include anaérobie conditions, elevated température, or the presence of light.

If proper protein expression is desired, a polyadenylation région at the 3'-end of the coding région should be included. The polyadenylation région can be derived from a naturally occurring PYR/PYL gene, from a variety of other plant genes, or from T-DNA.

The vector comprising the sequences (e.g., promoters or PYR/PYL coding régions) will typically comprise a marker gene that confers a selectable phenotype on plant cells. For example, the marker may encode biocide résistance, particularly antibiotic résistance, such as résistance to kanamycin, G418, bleomycin, hygromycin, or herbicide résistance, such as résistance to chlorosluforon or Basta.

In some embodiments, the mutated PYR/PYL nucleic acid sequence is expressed recombinantly in plant cells. A variety of different expression constructs, such as expression cassettes and vectors suitable for transformation of plant cells, can be prepared. Techniques for transforming a wide variety of higher plant species are well known and described in the technical and scientific literature. See, e.g., Weising et al. Ann. Rev. Genet. 22:421-477 (1988). A DNA sequence coding for a PYR/PYL protein can be combined with c/s-acting (promoter) and trans-acting (enhancer) transcriptional regulatory sequences to direct the timing, tissue type and levels of transcription in the intended tissues of the transformed plant. Translational control éléments can also be used.

Embodiments of the présent invention also provide for a mutated PYR/PYL nucleic acid operably linked to a promoter which, in some embodiments, is capable of driving the transcription of the PYR/PYL coding sequence in plants. The promoter can be, e.g., derived from plant or viral sources. The promoter can be, e.g., constitutively active, inducible, or tissue spécifie. In construction of recombinant expression cassettes, vectors, transgenics, of the invention, a different promoters can be chosen and employed to differentially direct gene expression, e.g., in some or ail tissues of a plant or animal.

Constitutive promoters

A fragment can be employed to direct expression of a mutated PYR/PYL nucleic acid in ail transformed cells or tissues, e.g., as those of a regenerated plant. The term constitutive regulatory element means a regulatory element that confers a level of expression upon an operatively linked nucleic molécule that is relatively independent of the cell or tissue type in which the constitutive regulatory element is expressed. A constitutive regulatory element that is expressed in a plant generally is widely expressed in a large number of cell and tissue types. Promoters that drive expression continuously under physiological conditions are referred to as constitutive promoters and are active under most environmental conditions and states of development or cell différentiation.

A variety of constitutive regulatory éléments useful for ectopic expression in a transgenîc plant are well known in the art. The cauliflower mosaic virus 35S (CaMV 35S) promoter, for example, is a well-characterized constitutive regulatory element that produces a high level of expression in ail plant tissues (Odell et al., Nature 313:810-812 (1985)). The CaMV 35S promoter can be particularly useful due to its activity in numerous diverse plant species (Benfey and Chua, Science 250:959-966 (1990); Futtererefa/., Physiol. Plant 79:154 (1990); Odell et a/., supra, 1985). A tandem 35S promoter, in which the intrinsic promoter element has been duplicated, confers higher expression levels in comparison to the unmodified 35S promoter (Kay et al., Science 236:1299 (1987)). Other useful constitutive regulatory éléments include, for example, the cauliflower mosaic virus 19S promoter; the Figwort mosaic virus promoter; and the nopaline synthase (nos) gene promoter (Singer et al., Plant Mol. Biol. 14:433 (1990); An, Plant Physiol. 81:86 (1986)).

Additional constitutive regulatory éléments including those for efficient expression in monocots also are known in the art, for example, the pEmu promoter and promoters based on the rice Actin-1 5' région (Last et al., Theor. Appl. Genet. 81:581 (1991); Mcelroy étal., Mol. Gen. Genet. 231:150(1991); Mcelroy étal., Plant Cell 2:163 (1990)).

Chimeric regulatory éléments, which combine éléments from different genes, also can be useful for ectopically expressing a nucleic acid molécule encoding a mutated PYR/PYL receptor protein (Cornai et al., Plant Mol. Biol. 15:373 (1990)).

Other examples of constitutive promoters include the 1'- or 2 - promoter derived from T-DNA of Agrobacterium tumafaciens (see, e.g., Mengiste (1997) supra·, O'Grady (1995) Plant Mol. Biol. 29:99-108): actin promoters, such as the Arabidopsis actin gene promoter (see, e.g., Huang (1997) Plant Mol. Biol. 1997 33:125-139); alcohol dehydrogenase (Adh) gene promoters (see, e.g., Millar (1996) Plant Mol. Biol. 31:897-904); ACTH from Arabidopsis (Huang étal. Plant Mol. Biol. 33:125-139 (1996)), Cat3from Arabidopsis(GenBank No. U43147, Zhong étal., Mol. Gen. Genet. 251:196203 (1996)), the gene encoding stearoyl-acyl carrier protein desaturase from Brassica napus (Genbank No. X74782, Solocombe étal. Plant Physiol. 104:1167-1176 (1994)), GPc1 from maize (GenBank No. X15596, Martinez étal. J. Mol. Biol 208:551-565 (1989)), Gpc2 from maize (GenBank No. U45855, Manjunath étal., Plant Mol. Biol. 33:97-112 (1997)), other transcription initiation régions from various plant genes known to those of skill. See also Holtorf Plant Mol. Biol. 29:637-646 (1995).

Inducible promoters

Alternative^, a plant promoter may direct expression of the mutated PYR/PYL polynucleotide under the influence of changing environmental conditions or developmental conditions. Examples of environmental conditions that may effect transcription by inducible promoters include anaérobie conditions, elevated température, drought, or the presence of light. Such promoters are referred to herein as inducible promoters. In some embodiments, an inducible promoter is one that is induced by one or more environmental stressors, încluding but not limited to, drought, freezing cold, and high sait. For example, the invention can incorporate a drought-specific promoter such as a drought-inducible promoter of maize (e.g., the maize rab17 drought-inducible promoter(Vilardell et al. (1991) Plant Mol. Biol. 17:985-993; Vilardell étal. (1994) Plant Mol. Biol. 24:561-569)); or alternative^ a cold, drought, and high sait inducible promoter from potato (Kirch (1997) Plant Mol. Biol. 33:897-909) or from Arabidopsis (e.g., the rd29A promoter (Kasuga étal. (1999) Nature Biotechnology 17:287-291). Other environmental stress-inducible promoters include promoters from the following genes: Rab21, Wsi18, Lea3, Uge1, Dip1, and R1G1B in rice (Yi et al. (2010) Planta 232:743754).

In some embodiments, a plant promoter is a stress-inducible promoter (e.g., a drought-, cold-, or salt-inducible promoter) that comprises a dehydration-responsive element (DRE) and/or an ABA-responsive element (ABRE), including but not limited to the rd29A promoter.

Alternatively, plant promoters which are inducible upon exposure to plant hormones, such as auxins, are used to express the mutated PYR/PYL polynucleotide. For example, the invention can use the auxin-response éléments E1 promoter fragment (AuxREs) in the soybean (Glycine max L.) (Liu (1997) Plant Physiol. 115:397-407); the auxin-responsive Arabidopsis GST6 promoter (also responsive to salicylic acid and hydrogen peroxide) (Chen (1996) Plant J. 10: 955-966); the auxin-inducible parC promoter from tobacco (Sakai (1996) 37:906-913); a plant biotin response element (Streit (1997) Mol. Plant Microbe Interact. 10:933-937); and, the promoter responsive to the stress hormone abscisic acid (Sheen (1996) Science 274:1900-1902).

Plant promoters inducible upon exposure to chemicals reagents that may be applied to the plant, such as herbicides or antibiotics, are also useful for expressing the mutated PYR/PYL polynucleotide. For example, the maîze ln2-2 promoter, activated by benzenesulfonamide herbicide safeners, can be used (De Veylder (1997) Plant Cell Physiol. 38:568-577); application of different herbicide safeners induces distinct gene expression patterns, including expression in the root, hydathodes, and the shoot apical meristem. A PYR/PYL coding sequence can also be under the control of, e.g., a tetracycline-inducible promoter, e.g., as described with transgenic tobacco plants containing the Avena sativa L. (oat) arginine decarboxylase gene (Masgrau (1997) Plant J. 11:465-473); or, a salicylic acid-responsive element (Stange (1997) Plant J. 11:1315-1324; Uknes étal., Plant Cell 5:159-169 (1993); Bi et al., Plant J. 8:235-245 (1995)).

Examples of useful inducible regulatory éléments include copper-inducible regulatory éléments (Mett et al., Proc. Natl. Acad. Sci. USA 90:4567-4571 (1993); Furst étal., Cell55:705-717 (1988)); tétracycline and chlor-tetracycline-inducible regulatory éléments (Gatz et al., Plant J. 2:397-404 (1992); Roder et al., Mol. Gen. Genet. 243:3238 (1994); Gatz, Meth. Cell Biol. 50:411-424 (1995)); ecdysone inducible regulatory éléments (Christopherson étal., Proc. Natl. Acad. Sci. USA 89:6314-6318 (1992); Kreutzweiser étal., Ecotoxicol. Environ. Safety28:14-24(1994)); heat shockinducible regulatory éléments (Takahashi et al., Plant Physiol. 99:383-390 (1992); Yabe et al., Plant Cell Physiol. 35:1207-1219 (1994); Ueda étal., Mol. Gen. Genet. 250:533-539 (1996)); and lac operon éléments, which are used in combination with a constitutively expressed lac repressor to confer, for example, IPTG-inducible expression (Wilde étal., EMBO J. 11:1251-1259 (1992)). An inducible regulatory element useful in the transgenic plants of the invention also can be, for example, a nitrate-inducible promoter derived from the spinach nitrite reductase gene (Back et al., Plant Mol. Biol. 17:9 (1991 )) or a light-inducible promoter, such as that associated with the small subunit of RuBP carboxylase or the LHCP gene families (Feînbaum et al., Mol. Gen. Genet. 226:449 (1991); Lam and Chua, Science 248:471 (1990)).

Tissue-specific promoters

Alternative^, the plant promoter may direct expression of the mutated PYR/PYL polynucleotide in a spécifie tîssue (tissue-specific promoters). Tissue spécifie promoters are transcriptional control éléments that are only active in particular cells or tissues at spécifie times during plant development, such as in végétative tissues or reproductive tissues.

Examples of tissue-specific promoters under developmental control include promoters that initiate transcription only (or primarily only) in certain tissues, such as végétative tissues, e.g., roots or leaves, or reproductive tissues, such as fruit, ovules, seeds, pollen, pistols, flowers, or any embryonic tissue, or epidermis or mesophyll. Reproductive tissue-specific promoters may be, e.g., ovule-specific, embryo-specific, endosperm-specific, integument-specific, seed and seed coat-specific, pollen-specific, petal-specific, sepal-specific, or some combination thereof. ln some embodiments, the promoter is cell-type spécifie, e.g., guard cell-specific.

Epidermal-specific promoters include, for example, the Arabidopsis LTP1 promoter (Thoma étal. (1994) Plant Physiol. 105(1):35-45), the CER1 promoter (Aarts étal. (1995) Plant Cell 7:2115-27), and the CER6 promoter (Hooker et al. (2002) Plant Physiol 129:1568-80), and the orthologous tomato LeCER6 (Vogg et al. (2004) J. Exp Bot. 55:1401-10).

Guard cell-specific promoters include, for example, the DGP1 promoter (Li et al. (2005) Science China CLife Sci. 48:181-186).

Other tissue-specific promoters include seed promoters. Suitable seed-specific promoters are derived from the following genes: MAC1 from maize (Sheridan (1996) Genetics 142:1009-1020); Cat3 from maize (GenBank No. L05934, Abler (1993) Plant Mol. Biol. 22:10131-1038); vivparous-1 from Arabidopsis (Genbank No. U93215); atmycl from Arabidopsis (Urao (1996) Plant Mol. Biol. 32:571-57; Conceicao (1994) Plant 5:493505); napA from Brasslca napus (GenBank No. J02798, Josefsson (1987) JBL 26:12196-1301); and the napin gene family from Brassica napus (Sjodahl (1995) Planta 197:264-271).

A variety of promoters specifically active in végétative tissues, such as leaves, stems, roots and tubers, can also be used to express polynucleotides encoding mutated PYR/PYL receptor polypeptides. For example, promoters controlling patatin, the major storage protein of the potato tuber, can be used, see, e.g., Kim (1994) Plant Mol. Biol. 26:603-615; Martin (1997) Plant J. 11:53-62. The ORF13 promoter from Agrobacterium rhizogenes that exhibits high activity in roots can also be used (Hansen (1997) Mol. Gen. Genet. 254:337-343. Other useful végétative tissue-specific promoters include: the tarin promoter of the gene encoding a globulin from a major taro (Colocasia esculenta L. Schott) corm protein family, tarin (Bezerra (1995) Plant Mol. Biol. 28:137-144); the curculin promoter active during taro corm development (de Castro (1992) Plant Cell 4:1549-1559) and the promoter for the tobacco root-specific gene TobRB7, whose expression is localized to root meristem and immature central cylinder régions (Yamamoto (1991) Plant Cell 3:371 -382).

Leaf-specific promoters, such as the ribulose biphosphate carboxylase (RBCS) promoters, can also be used. For example, the tomato RBCS1, RBCS2 and RBCS3A genes are expressed in leaves and light-grown seedlings, only RBCS1 and RBCS2 are expressed in developing tomato fruits (Meier (1997) FEBS Lett. 415:91-95). A ribulose bisphosphate carboxylase promoters expressed almost exclusively in mesophyll cells in leaf blades and leaf sheaths at high levels, described by Matsuoka (1994) Plant J. 6:311-319, can be used. Another leaf-specific promoter is the light harvesting chlorophyll a/b binding protein gene promoter, see, e.g., Shiina (1997) Plant Physiol. 115:477-483; Casai (1998) Plant Physiol. 116:1533-1538. The Arabidopsis thaliana myb-related gene promoter (AtmybS) described by Li (1996) FEBS Lett. 379:117-121, is leaf-specific. The Atmyb5 promoter is expressed in developing leaf trîchomes, stipules, and epidermal cells on the margins of young rosette and cauline leaves, and in immature seeds. AtmybS mRNA appears between fertilization and the 16 cell stage of embryo development and persists beyond the heart stage. A leaf promoter identified in maize by Busk (1997) Plant J. 11:1285-1295, can also be used.

Another class of useful végétative tissue-specific promoters are meristematic (root tip and shoot apex) promoters. For example, the SHOOTMERISTEMLESS and SCARECROW promoters, which are active in the developing shoot or root apical meristems, described by Di Laurenzio (1996) Ce//86:423-433; and, Long (1996) Nature 379:66-69; can be used. Another useful promoter is that which controls the expression of 3-hydroxy-3- methylglutaryl coenzyme A reductase HMG2 gene, whose expression is restricted to meristematic and floral (secretory zone of the stigma, mature pollen grains, gynoecium vascular tissue, and fertilized ovules) tissues (see, e.g., Enjuto (1995) Plant Cell. 7:517-527). Also useful are kn1-related genes from maize and other species which show meristem-specific expression, see, e.g., Granger (1996) Plant Mol. Biol. 31:373-378; Kerstetter (1994) Plant Ce//6; 1877-1887; Hake (1995) Philos. Trans. R.

Soc. Lond. B. Biol. Sci. 350:45-51. For example, the Arabidopsis thaliana KNAT1 promoter (see, e.g., Lincoln (1994) Plant Ce//6:1859-1876).

One of skill will recognize that a tissue-specific promoter may drive expression of operably linked sequences in tissues other than the target tissue. Thus, as used herein a 5 tissue-specific promoter is one that drives expression preferentially in the target tissue, but may also lead to some expression in other tissues as well.

In another embodiment, the mutated PYR/PYL polynucleotide is expressed through a transposable element. This allows for constitutive, yet periodic and infrequent expression of the constitutively active polypeptide. The invention also provides for use of tissue-specific promoters derived from viruses including, e.g., the tobamovirus subgenomic promoter (Kumagai (1995) Proc. Natl. Acad. Sci. USA 92:1679-1683; the rice tungro bacilliform virus (RTBV), which replicates only in phloem cells in infected rice plants, with its promoter which drives strong phloem-specific reporter gene expression; the cassava vein mosaic virus (CVMV) promoter, with highest activity in vascular éléments, in leaf mesophyll cells, and in root tips (Verdaguer (1996) Plant Mol. Biol. 31:1129-1139).

Production of Transgenic Plants

In another aspect, the présent invention provides for transgenic plants comprising recombinant expression cassettes for expressing a constitutively active PYR/PYL receptor protein as described herein in a plant. In some embodiments, a transgenic plant is generated that contains a complété or partial sequence of a polynucleotide that is derived from a species other than the species of the transgenic plant. It should be recognized that transgenic plants encompass the plant or plant cell in which the expression cassette is introduced as well as progeny of such plants or plant cells that contain the expression cassette, including the progeny that hâve the expression cassette stably integrated in a chromosome.

A recombinant expression vector comprising a PYR/PYL coding sequence driven by a heterologous promoter may be introduced into the genome of the desired plant host by a variety of conventional techniques. For example, the DNA construct may be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the DNA construct can be introduced directly to plant tissue using ballistic methods, such as DNA particle bombardment. Alternatively, the DNA construct may be combined with suitable T-DNA flanking régions and introduced into a conventional Agrobacterium tumefaciens host vector. The virulence fonctions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is 39 infected by the bacteria. While transient expression of the constitutively active PYR/PYL receptor is encompassed by the invention, generally expression of construction of the invention will be from insertion of expression cassettes into the plant genome, e.g., such that at least some plant offspring also contain the integrated expression cassette.

Microinjection techniques are also useful for this purpose. These techniques are well known in the art and thoroughly described in the literature. The introduction of DNA constructs using polyethylene glycol précipitation is described in Paszkowski et al. EMBO J. 3:2717-2722 (1984). Electroporation techniques are described in Fromm et al. Proc. Natl. Acad. Sel. USA 82:5824 (1985). Ballistic transformation techniques are described in Klein et al. Nature 327:70-73 (1987).

Agrobacterium tumefaciens-mediated transformation techniques, including disarming and use of binary vectors, are well described in the scientific literature. See, for example, Horsch et al. Science 233:496-498 (1984), and Fraley et al. Proc. Natl. Acad. Sci. USA 80:4803 (1983).

Transformed plant cells derived by any of the above transformation techniques can be cultured to regenerate a whole plant that possesses the transformed génotype and thus the desired phenotype such as enhanced abiotic stress résistance. Such régénération techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker which has been introduced together with the desired nucléotide sequences. Plant régénération from cultured protoplasts is described in Evans étal., Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, pp. 124-176, MacMillilan Publishing Company, New York, 1983; and Binding, Régénération of Plants, Plant Protoplasts, pp. 21-73, CRC Press, Boca Raton, 1985. Régénération can also be obtained from plant cailus, expiants, organs, or parts thereof. Such régénération techniques are described generally in Klee et al. Ann. Rev. of Plant Phys. 38:467-486 (1987).

One of skill will recognize that after the expression cassette is stably incorporated in transgenic plants and confirmed to be opérable, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.

The expression cassettes of the invention can be used to confer abiotic stress résistance on essentially any plant. Thus, the invention has use over a broad range of plants, including species from the généra Asparagus, Atropa, Avena, Brassica, Citrus, Citrullus, Capsicum, Cucumis, Cucurbita, Daucus, Fragaria, Glycine, Gossypium, Helianthus, Heterocallis, Hordeum, Hyoscyamus, Lactuca, Linum, Lolium, Lycopersicon, Malus, Manihot, Majorana, Medicago, Nicotiana, Oryza, Panieum, Pannesetum, Persea, 40

Pisum, Pyrus, Prunus, Raphanus, Secale, Senecio, Sinapis, Solanum, Sorghum, Trigonella, Triticum, Vitis, Vigna, and, Zea. In some embodiments, the plant is selected from the group consisting of rice, maize, wheat, soybeans, cotton, canola, turfgrass, and alfalfa. In some embodiments, the plant is an ornamental plant. In some embodiment, the plant is a vegetable- or fruit-producing plant.

Those of skill will recognize that a number of plant species can be used as models to predict the phenotypic effects of transgene expression in other plants. For example, it is well recognized that both tobacco (Nicotiana) and Arabîdopsîs plants are useful models of transgene expression, particularly in other dicots.

In some embodiments, the plants of the invention hâve enhanced ABA-mediated phenotypes, for example enhanced seed dormancy, as compared to plants that are otherwise identical except for expression of the constitutively active PYR/PYL receptor polypeptide. Those of skill in the art will recognize that ABA is a well-studied plant hormone and that ABA médiates many changes in characteristics, any of which can be monitored to détermine changes in phenotype. In some embodiments, an enhanced ABA-mediated phenotype is manifested by altered timing of seed germination or altered stress (e.g., drought, freezing cold, and/or sait) tolérance.

Abiotic stress résistance can assayed according to any of a number of well-known techniques. For example, for drought tolérance, plants can be grown under conditions in which less than optimum water is provided to the plant. Drought résistance can be determined by any of a number of standard measures including turgor pressure, growth, yield, and the like. In some embodiments, a transgenic plant expressing a mutated PYR/PYL receptor as described herein has enhanced drought tolérance if the loss of turgor in the transgenic plant is reduced by at least about 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more as compared to a non-transgenic control plant over a defined period of time (e.g., over the course of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more, e.g., 3, 4, 5 weeks or more).

In some embodiments, the enhanced ABA-mediated phenotype is enhanced tolérance to moderate or high salinity. Salinity tolérance can be determined by any of a number of standard measures, including germination, growth, yield, or plant survival, leaf injury, prématuré loss of chlorophyll, and the like. In some embodiments, transgenic plants expressing a mutated PYR/PYL receptor as described herein hâve enhanced sait tolérance if the survival of the transgenic plants under moderate-salt or high-salt conditions (e.g., about 50 mM, 100 mM, 150 mM, 200 mM, 250 mM, 300 mM NaCI or higher) is increased by at least about 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more as compared to a non-transgenic control plant over a defined period of time (e.g., over the course of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more, e.g., 3, 4, 5 weeks or more).

EXAMPLES

The following examples are offered to illustrate, but not to limit the claimed invention.

Example 1: Saturation mutagenesis of PYR1 identifies activating mutations that increase PYR1-PP2C interactions

To define sites that can be mutated to improve interactions between PYR/PYL receptors and PP2Cs, we conducted saturation mutagenesis on 39 residues in PYR1 that normally contact ABA (i.e., are within the ligand-binding pocket of PYR1 ) and/or PP2Cs (i.e., are within the PP2C binding interface). Ail 741 single-mutant variants possible at these functionally critîcal locations were constructed and then assayed for PP2C interactions using a yeast two-hybrid based assay. Saturation mutagenesis is a method that involves the construction of ail possible amino acid variants at a given site (i.e., the génération of ail 19 substitution mutants per site). We focused mutagenesis efforts on PYR1 because it is a well-characterized member of the PYR/PYL receptor family and has extensive structural data on which to guide mutagenesis studies, although it should be noted that the sites targeted display high sequence conservation among the PYR/PYL receptors (Figure 1 ). Moreover, PYR1 is well suited for functional studies because its low basal activity allows its activation status to be studied using a yeast-based two-hybrid assay in which wild-type PYR1 will only bind to the PP2C HAB1 (or other PP2Cs) when the appropriate yeast cells are grown in the presence of ABA. Thus, this assay allows mutations that activate PYR1 to be identified as those that stimulate reporter gene expression in the absence of added ABA.

Sites selected for our mutagenesis study were guided by crystallographic data for ABA-bound PYR1 and an ABA-PYR-HAB1 ternary complex (Santiago et al., 2009; Nishimura et al., 2009; Dupeux et al., 2011 ). Residues within 5A of ABA or PP2C were targeted for mutagenesis, with the exception of R116, which forms an architecturally important sait bridge (Santiago et al., 2009; Nishimura étal., 2009). In total, 39 target sites were selected for mutagenesis and ultimately a total of 741 PYR1 mutants were generated by site-directed mutagenesis.

Mutants were created using the QuikChange® site-directed mutagenesis kit (Stratagene) using primers that contain random nucléotides (i.e., NNN) at the target position. In addition, each reaction contained a small amount of M and W codon primers to enrich the frequency of rare codons. Site-directed mutagenesis reactions were conducted on pBD GAL4-PYR1 template (Park étal., 2009), digested with Dpnl, and transformed into competent Escherichia coli DH5a cells. Plasmid DNA for 96 colonies per site was isolated using Bioneer AccuPrep® Plasmid Mini Extraction Kit (Alameda, CA) and sequenced to identify mutants; this typically identified about 13 of the 19 desired 5 mutations per target site. The remaining mutations at each site were constructed with spécifie mutagenic primers. This process was conducted for ail 39 target sites to yield a set of 741 sequence-validated mutant PYR1 clones. The vector template used, pBDGAL4-PYR1, expresses a GAL4 DNA binding domain (BD) - PYR1 fusion protein when transformed into suitable yeast strains. Mutants were also created using the

QuikChange lightning multi-site directed mutagenesis kit (Agilent Technologies, USA), as described in Example 5.

To interrogate the effects of mutations on PP2C interactions, the mutant clones were indîvidually transformed into S. cerevisiae strain Y190 containing pACT-HAB1 (Park et al., 2009), which expresses a GAL4 activation domain - HAB1 fusion protein.

Yeast transformants were selected for the presence of plasmids on sélective SD agar plates lacking Leu and Trp and examined for PP2C interactions by using X-Gal staining to monitor β-gal reporter gene expression levels. 29 of the 741 mutants, located in 10 different residues, increased PYR1-HAB1 interaction in the absence of added ABA (Table 1 and Figure 2). By increasing PYR-PP2C binding, the identified mutants are expected to increase basal receptor activity. As a control for this expectation and to explore the efficacy of our mutant set, the coding sequences for 8 PYR1 mutants (H60P, V83F, I84Q, A89W, M158I, F159V, T162F, and K170W) were cloned as 6X His (SEQ ID NO:173) fusion proteins in the vector pET-28a, expressed in E. coli, and purified using previously described methods (Park et al., 2009), and then tested for their effects on

HAB1 phosphatase activity at different PYR1 :PP2C stoichiometry.

Recombinant receptor proteins were produced as follows: Coding sequences were cloned into pET28 yielding 6xHIS (SEQ ID NO:173) fusions proteins and transformed into E. coli expression strain BL21. To préparé recombinant protein, 1 ml of an overnight culture was inoculated to 50 ml TB (1.2% peptone, 2.4% yeast extract, 72 mM K2HPO4, 30 17 mM KH2PO4, and 0.4% glycerol I) and was grown for additional 2 hours at 30°C with shaking. Protein expression was induced by addition of IPTG to 1mM. Cells were harvested 6 hr later by centrifugation for 15 min at 5000 x g and the pellet was resuspended in 5 ml of the Buffer A (50 mM NaH2PO4, 300 mM NaCl) containing 10 mM imidazole, pH 8.0). Cells were stored at -80°C before purification. After thawing, cells were sonicated on ice five times for 30 sec with 30 sec resting intervals. A cleared lysate was obtained after centrifugation at 12,000 x g for 10 min and applied to 1 ml of Ni-NTA column (Qiagen) and washed with 20 column volumes of Buffer A containing 30 mM imidazole. Bound protein was eluted with 10 ml of Buffer A with 250 mM imidazole. The elutate was dialyzed against TBS. The purified recombinant proteins were then used together with recombinant phosphatases in receptor assays. In these assays, receptor activity is indicated by inhibition of phosphatase activity, as inferred from initial reaction velocities for GST-HAB1 mediated hydrolysis of the synthetic phosphatase substrate pNPP. Reactions contained 600 nM GST-HAB1 and either 0, 600, 1200, 2400 or 4800 nM 6xHis-PYR1 or variants in a reaction buffer consisting of 33 mM Tris-OAc, pH 7.9, 66 mM KOAc, 0.1% BSA, 25 mM Mn(OAc)2, 50 mM pNPP. To infer the level of receptor activation with respect to fully activated wild type receptor, control reactions were also conducted using saturating levels of (+)-ABA (10 μΜ), and 600 nM wild type PYR1 and HAB1. Immediately after mixing proteins and substrates, reactions were monitored for hydrolysis of pNPP at A₄₀5 at -10 second intervals over 20 minutes using a Wallac plate reader. Reaction progressions were plotted, initial velocities calculated and converted to spécifie activities using a standard curve for 4-nitrophenol made in the same buffer system volumes / plate reader used for enzymatic reaction measurements. The values shown are expressed as %-control phosphatase activity levels as measured in the absence of receptor protein. The average spécifie activity level of GST-HAB1 utiiized in our experiments was -4000 pmol/min/mg, when assayed on the phosphatase substrate pNPP in the absence of PYR1 or other receptors, as described using the methods above.

As shown in Figure 2, Figure 15 and Figure 17, each of the activating mutants increased basal receptor activity in comparison to wild-type PYR1. These results demonstrate that the PP2C binding reported using the Y2H assay faithfully reflects différences in basal receptor activation status. Thus, our mutagenesis strategy has systematically defined a comprehensive set of mutations that can be used to improve PYR/PYL-PP2C interactions and increase basal receptor activation levels. We note that to date, full CA mutants hâve not been described for any ABA receptor and that PYL6 and PYL10, which hâve high basal activities (Melcher K, étal. (2010); Hao Q, étal. (2011) Mol Cell 42 (5):662-672), are not full CA receptors (See Figure 14 and Figure 17).

Table 1. Mutation sites and strength of activating mutations identified

Residue	Contact Type	Activating Mutations Defined	Strength of Activating Mutations
+++	++	+
P55	LIG
K59	LIG
H60	LIG + PPI	P, G, R, A, W, I, K, V, M	P, G	R, A	w, I, K, V,

Residue	Contact Type	Activating Mutations Defined	Strength of Activating Mutations
+++	++ \|l t	+
					M
F61	LIG + PPI
I62	LIG + PPI
K63	PPI
V81	LIG
V83	LIG	F, L, P	F	L	P
I84	PPI	Q, E, P, H, K	Q	E, P, H	K
S85	PPI
G86	PPI
L87	LIG + PPI	F		F
P88	LIG + PPI
A89	LIG + PPI	W	W
S92	LIG
E94	LIG
F108	LIG
1110	LIG
H115	LIG + PPI
R116	LIG + PPI
L117	LIG + PPI
Y120	LIG
S122	LIG
E141	LIG
P148	PPI
G150	PPI
N151	PPI
D154	PPI
D155	PPI
T156	PPI
M158	PPI	T, C, V. I	T, c	V	I
F159	LIG + PPI	V, A	V		A
A160	LIG
T162	PPI	F	F
V163	LIG + PPI
V164	LIG

Residue	Contact Type	Activating Mutations Defined	Strength of Activating Mutations
+++	++	4*
L166	PPI	Y. F		Y, F
N167	LIG
K170	PPI	W	W

LIG = Ligand-binding pocket residue

II

PPI = PP2C binding interface residue

LIG + PPI = Ligand-binding pocket residue and PP2C binding interface residue

With the exception of mutations at V83, ali of the activating mutations tested in Figure 2 are located in residues that lie at the PYR1-PP2C or PYR1-PYR1 interaction interfaces. Residue V83 is located on the edge of the gâte” loop, and its hydrophobie side chain points into the ABA binding pocket and forrns close contact with ABA in ABAbound receptor structures. We hypothesize that the activating mutation^ at this site may mimic ligand occupancy and consequently stabilize the closed form of the gâte. Another gâte residue, L87, can also be mutated to resuit in receptor activation. Residue M158 is located in the pore that interacts with the PP2C tryptophan lock residue'and is also positioned to directly stabilize PYR/PYL-PP2C interactions.

Example 2: Strong constitutively active receptors can be engineered by combining activating mutations

To establish that the activating mutations can be combined to further enhance receptor activation, we constructed a triple mutant (H60P, V83F, F159V) called PYR1^CA3and a quadruple mutant (H60P, V83F, F159V, M158I) called PYR1^CA4 using the Quickchange Lightening multi-site directed mutagenesis kit (Agilent; USA). The mutant clones were sequence validated and recombinant proteins produced in E. coli and utilized in PP2C assays as described above. As shown in Figure 3, both the triple and quadruple mutants dramatically increased basal PYR1 activity relative to wild-type PYR1. Importantly, the constitutively active (CA) alleles interact with ABU and ABI2, in addition to HAB1, demonstrating that their constitutive activity is not restricted to particular PP2Cs within the groups of ABA-regulated phosphatases. This demonstrates that single activating mutations can be combined to create mutant proteins with enhanced basal activation levels.

Additional quadruple mutants PYR1^CA4B (V83F, M158I, F159V, K170W)and PYR1^CA4C (H60P, A89W, M158I, F159V) were constructed to enhance receptor activation. As shown in Figure 9, Figure 16, and Figure 17, both the PYR1^CA4B and

PYR1^CA4C mutants dramatically increased basal PYR1 activity relative to wild-type PYR1. Thus, combinations of four single activating mutations can be combined to create mutant proteins with enhanced basal activation levels.

Example 3: Activating mutations function in diverse PYR/PYL receptors

As described previously, the sites that can be mutated to activate PYR1 are highly conserved across the PYR/PYL receptor family (Figure 1 ) and it is therefore expected that the activating mutations identified in PYR1 can be used to activate other receptors. To test this hypothesis, mutations homologous to the PYR1 triple or quadruple mutants described in Example 2 were introduced into PYL2 to generate the mutants PYL2^CA3(H65P, V87F, F165V) and PYL2^CA4 (H65P, V87F, M164I, F165V). The mutations were also introduced into PYL9 to create the PYL9^CA4 mutant (V85F, Y160I, F161V) using the Lightening multi-site directed mutagenesis kit. Recombinant proteins were produced as described above in Example 2. As shown in Figure 4, the mutant proteins were highly activated in the absence of ABA in comparison to wild-type PYL2 or PYL9, demonstrating that activating mutations can be transplanted into other receptors in the ABA receptor family. As observed with PYR1 CA alleles, the PYL2 and PYL9 CA alleles are active towards multiple PP2Cs (Figure 4).

Further, mutations homologous to the quadruple mutant CA4C described above were introduced into PYL2 to create the PYL2^CA4C mutant (H65P, A93W, M164I, F165V). The homologous mutations were also introduced into PYL9 to create the PYL9^CA4Cmutant (A91W, Y160I, F161V) as described above. As shown in Figure 16 and Figure 17, the mutant proteins were highly activated in the absence of ABA in comparison to wild-type PYL2 or PYL9. Thus, combining a small number of spécifie partially-activating mutations enables full activation of diverse receptors, despite only 55% and 49% amino acid sequence identity between PYL2 - PYR1 and PYL9 - PYR1 respectively.

Example 4: In planta activation of ABA signaling by constitutively active receptors

The activating mutations identified by our work are expected to increase ABA signaling above basal levels when expressed in plants. Such activation can be quantified in a number of ways, including analyses of ABA-regulated gene expression and characterization of ABA-mediated physiological responses in transgenic plants expressing the constitutively active or control wild-type receptor proteins. We therefore made two sets of transgenic plants expressing wild-type PYL2 or PYL2^CA3 in either the wild-type Columbia background or an aba2-1 mutant background. The aba2 mutant is defective in ABA aldéhyde oxidase, an enzyme necessary for ABA biosynthesis. The aba2 mutant possesses a number of phenotypes that resuit from reduced ABA levels, including wiltiness, increased sensitivity to multiple abiotic stresses, and non-dormant seeds. In addition, its seed germination does not require gibberellin (GA) biosynthesis, unlike the wild-type which requires GA for germination. As a resuit, aba2 mutants are résistant to the effects of GA biosynthesis inhibitors (such as paclobutrazole). If PYL2^CA3effectively activâtes ABA signaling, it should be able to suppress the effects of ABA déplétion in the aba2 mutant and affect ABA regulated gene expression in both the wildtype and aba2 strains.

To create the desired transgenic plants, the coding sequences of PYL2 and

PYL2^CA3 were cloned into a modifïed version of the vector pEGAD to create 35S-driven

GFP-PYL fusion proteins. Prior work has demonstrated that N-terminal

GFP fusion tags do not interfère with PYL receptor function (Park et al., 2009); the virtue of using a GFP tag is that it enables rapid monitoring of fusion protein levels in transgenic plants as well as lines that display transgene silencing. The constructs created were sequence validated and then introduced into Columbia or the aba2-1 mutant using agrobacterium mediated transformation via the floral dip method. For each génotype cjonstructed, approximately 40 primary transgenic plants were identified by glufosinate résistance or GFP expression in T1 seedlings, and single-insertion homozygous lines were then isolated from the progeny of 10 T1 lines; two independent PYL2^CA3 single insertion lines were characterized. Interestingly, we observed that ali of the PYL2^CA3 transgenics obtained in both the wild-type and aba2 backgrounds displayed détectable GFP expression în developing and imbibed seeds, but undetectable expression after germination stages. Our inability to recover PYL2^CA3 transgenics with post-germination expression from a total of greater than 80 lines analyzed suggests that there may hâve been sélection against hïgh-level transgene expression after germination; this was not observed for wild-type PYL2 overexpressing transgenics, suggesting that sélection acted specifically against the pyl2^ca3 allele, possibly indicating toxicity of the

CA3 allele in adult plants when expressed under the constitutive 35S promoter.

To investigate the effects of the PYL2^CA3 allele, we performed a number of physiological assays on wild-type and aba2-1 génotypes. Columbia (Col), 35S::PYL2, and 35S::PYL2^CA3 seed samples were divided into two portions; one portion was stratified on 1/3 MS plates for 6 days at 4°C and the second portion was plated six days later 1/3 MS plates. Both samples were the transferred to room température (23°C) and incubated in darkness. A seed was scored as positive for germination if it possessed a radical at least % the length of the seed. Each experiment was performed in triplicate and each point plotted représente the average of tests conducted using 40 to 70 seeds. As shown in Figure 5 and Figure 11, in the wild-type Columbia background, overexpression of the PYL2^CA3, but not wild-type PYL2, induces a state of hyperdormancy in seeds as indicated by the stratification dépendent germination of

PYL2^CA3 lines. Seed dormancy is induced by ABA and it is well established that mutants with increased ABA sensitivity hâve higher seed dormancy; for example, the enhanced response to aba1 (era1) mutation shows a similar stratification requirement (Cutler et al., 1996). Thus, overexpression of PYL2^CA3 activâtes the ABA-regulated seed dormancy pathway.

To investigate if other ABA responses are affected in the pyi_2^CA3 lines, we profiled the expression levels of several ABA-regulated genes using quantitative RT-PCR (qRTPCR). For these experiments, seeds of Col, 35S::PYL2, and two independent 35S:: p_YL2^CA3 transgenîc lines were imbibed for 32 hours in either water or 5 μΜ ABA at room température under continuous illumination, after which RNA was isolated using Concert™ Plant RNA Reagent and utilized in qRT-PCR reactions using|Primers for the ABA-regulated genes Em6 (At2g40170), LEA (At2g21490), and Rd29b (At5g52300). Biological duplicates with triple technical replicate measurements were conducted and gene expression levels were determined. For qRT-PCR analyses of gene expression, cDNA was generated from 5 pg of total RNA using superscript reverse transcriptase II (Invitrogen), in a reaction mixture containing a oligo-dTïo (SEQ ID NO.174) and ribosomal RNA primer (5'-ACATCTAAGGGCATCACAGAC-3’; SEQ ID NO: 175). Realtime quantitative PCR analysis was performed by AACt method of relative quantification. PCR mixtures contained 2 pl of cDNA, 7.5 pl of 2* Maxima® SYBR grean/Fluorescein qPCR master mix (2x) (Fermentas) and 330 nM of each gene-specific primer in a final volume of 15 pl. The RT-PCRs were done using BioRad CFX96 Real-Time System and BioRad CFX Manager software (BioRad). PCRs were performed under the following conditions: 3 min at 95’C, and 40 cycles of 10 s at 95°C, 10 s at 55®C and 30 s 72°C in 96-well optical reaction plates (BioRad). The specificity of amplicons was verified by melting curve (disassociation) analysis (60-95^oC) after 40 cycles. Input cDNA was normalized using rRNA primers. The following primers were used to detect spécifie gene expression levels: Em6 (At2g40170) TCGAAGCTCAACAGCATCTC (SEQ ID NO:176) and ACTGCTCCTTTCGAGTTTGC (SEQ ID NO;177), LEA (At2g21490)

CGTCGGTCTGGAAGTTCATC (SEQ ID NO: 178) and TCTTCTTCCTCCTCCCTCCT (SEQ ID NO:179), Rd29b (At5g52300) ATCCGAAAACCCATAGTCC (SEQ ID NO: 180) and TGGTGGGGAAAGTTAAAGGA (SEQ ID NO: 181), and rRNA

AAACGGCTACCACATCCAAG (SEQ ID NO: 182) and GACTCGAAAGAGCCCGGTAT (SEQ ID NO: 183). As shown in Figure 6 and Figure 12, two independent ργ|_2^ΟΑ3transgenîc lines display elevated levels of ABA-regulated genes in the absence of ABA treatment. The expression levels of these genes are comparable (Figure 6) or elevated (Figure 12) with respect to the levels observed in wild-type seeds treated with 5 pM ABA. Thus, the pYL2^CA3 allele causes high-level induction of several ABA-regulated genes, consistent with the conclusion that the PYL2^CA3 activâtes ABA signaling in vivo comparable to ABA treatment.

As a further test of the abilîty of PYL2^CA3 to activate ABA signaling in vivo, we examined the ability of this allele to revert phenotypes caused by ABA deficiency, reasoning that effective activation of the ABA pathway should suppress phenotypes observed in the aba2 mutant. Since aba2 mutants hâve greatly reduced ABA levels, the aba2 genetic background provides a stringent test for constitutive activation of signaling, which by définition should be ABA-independent. To test this, we examined the germination of various génotypes on paclobutrazol, an inhibitor of GA biosynthesis.

Wild-type seed germination is blocked by paclobutrazol treatment but aba2 mutants germinate due to defects in ABA-induced seed dormancy. We also examined the germination of various génotypes in the presence of NaCl, which, like paclobutrazole, inhibits seed germination in an ABA- and aba2-dependent manner (Gonzalez-Guzman M. étal. (2002) Plant Cell 14(8):1833-1846; Leon-Kloosterziel KM, etalï (1996) Plant J (4):655-661). Consistent with our observations made in wild-type plants overexpressing PYL2^CA3, the PYL2^CA3 transgene suppressed the paclobutrazol and NaCl résistance observed in the aba2 mutants, while overexpression of wild-type PYL2 was unable to suppress this aba2 phenotype (Figure 7 and Figure 13). Thus, expression of PYL2^CA3 in developing seeds is sufficient to activate an ABA-dependent physiological process despîte the depleted ABA levels présent in the aba2 background. Collectively, our body of data demonstrates that the PYL2^CA3 is a potent activator of ABA responses in transgenic plants and that activating mutations can be used to modulate ABA signaling in vivo.

Example 5: Methods

Site-Saturation Mutagenesis

Mutants were created using one of two methods. About half the mutants were made using the QuikChange site-directed mutagenesis kit (Stratagene, USA) using primers that contain random nucléotides (/.e., NNN) at target position (see Table 2 for a list of all mutagenesis primer sequences used). 20 pL mutagenesis reactions were conducted using pBD GAL4-PYR1 template (Park et al. (2009) Science 324 (5930):1068-1071), as per the manufacturers' instructions, containing 10 pmol NNN primer and 0.5 pmol each of M- and W-encoding primers, which were added to enrich the frequency of rare codons. Plasmid DNA for 96 colonies per site was isolated using Bioneer AccuPrep® Plasmid Mini Extraction Kit (Alameda, CA) and sequenced to identify mutants, which identified on average 12 of the 19 desired mutations per target site per 96 clones sequenced. In the second mutagenesis method we made mutations using the QuikChange lightning multi-site directed mutagenesis kit (Aailent

Technologies, USA) using a phosphorylated primer that instead of NNN at the mutagenesis target site contained the sequence NNK, which reduces degeneracy (Kretz KA, et al. (2004) Methods Enzymol 388:3-11 ). Plasmid DNA for 96 colonies per site was isolated using Beckman Multimek 96 robot and Perfectprep Vac kit (5 Prime Inc,,

USA) and sequenced, which identified 14 of the 19 desired mutations per 96 clones sequenced on average. Mutations not identified by sequencing of random clones were constructed with specifically designed mutagenic primers using the QuickChange® lightning multi-site directed mutagenesis kit (Agilent Technologies, USA). This process was conducted for ail 39 target sites to ultimately yieid a set of 741 sequence-validated 10 mutant PYR1 clones.

Table 2. Mutagenesis primers

Primer name	Primer sequence	SE Q ID N O
pyl2A93W	CTCCGGCCTCCCAtggTCAACCAGTACCGAGC	18 4
pyl2A93W+	CTCCGGCCTCCCATGGTCAACCAGTACCGAGC	18 4
pyl2V87F	CAGAGAAGTGACCtttATCTCCGGCCTCCC	18 5
pyl2V87F+	CAGAGAAGTGACCTTTATCTCCGGCCTCCC	18 5
PYR1R116#	CATCGGAGGCGAACATnnkCTGACGAATTACAAATCC g	18 6
PYR1R116E	CATCGGAGGCGAACATGAGCTGACGAATTACAAATC Cg	18 7
PYR1R116E	CATCGGAGGCGAACATGAGCTGACGAATTACAAATC Cg	18 7
PYR1R116H	CATCGGAGGCGAACATCATCTGACGAATTACAAATCC g I	18 8
PYR1R116H	CATCGGAGGCGAACATCATCTGACGAATTACAAATCC g	18 8
PYR1R116I	CATCGGAGGCGAACATATTCTGACGAATTACAAATCC g	18 9

Primer name	Primer sequence	SE Q ID N 0
PYR1R116I	CATCGGAGGCGAACATATTCTGACGAATTACAAATCC 9	18 9
PYR1R116T	CATCGGAGGCGAACATACCCTGACGAATTACAAATCC g	19 0
PYR1R116T	CATCGGAGGCGAACATACCCTGACGAATTACAAATCC g	19 0
PYR1R116Y	CATCGGAGGCGAACATTATCTGACGAATTACAAATCC g	19 1
PYR1R116Y	CATCGGAGGCGAACATTATCTGACGAATTACAAATCC g	19 1
PYL2E147K	CACGGTGGTTCTTaAATCTTACACCGTTGATATTCc	19 2
PYL2E147L	CACGGTGGTTCTTTTATCTTACACCGTTGATATTCc	19 3
PYL2E98D	CCTCAACCAGTACCGAtCGGCTTGAGTTCGTC	19 4
pyl2F165V+	GAGGAAGACACTAAAATGGTTGTGGACACTGTCGTC	19 5
pyl2F165V+	GAGGAAGACACTAAAATGGTTGTGGACACTGTCGTC	19 5
py!2H60P+	cCGAACGCTACAAACcCTTTGTAAAAAGGTGCc	19 6
PYL2H65P+	CCGAACGCTACAAACCCTTTGTAAAAAGGTGCC		19 6
PYL2K64L	CAACCCCGAACGCTACTTACACTTTGTAAAAAGC	3TGC	19 7
pyl2m158l.f1 59v+	CAGAGGAAGACACTAAAATcGTTGTGGACACTGTCG	19 8
PYL2V85I	GGAAGCGTCAGAGAAatcACCGTAATCTCCGGCC	19 9
PYL9A91W+	TGTTAAATCTGGTCTTCCTTGGACAACATCTACTGAG AG	20 0

Primer name	Primer sequence	SE Q ID N 0
PYL9 A91WV85F+	GCAGTCTTAGAGAAGTCAAI I I IAAATCTGGTCTTCCT TG GACAACATCTACTGAGAG	20 1
PYL9F161V +	GATGAGACTTGCTACGTTGTTGAAGCACTTATCAG	20 2
PYL9V85F+	GTCTTAGAGAAGTCAATTTTAAATCTGGTCTTCCTG	20 3
PYR1A160#	GGATGATACTCGTATGTTTnnkGATACGGTTGTGAAGC	20 4
PYR1A160E	GGATGATACTCGTATGTTTgagGATACGGTTGTGAAG C	20 5
PYR1A160H	GGATGATACTCGTATGTTTcatGATACGGTTGTGAAGC	20 6
PYR1A160K	GGATGATACTCGTATGTTTaaaGATACGGTTGTGAAG C	20 7
PYR1A160N	GGATGATACTCGTATGTTTaatGATACGGTTGTGAAGC	20 8
PYR1A160Q	GGATGATACTCGTATGTTTcaaGATACGGTTGTGAAGC	20 9
PYR1A160T	GGATGATACTCGTATGTTTactGATACGGTTGTGAAGC	21 0
PYR1A89M+	CATCAGTGGATTACCGATGAACACATCAACGGAAAG	21 1
pyr1a89N+	catcagtggattaccgAACaacacatcaacggaaag	21 2
PYR1A89NN N-	CTTTCCGTTGATGTGTTNNNCGGTAATCCACTGATG	21 3
PYR1A89NN N+	CATCAGTGGATTACCGNNNAACACATCAACGGAAAG	21 4
PYR1A89W +	CATCAGTGGATTACCGTGGAACACATCAACGGAAAG	21 5

Primer name	Primer sequence	SE Q ID N 0
pyr1a89Y+	catcagtggattaccgTACaacacatcaacggaaag	21 6
PYR1D154F	CCGGAAGGTAACTCGGAGTTTGATACTCGTATGjTTTG CTG	21 7
PYR1D154F	CCGGAAGGTAACTCGGAGTTTGATACTCGTATGTTTG CTG	21 7
PYR1D154I	CCGGAAGGTAACTCGGAGATTGATACTCGTATGTTTG CTG	21 8
PYR1D154I	CCGGAAGGTAACTCGGAGATTGATACTCGTATGTTTG CTG	21 8
PYR1D154M	CCGGAAGGTAACTCGGAGATGGATACTCGTATGTTT GCTG	21 9
PYR1D154M	CCGGAAGGTAACTCGGAGATGGATACTCGTATGTTT GCTG	21 9
PYR1D154Y	CCGGAAGGTAACTCGGAGTATGATACTCGTATGTTTG CTG	22 0
PYR1D155#	GGAAGGTAACTCGGAGGATnnkACTCGTATGTTTGCT GATAC	22 1
PYR1D155E	GGAAGGTAACTCGGAGGATgaaACTCGTATGTTTGCT GATAC	22 2
PYR1D155H	GGAAGGTAACTCGGAGGATcatACTCGTATGTTTGCTG ATAC	22 3
PYR1D155P	GGAAGGTAACTCGGAGGATcctACTCGTATGTTTGCTG ATAC	22 4
PYR1D155T	GGAAGGTAACTCGGAGGATactACTCGTATGTTTGCTG ATAC	22 5
pyr1e141f+	ggacggtggttttgttttcttacgtcgttgatatgc	22 6
pyr1e141g+	ggacggtggttttgggatcttacgtcgttgatatgc	22 7
pyr1e141k+	ggacggtggttttgaaatcttacgtcgttgatatgc	22 8

Primer name	Primer sequence		SE Q ID N 0
pyr1e141L+	ggacggtggttttgttgtcttacgtcgttgatatgc		22 9
PYR1E141M +	GGACGGTGGTTTTGATGTCTTACGTCGTTGATATGC	23 0
PYR1E141N NN-	GCATATCAACGACGTAAGANNNCAAAACCACCGTCC	23 1
PYR1E141N NN+	GGACGGTGGTTTTGNNNTCTTACGTCGTTGATATGC	23 2
pyr1e141s+	ggacggtggttttgtcatcttacgtcgttgatatgc		23 3
PYR1E141W +	GGACGGTGGTTTTGTGGTCTTACGTCGTTGATATGC	23 4
pyr1e94C+	gcgaacacatcaacgTGTagactcgatatactcg		23 5
pyr1e94D+	gcgaacacatcaacggatagactcgatatactcg		23 6
pyr1e94F+	gcga acacatcaa cg ttcag actcg atata ctcg		23 7
pyr1e94l+	gcgaacacatcaacgATAagactcgatatactcg		23 8
PYR1E94M+	GCGAACACATCAACGATGAGACTCGATATACTCG	23 9
PYR1E94NN			24
N-	CGAGTATATCGAGTCTNNNCGTTGATGTGTTCGC	0
PYR1E94NN N+	GCGAACACATCAACGNNNAGACTCGATATACTCG	24 1
pyr1e94R+	gcgaacacatcaacgcgAagactcgatatactcg		24 2
PYR1E94W +	GCGAACACATCAACGTGGAGACTCGATATACTCG	24 3
pyr1 e94Y+	gcgaacacatcaacgTATagactcgatatactcg		24 4

Primer name	Primer sequence	SE Q ID N 0
pyrlfl 08c+	ggagagttaccggatgcagtatcatcggagg		24 5
pyr1f108d+	ggagagttaccggagacagtatcatcggagg		24 6
pyr1f108e+	ggagagttaccggagagagtatcatcggagg		24 7
pyr1f108k+	ggagagttaccggaaagagtatcatcggagg		24 8
PYR1F108M +	GGAGAGTTACCGGAATGAGTATCATCGGAGG		24 9
PYR1F108N NN-	CCTCCGATGATACTNNNTCCGGTAACTCTCC		25 0
PYR1F108N NN+	GGAGAGTTACCGGANNNAGTATCATCGGAGG		25 1
pyr1f108t+	ggagagttaccggaaccagtatcatcggagg		25 2
PYR1F108W +	GGAGAGTTACCGGATGGAGTATCATCGGAGG		25 3
pyr1f159a+	ggatgatactcgtatggctgctgatacggttg		25 4
pyr1f159d+	ggatgatactcgtatggatgctgatacggttg		25 5
pyr1 f 159e+	ggatgatactcgtatggaagctgatacggttg		25 6
pyrlfl 59h+	ggatgatactcgtatgcatgctgatacggttg		25 7
pyr1f159L+	ggatgatactcgtatgttagctgatacggttg		25 8
PYR1F159M +	GGATGATACTCGTATGATGGCTGATACGGTTG		25 9
PYR1F159N NN-	CAACCGTATCAGCNNNCATACGAGTATCATCC		26 0

Primer name	Primer sequence	SE Q ID N 0
PYR1F159N NN+	GGATGATACTCGTATGNNNGCTGATACGGTTG	26 1
pyr1f159t+	g gatg a tactcg tatg actg ctg a ta cgg ttg	26 2
pyr1f159V+	ggatgatactcgtatggttgctgatacggttg	26 3
PYR1F159W +	GGATGATACTCGTATGTGGGCTGATACGGTTG	26 4
pyr1f61d+	gacaaaccacaaacatacaaacacgacatcaaatcctgctccgtcg	26 5
pyr1f61e+	gacaaaccacaaacatacaaacacgagatcaaatcctgctccgtcg	26 6
pyr1f61h+	gacaaaccacaaacatacaaacaccacatcaaatcctgctccgtcg	26 7
PYR1F61M+	GACAAACCACAAACATACAAACACATGATCAAATCCT GCTCCGTCG	26 8
PYR1F61NN	CGACGGAGCAGGATTTGATNNNGTGTTTGTATGTTTG	26
N-	TGGTTTGTC	9
PYR1F61NN	GACAAACCACAAACATACAAACACNNNATCAAATCCT	27
N+	GCTCCGTCG	0
pyr1f61q+	gacaaaccacaaacatacaaacaccaaatcaaatcctgctccgtcg	27 1
pyr1f61s+	gacaaaccacaaacatacaaacactccatcaaatcctgctccgtcg	27 2
PYR1F61W+	GACAAACCACAAACATACAAACACTGGATCAAATCCT GCTCCGTCG	27 3
PYR1G150E	cGTCGTTGATATGCCGGAAGAGAACTCGGAGGATGA TACtc	27 4
PYR1G150F	cGTCGTTGATATGCCGGAATTTAACTCGGAGGATGAT ACtc	27 5
PYR1G150F	cGTCGTTGATATGCCGGAATTTAACTCGGAGGATGAT ACtc	27 5

Primer name	Primer sequence	SE Q ID N 0
PYR1G150I	cGTCGTTGATATGCCGGAAATTAACTCGGAGGATGAT ACtc	27 6
PYR1G150N	cGTCGTTGATATGCCGGAAaatAACTCGGAGGATGATA Ctc	27 7
PYR1G150T	cGTCGTTGATATGCCGGAAACTAACTCGGAGGATGAT ACtc	27 8
PYR1G150Y	cGTCGTTGATATGCCGGAATATAACTCGGAGGATGAT ACtc	27 9
PYR1G86#	GACGTGATCGTCATCAGTnnkTTACCGGCGAACACAT C	28 0
pyr1H115D+	catcggaggcgaagataggctgacgaattac	28 1
pyr1H115e+	catcggaggcgaagagaggctgacgaattac	28 2
pyr1H115i+	catcggaggcgaaattaggctgacgaattac	28 3
PYR1H115M +	CATCGGAGGCGAAATGAGGCTGACGAATTAC	28 4
pyr1H115n+	catcggaggcgaaaataggctgacgaattac	28 5
PYR1H115N NN-	GTAATTCGTCAGCCTNNNTTCGCCTCCGATG	28 6
PYR1H115N NN+	CATCGGAGGCGAANNNAGGCTGACGAATTAC	28 7
PYR1H115 W+	CATCGGAGGCGAATGGAGGCTGACGAATTAC	28 8
pyr1 h60N+	GACAAACCACAAACATACAAAAACTTCATCAAATCCT GCTCCGTCG	28 9
pyr1h60S+	GACAAACCACAAACATACAAATCCTTCATCAAATCCT GCTCCGTCG	29 0
pyr11110E+	gttaccggattcagtGAGatcggaggcgaac	29 ¹

Primer name	Primer sequence	SE Q ID N 0
PYR1I110M +	GTTACCGGATTCAGTATGATCGGAGGCGAAC	29 2
PYR1I110N NN-	GTTCGCCTCCGATNNNACTGAATCCGGTAAC	29 3
PYR1I110N NN+	GTTACCGGATTCAGTNNNATCGGAGGCGAAC	29 4
PYR1I110W +	GTTACCGGATTCAGTTGGATCGGAGGCGAAC	29 5
PYR1162C+	ccacaaacatacaaacacttcTGCaaatcctgctccgtcgaac	29 6
PYR1I62H+	ccacaaacatacaaacacttccATaaatcctgctccgtcgaac	29 7
PYR1I62M+	CCACAAACATACAAACACTTCATGAAATCCTGCTCCG TCGAAC	29 8
PYR1l62n+	ccacaaacatacaaacacttcAACaaatcctgctccgtcgaac	29 9
PYR1I62NN	GTTCGACGGAGCAGGATTTNNNGAAGTGTTTGTATGT	30
N-	TTGTGG	0
PYR1I62NN	CCACAAACATACAAACACTTCNNNAAATCCTGCTCCG	30
N+	TCGAAC	1
PYR1162W+	CCACAAACATACAAACACTTCTGGAAATCCTGCTCCG TCGAAC	30 2
PYR1I62Y+	ccacaaacatacaaaca cttcTAT a aa tcctg ctccgtcga ac	30 3
pyr1I82#	ACGCGCGACGTGnnkGTCATCAGTGGATTACCGg	30 4
PYR1184#	GCGACGTGATCGTCnkkAGTGGATTACCGGCG	30 5
PYR1K170#	GTTGTGAAGCTTAATTTGCAGnnkCTCGCGACGGTTG C	30 6
PYR1K170C	GTTGTGAAGCTTAATTTGCAGtgtCTCGCGACGGTTGC	30 7

Primer name	Primer sequence '	SE Q ID N 0
PYR1K170F	GTTGTGAAGCTTAATTTGCAGtttCTCGCGACGGTTGC	30 8
PYR1K170H	GTTGTGAAGCTTAATTTGCAGcatCTCGCGACGGTTGC	30 9
PYR1K170I	GTTGTGAAGCTTAATTTGCAGataCTCGCGACGGTTGC	31 0
pyr1k170w+	GAAGCTTAATTTGCAGtggCTCGCGACGGTTGCTG	31 1
PYR1K59D+	caaaccacaaacatacGATcacttcatcaaatcctgc	31 2
PYR1K59E+	caaaccacaaacatacGAAcacttcatcaaatcctgc	31 3
PYR1K59L+	caaaccacaaacataccttcacttcatcaaatcctgc	31 4
PYR1K59M+	CAAACCACAAACATACATGCACTTCATCAAATCCTGC	31 5
PYR1K59N+	caaaccacaaaca tac AAT ca cttcatca aatcctg c	31 6
PYR1K59NN N+	CAAACCACAAACATACNNNCACTTCATCAAATCCTGC	31 7
PYR1K59Q+	caaaccacaaacatacCAAcacttcatcaaatcctgc	31 8
PYR1K59W +	CAAACCACAAACATACTGGCACTTCATCAAATCCTGC	31 9
pyr1K63#	CATACAAACACTTCATCnnkTCCTGCTCCGTCG	32 0
pyr1K63A	CATACAAACACTTCATCGCATCCTGCTCCGTCG	32 1
pyr1K63A	CATACAAACACTTCATCGCATCCTGCTCCGTCG	32 1
pyr1K63D	CATACAAACACTTCATCGACTCCTGCTCCGTCG	32 2

Primer name	Primer sequence	SE Q ID N 0
pyr1K63D	CATACAAACACTTCATCGACTCCTGCTCCGTCG	32 2
pyr1K63F	CATACAAACACTTCATCTTTTCCTGCTCCGTCG	32 3
pyr1 K63F	CATACAAACACTTCATCTTTTCCTGCTCCGTCG	32 3
pyr1K63H	CATACAAACACTTCATCCACTCCTGCTCCGTCG	32 4
pyr1K63H	CATACAAACACTTCATCCACTCCTGCTCCGTCG	32 4
pyr 1K63R	CATACAAACACTTCATCAGATCCTGCTCCGTCG	32 5
pyr1 K63R	CATACAAACACTTCATCAGATCCTGCTCCGTCG	32 5
pyr1K63T	CATACAAACACTTCATCACATCCTGCTCCGTCG	32 6
pyr1K63T	CATACAAACACTTCATCACATCCTGCTCCGTCG J	32 6
pyr1L117A+	ggaggcgaacataggGCGacgaattacaaatccg	32 7
pyr1L117D+	ggaggcgaacataggGATacgaattacaaatccg	32 8
pyr1 L117E+	ggaggcgaacataggGAGacgaattacaaatccg	32 9
PYR1L117M +	GGAGGCGAACATAGGATGACGAATTACAAATCCG	33 0
pyr1L117N+	ggaggcgaacataggAACacgaattacaaatccg	33 1
PYR1L117N NN-	CGGATTTGTAATTCGTNNNCCTATGTTCGCCTCC	33 2
PYR1L117N NN+	GGAGGCGAACATAGGNNNACGAATTACAAATCCG	33 3

Primer name	Primer sequence	SE Q ID N 0
PYR1L117W +	GGAGGCGAACATAGGTGGACGAATTACAAATCCG	33 4
PYR1L166#	CTGATACGGTTGTGAAGnnkAATTTGCAGAAACTCGC GACG	33 5
PYR1L166E	CTGATACGGTTGTGAAGgaaAATTTGCAGAAACTCGC GACG	33 6
PYR1L166H	CTGATACGGTTGTGAAGcatAATTTGCAGAAACTCGCG ACG	33 7
PYR1L166P	CTGATACGGTTGTGAAGcctAATTTGCAGAAACTCGCG ACG	33 8
PYR1L166Q	CTGATACGGTTGTGAAGcaaAATTTGCAGAAACTCGC GACG	33 9
PYR1L166Y	CTGATACGGTTGTGAAGtatAATTTGCAGAAACTCGCG ACG	34 0
PYR1L87#	GTGATCGTCATCAGTGGAnnkCCGGCGAACACATCAA C	34 1
PYR1M158D	CGGAGGATGATACTCGTGACTTTGCTGATACGGTTGT GAAGC	34 2
PYR1M158F	CGGAGGATGATACTCGTTTCTTTGCTGATACGGTTGT GAAGC	34 3
PYR1M158H	CGGAGGATGATACTCGTCACTTTGCTGATACGGTTGT GAAGC	34 4
pyr1m158l+	CGGAGGATGATACTCGTattTTTGCTGATACGGTTG	34 5
PYR1M158N	CGGAGGATGATACTCGTAACTTTGCTGATACGGTTGT GAAGC	34 6
PYR1M158Q	CGGAGGATGATACTCGTCAGTTTGCTGATACGGTTGT GAAGC	34 7
PYR1M158Y	CGGAGGATGATACTCGTTATTTTGCTGATACGGTTGT GAAGC	34 8
PYR1N151F	CGTTGATATGCCGGAAGGTTTCTCGGAGGATGATACT Cg	34 9

Primer name	Primer sequence	SE Q ID N 0
PYR1N151F	CGTTGATATGCCGGAAGGTTTCTCGGAGGATGATACT Cg	34 9
PYR1N151H	CGTTGATATGCCGGAAGGTCACTCGGAGGATGATAC TCg	35 0
PYR1N151I	CGTTGATATGCCGGAAGGTATCTCGGAGGATGATAC TCg	35 1
PYR1N151M	CGTTGATATGCCGGAAGGTATGTCGGAGGATGATAC TCg	35 2
PYR1N151V	CGTTGATATGCCGGAAGGTGTCTCGGAGGATGATAC TCg I	35 3
PYR1N151Y	CGTTGATATGCCGGAAGGTTACTCGGAGGATGATAC TCg	35 4
pyr1N167a+	gatacggttgtgaagcttgctttgcagaaactcgcg	35 5
pyr1N167c+	gatacggttgtgaagctttgtttgcagaaactcgcg	35 6
pyr1N167d+	1 gatacggttgtgaagcttgatttgcagaaactcgcg	35 7
pyr1N167e+	gatacggttgtgaagcttgaattgcagaaactcgcg	35 8
pyr1N167g+	gatacggttgtgaagcttggtttgcagaaactcgcg	35 9
PYR1N167M +	GATACGGTTGTGAAGCTTATGTTGCAGAAACTCGCG	36 0
PYR1N167N NN-	CGCGAGTTTCTGCAANNNAAGCTTCACAACCGTATC	36 1
PYR1N167N NN+	GATACGGTTGTGAAGCTTNNNTTGCAGAAACTCGCG	36 2
pyr1N167p+	gatacggttgtgaagcttcctttgcagaaactcgcg	36 3
pyr1N167s	g ata cg g ttg tga ag ctttctttg cag a aactcgcg	36 4

Primer name	Primer sequence	SE Q ID N O
pyr1N167t+	gatacggttgtgaagcttactttgcagaaactcgcg	36 5
PYR1N167 w+	GATACGGTTGTGAAGCTTTGGTTGCAGAAACTCGCG	36 6
	CTTACGTCGTTGATATGnnkGAAGGTAACTCGGAGGA	36
PYR1P148#	TG	7
PYR1P55c+	cgtacGAcgattcgacaaatgtcaaacatacaaacacttcatc	36 8
PYR1P55h+	cgtacGAcgattcgacaaaccacaaacatacaaacacttcatc	36 9
PYR1P55Î+	cgtacGAcgattcgacaaaatacaaacatacaaacacttcatc	37 0
PYR1P55k+	cgtacGAcgattcgacaaaaagcaaacatacaaacacttcatc	37 1
	CGTACGACGATTCGACAAAATGCAAACATACAAACAC	37
PYR1P55M+	TTCATC	2
PYR1P55NN	GATGAAGTGTTTGTATGTTTGNNNTTTGTCGAATCGT	37
N-	CGTACG	3
PYR1P55NN	CGTACGACGATTCGACAAANNNCAAACATACAAACAC	37
N+	TTCATC	4
PYR1P55V+	cg ta cG Acg a ttcg acaaag tacaaacatacaaacacttcatc	37 5
PYR1P55W	CGTACGACGATTCGACAAATGGCAAACATACAAACAC	37
+	TTCATC	6
PYR1P55y+	cgtacGAcgattcgacaaatatcaaacatacaaacacttcatc	37 7
Pyr1p88a+	gtcatcagtggattaGCGgcgaacacatcaacg	37 8
Pyr1p88D+	gtcatcagtggattagatgcgaacacatcaacg	37 9
Pyr1p88g+	gtcatcagtggattaggggcgaacacatcaacg	38 0

Primer name	Primer sequence	SE Q ID N O
Pyr1p88K+	gtcatcagtggattaaaggcgaacacatcaacg	38 1
PYR1P88M+	GTCATCAGTGGATTAATGGCGAACACATCAACG	38 2
PYR1P88NN N-	CGTTGATGTGTTCGCNNNTAATCCACTGATGAC	38 3
PYR1P88NN N+	GTCATCAGTGGATTANNNGCGAACACATCAACG	38 4
PYR1P88W +	GTCATCAGTGGATTATGGGCGAACACATCAACG	38 5
Pyr1 p88y+	gtcatcagtggattaTATgcgaacacatcaacg	38 6
PYR1S122#	GGCTGACGAATTACAAAnnkGTTACGACGGTGCATCG	38 7
PYR1S122E	GGCTGACGAATTACAAAgaaGTTACGACGGTGCATCG	38 8
PYR1S122I	GGCTGACGAATTACAAAatcGTTACGACGGTGCATCG	38 9
PYR1S122K	GGCTGACGAATTACAAAaaaGTTACGACGGTGCATCG	39 0
PYR1S122W	GGCTGACGAATTACAAAtggGTTACGACGGTGCATCG	39 1
PYR1S85#	CGACGTGATCGTCATCnnkGGATTACCGGCGAACAC	39 2
pyr1s92D+	ccggcgaacacagatacggaaagactcg	39 3
pyr1 s92G+	ccggcgaacacaggaacggaaagactcg	39 4
pyr1s92K+	ccggcgaacacaaagacggaaagactcg	39 5
PYR1S92M+	CCGGCGAACACAATGACGGAAAGACTCG	39 6

Primer name	Primer sequence 1	SE Q ID N 0
PYR1S92NN N-	CGAGTCTTTCCGTNNNTGTGTTCGCCGG	39 7
PYR1S92NN N+	CCGGCGAACACANNNACGGAAAGACTCG	39 8
PYR1S92W +	CCGGCGAACACATGGACGGAAAGACTCG	39 9
pyr 1s92y+	ccggcgaacacaTATacggaaagactcg	40 0
PYR1T156#	GAAGGTAACTCGGAGGATGATnnkCGTATGTTTGCTG ATACG	40 1
PYR1T156A	GAAGGTAACTCGGAGGATGATgctCGTATGTTTGCTGA TACG	40 2
PYR1T156H	GAAGGTAACTCGGAGGATGATcatCGTATGTTTGCTGA TACG	40 3
PYR1T156K	GAAGGTAACTCGGAGGATGATaaaCGTATGTTTGCTG ATACG	40 4
PYR1T156N	GAAGGTAACTCGGAGGATGATaatCGTATGTTTGCTGA TACG	40 5
PYR1T156Q	GAAGGTAACTCGGAGGATGATcaaCGTATGTTTGCTG ATACG	40 6
PYR1T156Y	GAAGGTAACTCGGAGGATGATtatCGTATGTTTGCTGA TACG	40 7
PYR1T162#	CTCGTATGTTTGCTGATnnkGTTGTGAAGCTTAATTTG CAGA	40 8
PYR1T162F	CTCGTATGTTTGCTGATtttGTTGTGAAGCTTAATTTGC AGA	40 9
PYR1T162I	CTCGTATGTTTGCTGATattGTTGTGAAGCTTAATTTGC AGA n	41 0
PYR1T162Y	CTCGTATGTTTGCTGATtatGTTGTGAAGCTTAATTTGC AGA	41 1
PYR1V163M	CGTATGTTTGCTGATACGATGGTGAAGCTTAATTTGC	41
+	AGAAACTCGC	2

Primer name	Primer sequence	SE Q ID N 0
PYR1V163N	GCGAGTTTCTGCAAATTAAGCTTCACNNNCGTATCAG	41
NN-	CAAACATACG	3
PYR1V163N	CGTATGTTTGCTGATACGNNNGTGAAGCTTAATTTGC	41
NN+	AGAAACTCGC	4
PYR1V163W	CGTATGTTTGCTGATACGTGGGTGAAGCTTAATTTGC	41
+	AGAAACTCGC	5
PYR1V164#	CGTATGTTTGCTGATACGGTTnnkAAGCTTAATTTGCA G	41 6
PYR1V164A	CGTATGTTTGCTGATACGGTTgcgAAGCTTAATTTGCA G	41 7
PYR1V164D	CGTATGTTTGCTGATACGGTTgacAAGCTTAATTTGCA G	41 8
PYR1V164K	CGTATGTTTGCTGATACGGTTaagAAGCTTAATTTGCA G	41 9
PYR1V164N	CGTATGTTTGCTGATACGGTTaatAAGCTTAATTTGCA G	42 0
PYR1V164W	CGTATGTTTGCTGATACGGTTtggAAGCTTAATTTGCA G	42 1
PYR1V164Y	CGTATGTTTGCTGATACGGTTtatAAGCTTAATTTGCAG	42 2
PYR1V81C+	gatgcacgcgcgactgtatcgtcatcagtg	42 3
PYR1V81e+	gatgcacgcgcgacgagatcgtcatcagtg	42 4
PYR1V81I+	gatgcacgcgcgacatcatcgtcatcagtg	42 5
PYR1V81M+	GATGCACGCGCGACATGATCGTCATCAGTG	42 6
PYR1V81NN N-	CACTGATGACGATNNNGTCGCGCGTGCATC	42 7
PYR1V81NN N+	GATGCACGCGCGACNNNATCGTCATCAGTG	42 8

Primer name	Primer sequence	SE Q ID N 0
PYR1V81W +	GATGCACGCGCGACTGGATCGTCATCAGTG		42 9
PYR1V81y+	gatg cacg cg cg a ctata tcgtca tcag tg		43 0
PYR1V83C+	cgcgcgacgtgatctgcatcagtggattacc		43 1
PYR1V83d+	cgcgcgacgtgatcgacatcagtggattacc		43 2
PYR1V83e+	cgcgcgacgtgatcgagatcagtggattacc		43 3
PYR1V83F+	cg cg cg acgtg atcttta tcag tgga tta cc		43 4
PYR1V83k+	cgcgcgacgtgatcaagatcagtggattacc		43 5
PYR1V83M+	CGCGCGACGTGATCATGATCAGTGGATTACC		43 6
PYR1V83NN N-	GGTAATCCACTGATNNNGATCACGTCGCGCG		43 7
PYR1V83NN N+	CGCGCGACGTGATCNNNATCAGTGGATTACC	I	43 8
PYR1V83q+	cgcgcgacgtgatccaaatcagtggattacc		43 9
PYR1V83W +	CGCGCGACGTGATCTGGATCAGTGGATTACC		44 0
PYR1V83y+	cgcgcgacgtgatctacatcagtggattacc		44 1
pyr1y120A+	cataggctgacgaatGCCaaatccgttacgacg		44 2
pyr1y120C+	cataggctgacgaatTGTaaatccgttacgacg		44 3
pyr1y120E+	cataggctgacgaatGAGaaatccgttacgacg		44 4

Primer name	Primer sequence	SE Q ID N O
pyr1y120G+	cataggctgacgaatGGCaaatccgttacgacg	44 5
pyr1y120H+	cataggctgacgaatCACaaatccgttacgacg	44 6
PYR1Y120M +	CATAGGCTGACGAATATGAAATCCGTTACGACG	44 7
PYR1Y120N NN-	CGTCGTAACGGATTTNNNATTCGTCAGCCTATG	44 8
PYR1Y120N NN+	CATAGGCTGACGAATNNNAAATCCGTTACGACG	44 9
pyr1y120P+	cataggctgacgaatCCCaaatccgttacgacg	45 0
pyr1y120Q+	cataggctgacgaatCAGaaatccgttacgacg	45 1
PYR1Y120W +	CATAGGCTGACGAATTGGAAATCCGTTACGACG	45 2

Yeast-based receptor activation assays

Mutant pBD GAL-PYR1 clones were individually transformed into S. cerevisiae strain Y190 containing pACT-HAB1 (Park et al., 2009), which expresses a GAL4 activation domain-HAB1 fusion protein. Yeast transformants were selected for the presence of plasmids on synthetic dextrose (SD) agar plates lacking Leu and Trp (SDLT) and examined for PP2C interactions by using X-gal staining to monitor β-gal reporter gene expression levels. Individual clones were arrayed into 96 well plates and then spotted onto SD-LT lawn (i.e, one-well) plates. Each assay plate contained 95 mutant clones and one wild type PYR1 control clone. Plates were stained by the chloroform overlay X-gal method after 2 days incubation at 30 °C. Each assay plate was tested least three times and the activating mutations shown in Figure 1 were observed as X-gaF in ail three separate experiments.

ln vitro receptor activation assays

Full length ABU and ABI2 were cloned into a modified pSUMO vector (LifeSensors

Inc, USA) vector yielding 6xHis-SUMO fusion proteins; GST-HAB1 was expressed and 69 purified as previously described (Park et al., 2009). Mutant receptors were cloned into pET28 yielding 6xHis-fusion proteins. Clones were transformed into E. coli expression strain BL21 (DE3) pLysS and recombinant proteins prepared as follows: 1 ml of an overnight culture was inoculated in to 200 ml TB (for receptors) or 200 ml LB (for PP2Cs). The cultures were pre-incubated 2 hours at 30°C and, for PP2C expression, media was supplemented with 4 mM MnCI₂ one hour after inoculation. After preincubation, IPTG was added (1 mM) and cells were induced at 15°C for hours, after which they were collected by centrifugation, resuspended in 5 ml Buffer A (50 mM

NaH₂PO₄, 300 mM NaCI) + 10 mM imidazole, pH 8.0 and stored at -80°b. For purification, cells were thawed, sonicated on ice (60 seconds) and a cleared lysate was then applied a 1 ml-bed volume column of Ni-NTA (Qiagen, USA), washed with 20 column volumes of Buffer A + 30 mM imidazole and bound protein eluted with 1 ml of

Buffer A + 250 mM imidazole. For receptors, the elutate was dialyzed againstTBS and for PP2Cs, fusion proteins were desalted by passage over a Sephadex G50 column.

The purified receptors and phosphatases were then used in receptor assays where receptor activation is indicated by inhibition of phosphatase activity, as inferred from initial reaction velocities for PP2C-mediated hydrolysis of the synthetic phosphatase substrate pNPP in reactions containing 600 nM PP2C and either 0, 600, 1200, 2400 or 4800 nM receptor. The receptor assay buffer consisted of 33 mM Tris-OAc, pH 7.9, 66 mM KOAc, 0.1% BSA, 25 mM Mn(OAc)₂, 0.1% β-ΜΕ and 50 mM pNPP. Immediately after mixing proteins and substrates, reactions were monitored for hydrolysis of pNPP at A₄₀5 at -2 minutes intervals using a Wallac plate reader. Reaction progressions were plotted, initial velocities calculated and converted to spécifie activities by comparison to a standard curve for 4-nitrophenol made in the same buffer System. PP2C activity values shown in figures are expressed as %-control phosphatase activity levels, as measured under identical reaction conditions in the absence of receptor protein. The average spécifie activity level of GST-HAB1,6xHis-SUMO-ABI1 and 6xHis-SUMCD-ABI2 utilized in our experiments was -4500 (GST-PP2C) or ~2500 (SUMO-PP2C) pm^l/min/mg, when assayed using the phosphatase substrate pNPP in the absence of PYR1 or other receptors.

Transgenîc Plants

To create the desired transgenîc plants, the coding sequences of PYL2, PYL2^CA3and PYL2^CA4 were cloned into a modified version of the pEGAD (Cutler SR et al (2000) Proc NatlAcad Sci USA 97(7):3718-3723) to create 35S-driven GFP-receptor fusion proteins. Prior work has demonstrated that an N-terminal GFP fusion tags does not interfère with PYR1 function in vivo (Park et al., 2009). The constructs were sequence validated and then introduced into Columbia or the aba2-1 mutant using agrobacterium70 mediated transformation via the floral dip method (Clough SJ & Bent AF (1998) Plant J 16(6):735-743). For each génotype constructed, approximately 40 primary transgenic plants were identified by virtue glufosinate résistance or GFP expression in T1 seedlings, and single-insertion homozygous lines were then isolated from the progeny of 10 T1 lines.

Seed assays

In order to assay dormancy of seeds for Columbia, 35S::GFP-PYL2, and 35S::GFP-PYL2^cm were divided into two portions and surface sterilized using chlorine gas (prepared in situ using bleach and HCl). One portion was stratified on 1/3 MS agar plates for 6 days at 4°C in darkness and the second portion, which was maintained at room température, was seeded six days later on the 1/3 MS agar plates; both samples were transferred to a 23°C light-tight growth chamber and germination scored at 24 hour periods. The homozygous 35S::GFP-PYL2 and 35S::GFP-PYL2^cm seeds used in these experiments were -5- and ~6-months post-harvest respectively at the time of the experiment shown in Figure 12.

Germination tests on paclobutrazol (Wako Chemicals, Japan) and NaCI were conducted as following. Columbia, aba2-1, aba2-1;35S::GFP-PYL2 and aba21 ;35S::GFP-PYL2^CA3 seeds were surface sterilized and plated onto 1/3 MS agar media containing 25, 50 or 100 μΜ paclobutrazol or 0, 50, 200, 250 mM NaCI. Control wells contained 1/3 MS agar and 0.1% DMSO, the carrier solvent for paclobutrazol. The seeds were stratified for four days in darkness and then transferred to continuous illumination at room température (23°C). Germination was assayed after 72 hours; seeds showing radicals at least 1/2 seed length or greater were scored as positive. Each experiment was performed in triplicate; experiments were performed on seeds that were ~6-months post-harvest.

Quantitative RT-PCR

Wild type or transgenic lines were imbibed for 32 hours in either water or 5 μΜ ABA at room température under continuous illumination, after which RNA was isolated using Concert™ Plant RNA Reagent followed by l_iCI₂ précipitation and DNase treated using RNase-free DNAse (Ambion). Purified RNA was utilized in qRT-PCR reactions using primers for the ABA-regulated genes Em6 (At2g40170), LEA (At2g21490), and Rd29b (At5g52300). Biological duplicates with triple technical replicate measurements were conducted and gene expression levels were determined. For qRT-PCR analyses of gene expression, cDNA was generated from 5 pg of total RNA using superscript reverse transcriptase II (Invitrogen), in reaction mixture containing a oligo-dT2o (SEQ ID NO: 174) and ribosomal RNA primer 3404 (-) (5'-ACATCTAAGGGCATCACAGAC-3') (SEQ ID

NO:175). Real-time quantitative PCR analysis was performed by AACt method of relative quantification. PCR mixtures contained 2 μΙ of cDNA, 7.5 μΙ of 2* Maxima® SYBR green/Fluorescein qPCR master mix (2x) (Fermentas) and 330 nM of e^ich gene-specific primer in a final volume of 15 μΙ. The RT-PCRs were done using BioRad CFX96 RealTime System and BioRad CFX Manager software (BioRad). PCRs were performed under the following conditions: 3 min at 95°C, and 40 cycles of 10 s at 95°C, 10 s at 55°C and 30 s 72°C in 96-well optical reaction plates (BioRad). The specificity of amplicons was verified by melting curve (disassociation) analysis (60-95^eC) after 40 cycles. Input cDNA was normalized using rRNA primers. The following primers were used to detect spécifie gene expression levels: Em6 (At2g40170) tcgaagctcaacagcatctc (SEQ ID NO: 176) and actgctcctttcgagtttgc (SEQ ID NO: 177), LEA (At2g21490) cgtcggtctggaagttcatc (SEQ ID NO:178) and tcttcttcctcctccctcct (SEQ ID NO: 179), Rd29b (At5g52300) atccgaaaacccatagtcc (SEQ ID NO:180) and tggtggggaaagttaaagga (SEQ ID NO: 181) and rRNA aaacggctaccacatccaag (SEQ ID NO: 182) and gactcgaaagagcccggtat (SEQ ID NO: 183).

We hâve used saturation mutagenesis to îdentify a sériés of mutations in PYR1 that increase its basal activity. Combinations of these mutations led to the rapid construction of a near fully activated PYR1 variant. The activating combinations can be incorporated into diverse PYL receptors to elicit full activation and the PYL2 and PYL9 CA alleles are nearly indistinguishable from wild type receptors examined under saturating ABA levels. When PYL2^CA3 is expressed in vivo, it activâtes ABA signaling and enables near complété suppression of 2 separate ABA-mediated seed responses that are déficient in the aba2-1 mutant; this stringent functional test shows tliat activation of PYL2 is sufficient to activate ABA signaling in vivo and makes an indirect explanation involving the action of ABA on other receptors unlikely.

ABA can normally activate a multiplicîty of receptors in the wild type context, and it is not yet clear if different receptors hâve different sub-functîons in ABA signaling. To date, sélective ABA receptor activation has only been achieved using pyrabactin, which has strong agonist activity on PYR1 and PYL1 and essentially activâtes the full complément of ABA-responsive gene transcription in seeds. However, pyrabactin's effects are complicated by its weak partial-agonist / antagonist activity on other receptors like PYL2 (Peterson FC, et al. (2010) Nature Stuctural and Molecular Biology 17(9): 1109-1113; Melcher K, et al. (2010) Nature Stuctural and Molecular Biology 17(9): 1102-1108) and PYL5 (Hao Q, et al. (2011) Mol Cell 42 (5):662-672). CA alleles hâve the advantage of avoiding the complication of pharmacological treatments. Activation of PYL2 by the CA3 mutations mimics the effects of ABA-treàtment on seeds at the transcript level for three ABA marker genes, suppresses the sait and paclobutrazol sensitivity of aba2-1 mutation and induces hyperdormancy. Together with pyrabactin's previously characterized effects, our data suggest that activation of a single receptor (PYR1 or PYL2) is sufficient to activate signaling in seeds and that multiple receptors need not be activated to elicit an ABA response.

Our efforts hâve shown that combinations of activating mutations can be incorporated into diverse PYR/PYL receptors to elicit full constitutive activation. As is known to those skilled in the art, constitutively active receptor mutations are valuable because they allow ligand-independent activation of signaling pathwaysj. In the context of PYR/PYL receptors, activating ABA signaling and its associated downstream responses in transgenic plants can be used to improve water use, yield under conditions of stress, and other ABA-regulated traits. Moreover, constitutively active receptor mutations are bénéficiai in comparison to chemical agonists (such as ABA) because ,1 constitutively active mutants allow single receptors to be activated selectively. Since the PYL/PYL receptors résidé in a relatively large gene family, sélective activation of single 15 receptors by constitutively active mutations allows responses controlled by distinct family members to be specifïcally activated; this is in contrast to the general activation of signaling elicited by ABA. The value of this is multifold. While ABA is bénéficiai for inducing stress tolérance, its application often has undesirable side effects such as chlorosis; thus, ABA has side effects that may limit its use. Spécifie activation of defined 20 receptors by sélective agonists or defined constitutively active mutants may enable désirable and undesirable side effects to be disentangled and controlled with specificity. Lastly, tissue spécifie or regulated expression of constitutively active alleles enables a level of control that cannot be afforded by chemical agonists.

Example 6: RD29A-driven PYL2^CA4 transgenes induce minimal effects on 25 Arabidopsis growth and germination under non-stressed conditions

As shown in the above examples, constitutive expression of GFP-PYL2^CA4 from the

35S promoter is associated with a number of undesirable effects, including enhanced seed dormancy. in general, constitutive expression of abiotic stress responses is associated with reduced growth and other physiological effects that reduce yield.

Inducible expression can be used to bypass these négative effects. For example, RD29A-driven drought inducible expression of DREB1 A, a positively acting transcription factor in the abscisic acid pathway, improves drought tolérance with minimal effects under normal growth conditions, while constitutive 35S-driven DREB1A severely impairs growth (Kasuga et al., 1999). To investigate the efficacy of drought inducible constitutively active receptors for modulating stress tolérance, we generated transgenic Arabidopsis plants that express either wild-type PYL2 or a PYL2^CA4 receptor under the control of the RD29A promoter. The stress tolérance of these plants in relationship to control plants was investigated using both sait stress and drought stress treatments.

To create the desired transgenic plants, we replaced the 35S promoter présent in pEGAD (Cutler et al. (2000) Proc Natl Acad Sci USA 97:3718-3723) with the Arabidopsis RD29A promoter and then cloned desired PYL2 variants into the modified vector. The RD29A promoter was amplified from A. thaliana genomic DNA with the following primers (5’- GAGCTCCCATAGATGCAATTCAATCAAAC-3· (SEQ ID NO:453) and 5’ACCGGTCAAAGAI I I I I I ICTTTCCAATAG-3’) (SEQ ID NO:454) and cloned into pEGAD using Agel and Sacl restriction enzymes. The coding sequences of PYL2 and PYL2^CA4 were cloned into the above vector to create RD29A-driven GFP-receptor fusion proteins henceforth referred to as RD29A::GFP-PYL2 and RD29A::GFP-PYL2^CA4. The constructs were sequence validated and then introduced into Columbia wild-type background by Agrobac/er/um-mediated transformation using the floral dip method (Clough et al. 1998). For each génotype constructed, approximately 25 primary transgenic plants were identified by virtue of glufosinate résistance and/or GFP expression in T1 seedlings, and single-insertion homozygous lines were then identified from the T2 and T3 progeny of the primary T1 lines.

Given that 35S:PYL2^CA3 lines hâve dramatically enhanced seed dormancy in comparison to wild-type plants, we first sought to establish if the RD29A::GFP-PYL2 or RD29A::GFP-PYL2^ca4 constructs affected seed dormancy. The CA4 construct was chosen because of its greater degree of constitutive activity relative to the CA3 construct (see, e.g., Figure 17) and thus is expected to affect ABA responses more strongly than the CA3 mutation. GFP fusion proteins were utilized to facilitate sélection and analysis of transgenic plants. We note that it has previously been shown that a 35S::GFP-PYL1 construct is sufficient to rescue the pyrabactin insensitivity of the pyr1-1 mutant, which indicates that the GFP tag is not likely to impair PYR1 or PYL2 protein function (Park et al. 2009). In order to assay dormancy of different génotypes, seeds for wild-type Columbia, RD29A::GFP-PYL2, and two independent RD29A::GFP-PYL2^CA4 transgenics (lines #1 and #2) were divided in two aliquots and dry-surface sterilizedlfor two hours using chlorine gas (prepared in situ by mixing commercial bleach and 12N HCl). One portion of sterilized seeds was stratified on 1/3 MS agar plats for 5 days at 4°C in darkness and the second portion, which was maintained dry at room température, was seeded six days later on the 1/3 MS agar plates; both samples were transferred to a 23°C light-tight growth chamber and germination scored at 24 hour intervals. As shown in Figure 18, RD29A-driven expression of the PYL2^CA4 transgene was associated with a modest enhancement of seed dormancy that varies in severity between the 2 lines characterized. This variation suggests that appropriate sélection of transgenic lines can be used to mitigate the severity of the seed effect. The mild seed phenotype observed is consistent with documented expression of the RD29A promoter during seed development in public microarray databases (Schmid et al., 2005). Nonetheless, the effects of the transgene on seed dormancy are minor when using the inducible promoter in comparison to that observed with the 35S-driven pyi_2^CA3 variant.

To further investigate the effects of the RD29A-driven PYL2^CA4 constructs, we characterized the whole plant phenotypes at flowering. As shown in Figure 19, minimal effects on whole plant growth are observed. The effect of the transgenes on whole plant fertility was also examined. As shown in Figure 20, none of the transgenîc plants characterized possessed significant différences in silique length or number, which are proxies for seed yield. Thus, RD29A-driven expression of PYL2 or PYL2^CA4 proteins is associated with minimal effects on plant yield and physiology under non-stressed conditions.

Example 7: The RD29A promoter drives drought-inducible expression of PYL proteins

To confirm that the transgenîc plants constructed express PYL proteins appropriately in response to stress, mature rosette leaves of 4 week old plants grown under short days for the RD29A::GFP-PYL2 and two independent RD29A::GFP-PYL2^CA4transgenîc génotypes were detached and allowed to dry for 4 hours. Proteins were subsequently extracted in TBS buffer (10 mM Tris-CI (pH 7,4), 150 mM NaCI) supplemented with 1% protease inhibitor mixture (Sigma-Aldrich, USA). 20 pg total protein was then separated on a 10% acrylamide (wt/vol) SDS/PAGE gel and then blotted onto nitrocellulose membranes and probed with monoclonal anti-GFP (Clontech, USA) or anti-a-tubulin (Sigma-Aldrich, USA) antibody at 1:10,000 dilution. An antimouse-HRP (1:10,000) conjugate was used as a secondary antibody and ECL (GE Healthcare, USA) was then used to visualize immunoreactive protein. As shown in Figure 21, RD29A-driven PYL proteins were expressed at high levels iJresponse to déhydration and had lower basal levels in the absence of stress, consistent with the previously characterized induction of the RD29A promoter after desiccation (YamaguchiShinozaki étal., 1992). Thus, the RD29A-driven PYL2 constructs induce PYL2 proteins in a stress-inducible manner in mature Arabidopsis plants, as expected.

Example 8: Arabidopsis plants expressing RD29A-driven PYR1CA4 or PYL2CA4 receptors possess improved sait tolérance

ABA plays a well-recognized rôle in mediating sait tolérance (Zhu, 2002). We therefore sought to exaine if Arabidopsis plants expressing RD29A-driven PYR1, PYL2, PYR1^CA4, or pyl2^CA4 variants can enhance Arabidopsis sait tolérance. RD29A-driven

PYR1 and PYR1^CA4 transgenic plants were constructed using methods described in Example 6 for analogous PYL2 constructs. Salinity sensitivity assays of wild-type and transgenic materials were conducted as follows: seedlings of the wild-type Columbia, RD29A::GFP-PYR1, two independent RD29A::GFP-PYR1^CA4, RD29A::GFP-PYL2, or two independent RD29A::GFP-PYL2^CA4 lines were sown and germinated in BD Falcon 100 x 15 mm disposable square integrid pétri dishes on a general growth media consisting of 0.5% Murashige and Skoog Basal Sait Mixture (MS), 0.5% sucrose, and 0.5% Gelzan™ agar and 100 mg/ml carboxyline antimicrobial agent. A stérile 80 x 80 mm nylon mesh was placed on top of 25 ml molten media. The nylon mesh used contains 1000 micron square openings, 59% open area, and a 515 micron thread diameter (obtained from Small Parts, USA). These mesh coverings enable facile transfer of seedlings from low salinity to high salinity pétri plates. Nine sterilized seeds were sown evenly over 10x10 mesh square units, stratified in darkness at 4°C for 5 days and then exposed to continuous light at room température. Severi days later,

I seedlings were transferred to plates containing 100 mM NaCI plus the general growth media to induce expression of the RD29A promoter. Following transgene induction, seedlings were transferred to 250 mM NaCI plates and seedling survival rates were scored 14 days after transfer to the high-salt plates. As shown in Figure 22A, RD29A::GFP-PYR1^CA4 and RD29A::GFP-PYL2^CA4 transgenic plants displayed significant improvements in survival under high salinity conditions in comparison to both wild-type and RD29A::GFP-PYR1 and RD29A::GFP-PYL2 transgenic plants. Quantification of the survival rates of the PYR1 (Figure 22B) and PYL2 (Figure 22C) sériés of transgenic plants revealed significant improvements in sait tolérance of the CA expressing transgenic lines. To confirm that the 100 mM NaCI treatment effective!^ induced expression of the various PYR1 and PYL2 proteins, qRT-PCR assays were performed on seedlings after transfer to 100 mM NaCI. Seeding tissues were harvested in three hour intervals post-transfer (0, 3, and 6 hours post-transfer), and RNA isolated using Concert™ Plant RNA Reagent was DNase treated using RNase-free DNase (Ambion, USA). Purified RNA was then utilized in qRT-PCR reactions using oligonucleotide primers for the ABA-regulated genes RAB18 (At5g66400) and RD29B (At5g52300). Biological triplicate and triple technical replicate measurements were conducted. For qRT-PCR analyses of gene expression, cDNA was generated from 2 pg of total RNA using Superscript Reverse Transcriptase III (Invitrogen, USA) in a reaction mixture containing an oligo-dT20 (SEQ ID NO:174) primer. Real-time quantitative PCR analysis was performed by AACt method of relative quantification. PCR mixtures contained 2 pl of cDNA, 7.5 pl of 2* Maxima® SYBR green/Fluorescein qPCR master mix (2x) (Fermentas) and 330 nM of each gene-specific primer in a final reaction volume of 15 pl. The RT-PCRs were performed using BioRad CFX Manager software (BioRad, USA).

PCRs were performed under the following conditions: 3 min at 95°C, followed by 40 cycles of 10 s at 95°C, 10 s at 55°C and 30 s at 72°C in 96-well optical reaction plates (BioRad). The specificity of amplicons was verified by melting curve (disassociation) analysis (60-95°C) after 40 cycles. Input cDNA was normalized using rRNA primers. As shown in Figure 23, heightened expression of ABA-responsive genes was observed in the RD29A::GFP-PYL2^CA4 line #1 in comparison to wild-type and RD29A::GFP-PYL2 transgenic plants. Thus, RD29A-driven expression of PYR1^CA4 or PYL2^CA4 is associated with a heightened ABA response and improved sait tolérance in Arabidopsis seedlings.

Example 9: RD29A-driven PYL2^CA4 receptors improve Arabidopsis drought tolérance

To investigate if RD29A-driven expression of PYL2^CA4 enhances drought tolérance, mature plants of either the Columbia wild-type, RD29A::GFP-PYL2, or two independent RD29A::GFP-PYL2^CA4 transgenic génotypes were subjected to water deprivation experiments and water loss monitored two weeks post-water deprivation. The experiments were conducted as follows: seedlings of each génotype were individually transferred to hydrated Jiffy-7 peat pellet soil and grown to maturity (-6 weeks) in short day conditions (8/16 light dark) with regular watering; ~40 plants per génotype were characterized. Once mature, pots were sealed using a combination of polyvinyl-chloride and Parafilm to minimize non-transpirational water loss. The lower half of the pot was sealed with polyvinyl-chloride wrap while the upper half was sealed with Parafilm. Control well-watered plants (—10 plants per génotype) were grown alongside treated specimens. Plants were photographed and weighed weekly throughout the course of the experiment. At the completion of the experiment, each pot (containing plant biomass and soil) was oven-dried and weighed to détermine the dry weight of each pot, which was then used to infer the water content measured throughout the course of the water deprivation experiment. The plants were additionally scored visually for leaf collapse (/.e., loss of turgor), which is an indication of drought stress. Aerial plant dry mass was additionally measured for both control and experimental plants at the cessation of the experiment. As shown in Figure 24A, RD29A::GFP-PYL2^CA4 transgenic plants better survived 2 weeks of water deprivation than did either the Columbia wild-type or RD29A::GFP-PYL2 génotypes, as evidenced by reduced turgor loss. Additionally, quantification of water rétention revealed that the RD29A::GFP-PYL2^CA4 transgenic plants better retained water over the 2 weeks of water deprivation than did either the Columbia wild-type or RD29A::GFP-PYI_2 génotypes. This improvement in stress tolérance cannot be attributed to a différence in plant size, as the dry weights of control and water-stressed plants did not signifîcantly differ, as shown in Figure 25. Thus, drought inducible expression of the PYL2^CA4 receptor enhances Arabidopsis drought tolérance.

Example 10: The RD29A::GFP-PYL2^CA4 transgene affects stomatal aperture after recovery from desiccation

Given the importance of stomatal aperture to transpiration and water use, we sought to examine if the drought-induced expression of pyl2^CA4 driven by the RD29A promoter affected stomatal aperture. To investigate this, we examined the aperture of stomata in plants after recovery from desiccation. Plants from the Columbia, RD29A::GFP-PYL2, or RD29A::GFP-PYL2^CA4 transgenic génotypes were severed and dried for one hour to enable induction of the RD29A promoter. Plants were then rehydrated for 90 minutes after which stomatal morphologies of 4 leaves per génotype were captured by molding onto Suzuki’s Universal Micro-Printing (SUMP) plates (SUMP Laboratory, Tokyo). The stomatal impressions were images using a TM 1000 Hitachi Tabletop SEM at X1200 magnification (—100 stomata per génotype). As shown in Figure 26, the RD29A::GFP-PYL2^CA4 transgenics had reduced stomatal aperture in comparison to wild-type and RD29A::GFP-PYL2 plants.

It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. Ail publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for ail purposes.

Claims

Claims

1. An isolated nucleic acid comprising a polynucleotide encoding a mutated PYR/PYL receptor polypeptide comprising one or more amino acid substitutions in a ligandbinding pocket and/or atype 2 protein phosphatase (PP2C) binding interface as compared to a wild-type PYR/PYL receptor polypeptide, wherein the mutated PYR/PYL receptor binds to PP2C in the absence of abscisic acid.
2. The isolated nucleic acid of claim l, wherein the mutated PYR/PYL receptor polypeptide comprises one or more amino acid substitutions in the ligand-binding pocket.
3. The isolated nucleic acid of claim 2, wherein the mutated PYR/PYL receptor polypeptide comprises one or more amino acid substitutions corresponding to the amino acid substitutions H60P/G/R/A/W/I/K/V/M, V83F/P, L87F, A89W or F159V/A in PYRl as set forth in SEQ ID NO:l. |[

H
4. The isolated nucleic acid of claim 3, wherein the mutated PYR/PYL receptor polypeptide comprises one or more amino acid substitutions corresponding to the amino acid substitutions H60P/G, V83F, A89W or F159V in PYRI as set forth in SEQ ID NO: I.
5. The isolated nucleic acid of claim l, wherein the mutated PYR/PYL receptor polypeptide comprises one or more amino acid substitutions in the PP2C binding interface.
6. The isolated nucleic acid of claim 5, wherein the mutated PYR/PYL receptor polypeptide comprises one or more amino acid substitutions corresponding to the amino acid substitutions H60P/G/R/A/W/I/K/V/M, I84Q/E/P/H/K, L87F, A89W, M158T/C/V/I,

F159V/A, Tl 62F, L166Y/F, or K170W in PYR I as set forth in SEQ ID NO: l.
7. The isolated nucleic acid of claim 6, wherein the mutated PYR/PYL receptor polypeptide comprises one or more amino acid substitutions corresponding to the amino acid substitutions H60P/G, I84Q, A89W, MI58T/C, Fl59V, or Kl70W in PYRl as set forth in SEQ IDN0:l.

I

ΡΛ5Ι0755/ΟΑ/Ι249055 I
8. The isolated nucleic acid of claim l, wherein the mutated P|YR/PYL receptor polypeptide comprises one or more amino acid substitutions in the ligand-binding pocket and one or more amino acid substitutions in the PP2C binding interface.
9. The isolated nucleic acid of claim l, wherein the mutated PYR/PYL receptor polypeptide comprises amino acid substitutions corresponding to the amino acid substitutions H60P, V83F, and Fl59V in PYRl as set forth in SEQ ID NO:I.
10. The isolated nucleic acid of claim l, wherein the mutated PYR/PYL receptor polypeptide comprises amino acid substitutions corresponding to the amino acid substitutions H60P, V83F, MI58l,and Fl59V in PYRl as set forth in SEQIDNO:!.
11. The isolated nucleic acid of claim l, wherein the mutated PYR/PYL receptor polypeptide comprises amino acid substitutions corresponding to the amino acid substitutions H60P, A89W, Μ158I, and F159V in PYR l as set forth in SEQ ID NO: I.
12. The isolated nucleic acid of claim l, wherein the mutated PYR/PYL receptor polypeptide comprises amino acid substitutions corresponding to the amino acid substitutions V83F, M158I, F159V, and K170W in PYRl as set forth in SEQ ID NO:l.

I
13. The isolated nucleic acid of claim l, wherein the mutated PYR/PYL receptor polypeptide significantly inhibits the activity of the PP2C in a phosphatase assay in the absence of abscisic acid.
14. The isolated nucleic acid of claim 13, wherein the mutated PYR/PYL receptor polypeptide inhibits the activity of the PP2C by at least 50% in the absence of abscisic acid as compared to the level of PP2C activity of a PP2C that is contacted with a wild-type PYR/PYL receptor polypeptide in the absence of abscisic acid.
15. The isolated nucleic acid of any of daims I -14, wherein the mutated PYR/PYL receptor polypeptide is substantially identical to any of SEQ ID NOs:l-l55.
16. The isolated nucleic acid of claim I, wherein the mutated PYR/PYL receptor polypeptide isany ofSEQ IDNOs:l20-l55.

ΡΑ510755/ΟΑ/Ι249055.1
17. The isolated nucleic acid of claim l, wherein the PP2C is HAB l.
18. An expression cassette comprising a promoter operably lînked to the polynucleotide of any of claims l -17, wherein introduction of the expression cassette into a plant results in the plant having a PYR/PYL receptor that binds to atype 2 protein phosphatase (PP2C) in the absence of abscisic acid.
19. The expression cassette of claim 18, wherein the promoter is heterologous to the polynucleotide.
20. The expression cassette of claim 18, wherein the promoter îs inducible.
21. The expression cassette of claim 20, wherein the promoter îs a stressinducible promoter.
22. The expression cassette of claim 18, wherein the promoter is tissuespecific.
23. The expression cassette of claim 18, wherein introduction of the expression cassette into a plant results in the plant having significantly inhibited PP2C activity in the absence of abscisic acid as compared to a plant lacking the expression cassette.

il
24. An expression vector comprising the expression cassette ofj any of claims l8-23.
25. A plant comprising the expression cassette of any of claims 18-23, wherein the plant has significantly inhibited PP2C activity in the absence of abscisic acid.
26. A plant cell from the plant of claim 25.
27. A seed, flower,leaf, fruit, processed food, or food ingrédient from the plant of claim 25.
28. A method of producing a plant havingsignîficantly inhibited activity of a type 2 protein phosphatase (PP2C) in the absence of abscisic acid, the method comprising:

PA510755/OA/J 249055.1 •F i

introducing the expression cassette of any of daims 18-23 into a plurality of plants; and selecting a plant that expresses the polynucleotide from the plurality of plants.
29. The method of claim 28, wherein the mutated PYR/PYL receptor polypeptide comprises one or more amino acid substitutionscorresponding to the amino acid substitutions H60P/G/R/A/W/I/K/V/M, V83F/L/P, I84Q/E/P/H/K, L87F, A89W, M158T/C/V/I, F159V/A, T162F, L166Y/F, or K170 W in PYRI as set forth in SEQ ID NO: 1.
30. The method of claim 29, wherein the mutated PYR/PYL receptor polypeptide comprises amino acid substitutions corresponding to the amino acid substitutionsH60P, V83F, and F159V in PYR1 as set forth in SEQ IDNO:I.
31. The method of claim 29, wherein the mutated PYR/PYL receptor polypeptide comprises amino acid substitutions corresponding to the amino acid substitutionsH60P, V83F, Ml581, and F159V in PYR1 as set forth in SEQ1DNO:1.
32. The method of claim 28, wherein the mutated PYR/PYL receptor polypeptide is substantially identical to any of SEQ ID NOs:l-155.
33. The method of claim 28, wherein the promoter is an inducible promoter.
34. The method of claim 33, wherein the promoter is a stress-inducible promoter.
35. The method of claim 28, wherein the promoter is tissue-specific.
36. The method of claim 28, further comprising selecting a plant that has enhanced stress tolérance.
37. The isolated nucleic acid of claim 2, wherein the mutated PYR/PYL receptor polypeptide comprises an amino acid substitution corresponding to the'^lnt^aci substitutions V83L as set forth in SEQ ID NO: 1.