OA11937A - HIV immunogenic compositions and methods. - Google Patents

Abstract

The invention provides immunogenic compositions which enhance beta-chemokine levels in a mammal. The immunogenic compositions contain an HIV antigen, an isolated nucleic acid molecule containing an immunostimulatory sequence (ISS) and an adjuvant. The HIV antigen can be a whole-killed HIV virus devoid of outer envelope protein gp120. Alternatively, the HIV antigen can be a whole-killed HIV virus, or a p24 antigen. Also provided is a method of inhibiting AIDS, by enhancing beta-chemokine production in the mammal by administering to the mammal an immunogenic composition containing an HIV antigen, an isolated nucleic acid molecule containing an immunostimulatory sequence (ISS) and an adjuvant.

Description

11937 1

HIV IMMONOGENIC COMPOSITIONS AND METHODS 5

BACKGROÜND INFORMATION

This invention relates to AcquiredImmunodeficiency Syndrome (AIDS) and, more specifically, 10 to immunogenic compositions for use in preventing andtreating AIDS.

More than 30 million people world wide are nowinfected with the human immunodeficiency virus (HIV), thevirus responsible for AIDS. About 90% of HIV infected 15 individuals live in developing countries, including sub-Saharan Africa and parts of South-East Asia, although theHIV épidémie is rapidly spreading throughout the world.Anti-viral therapeutic drugs that reduce viral burden andslow the progression to AIDS hâve recently become 20 available. However., these drugs are prohibitively expensive for use in developing nations. Thus, thereremains an urgent need to develop effective preventativeand therapeutic vaccines to curtail the global AIDSépidémie. 25 To date, HIV has proven a difficult target for effective vaccine development. Because of the propensityof HIV to rapidly mutate, there are now numerous strainspredominating in different parts of the world whoseepitopes differ. Additionally, in a particular infected 30 individuel, an HIV virus can escape from the control of 119 3 7 2 the host immune System by developing mutations in anepitope. There remains a need to develop improved HIVvaccines that stimulate the immune System to recognite abroad spectrum of conserved epitopes, including epitopes 5 from the p24 core antigen.

During the 1990's, more than 30 differentcandidate HIV-1 vaccines entered human clinical trials.These vaccines elicit various humoral and cellular immuneresponses, which differ in type and strength depending on 10 the particular vaccine components. There remains a needto develop HIV vaccine compositions that strongly elicitthe particular immune responses correlated withprotection against HIV infection.

The nature of protective HIV immune responses 15 has been addressed through studies of individuals whohâve reraained uninfected despite repeated exposure toHIV, or who hâve been infected with HIV for many yearswithout developing AIDS. These studies hâve shown thatimmune responses of the T helper 1 (Thl) type correlate 20 well with protection against HIV infection and subséquentdisease progression. Besides antigen-specific Thlresponses, CD8+ cytotoxic T cell responses are consideredimportant in preventing initial HIV infection and diseaseprogression. During an effective anti-viral immune 25 response, activated CD8+ T cells directly kill virus-infected cells and secrete cytokines with antiviralactivity.

The β-chemokine System also appears to beimportant in protection against initial HIV infection and 30 disease progression. Infection of immune cells by mostprimary isolâtes of HIV requires interaction of the viruswith CCR5, whose normal biological rôle is as the 119 37 3 principal receptor for the β-chemokines RANTES, ΜΙΡ-Ιαand ΜΙΡ-β. Genetic polymorphisms resulting in decreasedexpression of the CCR5 receptor hâve been shown toprovide résistance to HIV infection. Additionally, a

5 significant corrélation between β-chemokine levels andrésistance to HIV infection, both in exposed individualsand in cultured cells, has been demonstrated. It hasbeen suggested that β-chemokines may block HIV infectivity by several mechanisms, including competing10 with or interfering with HIV binding to CCR5, and downregulating surface CCR5.

Because of the importance of β-chemokines inpreventing initial HIV infection and disease progression,an effective HIV immunogenic composition should induce 15 high levels of β-chemokine production, both prior to infection and in response to infectious virus. However,HIV immunogenic compositions capable of inducing highlevels of β-chemokine production hâve not been describedIn particular, immunogenic compositions which stimulate 20 high levels of β-chemokine production, induce HIV- specific Thl cellular and humoral immune responses, and i induce HIV-specific cytotoxic activity, hâve not beendescribed.

Compositions that elicit certain types of HIV- 25 spécifie immune responses may not elicit other importantprotective responses. For example, Demi et al., Clin.Chem. Lab. Med. 37:199-204 (1999), describes a vaccinecontaining an HIV-1 gpl60 envelope antigen, animmunostimulatory DNA sequence and alum adjuvant, which, 30 despite inducing an antigen-specific Thl-type cytokineresponse, was incapable of inducing an antigen-specificcytotoxic T lymphocyte response. Furthermore, a vaccinecontaining only envelope antigens would not be expected 11937 4 to induce an immune response against the more highlyconserved core proteins of HIV.

Thus, there exists a need for immunogeniccompositions and methods that will prevent HIV infection 5 as well as slow progression to AIDS in infected individuals. Ideally, such compositions and methods willelicit potent Thl cellular and humoral immune responsesspécifie for conserved HIV epitopes, elicit HIV-specificcytotoxic T lymphocyte activity, and stimulate production 10 of high levels of β-chemokines. Such=vaccines could beused to prevent maternai transmission of HIV, forvaccination of newborns, children and high-riskindividuals, and for vaccination of infected individuals.Such vaccines could also be used in combination with 15' other HIV thérapies, including protease inhibitors. Theprésent invention satisfies this need and providesrelated advantages as well.

SUMMRRY OF THE INVENTION

The invention provides immunogenic compositions 20 which enhance β-chemokine levels in a mammal. Theimmunogenic compositions contain an HIV antigen, anisolated nucleic acid molécule containing animmunostimulatory sequence (ISS) and an adjuvant. TheHIV antigen can be a whole-killed HIV virus devoid of 25 outer envelope protein gpl20. Alternatively, the HIVantigen can be a whole-killed HIV virus, or a p24antigen.

In the immunogenic compositions of theinvention, the isolated nucleic acid molécule containing 30 an ISS can be an oligodeoxynucleotide. The isolated nucleic acid molécule containing an ISS can contain two 11937 5 or more CpG sequences. Exemplary ISS-containing nucleicacid molécules .contain the motif 5'-Cytosine, Guanine,Pyrimidine, Pyrimidine-3'. The isolated nucleic acidmolécule can contain a phosphorothioate backbone. Theisolated nucleic acid molécule can be conjugated to theHIV antigen.

In the immunogenic compositions of theinvention, the adjuvant can be suitable foradministration to a human. An exemplary adjuvant isIncomplète Freund' s Adjuvant.

The immunogenic compositions of the inventioncan further enhance HIV-specific IgG2b antibodyproduction in a mammal. The immunogenic compositions ofthe invention can also enhance an HIV-specific cytotoxicT lymphocyte response in a mammal.

Also provided are kits, which contain an HIVantigen, an isolated nucleic acid molécule containing animmunostimulatory sequence (ISS) and an adjuvant. Thecomponents of the kits, when combined, produce theimmunogenic compositions of the invention.

The invention also provides methods of makingthe immunogenic compositions, by combining an HIVantigen, an isolated nucleic acid molécule containing animmunostimulatory sequence (ISS) and an adjuvant. Thecomponents can be combined ex vivo or in vivo to arriveat the immunogenic compositions.

The invention also provides a method ofimmunizing a mammal, by enhancing β-chemokine productionin the mammal by administering to the mammal animmunogenic composition containing an HIV antigen, an Π9 3 7 6 isolated nucleic acid molécule containing animmunostimulatory sequence (ISS) and an adjuvant. Alsoprovided is a method of inhibiting AIDS, by enhancing β-chemokine production in the mammal by administering to 5 the mammal an immunogenic composition containing an HIVantigen, an isolated nucleic acid molécule containing animmunostimulatory sequence (ISS) and an adjuvant. In themethods of the invention, the mammal can be a primate,such as a human, or a rodent. In certain embodiments of 10 the method, the primate is a prégnant mother or aninfant. A human can be HIV séronégative or HIVséropositive. The immunogenic compositions canadvantageously be administered to the mammal two or moretimes.

15 BRIEF DESCRIPTION OF THE DRAWXNGS

Figures IA and IB show control and antigen-stimulated interferon-γ (IFN-γ) production for indicatedtreatment groups.

Figures 2A and 2B show production of total IgG,20 IgGl and IgG2 isotypes for indicated treatment groups.

Figures 3A and 3B show control and antigen-stimulated RANTES production for indicated treatmentgroups.

Figure 4A shows a comparison of IFN-γ25 production following treatment with two different immunostimuatory sequences.

Figure 4B shows a comparison of IFN-γproduction following treatment with two differentimmunostimuatory sequences. 119 3 7 7

Figure 5A shows HIV antigen-stimulated IFN-γproduction from peripheral blood mononuclear cells.

Figure 5B shows HIV antigen-stimulated IFN-γproduction from CD4 + cells. 5 Figure 5C shows HIV antigen-stimulated IFN-γ production from CD8+ cells.

Figure 6A shows production of total anti-p24IgG for indicated treatment groups.

Figure 6B shows production of anti-p24 IgGl and10 IgG2 isotypes for indicated treatment groups.

Figure 7A shows control and antigen-stimulatedIFN-γ production for different treatment groups.

Figure 7B shows control and antigen-stimulatedRANTES production for different treatment groups. 15 Figure 7C shows production of total anti-p24

IgG for different treatment groups.

Figure 7D shows production of anti-p24 IgGl andIgG2 isotypes for different treatment groups.

Figure 7E shows T cell proliférative responses20 to HIV antigens for different treatment groups.

DETAII.ED DESCRIPTION OF THE INVENTION

The présent invention provides immunogenic HIVcompositions containing an HIV antigen, an isolatednucleic acid molécule containing an immunostimulatory 119 37 8 sequence, and an adjuvant. Also provided are kitscontaining-the components of such compositions, for usetogether. The invention also provides methods ofimmunizing a mammal with such compositions, or with thecomponents of such compositions, so as to enhanceproduction of β-chemokines in the immunized mammal.Advantageously, the compositions of the invention canalso induce potent Thl immune responses against a broadspectrum of HIV epitopes, and provide a strong HIV-specific cytotoxic T lymphocyte response. T’nus, theimmunogenic compositions of the invention are useful forpreventing HIV infection and slowing progression to AIDSin infected individuals.

As used herein, the term "HIV" refers to ailforms, subtypes and variations of the HIV virus, and issynonymous with the older terms HTLVIII and LAV. Variouscell Unes permanently infected with the HIV virus hâvebeen developed and deposited with the ATCC, includingthose having accession numbers CCL 214, TIB 161, CRL 1552and CRL 8543, ail of which are described in ü.S. Pat. No.4,725,669 and Gallo, Scientific American 256:46 (1987).

As used herein, the term "whole-killed HIVvirus" refers to an intact, inactivated HIV virus.

As used herein, the term "outer envelopeprotein" refers to that portion of the membraneglycoprotein of a retrovirus which protrudes beyond themembrane, as opposed to the transmembrane protein, gp41.

As used herein, the term "HIV virus devoid ofouter envelope proteins" refers to a préparation of HIVparticles or HIV gene products devoid of the outer 119 37 9 envelope protein gpl20, but contains the more geneticallyconserved parts of the virus (eg. p24 and gp41).

As used herein, the term "HIV p24 antigen"refers to the gene product of the gag région of HIV,characterized as having an apparent relative molecularweight of about 24,000 daltons designated p24. The term"HIV p24 antigen" also refers to modifications andfragments of p24 having the immunological activity ofp24. Those skilled in the art can détermine appropriatemodifications of p24, such as additions, délétions orsubstitutions of natural antino acids or amino acidanalogs, that serve, for example, to increase itsstability or bioavailability or facilitate itspurification, without destroying its immunologicalacitivity. Likewise, those skilled in the art candétermine appropriate fragments of p24 having theimmunological activity of p24. An immunologically activefragment of p24 can hâve front 6 residues from thepolypeptide up to the full length polypeptide minus oneamino acid.

As used herein, the term "immunostimulatorysequence" or "ISS" refers to a nucléotide sequencecontaining an unmethylated CpG motif that is capable ofenhancing the immune response in a maramal whenadministered in combination with an antigen.Immunostimulatory sequences are described, for example,in PCT publication WO 98/55495.

As ISS can contain, for example, at least onesequence consisting of 5'-Cytosine, Guanine, Pyrimidine,Pyrimidine-3'. For example, the sequence 5'-CGTT-3' isfound in two copies in the sequence designated SEQ IDNO:1, described in Example I, and one copy each of the 119 3 7 10 sequence 5'-CGTT-3' and the sequence 5'-CGCT-3' are foundin the sequence designated SEQ ID NO:4, described inExample IV.

An ISS can contain the hexameric motif 5'-Purine, Purine, Cytosine, Guanine, Pyrimidine,Pyrimidine-3', such as the motif 5'-GACGTT-3', two copiesof which are found in the nucléotide sequence designatedSEQ ID NO:1. An ISS can also contain, for example,either the octameric motif 5’-Purine, Purine, Cytosine,Guanine, Pyrimidine, Pyrimidine, Cytosine, Cytosine-3'. or5'-Purine, Purine, Cytosine, Guanine, Pyrimidine,Pyrimidine, Cytosine, Guanine-3’, such as the sequence5'-AACGTTCG-3'. An exemplary isolated nucleic acidmolécule containing the ISS motif 5'-AACGTTCG -3' has thenucléotide sequence designated SEQ ID NO:2, as describedin Example I.

An ISS can contain more than one unmethylatedCpG motif, such as two or more CpG motifs. An exemplaryisolated nucleic acid molécule containing two CpG motifshas the nucléotide sequence designated SEQ ID NO:1 or thesequence designated SEQ ID NO:2, described in Example I,below. An exemplary isolated nucleic acid moléculecontaining three unmethylated CpG motifs has thenucléotide sequence designated SEQ ID NO:4, as describedin Example IV. SEQ ID NO:4 also contains two copies ofthe hexameric motif 5'-Purine, Pyrimidine, Cytosine,Guanine, Pyrimidine, Pyrimidine-3', namely both thesequence 5'-GTCGCT-3' and the sequence 5'-GTCGTT-3'.

As used herein, the term "nucleic acid moléculecontaining an ISS" refers to a linear, circular orbranched single- or double-stranded DNA or RNA nucleicacid that contains an immunostimulatory sequence. · The 119 37 11 term "isolated," with reference to a nucleic acidmolécule containing an ISS, is intended to distinguishthe ISS-containing nucleic acid molécule from an ISS thatmay naturally be présent in a whole-killed HIV virus 5 préparation. A nucleic acid molécule containing an ISScan contain multiple ISSs. The ISSs can be adjacentwithin the nucleic acid molécule, or they can beseparated by additional nucléotide bases within thenucleic acid molécule. Such a nucleic acid molécule can 10 be of any length greater than 6 bases or base pairs, andis preferably greater than about 15 bases or-base pairs,such as greater than about 20 bases or base pairs, andcan be several kb in length. A nucleic acid molécule containing an ISS can 15 be, for example, a synthetic oligonucleotide, a naturallyoccurring nucleic acid molécule of any species, or avector. A nucleic acid molécule containing an ISS cancontain either natural or modified nucléotides or naturalor unnatural nucléotide linkages. Modifications known in 20 the art, include, for example, modifications of the 3'OHor 5'OH group, modifications of the nucléotide base,modifications of the sugar component, and modificationsof the phosphate group. An unnatural nucléotide linkagecan be, for example, a phosphorothioate linkage in place 25 of a phosphodiester linkage, which increases the résistance of the nucleic acid molécule to. nucleasedégradation. Various modifications and linkages aredescribed, for example, in PCT -publication"WO 98/55435.

As used herein, the term "adjuvant" refers to a 30 substance which, when added to an immunogenic agent,nonspecifically enhances or potentiates an immuneresponse to the agent in the récipient host upon exposureto the mixture. Adjuvants can include, for example, 119 37 12 oil-in-water émulsions, water-in oil elmulsions, alum(aluminum salts), liposomes and microparticles, such aspolysytrene, starch, polyphosphazene and polylactide/polyglycosides. Adjuvants can also include, 5 for example, squalene mixtures (SAF-I), muramyl peptide,saponin dérivatives, mycobacterium cell wallpréparations, monophosphoryl lipid A, mycolic aciddérivatives, nonionic block copolymer surfactants, QuilA, choiera toxin B subunit, polyphosphazene and 10 dérivatives, and immunostimulating complexes (ISCOMs) such as those described by Takahashi et al. (1990) Nature344:87 3-875. Fo-r veterinary use and for production ofantibodies in animais, mitogenic components of Freund’sadjuvant (both complété and incomplète) can be used. In 15 humans, Incomplète Freund’s Adjuvant (IFA) is a preferredadjuvant. Various appropriate adjuvants are well knownin the art and are reviewed, for example, by Warren andChedid, CRC Critical Reviews in Immunoloav 8:83 (1988).

As used herein, "AIDS” refers to the 20 symptomatic phase of HIV infection, and includes bothAcquired Immune Deficiency Syndrome (commonly known asAIDS) and "ARC," or AIDS-Related Complex, as described byAdler, Brit. Med. J. 294: 1145 (1987). The immunologicaland clinical manifestations of AIDS are well known in the 25 art and include, for example, opportunistic infectionsand cancers resulting from immune deficiency.

As used herein, the term "inhibiting AIDS"refers to a bénéficiai prophylactic or tnerapeutic effectof the immunogeniç composition in relation to HIV 30 infection or AIDS symptoms. Such bénéficiai effects include, for example, preventing initial infection of anindividual exposed to HIV; reducing viral burden in anindividual infected with HIV; prolonging the asymptomatic 119 37 13 phase of HIV infection; increasing overall health orquality of life in an individual with AIDS; andprolonging life expectency of an individual with AIDS. Aclinician can compare the effect of immunization with the 5 patient's condition prior to treatment, or with the expected condition of an untreated patient, to déterminewhether the treatment is effective in inhibiting AIDS.

As used herein, the term "β-chemokine" refersto a member of a class of small, chemoattractive 10 polypeptides that includes RANTES, macrophageinflaramatory protein-ΐβ (ΜΙΡ-Ιβ) and macrophageinflammatory protein-la (ΜΙΡ-la). The physical andfunctional properties of β-chemokines are well known inthe art. 15 As, used herein, the term "enhances," with respect to an immune response such as β-chemokineproduction, IgG2b production or cytotoxic T lymphocyteactivity, is intended to mean that the immunogeniccomposition elicits a greater immune response than does a 20 composition containing any two of the three components ofthe immunogenic composition, administered in the sanieamounts and following the same immunization schedule. Asdisclosed herein, the components of the immunogeniccompositions of the invention can act in synergy. For 25 example, the immunogenic compositions of the inventioncan enhance β-chemokine production by elicitingproduction of a higher concentration of β-chemokine thanwould be expected by adding the effects of pairwisecombinations of components of the immunogenic 30 composition.

The β-chemokine production that is enhanced canbe either "HIV-specific β-chemokine production," which 119 37 14 refers to production of a β-chemokine in response tostimulation of T cells with an HIV antigen.

Alternatively, or additionally, the β-chemokineproduction that is enhanced can be "non-specific β-chemokine production," which refers to production of a β-chemokine in the absence of stimulation of T cells withan HIV antigen.

As used herein, the term "kit" refers tocomponents packaged or marked for use together. Forexample, a kit can contain an HIV antigen, an ISS and anadjuvant in three separate containers. Alternatively, akit can contain any two components in one container, anda third component and any additional components in one ormore separate containers. Optionally, a kit furthercontains instructions for combining the components so asto formulate an immunogenic composition suitable foradministration to a mammal.

The invention provides an immunogeniccomposition containing an HIV antigen, a nucleic acidmolécule containing an immunostimulatory sequence (ISS),and an adjuvant. The immunogenic composition enhances β-chemokine production in a mammal administered thecomposition.

In one embodiment, the HIV antigen in theimmunogenic composition is a whole-killed HIV virus,which can be prepared by methods known in the art. Forexample, HIV virus can be prepared by culture from aspecimen of peripheral blood of infected individuels. Inan exemplary method of culturing HIV virus, mononuclearcells from peripheral blood (e.g. lymphocytes) can beobtained by layering a specimen of heparinized venousblood over a Ficoll-Hypaque density gradient and 119 3 7 15 centrifuging the specimen. The mononuclear cells arethen collected, activated, as with phytohemagglutinin fortwo to three days, and cultured in an appropriât© medium,preferably supplemented with interleukin 2. The viruscan be· detected either by an assay for reverse .transcriptase, by an antigen capture assay for.p24, byimmunofluorescence or by électron microscopy to detectthe presence of viral particles in cells, ail of whichare methods well-known to those skilled in the art.

Methods for isolating whoie-killed HIVparticles are described, for example, in Richieri et al.,Vaccine 16:119-129 (1998), and U.S. Patent Nos. 5,661,023and 5,256,767. In one embodiment, the HIV virus is anHZ321 isolate from an individual infected in Zaïre in1976, which is described in Choi et al., AIDS Res. Hum.Retroviruses 13:357-361 (1997). HZ321 is the désignation of an HIV-1 isolate having the env nucléotide sequence set forthin GenBank Accession number M15896.

Various methods are known in the art forrendering a virus non-infectious (see, for exampleHanson, MEDICAL VIROLOGY II (1983), de la Mara andPeterson, eds., Elsevier,). For example, the virus canbe inactivated by treatment with Chemicals or by physicalconditions such as heat or irradiation. Preferably, thevirus is treated with an agent or agents that maintainthe immunogenic properties of the virus. For exemple,the virus can be treated with beta-propiolactone or gammaradiation, or both beta-propiolactone and gammaradiation, at dosages and for times sufficient toinactivate the virus. _c- "in another embodiment, the HIV antigen in theimmunogenic composition is a whoie-killed HIV virusdevoid of outer envelope proteins, which can be preparedby methods known in the art. In order to préparé whole- 11937 16 killed virus devoid of outer envelope proteins, theisolated virus is treated so as to remove the outerenvelope proteins. Such removal is preferablyaccomplished by repeated freezing and thawing of thevirus in conjunction with physical methods which causethe swelling and contraction of the viral particles,although other physical or non-physical methods, such assonication, can also be employed alone or in combination.

In yet another embodiment, the HIV antigen inthe immunogenic composition is a substantially purifiedgene product of HIV. Such gene products include thoseProducts encoded by the gag genes (p55, p39, p24, pl7 andpl5) , the pol genes (p66/p51 and p31-34) and thetransraembrane glycoprotein gp41. These gene products maybe used alone or in combination with other HIV antigens.

The substantially purified gene product of HIVcan be a substantially purified HIV p24 antigen. p24 canbe substantially purified from the virus by biochemicalmethods known in the art, or can be produced by cloningand expressing the appropriate gene in a host organismsuch as bacterial, fungal or mammalian cells, by methodswell known in the art. Alternatively, p24 antigen, or amodification or fragment thereof that retains theimmunological activity of p24, can be synthesized, usingmethods well known in the art, such as automated peptidesynthesis. Détermination of whether a modification orfragment of p24 retains the immunological activity of p24can be made, for example, by imraunizing a marnai andcomparing the immune responses so generated, or testingthe ability of the modification or fragment to competewith p24 for binding to a p24 antibody. 11937 17

The immunogenic compositions of the inventionalso contain an isolated nucleic acid molécule having atleast one immunostimulatory sequence (ISS). The HIVantigen and the nucleic acid molécule can be mixedtogether, or can be conjugated by either a covalent ornon-covalent linkage. Methods of conjugating antigensand nucleic acid molécules are known in the art, andexemplary methods are described in PCT publication WO98/55495. A nucleic acid molécule containing an ISS canbe prepared using methods well known in the artincluding, for example, oligonucleotide synthesis, PCR,enzymatic or Chemical dégradation of larger nucleic acidmolécules, and conventional polynucleotide isolationprocedures. Methods of producing a nucleic acid moléculecontaining an ISS, including a nucleic acid moléculecontaining one or more modified bases or linkages, aredescribed, for example, in PCT publication WO 98/55495.

Those skilled in the art can readily déterminewhether a particular nucleic acid molécule containing anISS is effective-in enhancing a desired immune responsein a particular mammal by immunizing a mammal of the samespe'cies, or a species known in the art to exhibit similarimmune responses, with a composition containing aparticular ISS. For example, an optimal ISS to includein an immunogenic composition for administration to ahuman can be determined in either a human or a non-humanprimate, such as a baboon, chimpanzee, macaque or monkey.

The immunogenic compositions of the inventionfurther contain an adjuvant, such as an adjuvantdemonstrated to be safe in humans. An exemplary adjuvantis Incomplète Freund's Adjuvant (IFA). Another exemplary '119 3 7 18 adjuvant contains mycobacterium cell wall components andmonophosphoryl lipid A, such as the commerciallyavailable adjuvant DETOX™. Another exemplary adjuvant isalum. The préparation and formulation of adjuvants inimmunogenic compositions are well known in the art.

Optionally, the immunogenic compositions of theinvention can contain or be formulated together withother pharmaceutically acceptable ingrédients, includingstérile water or physiologically buffered saline. Apharmaceutically acceptable ingrédient can be anycompound that acts, for example, to stabilize,solubilize, emulsify, buffer or maintain sterility of theimmunogenic composition, which is compatible withadministration to a mammal and does not render theimmunogenic composition ineffective for its intendedpurpose. Such ingrédients and their uses are well knownin the art.

The invention also provides kits containing anHIV antigen, an isolated nucleic acid molécule containingan ISS, and an adjuvant. The components of the kit, whencombined, produce an immunogenic composition whichenhances β-chemokine levels in a mammal.

The components of the kit can be combined exvivo to produce an immunogenic composition containing anHIV antigen, a nucleic acid molécule containing an ISSand an adjuvant. Alternatively, any two components canbe combined ex vivo, and administered with a thirdcomponent, such that an immunogenic composition forms invivo. For example, an HIV antigen can be emulsified in,dissolved in, mixed with, or adsorbed to an adjuvant andinjected into a mammal, preceded or followed by injectionof the nucleic acid molécule containing the ISS. 119 3 7 19

Likewise, each. comportent of the kit can be administeredseparately. Those skilled in the art understand thatthere are various methods of combining and administeringan HIV antigen, an isolated nucleic acid moléculecontaining an ISS, and an adjuvant, so as to. enhance β-chemokine production in a mammal.

An immunogenic composition of the invention iseffective in enhancing β-chemokine production in a mammaladministered the composition. As described in Examples Iand III, below, production of the β-chemokine RANTES canbe detected and quantitated using an ELISA assay ofsupernatants of T cells (such as lymph nodes cells orperipheral blood cells) from mammals administered thecomposition. In order to détermine antigen-specific β-chemokine production, T cells from an immunized mammalcan be,stimulated with HIV antigen in combination withantigen-presenting thymocytes, and the β-chemokine levelsmeasured in the supernatant. In order to détermine non-specific β-chemokine production, either T cell supernatant or a blood or plasma sample from an immunizedmammal can be assayed. Similarly, production of other β-chemokines, such as MIP-1# and MIP-Ιβ, can be detectedand quantitated using commercially available ELISAassays, according to manufacturer's instructions.

An immunogenic composition of the invention canfurther be capable of enhancing HIV-specific IgG2bantibody production in a mammal administered thecomposition. As described in Examples II and III, below,HIV in combination with ISS, or with IFA, stimulate HIV-specific IgGl antibody production, but not HIV-specificIgG2b antibody production. In contrast, the immunogeniccompositions of the invention can stimulate potent HIV-specific IgG2b antibody production. High levels of IgG2b 119 3 7 20 antibodies, which are associated with a Thl type response, are correlated with protection against HIVinfection and progression to AIDS.

An immunogenic composition of the invention canfurther be capable of enhancing'HIV-specific cytotoxic Tlymphocyte (CTL) responses in a mammal administered thecomposition. As described in Example II, below,an HIV antigen in combination with an adjuvant elicitedlow levels of IFN-γ production by either CD4+ T cells orCD8 + T cells. However, when an ISS was included in thecomposition together with an HIV and an adjuvant, therewas a dose-dependent increase in IFN-γ production by bothCD4 + T cells and CD8+ T cells. IFN-γ production by CD4 + T cells ischaracterized as a classic Thl-type response. IFN-γproduction by CD8+ T cells, however, is considered to bea cytotoxic T lymphocyte (CTL) response, and is highlycorrelated with cytolytic activity. CTL activity is animportant component of an effective prophylactic ortherapeutic anti-HIV immune response. Methods ofdetermining whether a CTL response is enhanced followingadministration of an immunogenic composition of theinvention are well known in the art, and includecytolytic assays (described, for example, in Demi et al.supra (1999)), and ELISA and ELISPOT assays for CD8-specific IFN-γ production (see Examples I and II, below).

The invention also provides a method ofimmunizing an individual. The method consists ofenhancing β-chemokine production in an individual byadministering to a mammal an immunogenic compositioncontaining an HIV antigen, an isolated nucleic acidmolécule containing an ISS, and an adjuvant. The 119 37 21 comportants of the immunogenic composition can be administered in any order or combination, such that theimmunogenic composition is formed ex vivo or in vivo.

Preferably, the HIV antigen, ISS and adjuvantare administered simültaneously or at about the .sametime, in about the same site. However, administering thecomponents within several minutes or several hours ofeach other can also be effective in providing animmunogenic composition that enhances β-chemokineproduction. Additionally, administering the componentsat different sites in the mammal can also be effective inproviding an immunogenic composition that enhances β-chemokine production.

The immunogenic compositions of the inventioncan be administered to a human to inhibit AIDS, such asby preventing initial infection of an individual exposed' to HIV, reducing viral burden in an individual infectedwith HIV, prolonging the asymptomatic phase of HIVinfection, increasing overall health or quality of lifein an individual with AIDS, or prolonging life expectencyof an individual with AIDS. As described in Examples I-III, below, administration to a mammal of an immunogeniccomposition containing an HIV antigen, an isolatednucleic acid molécule containing an immunostimulatorysequence, and an adjuvant stimulâtes immune responsescorrelated with protection against HIV infection andprogression to AIDS.

In particular, the immunogenic compositionsenhance β-chemokine production more effectively rhanwould be expected by combination of any two components ofthe immunogenic compositions. Additionally, theimmunogenic compositions promore strong Thl type immune 119 3 7 22 responses, including both Thl type cytokines (e.g. IFN-γ)and Thl type antibody isotypes (e.g. IgG2b). Thus, theimmunogenic compositions of the invention will beeffective as vaccines to prevent HIV infection when 5 administered to séronégative individuals, and to reduceviral burden, prolong the asymptomatic phase ofinfection, and positively affect the health or lifespanof a séropositive individual.

Individuals who hâve been exposed to the HIV10 virus usually express in their sérum certain antibodies spécifie for HIV. Such individuals are termed"séropositive" for HIV, in contrast to individuals whoare "séronégative." The presencë' of HIV spécifieantibodies can be determined by commercially available 15 assay Systems.

At the présent time, serological tests todetect the presence of antibodies to the virus are themost widely used method of determining infection. Suchmethods can, however, resuit in both false négatives, as 20 where an individual has contracted the virus but not yetmounted an immune response, and in false positives, aswhere a fétus may aeguire the antibodies, but not thevirus from the mother. Where serological tests providean indication of infection, it may be necessary to 25 consider ail those who test séropositive as in fact,being infected. Further, certain of those individualswho are found to be séronégative may in fact be treatedas being infected if certain other indications ofinfection, such as contact with a known carrier, are 30 satisfied.

The immunogenic compositions of the inventioncan be administered -to an individual who is HIV 119 37 23 séronégative or séropositive. In a séropositiveindividual, it may be désirable to administer thecomposition as part of a treatment regimen that includestreatment with anti-viral agents, such as protease 5 inhibitors. Anti-viral agents and their uses in treatment regimens are well known in the art, and anappropriate regimen for a particular individual can bedetermined by a skilled clinician.

As shown in Example IV, below, administration 10 of the immunogenic compositions of the invention to aprimate fétus or to a primate neonate resulted in thegénération of a strong anti-HIV immune response,indicating that the immune Systems of fetuses and infantsare capable of mounting an immune response to such 15 compositions which should protect the child from HIVinfection or progression to AIDS. Accordingly, theimmunogenic compositions of the invention can beadministered to an HIV-infected prégnant mother toprevent HIV transmission to the fétus, or to a fétus, an 20 infant, a child or an adult as either a prophylactic ortherapeutic vaccine.

The dose of the immunogenic composition, orcomponents thereof, to be administered in the methods ofthe invention is selected so as to be effective in 25 stimulating the desired immune responses. Generally, animmunogenic composition formulated for a singleadministration contains between about 1 to 200 pg ofprotein. Preferably, an immunogenic composition containsabout 100 pg of protein for administration to a primate, 30 such as a human. As shown in Example IV, below, about100 pg of HIV antigen in an immunogenic compositionelicits a strong immune response in a primate. As shown 119 37 24 in Examples I-III, below, about 10 pg of HIV antigen issuitable for administration to a rodent.

The immunogenic composition can further containfrom about 0.1 pg/ml to about 1 mg/ml of an isolatednucleic acid molécule containing an ISS sequence, such asabout 1 pg/ml, about 10 pg/ml, or about 100 pg/ml. Asshown in Example I, below, a ratio of at least 5:1 byweight of nucleic acid molécule to HIV antigen was moreeffective t’nan lower ratios for eliciting immuneresponses. In rodents, an effective amount of anoligonucleotide containing an ISS in an immunogeniccomposition is from 5 pg to greater than 50 pg, such asabout 100 pg. In primates, about 500 pg of anoligonucleotide containing an ISS is suitable in animmunogenic composition. Those skilled in the art canreadily détermine an appropriate amount of ISS to elicita desired immune response.

As with ail immunogenic compositions, theimmunologically effective amounts of the components mustbe determined empirically, but can be based, for example,on immunologically effective amounts in animal models,such as rodents and non-human primates. Factors to beconsidered include the antigenicity, the formulation(e.g. volume, type of adjuvant), the route of administration, the number of immunizing doses to beadministered, the physical condition, weight and âge ofthe individual, and the like. Such factors are wellknown in the vaccine art and it is well within the skillof immunologists to make such dererminations withoutundue expérimentation.

The immunogenic compositions of the inventioncan be administered locally or systemically by any method 119 37 25 known in the art, including, but not limited to, intramuscular, intradermal, intravenous, subcutaneous,intraperitoneal, intranasal, oral or other mucosalroutes. The immunogenic compositions can be administeredin a suitable, nontoxic pharmaceutical carrier, or can beformulated in microcapsules or as a sustained releaseimplant. The immunogenic compositions of the inventioncan be administered multiple times, if desired, in orderto sustain the desired immune response. The appropriateroute, formulation and immunization schedule can bedetermined by those skilled in the art.

It is understood that modifications which donot substantially affect the activity of the variousembodiments of this invention are also included withinthe définition of the invention provided herein.Accordingly, the following examples are intended toillustrate but not limit the présent invention.

EXAMPLE I

Elicitation of cytokine, antibody and chemokine responses by HIV immunogenic compositions

This example shows that immunogeniccompositions containing an HIV antigen, animmunostimulatory nucleic acid molécule and an adjuvant,are potent stimulators of IFN-γ production (a'Thlcytokine), antibody responses and β-chemokine productionin a mamraal. In particular, β-chemokine production isenhanced to a greater extent than would be expected fromthe additive effects of any two components in thecomposition. Therefore, immunogenic compositionscontaining an HIV antigen, an immunostimulatory nucleicacid molécule and an adjuvant médiate potent immuneresponses of the types that are important in protecting 119 37 26 against HIV infection and disease progression, indicatingthat these compositions will be effective prophylacticand therapeutic vaccines.

Materials and Methods

Oligodeoxynucleotides. ODN (oligodeoxynucleotides) usedin this study were purchased from Retrogen (San Diego,California) . They were phosp’norothioate-modified toincrease résistance to nuclease dégradation. The ODNsequences with the corresponding CpG or non-CpG motifsare underlined in Table 1.

Table 1 ODN Sequence Motif SEQ ID 1826 5' TCCATGACGTTCCTGACGTT 3’ CpG 1 Oct 5' TGACTGTGAACGTTCGAGATGA 3' CpG 2 1745 5’ TCCAATGAGCTTCCTGAGTCT 3' non-CpG 3

Immunizations. The HIV-1 antigen was prepared from virusparticles obtained from cultures of a chronicallyinfected Hut 78 with a Zairian virus isolate (HZ321)which has been characterized as subtype "M," containingan env h/gag G recombinant.virus (Choi et al., supra(1997)). The gpl20 was depleted during the two-steppurification process. The antigen was inactivated by theaddition of β-propiolactone and gamma irradiation at 50kGy. Western blot and HPLC.analysis showed undetectablelevels of gpl20 in the préparation of this antigen (Prioret al., Pharm. Tech. 19:30-52 (1995)). For in vitroexperiments, native p24 was preferentially lysed frompurified HIV-1 antigen with 2% triton X-100 and thenpurified with Pharmacia Sepharose Fast Flow S resin.Chromatography was carried out at pH = 5.0 and p24 was 119 37 21 eluted with linear sait gradient. Purity of the finalproduct was estimated to be >99% by both SDS {sodiumdodecyl sulfate) electrophoresis and reverse phase highpressure liquid chromatography. The ODN was added to thediluted HIV-1 antigen in a volume of at least 5% of thefinal volume. CFA (complété Freund's adjuvant) was preparedby resuspending mycobacterium tubarculosis H37RA (DIFCO,Detroit, Michigan) at 10 mg/ml in IFA (DIFCO, Detroit,Michigan). IFA or ISA 51® was formulated by adding onepart of the surfactant Montanide 80 (high purity mannidemonoleate, Seppie, Paris) to nine parts of Drakeol 6 VRlight minerai oil (Panreco, Karnes City., Pennsylvania) .The gpl20-depleted HIV-1 antigen was diluted in PBS to200/zg/ml and emulsified with equal volumes of CFA or IFAwith or without ODN.

Eight to twelve weeks old Lewis rats fromCharles Rivers (Wilmington, Massachusetts), maintained ina pathogen-free facility, were injected intradermally inthe hind footpad with 100μ1 of émulsion. Each animalreceived lO^g of the inactivated HIV-1 antigen in eitherCFA (n=6), IFA (n=6), 50 pg ISS (n=3), or IFA plus 50 pgISS (n=6). Two weeks later, the animais were boostedsubcutaneously in the base of the tail using the sameregimen, except that the animais primed with HIV-1antigen in CFA were instead boosted with HIV-1 antigen inIFA. Rats were primed and boosted with HIV-1 antigen inthe presence of the ODN 1826, which contains an ISS, orODN 1745, which does not contain an ISS. On day 28, theanimais were sacrificed for cytokine, chemokine, andantibody analysis. For ISS dose response studies, n=3for ail groups. ίΠ9 3 7 28

ELISA for antigen-specific antibody. Whole blood wascollected from immunized animais by heart puncture at theend of the study. The SST tubes were centrifuged at800 rpm for 20 minutes. Sera were aliquoted and storedat -20°C until assayed. PVC plates (polychlorinatedbiphenyl plates, Falcon, Oxnard, California) were coatedwith native p24 diluted in PBS at ljug/ml and stored at4°C overnight. Plates were blocked by adding 200μ1 perwell of 4% BSA in PBS for 1 hour. Sera were diluted in1% BSA in PBS at 1:100 followed by four-fold serialdilution. 100μ1 of diluted sera were added in duplicateand incubated at room température for 2 hours. Plateswere washed with 0.05% Tween 20 in PBS three times andblotted dry. The detecting secondary antibodies (goatanti-rat IgG biotin, goat anti-rat IgGl biotin or goatanti-rat IgG2a biotin, Zymed, San Francisco, California)were diluted in 1% BSA in PBS. 100μ1 of dilutedsecondary antibody was added to each well and incubatedat room température for another hour. After washingexcess secondary antibody, strep-avidin-biotin-HRP (Pierce, Rockford, Illinois) were added at 50μ1 per welland incubated for 30 minutes. Plates were washed with0.05% Tween 20 in PBS three times. ABTS substrate(KPL, Gaithersburg, Maryland) was added until abluish-green color developed. The reaction was stoppedby the addition of 1% SDS and the plate was read atabsorbance 405 nm.

The antibody response reported as 50% antibodytiter was the reciprocal of the dilution equal to 50% ofthe maximum binding (highest optical reading) for everygiven sample. The absorbance value (OD @ 405 nm) wasplotted against antibody dilution in a log scale,yielding a sigmoidal dose response curve. 50% of themaximum binding was calculated by multiplying the highest 119 3 7 29 OD by 0.5. The 50% value was located on the curve andthe corresponding x-axis value was reported as theantibody dilution. ELISA Assay for Cytokine and Chemokine Anaylsis. Thedraining lymph nodes (superficial inguinal and popliteal)were isolated from immunized animais two weeks after theboost. Single cell suspensions from these lymph nodeswere prepared by mechanical dissociation using stérile 70μια mesh screen. T cells were purified from lymph nodecells by the panning method. Briefly, pétri dishes (100x 15mm) were pre-coated with 20^g/ml of rabbit anti-ratIgG (Rockland, San Francisco, California) for 45 minutesat room température. The pétri dishes were washed twicewith ice cold PBS and once with ice cold 2% human ABsérum in PBS. IxlO7 lymph node cells were added topre-washed plates and incubated at 4°C for 90 minutes.

The non-adherent cells (enriched T cells) were thencollected and transferred into stérile 50-ml conicaltubes. The plates were washed twice and combined withthe non-adherent cells. The cells were then centrifugedand cell pellets resuspended in complété media at 4xl06 cells/ml (5% human AB sérum in RPMI 1640, with25 mM hepes, 2mM L-glutamine, 100 pg streptomycin and5xlO-âM β-mercaptoethanol) .

Gamma-irradiated thymocytes from a naive Lewisrat were used as antigen presenting cells. 2xl05 enrichedT cells and 5xl05 thymocytes were added to each well of a96-round bottom plate. The HIV-1 antigen and native p24were diluted in complété media at 10pg/ml while con A wasdiluted to 5pg/ml. 100μ1 of each antigen or T cellmitogen were added in triplicates. The plates wereincubated at 5% C02, 37°C for 72 hours. Supernatants wereharvested and stored at -70°C until assayed. The samples »119 3 7 30 were assayed for IL-4, IFN-γ and RANTES usingcommercially available kits (Biosource, Camarillo,California) spécifie for rat cytokines and chemokines.

Statistical methods. The Mann-Whitney ü nonparametric 5 statistic was utilized to compare groups. Ail p valuesare two tailed.

Results

As shown in Figure IA, administration ofenvelope-depleted HIV-Γ in combination with IFA and ISS 10 (ODN 1826) was a more potent inducer of both HIV-1antigen-stimulated and p24 antigen-stimulated IFN-γproduction than HIV-1 in CFA (p=.Q02), HIV-1 in IFA, orHIV-1 in ISS (p=.O2). Increased production ofunstimulated IFN-γ (control) was also observed following

15 administration of envelope-depleted HIV-1 in combinationwith IFA and ISS. ünexpectedly, administration of HIV-1in combination with IFA and ISS resulted in IFN-γproduction that was several times greater than theadditive effects of HIV-1 in IFA alone or HIV-1 in ISS 20 alone. Of note, the level of cytokine secreted afterHIV-1 stimulation was higher than after p24 stimulation,due to the presence of multiple T cell epitopes in thewhole HIV-1 antigen.

Complété Freund's Adjuvant (CFA) is currently 25 the most potent adjuvant known for stimulating cell-mediated immune responses. However, CFA is not anappropriate adjuvant for use in humans because of safetyissues. As shown in Figure IA, HIV in CFA inducedunstimulated and HIV-stimulated IFN-γ production more

30 effectively than HIV in IFA alone or HIV in ISS alone,but not as well as HIV in the combination of IFA and ISS 119 3 7 31

Thus, the discovery of the superior effects of thecombination of ISS and IFA for use in an HIV immunogeniccomposition provides for safe and effective vaccines forhuman therapy. 5 To examine the dose-relatêd immune response to IFN-γ, Lewis rats were immunized with the inactivatedgpl20-depleted HIV-1 antigen emulsified in IFA containingdifferent concentrations of CpG ODN 1826 (50, 25 and 5 pgper rat). The highest production of antigen-stimulated 10 IFN-γ was obtained using 50 pg of CpG ODN 1826, as shownin Figure IB.

To examine whether CpG ODN could also boost theantibody response to an HIV-1 antigen, sera were assayed 15 for total IgG and Th2 isotype (IgGl and IgG2a) antibodyresponses to p24 antigen. As shown in Figure 2A, anti-p24 total IgG responses were strongly enhanced andcomparable in both the HIV in CFA and HIV in IFA/ISSgroups of animais. Administration of HIV-1 in 20 combination with IFA and ISS resulted in total p24 antibody production that was greater than the additiveeffects of HIV-1 in IFA alone or ISS alone, and almost asgreat as HIV-1 in CFA. The IgGl and IgG2a responses werecomparable among animais immunized with HIV-1 antigen in 25 CFA, IFA or IFA/ISS. As shown in Figure 2B, the antibodyresponse was dépendent on the dose of ISS.

Production of the β-chemokine RANTES inresponse to immunization was then examined. As shown inFigure 3A, both unstimulated and antigen-stimulated cells 30 from the HIV/IFA/ISS group showed enhanced production ofRANTES, to a level comparable with the HIV in CFA group,and significantly higher than the HIV/IFA group (p=.002)or HIV/ISS group (p=.O2). Unexpectedly, administration 119 37 32 of HIV-1 in combination with IFA and ISS resulted in bothunstimulated and antigen-stimulated RANTES productionthat was greater than the additive effects of HIV-1 inIFA alone or HIV-1 in ISS alone. As shown in Figure 3B, 5 both unstimulated and antigen-stimulated RANTESproduction was dépendent on the dose of ISS.

In none of the groups was production observedof antigen-induced IL-4, a Th2 type cytokine. Thecontrol sequence (1745) did not stimulate IFN-γ, RANTES, 10 or p24 antibody.

Cytokine and chemokine production was comparedwith compositions containing two oligonucleotidescontaining different immunostimulatory sequences. Asshown in Figure 4A, immunogenic compositions containing 15 HIV-1 antigen and IFA with either ODN 1826 (SEQ ID NO:1)or ODN Oct (SEQ ID NO:2) induced antigen-stimulated IFN-γproduction to a greater extent than compositions containing HIV-1 antigen and IFA, or HIV-1 antigen andCFA. Furthermore, as shown in Figure 4B, immunogenic 20 compositions containing HIV-1 antigen and IFA with eitherODN Oct or ODN 1826 induced unstimulated and antigen-stimulated RANTES production to a greater extent thancompositions containing HIV-1 antigen and IFA, or HIV-1antigen and CFA. 25 Thus, the immunogenic compositions of the invention can be used to enhance β-chemokine productionin an individual. Because of the strong corrélationbetween β-chemokine levels and protection from HIVinfection and disease progression, the compositions of 30 the invention will be more effective than other describedcompositions for inhibiting AIDS. 119 3 7 33

EXAMPLE II

Elicita~tion of CD4 and CD8 immune responses bv HIV immunogenic compositions

This example shows the induction of potent CD4 5 and CD8 HIV-specific Thl type immune responses followingimmunization with an immunogenic composition containingan HIV antigen, a nucleic acid containing an immunostimulatory sequence and an adjuvant. Antigen-specific responses by CD8+, cytotoxic T lymphocytes are 10 an important factor in preventing initial HIV infectionand disease progression. Thus, this example providesfurther evidence that the immunogenic compositions of theinvention are effective prophylactic and therapeuticvaccines. 15 Materials and Methods HIV antigen, ISS (ODN 1826) and IFA wereprepared essentially as described in Example I. Lewisrats were immunized essentially as described in ExampleI, and sacrificed at day 28 for ELISPOT and p24 antibody 20 analysis. p24 antibody analysis was performedessentially as described in Example I. ELISPOT for gamma-interferon from bulk and purified Tcell populations. Single cell suspensions were prepared 25 from spleens of the immunized rats by mincing and pressing through a stérile fine mesh nylon screen in RPMI1640 (Hyclone, Logan, ütah). The splénocytes werepurified by ficoll gradient centrifugation. CD4 and CD8cells were isolated by magnetic bead déplétion. 2x10^ 30 cells were stained with 5pg of either mouse anti-rat CD4(clone: OX-35, Pharmingen, San Diego, California) or 119 3 7 34 mouse anti-rat CD8 (clone: OX-8, Pharmingen, San Diego,California). Cells were incubated on ice for 30 minutesand washed with ice cold 2% Human AB sérum in PBS. Pre-washed Dynabeads (DYNAL, Oslo, Norway) coated with goatanti-mouse IgG were added to the cell suspension andincubated at 4°C for 20 minutes with constant mixing.

Purified CD4, CD8 and non-depleted splénocyteswere resuspended in complété media (5% inactivated HumanAB sérum in RPMI 1640, Pen-strep, L-glutamine and β-ΜΕ)at 5x10^ cells/ml and used for ELISPOT assay to enumeratethe individual IFN-γ secreting cells. Briefly, 96 wellnitrocellulose bottom microtiter plates (Millipore Co.,Bedford, U.K.) were coated with 400 ngs per well of mouseanti-rat IFN-γ (clone: DB-1, Biosource, Camarillo,California). After overnight incubation at 4°C, plateswere washed with stérile PBS and blocked with 5% human ABsérum in RPMI 1640 containing pen-strep, L-glutamine andβ-ΜΕ) for 1 hour at room température. Plates were washedwith stérile PBS and 5x10$ per well of splénocytes (purified CD4, purified CD8 or non-depleted) were addedin triplicate and incubated overnight at 37°C and 5% CC>2 ·Cells were cultured with media, OVA .(Chicken EggOvalbumin, Sigma-Aldrich, St. Louis, Missouri), nativep24 or gp!20-depleted HIV-1 antigen. CD4 purified and CD8 purified splénocytes were assayed in complété mediacontaining 20 units/ml of recombinant rat IL-2 (Pharmingen, San Diego, CA).

After washing unbound cells, 400 ng per well ofthe polyclonal rabbit anti-rat IFN-γ were added andincubated at room température for 2 hours, then washedand stained with goat anti-rabbit IgG biotin (Zymed, SanFrancisco, California) . After extensive washes withstérile PBS, avidin alkaline phosphatase complex (Sigma- 119 37 35

Aldrich, St. Louis, MO) was added and incubated foranother hour at room température. The spots weredeveloped by adding chromogenic alkaline phosphatesubstrate (Sigma, St. Louis, MO) and the IFN-γ cells werecounted using a dissection microscope (X 40) with ahighlight 3000 light source (Olympus, Lake Success, NY).

Statistical Methods. The Mann-Whitney ü nonparametricstatistic was utilized to compare groups. The Spearmanrank corrélation was performed to examine relationshipsbetween CD4 and CD8 gamma interferon production. Ail pvalues are two tailed.

Results

The production of IFN-γ by non-depletedsplénocytes, and by purified CD4+ or purified CD8+populations, was examined. IFN-γ production by CD4+cells is a characteristic Thl immune response, whereasIFN-γ production by CD8+ cells is a correlate ofcytotoxic T lymphocyte (CTL) cytolytic activity.

The frequency of IFN-γ producing cellsincreased with dose of ISS in non-depleted splénocytes inresponse to either whole-killed, gpl20-depleted HIV (theimmunizing antigen) or purified p24 antigen (seeFigure 5A). The highest frequency of cytokine producingcells was observed with the combination of 100 pg of ISSwith HIV-1 in IFA, for both HIV-1 and p24 antigenstimulated cells (p=0.03 when compared the HIV in IFAgroup) .

The purified CD4+ T cell population alsoexhibited a dose-dependenr increase in the frequency ofcells expressing IFN-γ in response to HIV and p24 119 37 36 antigens, with the greatest frequency being at the 100 pgdose of ISS when combined with HIV-1 in IFA (p=0.03 whencompared the HIV in IFA group)(see Figure 5B).

Furthermore, the purified CD8+ population also exhibiteda dose-dependent increase in the frequency of cellsexpressing IFN-γ in response to HIV and p24 antigens,with the greatest frequency being at the 100 pg dose ofISS when combined with HIV-1 in IFA (p=0.03 when comparedthe HIV in IFA group)(see Figure 5C). None of theanimais produced IFN-γ secreting cells when stimulatedwith OVA, an irrelevant protein antigen.

Of note, the frequency of IFN-γ producing CD8+T cells was generally lower than the frequency of CD4 + Tcells expressing IFN-γ. There was a strong corrélationbetween the génération of IFN-γ between CD4+ T cells andCD8+ T cells with both HIV antigen stimulation (r=0.80,p=0.002) and for p24 antigen stimulation (r=0.79,p=0.003) .

The results shown in Figures 5A, B and C thusdemonstrate that the immunogenic compositions of theinvention elicit Thl and cytotoxic T lymphocyteresponses, both of which are correlated with protectionfrom initial HIV infection and progression to AIDS.

Finally, total IgG, IgGl and IgG2b spécifie forp24 was examined. As shown in Figure 6A, the addition ofISS at ail doses to HIV in IFA increased anti-p24antibody response (total IgG) compared to HIV in IFA,although a dose response was not évident. Specifically,the addition of ISS to HIV in IFA favored the productionof IgG2b antibody (a Thl type response) compared to HIVin IFA, which induced only IgGl subtype antibody (a Th2type response), as shown in Figure 6B. 119 3 7 37

In summary, the data in this Example show thatan immunogenic composition containing an HIV antigen, anISS and an adjuvant can be used to generate potent HIV-specific CD4 and CD8 HIV-specific immune responses. The 5 induction of CD4 T helper cells may be pivotai for génération of CD8 effector cells. CD8 T cells can serveas effectors against HIV virus by several mechanisms,including direct cytolytic (CTL) activity, as well asthrough the release of antiviral suppressive factors, 10 such as β-chemokines and other less well-characterized factors. These results contrast with results reported byDemi et al., supra (1999), who showed that a combinationof HIV envelope gpl60 antigen, an ISS and an adjuvant didnot induce HIV- spécifie CTL activity. Accordingly, the 15 compositions described herein are superior to otherdescribed compositions for use as HIV vaccines.

EXAMPLE III

Comparison of immune responses elicited by different iarntmogenie compositions and inaronization schadules 20 This example shows that a nucleic acid containing an ISS is more effective in elicitingprotective immune responses, including RANTES productionand HIV-specific IgG2b antibody production, whenadministered simultaneously with an HIV antigen and an 25 adjuvant than when used to prime the mammal one weekprior to administration of the antigen and adjuvant.

This example also shows that a composition containing anHIV antigen, an ISS and an adjuvant promotes antigen-dependent lymphocyte prolifération more effectively than 30 a composition containing only HIV and IFA. 119 3 7 38

Materials and mettions HIV antigen, ISS (ODN 1826) and IFA wsreprepared essentially as described in Example I. Lewisrats (three per group) were immunized at day 7 and, whereindicated, primed at day 0, with the compositions shownin Table 2.

Table 2

Grouo Dav 0 Dav 7 A ISS HIV-1 B HIV-1 C ISS HIV-l/IFA D HIV-1/IFA E HIV-l/IFA/ISS

Animais were sacrificed at day 21 for cytokine,chemokine and antibody analysis, essentially as describedin Example I, as well as for analysis of lymphocyteprolifération.

Lymphocyte prolifération assay. Single cell suspensionswere prepared from the draining lymph nodes of immunizedanimais. 3 cells were depleted from the lymph node cellsby panning. Briefly, lymph node cells were incubatedwith anti-rat IgG pre-coated pétri dishes for 90 minutes.The non-adherent cells (enriched T cells) were collectedand resuspended in complété tissue culture media at 4x10*cells/ml. The enriched T cells were cultured with p24 orHIV-1 antigen in the presence of γ-irradiated thymocytesat 37°C, 5% C02 for 40-48 hours. Samples were pulsed withtritiated thymidine and incubated for another 16 hours.Cells were harvested and tritiated thymidine 119 37 39 incorporation was counted using a β-scintillationcounter.

Results

As shown in Figure 7A, T cells from animaisprimed with ISS and subsequently boosted with HIV-1 inIFA (Group C), animais immunized with HIV-1 in IFA, andanimais immunized with a combination of HIV-1, IFA andISS (Group E), exhibited increased IFN-γ production inresponse to whole-killed, gpl20-depleted HIV (theimmunizing antigen) and a lesser increase in IFN-yproduction in response to purified p24 antigen.

However, as shown in Figure 7B, only T cellsfrom animais immunized with a combination of HIV-1, IFAand ISS (Group E) showed high levels of either non-stimulated (media) , or HIV-stimulated RANTES production.RANTES production from animais of Group E was severalfold higher than from animais primed with ISS, thenboosted one week later with HIV-1 in IFA (Group C). Sérum levels of total IgG, IgGl and IgG2bspécifie for p24 antigen were also examined. As shown inFigure 7C, animais immunized with a combination of HIV-1,IFA and ISS (Group E) showed the highest levels of totalIgG. Unexpectedly, whereas animais not receiving ISS(Group D) and animais primed with ISS (Group C) producedprimarily IgGl (Th2-type) antibodies, animais immunizedwith a combination of HIV-1, IFA and ISS (Group E)produced primarily IgG2b (Thl-type) antibodies (seeFigure 7D). T cell proliférative responses to p24 antigenand gpl20-depleted HIV were also measured. As shown in 119 3 7 40

Figure 7E, T cells from animais immunized with a combination of HIV-1, IFA and ISS (Group E) proliferatedmore strongly in response to either gpl20-depleted HIV orp24 antigen than did T cells from animais primed with ISSthen administered HIV-1 in IFA one week later (Group C) ,or from animais administered only HIV-1 in IFA (Group D).

Thus, the immunogenic compositions of theinvention effectively elicit HIV-specific Thl cytokine(IFN-γ) and humoral responses (IgG2 antibodies), andenhance both non-specific and HIV-specific β-chemokineproduction. These responses to the immunogeniccompositions correlate with strong HIV-specific Tlymphocyte proliférative responses.

ΕΧΑΜΡΙ,Ε IV

Immunization of a primate with an HIV immunocrenic composition

This example shows that immunogeniccompositions containing an HIV antigen, an isolatednucleic acid molécule containing an ISS and an adjuvantare effective in enhancing HIV-specific immune responsesin primates.

Three baboon fetuses were injected in uterowith an immunogenic composition containing gpl20-depletedHIV-1 (100 ug total protein, équivalent to 10 p24 unies)in IFA with 500 pg of the ISS designated ODN 2006. Thesequence of ODN 2006 is 5’-TCGTCGCTGTTGTCGTTTCTT-3' (SEQID NO:4). Four weeks later, the fetuses were boostedusing the same regimen. 119 3 7 41

Peripheral blood mononuclear cells from thenéonatal baboons were collected, and proliférativeresponses to p24 and HIV-1 antigen were assayed. Asshown in Table 3, in ail three animais, the HIV-1stimulation index, which is the ratio of T cellprolifération (3H incorporation) in response to antigen toT cell prolifération without antigen, was indicative of astrong immune response (i.e. stimulation index >3). Twobaboon fetuses injected in utero and boosted as neonatesshowed similar results.

Table 3

Baboon HIV-1 Stimulation Index 6533 13.3 5924 5.87 6683 15.1

Production of HIV-specific antibodies,cytokines and β-chemokines are also measuréd in the samebaboons. These results show that the types of immuneresponses elicited by the immunogenic compositionsdescribed in Examples I-III, above, for rodents, are alsoelicited in primates.

These results demonstrate that the HIVimmunogenic compositions and methods of the invention areeffective in primates in stimulating HIV-specific immuneresponses. Furthermore, these results demonstrate thatfetuses and infants are able to elicit strong HIV immuneresponses to the immunogenic compositions of theinvention, indicating that these compositions will beuseful for preventing maternai transmission of HIV and aspédiatrie vaccines. 11937 42

Throughout this application variouspublications hâve been referenced. The disclosures ofthese publications in their entireties are herebyincorporated by reference in this application in order to 5 more fully describe the State of the art to which thisinvention pertains.

Although the invention has been described withreference to the disclosed embodiments, those skilled inthe art will readily appreciate that the' spécifie 10 experiments detailed are only illustrative of theinvention. It should be understood that variousmodifications can be made without departing from thespirit of the invention. Accordingly, the invention islimited only by the following daims.

Claims (36)

43 ”937 What is claimed is:

1. An immunogenic composition, comprising: (s) a whoie-killed HIV virus devoid ofouter envelope prorein gp!20; (b) an isolated nucleic acid moléculecontaining an immunostimulatorysequence (ISS); and (c) an adjuvant, which enhances β-chemokine levels in a mammal.

2. The immunogenic composition ox claim T, wherein said HIV virus is HIV-1.

3. The immunogenic composition of claim 1, wherein said HIVvirus is an HZ321 strain virus, wherein HZ321 is the désignation of an HTV-1 isolatehaving the env nucléotide sequence set forth in GenBank Accession number Ml 5896.

4. The immunogenic composition of claim 1, 15 wherein said isolated nucleic acid molécule is an oligodeoxynucleotide.

5. The immunogenic composition of claim 1,.wherein said isolated nucleic acid molécule comprises twoor more CpG sequences.

6. The immunogenic composition of claim 1, wherein said isolated nucleic acid molécule comprises atleast -one seguence consisting of 5'-Cytosine, Guanine,Pyrimidine, Pyrimidine-3’.

7. The immunogenic composition of claim 1, 25 wherein said isolated nucleic acid molécule comprises atleast one sequence consisting of 5'-CGTT-3’. ”9 3 7

•8. The immunogenic composition of claim 1,wherein said isolated nucleic acid molécule comprises atleast one sequence consisting of 5'-Purine, Purine,Cytosine, Guanine, Pyrimidine, Pyrimidine-3'

9. The immunogenic composition of claim 1, wherein said isolated nucleic acid molécule comprises atleast one sequence consisting of 5’-GACGTT-3 '.

10. The immunogenic composition of claim 1,wherein said isolated nucleic acid molécule comprises at 10 least one sequence consisting of 5’-TCCATGACGTTCCTGACGTT-3’ {SEQ ID NO:1).

11. The immunogenic composition of claim 1,wherein said isolated nucleic acid molécule comprises atleast one sequence consisting of 5 ’ -AACGTTCG-3 * .

12. The immunogenic composition of claim 1, wherein said isolated nucleic acid molécule comprises aphosphorothioate backbone.

13. The immunogenic composition of claim 1,wherein said HIV virus is conjugated to said nucleic acid 20 molécule.

14. The immunogenic composition of claim 1,wherein said adjuvant is suitable for use in humans.

15. The immunogenic composition of claim 1, 25 wherein said adjuvant comprises incomplète Freurrd.' s adjuvant (IFA). 1 19 37' 45

16. The immunogenic composition of claim 1,wherein said adjuvant comprises mycobacterium cell wallcomponents and monophosphoryl lipid A.

17. The immunogenic composition of claim 1, 5 wherein said adjuvant comprises alum.

18. The immunogenic composition of claim 1,wherein said enhanced β-chemokine production is non-specific β-chemokine production.

19. The immunogenic composition of claim 1,10 wherein said enhanced β-chemokine production is HIV- specific β-chemokine production.

20 wherein said The immunogenic composition of claim 1,β-chemokine is RANTES.

21. The immunogenic composition of claim 1,15 said composition further capable of enhancing HIV- specific IgG2b antibody production in a mammal.

22. The immunogenic composition of claim 1,said composition further capable of enhancing an HIV-specific cytotoxic T lymphocyte (CTL) response in a 20 mammal. 25

23. A kit, comprising: (a) a whole-killed HIV virus devoia o outer envelope protein gpl20; (b) an isolated nucleic acid molee-ule containing an immunostimulatory sequence (ISS); and (c) an adjuvant, components, when combined, producing the 30 immunogenic composition of claim 1. 119 3 7 4 6

24. A method of making the immunogeniccomposition of claim 1, comprising combining: (a) a whole-killed HIV virus devoid ofouter envelope protein gpl20; (b) an isolated nucleic acid moléculecontaining an immunostimulatorysequence (ISS); and (c) an adjuvant.

25. The method of claim 24, wherein saidcombining is ex vivo.

26 combining is The method of claim 24, wherein saidin vivo.

27. A method of immunizing a mammal,comprising enhancing β-chemokine production in the mammalby administering to the mammal the immunogenic composition of claim 1.

28. A method of inhibiting AIDS, comprisingenhancing β-chemokine production in a mammal byadministering to the mammal the immunogenic compositionof claim 1.

29. The method of claim 27 or claim 28,wherein said mammal is a primate.

30. The method of claim 29, wherein saidprimate is an infant.

31. The method of claim 29, wherein said primate is prégnant. 119 3 7 47

32. The method of claim 29, wherein saidprimate is a human.

33. The method of claim 32, wherein said humanis HIV séronégative.

34. The method of claim 32, wherein said human is HIV séropositive.

35. The method of claim 27, wherein saidmammal is a rodent.

36. The method of claim 27 or claim 28,wherein said composition is administered to said mammaltwo or more times. 10 SEQUENCE LISTING <110> The Immune Response Corporation <120> HIV Immunogenic Compositions and Methods <130> FP-IM 4995 <150> US 60/132,762 <151> 1999-05-06 <150> US 60/150,667 <151> 1999-08-25 <150> -PCT/US00/12495 <151> 2000-05-05 <160> 4 <170> FastSEQ for Windows Version 4.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> phosphorothioate-modified syntheticoligodeoxynucleotide <400> 1 tccatgacgt tcctgacgtt 20 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> phosphorothioate-modified syntheticoligodeoxynucleotide <400> 2 tgactgtgaa cgttcgagat ga 22 <210> 3<211> 21<212> DNA <213> Artificial Sequence <220> <223> phosphorothioate-modified synthetic 1 olxgodeoxynuc1eotide 119 3 7 <400> 3 tccaatgagc ttcctgagtc t 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> phosphorothioate-modified syntheticoligodeoxynucleotide <400> 4 tcgtcgctgt tgtcgtttct t 21 2