NZ796465A - Hsd17b13 variants and uses thereof - Google Patents

Abstract

Provided are compositions related to HSD17B13 variants, including isolated nucleic acids and proteins related to variants of HSD17B13, and cells comprising those nucleic acids and proteins. Also provided are methods related to HSD17B13 variants. Such methods include methods for modifying a cell through use of any combination of nuclease agents, exogenous donor sequences, transcriptional activators, transcriptional repressors, and expression vectors for expressing a recombinant HSD17B13 gene or a nucleic acid encoding an HSD17B13 protein. Also provided are therapeutic and prophylactic methods for treating a subject having or at risk of developing chronic liver disease.

Description

Provided are compositions related to 13 ts, including ed nucleic acids and proteins related to ts of HSD17B13, and cells comprising those nucleic acids and proteins.

Also provided are methods related to HSD17B13 variants. Such s include methods for modifying a cell through use of any combination of nuclease agents, exogenous donor sequences, transcriptional activators, transcriptional repressors, and expression vectors for expressing a recombinant HSD17B13 gene or a nucleic acid encoding an HSD17B13 protein. Also provided are therapeutic and prophylactic methods for treating a subject having or at risk of developing chronic liver disease.

NZ 796465 HSD17B13 VARIANTS AND USES THEREOF CROSS-REFERENCE TO D APPLICATIONS The present application is a divisional application from New Zealand patent application number 785361, which is in turn a onal application from New Zealand patent application number 755715, the entire disclosures of which are incorporated herein by reference.

This application claims the t of US Application No. 62/449,335, filed y 23, 2017, US Application No. 62/472,972, filed March 17, 2017, and US Application No.: 62/581,918, filed November 6, 2017, each of which is herein orated by reference in its entirety for all purposes.

REFERENCE TO A CE LISTING SUBMITTED AS A TEXT FILE VIA EFS WEB The Sequence Listing written in file 507242SEQLIST.txt is 507 kilobytes, was created on January 19, 2018, and is hereby incorporated by reference.

BACKGROUND c liver disease and cirrhosis are leading causes of morbidity and mortality in the United States, accounting for 38,170 deaths (1.5% of total deaths) in 2014 (Kochanek et al. (2016) Natl Vital Stat Rep 22, herein incorporated by reference in its entirety for all purposes). The most common etiologies of cirrhosis in the U.S. are alcoholic liver disease, c hepatitis C, and nonalcoholic fatty liver disease (NAFLD), together accounting for ~80% of patients awaiting liver transplant n 2004 and 2013 (Wong et al. (2015) Gastroenterology 148:547-555, herein incorporated by reference in its entirety for all purposes).

The estimated prevalence of NAFLD in the U.S. is between 19 and 46 percent (Browning et al. (2004) Hepatology 40:1387-1395; Lazo et al. (2013) Am J Epidemiol 178:38-45; and Williams et al. (2011) Gastroenterology 140:124-131, each of which is herein incorporated by reference in its entirety for all purposes) and is rising over time (Younossi et al. (2011) Clin Gastroenterol Hepatol 9:524-530 e1; quiz e60 (2011), herein incorporated by reference in its entirety for all es), likely in conjunction with increased rates of obesity, its primary risk factor (Cohen et al. (2011) Science 332:1519-1523, herein incorporated by reference in its entirety for all purposes). While significant advances have been made in the ent of hepatitis C n et al. (2013) Ann Intern Med 158:329-337 and van der Meer et al. (2012) JAMA 308:2584-2593, each of which is herein incorporated by reference in its entirety for all purposes), there are currently no ce-based ents for alcoholic or nonalcoholic liver disease and cirrhosis.

Previous genome wide association studies (GWAS) have identified a limited number of genes and variants associated with chronic liver disease. The most robustly validated genetic association to date is to a common missense variant in the patatin-like phospholipase domain containing 3 gene 3 48Met, rs73 8409), initially found to be associated with increased risk of nonalcoholic fatty liver disease (NAFLD) (Romeo et al. (2008) Nat. Genet. 40: 1461-1465 and Speliotes et al. (2011) PLoS Genet. 7:e1001324, each of which is herein incorporated by reference in its entirety for all purposes), and uently found to be ated with disease severity (Rotman et al. (2010) Hepatology 52:894-903 and an et al. (2009) J. Lipid Res. 50:21 1 1-21 16, each of which is herein incorporated by reference in its entirety for all purposes) and progression (Trepo et al. (2016) J. Hepatol. .1016/j.jhep.2016.03.01 1, herein incorporated by reference in its entirety for all purposes).

Variation in the transmembrane 6 superfamily member 2 (TM6SF2) gene has also been shown to confer increased risk for NAFLD (Kozlitina et al. (2014) Nat. Genet. 46:352-356; Liu et al. (2014) Nat. Commun. 5:4309; and Sookoian et al. (2015) Hepatology 61 :515-525, each of which is herein incorporated by reference in its entirety for all purposes). The normal functions of these two proteins are not well tood, though both have been proposed to be involved in hepatocyte lipid metabolism. How variants in PNPLA3 and TM6SF2 contribute to increased risk of liver disease has yet to be elucidated. GWAS have also fied several genetic factors to be associated with serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) (Chambers et al. (2011) Nat. Genet. 43: 13 1-1 138 and Yuan et al. (2008) Am. J. Hum. Genet. 83 :520-528, each of which is herein incorporated by reference in its entirety for all purposes), quantitative markers of hepatocyte injury and liver fat accumulation that are fiequently measured clinically. To date, there are no described protective genetic variants for chronic liver disease.

The discovery ofprotective genetic variants in other settings, such as f-function variants in PCSK9 that reduce the risk of cardiovascular disease, has been the catalyst for development of new classes of eutics.

Knowledge of genetic factors underlying the development and progression of chronic liver e could improve risk fication and provide the foundation for novel therapeutic strategies. A better understanding of underlying genetic s is needed to improve risk stratification and generate novel therapies for liver disease.

SUMMARY Methods and compositions are provided related to the HSDI 7BI3 rs72613567 variant gene, variant HSDI 7BI3 transcripts, and variant HSD17B13 protein ms.

In one aspect, provided are isolated nucleic acids comprising the mutant residue from the HSDI 7BI3 rs72613567 variant gene. Such isolated nucleic acids can comprise at least 15 contiguous nucleotides of an HSDI 7BI3 gene and have a e ed between nucleotides corresponding to ons 12665 and 12666 of SEQ ID NO: 1 when optimally aligned with SEQ ID NO: 1. Optionally, the contiguous nucleotides are at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a corresponding sequence in SEQ ID NO: 2 including position 12666 of SEQ ID NO: 2 when optimally aligned with SEQ ID NO: 2.

Optionally, the HSDI 7BI3 gene is a human HSDI 7BI3 gene. Optionally, the isolated nucleic acid comprises at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10000, at least 11000, at least 12000, at least 13000, at least 14000, at least 15000, at least 16000, at least 17000, at least 18000, or at least 19000 contiguous nucleotides of SEQ ID NO: 2.

Some such isolated nucleic acids comprise an HSDI 7BI3 ne in which one or more nonessential segments of the gene have been deleted with respect to a corresponding wild type HSDI 7BI3 gene. ally, the deleted segments comprise one or more intronic sequences. Optionally, the isolated nucleic acid further comprises an intron corresponding to intron 6 of SEQ ID NO: 2 when optimally aligned with SEQ ID NO: 2. Optionally, the intron is intron 6 of SEQ ID NO: 2.

In another aspect, provided are isolated nucleic acids corresponding with ent HSDI 7BI3 mRNA transcripts or cDNAs. Some such isolated nucleic acids comprise at least 15 contiguous nucleotides encoding all or part of an HSD17B13 protein, n the contiguous nucleic acids se a segment that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% cal to a segment present in SEQ ID NO: 7 (HSDI 7BI3 Transcript D), SEQ ID NO: 10 (HSD17BI3 Transcript G), and SEQ ID NO: 11 (HSD17BI3 Transcript H) that is not present in SEQ ID NO: 4 (HSDI 7BI3 Transcript A). ally, the contiguous nucleotides further comprise a segment that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a segment present in SEQ ID NO: 7 (HSDI 7BI3 Transcript D) that is not present SEQ ID NO: 11 (HSDI 7BI3 Transcript H), and wherein the contiguous nucleotides further comprise a segment that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a segment present in SEQ ID NO: 7 (HSDI 7BI3 Transcript D) that is not present in SEQ ID NO: 10 (HSDI 7BI3 ript G). Optionally, the contiguous nucleotides r comprise a segment that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a segment t in SEQ ID NO: 11 (HSDI 7BI3 Transcript H) that is not present in SEQ ID NO: 7 (HSDI 7BI3 Transcript D). Optionally, the uous nucleotides further comprise a segment that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a segment present in SEQ ID NO: 10 (HSDI 7BI3 Transcript G) that is not present in SEQ ID NO: 7 (HSDI 7BI3 Transcript D).

Some such isolated c acids comprise at least 15 contiguous nucleotides encoding all or part of an HSD17B13 protein, wherein the contiguous nucleotides se a segment that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a segment present in SEQ ID NO: 8 (HSDI 7BI3 Transcript E) that is not present in SEQ ID NO: 4 (HSDI 7BI3 Transcript A). Optionally, the contiguous nucleotides further comprise a segment that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% cal to a segment present in SEQ ID NO: 8 (HSDI 7BI3 Transcript E) that is not present in SEQ ID NO: 11 (HSDI 7BI3 Transcript H) Some such isolated nucleic acids comprise at least 15 contiguous nucleotides ng all or part of an 13 protein, wherein the contiguous nucleotides comprise a segment that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a segment present in SEQ ID NO: 9 (HSDI 7BI3 Transcript F) that is not present in SEQ ID NO: 4 (HSDI 7BI3 Transcript A).

Some such isolated nucleic acids comprise at least 15 uous nucleotides encoding all or part of an HSD17B13 protein, n the contiguous nucleotides comprise a segment that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a segment present in SEQ ID NO: 6 (HSDI 7BI3 Transcript C) that is not present in SEQ ID NO: 4 (HSDI 7BI3 Transcript A).

Optionally, the HSD17B13 protein is a human HSD17B13 protein. Optionally, the isolated nucleic acid comprises at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, or at least 2000 contiguous nucleotides encoding all or part of an HSD17B13 protein.

Some such isolated nucleic acids comprise a sequence at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% cal to the sequence set forth in SEQ ID NO: 6, 7, 8, 9, 10, or 11 (HSDI 7BI3 Transcript C, D, E, F, G, or H) and encoding an HSD17B13 protein comprising the sequence set forth in SEQ ID NO: 14, 15, 16, 17, 18, or 19 (HSD17B13 Isoform C, D, E, F, G, or H), respectively.

In any of the above nucleic acids, the contiguous nucleotides can optionally comprise sequence from at least two different exons of an HSDI 7BI3 gene without an intervening .

In another aspect, provided are proteins encoded by any of the above isolated nucleic acids.

In another aspect, provided are isolated nucleic acids that hybridize to or near the mutant e from the HSDI 7BI3 rs72613567 variant gene. Such isolated nucleic acids can comprise at least 15 uous nucleotides that hybridize to an HSDI 7BI3 gene at a segment that includes or is within 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 tides of a position corresponding to position 12666 in SEQ ID NO: 2 when optimally d with SEQ ID NO: 2. Optionally, the segment is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a corresponding sequence in SEQ ID NO: 2 when optimally d with SEQ ID NO: 2. ally, the segment comprises at least 20, , 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or 2000 contiguous nucleotides of SEQ ID NO: 2. Optionally, the segment includes position 12666 in SEQ ID NO: 2 or a on corresponding to position 12666 in SEQ ID NO: 2 when lly aligned with SEQ ID NO: 2. Optionally, the HSDI 7BI3 gene is a human HSDI 7BI3 gene.

Optionally, the isolated nucleic acid is up to about 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides in length. ally, the isolated nucleic acid is linked to a heterologous nucleic acid or comprises a heterologous label. Optionally, the heterologous label is a fluorescent label.

In r aspect, provided are isolated nucleic acids that hybridize to different HSDI 7BI3 mRNA transcripts or cDNAs. Some such isolated nucleic acids hybridize to at least uous nucleotides of a nucleic acid encoding an HSD17B13 protein, wherein the contiguous nucleotides comprise a segment that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a segment present in SEQ ID NO: 7 BI3 Transcript D), SEQ ID NO: 10 (HSD17BI3 ript G), and SEQ ID NO: 11 (HSDI 7BI3 Transcript H) that is not present within SEQ ID NO: 4 (HSDI 7BI3 Transcript A).

Some such isolated nucleic acids hybridize to at least 15 contiguous nucleotides of a nucleic acid encoding an HSD17B13 protein, wherein the contiguous nucleotides comprise a segment that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a t t in SEQ ID NO: 8 (HSDI 7BI3 Transcript E) and SEQ ID NO: 11 (HSDI 7BI3 Transcript H) that is not present in SEQ ID NO: 4 (HSDI 7BI3 Transcript A).

Some such isolated nucleic acids hybridize to at least 15 uous nucleotides of a c acid encoding an HSD17B13 protein, wherein the contiguous nucleotides comprise a segment that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a segment in SEQ ID NO: 9 (HSDI 7BI3 Transcript F) that is not present in SEQ ID NO: 4 (HSDI 7BI3 Transcript A).

Some such isolated nucleic acids hybridize to at least 15 contiguous nucleotides of a nucleic acid encoding an HSD17B13 protein, wherein the contiguous nucleotides comprise a segment that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a segment present in SEQ ID NO: 6 (HSDI 7BI3 Transcript C) that is not present in SEQ ID NO: 4 (HSDI 7BI3 Transcript A).

Optionally, the HSD17B13 protein is a human HSD17B13 protein. Optionally, the isolated nucleic acid is up to about 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 nucleotides in length. Optionally, the ed nucleic acid is linked to a heterologous nucleic acid or comprises a heterologous label. Optionally, the heterologous label is a fluorescent label. ally, any of the above isolated nucleic acids se DNA. Optionally, any of the above isolated nucleic acids comprise RNA. Optionally, any of the above isolated nucleic acids are an antisense RNA, a short hairpin RNA, or a small-interfering RNA. Optionally, any of the above isolated nucleic acids can include a non-natural nucleotide.

In another aspect, provided are vectors and exogenous donor sequences comprising any of the above isolated nucleic acids and a heterologous nucleic acid sequence.

In another aspect, provided is the use of any of the above isolated c acids, vectors, or exogenous donor sequences in a method of detecting an HSDI 7BI3 3567 variant in a subject, a method of detecting the presence ofHSDI 7BI3 Transcript C, D, E, F, G, or H in a subject, a method of determining a subject’s susceptibility to developing a chronic liver disease, method of diagnosing a subject with fatty liver disease, or a method of modifying an HSDI 7BI3 gene in a cell, a method for altering sion of an HSDI 7BI3 gene in a cell.

In another aspect, provided are guide RNAs that target the HSDI 7BI3 gene. Such guide RNAs can be effective to direct a Gas enzyme to bind to or cleave an HSDI 7BI3 gene, wherein the guide RNA comprises a DNA-targeting segment that hybridizes to a guide RNA ition ce within the HSDI 7BI3 gene. That is, such guide RNAs can be effective to direct a Gas enzyme to bind to or cleave an HSDI 7BI3 gene, wherein the guide RNA comprises a DNA-targeting t that s a guide RNA target sequence within the HSDI 7BI3 gene.

Such guide RNAs can be effective to direct a Gas enzyme to bind to or cleave an HSDI 7BI3 gene, wherein the guide RNA comprises a DNA-targeting segment that targets a guide RNA target sequence within the HSDI 7BI3 gene that includes or is proximate to a position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. ally, the guide RNA target sequence comprises, ts essentially of, or consists of any one of SEQ ID NOS: 226-239 and 264-268. Optionally, the DNA-targeting segment comprises, ts essentially of, or consists of any one of SEQ ID NOS: 1629-1642 and 1648-1652. Optionally, the guide RNA comprises, consists essentially of, or consists of any one of SEQ ID NOS: 706-719; 936-949; 1166-1179, 1396-1409, 725-729, 955-959, 1185-1189, and 1415-1419. Optionally, the guide RNA target sequence is selected from SEQ ID NOS: 226-239 or SEQ ID NOS: 230 and 231. Optionally, the guide RNA target sequence is selected from SEQ ID NOS: 226-230 and 264-268. Optionally, the guide RNA target sequence is within a region corresponding to exon 6 and/or intron 6 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally d with SEQ ID NO: 2. Optionally, the guide RNA target sequence is within a region corresponding to exon 6 and/or intron 6 and/or exon 7 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. Optionally, the guide RNA target sequence is within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, , 15, 10, or 5 nucleotides of the position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. Optionally, the guide RNA target sequence includes the position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is lly aligned with SEQ ID NO: 2.

Such guide RNAs can be effective to direct a Gas enzyme to bind to or cleave an HSDI 7BI3 gene, n the guide RNA comprises a DNA-targeting t that targets a guide RNA target sequence within the HSDI 7BI3 gene that includes or is proximate to the start codon of the HSDI 7BI3 gene. Optionally, the guide RNA target ce comprises, consists essentially of, or consists of any one of SEQ ID NOS: 20-81 and 259-263. Optionally, the DNA- targeting segment ses, consists essentially of, or consists of any one of SEQ ID NOS: 1423-1484 and 1643-1647. Optionally, the guide RNA comprises, consists essentially of, or consists of any one of SEQ ID NOS: 1, 730-791, 960-1021, 1190-1251, 720-724, 950- 954, 1180-1184, and 1410-1414. ally, the guide RNA target sequence is selected from SEQ ID NOS: 20-81 and 259-263. Optionally, the guide RNA target sequence is ed from SEQ ID NOS: 21 -23, 33, and 35. Optionally, the guide RNA target sequence is selected from SEQ ID NOS: 33 and 35. ally, the guide RNA target sequence is within a region corresponding to exon 1 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. Optionally, the guide RNA target sequence is within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the start codon.

Such guide RNAs can be effective to direct a Gas enzyme to bind to or cleave an HSDI 7BI3 gene, wherein the guide RNA comprises a DNA-targeting segment that targets a guide RNA target ce within the HSDI 7BI3 gene that includes or is proximate to the stop codon of the HSDI 7BI3 gene. Optionally, the guide RNA target sequence comprises, consists essentially of, or consists of any one of SEQ ID NOS: 82-225. Optionally, the DNA-targeting segment comprises, consists essentially of, or consists of any one of SEQ ID NOS: 1485-1628.

Optionally, the guide RNA comprises, consists essentially of, or consists of any one of SEQ ID NOS: 562-705, 792-935, 1022-1165, and 1252-1395. ally, the guide RNA target sequence is selected from SEQ ID NOS: 82-225. Optionally, the guide RNA target sequence is within a region corresponding to exon 7 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. Optionally, the guide RNA target sequence is within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the stop codon.

Optionally, the HSDI 7BI3 gene is a human HSDI 7BI3 gene. Optionally, the HSDI 7BI3 gene comprises SEQ ID NO: 2.

Some such guide RNAs comprise a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) RNA (chNA) comprising the DNA-targeting segment and a trans-activating CRISPR RNA (trachNA). Optionally, the guide RNA is a modular guide RNA in which the chNA and the trachNA are te molecules that ize to each other.

Optionally, the chNA comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 1421 and the trachNA comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 1422. Optionally, the guide RNA is a single-guide RNA in which the chNA is fused to the trachNA via a linker. Optionally, the single-guide RNA comprises, consists essentially of, or ts of the sequence set forth in any one of SEQ ID NOS: 1420 and 8.

In another aspect, provided are antisense RNAs, siRNAs, or shRNAs that hybridize to a sequence within an HSDI 7BI3 transcript disclosed herein. Some such antisense RNAs, siRNAs, or shRNAs ize to a sequence within SEQ ID NO: 4 (HSDI 7BI3 Transcript A).

Optionally, the antisense RNA, siRNA, or shRNA can decrease expression ofHSDI 7BI3 Transcript A in a cell. Optionally, the antisense RNA, siRNA, or shRNA hybridizes to a sequence present in SEQ ID NO: 4 (HSDI 7BI3 Transcript A) that is not present in SEQ ID NO: 7 (HSDI 7BI3 Transcript D). Optionally, the antisense RNA, siRNA, or shRNA hybridizes to a sequence within exon 7 or a sequence spanning the exon 6-exon 7 boundary of SEQ ID NO: 4 (HSDI 7BI3 Transcript A). Some such antisense RNAs, siRNAs, or shRNAs hybridize to a ce within SEQ ID NO: 7 (HSDI 7BI3 Transcript D). Optionally, the antisense RNA, siRNA, or shRNA can se expression ofHSDI 7BI3 Transcript D in a cell. Optionally, the antisense RNA, siRNA, or shRNA hybridizes to a ce present in SEQ ID NO: 7 (HSDI 7BI3 Transcript D) that is not present in SEQ ID NO: 4 (HSDI 7BI3 Transcript A).

Optionally, the antisense RNA, siRNA, or shRNA izes to a sequence within exon 7 or a sequence spanning the exon 6-exon 7 boundary of SEQ ID NO: 7 (HSDI 7BI3 Transcript D).

In another aspect, provided are DNAs encoding any of the above guide RNAs, nse RNAs, siRNAs, or shRNAs. In another aspect, provided are s comprising a DNA ng any of the above guide RNAs, antisense RNAs, siRNAs, or shRNAs and a heterologous nucleic acid. In another aspect, provided is the use of any of the above guide RNAs, antisense RNAs, siRNAs, or shRNAs DNAs ng guide RNAs, antisense RNAs, siRNAs, or shRNAs or vectors sing DNAs encoding guide RNAs, antisense RNAs, siRNAs, or shRNAs in a method of modifying an HSDI 7BI3 gene in a cell or a method for altering expression of an HSDI 7BI3 gene in a cell.

In another aspect, provided are itions comprising any of the above isolated c acids, any of the above guide RNAs, any of the above isolated polypeptides, any of the above antisense RNAs, siRNAs, or shRNAs, any of the above vectors, or any of the above exogenous donor sequences. Optionally, the composition comprises any of the above guide RNAs and a Gas protein, such as a Cas9 protein. Optionally, such compositions comprise a carrier increasing the stability of the isolated polypeptide, the guide RNA, the antisense RNA, the siRNA, the shRNA, the isolated nucleic acid, the vector, or the exogenous donor sequence. ally, the carrier comprises a poly(lactic acid) (PLA) microsphere, a ,L-lactic- coglycolic-acid) (PLGA) microsphere, a liposome, a micelle, an inverse micelle, a lipid cochleate, or a lipid microtubule.

Also provided are cells comprising any of the above isolated nucleic acids, any of the above guide RNAs, any of the above antisense RNAs, siRNAs, or shRNAs, any of the above isolated polypeptides, or any of the above vectors. Optionally, the cell is a human cell, a rodent cell, a mouse cell, or a rat cell. Optionally, any of the above cells are liver cells or pluripotent cells.

Also provided are uses of any of the above guide RNAs in a method of modifying an HSDI 7BI3 gene in a cell or a method for altering expression of an HSDI 7BI3 gene in a cell.

Also provided are uses of any of the above antisense RNAs, , or shRNAs in a method for altering expression of an HSDI 7BI3 gene in a cell.

Also provided are s of ing a cell, modifying an HSDI 7BI3 gene, or altering expression of an HSDI 7BI3 gene. Some such methods are for modifying an HSDI 7BI3 gene in a cell, comprising contacting the genome of the cell with: (a) a Gas protein; and (b) a guide RNA that forms a complex with the Gas protein and targets a guide RNA target sequence within the HSDI 7BI3 gene, wherein the guide RNA target sequence includes or is ate to a on corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2, wherein the Gas protein cleaves the HSDI 7BI3 gene.

Optionally, the Gas protein is a Cas9 protein. Optionally, the guide RNA target sequence comprises, consists essentially of, or consists of any one of SEQ ID NOS: 226-239 and 264-268.

Optionally, the DNA-targeting segment comprises, consists essentially of, or ts of any one of SEQ ID NOS: 1629-1642 and 652. Optionally, the guide RNA comprises, consists essentially of, or consists of any one of SEQ ID NOS: 706-719; 936-949; 1166-1179, 1396-1409, 725-729, 955-959, 1185-1189, and 1415-1419. Optionally, the guide RNA target sequence is selected from SEQ ID NOS: 226-239, or wherein the guide RNA target sequence is selected from SEQ ID NOS: 230 and 231. Optionally, the guide RNA target ce is selected from SEQ ID NOS: 226-239 and 264-268 or is selected from SEQ ID NOS: 264-268. Optionally, the guide RNA target sequence is within a region corresponding to exon 6 and/or intron 6 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. Optionally, the guide RNA target sequence is within a region ponding to exon 6 and/or intron 6 and/or exon 7 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. ally, the guide RNA target sequence is within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, , 20, 15, 10, or 5 nucleotides of the position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. Optionally, the guide RNA target sequence includes the position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2.

Some such methods further comprise contacting the genome with an exogenous donor sequence comprising a 5’ gy arm that hybridizes to a target sequence 5’ of the position corresponding to position 12666 of SEQ ID NO: 2 and a 3’ homology arm that hybridizes to a target sequence 3’ of the position corresponding to position 12666 of SEQ ID NO: 2, wherein the exogenous donor sequence recombines with the HSDI 7BI3 gene.

Optionally, the exogenous donor sequence further ses a nucleic acid insert flanked by the ’ homology arm and the 3’ homology arm. ally, the c acid insert comprises a thymine, and n upon recombination of the exogenous donor sequence with the HSDI 7BI3 gene, the thymine is inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1. Optionally, the exogenous donor sequence is between about 50 nucleotides to about 1 kb in length or n about 80 nucleotides to about 200 nucleotides in length. Optionally, the ous donor sequence is a single-stranded oligodeoxynucleotide.

Some such methods are for modifying an HSDI 7BI3 gene in a cell, comprising contacting the genome of the cell with: (a) a Gas protein; and (b) a first guide RNA that forms a complex with the Gas protein and targets a first guide RNA target sequence within the HSDI 7BI3 gene, wherein the first guide RNA target sequence comprises the start codon for the HSDI 7BI3 gene or is within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon or is selected fiom SEQ ID NOS: 20-81 or is selected from SEQ ID NOS: 20-81 and 259-263, wherein the Gas protein cleaves or alters expression of the HSDI 7BI3 gene. Optionally, the first guide RNA target sequence comprises, consists essentially of, or consists of any one of SEQ ID NOS: 20-81 and 259-263. Optionally, the first guide RNA target sequence comprises, ts essentially of, or consists of any one of SEQ ID NOS: 20-41, any one of SEQ ID NOS: 21-23, 33, and 35, or any one of SEQ ID NOS: 33 and . ally, the first guide RNA comprises, consists essentially of, or consists of a DNA- targeting segment that comprises any one of SEQ ID NOS: 1423-1484 and 1643-1647.

Optionally, the first guide RNA ses, consists essentially of, or ts of a DNA- ing segment that comprises any one of SEQ ID NOS: 1447-1468, any one of SEQ ID NOS: 1448-1450, 1460, and 1462; or any one of SEQ ID NOS: 1460 and 1462. Optionally, the first guide RNA comprises, ts essentially of, or consists of any one of SEQ ID NOS: 500-561, 730-791, 960-1021, 1190-1251, 720-724, 950-954, 1180-1184, and 1410-1414. Optionally, the first guide RNA comprises, consists essentially of, or consists of any one of SEQ ID NOS: 524- 545, 5, 984-1005, and 1214-1235, or any one of SEQ ID NOS: 295-297, 525-527, 755- 757, 985-987, 1215-1217, 307, 309, 537, 539, 767, 769, 997, 999, 1227, and 1229, or any one of SEQ ID NOS: 307, 309, 537, 539, 767, 769, 997, 999, 1227, and 1229. Optionally, the first guide RNA target ce is selected from SEQ ID NOS: 20-41, is selected fiom SEQ ID NOS: 21-23, 33, and 35, or is selected fiom SEQ ID NOS: 33 and 35. Optionally, the Gas protein is a Cas9 protein. Optionally, the Gas protein is a nuclease-active Cas n. Optionally, the Gas protein is a nuclease-inactive Cas protein fused to a transcriptional activator domain or a nuclease-inactive Cas protein fused to a transcriptional repressor domain.

Some such methods further comprise contacting the genome of the cell with a second guide RNA that forms a complex with the Gas protein and targets a second guide RNA target sequence within the HSDI 7BI3 gene, wherein the second guide RNA target sequence comprises the stop codon for the HSDI 7BI3 gene or is within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the stop codon or is selected from SEQ ID NOS: 82-225, n the cell is modified to comprise a deletion between the first guide RNA target sequence and the second guide RNA target sequence. ally, the second guide RNA target sequence comprises, consists essentially of, or consists of any one of SEQ ID NOS: 82-225. Optionally, the second guide RNA comprises, ts essentially of, or consists of a rgeting segment that ses any one of SEQ ID NOS: 628. Optionally, the second guide RNA comprises, consists essentially of, or consists of any one of SEQ ID NOS: 562-705, 792- 935, 1022-1165, and 1252-1395.

Some such methods are for decreasing expression of an HSDI 7BI3 gene in a cell or decreasing expression of a particular HSDI 7BI3 ript (e.g., Transcript A or Transcript D) in a cell. Some such methods are for decreasing expression of an HSDI 7BI3 gene in a cell, comprising: contacting the genome of the cell with an antisense RNA, an siRNA, or an shRNA that hybridizes to a sequence within exon 7 of SEQ ID NO: 4 (HSDI 7BI3 Transcript A) and decreases expression ofHSDI 7BI3 Transcript A. Some such methods are for decreasing expression of an HSDI 7BI3 gene in a cell, comprising: contacting the genome of the cell with an antisense RNAs, an siRNA, or an shRNA that hybridizes to a sequence within an HSDI 7BI3 transcript disclosed herein. In some such methods, the antisense RNA, siRNA, or shRNA hybridizes to a sequence within SEQ ID NO: 4 (HSDI 7BI3 Transcript A). ally, the antisense RNA, siRNA, or shRNA can decrease sion ofHSDI 7BI3 Transcript A in a cell.

Optionally, the antisense RNA, siRNA, or shRNA hybridizes to a sequence present in SEQ ID NO: 4 (HSDI 7BI3 Transcript A) that is not present in SEQ ID NO: 7 (HSDI 7BI3 Transcript D).

Optionally, the antisense RNA, siRNA, or shRNA izes to a sequence within exon 7 or a sequence spanning the exon 6-exon 7 boundary of SEQ ID NO: 4 (HSDI 7BI3 Transcript A). In some such methods, the nse RNA, siRNA, or shRNA hybridizes to a sequence within SEQ ID NO: 7 (HSDI 7BI3 Transcript D). Optionally, the antisense RNA, siRNA, or shRNA can decrease expression ofHSDI 7BI3 Transcript D in a cell. Optionally, the antisense RNA, siRNA, or shRNA hybridizes to a sequence present in SEQ ID NO: 7 (HSDI 7BI3 ript D) that is not present in SEQ ID NO: 4 (HSDI 7BI3 Transcript A). Optionally, the antisense RNA, siRNA, or shRNA hybridizes to a sequence within exon 7 or a sequence spanning the exon 6- exon 7 boundary of SEQ ID NO: 7 (HSDI 7BI3 Transcript D).

In any of the above methods for of modifying an HSDI 7BI3 gene or altering expression of an HSDI 7BI3 gene, the method can further comprise introducing an expression vector into the cell, wherein the expression vector comprises a recombinant HSDI 7BI3 gene comprising a thymine inserted between nucleotides corresponding to ons 12665 and 12666 of SEQ ID NO: 1 when the inant HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1. Optionally, the recombinant HSDI 7BI3 gene is a human gene. Optionally, the recombinant HSDI 7BI3 gene is an HSDI 7BI3 minigene in which one or more nonessential segments of the gene have been deleted with respect to a corresponding wild type HSDI 7BI3 gene. Optionally, the d segments se one or more intronic sequences. Optionally, the HSDI 7BI3 minigene comprises an intron corresponding to intron 6 of SEQ ID NO: 2 when optimally aligned with SEQ ID NO: 2.

In any of the above methods for of modifying an HSDI 7BI3 gene or altering expression of an HSDI 7BI3 gene, the method can further comprise introducing an expression vector into the cell, wherein the expression vector comprises a nucleic acid encoding an HSD17B13 protein that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15 (HSD17B13 Isoform D). ally, the nucleic acid encoding the 13 protein is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 7 (HSD17BI3 Transcript D) when optimally aligned with SEQ ID NO: 7.

In any of the above methods for of modifying an HSDI 7BI3 gene or altering expression of an HSDI 7BI3 gene, the method can r comprise introducing an HSD17B13 n or fragment thereof into the cell. Optionally, the HSD17B13 protein or nt thereof is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% cal to SEQ ID NO: 15 (HSD17B13 Isoform D).

Some such methods are for modifying a cell, comprising introducing an expression vector into the cell, wherein the expression vector comprises a recombinant HSDI 7BI3 gene comprising a thymine inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the recombinant HSDI 7BI3 gene is lly aligned with SEQ ID NO: 1. Optionally, the recombinant HSDI 7BI3 gene is a human gene. Optionally, the recombinant HSDI 7BI3 gene is an HSDI 7BI3 minigene in which one or more nonessential ts of the gene have been deleted with respect to a corresponding wild type HSDI 7BI3 gene. Optionally, the deleted segments comprise one or more intronic sequences. Optionally, the HSDI 7313 ne comprises an intron corresponding to intron 6 of SEQ ID NO: 2 when optimally aligned with SEQ ID NO: 2.

Some such methods are for modifying a cell, comprising introducing an expression vector into the cell, wherein the expression vector comprises a nucleic acid encoding an HSD17B13 protein that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15 (HSD17B13 Isoform D). Optionally, the nucleic acid encoding the HSD17B13 protein is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 7 (HSD17BI3 Transcript D) when lly aligned with SEQ ID NO: 7.

Some such methods are for ing a cell, comprising introducing an HSD17B13 protein or fragment thereof into the cell. Optionally, the HSD17B13 protein or nt thereof is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15 (HSD17B13 Isoform D).

In any of the above methods of modifying a cell, modifying an HSDI 7BI3 gene, or altering expression of an HSDI 7BI3 gene, the cell can be a human cell, a rodent cell, a mouse cell, or a rat cell. Any of the cells can be pluripotent cells or differentiated cells. Any of the cells can be liver cells. In any of the above methods of modifying a cell, ing an HSDI 7BI3 gene, or altering expression of an HSDI 7BI3 gene, the method or cell can be ex vivo or in vivo. The guide RNAs used in any of the above methods can be modular guide RNAs comprising separate chNA and trachNA les that hybridize to each other or a single- guide RNA in which the chNA portion is fused to the trachNA portion (e.g., by a linker).

In another aspect, provided are methods of treating a subject who has or is susceptible to developing a chronic liver disease. In another aspect, provided are methods of treating a subject who has or is susceptible to developing an alcoholic or nonalcoholic liver e. Such subjects can be, for example, a subject who is not a carrier of the HSDI 7BI3 rs72613567 t or subject who is not a homozygous carrier of the HSDI 7BI3 rs72613567 variant. Some such s comprise a method of treating a subject who is not a carrier of the HSDI 7BI3 rs72613567 variant and has or is susceptible to developing a chronic liver disease, comprising introducing into the subject: (a) a Gas protein or a nucleic acid encoding the Gas n; (b) a guide RNA or a c acid encoding the guide RNA, wherein the guide RNA forms a complex with the Gas protein and targets a guide RNA target sequence within an HSDI 7BI3 gene, wherein the guide RNA target sequence includes or is proximate to a position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2; and (c) an exogenous donor sequence sing a 5’ homology arm that hybridizes to a target ce 5’ of the position corresponding to position 12666 of SEQ ID NO: 2, a 3’ homology arm that hybridizes to a target sequence 3 ’ of the position corresponding to position 12666 of SEQ ID NO: 2, and a nucleic acid insert comprising a thymine flanked by the 5’ gy arm and the 3 ’ homology arm, wherein the Gas protein cleaves the HSDI 7BI3 gene in a liver cell in the t and the exogenous donor sequence recombines with the HSDI 7BI3 gene in the liver cell, wherein upon recombination of the exogenous donor sequence with the HSDI 7BI3 gene, the thymine is inserted between nucleotides corresponding to ons 12665 and 12666 of SEQ ID NO: 1 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1.

Optionally, the guide RNA target ce is selected from SEQ ID NOS: 226-239, or wherein the guide RNA target sequence is selected from SEQ ID NOS: 230 and 231.

Optionally, the guide RNA target sequence is ed from SEQ ID NOS: 226-239 and 8.

Optionally, the guide RNA target sequence is within a region corresponding to exon 6 and/or intron 6 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2.

Optionally, the guide RNA target sequence is within a region corresponding to exon 6 and/or intron 6 and/or exon 7 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. Optionally, the guide RNA target sequence is within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. Optionally, the guide RNA target sequence includes the position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is lly aligned with SEQ ID NO: 2.

Optionally, the exogenous donor sequence is between about 50 nucleotides to about 1 kb in length. Optionally, the exogenous donor sequence is between about 80 nucleotides to about 200 nucleotides in length. Optionally, the exogenous donor sequence is a -stranded eoxynucleotide.

Some such methods comprise a method of treating a subject who is not a carrier of the HSDI 7BI3 rs72613567 variant and has or is susceptible to developing a chronic liver disease, comprising introducing into the subject: (a) a Gas protein or a nucleic acid encoding the Cas protein; (b) a first guide RNA or a nucleic acid encoding the first guide RNA, wherein the first guide RNA forms a x with the Gas protein and targets a first guide RNA target sequence within an HSDI 7BI3 gene, wherein the first guide RNA target sequence comprises the start codon for the HSDI 7BI3 gene or is within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon or is selected fiom SEQ ID NOS: 20-81 or is selected from SEQ ID NOS: 20-81 and 259-263; and (c) an expression vector comprising a recombinant HSDI 7BI3 gene comprising a e inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the recombinant HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1, wherein the Gas protein cleaves or alters expression of the HSDI 7BI3 gene in a liver cell in the subject and the expression vector expresses the inant HSDI 7BI3 gene in the liver cell in the subject. Some such methods comprise a method of treating a subject who is not a r of the HSDI 7BI3 rs72613567 variant and has or is susceptible to developing a c liver disease, comprising introducing into the subject: (a) a Gas protein or a nucleic acid encoding the Gas protein; (b) a first guide RNA or a nucleic acid encoding the first guide RNA, n the first guide RNA forms a complex with the Gas protein and targets a first guide RNA target sequence within an HSDI 7BI3 gene, wherein the first guide RNA target sequence comprises the start codon for the HSDI 7BI3 gene or is within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon or is selected from SEQ ID NOS: 20-81 or is selected from SEQ ID NOS: 20-81 and 259-263; and optionally (c) an expression vector comprising a recombinant HSDI 7BI3 gene comprising a thymine inserted between nucleotides corresponding to ons 12665 and 12666 of SEQ ID NO: 1 when the recombinant HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1, wherein the Gas protein cleaves or alters expression of the HSDI 7BI3 gene in a liver cell in the subject and the expression vector expresses the recombinant HSDI 7BI3 gene in the liver cell in the Optionally, the first guide RNA target sequence is ed from SEQ ID NOS: 20- 41, is selected from SEQ ID NOS: 21-23, 33, and 35, or is selected from SEQ ID NOS: 33 and . Optionally, the Gas protein is a nuclease-active Cas protein. Optionally, the Gas protein is a nuclease-inactive Cas n fused to a transcriptional repressor domain.

Such methods can further comprise introducing into the subject a second guide RNA, wherein the second guide RNA forms a complex with the Gas protein and targets a second guide RNA target sequence within the HSDI 7BI3 gene, wherein the second guide RNA target sequence comprises the stop codon for the HSDI 7BI3 gene or is within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the stop codon or is ed from SEQ ID NOS: , wherein the Gas protein cleaves the HSDI 7BI3 gene in the liver cell within both the first guide RNA target sequence and the second guide RNA target sequence, wherein the liver cell is modified to comprise a deletion between the first guide RNA target sequence and the second guide RNA target sequence.

Optionally, the recombinant HSDI 7BI3 gene is an HSDI 7BI3 minigene in which one or more nonessential segments of the gene have been d with respect to a corresponding wild type HSDI 7BI3 gene. Optionally, the deleted segments comprise one or more ic sequences. Optionally, the HSDI 7BI3 ne comprises an intron corresponding to intron 6 of SEQ ID NO: 2 when lly aligned with SEQ ID NO: 2.

In any of the above therapeutic or prophylactic methods, the Gas protein can be a Cas9 ns. In any of the above therapeutic or prophylactic methods, the subject can be a human. In any of the above therapeutic or prophylactic methods, the chronic liver disease can be a fatty liver disease, a nonalcoholic fatty liver disease (NAFLD), an alcoholic liver fatty liver disease, a cirrhosis, or a hepatocellular carcinoma. Likewise, in any of the above methods, the therapeutic or prophylactic method can be for a liver disease that is an alcoholic liver e or a nonalcoholic liver e.

Some such methods comprise a method of treating a subject who is not a carrier of the HSDI 7BI3 rs72613567 variant and has or is susceptible to developing a chronic liver disease, comprising introducing into the subject: an antisense RNA, an siRNA, or an shRNA that hybridizes to a sequence within exon 7 or a sequence spanning the exon 6-exon 7 boundary of SEQ ID NO: 4 (HSDI 7BI3 Transcript A) and decreases expression ofHSDI 7BI3 Transcript A in a liver cell in the subject. Some such methods comprise a method of treating a subject who is not a r of the HSDI 7BI3 rs72613567 variant and has or is susceptible to developing a chronic liver disease, comprising introducing into the subject: an antisense RNAs, an siRNA, or an shRNA that hybridizes to a sequence within an HSDI 7BI3 transcript disclosed .

Optionally, the antisense RNA, siRNA, or shRNA hybridizes to a sequence within SEQ ID NO: 4 (HSDI 7BI3 Transcript A). Optionally, the antisense RNA, siRNA, or shRNA can decrease sion ofHSDI 7BI3 Transcript A in a cell. Optionally, the antisense RNA, siRNA, or shRNA hybridizes to a sequence present in SEQ ID NO: 4 (HSDI 7BI3 Transcript A) that is not present in SEQ ID NO: 7 (HSDI 7BI3 Transcript D). Optionally, the antisense RNA, siRNA, or shRNA hybridizes to a sequence within exon 7 or a sequence spanning the exon 6-exon 7 boundary of SEQ ID NO: 4 (HSDI 7BI3 Transcript A).

Optionally, such methods further comprise introducing an expression vector into the subject, wherein the expression vector comprises a recombinant HSDI 7B]3 gene comprising a e inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the recombinant HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1, wherein the expression vector expresses the recombinant HSDI 7BI3 gene in the liver cell in the subject. ally, such methods further comprise introducing an expression vector into the t, wherein the expression vector comprises a nucleic acid ng an HSD17B13 protein that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15 (HSD17B13 Isoform D), wherein the expression vector expresses the c acid encoding the 13 protein in the liver cell in the subject. Optionally, the nucleic acid encoding the HSD17B13 protein is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 7 (HSD17BI3 Transcript D) when optimally aligned with SEQ ID NO: 7.

Optionally, such methods further comprise introducing a messenger RNA into the subject, wherein the messenger RNA encodes an HSD17B13 protein that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15 B13 Isoform D), n the mRNA expresses the HSD17B13 protein in the liver cell in the subject. Optionally, a complementary DNA reverse transcribed from the ger RNA is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% cal to SEQ ID NO: 7 (HSDI 7BI3 Transcript D) when optimally aligned with SEQ ID NO: Optionally, such methods further se introducing an HSD17B13 protein or fragment thereof into the subject. Optionally, the HSD17B13 protein or fragment thereof is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15 (HSD17B13 m D).

Some such methods comprise a method of treating a subject who is not a carrier of the HSDI 7BI3 rs72613567 variant and has or is susceptible to ping a chronic liver disease comprising introducing an expression vector into the subject, n the expression vector comprises a recombinant HSDI 7BI3 gene comprising a e inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the recombinant HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1, wherein the expression vector expresses the recombinant HSDI 7BI3 gene in a liver cell in the subject.

In any of the above methods, the inant HSDI 7BI3 gene can be a human gene.

In any of the above methods, the recombinant HSDI 7BI3 gene can be at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 2 when optimally aligned with SEQ ID NO: 2. In any of the above methods, the recombinant HSDI 7BI3 gene can be an HSDI 7BI3 minigene in which one or more nonessential segments of the gene have been deleted with respect to a corresponding wild type HSDI 7BI3 gene.

Optionally, the deleted segments comprise one or more intronic sequences. Optionally, the HSDI 7BI3 minigene comprises an intron corresponding to intron 6 of SEQ ID NO: 2 when lly aligned with SEQ ID NO: 2.

Some such methods comprise a method of treating a subject who is not a carrier of the HSDI 7BI3 rs72613567 variant and has or is susceptible to developing a chronic liver disease comprising introducing an expression vector into the subject, wherein the expression vector comprises a nucleic acid encoding an HSD17B13 protein that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15 (HSD17B13 Isoform D), wherein the expression vector expresses the nucleic acid encoding the HSD17B13 protein in a liver cell in the subject. ally, the c acid encoding the HSD17B13 protein is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 7 (HSDI 7BI3 ript D) when optimally aligned with SEQ ID NO: 7.

Some such methods comprise a method of treating a subject who is not a r of the HSDI 7BI3 rs72613567 variant and has or is susceptible to developing a chronic liver disease sing introducing a messenger RNA into the subject, n the ger RNA encodes an HSD17B13 protein that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15 (HSD17B13 Isoform D), wherein the mRNA expresses the HSD17B13 n in the liver cell in the subject. Optionally, a complementary DNA reverse transcribed from the messenger RNA is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 7 (HSD17BI3 Transcript D) when lly aligned with SEQ ID NO: 7.

Some such methods comprise a method of treating a subject who is not a carrier of the HSDI 7BI3 rs72613567 variant and has or is susceptible to developing a chronic liver disease comprising introducing an HSD17B13 protein or fragment thereof into the liver of the t.

Optionally, the HSD17B13 protein or fragment thereof is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15 (HSD17B13 Isoform D).

In any of the above methods, the t can be a human. In any of the above methods, the chronic liver disease can be nonalcoholic fatty liver disease (NAFLD), alcoholic liver fatty liver disease, cirrhosis, or hepatocellular carcinoma. Likewise, in any of the above methods, the therapeutic or prophylactic method can be for a liver disease that is an alcoholic liver disease or a nonalcoholic liver disease. In any of the above methods, the introducing into the subject can comprise hydrodynamic delivery, virus-mediated delivery, lipid-nanoparticle- mediated delivery, or intravenous infusion.

BRIEF DESCRIPTION OF THE S Figures 1A and 1B show tan plots (left) and quantile-quantile plots (right) of single tide variant associations with median alanine aminotransferase (ALT; Figure 1A) and ate aminotransferase (AST; Figure 1B) levels in the GHS discovery cohort. Figure 1A shows that there were 31 variants in 16 genes significantly associated with ALT levels (N=41,414) at P < 1.0 x 107. Figure 1B shows that there were 12 variants in 10 genes significantly associated with AST levels (N=40,753) at P < 1.0 x 107. All significant associations are shown in Table 2. There were en variants in nine genes (indicated here by their gene name), including HSDI 7313, that remained significantly associated with ALT or AST in a replication meta-analysis of three separate an-ancestry cohorts (Table 3). The association tests were well calibrated, as shown by wide quantile-quantile plots and c control lambda values (Figure 1A and Figure 1B).

Figures 2A and 2B show that HSDI 7BI3 rs72613567:TA is associated with reduced risk of alcoholic and nonalcoholic liver disease phenotypes in the discovery cohort (Figure 2A), and with reduced risk ression from simple steatosis to steatohepatitis and fibrosis in the bariatric surgery cohort (Figure 2B). Odds ratios were calculated using logistic regression, with adjustment for age, age2, sex, BMI, and pal ents of ancestry. Genotypic odds ratios for heterozygous (Het OR) and homozygous (Hom OR) carriers are also shown. In the GHS discovery cohort in Figure 2A, variant HSDI 7313 was associated with significantly reduced risk of nonalcoholic and alcoholic liver disease, cirrhosis, and hepatocellular carcinoma in an allele dosage-dependent manner. In the GHS bariatric surgery cohort in Figure 2B, HSDI 7BI3 3567 was ated with 13% and 52% lower odds of nonalcoholic steatohepatitis (NASH), and 13% and 61% lower odds of fibrosis, in heterozygous and homozygous TA rs, respectively.

Figures 3A-3D show expression of four HSDI 7BI3 Transcripts (A-D) in homozygous reference (T/T), heterozygous (T/TA), and homozygous alternate (TA/TA) carriers of the HSDI 7BI3 rs72613567 splice variant. Each transcript is illustrated with a corresponding gene model. Coding regions in gene models are indicated in the striped boxes and untranslated regions in the black boxes. Figure 3A shows a representation of Transcript A and expression data for Transcript A. Figure 3B shows a representation of Transcript B and expression data for Transcript B. In ript B, exon 2 is skipped. Figure 3C shows a representation of Transcript C and expression data for Transcript C. In Transcript C, exon 6 is skipped. Figure 3D shows a representation of Transcript D and expression data for Transcript D. The asterisk in Transcript D illustrates insertion of G fiom rs72613567 at the 3’ end of exon 6, which leads to premature truncation of the protein. Transcript D becomes the dominant transcript in homozygous carriers of the HSDI 7BI3 splice variant. Gene expression is displayed in FPKM units (Fragments Per Kilobase of transcript per n mapped reads). Insets in Figure 3B and Figure 3C show a zoomed-in view.

Figure 4 shows that q studies ofhuman liver reveal eight HSDI 7BI3 ripts, including six novel HSDI 7BI3 transcripts (Transcripts C-H). Expression of the transcripts is displayed in FPKM units (fragments per kilobase of transcript per million mapped reads). Structures of the transcripts are provided on the right side of the figure.

Figures 5A and 5B show locus-zoom plots ofHSDI 7BI3 (regional association plots in the region around HSDI 7313) in the GHS discovery cohort for ALT and AST, respectively.

No significant recombination across the region was ed. Diamonds indicate the splice variant 3567. Each circle indicates a single nucleotide variant with the color of the circle WO 36758 2018/014454 indicating the linkage disequilibrium (r2 calculated in the DiscovEHR cohort) between that variant and 3567. Lines te estimated recombination rates in HapMap. The bottom panels show the relative position and the transcribed strand of each gene in the locus. There were no significant associations between ALT or AST and coding or splice region ts in the neighboring gene HSDI 7B] 1 (most significant P-values 1.4x10'1 and 4.3x10'2 for ALT and AST, respectively).

Figures 6A-6D show mRNA expression of four additional novel HSDI 7BI3 transcripts (E-H) in homozygous reference (T/T), heterozygous (T/TA), and homozygous alternate (TA/TA) carriers of the HSDI 7BI3 splice variant. Each transcript is illustrated with a corresponding gene model. Coding regions in gene models are indicated in striped boxes and untranslated regions in black boxes. Figures 6A and 6D show that Transcripts E and H contain an additional exon between exons 3 and 4. Figure 6B shows that Transcript F involves read- through from exon 6 to intron 6. Figure 6C shows that in ript G, exon 2 is skipped. The asterisk in Transcripts G and H es 6C and 6D, respectively) illustrates insertion ofG from rs72613567 at the 3’ end of exon 6, which leads to premature truncation of the protein. The transcripts are differentially expressed according to HSDI 7BI3 genotype, as shown in the box plots. mRNA expression is displayed in FPKM units (Fragments Per Kilobase of transcript per Million mapped reads).

Figures 7A-7B show a protein sequence alignment of HSD17B13 protein ms Figure 8 shows that HSDI 7BI3 rs72613567:TA is ated with reduced risk of lic and nonalcoholic liver disease phenotypes. Specifically, Figure 8 shows in the Dallas Liver Study, HSDI 7BI3 rs72613567 was associated with lower odds of any liver e in an allele dosage-dependent manner. Similar allele dosage-dependent effects were observed across liver disease subtypes. Odds ratios were calculated using logistic regression, with adjustment for age, age2, gender, BMI, and self-reported ethnicity.

Figure 9 shows HSDI 7BI3 rs72613567 is associated with reduced risk of progression fiom simple steatosis to steatohepatitis and fibrosis. Specifically, it shows that prevalence of histopathologically-characterized liver disease according to HSDI 7BI3 rs72613567 genotype in 2,391 duals with liver biopsies from the GHS bariatric surgery cohort. The prevalence of normal liver did not appear to differ by genotype (P = 0.5 by Chi- squared test for trend in proportions), but the prevalence ofNASH decreased (P = 1.6x10'4) and that of simple steatosis increased (P = 1.1x10‘3) with each TA allele.

Figures 10A-10E show expression, subcellular localization, and enzymatic activity of a novel HSDI 7BI3 transcript. Figure 10A shows a Western blot from HepG2 cells overexpressing HSDI 7BI3 Transcripts A and D and shows that HSDI 7B]3 Transcript D was translated to a truncated protein with lower molecular weight compared to HSDI 7BI3 Transcript A. Figure 10B shows HSD17B13 western blots from fresh frozen human liver and HEK293 cell samples. Human liver samples are from homozygous reference (T/T), heterozygous (T/TA), and gous alternate (TA/TA) carriers of the HSDI 7BI3 rs72613567 splice t. Cell samples are from HEK293 cells overexpressing non-tagged HSDI 7BI3 Transcripts A and D.

HSDI 7BI3 Transcript D was translated to a truncated protein IsoD with lower molecular weight than HSD17B13 IsoA. Figure 10C shows HSD17B13 IsoD n levels were lower than IsoA protein levels from both human liver (left) and cell (right) samples. Protein level normalized to actin is shown in the bar columns; ** P<0.001, 5. Figure 10D shows enzymatic ty ofHSD17B13 isoforms A and D to 17-beta estradiol (estradiol), leukotriene B4 , and 13- Hydroxyoctadecadienoic acid -HODE). HSD17B13 Isoform D shows <10% enzymatic activity of the corresponding values for Isoform A. Figure 10E shows HSD17B13 Isoform D when overexpressed in HEK293 cells did not show much conversion of estradiol (substrate) to estrone (product) when measured in the culture media, while overexpressed HSD17B13 Isoform A showed robust conversion.

Figures 11A-11C show that HSD17B13 m D protein has lower molecular weight and is unstable when overexpressed in HEK 293 cells. Figure 11A shows RT-PCR of HSDI 7313 from HEK 293 cells overexpressing HSDI 7BI3 Transcripts A (IsoA) and D (IsoD), indicating that HSDI 7B]3 IsoD RNA level was higher than IsoA RNA level. Figure 11B shows a western blot from the same cell lines indicating that HSDI 7BI3 Transcript D was translated to a ted protein with lower molecular weight compared to HSDI 7BI3 Transcript A. Figure 11C shows that HSD17B13 IsoD protein levels were lower than IsoA protein levels gh the RNA level was . HSD17B13 protein level was normalized to actin; *P<0.05.

Figure 12 shows similar localization patterns ofHSD17B13 isoform A and isoform D to isolated lipid droplets (LD) derived from HepG2 stable cell lines. ADRP and TIP47 were used as lipid droplet s. LAMPl and COX IV were used as s for the , calreticulin, lysosomal, endoplasmic reticulum, and mitochondrial compartments, respectively. GAPDH was included as a cytosolic marker, and actin was used as a eletal marker. This experiment was repeated twice in HepG2 cells, with the above being representative ofboth runs. PNS=Post- nuclear fraction; TM=total membrane.

Figures 13A-13D show oleic acid increased triglyceride content in HepG2 cells overexpressing HSDI 7BI3 Transcript A or D. Figure 13A shows treatment with increasing concentrations of oleic acid increased triglyceride (TG) content to a similar extent in control (GFP overexpressing cells) and HSDI 7BI3 Transcript A and D cell lines. Figure 13B shows HSDI 7BI3 Transcripts A and D RNA levels were similar in the cell lines. RNA levels are shown reads per kilobase of transcript per million mapped reads (RPKM). Figure 13C shows a western blot from HepG2 cells overexpressing HSDI 7BI3 Transcripts A and D. HSDI 7BI3 Transcript D was ated to a truncated protein with lower molecular weight compared to HSDI 7BI3 Transcript A. Figure 13D shows 13 IsoD n levels were lower than IsoA n . Protein level normalized to actin; **P<0.01.

Figure 14 shows Km and Vmax values for estradiol using purified inant HSD17B13 protein. For Km and Vmax inations, assays were performed with a dose range of 17B-estradiol between 0.2 “M to 200 “M and time points from 5 minutes to 180 minutes, with 500 “M NAD+ and 228 nM HSD17B13. Vmax and Km were then determined using the Michaelis-Menten model and Prism software Pad Software, USA).

Figure 15 shows percent genome editing (total number of insertions or deletions observed within a window 20 base pairs on either side of the Cas9-induced DNA break over the total number of ces read in the PCR reaction from a pool of lysed cells) at the mouse Hsd] 7b13 locus as determined by next-generation sequencing (NGS) in primary cytes isolated from hybrid wild type mice (75% C57BL/6NTac 25% 129S6/SvaTac). The samples tested included hepatocytes treated with ribonucleoprotein complexes containing Cas9 and guide RNAs designed to target the mouse Hsd] 7b13 locus.

Figure 16 shows percent genome editing (total number of insertions or deletions observed over the total number of sequences read in the PCR reaction from a pool of lysed cells) at the mouse Hsd] 7b13 locus as ined by next-generation sequencing (NGS) in samples isolated from mouse livers three weeks post-injection ofAAV8 containing ngNA expression cassettes designed to target mouse Hsd] 7b13 into Cas9-ready mice. Wild type mice not expressing any Cas9 were injected with AAV8 ning all of the ngNA expression cassettes were used as a negative l.

Figures 17A and 17B show relative mRNA expression for mouse Hsd] 7b13 and a non-target HSD family member, respectively, as determined by RT-qPCR in liver samples from Cas9-ready mice treated with AAV8 carrying guide RNA sion cassettes designed to target mouse Hsd] 7b13. Wild type mice not expressing any Cas9 were injected with AAV8 carrying guide RNA expression cassettes for all of the guide RNAs were used as a negative l.

DEFINITIONS The terms “protein,” “polypeptide,” and “peptide,” used interchangeably herein, include polymeric forms of amino acids of any length, including coded and non-coded amino acids and ally or biochemically modified or derivatized amino acids. The terms also include polymers that have been modified, such as polypeptides having modified peptide backbones.

Proteins are said to have an “N-terminus” and a minus.” The term “N- terminus” relates to the start of a protein or polypeptide, terminated by an amino acid with a free amine group (-NH2). The term “C-terminus” relates to the end of an amino acid chain (protein or polypeptide), terminated by a fiee carboxyl group (-COOH).

The terms “nucleic acid” and “polynucleotide,” used interchangeably herein, include polymeric forms of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, or analogs or modified versions thereof. They include single-, double-, and multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, and polymers comprising purine bases, pyrimidine bases, or other natural, ally modified, biochemically modified, non-natural, or derivatized nucleotide bases.

Nucleic acids are said to have “5’ ends” and “3’ ends” because cleotides are reacted to make oligonucleotides in a manner such that the 5’ ate of one mononucleotide e ring is attached to the 3’ oxygen of its neighbor in one direction via a odiester linkage. An end of an oligonucleotide is referred to as the “5’ end” if its 5’ phosphate is not linked to the 3’ oxygen of a mononucleotide pentose ring. An end of an oligonucleotide is referred to as the “3’ end” if its 3’ oxygen is not linked to a 5’ phosphate of another mononucleotide pentose ring. A nucleic acid sequence, even if internal to a larger oligonucleotide, also may be said to have 5’ and 3’ ends. In either a linear or circular DNA molecule, discrete elements are referred to as being “upstream” or 5’ of the “downstream” or 3’ elements.

The term “wild type” includes entities having a structure and/or activity as found in a normal (as contrasted with mutant, diseased, altered, or so forth) state or context. Wild type genes and polypeptides often exist in multiple different forms (e.g., alleles).

The term “isolated” with t to proteins and c acid includes proteins and nucleic acids that are relatively purified with respect to other bacterial, viral, or ar components that may normally be present in situ, up to and including a substantially pure preparation of the n and the polynucleotide. The term “isolated” also includes proteins and nucleic acids that have no naturally occurring counterpart, have been chemically synthesized and are thus ntially uncontaminated by other proteins or nucleic acids, or has been separated or purified from most other cellular components with which they are naturally accompanied (e.g., other cellular ns, polynucleotides, or cellular components).

“Exogenous” molecules or sequences include molecules or sequences that are not normally present in a cell in that form. Normal presence includes presence with t to the particular developmental stage and environmental conditions of the cell. An exogenous molecule or sequence, for example, can include a mutated version of a corresponding endogenous sequence within the cell or can include a sequence corresponding to an endogenous sequence within the cell but in a different form (i.e., not within a chromosome). In contrast, endogenous les or sequences include molecules or sequences that are normally present in that form in a particular cell at a particular developmental stage under particular environmental conditions.

The term “heterologous” when used in the context of a nucleic acid or a protein indicates that the nucleic acid or protein comprises at least two ns that do not naturally occur together. Likewise, the term “heterologous” when used in the context of a promoter operably linked to a nucleic acid encoding a n indicates that the promoter and the nucleic acid encoding the n do not lly occur together (i.e., are not naturally operably linked).

For example, the term “heterologous,” when used with nce to portions of a c acid or portions of a protein, indicates that the nucleic acid or protein comprises two or more sub- sequences that are not found in the same relationship to each other (e.g., joined together) in nature. As one e, a “heterologous” region of a c acid vector is a segment of nucleic acid within or attached to another nucleic acid molecule that is not found in association with the other molecule in nature. For example, a heterologous region of a nucleic acid vector could include a coding sequence flanked by sequences not found in association with the coding sequence in nature. Likewise, a “heterologous” region of a protein is a segment of amino acids within or attached to another peptide molecule that is not found in association with the other peptide molecule in nature (e.g., a fusion protein, or a protein with a tag). Similarly, a nucleic acid or protein can comprise a heterologous label or a heterologous secretion or localization sequence.

The term ” refers to a chemical moiety or protein that is directly or indirectly detectable (e.g., due to its spectral properties, conformation, or ty) when attached to a target compound. The label can be ly detectable (fluorophore) or indirectly detectable (hapten, enzyme, or fluorophore quencher). Such labels can be detectable by spectroscopic, photochemical, biochemical, chemical, or chemical means. Such labels include, for example, abels that can be measured with radiation-counting devices; pigments, dyes or other chromogens that can be visually observed or measured with a spectrophotometer; spin labels that can be measured with a spin label analyzer; and fluorescent labels (fluorophores), where the output signal is ted by the excitation of a suitable lar adduct and that can be visualized by excitation with light that is absorbed by the dye or can be measured with standard fluorometers or imaging systems. The label can also be, for example, a chemiluminescent substance, where the output signal is generated by chemical modification of the signal nd; a metal-containing substance; or an enzyme, where there occurs an enzyme-dependent secondary generation of signal, such as the formation of a colored product from a colorless substrate. The term “label” can also refer to a “tag” or hapten that can bind selectively to a conjugated molecule such that the ated le, when added subsequently along with a substrate, is used to generate a detectable . For example, one can use biotin as a tag and then use an avidin or streptavidin conjugate of horseradish peroxidate (HRP) to bind to the tag, and then use a calorimetric substrate (e.g., tetramethylbenzidine (TMB)) or a fluorogenic substrate to detect the presence of HRP. The term “label” can also refer to a tag that can be used, for example, to facilitate purification. Non-limiting es of such tags include myc, HA, FLAG or 3XFLAG, 6XHis or polyhistidine, glutathione-S-transferase (GST), maltose binding protein, an epitope tag, or the Fc portion of immunoglobulin. Numerous labels are known and include, for example, particles, fluorophores, haptens, enzymes and their calorimetric, enic and chemiluminescent substrates and other labels.

“Codon optimization” takes advantage of the degeneracy of codons, as exhibited by the multiplicity of three-base pair codon combinations that specify an amino acid, and generally includes a process of modifying a nucleic acid sequence for enhanced expression in particular host cells by replacing at least one codon of the native sequence with a codon that is more frequently or most frequently used in the genes of the host cell while maintaining the native amino acid sequence. For e, a polynucleotide ng a Cas9 protein can be modified to substitute codons having a higher frequency of usage in a given prokaryotic or eukaryotic cell, including a bacterial cell, a yeast cell, a human cell, a non-human cell, a mammalian cell, a rodent cell, a mouse cell, a rat cell, a hamster cell, or any other host cell, as compared to the naturally occurring nucleic acid sequence. Codon usage tables are readily ble, for example, at the “Codon Usage Database.” These tables can be adapted in a number of ways. See Nakamura et al. (2000) Nucleic Acids Research 28:292, herein incorporated by reference in its entirety for all purposes. Computer algorithms for codon optimization of a ular sequence for expression in a particular host are also available (see, e.g., Gene Forge).

The term “locus” refers to a specific location of a gene (or significant sequence), DNA sequence, polypeptide-encoding sequence, or position on a chromosome ofthe genome of an organism. For example, an “HSDI 7BI3 locus” may refer to the specific location of an HSDI 7BI3 gene, HSD17B13 DNA sequence, HSD17B13-encoding ce, or 13 position on a chromosome ofthe genome of an organism that has been identified as to where such a sequence resides. An “HSDI 7BI3 locus” may comprise a regulatory element of an HSDI 7BI3 gene, including, for e, an er, a promoter, 5’ and/or 3’ UTR, or a combination thereof.

The term “gene” refers to a DNA sequence in a chromosome that codes for a product (e. g., an RNA product and/or a polypeptide product) and es the coding region interrupted with one or more non-coding introns and sequence located adjacent to the coding region on both the 5’ and 3’ ends such that the gene corresponds to the full-length mRNA (including the 5’ and 3’ slated sequences). The term “gene” also includes other non-coding sequences ing tory sequences (e.g., promoters, enhancers, and transcription factor binding sites), polyadenylation signals, internal ribosome entry sites, silencers, insulating sequence, and matrix attachment regions. These sequences may be close to the coding region of the gene (e.g., within kb) or at distant sites, and they influence the level or rate of ription and translation of the gene. The term “gene” also encompasses “minigenes.” The term “minigene” refers to a gene in which one or more nonessential segments of the gene have been deleted with respect to a corresponding naturally occurring ne gene but in which at least one intron remains. Deleted segments can be intronic sequences. For e, deleted segments can be intronic sequences of at least about 500 base pairs to several kilobases.

Typically, intronic ces that do not encompass essential regulatory elements may be deleted. The gene segments sing a minigene will typically be arranged in the same linear order as is present in the germline gene, but this will not always be the case. Some desired regulatory ts (e.g., enhancers, silencers) may be relatively position-insensitive so that the regulatory element will function correctly even if positioned differently in a minigene than in the corresponding germline gene. For example, an enhancer may be located at a different distance from a promoter, in a different orientation, and/or in a different linear order. For example, an enhancer that is located 3’ to a promoter in germline configuration might be located 5’ to the promoter in a minigene. Similarly, some genes may have exons which are alternatively spliced at the RNA level. Thus, a minigene may have fewer exons and/or exons in a different linear order than the corresponding germline gene and still encode a functional gene product. A cDNA encoding a gene product may also be used to uct a minigene (e.g., a hybrid cDNA-genomic fusion).

The term “allele” refers to a t form of a gene. Some genes have a variety of different forms, which are located at the same position, or genetic locus, on a some. A diploid organism has two alleles at each genetic locus. Each pair of alleles represents the genotype of a specific genetic locus. Genotypes are bed as homozygous if there are two identical alleles at a particular locus and as heterozygous if the two alleles differ.

The term “variant” or “genetic variant” refers to a nucleotide sequence differing from the sequence most prevalent in a population (e.g., by one nucleotide). For example, some variations or substitutions in a nucleotide sequence alter a codon so that a different amino acid is encoded resulting in a genetic t polypeptide. The term nt” can also refer to a gene differing in sequence from the sequence most ent in a population at a position that does not change the amino acid sequence of the d ptide (i.e., a conserved change). c variants can be associated with risk, associated with protection, or can be neutral.

A “promoter” is a regulatory region ofDNA usually comprising a TATA box capable of directing RNA polymerase II to initiate RNA synthesis at the riate transcription initiation site for a particular cleotide sequence. A promoter may additionally comprise other regions which influence the transcription initiation rate. The promoter sequences disclosed herein modulate transcription of an operably linked polynucleotide. A promoter can be active in one or more of the cell types disclosed herein (e.g., a eukaryotic cell, a non-human mammalian cell, a human cell, a rodent cell, a pluripotent cell, a differentiated cell, or a combination thereof).

A promoter can be, for example, a constitutively active promoter, a conditional promoter, an inducible promoter, a temporally restricted promoter (e.g., a developmentally regulated er), or a lly cted promoter (e.g., a cell-specific or tissue-specific promoter).

Examples ofpromoters can be found, for example, in WC 201 3/176772, herein incorporated by reference in its entirety for all es.

Examples of inducible promoters include, for example, chemically regulated promoters and physically-regulated promoters. ally regulated promoters include, for example, alcohol-regulated promoters (e.g., an alcohol dehydrogenase (ach) gene promoter), tetracycline-regulated promoters (e.g., a tetracycline-responsive promoter, a tetracycline or sequence (tetO), a tet-On promoter, or a tet-Offpromoter), steroid regulated promoters (e.g., a rat glucocorticoid receptor, a promoter of an en receptor, or a promoter of an ecdysone receptor), or metal-regulated promoters (e.g., a metalloprotein promoter). Physically regulated promoters include, for example temperature-regulated promoters (e.g., a heat shock promoter) and light-regulated promoters (e.g., a light-inducible promoter or a light-repressible promoter).

Tissue-specific promoters can be, for example, -specific promoters, gliaspecific promoters, muscle cell-specific promoters, heart cell-specific promoters, kidney cell- specific ers, bone cell-specific promoters, endothelial cell-specific promoters, or immune cell-specific promoters (e.g., a B cell promoter or a T cell promoter). pmentally ted promoters include, for example, promoters active only during an embryonic stage of development, or only in an adult cell.

“Operable linkage” or being “operably linked” includes juxtaposition of two or more components (e.g., a promoter and another sequence element) such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components. For example, a promoter can be operably linked to a coding sequence if the er controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors.

Operable linkage can include such sequences being uous with each other or acting in trans (e. g., a regulatory sequence can act at a distance to control transcription of the coding sequence).

The term “primer” refers to an oligonucleotide e of acting as a point of initiation of cleotide synthesis along a complementary strand when placed under ions in which synthesis of a primer extension t complementary to a polynucleotide is catalyzed. Such conditions include the presence of four different tide triphosphates or nucleoside s and one or more agents for polymerization, such as DNA polymerase and/or e transcriptase, in an appropriate buffer (including substituents which are cofactors, or which affect pH, ionic strength, and so forth), and at a suitable temperature. Extension of the primer in a sequence specific manner can include, for example, methods of PCR, DNA sequencing, DNA extension, DNA polymerization, RNA transcription, or reverse transcription.

A primer must be sufficiently long to prime the synthesis of extension products in the presence of an agent for polymerase. A typical primer is at least about 5 nucleotides in length of a sequence substantially complementary to the target sequence, but longer primers are preferred.

Typically, primers are about 15-30 nucleotides in length, but longer primers may also be employed. A primer sequence need not be exactly complementary to a template or target sequence but must be sufficiently complementary to hybridize with a template or target sequence. The term “primer pair” means a set of s including a 5’ am primer, which hybridizes to the 5 ’ end of the DNA sequence to be amplified and a 3 ’ downstream primer, which hybridizes to the complement of the 3 ’ end of the sequence to be amplified. Primer pairs can be used for amplification of a target cleotide (e.g., by rase chain reaction (PCR) or other conventional nucleic-acid amplification s). “PCR” or “polymerase chain reaction” is a technique used for the amplification of specific DNA segments (see US Pat. Nos. 4,683,195 and 4,800,159, each of which is herein incorporated by reference in its entirety for all purposes).

The term “probe” refers to a molecule which can detectably distinguish between target les differing in structure. Detection can be accomplished in a variety of different ways depending on the type of probe used and the type of target molecule. Thus, for example, detection may be based on mination of activity levels of the target molecule, but preferably is based on detection of c binding. Examples of such specific binding e antibody binding and nucleic acid probe ization. Thus, probes can include, for example, enzyme substrates, antibodies and antibody fragments, and nucleic acid hybridization probes. For example, a probe can be an isolated polynucleotide attached to a conventional detectable label or reporter molecule, such as a radioactive isotope, ligand, chemiluminescent agent, enzyme, or the like. Such a probe is complementary to a strand of a target polynucleotide, such as a polynucleotide comprising the HSDI 7BI3 rs72613567 variant or specific HSD17B13 mRNA transcripts. Deoxyribonucleic acid probes may include those generated by PCR using HSDI 7BI3-mRNA/cDNA-specific primers or HSDI 7BI3-rs72613567-specific s, oligonucleotide probes synthesized in vitro, or DNA ed fiom bacterial artificial chromosome, fosmid, or cosmid libraries. Probes e not only deoxyribonucleic or ribonucleic acids but also polyamides and other probe materials that can specifically detect the presence of a target DNA sequence. For nucleic acid probes, ion reagents can include, for example, radiolabeled probes, enzymatic d probes (e.g., horse radish peroxidase and alkaline phosphatase), affinity labeled probes (e.g., biotin, avidin, and streptavidin), and fluorescent labeled probes (e.g., 6-FAM, VIC, TAMRA, MGB, fluorescein, rhodamine, and texas red). The nucleic acid probes described herein can readily be incorporated into one of the established kit formats which are well known.

The term “antisense RNA” refers to a single-stranded RNA that is complementary to a messenger RNA strand transcribed in a cell.

The term “small interfering RNA (siRNA)” refers to a typically double-stranded RNA molecule that s the RNA interference (RNAi) pathway. These molecules can vary in length (generally between 18-30 base pairs) and n varying degrees of complementarity to their target mRNA in the nse strand. Some, but not all, siRNAs have unpaired overhanging bases on the 5’ or 3’ end of the sense strand and/or the antisense strand. The term “siRN ” includes duplexes of two te strands, as well as single strands that can form hairpin structures comprising a duplex region. The double-stranded structure can be, for example, less than 20, 25, 30, 35, 40, 45, or 50 nucleotides in length. For example, the double- stranded structure can be from about 21-23 nucleotides in length, from about 19-25 tides in length, or from about 19-23 nucleotides in length.

The term “short hairpin RNA )” refers to a single strand ofRNA bases that self-hybridizes in a n ure and can induce the RNA interference (RNAi) pathway upon processing. These molecules can vary in length (generally about 50-90 nucleotides in length, or in some cases up to greater than 250 nucleotides in length, e.g., for microRNA-adapted shRNA). shRNA molecules are processed within the cell to form siRNAs, which in turn can knock down gene expression. shRNAs can be incorporated into vectors. The term ” also refers to a DNA molecule from which a short, hairpin RNA molecule may be transcribed.

] “Complementarity” of nucleic acids means that a nucleotide sequence in one strand of nucleic acid, due to ation of its nucleobase , forms hydrogen bonds with another sequence on an opposing nucleic acid strand. The complementary bases in DNA are typically A with T and C with G. In RNA, they are typically C with G and U with A. Complementarity can be perfect or substantial/sufficient. Perfect complementarity between two nucleic acids means that the two nucleic acids can form a duplex in which every base in the duplex is bonded to a complementary base by Watson-Crick pairing. “Substantial” or “sufficient” complementary means that a sequence in one strand is not completely and/or tly complementary to a sequence in an opposing strand, but that sufficient bonding occurs between bases on the two strands to form a stable hybrid complex in set of hybridization conditions (e.g., salt concentration and temperature). Such conditions can be predicted by using the sequences and standard mathematical ations to predict the Tm (melting temperature) of hybridized strands, or by empirical determination of Tm by using routine methods. Tm includes the ature at which a population of hybridization complexes formed n two nucleic acid strands are 50% denatured (i.e., a population of -stranded nucleic acid molecules becomes half dissociated into single strands). At a temperature below the Tm, formation of a hybridization complex is favored, whereas at a temperature above the Tm, melting or separation of the strands in the hybridization complex is favored. Tm may be estimated for a c acid having a known G+C content in an aqueous 1 M NaCl solution by using, e.g., Tm=81.5+0.41(% G+C), although other known Tm computations take into account nucleic acid structural characteristics.

“Hybridization condition” includes the tive environment in which one nucleic acid strand bonds to a second nucleic acid strand by complementary strand interactions and en bonding to produce a hybridization x. Such conditions include the chemical components and their concentrations (e.g., salts, chelating agents, formamide) of an aqueous or organic on containing the c acids, and the temperature of the mixture. Other factors, such as the length of incubation time or reaction chamber dimensions may contribute to the environment. See, e.g., Sambrook et al., Molecular Cloning, A Laboratory Manual, nd ed., pp. 1.90-1.91, 9.47-9.51, 1 1.47-11.57 (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), herein incorporated by reference in its entirety for all purposes.

Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. The conditions appropriate for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementation, variables which are well known. The greater the degree of complementation between two nucleotide ces, the r the value of the melting temperature (Tm) for hybrids of nucleic acids having those sequences. For hybridizations between nucleic acids with short stretches of complementarity (e.g. complementarity over 35 or fewer, 30 or fewer, 25 or fewer, 22 or fewer, 20 or fewer, or 18 or fewer nucleotides) the position of mismatches becomes important (see ok et al., supra, 11.7-1 1.8). Typically, the length for a izable nucleic acid is at least about 10 nucleotides. Illustrative minimum lengths for a izable nucleic acid include at least about 15 nucleotides, at least about 20 nucleotides, at least about 22 nucleotides, at least about 25 nucleotides, and at least about 30 nucleotides. Furthermore, the temperature and wash solution salt concentration may be ed as ary according to factors such as length of the region of complementation and the degree of mentation.

The sequence ofpolynucleotide need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. Moreover, a polynucleotide may hybridize over one or more segments such that intervening or nt segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure). A polynucleotide (e.g., gRNA) can comprise at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% sequence complementarity to a target region within the target nucleic acid sequence to which they are targeted. For example, a gRNA in which 18 of 20 nucleotides are complementary to a target region, and would therefore specifically hybridize, would represent 90% complementarity.

In this example, the remaining noncomplementary nucleotides may be red or interspersed with complementary nucleotides and need not be contiguous to each other or to complementary nucleotides.

Percent complementarity between particular stretches of nucleic acid sequences within nucleic acids can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs hul et al. (1990) J. Mol. Biol. 215:403-410; Zhang and Madden (1997) Genome Res. 7:649-656) or by using the Gap program (Wisconsin Sequence is Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489).

The methods and compositions provided herein employ a y of different components. Some ents throughout the description can have active variants and fragments. Such components include, for example, Cas9 proteins, CRISPR RNAs, trachNAs, and guide RNAs. ical activity for each of these components is described elsewhere herein.

“Sequence identity” or “identity” in the context of two polynucleotides or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for m correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins, residue ons which are not cal often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and ore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent ce identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have nce similarity” or “similarity.” Means for making this adjustment are well known. Typically, this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence ty. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE ligenetics, Mountain View, California). ntage of sequence identity” includes the value determined by comparing two lly aligned sequences (greatest number of perfectly matched residues) over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number ofpositions in the window of comparison, and multiplying the result by 100 to yield the tage of sequence identity. Unless otherwise specified (e.g., the shorter sequence es a linked heterologous sequence), the ison window is the full length of the shorter of the two sequences being compared.

] Unless otherwise stated, sequence identity/similarity values include the value obtained using GAP n 10 using the following parameters: % identity and % similarity for a tide sequence using GAP Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity for an amino acid sequence using GAP Weight of 8 and Length Weight of 2, and the BLOSUM62 scoring matrix; or any equivalent m thereof.

“Equivalent program” includes any sequence comparison program that, for any two sequences in on, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence ty when compared to the ponding ent generated by GAP Version 10.

The term “conservative amino acid substitution” refers to the substitution of an amino acid that is normally present in the sequence with a different amino acid of similar size, charge, or polarity. Examples of conservative substitutions include the substitution of a non-polar (hydrophobic) residue such as isoleucine, valine, or leucine for another non-polar residue.

Likewise, examples of conservative substitutions include the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between ine and asparagine, or between glycine and serine. Additionally, the substitution of a basic e such as lysine, ne, or histidine for another, or the substitution of one acidic residue such as aspartic acid or glutamic acid for another acidic e are additional examples of conservative substitutions. Examples of non-conservative substitutions include the substitution of a non-polar (hydrophobic) amino acid residue such as cine, valine, leucine, alanine, or methionine for a polar (hydrophilic) residue such as cysteine, glutamine, ic acid or lysine and/or a polar residue for a non-polar e. Typical amino acid categorizations are summarized below.

Alanine Ala A Nonpolar Neutral 1 .8 Arginine Arg R Polar Positive -4.5 Asparagine Asn N Polar Neutral -3.5 Aspartic acid Asp D Polar ve -3.5 Cysteine Cys C Nonpolar Neutral 2.5 Glutamic acid Glu E Polar Negative -3.5 ine Gln Q Polar Neutral -3.5 Glycine Gly G Nonpolar Neutral -0.4 Histidine His H Polar Positive -3.2 Isoleucine Ile I Nonpolar Neutral 4.5 Leucine Leu L Nonpolar Neutral 3.8 Lysine Lys K Polar Positive -3.9 Methionine Met M Nonpolar Neutral 1 .9 Phenylalanine Phe F Nonpolar Neutral 2.8 e Pro P Nonpolar Neutral -1.6 Serine Ser S Polar Neutral -0.8 Threonine Thr T Polar Neutral -0.7 Tryptophan Trp W Nonpolar Neutral -0.9 Tyrosine Tyr Y Polar Neutral -1.3 Valine Val V Nonpolar Neutral 4.2 A subject nucleic acid such as a primer or a guide RNA hybridizes to or targets a position or includes a position proximate to a specified nucleotide position in a reference nucleic acid when it is within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the position.

The term “biological sample” refers to a sample of biological material, within or obtainable fiom a subject, from which a nucleic acid or protein is recoverable. The term biological sample can also encompass any material derived by processing the sample, such as cells or their progeny. Processing of the biological sample may involve one or more of filtration, lation, extraction, concentration, fixation, inactivation of interfering components, and the like. In some embodiments, a biological sample comprises a c acid, such as genomic DNA, cDNA, or mRNA. In some ments, a biological sample comprises a protein. A subject can be any organism, including, for example, a human, a non-human mammal, a rodent, a mouse, or a rat. The biological sample can be d fiom any cell, tissue, or biological fluid from the subject. The sample may comprise any clinically relevant tissue, such as a bone marrow sample, a tumor biopsy, a fine needle aspirate, or a sample ofbodily fluid, such as blood, plasma, serum, lymph, ascitic fluid, cystic fluid, or urine. In some cases, the sample ses a buccal swab. The sample used in the methods disclosed herein will vary based on the assay format, nature of the ion method, and the tissues, cells, or extracts that are used as the sample.

The term “control sample” refers to a sample ed from a subject who does not have the HSDI 7BI3 rs72613567 t, and preferably is homozygous for the wild type allele of the HSDI 7BI3 gene. Such samples can be ed at the same time as a biological sample or on a different occasion. A biological sample and a l sample can both be obtained fiom the same tissue or bodily fluid.

A ogous” sequence (e.g., nucleic acid sequence) includes a sequence that is either cal or substantially similar to a known reference sequence, such that it is, for example, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the known reference sequence. gous sequences can include, for example, orthologous ce and paralogous sequences. Homologous genes, for example, typically descend fiom a common ancestral DNA sequence, either through a speciation event (orthologous genes) or a genetic duplication event (paralogous genes). “Orthologous” genes include genes in different species that evolved fiom a common ancestral gene by speciation. Orthologs typically retain the same function in the course of evolution. “Paralogous” genes include genes related by duplication within a genome. Paralogs can evolve new functions in the course of evolution.

The term “in vitro” includes artificial environments and to processes or reactions that occur within an artificial environment (e.g., a test tube). The term “in vivo” includes natural nments (e.g., a cell or organism or body, such as a cell within an organism or body) and to processes or reactions that occur within a natural environment. The term “ex vivo” includes cells that have been removed fiom the body of an individual and to processes or reactions that occur within such cells.

Compositions or methods “comprising” or “including” one or more recited elements may include other elements not specifically recited. For example, a composition that “comprises” or “includes” a n may contain the protein alone or in combination with other ingredients. The transitional phrase “consisting essentially of” means that the scope of a claim is to be interpreted to encompass the specified elements d in the claim and those that do not ally affect the basic and novel characteristic(s) of the claimed invention. Thus, the term sting essentially of” when used in a claim of this invention is not intended to be interpreted to be equivalent to “comprising.” “Optional” or “optionally” means that the subsequently described event or circumstance may or may not occur and that the description includes instances in which the event or circumstance occurs and instances in which it does not.

Designation of a range of values includes all integers within or defining the range, and all subranges defined by integers within the range.

Unless otherwise apparent from the context, the term ” asses values within a standard margin of error ofmeasurement (e.g., SEM) of a stated value.

The term “and/or” refers to and asses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or” The term “or” refers to any one member of a particular list and also es any ation ofmembers of that list.

The singular forms of the articles “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a Cas9 protein” or “at least one Cas9 protein” can include a plurality of Cas9 proteins, including es thereof.

Statistically significant means p £0.05.

DETAILED DESCRIPTION I. Overview Provided herein is an HSDI 7BI3 variant discovered to be associated with reduced alanine and aspartate transaminase levels; a reduced risk of chronic liver diseases including nonalcoholic and alcoholic liver fatty liver e, cirrhosis, and cellular carcinoma; and reduced progression from simple steatosis to more clinically advanced stages of chronic liver disease. Also provided herein are previously unidentified transcripts of the HSDI 7BI3 gene associated with the variant.

Isolated nucleic acids and proteins related to variants ofHSDI 7313, and cells comprising those nucleic acids and proteins are provided herein. Also provided are methods for modifying a cell through use of any combination of nuclease agents, exogenous donor sequences, transcriptional activators, riptional repressors, and expression vectors for expressing a recombinant HSDI 7BI3 gene or a nucleic acid encoding an HSD17B13 protein.

Also provided are therapeutic and prophylactic s for treating a t having or at risk of developing chronic liver disease.

II. HSDI7313 Variants Provided herein are isolated nucleic acids and ns related to variants of HSDI 7313 (also known as hydroxysteroid 17-beta dehydrogenase 13, 17-beta-hydroxysteroid dehydrogenase 13, droxysteroid dehydrogenase-13, D13, short-chain dehydrogenase/reductase 9, SCDR9, HMFN03 76, NIIL497, and SDR16C3). The human HSDI 7BI3 gene is approximately 19 kb in length and includes seven exons and six introns located at 4q22.1 in the genome. Exemplary human HSD17B13 protein sequences are assigned t Accession No. Q7ZSP4 (SEQ ID NOS: 240 and 241; Q7ZSP4-1 and Q7ZSP4-2, tively) and NCBI Reference Sequence Nos. NP_835236 and 129702 (SEQ ID NOS: 242 and 243, respectively). Exemplary human HSD17B13 mRNAs are assigned NCBI Reference Sequence Nos. NM_178135 and NM_001136230 (SEQ ID NOS: 244 and 245, respectively).

In particular, provided herein is a splice variant ofHSDI 7BI3 13567) having an insertion of an adenine adjacent to the donor splice site in intron 6. The adenine is an insertion on the forward (plus) strand of the some, which corresponds to an inserted thymine on the reverse ) strand of the chromosome. e the human HSDI 7BI3 gene is transcribed in the reverse direction, this nucleotide insertion is reflected as an inserted thymine in the exemplary HSDI 7BI3 rs72613567 variant sequence provided in SEQ ID NO: 2 relative to the exemplary wild type HSDI 7BI3 gene sequence provided in SEQ ID NO: 1. The insertion will therefore be referred to herein as a e inserted between positions 12665 and 12666 in SEQ ID NO: 1 or at position 12666 in SEQ ID NO: 2.

Two mRNA transcripts (A and B; SEQ ID NOS: 4 and 5, respectively) were previously identified to be expressed in subjects with the wild type HSDI 7BI3 gene. Transcript A includes all seven exons of the HSDI 7BI3 gene, whereas exon 2 is skipped in Transcript B.

Transcript A is the dominant transcript in wild type subjects. Provided herein, however, are six additional, previously unidentified, HSDI 7BI3 ripts that are expressed (C-H, SEQ ID NOS: 6 to 11, respectively). These transcripts are shown in Figure 4. In Transcript C, exon 6 is skipped compared to Transcript A. In Transcript D, there is an insertion of a guanine 3’ of exon 6, resulting in a frameshift in and premature truncation of exon 7 ed to Transcript A. In Transcript E, there is an additional exon between exons 3 and 4 compared to Transcript A. In Transcript F, which is expressed only in HSDI 7BI3 rs72613567 variant carriers, there is read- through from exon 6 into intron 6 compared to Transcript A. In Transcript G, exon 2 is skipped, and there is an insertion of a guanine 3’ of exon 6, resulting in a frameshifi in and premature truncation of exon 7 compared to Transcript A. In Transcript H, there is an additional exon between exons 3 and 4, and there is an insertion of a guanine 3’ of exon 6, resulting in a frameshifi in and premature truncation of exon 7 compared to Transcript A. Transcripts C, D, F, G, and H are dominant in HSDI 7BI3 rs72613567 t carriers, with Transcript D being the most abundant transcript in carriers of the HSDI 7BI3 rs72613567 variant. Also provided herein is one additional, usly unidentified, HSDI 7BI3 transcript that is expressed at low levels (F’, SEQ ID NO: 246). Like Transcript F, Transcript F’ also includes a read-through from exon 6 into intron 6 compared to Transcript A, but, in st to Transcript F, the hrough does not include the inserted thymine present in the HSDI 7BI3 rs72613567 t gene. The nucleotide positions of the exons within the HSDI 7BI3 genes for each ript are provided below.

Nucleotide ons in SEQ ID NO: 1 for Exons of HSD17B13 Transcripts More Prevalent in ts Homozygous for Wild Type HSDI7313 Gene. ——'-—-—'-—- m_——— Im———— *Inc1udes read-through from exon 6 into intron 6; read-through = positions 12665-13501 tide Positions in SEQ ID NO: 2 for Exons of HSD17B13 Transcripts More Prevalent in Subjects Homozygous for rs72613567 HSDI7313 Variant Gene tion of T at Position 12666).

——'-—'-—'-—'-—'- AIncludes additional residue 12665 at 3’ end compared to Transcript A *Includes read-through from exon 6 into intron 6; read-through = ons 12665-13502 As explained in more detail elsewhere herein, the HSDI 7BI3 rs72613567 variant is associated with reduced alanine and aspartate transaminase levels and a reduced risk of chronic liver diseases including nonalcoholic and alcoholic liver fatty liver disease, cirrhosis, and hepatocellular carcinoma. The HSDI 7BI3 rs72613567 variant is also associated with reduced progression from simple steatosis to more clinically advanced stages of chronic liver disease.

A. Nucleic Acids ] Disclosed herein are isolated c d to HSDI 7BI3 variants and variant HSD17B13 transcripts. Also disclosed are isolated nucleic acids that hybridize under stringent or te conditions with any of the nucleic acids disclosed herein. Such nucleic acids can be useful, for example, to express HSDI 7BI3 variant proteins or as primers, probes, exogenous donor sequences, guide RNAs, antisense RNAs, shRNAs, and siRNAs, each of which is described in more detail elsewhere herein.

Also disclosed are onal nucleic acids that can interact with the disclosed polynucleotides. Functional nucleic acids are c acid molecules that have a specific function, such as binding a target molecule or catalyzing a specific reaction. es of functional nucleic acids include antisense molecules, aptamers, ribozymes, x forming molecules, and external guide sequences. The functional nucleic acid molecules can act as effectors, inhibitors, modulators, and stimulators of a specific ty possessed by a target molecule, or the onal nucleic acid molecules can possess a de novo activity independent of any other molecules.

Antisense molecules are designed to interact with a target nucleic acid molecule through either cal or non-canonical base g. The interaction of the antisense molecule and the target molecule is designed to promote the destruction of the target molecule through, for example, RNase-H-mediated RNA-DNA hybrid degradation. Alternatively, the antisense molecule is designed to interrupt a processing on that normally would take place on the target le, such as transcription or replication. Antisense molecules can be designed based on the sequence of the target molecule. Numerous methods for optimization of antisense efficiency by finding the most accessible regions of the target molecule exist. Exemplary methods would be in vitro selection experiments and DNA modification studies using DMS and DEPC. Antisense molecules generally bind the target molecule with a dissociation constant (kd) less than or equal to 106, 10's, 10'“), or 10'”. A representative sample of methods and techniques which aid in the design and use of antisense les can be found in the following non-limiting list of US patents: 5,135,917; 533; 158; 5,641,754; 5,691,317; ,780,607; 138; 5,849,903; 5,856,103; 5,919,772; 5,955,590; 5,990,088; 5,994,320; ,998,602; 6,005,095; 995; 6,013,522; 6,017,898; 6,018,042; 6,025,198; 6,033,910; 6,040,296; 6,046,004; 319; and 6,057,437, each of which is herein incorporated by reference in its entirety for all purposes. Examples of antisense molecules e antisense RNAs, small interfering RNAs (siRNAs), and short hairpin RNAs (shRNAs), which are described in greater detail elsewhere herein.

The isolated nucleic acids disclosed herein can comprise RNA, DNA, or both RNA and DNA. The isolated nucleic acids can also be linked or fused to a heterologous nucleic acid sequence, such as in a vector, or a heterologous label. For e, the isolated nucleic acids disclosed herein can be in a vector or exogenous donor sequences comprising the isolated c acid and a heterologous nucleic acid sequence. The isolated nucleic acids can also be linked or fused to a heterologous label, such as a fluorescent label. Other examples of labels are disclosed elsewhere herein.

] The disclosed nucleic acids molecules can be made up of, for example, nucleotides or non-natural or modified nucleotides, such as nucleotide analogs or tide substitutes. Such nucleotides include a nucleotide that contains a modified base, sugar or phosphate group, or that incorporates a non-natural moiety in its structure. Examples of non-natural nucleotides include dideoxynucleotides, biotinylated, aminated, deaminated, alkylated, benzylated and fluorophor- labeled nucleotides.

] The c acids molecules disclosed herein can comprise one or more nucleotide analogs or substitutions. A nucleotide analog is a tide which contains some type of modification to either the base, sugar, or phosphate moieties. Modifications to the base moiety would include natural and synthetic modifications of A, C, G, and T/U as well as ent purine or pyrimidine bases, such as pseudouridine, uracilyl, hypoxanthinyl (I), and 2- aminoadeninyl. Modified bases include, for example, 5-methylcytosine (5-me-C), 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, ne and thymine, 5-uracil ouracil), 4-thiouracil, 8-halo, 8- amino, 8-thiol, 8-thioalkyl, oxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and nes, 7 - methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7- deazaadenine and 3-deazaguanine and 3-deazaadenine. Additional base modifications can be found, for example, in US Pat. No. 3,687,808; Englisch et al. (1991) Angewandte Chemie, International Edition 30:613; and Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, , S. T. and Lebleu, B. ed., CRC Press, 1993, each of which is herein incorporated by reference in its entirety for all purposes. Certain nucleotide analogs, such as 5-substituted pyrimidines, yrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, 5-propynylcytosine, and 5-methylcytosine can increase the stability of duplex formation. Often base modifications can be combined with, for example, a sugar modification, such as 2’-O-methoxyethyl, to achieve unique properties such as sed duplex stability. There are numerous US patents, such as 205; 5,130,302; ,134,066; 5,175,273; 5,367,066; 272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; ,525,711; 540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; and 5,681,941, which detail and describe a range of base modifications. Each of these is herein incorporated by reference in its entirety for all purposes.

Nucleotide s can also include modifications of the sugar moiety. Modifications to the sugar moiety can include, for example, natural modifications of the ribose and deoxy ribose as well as tic modifications. Sugar modifications include, for example, the WO 36758 following modifications at the 2’ position: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl, and alkynyl may be substituted or unsubstituted C1 to C10, alkyl or C2 to C10 alkenyl and alkynyl. Exemplary 2’ sugar modifications also include, for example, -O[(CH2)n O]m CH3, -O(CH2)nOCH3, -O(CH2)n NH2, -O(CH2)n CH3, -O(CH2)n -ONH2, and -O(CH2)nON[(CH2)nCH3)]2, where n and m are from 1 to about 10.

Other modifications at the 2’ position include, for example, C1 to C10 lower alkyl, substituted lower alkyl, l, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, S02 CH3, ONOz, N02, N3, NH2, heterocycloalkyl, heterocycloalkaryl, lkylamino, polyalkylamino, substituted silyl, an RNA ng group, a er group, an intercalator, a group for improving the pharmacokinetic properties of an ucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar ties. Similar modifications may also be made at other positions on the sugar, particularly the 3’ position of the sugar on the 3’ al nucleotide or in 2’-5’ linked oligonucleotides and the 5’ position of 5’ terminal nucleotide. Modified sugars can also include those that contain modifications at the bridging ring oxygen, such as CH2 and S. tide sugar s may also have sugar mimetics such as cyclobutyl moieties in place of the uranosyl sugar. There are numerous US patents that teach the preparation of such modified sugar structures such as 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; ,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; ,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, each ofwhich is herein incorporated by reference in its entirety for all purposes.

Nucleotide analogs can also be modified at the phosphate moiety. Modified phosphate moieties include, for example, those that can be modified so that the linkage between two nucleotides contains a phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, methyl and other alkyl onates including 3 ’- alkylene phosphonate and chiral phosphonates, phosphinates, phosphoramidates ing 3 ’- amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates. These phosphate or modified phosphate linkage between two nucleotides can be through a 3 ’-5’ linkage or a 2’-5’ linkage, and the linkage can contain ed polarity such as 3’-5’ to 5’-3’ or 2’-5’ to 5’-2’.

Various salts, mixed salts and free acid forms are also included. Numerous US s teach how to make and use nucleotides containing modified phosphates and include, for example, 3,687,808; 863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; ,278,302; 5,286,717; 5,321,131; 5,399,676; 939; 496; 5,455,233; 5,466,677; ,476,925; 126; 5,536,821; 5,541,306; 5,550,111; 253; 5,571,799; 5,587,361; and ,625,050, each of which is herein incorporated by reference in its entirety for all purposes.

Nucleotide substitutes include molecules having similar functional properties to nucleotides, but which do not contain a phosphate moiety, such as peptide nucleic acid (PNA). tide substitutes include les that will recognize nucleic acids in a -Crick or Hoogsteen manner, but which are linked together through a moiety other than a phosphate moiety. Nucleotide substitutes are able to conform to a double helix type structure when cting with the appropriate target nucleic acid.

Nucleotide substitutes also include nucleotides or nucleotide s that have had the phosphate moiety or sugar moieties replaced. Nucleotide substitutes may not contain a standard phosphorus atom. Substitutes for the phosphate can be, for example, short chain alkyl or lkyl intemucleoside linkages, mixed heteroatom and alkyl or lkyl intemucleoside es, or one or more short chain heteroatomic or heterocyclic intemucleoside es.

These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. Numerous US patents se how to make and use these types ofphosphate replacements and include, but are not limited to, 5,034,506; 5,166,315; 5,185,444; ,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; ,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; ,608,046; 5,610,289; 5,618,704; 5,623,070; 312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference in its entirety for all es.

It is also understood in a nucleotide substitute that both the sugar and the phosphate moieties of the nucleotide can be replaced, by, for example, an amide type linkage (aminoethylglycine) (PNA). US patents 5,539,082; 5,714,331; and 5,719,262 teach how to make and use PNA molecules, each of which is herein incorporated by reference in its entirety for all purposes. See also Nielsen et al. (1991) Science 254: 1497-1500, herein incorporated by reference in its entirety for all purposes.

It is also possible to link other types of molecules (conjugates) to nucleotides or nucleotide analogs to enhance, for example, cellular uptake. Conjugates can be chemically linked to the nucleotide or nucleotide analogs. Such conjugates include, for example, lipid moieties such as a cholesterol moiety (Letsinger et al. (1989) Proc. Natl. Acad. Sci. USA 86:6553-6556, herein incorporated by reference in its entirety for all es), cholic acid (Manoharan et al. (1994) . Med. Chem. Let. 4: 1053-1060, herein incorporated by reference in its entirety for all purposes), a thioether such as hexyl-S-tritylthiol (Manoharan et al. (1992) Ann. N. Y. Acad. Sci. 660:306-309; Manoharan et al. (1993) Bioorg. Med. Chem. Let. 3 :2765-2770, herein incorporated by reference in its entirety for all purposes), a thiocholesterol (Oberhauser et al. (1992) Nucl. Acids Res. 20:533-53 8, herein incorporated by reference in its entirety for all es), an tic chain such as ndiol or l residues (Saison- Behmoaras et al. (1991) EMBO J. 10:1111-1118; Kabanov et al. (1990) FEBS Lett. 259:327-330; Svinarchuk et al. (1993) Biochimie 75:49-54, each of which is herein incorporated by nce in its entirety for all purposes), a phospholipid such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glyceroH-phosphonate (Manoharan et al. (1995) Tetrahedron Lett. 36:3651-3654; Shea et al. (1990) Nucl. Acids Res. 18:3777-3783, each of which is herein incorporated by reference in its entirety for all purposes), a polyamine or a polyethylene glycol chain (Manoharan et al. (1995) Nucleosides & Nucleotides 14:969-973, herein incorporated by reference in its entirety for all es), or adamantane acetic acid (Manoharan et al. (1995) Tetrahedron Lett. 36:365 1 -3 654, herein incorporated by reference in its entirety for all purposes), a yl moiety (Mishra et al. (1995) Biochim. Biophys. Acta 29-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al. (1996) J. Pharmacol. Exp. Ther. 277:923-937, herein incorporated by reference in its entirety for all purposes). Numerous US patents teach the preparation of such conjugates and include, for example, US Pat. Nos. 979; 882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; ,552,538; 5,578,717, 731; 5,580,731; 5,591,584; 124; 5,118,802; 5,138,045; ,414,077; 5,486,603; 5,512,439; 718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 013; 5,082,830; WO 36758 ,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; ,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; ,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; ,595,726; 5,597,696; 5,599,923; 5,599,928 and 941, each of which is herein incorporated by nce in its entirety for all es.

The isolated nucleic acids disclosed herein can comprise a nucleotide sequence of a lly occurring HSDI 7BI3 gene or mRNA transcript, or can se a non-naturally occurring sequence. In one example, the non-naturally occurring sequence can differ from the non-naturally occurring sequence due to synonymous mutations or ons that do not affect the encoded HSD17B13 protein. For example, the sequence can be identical with the exception of synonymous mutations or mutations that do not affect the encoded HSD17B13 protein. A synonymous on or substitution is the substitution of one nucleotide for another in an exon of a gene coding for a protein such that the produced amino acid sequence is not modified. This is possible because of the degeneracy of the genetic code, with some amino acids being coded for by more than one three-base pair codon. Synonymous substitutions are used, for example, in the s of codon optimization.

Also disclosed herein are proteins encoded by the nucleic acids disclosed herein and compositions comprising an isolated nucleic acid or protein disclosed herein and a carrier increasing the ity of the isolated nucleic acid or protein (e.g., prolonging the period under given conditions of storage (e.g., -20°C, 4°C, or ambient temperature) for which degradation products remain below a threshold, such below 0.5% by weight of the starting nucleic acid or protein; or increasing the stability in vivo). Non-limiting examples of such carriers e poly(lactic acid) (PLA) microspheres, poly(D,L-lactic-coglycolic-acid) (PLGA) microspheres, mes, es, inverse micelles, lipid ates, and lipid microtubules. (1) Nucleic Acids Including Mutant Residue ofHSD17B13 rs72613567 Variant Disclosed herein are isolated nucleic acids comprising at least 15 contiguous nucleotides of an HSDI 7BI3 gene and having a thymine at a position ponding to position 12666 (or thymines at positions corresponding to positions 12666 and 12667) of the HSDI 7BI3 rs72613567 variant (SEQ ID NO: 2) when optimally aligned with the HSDI 7BI3 rs72613567 variant. That is, disclosed herein are isolated nucleic acids comprising at least 15 contiguous nucleotides of an HSDI 7BI3 gene and having a thymine inserted between nucleotides corresponding to positions 12665 and 12666 of the wild type HSDI 7BI3 gene (SEQ ID NO: 1) when optimally aligned with the wild type HSDI 7BI3 gene. Such ed nucleic acids can be useful, for example, to express HSDI 7BI3 variant transcripts and proteins or as exogenous donor sequences. Such isolated nucleic acids can also be useful, for example, as guide RNAs, primers, and .

The HSDI 7BI3 gene can be an HSDI 7BI3 gene from any organism. For example, the HSDI 7BI3 gene can be a human HSDI 7BI3 gene or an ortholog from another organism, such as a non-human mammal, a rodent, a mouse, or a rat.

It is understood that gene sequences within a population can vary due to polymorphisms such as single-nucleotide polymorphisms. The es provided herein are only exemplary ces. Other ces are also le. As one example, the at least 15 contiguous nucleotides can be at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a corresponding sequence in the HSDI 7BI3 rs72613567 variant (SEQ ID NO: 2) including position 12666 or positions 12666 and 12667 of SEQ ID NO: 2 when optimally aligned with SEQ ID NO: 2. Optionally, the isolated nucleic acid comprises at least 15 contiguous nucleotides of SEQ ID NO: 2 including position 12666 or positions 12666 and 12667 of SEQ ID NO: 2. As another example, the at least 15 contiguous nucleotides can be at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a corresponding sequence in the wild type HSDI 7BI3 gene (SEQ ID NO: 1) ing positions 12665 and 12666 of SEQ ID NO: 1 when optimally aligned with SEQ ID NO: 1, wherein a thymine is present n the ons corresponding to positions 12665 and 12666 of SEQ ID NO: 1. Optionally, the isolated nucleic acid comprises at least 15 contiguous nucleotides of SEQ ID NO: 1 including positions 12665 and 12666 of SEQ ID NO: 1, wherein a thymine is present between the positions corresponding to positions 12665 and 12666 of SEQ ID NO: 1.

The ed nucleic acid can comprise, for example, at least 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 contiguous nucleotides of an HSDI 7BI3 gene. Alternatively, the isolated c acid can comprise, for example, at least 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 16000, 17000, 18000, or 19000 contiguous nucleotides of an HSDI 7BI3 gene.

In some cases, the isolated nucleic acid can se an HSDI 7BI3 minigene in which one or more nonessential segments of the gene have been deleted with respect to a corresponding wild type HSDI 7BI3 gene. As one example, the deleted ts se one or more intronic sequences. Such HSDI 7BI3 minigenes can se, for example, exons corresponding to exons 1-7 from HSDI 7BI3 Transcript D and an intron corresponding to intron 6 in SEQ ID NO: 2 when optimally aligned with SEQ ID NO: 2. As one example, an HSDI 7BI3 minigene may comprise exons 1-7 and intron 6 from SEQ ID NO: 2. nes are described in more detail elsewhere . (2) Nucleic Acids Hybridizing to Sequence Adjacent to or Including Mutant Residue ofHSD17B13 3567 Variant ] Also disclosed herein are isolated nucleic acids comprising at least 15 contiguous nucleotides that hybridize to an HSDI 7BI3 gene (e.g., an HSDI 7BI3 minigene) at a segment that includes or is within 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of a position corresponding to position 12666 or positions 12666 and 12667 of the HSDI 7BI3 rs72613567 variant (SEQ ID NO: 2) when optimally aligned with the HSDI 7BI3 rs72613567 variant. Such isolated nucleic acids can be useful, for example, as guide RNAs, primers, probes, or exogenous donor sequences.

The HSDI 7BI3 gene can be an HSDI 7BI3 gene from any organism. For e, the HSDI 7BI3 gene can be a human HSDI 7BI3 gene or an ortholog from another organism, such as a non-human mammal, a mouse, or a rat.

As one e, the at least 15 contiguous nucleotides can hybridize to a segment of the HSDI 7BI3 gene or HSDI 7BI3 minigene that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a corresponding sequence in the HSDI 7BI3 rs72613567 variant (SEQ ID NO: 2) when optimally aligned with SEQ ID NO: 2. Optionally, the isolated nucleic acid can hybridize to at least 15 contiguous nucleotides of SEQ ID NO: 2.

Optionally, the isolated nucleic acid hybridizes to a segment ing position 12666 or positions 12666 and 12667 in SEQ ID NO: 2 or a position corresponding to position 12666 or positions 12666 and 12667 in SEQ ID NO: 2 when optimally aligned with SEQ ID NO: 2.

The segment to which the isolated nucleic acid can ize can comprise, for example, at least 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 75, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 contiguous nucleotides of an HSDI 7BI3 gene. atively, the isolated nucleic acid can comprise, for example, at least 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 16000, 17000, 18000, or 19000 contiguous nucleotides of an HSDI 7BI3 gene. Alternatively, the segment to which the isolated nucleic acid can hybridize can be, for example, up to 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 75, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 contiguous nucleotides of an HSDI 7BI3 gene. For example, the segment can be about 15 to 100 nucleotides in , or about 15-35 nucleotides in length. (3) cDNAs and Variant Transcripts Produced by HSD17B13 rs72613567 Variant Also provided are nucleic acids corresponding to all or part of an mRNA transcript or a cDNA corresponding to any one of Transcripts A-H (SEQ ID NOS: 4-11, tively), and particularly Transcripts C-H, when optimally aligned with the any one of Transcripts A-H. It is understood that gene sequences and within a population and mRNA sequences transcribed from such genes can vary due to polymorphisms such as single-nucleotide polymorphisms. The sequences provided herein for each Transcript are only ary sequences. Other sequences are also possible. Specific, non-limiting es are provided below. Such isolated nucleic acids can be useful, for example, to s HSDI 7BI3 t transcripts and proteins.

The isolated nucleic acid can be of any length. For example, the isolated nucleic acid can comprise at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or 2000 contiguous nucleotides encoding all or part of an HSD17B13 protein. In some cases, the isolated nucleic acids comprises contiguous nucleotides encoding all or part of an HSD17B13 protein, wherein the contiguous nucleotides comprise ce from at least two different exons of an HSDI 7BI3 gene (e.g., spanning at least one xon boundary of an HSDI 7BI3 gene without an intervening ).

HSDI 7BI3 Transcript D (SEQ ID NO: 7), Transcript G (SEQ ID NO: 10), and ript H (SEQ ID NO: 11) include an insertion of a guanine at the 3’ end of exon 6, resulting in a frameshift in exon 7 and premature truncation of the region of the HSD17B13 protein encoded by exon 7 compared to Transcript A. Accordingly, provided herein are isolated c acids comprising a segment (e.g., at least 15 contiguous nucleotides) present in Transcripts D, G, and H (or fragments or homologs thereof) that is not present in Transcript A (or a fragment or homolog thereof). Such regions can be readily identified by comparing the sequences of the Transcripts. For e, provided herein are isolated nucleic acids comprising at least 15 uous nucleotides (e.g., at least 20 contiguous nucleotides or at least 30 contiguous nucleotides) encoding all or part of an 13 protein, wherein a segment of the contiguous nucleotides (e.g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides or at least contiguous nucleotides) is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a region ng the exon 6-exon 7 boundary in SEQ ID NO: 7 BI3 Transcript D), SEQ ID NO: 10 (HSD17BI3 Transcript G), or SEQ ID NO: 11 (HSDI 7BI3 Transcript H) when lly aligned with SEQ ID NO: 7, 10, or 11, respectively, and the t includes a guanine at a residue corresponding to residue 878 at the 3’ end of exon 6 in SEQ ID NO: 7 (i.e., an ion of a guanine at the 3’ end of exon 6 relative to Transcript A in addition to the e at the start of exon 7), a residue corresponding to residue 770 at the 3’ end of exon 6 in SEQ ID NO: 10 (i.e., an insertion of a e at the 3’ end of exon 6 relative to Transcript B in addition to the guanine at the start of exon 7), or a residue corresponding to residue 950 at the 3’ end of exon 6 in SEQ ID NO: 11 (i.e., an insertion of a guanine at the 3’ end of exon 6 relative to Transcript E in addition to the guanine at the start of exon 7). It is understood that such a nucleic acid would include a sufficient number of nucleotides in each of exons 6 and 7 to distinguish the inserted guanine from other features in the HSDI 7BI3 Transcripts (e.g., from the guanine at the start of exon 7, from the hrough into intron 6 in Transcript F, or from the deleted exon 6 in Transcript C).

As one example, the ed nucleic acid can comprise at least 15 contiguous nucleotides (e.g., at least 20 contiguous nucleotides or at least 30 contiguous nucleotides) of SEQ ID NO: 7 spanning the exon 6-exon 7 boundary, optionally comprising exons 6 and 7 of SEQ ID NO: 7, and optionally comprising the entire sequence of SEQ ID NO: 7.

Optionally, the ed nucleic acid further comprises a segment present in Transcript D (or a fragment or homolog thereof) that is not present in Transcript G (or a fragment or homolog thereof), and the isolated nucleic acid further comprises a segment present in Transcript D (or a fragment or homolog thereof) that is not present in Transcript H (or a fragment or g thereof). Such regions can be readily identified by comparing the sequences of the Transcripts. For example, such isolated nucleic acids can comprise a segment of the contiguous nucleotides (e.g., at least 5 contiguous nucleotides, at least 10 uous nucleotides or at least contiguous nucleotides) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% cal to a region spanning the boundary of exons 3 and 4 of SEQ ID NO: 7 (HSDI 7BI3 Transcript D) when lly aligned with SEQ ID NO: 7 to distinguish from ript H. Likewise, such isolated nucleic acids can comprise a segment of the uous nucleotides (e.g., at least 5 contiguous tides, at least 10 contiguous nucleotides or at least 15 uous nucleotides) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a region within exon 2 of SEQ ID NO: 7 (HSDI 7BI3 Transcript D), a region spanning the exon 1-exon 2 boundary of SEQ ID NO: 7, or a region spanning the exon 2-exon 3 boundary of SEQ ID NO: 7 when optimally aligned with SEQ ID NO: 7 to distinguish from Transcript G. Optionally, the ed nucleic acid comprises a sequence at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 7 (HSDI 7BI3 Transcript D) and encodes an HSD17B13 protein comprising the sequence set forth in SEQ ID NO: 15 (HSD17B13 Isoform D).Like Transcript D, Transcript H (SEQ ID NO: 11) es an insertion of a e 3 ’ of exon 6 compared to Transcript A. Transcript H further includes an additional exon (exon 3’) between exons 3 and 4 compared to Transcript A and Transcript D. Accordingly, provided herein are isolated nucleic acids as described for above comprising a segment present in Transcripts D, G, and H (or fragments or homologs thereof) that is not present in Transcript A (or a fragment or homolog thereof) but further comprising a segment (e.g., at least 15 contiguous nucleotides) of Transcript H (or a fragment or homolog thereof) that is not present in Transcript D (or a fragment or homolog thereof). Such regions can be readily identified by comparing the sequences of the Transcripts. For example, provided herein are isolated nucleic acids as described for Transcript D, wherein a segment of the uous nucleotides (e.g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides or at least 15 contiguous nucleotides) is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a region within exon 3’ of SEQ ID NO: 11 (HSDI 7BI3 Transcript H), a region spanning the exon 3-exon 3’ ry of SEQ ID NO: 11, or a region spanning the exon 3’-exon 4 ry of SEQ ID NO: 11 when optimally aligned with SEQ ID NO: 11. It is understood that such a nucleic acid would include a sufficient number of nucleotides in each of exons 3 and 3’ or each of exons 3’ and 4 to distinguish from other features in the HSDI 7BI3 transcripts (e.g., from the boundary of exons 3 and 4). For example, the region of exon 3’ can comprise the entire exon 3’.

Optionally, the isolated nucleic acid comprises a sequence at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 11 (HSDI 7BI3 Transcript H) and encodes an HSD17B13 protein comprising the sequence set forth in SEQ ID NO: 19 (HSD17B13 Isoform H).

As one example, the isolated nucleic acid can comprise at least 15 contiguous nucleotides (e.g., at least 20 contiguous nucleotides or at least 30 contiguous nucleotides) of SEQ ID NO: 11 including a region within exon 3’, a region spanning the exon 3-exon 3’ boundary, or a region spanning the exon 3’-exon 4 boundary, optionally comprising the entire exon 3’ of SEQ ID NO: 11, and optionally comprising the entire sequence of SEQ ID NO: 11.

] Like Transcript D, Transcript G (SEQ ID NO: 10) includes an insertion of a guanine 3’ of exon 6 ed to ript A. In on, r, Transcript G is missing exon 2 compared to ript A and Transcript D (i.e., Transcript G includes an exon 1-exon 3 boundary not present in Transcripts A and D). Accordingly, provided herein are isolated nucleic acids as bed above comprising a segment present in Transcripts D, G, and H (or fragments or homologs thereof) that is not t in Transcript A (or a fragment or homolog thereof) but further comprising a segment (e.g., at least 15 uous nucleotides) from Transcript G (or a fragment or homolog thereof) that is not present in Transcript D (or a fragment or homolog thereof). Such regions can be readily identified by comparing the sequences of the Transcripts.

For example, provided herein are isolated nucleic acids as described for Transcript D, n a segment of the contiguous nucleotides (e.g., at least 5 uous nucleotides, at least 10 contiguous tides or at least 15 contiguous nucleotides) is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a region spanning the exon 1- exon 3 boundary in SEQ ID NO: 10 (HSDI 7BI3 Transcript G) when optimally aligned with SEQ ID NO: 10. It is understood that such a c acid would include a sufficient number of nucleotides in each of exons 1 and 3 to distinguish from other features in the HSDI 7BI3 Transcripts (e.g., the boundary of exons 1 and 2 or the boundary of exons 2 and 3). For example, the region can comprise the ty of exons 1 and 3 in SEQ ID NO: 10. Optionally, the isolated nucleic acid comprises a sequence at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 10 (HSDI 7BI3 Transcript G) and encodes an HSD17B13 protein comprising the sequence set forth in SEQ ID NO: 18 (HSD17B13 Isoform G).

As one example, the isolated nucleic acid can se at least 15 contiguous nucleotides (e.g., at least 20 contiguous nucleotides or at least 30 contiguous tides) of SEQ ID NO: 10 including a region spanning the exon 1-exon 3 boundary, optionally comprising the exons 1 and 3 of SEQ ID NO: 10, and optionally comprising the entire sequence of SEQ ID NO: Also provided herein are isolated nucleic acids comprising a segment (e.g., at least 15 contiguous nucleotides) present in Transcript E (or a fragment or homolog thereof) that is not present in Transcript A (or a fragment or homolog thereof). Such regions can be readily identified by ing the sequences of the Transcripts. ript E (SEQ ID NO: 8) includes an onal exon n exons 3 and 4 compared to Transcript A. Accordingly, provided herein are isolated nucleic acids comprising at least 15 contiguous nucleotides (e.g., at least 20 contiguous nucleotides or at least 30 contiguous tides) encoding all or part of an HSD17B13 protein, wherein a segment of the contiguous nucleotides (e.g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides or at least 15 contiguous tides) is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a region within exon 3’ of SEQ ID NO: 8 (HSDI 7BI3 Transcript E), a region spanning the exon 3-exon 3’ boundary of SEQ ID NO: 8, or a region spanning the exon 3’-exon 4 ry of SEQ ID NO: 8 when optimally d with SEQ ID NO: 8. It is understood that such a nucleic acid would include a sufficient number ofnucleotides in each of exons 3 and 3’ or each of exons 3’ and 4 to distinguish from other features in the HSDI 7BI3 transcripts (e.g., from the boundary of exons 3 and 4). For example, the region of exon 3’ can comprise the entire exon 3’. Optionally, the isolated c acid further comprises a segment (e.g., at least 15 contiguous nucleotides) from Transcript E (or a fragment or homolog thereof) that is not present in Transcript H (or a fragment or homolog f). Such regions can be readily identified by comparing the sequences of the Transcripts. For example, provided herein are isolated nucleic acids as described above, wherein a segment of the contiguous nucleotides (e.g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides or at least 15 contiguous nucleotides) is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a region ng the exon 6-exon 7 boundary in SEQ ID NO: 8 (HSDI 7BI3 ript E) when optimally aligned with SEQ ID NO: 8. It is understood that such a nucleic acid would include a WO 36758 sufficient number of nucleotides in each of exons 6 and 7 to distinguish from other features in the HSDI 7BI3 Transcripts cularly the additional guanine at the 3’ end of exon 6 in Transcript H)). For example, the region can se the entirety of exons 6 and 7 in SEQ ID NO: 8. Optionally, the isolated nucleic acid comprises a ce at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 8 (HSDI 7BI3 ript E) and encodes an HSD17B13 protein comprising the sequence set forth in SEQ ID NO: 16 (HSD17B13 Isoform E).

As one example, the isolated c acid can comprise at least 15 contiguous nucleotides (e.g., at least 20 contiguous nucleotides or at least 30 contiguous nucleotides) of SEQ ID NO: 8 including a region within exon 3’, a region spanning the exon 3-exon 3’ boundary, or a region spanning the exon 3’-exon 4 boundary, optionally comprising the entire exon 3’ of SEQ ID NO: 8, and optionally comprising the entire sequence of SEQ ID NO: 8.

Also provided herein are isolated nucleic acids comprising a segment (e.g., at least 15 contiguous nucleotides) present in Transcript F (or a fragment or g f) that is not present in Transcript A (or a fragment or homolog f). Such regions can be readily identified by comparing the sequences of the Transcripts. Transcript F (SEQ ID NO: 9) includes a hrough from exon 6 into intron 6 compared to Transcript A, and the read-through includes the inserted thymine present in the HSDI 7BI3 rs72613567 variant gene. Accordingly, ed herein are isolated c acids comprising at least 15 contiguous tides (e.g., at least 20 contiguous nucleotides or at least 30 contiguous nucleotides) encoding all or part of an HSD17B13 protein, wherein a segment of the contiguous nucleotides (e.g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides or at least 15 contiguous nucleotides) is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a region within the read-through into intron 6 in SEQ ID NO: 9 (HSDI 7BI3 Transcript F) or a region spanning the boundary between the read-through into intron 6 and the rest of exon 6 in SEQ ID NO: 9 when optimally aligned with SEQ ID NO: 9. It is understood that such a nucleic acid would a sufficient number ofnucleotides in the read-through to distinguish the read-through from other features in the HSDI 7BI3 Transcripts (e.g., from boundary of exons 6 and 7 in other HSDI 7BI3 Transcripts). Optionally, the contiguous nucleotides comprise a sequence t in Transcript F (i.e., the inserted thymine) that is not present in Transcript F’ (SEQ ID NO: 246).

Transcript F’ also includes a read-through from exon 6 into intron 6 compared to Transcript A, but the read-through does not include the inserted thymine present in the HSDI 7BI3 3567 variant gene. For example, the region can be the entire read-through into intron 6 in SEQ ID NO: 9. Optionally, the isolated nucleic acid comprises a sequence at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the ce set forth in SEQ ID NO: 9 (HSDI 7BI3 Transcript F) and encodes an HSD17B13 n comprising the sequence set forth in SEQ ID NO: 17 (HSD17B13 Isoform F).

As one example, the isolated nucleic acid can comprise at least 15 contiguous nucleotides (e.g., at least 20 contiguous nucleotides or at least 30 contiguous nucleotides) of SEQ ID NO: 9 including a region within the hrough into intron 6 or a region spanning the boundary between the hrough into intron 6 and the rest of exon 6, optionally comprising the entire read-through into intron 6, and ally comprising the entire sequence of SEQ ID NO: 9.

Also provided herein are ed nucleic acids comprising a segment (e.g., at least 15 contiguous nucleotides) present in Transcript F’ (or a fragment or homolog thereof) that is not present in Transcript A (or a fragment or homolog thereof). Such regions can be readily identified by comparing the sequences of the Transcripts. ript F’ (SEQ ID NO: 246) includes a read-through from exon 6 into intron 6 compared to Transcript A, and the read- through does not include the ed thymine present in the HSDI 7BI3 rs72613567 variant gene. Accordingly, ed herein are isolated nucleic acids sing at least 15 contiguous nucleotides (e.g., at least 20 contiguous nucleotides or at least 30 contiguous nucleotides) encoding all or part of an HSD17B13 protein, wherein a segment of the contiguous nucleotides (e. g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides or at least 15 contiguous nucleotides) is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a region within the read-through into intron 6 in SEQ ID NO: 246 (HSDI 7BI3 Transcript F’) or a region spanning the boundary between the read-through into intron 6 and the rest of exon 6 in SEQ ID NO: 246 when optimally aligned with SEQ ID NO: 246. It is understood that such a nucleic acid would a sufficient number of nucleotides in the read-through to distinguish the read-through from other features in the HSDI 7BI3 Transcripts (e. g., from boundary of exons 6 and 7 in other HSDI 7BI3 ripts). Optionally, the contiguous nucleotides comprise a sequence present in Transcript F’ that is not present in Transcript F (SEQ ID NO: 9). The read-through in Transcript F es the inserted thymine present in the HSDI 7BI3 rs72613567 variant gene, s the read-through in Transcript F’ does not. For example, the region can be the entire read-through into intron 6 in SEQ ID NO: 246. Optionally, the isolated nucleic acid comprises a ce at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 246 (HSDI 7BI3 Transcript F’) and encodes an HSD17B13 protein comprising, ting essentially of, or consisting of the sequence set forth in SEQ ID NO: 247 (HSD17B13 Isoform F’).

As one example, the isolated nucleic acid can comprise at least 15 contiguous nucleotides (e.g., at least 20 uous nucleotides or at least 30 contiguous nucleotides) of SEQ ID NO: 246 ing a region within the read-through into intron 6 or a region spanning the boundary between the read-through into intron 6 and the rest of exon 6, optionally comprising the entire read-through into intron 6, and optionally comprising the entire sequence of SEQ ID NO: 246.

Also provided herein are isolated nucleic acids comprising a t (e.g., at least 15 contiguous nucleotides) present in Transcript C (or a fragment or homolog thereof) that is not present in Transcript A (or a fragment or homolog thereof). Such regions can be readily identified by comparing the sequences of the Transcripts. Transcript C (SEQ ID NO: 6) is missing exon 6 compared to Transcript A (i.e., Transcript C es an exon 5-exon 7 boundary not present in ript A). Accordingly, provided herein are isolated nucleic acids comprising at least 15 contiguous nucleotides (e.g., at least 20 contiguous nucleotides or at least 30 contiguous nucleotides) encoding all or part of an 13 protein, wherein a segment of the contiguous nucleotides (e.g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides or at least 15 contiguous nucleotides) is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a region spanning the exon 5-exon 7 boundary in SEQ ID NO: 6 (HSDI 7BI3 Transcript C) when optimally aligned with SEQ ID NO: 6. It is understood that such a nucleic acid would a sufficient number ofnucleotides in each of exons 5 and 7 to distinguish from other features in the HSDI 7BI3 Transcripts (e.g., from boundary of exons 5 and 6 or of exons 6 and 7 in other HSDI 7BI3 Transcripts). For example, the region can se the entirety of exons 5 and 7 in SEQ ID NO: 6. Optionally, the isolated c acid comprises a sequence at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% cal to the sequence set forth in SEQ ID NO: 6 (HSDI 7BI3 Transcript C) and encodes an HSD17B13 protein comprising the sequence set forth in SEQ ID NO: 14 (HSD17B13 Isoform As one example, the isolated nucleic acid can comprise at least 15 uous nucleotides (e.g., at least 20 contiguous nucleotides or at least 30 uous nucleotides) of SEQ ID NO: 6 including a region spanning the exon 5-exon 7 boundary, optionally comprising the entirety of exons 5 and 7 in SEQ ID NO: 6, and optionally comprising the entire sequence of SEQ ID NO: 6. (4) Nucleic Acids Hybridizing to cDNAs and Variant HSD17B13 Transcripts Also provided are nucleic acids hybridizing to segments of an mRNA transcript or a cDNA corresponding to any one of Transcripts A-H (SEQ ID NOS: 4-11, respectively), and particularly Transcripts C-H, when optimally aligned with the any one of ripts A-H.

Specific, non-limiting examples are provided below. Such isolated nucleic acids can be useful, for example, primers, probes, antisense RNAs, siRNAs, or shRNAs.

The segment to which the isolated nucleic acid can hybridize can comprise, for example, at least 5, at least 10, or at least 15 contiguous tides of a nucleic acid encoding an HSD17B13 protein. The segment to which the isolated nucleic acid can hybridize can comprise, for example, at least 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 75, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, or 2000 contiguous nucleotides of a nucleic acid ng an HSD17B13 protein. Alternatively, the t to which the isolated nucleic acid can hybridize can be, for example, up to 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 75, 90, 95, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 contiguous nucleotides of a c acid encoding an HSD17B13 protein. For e, the segment can be about 15 to 100 nucleotides in length, or about 15-35 nucleotides in length.

HSDI 7BI3 Transcript D (SEQ ID NO: 7), Transcript G (SEQ ID NO: 10), and Transcript H (SEQ ID NO: 11) include an insertion of a guanine at the 3’ end of exon 6, resulting in a frameshift in and ure truncation of exon 7 ed to Transcript A. Accordingly, ed herein are isolated nucleic acids comprising a region (e.g., at least 15 contiguous nucleotides) that hybridizes to a segment present in Transcripts D, G, and H (or fragments or homologs f) that is not t in Transcript A (or a fragment or homolog thereof). Such regions can be readily identified by comparing the sequences of the Transcripts. For example, provided herein are ed nucleic acids that hybridize to at least 15 contiguous nucleotides of a nucleic acid encoding an HSD17B13 protein, wherein contiguous nucleotides comprise a segment (e.g., at least 5 contiguous nucleotides, at least 10 contiguous tides or at least 15 contiguous nucleotides) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a region spanning the exon 6—exon 7 boundary in SEQ ID NO: 7 (HSDI 7BI3 Transcript D) when optimally aligned with SEQ ID NO: 7, and the segment includes a guanine at a residue corresponding to residue 878 at the 3’ end of exon 6 in SEQ ID NO: 7 (i.e., an insertion of a e at the 3’ end of exon 6 relative to Transcript A in addition to the guanine at the start of exon 7). atively, provided herein are ed nucleic acids that hybridize to at least 15 uous nucleotides of a segment of a nucleic acid encoding an HSD17B13 protein, wherein the contiguous nucleotides comprise a segment (e.g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides or at least 15 contiguous nucleotides) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a region spanning the exon 6-exon 7 ry in SEQ ID NO: 10 (HSDI 7BI3 Transcript G) when lly aligned with SEQ ID NO: 10, and the segment es a guanine at a residue corresponding to residue 770 at the 3’ end of exon 6 in SEQ ID NO: 10 (i.e., an insertion of a guanine at the 3’ end of exon 6 relative to Transcript B in addition to the guanine at the start of exon 7). atively, provided herein are isolated c acids comprising that hybridize to at least 15 contiguous nucleotides of a nucleic acid encoding an HSD17B13 protein, wherein the contiguous nucleotides comprise a segment (e.g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides or at least 15 contiguous nucleotides) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a region spanning the exon 6-exon 7 ry in SEQ ID NO: 11 (HSDI 7BI3 Transcript H) when optimally aligned with SEQ ID NO: 11, and the segment es a guanine at a residue corresponding to residue 950 at the 3’ end of exon 6 in SEQ ID NO: 11 (i.e., an insertion of a guanine at the 3’ end of exon 6 relative to Transcript E in addition to the guanine at the start of exon 7). It is understood that such nucleic acids would be designed to hybridize to a sufficient number of nucleotides in each of exons 6 and 7 to distinguish the inserted guanine from other features in the HSDI 7B]3 Transcripts (e.g., from the read-through into intron 6 in Transcript F or from the deleted exon 6 in Transcript C).

As one example, the segment can comprise a region of SEQ ID NO: 7 spanning the exon 6-exon 7 boundary (i.e., including the guanine at residue 878 of SEQ ID NO: 7). As another example, the segment can comprise a region of SEQ ID NO: 10 spanning the exon 6- exon 7 boundary (i.e., including the guanine at residue 770 of SEQ ID NO: 10). As another example, the segment can comprise a region of SEQ ID NO: 11 spanning the exon 6-exon 7 boundary (i.e., including the guanine at residue 950 of SEQ ID NO: 11).

Optionally, the isolated nucleic acid further comprises a region (e.g., 15 contiguous nucleotides) that hybridizes to a segment present in Transcript D (or a nt or homolog thereof) that is not present in Transcript G (or a nt or homolog thereof), and the ed nucleic acid further comprises a region that hybridizes to a segment present in Transcript D (or a fragment or homolog thereof) that is not present in Transcript H (or a fragment or g thereof). Such segments can be readily fied by comparing the sequences of the Transcripts.

For example, the segment (e.g., at least 5 uous nucleotides, at least 10 contiguous nucleotides or at least 15 contiguous nucleotides) present in Transcript D (or a fragment or homolog f) that is not present in Transcript H (or a fragment or homolog thereof) can be at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a region spanning the boundary of exons 3 and 4 of SEQ ID NO: 7 (HSDI 7BI3 Transcript D) when optimally aligned with SEQ ID NO: 7 to distinguish from Transcript H. Likewise, the segment (e.g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides or at least 15 uous nucleotides) present in Transcript D (or a fragment or homolog thereof) that is not t in Transcript G (or a fragment or g thereof) can be at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a region within exon 2 of SEQ ID NO: 7 (HSDI 7BI3 Transcript D), a region spanning the exon 1-exon 2 boundary of SEQ ID NO: 7, or a region spanning the exon 2-exon 3 boundary of SEQ ID NO: 7 when optimally aligned with SEQ ID NO: 7 to distinguish from Transcript G.

Like Transcript D, Transcript H (SEQ ID NO: 11) includes an insertion of a guanine at the 3’ end of exon 6 compared to Transcript A. ript H further includes an additional exon between exons 3 and 4 compared to ript A and Transcript D. ingly, provided herein are isolated nucleic acids as described above comprising a region that hybridizes to a segment present in Transcripts D, G, and H (or fragments or gs thereof) that is not present in Transcript A (or a fragment or homolog thereof) but further sing a region (e.g., at least 15 contiguous nucleotides) that hybridizes to a segment that is present in Transcript H (or a fragment or homolog thereof) but not in Transcript D (or a fragment or homolog thereof).

Such regions can be readily identified by comparing the sequences of the Transcripts. For example, the segment can be at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a region (e.g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides or at least 15 contiguous nucleotides) within exon 3’ of SEQ ID NO: 11 (HSDI 7BI3 Transcript H), a region ng the exon 3-exon 3’ boundary of SEQ ID NO: 11, or a region ng the exon 3 ’-exon 4 boundary of SEQ ID NO: 11 when optimally aligned with SEQ ID NO: 11. It is understood that such a nucleic acid would be designed to hybridize to a sufficient number of nucleotides in each of exons 3 and 3’ or each of exons 3’ and 4 to distinguish from other features in the HSDI 7BI3 transcripts (e.g., from the boundary of exons 3 and 4).

As one example, the segment can comprise a region of SEQ ID NO: 11 within exon 3’, spanning the exon 3-exon 3’ boundary, or spanning the exon 3’-exon 4 boundary.

Like Transcript D, ript G (SEQ ID NO: 10) includes an insertion of a guanine at the 3’ end of exon 6 compared to Transcript A. In addition, however, Transcript G is g exon 2 compared to Transcript A and Transcript D (i.e., Transcript G includes an exon 1-exon 3 boundary not present in Transcripts A and D). Accordingly, ed herein are isolated nucleic acids as described above comprising a region that hybridizes to a segment present in Transcripts D, G, and H (or nts or homologs thereof) that is not present in Transcript A (or a fragment or homolog thereof) but further comprising a region (e.g., at least 15 contiguous tides) that hybridizes to a segment present in Transcript G (or a fragment or homolog thereof) but not in Transcript D (or a fragment or homolog thereof). Such regions can be readily identified by comparing the sequences of the Transcripts. For example, the t can be at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a region (e. g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides or at least 15 contiguous tides) spanning the exon 1-exon 3 boundary in SEQ ID NO: 10 (HSDI 7BI3 Transcript G) when optimally aligned with SEQ ID NO: 10. It is understood that such a nucleic acid would be designed to hybridize to a sufficient number of nucleotides in each of exons 1 and 3 to distinguish from other es in the HSDI 7BI3 Transcripts (e.g., the boundary of exons 1 and 2 or the boundary of exons 2 and 3).

] As one example, the segment can comprise a region of SEQ ID NO: 10 spanning the exon 1-exon 3 boundary.

Also provided are isolated nucleic acids comprising a region (e.g., at least 15 contiguous tides) that hybridizes to a segment of a nucleic acid encoding an HSD17B13 protein that is t in Transcript E (or a nt or homolog thereof) but not in Transcript A (or a fragment or homolog thereof). Such regions can be readily identified by comparing the sequences of the Transcripts. Transcript E (SEQ ID NO: 8) includes an additional exon between exons 3 and 4 compared to Transcript A. Accordingly, provided herein are isolated nucleic acids that hybridize to at least 15 uous nucleotides of a nucleic acid encoding an 13 protein, wherein the contiguous nucleotides comprise a segment that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a region (e.g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides or at least 15 contiguous tides) within exon 3’ of SEQ ID NO: 8 (HSDI 7BI3 Transcript E), a region spanning the exon 3-exon 3’ boundary of SEQ ID NO: 8, or a region spanning the exon 3’-exon 4 boundary of SEQ ID NO: 8 when optimally aligned with SEQ ID NO: 8. It is understood that such a nucleic acid would be designed to hybridize to a sufficient number of nucleotides in each of exons 3 and 3’ or each of exons 3’ and 4 to distinguish from other es in the HSDI 7BI3 transcripts (e.g., from the boundary of exons 3 and 4).

] As one example, the segment can comprise a region of SEQ ID NO: 8 within exon 3’, spanning the exon 3-exon 3’ boundary of SEQ ID NO: 8, or spanning the exon 3’-exon 4 boundary.

Optionally, the isolated c acid further comprises a region (e.g., 15 contiguous nucleotides) that hybridizes to a segment present in Transcript E (or a fragment or homolog thereof) that is not present in Transcript H (or a fragment or homolog thereof). Such segments can be readily identified by comparing the sequences of the Transcripts. For example, the segment (e.g., at least 5 contiguous nucleotides, at least 10 uous nucleotides or at least 15 uous nucleotides) present in Transcript E (or a fragment or homolog thereof) that is not present in Transcript H (or a nt or homolog thereof) can be at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a region spanning the boundary of exons 6 and 7 of SEQ ID NO: 8 (HSDI 7BI3 Transcript E) when optimally d with SEQ ID NO: 8 to distinguish from Transcript G. It is understood that such a nucleic acid would be ed to hybridize to a sufficient number of nucleotides in each of exons 6 and 7 to distinguish from other features in the HSDI 7BI3 Transcripts (particularly the additional e at the 3 ’ end of exon 6 in Transcript H)).

Also provided are isolated nucleic acids comprising a region (e.g., at least 15 contiguous nucleotides) that hybridizes to a segment of a nucleic acid encoding an HSD17B13 protein that is present in Transcript F (or a fragment or homolog thereof) but not in Transcript A (or a fragment or homolog thereof). Such regions can be readily identified by ing the ces of the Transcripts. Transcript F (SEQ ID NO: 9) includes a read-through from exon 6 to intron 6 compared to Transcript A. Accordingly, provided herein are isolated nucleic acids that hybridize to at least 15 contiguous nucleotides of a nucleic acid encoding an HSD17B13 protein, wherein the uous nucleotides comprise a t (e.g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides or at least 15 contiguous tides) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a region within the read-through into intron 6 in SEQ ID NO: 9 (HSDI 7BI3 Transcript F) or a region spanning the boundary between the read-through into intron 6 and the rest of exon 6 in SEQ ID NO: 9 when optimally aligned with SEQ ID NO: 9. It is understood that such a nucleic acid would be designed to hybridize to a sufficient number of nucleotides in the read-through to distinguish the read-through from other features in the HSDI 7BI3 Transcripts (e.g., from boundary of exons 6 and 7 in other HSDI 7BI3 Transcripts). Optionally, the uous nucleotides comprise a sequence present in Transcript F (i.e., the ed thymine) that is not present in Transcript F’ (SEQ ID NO: 246). Transcript F’ also includes a read-through from exon 6 into intron 6 compared to Transcript A, but the read-through does not include the inserted thymine present in the HSDI 7BI3 rs72613567 variant gene.

As one example, the segment can comprise a region of SEQ ID NO: 9 within the read-through into intron 6 or ng the boundary between the read-through into intron 6 and the rest of exon 6.

Also provided are isolated nucleic acids comprising a region (e.g., at least 15 contiguous nucleotides) that hybridizes to a segment of a c acid ng an HSD17B13 protein that is present in ript F’ (or a fragment or g thereof) but not in Transcript A (or a fragment or homolog thereof). Such regions can be readily identified by comparing the sequences of the Transcripts. Transcript F’ (SEQ ID NO: 246) includes a read-through from exon 6 to intron 6 compared to Transcript A. ingly, provided herein are isolated nucleic acids that hybridize to at least 15 contiguous nucleotides of a nucleic acid encoding an HSD17B13 protein, wherein the contiguous nucleotides comprise a segment (e.g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides or at least 15 contiguous nucleotides) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a region within the read-through into intron 6 in SEQ ID NO: 246 (HSDI 7BI3 Transcript F’) or a region spanning the boundary between the read-through into intron 6 and the rest of exon 6 in SEQ ID NO: 246 when optimally aligned with SEQ ID NO: 246. It is understood that such a c acid would be designed to hybridize to a sufficient number of nucleotides in the read-through to distinguish the read-through from other features in the HSDI 7BI3 Transcripts (e.g., from boundary of exons 6 and 7 in other HSDI 7BI3 ripts).

Optionally, the uous nucleotides comprise a sequence present in ript F’ that is not present in Transcript F (SEQ ID NO: 9). The read-through in ript F includes the inserted thymine present in the HSDI 7BI3 rs72613567 variant gene, whereas the read-through in Transcript F’ does not.

As one example, the segment can comprise a region of SEQ ID NO: 246 within the read-through into intron 6 or spanning the ry between the read-through into intron 6 and the rest of exon 6.

Also provided are isolated nucleic acids comprising a region (e.g., at least 15 contiguous nucleotides) that hybridizes to a segment of a nucleic acid encoding an HSD17B13 protein that is present in Transcript C (or a fragment or homolog thereof) but not in Transcript A (or a fragment or homolog thereof). Such regions can be readily identified by ing the ces of the Transcripts. Transcript C (SEQ ID NO: 6) is missing exon 6 compared to Transcript A (i.e., Transcript C includes an exon 5-exon 7 boundary not present in Transcript A).

Accordingly, provided herein are isolated nucleic acids that hybridize to at least 15 uous nucleotides of a nucleic acid encoding an HSD17B13 protein, wherein the contiguous nucleotides comprise a segment (e.g., at least 5 contiguous nucleotides, at least 10 contiguous tides or at least 15 contiguous nucleotides) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a region spanning the exon 5-exon 7 ry in SEQ ID NO: 6 (HSDI 7BI3 Transcript C) when optimally aligned with SEQ ID NO: 6. It is understood that such a nucleic acid would be designed to hybridize to a sufficient number of tides in exons 5 and 7 to distinguish from other features in the HSDI 7313 Transcripts (e.g., from boundary of exons 5 and 6 or of exons 6 and 7 in other HSDI 7BI3 Transcripts).

As one example, the segment can comprise a region from SEQ ID NO: 6 spanning the exon 5-exon 7 boundary.

Also provided herein are isolated nucleic acids (e.g., antisense RNAs, siRNAs, or ) that hybridize to at least 15 contiguous nucleotides of a nucleic acid encoding an HSD17B13 protein, wherein contiguous nucleotides se a segment (e.g., at least 5 contiguous nucleotides, at least 10 contiguous tides or at least 15 contiguous nucleotides) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a region ofHSDI 7BI3 Transcript D (SEQ ID NO: 7). The isolated nucleic acids can comprise a region (e.g., at least 15 contiguous tides) that hybridizes to a segment present in ript D (or fragments or homologs thereof) that is not present in ript A (or a fragment or homolog thereof). Such regions can be readily identified by comparing the sequences of the Transcripts. HSDI 7BI3 Transcript D (SEQ ID NO: 7) includes an insertion of a guanine at the 3’ end of exon 6, resulting in a frameshift in and premature truncation of exon 7 compared to Transcript A (SEQ ID NO: 4). For example, provided herein are isolated nucleic acids that hybridize to at least 15 contiguous nucleotides of a c acid encoding an HSD17B13 protein, wherein contiguous nucleotides comprise a segment (e.g., at least 5 contiguous nucleotides, at least 10 uous tides or at least 15 contiguous tides) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a region spanning the exon 6—exon 7 boundary in SEQ ID NO: 7 (HSDI 7BI3 Transcript D) when optimally aligned with SEQ ID NO: 7. The segment can e a guanine at a residue corresponding to residue 878 at the 3’ end of exon 6 in SEQ ID NO: 7 (i.e., an insertion of a guanine at the 3’ end of exon 6 relative to Transcript A in addition to the guanine at the start of exon 7). It is understood that such nucleic acids would be designed to hybridize to a sufficient number of nucleotides in each of exons 6 and 7 to distinguish the inserted guanine from other features in the HSDI 7BI3 Transcripts (e.g., from the read-through into intron 6 in Transcript F or from the deleted exon 6 in Transcript C).

Also provided herein are ed nucleic acids (e.g., antisense RNAs, siRNAs, or shRNAs) that hybridize to at least 15 uous tides of a nucleic acid encoding an HSD17B13 protein, wherein contiguous nucleotides comprise a segment (e.g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides or at least 15 contiguous nucleotides) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a region ofHSDI 7BI3 Transcript A (SEQ ID NO: 4). The isolated nucleic acids can comprise a region (e.g., at least 15 contiguous nucleotides) that hybridizes to a segment present in Transcript A (or fragments or homologs thereof) that is not t in Transcript D (or a fragment or homolog thereof). Such s can be readily identified by comparing the sequences of the ripts. HSDI 7BI3 Transcript D (SEQ ID NO: 7) includes an insertion of a guanine at the 3’ end of exon 6, resulting in a frameshift in and premature truncation of exon 7 compared to ript A (SEQ ID NO: 4). For example, provided herein are isolated c acids that hybridize to at least 15 contiguous nucleotides of a nucleic acid encoding an 13 protein, wherein contiguous nucleotides comprise a segment (e.g., at least 5 contiguous nucleotides, at least 10 contiguous nucleotides or at least 15 contiguous nucleotides) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% cal to a region spanning the exon 6—exon 7 boundary in SEQ ID NO: 4 (HSDI 7BI3 Transcript A) when optimally aligned with SEQ ID NO: 4. (5) Vectors Also provided are vectors comprising any of the nucleic acids disclosed herein and a heterologous nucleic acid. The vectors can be viral or al s e of transporting a nucleic acid. In some cases, a vector can be a plasmid (e.g., a circular double-stranded DNA into which additional DNA segments can be ligated). In some cases, a vector can be a viral vector, wherein additional DNA segments can be ligated into the viral genome. In some cases, a vector can autonomously replicate in a host cell into which it is introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). In other cases, vectors (e. g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell and thereby are replicated along with the host genome. Moreover, certain vectors can direct the expression of genes to which they are operatively linked. Such vectors can be referred to as “recombinant expression vectors” or “expression s.” Such vectors can also be targeting vectors (i.e., ous donor sequences) as disclosed elsewhere herein.

] In some cases, the proteins encoded by the disclosed genetic variants are expressed by WO 36758 inserting c acids encoding the disclosed genetic variants into expression vectors such that the genes are operatively linked to necessary expression control sequences such as transcriptional and translational control sequences. sion vectors can include, for example, plasmids, retroviruses, adenoviruses, adeno-associated viruses (AAV), plant viruses such as cauliflower mosaic virus, tobacco mosaic virus, cosmids, YACs, EBV derived episomes, and the like. In some instances, nucleic acids comprising the disclosed c variants can be ligated into a vector such that riptional and translational control sequences within the vector serve their intended on of regulating the transcription and ation of the genetic t. The expression vector and expression control sequences are chosen to be compatible with the expression host cell used. Nucleic acid sequences comprising the disclosed genetic variants can be inserted into separate vectors or into the same expression vector. A nucleic acid sequence comprising the disclosed genetic variants can be inserted into the expression vector by standard methods (e.g., ligation of complementary restriction sites on the nucleic acid sing the disclosed genetic variants and vector, or blunt end ligation if no restriction sites are present).

In addition to a nucleic acid sequence comprising the disclosed genetic variants, the recombinant expression vectors can carry regulatory sequences that control the expression of the c variant in a host cell. The design of the expression vector, including the selection of regulatory sequences can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and so forth. Preferred regulatory sequences for mammalian host cell sion can include, for example, viral elements that direct high levels ofprotein expression in mammalian cells, such as promoters and/or enhancers derived from retroviral LTRs, cytomegalovirus (CMV) (such as the CMV promoter/enhancer), Simian Virus 40 (SV40) (such as the SV40 promoter/enhancer), adenovirus, (e.g., the adenovirus major late er (AdMLP)), polyoma and strong mammalian promoters such as native immunoglobulin and actin promoters. Further description of viral regulatory elements, and sequences thereof is provided in US Pat. Nos. 062; 4,510,245; and 4,968,615, each of which is herein incorporated by reference in its entirety for all purposes. Methods of expressing polypeptides in bacterial cells or fungal cells (e. g., yeast cells) are also well known.

In addition to a nucleic acid sequence sing the disclosed genetic variants and regulatory ces, the recombinant sion vectors can carry additional sequences, such as sequences that regulate replication of the vector in host cells (e.g., origins of replication) and selectable marker genes. A selectable marker gene can facilitate selection of host cells into which the vector has been introduced (see e.g., US Pat. Nos. 4,399,216; 4,634,665; and ,179,017, each of which is herein incorporated by reference in its entirety for all purposes). For example, a selectable marker gene can confer ance to drugs, such as G418, hygromycin, or methotrexate, on a host cell into which the vector has been introduced. Exemplary selectable marker genes include the dihydrofolate reductase (DHFR) gene (for use in dhfr-host cells with methotrexate selection/amplification), the neo gene (for G418 selection), and the glutamate synthetase (GS) gene.

B. Proteins ] Disclosed herein are isolated HSDI 7BI3 proteins and fragments thereof, and particularly HSDI 7BI3 proteins and fragments thereofproduced by the HSDI 7BI3 rs72613567 variant.

The isolated proteins disclosed herein can comprise an amino acid sequence of a naturally ing HSD17B13 protein, or can comprise a non-naturally occurring sequence. In one example, the turally occurring sequence can differ from the non-naturally occurring sequence due to conservative amino acid substitutions. For example, the sequence can be identical with the exception of conservative amino acid substitutions.

The isolated proteins disclosed herein can be linked or fused to heterologous ptides or heterologous molecules or labels, us examples of which are disclosed ere herein. For example, the proteins can be fused to a heterologous polypeptide providing increased or decreased stability. The fused domain or heterologous polypeptide can be located at the N-terminus, the C-terminus, or internally within the protein. A fusion partner may, for example, assist in providing T helper epitopes (an immunological fusion partner), or may assist in sing the protein (an expression enhancer) at higher yields than the native recombinant protein. n fusion partners are both immunological and expression ing fusion rs. Other fusion partners may be selected so as to increase the solubility of the ptide or to enable the polypeptide to be targeted to desired intracellular compartments.

Still r fusion partners include affinity tags, which facilitate purification of the polypeptide.

A fusion protein may be directly fused to the heterologous molecule or may be linked to the heterologous molecule via a linker, such as a peptide linker. le peptide linker sequences may be chosen, for example, based on the following s: (1) their ability to adopt a flexible extended conformation; (2) their inability to adopt a secondary structure that could interact with functional epitopes on the first and second polypeptides; and (3) the lack of hydrophobic or charged residues that might react with the polypeptide functional epitopes. For example, peptide linker sequences may contain Gly, Asn and Ser residues. Other near neutral amino acids, such as Thr and Ala may also be used in the linker sequence. Amino acid sequences which may be ly employed as linkers include those disclosed in Maratea et al. (1985) Gene 40:39-46; Murphy et al. (1986) Proc. Natl. Acad. Sci. USA 83:8258-8262; US Pat.

No. 4,935,233; and US Pat. No. 4,751,180, each of which is herein incorporated by reference in its entirety. A linker sequence may generally be, for example, from 1 to about 50 amino acids in length. Linker sequences are lly not ed when the first and second polypeptides have non-essential N-terminal amino acid regions that can be used to separate the functional domains and t steric interference.

The proteins can also be operably linked to a cell-penetrating domain. For example, the cell-penetrating domain can be derived fiom the HIV-1 TAT protein, the TLM cell- ating motif fiom human hepatitis B virus, MPG, Pep-1, VP22, a cell-penetrating e from Herpes simplex virus, or a polyarginine peptide sequence. See, e.g., herein incorporated by reference in its ty for all purposes. The cell-penetrating domain can be located at the N-terminus, the inus, or anywhere within the protein.

The proteins can also be operably linked to a heterologous polypeptide for ease of tracking or purification, such as a fluorescent protein, a purification tag, or an e tag.

Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, ric Azami Green, CopGFP, AceGFP, ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent proteins (e.g., eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, hire), cyan fluorescent proteins (e.g., eCFP, Cerulean, CyPet, AmCyanl, Midoriishi- Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFPl, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRedl, AsRed2, eqFP611, erry, mStrawberry, Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, Monomeric Kusabira-Orange, rine, thomato), and any other suitable fluorescent protein. Examples of tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein, thioredoxin (TRX), poly(NANP), tandem y purification (TAP) tag, myc, AcV5, AU1 , AU5, E, ECS, E2, FLAG, hemagglutinin (HA), nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, histidine (His), biotin carboxyl carrier protein , and calmodulin.

The ed proteins herein can also comprise tural or modified amino acids or e analogs. For example, there are numerous D-amino acids or amino acids which have a different functional substituent than the naturally occurring amino acids. The opposite stereo isomers of naturally occurring peptides are disclosed, as well as the stereo isomers of peptide analogs. These amino acids can readily be incorporated into polypeptide chains by charging tRNA molecules with the amino acid of choice and engineering genetic constructs that utilize, for example, amber codons, to insert the analog amino acid into a peptide chain in a site-specific way (Thorson et al. (1991) Methods Molec. Biol. 77 :43-73; Zoller (1992) Current Opinion in Biotechnology 3:348-354; Ibba, (1995) Biotechnology & Genetic Engineering Reviews 13:197- 216; Cahill et al. (1989) TIBS 14(10):400-403; Benner (1993) TIB Tech 12: 158-163; and Ibba and Hennecke (1994) Biotechnology 12:678-682, each of which are herein incorporated by reference in its entirety for all es).

Molecules can be produced that resemble peptides, but that are not connected Via a natural peptide linkage. For e, linkages for amino acids or amino acid analogs can include CH2NH--, --CH2S--, - --, H-- (cis and trans), --COCH2 --, -- CH(OH)CH2--, and --CHH2SO-- (see, e.g., Spatola, A.F. in try and Biochemistry of Amino Acids, es, and Proteins, B. Weinstein, eds., Marcel Dekker, New York, p. 267 (1983); Spatola, A. F., Vega Data (March 1983), Vol. 1, Issue 3, Peptide Backbone Modifications (general review); Morley (1994) Trends Pharm Sci 15(12):463-468; Hudson et al. (1979) Int JPeptProt Res 14:177-185; Spatola et al. (1986) Life Sci 38:1243-1249; Hann (1982) Chem. Soc Perkin Trans. I 307-314; Almquist et al. (1980) J. Med. Chem. 23:1392-1398; Jennings-White et al. (1982) Tetrahedron Lett 23:2533); Szelke et al. European Appln, EP 45665 CA (1982): 97:39405 ; Holladay et al. (1983) Tetrahedron. Lett 24:4401-4404; and Hruby (1982) Life Sci 31 :189-199; each of which is incorporated herein by reference in its entirety for all purposes. e s can have more than one atom between the bond atoms, such as b- alanine, gaminobutyric acid, and the like.

Amino acid analogs and peptide analogs often have enhanced or desirable properties, such as, more economical production, greater chemical stability, enhanced pharmacological ties (half-life, absorption, potency, efficacy, and so forth), altered specificity (e.g., a broad- spectrum ofbiological activities), reduced antigenicity, and others desirable properties.

D-amino acids can be used to generate more stable peptides because D amino acids are not recognized by peptidases and such. Systematic substitution of one or more amino acids of a consensus sequence with a D-amino acid of the same type (e.g., D-lysine in place of L- lysine) can be used to generate more stable peptides. Cysteine residues can be used to cyclize or attach two or more es together. This can be beneficial to constrain peptides into particular conformations (see, e.g., Rizo and Gierasch (1992) Ann. Rev. Biochem. 61 :387, herein by nce in its entirety for all es).

Also sed herein are nucleic acids encoding any of the proteins disclosed herein.

This includes all rate sequences d to a specific ptide sequence (i.e., all nucleic acids having a sequence that encodes one particular polypeptide ce as well as all nucleic acids, including degenerate nucleic acids, encoding the sed variants and derivatives of the protein sequences). Thus, while each particular nucleic acid sequence may not be written out herein, each and every sequence is in fact sed and described herein through the disclosed polypeptide sequences.

Also sed herein are compositions comprising an isolated polypeptide or protein sed herein and a carrier increasing the stability of the isolated polypeptide. Non-limiting examples of such carriers include poly(lactic acid) (PLA) microspheres, poly(D,L-lactic- coglycolic-acid) (PLGA) microspheres, liposomes, micelles, inverse micelles, lipid cochleates, and lipid microtubules. (1) HSDI7313 Proteins and Fragments Disclosed herein are isolated 13 proteins and fragments thereof, ularly HSD17B13 proteins and fragments thereofproduced by the HSDI 7BI3 rs72613567 t, or particularly HSD17B13 Isoforms C, D, E, F, F’, G, and H. Such proteins can include, for example an isolated polypeptide comprising at least 5, 6, 8, 10, 12, 14, 15, 16, 18, 20, 22, 24, 25, , 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, or 300 contiguous amino acids of HSD17B13 Isoform C, D, E, F, F’, G, or H or a fragment thereof. It is understood that gene sequences within a population and proteins encoded by such genes can vary due to polymorphisms such as single-nucleotide rphisms. The sequences provided herein for each HSD17B13 isoform are only exemplary sequences. Other sequences are also possible. For example, the isolated polypeptide comprises an amino acid sequence (e.g., a sequence of contiguous amino acids) at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSD17B13 m C, D, E, F, F’, G, or H when optimally aligned with m C, D, E, F, F’, G, or H, respectively. Optionally, the isolated polypeptide comprises a sequence identical to HSD17B13 Isoform C, D, E, F, F’, G, or H.

As one example, the isolated polypeptide can comprise a segment (e.g., at least 8 contiguous amino acids) that is t in Isoforms D, G, and H (or fragments or homologs thereof) that is not present in Isoform A (or a fragment or homolog thereof). Such regions can be y fied by comparing the sequences of the ms. The region encoded by exon 7 in Isoforms D, G, and H is frameshified and truncated compared to the region encoded by exon 7 in Isoform A. Thus, such an isolated ptide can comprise at least 5, 6, 8, 10, 12, 14, 15, 16, 18, 20, 22, 24, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, or 200 contiguous amino acids of an HSD17B13 protein (e.g., at least 8 contiguous amino acids, at least 10 contiguous amino acids, or at least 15 contiguous amino acids of an HSD17B13 protein), wherein a segment of the contiguous amino acids (e.g., at least 3 uous amino acids, at least 5 contiguous amino acids, at least 8 contiguous amino acids, at least 10 contiguous amino acids, or at least 15 contiguous amino acids) is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a segment including at least a portion of the region encoded by exon 7 in SEQ ID NO: 15 (HSD17B13 Isoform D), SEQ ID NO: 18 (HSD17B13 Isoform G), or SEQ ID NO: 19 (HSD17B13 Isoform H) when the isolated polypeptide is optimally aligned with SEQ ID NO: 15, 18, or 19, respectively.

Such isolated polypeptides can further comprise a segment present in m D (or a fragment or homolog thereof) that is not present in Isoform G (or a fragment or homolog thereof), and can further comprise a t present in Isoform D (or a nt or homolog thereof) that is not t in Isoform H (or a fragment or homolog thereof). Such regions can be readily identified by comparing the sequences of the Isoforms. For example, such isolated polypeptides can comprise a segment of the contiguous amino acids (e.g., at least 3 contiguous amino acids, at least 5 contiguous amino acids, at least 8 contiguous amino acids, at least 10 contiguous amino acids, or at least 15 contiguous amino acids) that is at least 90%, at least 95%, WO 36758 at least 96%, at least 97%, at least 98%, or at least 99% identical to a segment spanning the boundary of the regions encoded by exons 3 and 4 of SEQ ID NO: 15 (HSD17B13 Isoform D) when optimally aligned with SEQ ID NO: 15 to guish from Isoform H. Likewise, such isolated polypeptides can comprise a segment of the uous amino acids (e.g., at least 3 contiguous amino acids, at least 5 contiguous amino acids, at least 8 contiguous amino acids, at least 10 contiguous amino acids, or at least 15 contiguous amino acids) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a t within the region encoded by exon 2 in SEQ ID NO: 15 (HSD17B13 Isoform D), a segment spanning the boundary of the regions encoded by exons 1 and 2 in SEQ ID NO: 15, or a segment ng the boundary of the regions encoded by exons 2 and 3 in SEQ ID NO: 15 when optimally aligned with SEQ ID NO: 15 to distinguish from Isoform G.

Like Isoform D, the region encoded by exon 7 in Isoform H (SEQ ID NO: 19) is frameshifted and truncated ed to Isoform A. In addition, however, Isoform H includes a region encoded by an additional exon (exon 3’) between exons 3 and 4 compared to Isoforms A and D. Accordingly, such an isolated polypeptide can be as bed above sing a segment that is present in Isoforms D, G, and H (or nts or homologs thereof) that is not present in Isoform A (or a fragment or homolog thereof) but further comprising a segment (e.g., at least 8 contiguous amino acids) from m H (or a fragment or homolog thereof) that is not present in m D (or a fragment or homolog thereof). Such regions can be readily identified by comparing the sequences of the ms. For example, such an isolated polypeptide can further comprise a segment of the contiguous amino acids (e.g., at least 3 contiguous amino acids, at least 5 contiguous amino acids, at least 8 contiguous amino acids, at least 10 contiguous amino acids, or at least 15 contiguous amino acids) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% cal to a t including at least a portion of the region encoded by exon 3’ in SEQ ID NO: 19 (HSD17B13 Isoform H) when the isolated polypeptide is optimally aligned with SEQ ID NO: 19.

Like Isoform D, the region encoded by exon 7 in Isoform G (SEQ ID NO: 18) is frameshifted and truncated compared to Isoform A. In addition, however, Isoform G is missing the region encoded by exon 2 compared to Isoforms A and D and thus includes an exon 1-exon 3 boundary not present in Isoforms A and D. Accordingly, such an isolated polypeptide can be as described above comprising a segment that is present in Isoforms D, G, and H (or fragments or homologs thereof) that is not t in Isoform A (or a fragment or homolog thereof) but further comprising a segment (e.g., at least 8 contiguous amino acids) from m G (or a fragment or g thereof) that is not present in m D (or a fragment or homolog thereof). Such regions can be readily identified by comparing the sequences of the Isoforms. For example, such an isolated polypeptide can further comprise a segment of the contiguous amino acids (e.g., at least 3 contiguous amino acids, at least 5 contiguous amino acids, at least 8 contiguous amino acids, at least 10 contiguous amino acids, or at least 15 contiguous amino acids) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a segment spanning the boundary of the regions encoded by exons 1 and 3 in SEQ ID NO: 18 (HSD17B13 Isoform G) when the isolated polypeptide is optimally aligned with SEQ ID NO: Also provided herein are isolated polypeptides comprising a segment (e.g., at least 8 uous amino acids) that is present in Isoform E (or a fragment or homolog f) that is not t in Isoform A (or a fragment or g thereof). Isoform E includes a region encoded by an additional exon (exon 3’) between exons 3 and 4 that is not present in Isoform A.

Such s can be readily identified by comparing the sequences of the Isoforms.

Accordingly, the isolated polypeptide can comprise at least 5, 6, 8, 10, 12, 14, 15, 16, 18, 20, 22, 24, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, or 200 contiguous amino acids of an HSD17B13 protein (e.g., at least 8 contiguous amino acids, at least 10 contiguous amino acids, or at least 15 contiguous amino acids of an 13 protein), wherein a segment of the contiguous amino acids (e.g., at least 3 contiguous amino acids, at least 5 contiguous amino acids, at least 8 contiguous amino acids, at least 10 contiguous amino acids, or at least 15 contiguous amino acids) is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a segment including at least a portion of the region encoded by exon 3’ in SEQ ID NO: 16 (HSD17B13 Isoform E) or SEQ ID NO: 19 (HSD17B13 Isoform H) when the isolated polypeptide is optimally aligned with SEQ ID NO: 16 or 19, respectively.

Optionally, such an isolated ptide can further comprise a segment (e.g., at least 8 contiguous amino acids) from Isoform E (or a fragment or homolog thereof) that is not present in Isoform H (or a fragment or homolog thereof). Such regions can be readily identified by comparing the sequences of the ms. For example, such an isolated polypeptide can further se a segment of the contiguous amino acids (e.g., at least 3 contiguous amino acids, at least 5 contiguous amino acids, at least 8 uous amino acids, at least 10 contiguous amino acids, or at least 15 contiguous amino acids) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical a segment spanning the boundary of the regions encoded by exons 6 and 7 in SEQ ID NO: 16 (HSD17B13 Isoform E) when the isolated polypeptide is optimally aligned with SEQ ID NO: 16.

Also provided is an isolated polypeptide comprising a segment (e.g., at least 8 contiguous amino acids) present in Isoform F (or a fragment or homolog f) that is not present in Isoform A (or a fragment or homolog thereof). m F includes a region encoded by read-through from exon 6 into intron 6 that is not present in Isoform A. Such regions can be readily identified by comparing the sequences of the Isoforms. ingly, the isolated polypeptide can comprise at least 5, 6, 8, 10, 12, 14, 15, 16, 18, 20, 22, 24, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, or 200 contiguous amino acids of an HSD17B13 protein (e.g., at least 8 contiguous amino acids, at least 10 contiguous amino acids, or at least 15 contiguous amino acids of an 13 protein), wherein a segment of the uous amino acids (e.g., at least 3 contiguous amino acids, at least 5 contiguous amino acids, at least 8 contiguous amino acids, at least 10 contiguous amino acids, or at least 15 uous amino acids) is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a segment including at least a portion of the region encoded by the read-through into intron 6 in SEQ ID NO: 17 (HSD17B13 Isoform F) when the isolated polypeptide is optimally aligned with SEQ ID NO: 17.

Also ed is an isolated polypeptide comprising a segment (e.g., at least 8 contiguous amino acids) present in Isoform C (or a fragment or g thereof) that is not present in Isoform A (or a fragment or homolog f). Isoform C is missing the region encoded by exon 6 compared to Isoform A and includes an exon 5-exon 7 boundary not present in Isoform A. Such regions can be readily identified by comparing the sequences of the Isoforms. Accordingly, the isolated polypeptide can comprise at least 5, 6, 8, 10, 12, 14, 15, 16, 18, 20, 22, 24, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, or 200 contiguous amino acids of an HSD17B13 protein (e.g., at least 8 contiguous amino acids, at least 10 contiguous amino acids, or at least 15 contiguous amino acids of an 13 n), wherein a segment of the contiguous amino acids (e.g., at least 3 contiguous amino acids, at least 5 contiguous amino acids, at least 8 uous amino acids, at least 10 contiguous amino acids, or at least 15 contiguous amino acids) is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% cal to a segment spanning the boundary of the regions encoded by exons 5 and 7 in SEQ ID NO: 14 (HSD17B13 Isoform C) when the isolated polypeptide is optimally aligned with SEQ ID NO: 14.

Any of the isolated polypeptides disclosed herein can be linked to a heterologous molecule or heterologous label. Examples of such heterologous molecules or labels are disclosed elsewhere . For example, the heterologous molecule can be an immunoglobulin Fc domain, a peptide tag as disclosed ere herein, poly(ethylene glycol), polysialic acid, or glycolic acid. (2) Methods ucing HSD17313 Proteins or nts Also disclosed are methods ofproducing any of the HSD17B13 proteins or fragments thereof disclosed herein. Such HSD17B13 proteins or fragments thereof can be produced by any suitable method. For example, HSD17B13 proteins or fragments thereof can be produced from host cells comprising nucleic acids (e.g., recombinant sion vectors) ng such 13 ns or fragments thereof Such methods can comprise culturing a host cell comprising a nucleic acid (e.g., recombinant expression vector) encoding an HSD17B13 protein or fragment thereof, thereby producing the HSD17B13 protein or fragment thereof. The nucleic acid can be operably linked to a promoter active in the host cell, and the culturing can be under conditions whereby the nucleic acid is expressed. Such methods can further comprise recovering the expressed 13 protein or nt thereof. The recovering can further comprise purifying the 13 protein or fragment thereof Examples of suitable systems for protein sion include bacterial cell expression systems (e.g., Escherichia coli, Lactococcus lactis), yeast cell expression systems (e.g., Saccharomyces cerevisiae, Pichia is), insect cell expression systems (e.g., baculovirus- mediated n expression), and mammalian cell expression systems.

Examples of nucleic acids encoding HSD17B13 ns or nts thereof are disclosed in more detail elsewhere herein. Optionally, such nucleic acids are codon optimized for expression in the host cell. Optionally, such nucleic acids are operably linked to a promoter active in the host cell. The promoter can be a heterologous promoter (i.e., a er than is not a naturally occurring HSD1 7BI3 promoter). Examples ofpromoters suitable for Escherichia coli include arabinose, lac, tac, and T7 promoters. Examples ofpromoters suitable for Lactococcus lactis include P170 and nisin promoters. Examples ofpromoters suitable for Saccharomyces siae include constitutive promoters such as alcohol dehydrogenase (ADHI) or enolase (ENO) ers or ble promoters such as PHO, CUP1, GAL1, and G10.

Examples ofpromoters suitable for Pichia pastoris e the alcohol oxidase I (AOX I) promoter, the glyceraldehyde 3 phosphate dehydrogenase (GAP) promoter, and the glutathione dependent formaldehyde dehydrogenase (FLDI) promoter. An example of a er suitable for a baculovirus-mediated system is the late viral strong drin promoter.

Optionally, the nucleic acid further encodes a tag in frame with the HSD17B13 protein or fragment thereof to facilitate protein purification. Examples of tags are disclosed elsewhere herein. Such tags can, for example, bind to a partner ligand (e.g., immobilized on a resin) such that the tagged protein can be isolated from all other proteins (e.g., host cell proteins).

Affinity chromatography, high performance liquid chromatography (HPLC), and size exclusion chromatography (SEC) are examples of methods that can be used to improve the purity of the expressed protein.

Other methods can also be used to produce HSD17B13 proteins or fragments thereof.

For e, two or more es or polypeptides can be linked together by protein chemistry techniques. For example, peptides or polypeptides can be chemically synthesized using either Fmoc (9-fluorenylmethyloxycarbonyl) or Boc (tert -butyloxycarbonoyl) chemistry. Such peptides or polypeptides can be synthesized by standard chemical reactions. For example, a peptide or polypeptide can be synthesized and not cleaved from its synthesis resin, whereas the other fragment of a peptide or protein can be synthesized and uently cleaved from the resin, thereby ng a terminal group which is onally blocked on the other fragment.

By peptide sation reactions, these two fragments can be ntly joined via a peptide bond at their carboxyl and amino i, respectively. (Grant GA (1992) Synthetic es: A User Guide. W.H. n and Co., NY. (1992); and Bodansky M and Trost B., Ed. (1993) Principles of Peptide Synthesis. Springer-Verlag Inc., NY, each of which is herein incorporated by nce in its entirety for all purposes). Alternatively, the peptide or polypeptide can be independently synthesized in vivo as described herein. Once isolated, these independent peptides or polypeptides may be linked to form a peptide or fragment thereof via similar peptide condensation reactions.

For example, enzymatic ligation of cloned or synthetic peptide segments allow vely short peptide fragments to be joined to produce larger peptide fragments, polypeptides, or whole protein domains (Abrahmsen L et al. (1991) Biochemistry 30:4151, herein orated by reference in its entirety for all purposes). Alternatively, native chemical ligation of synthetic peptides can be utilized to synthetically construct large peptides or polypeptides from shorter peptide fragments. This method can consist of a two-step chemical reaction n et al. (1994) e 266:776-779, herein incorporated by reference in its entirety for all purposes).

The first step can be the chemoselective reaction of an unprotected synthetic peptide--thioester with another unprotected peptide segment ning an amino-terminal Cys residue to give a thioester-linked intermediate as the initial covalent product. Without a change in the reaction conditions, this intermediate can undergo spontaneous, rapid intramolecular reaction to form a native peptide bond at the ligation site (Baggiolini et al. (1992) FEBS Lett 307 :97-101; Clark- Lewis et al. (1994) JBiol Chem 269:16075; Clark-Lewis et al. (1991) Biochemistry 30:3128; and Rajarathnam et al. (1994) Biochemistry 33:6623-6630, each of which is herein incorporated by reference in its entirety for all es).

Alternatively, ected peptide ts can be chemically linked where the bond formed between the peptide segments as a result of the chemical ligation is an unnatural (non- peptide) bond (Schnolzer et al. (1992) Science 256:221, herein incorporated by reference in its entirety for all purposes). This technique has been used to synthesize analogs of protein domains as well as large amounts of relatively pure proteins with full biological activity (deLisle Milton RC et al., Techniques in Protein Chemistry IV. Academic Press, New York, pp. 7 , herein incorporated by reference in its entirety for all purposes).

C. Cells Also provided herein are cells (e.g., recombinant host cells) comprising any of the nucleic acids and ns disclosed . The cells can be in vitro, ex vivo, or in vivo. Nucleic acids can be linked to a promoter and other regulatory ces so they are sed to produce an encoded protein. Any type of cell is provided.

The cell can be, for example, a totipotent cell or a pluripotent cell (e.g., an embryonic stem (ES) cell such as a rodent ES cell, a mouse ES cell, or a rat ES cell). Totipotent cells include undifferentiated cells that can give rise to any cell type, and pluripotent cells include erentiated cells that possess the ability to develop into more than one differentiated cell types. Such pluripotent and/or totipotent cells can be, for example, ES cells or ES-like cells, such as an induced pluripotent stem (iPS) cells. ES cells include embryo-derived totipotent or pluripotent cells that are capable of contributing to any tissue of the developing embryo upon introduction into an embryo. ES cells can be derived from the inner cell mass of a blastocyst and are capable of differentiating into cells of any of the three vertebrate germ layers erm, ectoderm, and mesoderm).

The cell can also be a primary somatic cell, or a cell that is not a primary somatic cell.

Somatic cells can include any cell that is not a gamete, germ cell, gametocyte, or undifferentiated stem cell. The cell can also be a primary cell. Primary cells include cells or cultures of cells that have been isolated directly from an organism, organ, or tissue. y cells e cells that are neither ormed nor immortal. They include any cell ed from an organism, organ, or tissue which was not previously passed in tissue culture or has been previously passed in tissue e but is incapable ofbeing indefinitely passed in tissue culture. Such cells can be isolated by conventional techniques and include, for example, c cells, hematopoietic cells, endothelial cells, epithelial cells, fibroblasts, mesenchymal cells, keratinocytes, melanocytes, monocytes, mononuclear cells, adipocytes, preadipocytes, s, glial cells, hepatocytes, skeletal myoblasts, and smooth muscle cells. For example, primary cells can be derived from connective s, muscle tissues, nervous system tissues, or epithelial tissues.

Such cells also include would normally not proliferate indefinitely but, due to mutation or alteration, have evaded normal cellular senescence and instead can keep undergoing division. Such mutations or alterations can occur naturally or be intentionally d.

Examples of alized cells include Chinese hamster ovary (CHO) cells, human embryonic kidney cells (e.g., HEK 293 cells), and mouse embryonic fibroblast cells (e.g., 3T3 cells).

Numerous types of immortalized cells are well known. Immortalized or primary cells e cells that are typically used for culturing or for expressing recombinant genes or proteins.

The cell can also be a differentiated cell, such as a liver cell (e.g., a human liver cell).

The cell can be from any source. For example, the cell can be a eukaryotic cell, an animal cell, a plant cell, or a fungal (e. g., yeast) cell. Such cells can be fish cells or bird cells, or such cells can be mammalian cells, such as human cells, non-human mammalian cells, rodent cells, mouse cells or rat cells. Mammals include, for example, humans, non-human primates, monkeys, apes, cats dogs, horses, bulls, deer, bison, sheep, rodents (e.g., mice, rats, hamsters, guinea pigs), ock (e.g., bovine species such as cows, steer, etc.; ovine species such as sheep, goats, etc.; and e species such as pigs and boars). Birds include, for example, chickens, turkeys, h, geese, ducks, etc. Domesticated animals and agricultural animals are also included. The term “non-human anima ” excludes humans.

For mouse cells, the mouse can be any strain, including, for example, from a 129 strain, a C57BL/6 strain, a BALB/c strain, a Swiss Webster strain, a mix of 129 and C57BL/6, strains, a mix of BALB/c and C57BL/6 strains, a mix of 129 and BALB/c strains, and a mix of BALB/c, C57BL/6, and 129 strains. For example, a mouse can be at least partially from a BALB/c strain (e.g., at least about 25%, at least about 50%, at least about 75% d from a BALB/c strain, or about 25%, about 50%, about 75%, or about 100% derived from a BALB/c strain). In one example, the mouse is a strain comprising 50% BALB/c, 25% C57BL/6, and 25% 129. Alternatively, the mouse comprises a strain or strain combination that excludes BALB/c.

Examples of 129 strains include 129P1, 129P2, 129P3, 129X1, 12981 (e.g., 12981/8V, 8vlm), 12982, 12984, 12985, 12989/8vaH, 12986 (129/8vaTac), 12987, 12988, 129T1, and 129T2. See, e.g., Festing et al. (1999) Mammalian Genome 10(8):836, herein incorporated by reference in its entirety for all purposes. Examples of C57BL strains include C57BL/A, C57BL/An, C57BL/GrFa, C57BL/Kal_wN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, 108c8n, C57BL/10Cr, and C57BL/Ola. Mouse cells also be from a mix of an entioned 129 strain and an aforementioned C57BL/6 strain (e.g., 50% 129 and 50% 6). Likewise, mouse cells can be from a mix of aforementioned 129 s or a mix of aforementioned BL/6 s (e.g., the 12986 (129/8vaTac) strain).

] For rat cells, the rat can be any rat strain, including, for example, an ACI rat strain, a Dark Agouti (DA) rat strain, a Wistar rat , a LEA rat strain, a 8prague Dawley (SD) rat strain, or a Fischer rat strain such as Fisher F344 or Fisher F6. Rats can also be from a strain derived from a mix of two or more strains recited above. For example, the rat can be from a DA strain or an ACI strain. The ACI rat strain is characterized as having black agouti, with white belly and feet and an RTI‘WI haplotype. 8uch strains are available from a variety of sources including Harlan Laboratories. The Dark Agouti (DA) rat strain is characterized as having an agouti coat and an RTI‘WI haplotype. 8uch rats are available from a variety of sources including Charles River and Harlan Laboratories. In some cases, the rats are from an inbred rat strain.

See, e.g., US 235933 A1, herein incorporated by reference in its entirety for all purposes.

III. Methods ofModifying or Altering sion ofHSDI7313 Various methods are provided for modifying a cell h use of any combination of nuclease agents, exogenous donor sequences, transcriptional activators, transcriptional repressors, nse molecules such as antisense RNA, siRNA, and shRNA, HSD17B13 proteins or fragments thereof, and expression vectors for expressing a recombinant HSDI 7BI3 gene or a nucleic acid encoding an HSD17B13 protein. The s can occur in vitro, ex vivo, or in vivo. The nuclease agents, exogenous donor sequences, transcriptional activators, riptional repressors, nse molecules such as nse RNA, siRNA, and shRNA, HSD17B13 proteins or fragments thereof, and expression vectors can be introduced into the cell in any form and by any means as described ere herein, and all or some can be introduced simultaneously or sequentially in any combination. Some methods involve only altering an endogenous HSDI 7BI3 gene in a cell. Some methods involve only altering expression of an endogenous HSDI 7BI3 gene through use of transcriptional activators or repressors or through use of antisense molecules such as antisense RNA, siRNA, and shRNA. Some s involve only introducing a recombinant HSDI 7BI3 gene or nucleic acid encoding an HSD17B13 protein or fragment thereof into a cell. Some s e only introducing an HSD17B13 protein or fragment thereof into a cell (e.g., any one of or any combination of the HSD17B13 proteins or fragments thereof disclosed herein or any one of or any combination of HSD17B13 Isoforms A- H or fragments thereof disclosed ). For example, such methods can involve introducing one or more ofHSD17B13 Isoforms C, D, F, G, and H (or fragments thereof) into a cell or introducing HSD17B13 Isoform D (or a fragment thereof) into a cell. Alternatively, such methods can involve introducing one or more of HSD17B13 Isoforms A, B, and E or Isoforms A, B, E, and F’ (or fragments thereof) into a cell or introducing 13 Isoform A (or a fragment thereof) into a cell. Other methods can involve both altering an endogenous HSDI 7BI3 gene in a cell and introducing an HSD17B13 protein or fragment thereof or recombinant HSDI 7BI3 gene or nucleic acid encoding an HSD17B13 protein or fragment thereof into the cell. Yet other methods can involve both altering expression of an endogenous HSDI 7BI3 gene in a cell and introducing an HSD17B13 protein or fragment thereof or recombinant HSDI 7BI3 gene or nucleic acid encoding an 13 protein or fragment thereof into the cell.

A. Methods of Modifying HSDI7313 Nucleic Acids Various methods are provided for modifying an HSDI 7BI3 gene in a genome within a cell (e. g., a pluripotent cell or a differentiated cell such as a liver cell) through use of nuclease agents and/or exogenous donor sequences. The methods can occur in vitro, ex vivo, or in vivo.

The nuclease agent can be used alone or in combination with an exogenous donor sequence.

Alternatively, the exogenous donor ce can be used alone or in combination with a nuclease agent.

Repair in response to double-strand breaks (DSBs) occurs pally through two conserved DNA repair pathways: non-homologous end joining (NHEJ) and homologous recombination (HR). See Kasparek & Humphrey (2011) Seminars in Cell & Dev. Biol. 22:886- 897, herein incorporated by reference in its entirety for all purposes. NHEJ includes the repair of double-strand breaks in a nucleic acid by direct ligation of the break ends to one another or to an exogenous sequence without the need for a homologous template. Ligation of non-contiguous sequences by NHEJ can often result in deletions, insertions, or translocations near the site of the double-strand break.

Repair of a target nucleic acid (e.g., an HSDI 7BI3 gene) mediated by an exogenous donor sequence can include any process of exchange of genetic information between the two polynucleotides. For example, NHEJ can also result in the ed integration of an exogenous donor sequence through direct ligation of the break ends with the ends of the exogenous donor sequence (i.e., NHEJ-based e). Such NHEJ-mediated ed integration can be preferred for insertion of an exogenous donor sequence when homology directed repair (HDR) pathways are not readily usable (e.g., in non-dividing cells, primary cells, and cells which perform gy-based DNA repair ). In addition, in contrast to gy-directed repair, knowledge concerning large regions of ce ty flanking the cleavage site (beyond the overhangs created by Cas-mediated cleavage) is not , which can be beneficial when attempting targeted insertion into organisms that have s for which there is limited knowledge of the genomic ce. The ation can proceed via ligation ofblunt ends between the exogenous donor sequence and the cleaved genomic sequence, or via ligation of sticky ends (i.e., having 5’ or 3’ overhangs) using an exogenous donor sequence that is flanked by overhangs that are compatible with those generated by the Gas protein in the cleaved genomic sequence. See, e.g., US 2011/020722, (2013) Genome Res. 23(3):539-546, each of which is herein incorporated by reference in its entirety for all purposes. If blunt ends are d, target and/or donor resection may be needed to generation regions of microhomology needed for fragment g, which may create ed alterations in the target sequence.

Repair can also occur via homology directed repair (HDR) or homologous recombination (HR). HDR or HR includes a form of nucleic acid repair that can require nucleotide sequence homology, uses a ” molecule as a template for repair of a “target” molecule (i.e., the one that experienced the -strand break), and leads to transfer of genetic information from the donor to target. Without wishing to be bound by any particular theory, such transfer can e mismatch correction of heteroduplex DNA that forms between the broken target and the donor, and/or synthesis-dependent strand annealing, in which the donor is used to resynthesize c ation that will become part of the , and/or related processes. In some cases, the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide integrates into the target DNA. See Wang et al. (2013) Cell 153:910-918; Mandalos et al. (2012) PLOS ONE 7:e45768:1-9; and Wang et al. (2013) Nat Biotechnol. 31 32, each of which is herein incorporated by reference in its entirety for all purposes.

Targeted genetic modifications to an HSDI 7BI3 gene in a genome can be generated by contacting a cell with an exogenous donor sequence comprising a 5’ homology arm that hybridizes to a 5’ target sequence at a target genomic locus within the HSDI 7BI3 gene and a 3’ homology arm that hybridizes to a 3’ target sequence at the target genomic locus within the HSDI 7BI3 gene. The exogenous donor sequence can recombine with the target genomic locus to generate the targeted genetic modification to the HSDI 7BI3 gene. As one example, the 5’ homology arm can hybridize to a target sequence 5’ of the position corresponding to position 12666 of SEQ ID NO: 2, and the 3’ homology arm can hybridize to a target sequence 3’ of the position ponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. Such methods can result, for example, in an HSDI 7BI3 gene in which a thymine is inserted between tides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the HSDI 7BI3 gene is lly aligned with SEQ ID NO: 1 (or an adenine is inserted at the corresponding on on the opposite strand). As another e, the 5’ and 3’ homology arms can hybridize to 5’ and 3’ target sequences, respectively, at positions corresponding to those flanking exon 6 in SEQ ID NO: 1 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1. Such methods can result, for example, in an HSDI 7BI3 gene in which a sequence corresponding to exon 6 of SEQ ID NO: 1 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1 has been deleted. As another example, the 5’ and 3’ homology arms can hybridize to 5’ and 3’ target sequences, respectively, at positions corresponding to those g exon 2 in SEQ ID NO: 1 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1. Such methods can result, for example, in an HSDI 7BI3 gene in which a sequence corresponding to exon 2 of SEQ ID NO: 1 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1 has been d. As another example, the 5’ and 3’ homology arms can hybridize to 5’ and 3’ target sequences, respectively, at positions corresponding to the exon 6/intron 6 boundary in SEQ ID NO: 1 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1. As another example, the 5’ and 3’ homology arms can hybridize to 5’ and 3’ target ces, tively, at positions corresponding to exon 6 and exon 7 in SEQ ID NO: 1 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1.

Such methods can result, for example, in an HSDI 7BI3 gene in which a thymine is inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1 (or an adenine is inserted at the corresponding position on the opposite strand). As r e, the 5’ and 3’ homology arms can hybridize to 5’ and 3’ target sequences, respectively, at ons corresponding to those flanking or within the region corresponding to the donor splice site in intron 6 of SEQ ID NO: 1 (i.e., the region at the 5’ end of intron 6 in SEQ ID NO: 1). Such methods can , for example, in an HSDI 7BI3 gene in which the donor splice site in intron 6 is disrupted. Examples of exogenous donor sequences are disclosed elsewhere herein.

Targeted c modifications to an HSDI 7BI3 gene in a genome can also be generated by contacting a cell with a nuclease agent that s one or more nicks or double- strand breaks at a target sequence at a target genomic locus within the HSDI 7BI3 gene. Such methods can result, for example, in an HSDI 7BI3 gene in which the region corresponding to the donor splice site in intron 6 of SEQ ID NO: 1 is disrupted (i.e., the region at the 5’ end of intron 6 in SEQ ID NO: 1). Examples and variations of nuclease agents that can be used in the methods are described elsewhere herein.

For example, targeted genetic modifications to an HSDI 7BI3 gene in a genome can be generated by ting a cell or the genome of a cell with a Gas protein and one or more guide RNAs that hybridize to one or more guide RNA recognition sequences within a target genomic locus in the HSDI 7BI3 gene. That is, ed genetic modifications to an HSDI 7BI3 gene in a genome can be generated by contacting a cell or the genome of a cell with a Gas protein and one or more guide RNAs that target one or more guide RNA target sequences within a target genomic locus in the HSDI 7BI3 gene. For example, such methods can comprise ting a cell with a Gas protein and a guide RNA that target a guide RNA target sequence within the HSDI 7BI3 gene. As one example, the guide RNA target sequence is within a region ponding to exon 6 and/or intron 6 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. As one example, the guide RNA target sequence is within a region corresponding to exon 6 and/or intron 6 and/or exon 7 (e.g., exon 6 and/or intron 6, or exon 6 and/or exon 7), of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. As another example, the guide RNA target sequence can includes or is proximate to a position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally d with SEQ ID NO: 2. For e, the guide RNA target sequence can be within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally d with SEQ ID NO: 2. As yet another example, the guide RNA target sequence can include or be proximate to the start codon of an HSDI 7BI3 gene or the stop codon of an HSDI 7BI3 gene. For example, the guide RNA target sequence can be within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon or the stop codon. The Gas protein and the guide RNA form a complex, and the Gas n cleaves the guide RNA target sequence. Cleavage by the Gas protein can create a double-strand break or a single-strand break (e.g., if the Gas protein is a nickase). Such methods can result, for example, in an HSDI 7BI3 gene in which the region corresponding to the donor splice site in intron 6 of SEQ ID NO: 1 is disrupted (i.e., the region at the 5’ end of intron 6 in SEQ ID NO: 1), the start codon is disrupted, the stop codon is disrupted, or the coding sequence is deleted. Examples and variations of Gas (e.g., Cas9) ns and guide RNAs that can be used in the methods are described elsewhere herein.

In some s, two or more se agents can be used. For e, two nuclease agents can be used, each targeting a nuclease target ce within a region corresponding to exon 6 and/or intron 6, or exon 6 and/or exon 7, of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2, or including or proximate to a position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2 (e.g., within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2). For example, two nuclease agents can be used, each targeting a nuclease target sequence within a region corresponding to exon 6 and/or intron 6 and/or exon 7, of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. As another example, two or more nuclease agents can be used, each targeting a se target sequence including or proximate to the start codon. As r example, two nuclease agents can be used, one targeting a nuclease target sequence including or proximate to the start codon, and one targeting a nuclease target sequence including or ate to the stop codon, n cleavage by the nuclease agents can result in deletion of the coding region between the two nuclease target sequences. As yet another example, three or more nuclease agents can be used, with one or more (e.g., two) targeting nuclease target sequences including or proximate to the start codon, and one or more (e.g., two) targeting nuclease target sequences including or proximate to the stop codon, wherein cleavage by the nuclease agents can result in deletion of the coding region between the nuclease target sequences including or proximate to the start codon and the nuclease target sequence including or proximate to the stop codon.

Optionally, the cell can be further contacted with one or more additional guide RNAs that target additional guide RNA target sequences within the target genomic locus in the HSDI 7BI3 gene. By contacting the cell with one or more additional guide RNAs (e.g., a second guide RNA that target a second guide RNA target sequence), cleavage by the Gas protein can create two or more double-strand breaks or two or more single-strand breaks (e.g., if the Gas protein is a nickase).

Optionally, the cell can additionally be contacted with one or more exogenous donor ces which recombine with the target genomic locus in the HSDI 7BI3 gene to generate a targeted genetic modification. Examples and variations of ous donor sequences that can be used in the methods are disclosed elsewhere herein.

The Gas protein, guide RNA(s), and exogenous donor sequence(s) can be introduced into the cell in any form and by any means as described elsewhere herein, and all or some of the Gas protein, guide RNA(s), and exogenous donor sequence(s) can be introduced simultaneously or sequentially in any combination.

In some such s, the repair of the target nucleic acid (e.g., the HSDI 7BI3 gene) by the exogenous donor sequence occurs via homology-directed repair (HDR). Homology- directed repair can occur when the Gas protein s both strands ofDNA in the HSDI 7BI3 gene to create a double-strand break, when the Gas protein is a nickase that cleaves one strand of DNA in the target nucleic acid to create a -strand break, or when Cas es are used to create a double-strand break formed by two offset nicks. In such methods, the exogenous donor sequence comprises 5’ and 3’ homology arms corresponding to 5’ and 3’ target sequences. The guide RNA target sequence(s) or cleavage site(s) can be adjacent to the 5’ target sequence, adjacent to the 3’ target ce, adjacent to both the 5’ target ce and the 3’ target sequence, or adjacent to neither the 5’ target ce nor the 3’ target sequence. ally, the exogenous donor sequence can further comprise a nucleic acid insert flanked by the 5’ and 3 homology arms, and the nucleic acid insert is inserted between the 5’ and 3’ target sequences. If no nucleic acid insert is present, the exogenous donor sequence can function to delete the genomic sequence between the 5’ and 3 ’ target sequences. Examples of exogenous donor sequences are disclosed elsewhere herein.

Alternatively, the repair of the HSDI 7BI3 gene ed by the exogenous donor sequence can occur via mologous end joining (NHEJ)-mediated ligation. In such methods, at least one end of the ous donor sequence ses a short single-stranded region that is complementary to at least one overhang created by Gas-mediated cleavage in the HSDI 7BI3 gene. The complementary end in the exogenous donor sequence can flank a nucleic acid insert. For example, each end of the exogenous donor sequence can comprise a short single- stranded region that is complementary to an overhang created by Gas-mediated ge in the HSDI 7BI3 gene, and these complementary regions in the exogenous donor sequence can flank a nucleic acid insert.

Overhangs (i.e., staggered ends) can be created by resection of the blunt ends of a double-strand break created by diated cleavage. Such resection can generate the regions ofmicrohomology needed for fragment joining, but this can create unwanted or uncontrollable alterations in the HSDI 7BI3 gene. Alternatively, such overhangs can be created by using paired Cas nickases. For example, the cell can be contacted with first and second nickases that cleave opposite strands ofDNA, whereby the genome is modified h double nicking. This can be lished by contacting a cell with a first Cas protein nickase, a first guide RNA that target a first guide RNA target sequence within the target c locus in the HSDI 7BI3 gene, a second Cas protein nickase, and a second guide RNA that targets a second guide RNA target sequence within target genomic locus in the HSDI 7BI3 gene. The first Cas protein and the first guide RNA form a first complex, and the second Cas protein and the second guide RNA form a second x. The first Cas protein nickase cleaves a first strand of c DNA within the first guide RNA target sequence, the second Cas protein nickase cleaves a second strand of genomic DNA within the second guide RNA target sequence, and optionally the exogenous donor sequence recombines with the target c locus in the HSDI 7BI3 gene to generate the targeted genetic modification.

The first nickase can cleave a first strand of c DNA (i.e., the complementary strand), and the second nickase can cleave a second strand of genomic DNA (i.e., the non- complementary strand). The first and second nickases can be created, for example, by mutating a catalytic residue in the Rqu domain (e.g., the D10A mutation described elsewhere herein) of Cas9 or mutating a catalytic e in the HNH domain (e.g., the H840A on described elsewhere herein) of Cas9. In such methods, the double nicking can be employed to create a double-strand break having staggered ends (i.e., overhangs). The first and second guide RNA target sequences can be positioned to create a cleavage site such that the nicks created by the first and second es on the first and second strands ofDNA create a double-strand break.

Overhangs are created when the nicks within the first and second CRISPR RNA target sequences are offset. The offset window can be, for e, at least about 5 bp, 10 bp, 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp or more. See, e.g., Ran et al. (2013) Cell 154:1380-1389; Mali et al. (2013) Nat. Biotech.3 1 :833-83 8; and Shen et al. (2014) Nat. Methods 11:399-404, each of which is herein incorporated by reference in its entirety for all purposes. (1) Types ofTargeted Genetic Modifications Various types of targeted genetic modifications can be introduced using the methods described herein. Such targeted modifications can include, for example, additions of one or more nucleotides, deletions of one or more nucleotides, substitutions of one or more nucleotides, a point mutation, or a ation thereof. For example, at least 1, 2, 3, 4, 5, 7, 8, 9, 10 or more nucleotides can be changed (e.g., deleted, inserted, or substituted) to form the targeted genomic modification. The deletions, insertions, or substitutions can be of any size, as disclosed elsewhere herein. See, e.g., Wang et al. (2013) Cell 153:910-918; Mandalos et al. (2012) PLOS ONE 7:e45768:1-9; and Wang et al. (2013) Nat hnol. 31 :530-532, each of which is herein incorporated by nce in its ty for all purposes.

Such targeted genetic modifications can result in disruption of a target genomic locus.

Disruption can include tion of a regulatory element (e.g., promoter or enhancer), a missense mutation, a nonsense mutation, a frame-shift mutation, a truncation mutation, a null mutation, or an insertion or deletion of small number of nucleotides (e.g., causing a fiameshift mutation), and it can result in vation (i.e., loss of function) or loss of an allele. For example, a targeted modification can comprise disruption of the start codon of an HSDI 7BI3 gene such that the start codon is no longer functional.

In a specific example, a targeted modification can comprise a deletion between first and second guide RNA target sequences or Cas cleavage sites. If an exogenous donor sequence (e. g., repair template or targeting vector) is used, the ation can comprise a deletion between first and second guide RNA target sequences or Cas cleavage sites as well as an insertion of a c acid insert between the 5’ and 3’ target sequences.

Alternatively, if an exogenous donor sequence is used, alone or in combination with a nuclease agent, the ation can se a on between the 5’ and 3’ target sequences as well as an ion of a nucleic acid insert between the 5’ and 3’ target sequences in the pair of first and second homologous chromosomes, thereby ing in a homozygous modified genome. atively, if the exogenous donor sequence comprises 5’ and 3’ homology arms with no nucleic acid insert, the modification can comprise a deletion between the 5’ and 3’ target sequences.

The deletion between the first and second guide RNA target sequences or the deletion between the 5’ and 3’ target sequences can be a precise deletion n the deleted nucleic acid consists of only the nucleic acid sequence between the first and second nuclease cleavage sites or only the nucleic acid sequence between the 5’ and 3’ target sequences such that there are no additional deletions or insertions at the d genomic target locus. The on between the first and second guide RNA target sequences can also be an ise deletion extending beyond the first and second nuclease cleavage sites, consistent with imprecise repair by non-homologous end joining (NHEJ), resulting in additional deletions and/or insertions at the modified genomic locus. For example, the deletion can extend about 1 bp, about 2 bp, about 3 bp, about 4 bp, about bp, about 10 bp, about 20 bp, about 30 bp, about 40 bp, about 50 bp, about 100 bp, about 200 bp, about 300 bp, about 400 bp, about 500 bp, or more beyond the first and second Cas protein cleavage sites. Likewise, the modified genomic locus can comprise additional insertions tent with ise repair by NHEJ, such as insertions of about 1 bp, about 2 bp, about 3 bp, about 4 bp, about 5 bp, about 10 bp, about 20 bp, about 30 bp, about 40 bp, about 50 bp, about 100 bp, about 200 bp, about 300 bp, about 400 bp, about 500 bp, or more.

The targeted genetic modification can be, for example, a biallelic modification or a monoallelic modification. Biallelic modifications include events in which the same modification is made to the same locus on corresponding homologous chromosomes (e.g., in a diploid cell), or in which different modifications are made to the same locus on corresponding gous somes. In some methods, the targeted genetic modification is a monoallelic modification. A monoallelic modification es events in which a modification is made to only one allele (i.e., a modification to the HSDI 7BI3 gene in only one of the two homologous chromosomes). Homologous chromosomes include chromosomes that have the same genes at the same loci but possibly different alleles (e.g., chromosomes that are paired during meiosis).

The term allele includes any of one or more alternative forms of a genetic sequence. In a diploid cell or organism, the two alleles of a given sequence lly occupy corresponding loci on a pair of homologous chromosomes.

A monoallelic mutation can result in a cell that is heterozygous for the targeted HSDI 7BI3 modification. Heterozygosity includes situation in which only one allele of the HSDI 7BI3 gene (i.e., corresponding alleles on both homologous chromosomes) have the ed modification.

A lic modification can result in homozygosity for a targeted modification.

Homozygosity es situations in which both alleles of the HSDI 7BI3 gene (i.e., corresponding alleles on both homologous chromosomes) have the targeted modification.

Alternatively, a biallelic modification can result in compound heterozygosity (e.g., hemizygosity) for the targeted modification. Compound heterozygosity includes situations in which both s of the target locus (i.e., the alleles on both homologous chromosomes) have been modified, but they have been modified in different ways (e.g., a targeted ation in one allele and inactivation or disruption of the other allele). For example, in the allele without the targeted modification, a double-strand break created by the Gas protein may have been repaired by non-homologous end joining (NHEJ)-mediated DNA repair, which generates a mutant allele sing an insertion or a deletion of a nucleic acid sequence and thereby causes tion of that genomic locus. For example, a biallelic modification can result in compound heterozygosity if the cell has one allele with the targeted modification and another allele that is not capable ofbeing expressed. Compound heterozygosity es hemizygosity.

Hemizygosity includes situations in which only one allele (i.e., an allele on one of two homologous chromosomes) ofthe target locus is t. For example, a biallelic modification can result in hemizygosity for a targeted ation if the targeted modification occurs in one allele with a ponding loss or deletion of the other allele. (2) fying Cells with Targeted c Modifications The methods disclosed herein can further comprise identifying a cell having a modified HSDI 7BI3 gene. Various methods can be used to identify cells having a targeted genetic modification, such as a deletion or an insertion. Such methods can comprise identifying one cell having the targeted genetic modification in the HSDI 7BI3 gene. Screening can be done to identify such cells with modified genomic loci.

The screening step can comprise a quantitative assay for assessing modification of allele (MOA) (e.g., loss-of-allele (LOA) and/or gain-of-allele (GOA) assays) of a parental chromosome. For example, the tative assay can be carried out via a quantitative PCR, such as a real-time PCR (qPCR). The real-time PCR can utilize a first primer set that recognizes the target genomic locus and a second primer set that recognizes a non-targeted reference locus.

The primer set can se a fluorescent probe that recognizes the amplified sequence. The loss-of-allele (LOA) assay inverts the conventional screening logic and quantifies the number of copies of the native locus to which the mutation was directed. In a correctly targeted cell clone, the LOA assay detects one of the two native s (for genes not on the X or Y chromosome), the other allele being disrupted by the targeted modification. The same principle can be applied in reverse as a gain-of-allele (GOA) assay to quantify the copy number of the ed targeting vector. For example, the combined use ofGOA and LOA assays will reveal a correctly targeted heterozygous clone as having lost one copy of the native target gene and gained one copy of the drug resistance gene or other ed marker.

As an example, tative polymerase chain reaction (qPCR) can be used as the method of allele quantification, but any method that can reliably distinguish the difference between zero, one, and two copies of the target gene or between zero, one, and two copies of the nucleic acid insert can be used to develop a MOA assay. For example, TAQMAN® can be used to quantify the number of copies of a DNA template in a genomic DNA sample, especially by comparison to a reference gene (see, e.g., US 6,596,541, herein orated by nce in its entirety for all purposes). The reference gene is quantitated in the same genomic DNA as the target gene(s) or locus(loci). Therefore, two TAQMAN® amplifications (each with its respective probe) are performed. One TAQMAN® probe determines the “Ct” (Threshold Cycle) of the reference gene, while the other probe determines the Ct of the region of the targeted gene(s) or locus(loci) which is ed by sful targeting (i.e., a LOA assay). The Ct is a quantity that reflects the amount of starting DNA for each of the TAQMAN® probes, i.e. a less abundant sequence requires more cycles ofPCR to reach the threshold cycle. Decreasing by half the number of copies of the template sequence for a ® reaction will result in an increase of about one Ct unit. TAQMAN® reactions in cells where one allele of the target ) or loci) has been replaced by homologous recombination will result in an increase of one Ct for the target TAQMAN® reaction without an increase in the Ct for the reference gene when compared to DNA from non-targeted cells. For a GOA assay, another TAQMAN® probe can be used to determine the Ct of the nucleic acid insert that is replacing the targeted gene(s) or locus(loci) by successful targeting.

Other examples of suitable quantitative assays include fluorescence-mediated in situ hybridization (FISH), ative genomic hybridization, isothermic DNA amplification, quantitative hybridization to an immobilized probe(s), INVADER® Probes, TAQMAN® Molecular Beacon probes, or ECLIPSETM probe technology (see, e.g., US 144655, herein incorporated by nce in its entirety for all purposes). Conventional assays for screening for targeted modifications, such as ange PCR, Southern blotting, or Sanger sequencing, can also be used. Such assays typically are used to obtain evidence for a linkage between the inserted targeting vector and the targeted genomic locus. For e, for a long-range PCR assay, one primer can recognize a sequence within the inserted DNA while the other recognizes a target genomic locus sequence beyond the ends of the targeting vector’s homology arms.

Next generation cing (NGS) can also be used for screening. Next-generation sequencing can also be referred to as “NGS” or “massively parallel sequencing” or “high throughput sequencing.” In the methods sed herein, it is not necessary to screen for targeted cells using selection s. For example, the MOA and NGS assays described herein can be relied on without using selection cassettes.

B. Methods of Altering Expression ofHSDI7313 Nucleic Acids ] Various methods are provided for altering expression of nucleic acids encoding HSD17B13 proteins. In some methods, sion is altered through cleavage with a nuclease agent to cause tion of the nucleic acid encoding the HSD17B13 n, as described in further detail elsewhere herein. In some methods, expression is altered through use of a DNA- binding protein fused or linked to a transcription activation domain or a ription repression domain. In some methods, expression is altered through use ofRNA interference compositions, such as antisense RNA, shRNA, or siRNA.

In one example, expression of an HSDI 7BI3 gene or a nucleic acid encoding an HSD17B13 protein can be modified by contacting a cell or the genome within a cell with a nuclease agent that induces one or more nicks or double-strand breaks at a target sequence at a target genomic locus within the HSDI 7BI3 gene or nucleic acid encoding an HSD17B13 protein. Such cleavage can result in disruption of expression of the HSDI 7BI3 gene or nucleic acid ng an HSD17B13 protein. For example, the nuclease target sequence can e or be proximate to the start codon of an HSDI 7BI3 gene. For e, the target sequence can be within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon, and cleavage by the nuclease agent can disrupt the start codon. As r example, two or more nuclease agents can be used, each targeting a nuclease target sequence including or proximate to the start codon. As another example, two nuclease agents can be used, one targeting a nuclease target sequence including or proximate to the start codon, and one targeting a nuclease target sequence ing or proximate to the stop codon, n cleavage by the nuclease agents can result in deletion of the coding region between the two nuclease target sequences. As yet another example, three or more nuclease agents can be used, with one or more (e.g., two) targeting se target sequences including or proximate to the start codon, and one or more (e.g., two) targeting nuclease target sequences including or proximate to the stop codon, wherein ge by the se agents can result in deletion of the coding region between the nuclease target sequences including or proximate to the start codon and the se target sequence including or proximate to the stop codon. Other examples of modifying an HSDI 7BI3 gene or a nucleic acid encoding an 13 protein are disclosed elsewhere herein.

In r example, expression of an HSDI 7BI3 gene or a nucleic acid encoding an HSD17B13 protein can be modified by contacting a cell or the genome within a cell with a DNA-binding protein that binds to a target c locus within the HSDI 7BI3 gene. The DNA-binding protein can be, for example, a nuclease-inactive Cas protein fused to a transcriptional activator domain or a transcriptional sor domain. Other examples ofDNA- binding proteins include zinc finger proteins fused to a transcriptional activator domain or a transcriptional repressor domain, or Transcription Activator-Like Effector (TALE) proteins fused to a transcriptional activator domain or a transcriptional repressor domain. Examples of such proteins are disclosed elsewhere herein. For example, in some methods, a transcriptional repressor can be used to decrease expression of a wild type HSDI 7BI3 gene or an HSDI 7BI3 gene that is not the rs72613567 variant (e.g., to se expression ofHSDI 7BI3 Transcript or Isoform A). Likewise, in some methods, a transcriptional activator can be used to increase expression of an HSDI 7BI3 gene rs72613567 variant gene (e.g., to se expression of HSDI 7BI3 Transcript or Isoform D).

The target sequence (e.g., guide RNA target ce) for the DNA-binding protein can be anywhere within the HSDI 7BI3 gene or a nucleic acid encoding an HSD17B13 protein suitable for altering expression. As one example, the target sequence can be within a tory t, such as an enhancer or promoter, or can be in proximity to a regulatory element. For example, the target sequence can include or be proximate to the start codon of an HSDI 7BI3 gene. For example, the target sequence can be within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon.

In another example, antisense molecules can be used to alter expression of an HSDI 7BI3 gene or a nucleic acid encoding an HSD17B13 protein. Examples of antisense molecules include antisense RNAs, small interfering RNAs (siRNAs), and short hairpin RNAs (shRNAs). Such antisense RNAs, siRNAs, or shRNAs can be designed to target any region of an mRNA. For e, the antisense RNAs, siRNAs, or shRNAs can be ed to target a region unique to one or more of the HSD17B13 transcripts disclosed herein, or a region common to one or more of the HSD17B13 ripts disclosed herein. Examples of nucleic acids hybridizing to cDNAs and variant HSDI 7BI3 ripts are disclosed in more detail elsewhere . For example, the antisense RNA, siRNA, or shRNA can hybridize to a sequence within SEQ ID NO: 4 (HSDI 7BI3 Transcript A). Optionally, the antisense RNA, siRNA, or shRNA can decrease expression ofHSDI 7BI3 Transcript A in a cell. ally, the antisense RNA, siRNA, or shRNA izes to a sequence present in SEQ ID NO: 4 (HSDI 7BI3 Transcript A) that is not present in SEQ ID NO: 7 (HSDI 7BI3 ript D). Optionally, the antisense RNA, siRNA, or shRNA hybridizes to a sequence within exon 7 or a sequence spanning the exon 6- exon 7 boundary of SEQ ID NO: 4 (HSDI 7BI3 Transcript A).

As another example, the antisense RNA, siRNA, or shRNA can hybridize to a sequence within SEQ ID NO: 7 (HSDI 7BI3 Transcript D). Optionally, the antisense RNA, siRNA, or shRNA can decrease expression ofHSDI 7BI3 Transcript D in a cell. Optionally, the antisense RNA, siRNA, or shRNA hybridizes to a sequence present in SEQ ID NO: 7 (HSDI 7BI3 Transcript D) that is not t in SEQ ID NO: 4 (HSDI 7BI3 Transcript A).

Optionally, the antisense RNA, siRNA, or shRNA hybridizes to a sequence within exon 7 or a sequence spanning the exon 6-exon 7 boundary of SEQ ID NO: 7 (HSDI 7BI3 Transcript D).

C. Introducing Nucleic Acids and Proteins into Cells The nucleic acids and proteins disclosed herein can be introduced into a cell by any means. “Introducing” includes presenting to the cell the nucleic acid or protein in such a manner that the sequence gains access to the interior of the cell. The introducing can be accomplished by any means, and one or more of the components (e.g., two of the components, or all of the components) can be introduced into the cell simultaneously or sequentially in any combination.

For example, an exogenous donor sequence can be introduced prior to the introduction of a nuclease agent, or it can be introduced following introduction of nuclease agent (e.g., the exogenous donor sequence can be administered about 1, 2, 3, 4, 8, 12, 24, 36, 48, or 72 hours before or after introduction of the nuclease agent). See, e.g., US 2015/0240263 and US 201 5/01 10762, each of which is herein incorporated by reference in its entirety for all purposes.

Contacting the genome of a cell with a nuclease agent or exogenous donor sequence can comprise ucing one or more nuclease agents or nucleic acids encoding nuclease agents (e. g., one or more Cas proteins or nucleic acids encoding one or more Cas proteins, and one or more guide RNAs or nucleic acids encoding one or more guide RNAs (i.e., one or more CRISPR RNAs and one or more trachNAs)) and/or one or more exogenous donor sequences into the cell. ting the genome of cell (i.e., contacting a cell) can comprise introducing only one of the above components, one or more of the components, or all of the components into the cell.

A nuclease agent can be introduced into the cell in the form of a protein or in the form of a nucleic acid encoding the nuclease agent, such as an RNA (e.g., messenger RNA (mRNA)) or DNA. When introduced in the form of a DNA, the DNA can be operably linked to a promoter active in the cell. Such DNAs can be in one or more expression constructs.

For example, a Gas protein can be uced into the cell in the form of a protein, such as a Gas protein complexed with a gRNA, or in the form of a nucleic acid encoding the Gas protein, such as an RNA (e.g., messenger RNA (mRNA)) or DNA. A guide RNA can be introduced into the cell in the form of an RNA or in the form of a DNA encoding the guide RNA. When uced in the form of a DNA, the DNA ng the Gas protein and/or the guide RNA can be operably linked to a promoter active in the cell. Such DNAs can be in one or more expression constructs. For example, such sion constructs can be components of a single c acid le. Alternatively, they can be separated in any ation among two or more nucleic acid molecules (i.e., DNAs encoding one or more CRISPR RNAs, DNAs encoding one or more trachNAs, and DNA encoding a Gas protein can be components of separate nucleic acid molecules).

In some methods, DNA encoding a nuclease agent (e.g., a Gas protein and a guide RNA) and/or DNA encoding an exogenous donor sequence can be introduced into a cell via DNA minicircles. See, e.g., for all purposes. DNA minicircles are supercoiled DNA molecules that can be used for non-viral gene er that have neither an origin of replication nor an antibiotic selection marker. Thus, DNA minicircles are typically smaller in size than plasmid vector. These DNAs are devoid of bacterial DNA, and thus lack the unmethylated CpG motifs found in bacterial DNA.

The methods provided herein do not depend on a particular method for introducing a nucleic acid or protein into the cell, only that the nucleic acid or protein gains access to the interior of a least one cell. Methods for introducing nucleic acids and proteins into various cell types are known and include, for example, stable transfection methods, transient transfection methods, and virus-mediated s.

Transfection protocols as well as protocols for introducing nucleic acids or proteins into cells may vary. Non-limiting transfection methods include chemical-based transfection methods using liposomes; nanoparticles; calcium phosphate (Graham et al. (1973) Virology 52 (2): 456—67, Bacchetti et al. (1977) Proc. Natl. Acad. Sci. USA 74 (4): 1590—4, and Kriegler, M (1991). Transfer and Expression: A Laboratory . New York: W. H. n and Company. pp. 96—97); dendrimers; or cationic rs such as DEAE-dextran or polyethylenimine. Non-chemical methods include electroporation, Sono-poration, and optical transfection. Particle-based transfection includes the use of a gene gun, or magnet-assisted transfection (Bertram (2006) Current Pharmaceutical Biotechnology 7, 277—28). Viral methods can also be used for transfection. uction of nucleic acids or proteins into a cell can also be mediated by oporation, by intracytoplasmic injection, by viral infection, by adenovirus, by adeno- associated virus, by lentivirus, by retrovirus, by transfection, by lipid-mediated transfection, or by nucleofection. Nucleofection is an improved electroporation technology that enables c acid substrates to be red not only to the cytoplasm but also through the nuclear ne and into the nucleus. In addition, use of nucleofection in the methods disclosed herein typically requires much fewer cells than regular electroporation (e.g., only about 2 million compared with 7 n by regular oporation). In one example, nucleofection is performed using the LONZA® NUCLEOFECTORTM system.

Introduction of nucleic acids or proteins into a cell can also be accomplished by microinjection. Microinjection of an mRNA is preferably into the cytoplasm (e.g., to deliver mRNA directly to the translation machinery), while microinjection of a protein or a DNA encoding a DNA encoding a Gas protein is preferably into the nucleus. Alternatively, microinjection can be carried out by injection into both the nucleus and the cytoplasm: a needle can first be introduced into the nucleus and a first amount can be injected, and while removing the needle from the cell a second amount can be injected into the cytoplasm. If a nuclease agent protein is injected into the asm, the protein ably comprises a nuclear localization signal to ensure delivery to the nucleus/pronucleus. Methods for carrying out microinjection are well known. See, e.g., Nagy et al. (Nagy A, nstein M, Vintersten K, Behringer R., 2003, Manipulating the Mouse Embryo. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); Meyer et al. (2010) Proc. Natl. Acad. Sci. USA 107 : 1 5022-15026 and Meyer et al. (2012) Proc. Natl. Acad. Sci. USA 54-9359.

Other methods for introducing nucleic acid or proteins into a cell can include, for example, vector delivery, particle-mediated delivery, exosome-mediated delivery, lipidnanoparticle-mediated delivery, enetrating-peptide-mediated delivery, or implantable- device-mediated delivery. Methods of administering nucleic acids or proteins to a subject to modify cells in vivo are disclosed elsewhere herein.

Introduction of c acids and proteins into cells can also be lished by hydrodynamic delivery (HDD). Hydrodynamic delivery has emerged as a near-perfect method for intracellular DNA delivery in vivo. For gene ry to parenchymal cells, only essential DNA sequences need to be injected via a selected blood vessel, eliminating safety concerns associated with current viral and synthetic vectors. When injected into the bloodstream, DNA is e of reaching cells in the different tissues accessible to the blood. Hydrodynamic delivery employs the force ted by the rapid injection of a large volume of solution into the incompressible blood in the circulation to overcome the physical barriers of endothelium and cell nes that prevent large and membrane-impermeable compounds from entering parenchymal cells. In addition to the ry ofDNA, this method is useful for the efficient intracellular delivery ofRNA, proteins, and other small compounds in vivo. See, e.g., Bonamassa et al. (2011) Pharm. Res. 28(4):694-701 herein incorporated by reference in its entirety for all purposes.

Other methods for introducing nucleic acid or proteins into a cell can include, for example, vector delivery, particle-mediated delivery, exosome-mediated delivery, lipidnanoparticle-mediated delivery, cell-penetrating-peptide-mediated delivery, or implantable- device-mediated delivery. As specific examples, a nucleic acid or protein can be introduced into a cell in a carrier such as a poly(lactic acid) (PLA) microsphere, a poly(D,L-lactic-coglycolic- acid) (PLGA) microsphere, a me, a micelle, an inverse micelle, a lipid cochleate, or a lipid microtubule.

The introduction of nucleic acids or ns into the cell can be performed one time or multiple times over a period of time. For example, the introduction can be performed at least two times over a period of time, at least three times over a period of time, at least four times over a period of time, at least five times over a period of time, at least six times over a period of time, at least seven times over a period of time, at least eight times over a period of time, at least nine times over a period of times, at least ten times over a period of time, at least eleven times, at least twelve times over a period of time, at least thirteen times over a period of time, at least fourteen times over a period of time, at least fifteen times over a period of time, at least sixteen times over a period of time, at least seventeen times over a period of time, at least eighteen times over a period of time, at least nineteen times over a period of time, or at least twenty times over a period of time.

In some cases, the cells employed in the methods and compositions have a DNA construct stably incorporated into their genome. In such cases, the contacting can comprise providing a cell with the construct already stably incorporated into its genome. For example, a cell employed in the methods disclosed herein may have a preexisting Cas-encoding gene stably incorporated into its genome (i.e., a ady cell). “Stably incorporated” or “stably introduced” or “stably integrated” includes the introduction of a polynucleotide into the cell such that the tide sequence integrates into the genome of the cell and is capable ofbeing inherited by progeny thereof. Any protocol may be used for the stable incorporation of the DNA constructs or the various components of the targeted genomic integration system.

D. Nuclease Agents and DNA-Binding ns Any nuclease agent that induces a nick or double-strand break into a desired target ce or any DNA-binding protein that binds to a desired target sequence can be used in the methods and compositions disclosed herein. A naturally occurring or native se agent can be employed so long as the se agent induces a nick or double-strand break in a desired target sequence. Likewise, a lly occurring or native DNA-binding protein can be employed so long as the DNA-binding protein binds to the desired target ce.

Alternatively, a modified or engineered nuclease agent or DNA-binding protein can be employed. An “engineered nuclease agent or DNA-binding protein” includes a nuclease agent or DNA-binding protein that is engineered (modified or derived) from its native form to specifically recognize a desired target sequence. Thus, an engineered nuclease agent or DNA-binding n can be derived from a native, lly occurring nuclease agent or DNA-binding protein or it can be artificially created or synthesized. The engineered nuclease agent or DNA-binding protein can recognize a target ce, for example, wherein the target sequence is not a sequence that would have been recognized by a native (non-engineered or dified) se agent or DNA-binding protein. The modification of the nuclease agent or DNA- binding protein can be as little as one amino acid in a protein cleavage agent or one nucleotide in a nucleic acid cleavage agent. Producing a nick or double-strand break in a target sequence or other DNA can be referred to herein as “cutting” or “cleaving” the target sequence or other Active variants and fragments of nuclease agents or DNA-binding proteins (i.e., an ered nuclease agent or DNA-binding protein) are also provided. Such active variants can comprise at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the native nuclease agent or DNA-binding protein, wherein the active variants retain the ability to cut at a desired target sequence and hence retain nick or double-strand-break-inducing activity or retain the ability to bind a desired target sequence. For example, any of the nuclease agents described herein can be modified fiom a native clease sequence and designed to recognize and induce a nick or -strand break at a target sequence that was not recognized by the native nuclease agent. Thus, some ered nucleases have a specificity to induce a nick or double-strand break at a target sequence that is different from the corresponding native nuclease agent target sequence. Assays for nick or double-strand-break-inducing activity are known and generally measure the overall activity and specificity of the endonuclease on DNA substrates containing the target sequence.

The term “target sequence for a se agent” includes a DNA ce at which a nick or double-strand break is induced by a nuclease agent. Likewise, the term “target sequence for a DNA-binding n” includes a DNA sequence to which a nding protein will bind. The target sequence can be endogenous (or native) to the cell or the target sequence can be exogenous to the cell. A target sequence that is ous to the cell is not naturally occurring in the genome of the cell. The target sequence can also exogenous to the polynucleotides of interest that one desires to be positioned at the target locus. In some cases, the target sequence is present only once in the genome of the host cell.

Active variants and fragments of the exemplified target ces are also provided.

Such active variants can comprise at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the given target sequence, wherein the active ts retain biological activity and hence are capable ofbeing recognized and cleaved by a nuclease agent in a sequence-specific . Assays to measure the double- strand break of a target sequence by a se agent are known (e.g., TAQMAN® qPCR assay, Frendewey et al. (2010) Methods in Enzymology 476295-307, herein incorporated by reference in its entirety for all purposes).

The length of the target sequence can vary, and includes, for example, target ces that are about 30-36 bp for a zinc finger protein or zinc finger nuclease (ZFN) pair (i.e., about 15-18 bp for each ZFN), about 36 bp for a Transcription Activator-Like Effector (TALE) protein or Transcription Activator-Like Effector Nuclease (TALEN), or about 20 bp for a CRISPR/Cas9 guide RNA.

The target ce of the DNA-binding protein or nuclease agent can be positioned anywhere in or near the target genomic locus. The target sequence can be located within a coding region of a gene (e.g., the HSDI 7BI3 gene), or within regulatory regions that influence the expression of the gene. A target sequence of the DNA-binding protein or nuclease agent can be located in an intron, an exon, a promoter, an enhancer, a regulatory region, or any non-protein coding region.

One type of nding protein that can be employed in the various methods and compositions disclosed herein is a Transcription Activator-Like Effector (TALE). A TALE can be fused or linked to, for example, an epigenetic modification domain, a transcriptional tion domain, or a transcriptional repressor domain. Examples of such domains are described with respect to Gas proteins, below, and can also be found, for example, in WC 201 1/145121, herein incorporated by reference in its entirety for all es. Correspondingly, one type of nuclease agent that can be employed in the various methods and compositions disclosed herein is a Transcription Activator-Like Effector se (TALEN). TAL effector nucleases are a class of sequence-specific nucleases that can be used to make double-strand breaks at specific target sequences in the genome of a prokaryotic or otic organism. TAL effector nucleases are created by fusing a native or engineered transcription activator-like (TAL) effector, or functional part thereof, to the catalytic domain of an endonuclease such as FokI. The unique, modular TAL effector DNA binding domain allows for the design eins with ially any given DNA ition specificity. Thus, the DNA binding domains of the TAL effector nucleases can be engineered to recognize specific DNA target sites and thus, used to make double-strand breaks at desired target sequences. See (2010) Proc. Natl. Acad. Sci. USA. 107(50:21617-21622; Scholze & Boch (2010) nce 1:428-432; Christian et al. (2010) Genetics 7-761; Li et al. (2011) Nucleic Acids Res. 39(1):359-372; and Miller et al. (2011) Nature Biotechnology 29: 143—148, each of which is herein incorporated by reference in its entirety for all purposes.

Examples of suitable TAL nucleases, and methods for preparing suitable TAL nucleases, are disclosed, e.g., in US 2011/0239315 A1, US 269234 A1, US 2011/0145940 A1, US 2003/0232410 A1, US 2005/0208489 A1, US 026157 A1, US 2005/0064474 A1, US 2006/0188987 A1, and US 2006/0063231 A1, each of which is herein incorporated by reference in its entirety for all es. In various embodiments, TAL effector nucleases are engineered that cut in or near a target nucleic acid sequence in, for example, a genomic locus of interest, wherein the target nucleic acid sequence is at or near a sequence to be modified by a an exogenous donor sequence. The TAL nucleases suitable for use with the various methods and compositions provided herein include those that are specifically designed to bind at or near target nucleic acid sequences to be modified by exogenous donor sequences as described elsewhere herein.

In some TALENs, each monomer of the TALEN comprises 33-35 TAL repeats that recognize a single base pair via two hypervariable residues. In some TALENs, the se agent is a chimeric protein comprising a TAL-repeat-based DNA g domain operably linked to an independent se such as a FokI endonuclease. For example, the nuclease agent can comprise a first TAL-repeat-based DNA binding domain and a second TAL-repeat-based DNA g domain, wherein each of the first and the second TAL-repeat-based DNA binding domains is operably linked to a FokI nuclease, wherein the first and the second TAL-repeat- based DNA binding domain recognize two contiguous target DNA ces in each strand of the target DNA sequence ted by a spacer sequence of varying length (12-20 bp), and wherein the FokI nuclease ts ze to create an active nuclease that makes a double strand break at a target sequence.

] Another example of a nding protein is a zinc finger protein. Such zinc finger proteins can be linked or fused to, for example, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain. Examples of such domains are bed with t to Gas proteins, below, and can also be found, for example, in WC 201 1/145121, herein incorporated by reference in its entirety for all purposes.

Correspondingly, another example of a nuclease agent that can be employed in the various methods and itions disclosed herein is a zinc-finger nuclease (ZFN). In some ZFNs, each monomer of the ZFN comprises three or more zinc finger-based DNA binding domains, wherein each zinc finger-based DNA binding domain binds to a 3 bp subsite. In other ZFNs, the ZFN is a chimeric protein comprising a zinc finger-based DNA binding domain operably linked to an independent nuclease such as a FokI clease. For example, the se agent can comprise a first ZFN and a second ZFN, wherein each of the first ZFN and the second ZFN is operably linked to a FokI nuclease subunit, wherein the first and the second ZFN ize two contiguous target DNA sequences in each strand of the target DNA ce separated by about -7 bp spacer, and wherein the FokI nuclease ts dimerize to create an active nuclease that makes a double strand break. See, e.g., US 2006/0246567; US 2008/0182332; US 2002/0081614; US 2003/0021776; which is herein incorporated by reference in its ty for all es.

Other suitable DNA-binding proteins and nuclease agents for use in the methods and compositions described herein include CRISPR-Cas systems, which are described elsewhere herein.

The DNA-binding protein or nuclease agent may be introduced into the cell by any known means. A polypeptide encoding the DNA-binding protein or nuclease agent may be directly introduced into the cell. Alternatively, a cleotide ng the DNA-binding protein or nuclease agent can be introduced into the cell. When a polynucleotide encoding the DNA-binding protein or se agent is introduced into the cell, the DNA-binding protein or nuclease agent can be transiently, conditionally, or constitutively expressed within the cell. For example, the polynucleotide encoding the DNA-binding protein or nuclease agent can be contained in an expression cassette and be operably linked to a conditional er, an inducible promoter, a constitutive promoter, or a tissue-specific promoter. Such promoters are discussed in further detail elsewhere herein. Alternatively, the DNA-binding protein or nuclease agent can be uced into the cell as an mRNA encoding a DNA-binding protein or a nuclease agent.

WO 36758 A polynucleotide encoding a DNA-binding protein or nuclease agent can be stably integrated in the genome of the cell and operably linked to a promoter active in the cell.

Alternatively, a cleotide encoding a DNA-binding protein or nuclease agent can be in a targeting vector or in a vector or a plasmid that is separate from the targeting vector comprising the insert polynucleotide.

When the DNA-binding protein or nuclease agent is provided to the cell through the introduction of a polynucleotide encoding the DNA-binding protein or nuclease agent, such a polynucleotide encoding a DNA-binding protein or se agent can be modified to substitute codons having a higher frequency of usage in the cell of interest, as compared to the naturally occurring polynucleotide sequence encoding the DNA-binding protein or nuclease agent. For example, the polynucleotide encoding the nding protein or nuclease agent can be modified to substitute codons having a higher ncy of usage in a given prokaryotic or eukaryotic cell of interest, ing a bacterial cell, a yeast cell, a human cell, a non-human cell, a mammalian cell, a rodent cell, a mouse cell, a rat cell or any other host cell of interest, as ed to the naturally occurring polynucleotide sequence.

E. CRISPR-Gas Systems The methods sed herein can e Clustered Regularly Interspersed Short Palindromic Repeats (CRISPR)/CRISPR-associated (Cas) systems or components of such systems to modify a genome within a cell. CRISPR-Cas systems e transcripts and other elements involved in the expression of, or directing the ty of, Gas genes. A CRISPR-Cas system can be a type I, a type II, or a type 111 system. Alternatively a CRISPR/Cas system can be, for example, a type V system (e.g., subtype V-A or subtype V-B). The methods and compositions disclosed herein can employ CRISPR-Cas systems by utilizing CRISPR complexes (comprising a guide RNA (gRNA) complexed with a Gas protein) for site-directed cleavage of nucleic acids.

The -Cas systems used in the s disclosed herein can be non-naturally occurring. A “non-naturally occurring” system includes anything indicating the involvement of the hand of man, such as one or more components of the system being altered or mutated from their naturally occurring state, being at least substantially free from at least one other component with which they are naturally associated in nature, or being associated with at least one other component with which they are not naturally associated. For example, non-naturally occurring CRISPR/Gas systems can employ CRISPR complexes comprising a gRNA and a Gas protein that do not naturally occur together, a Gas protein that does not occur naturally, or a gRNA that does not occur naturally.

(I) Cas Proteins and Polynucleotides Encoding Cas Proteins Cas proteins generally se at least one RNA recognition or binding domain that can ct with guide RNAs (gRNAs, described in more detail below). Cas proteins can also comprise nuclease domains (e.g., DNase or RNase domains), DNA binding domains, se domains, protein-protein interaction domains, dimerization domains, and other domains. A nuclease domain possesses catalytic activity for c acid cleavage, which includes the breakage of the covalent bonds of a nucleic acid molecule. Cleavage can produce blunt ends or staggered ends, and it can be single-stranded or -stranded. For example, a wild type Cas9 n will typically create a blunt cleavage product. Alternatively, a wild type Cpfl protein (e. g., FnCpfl) can result in a cleavage t with a 5-nucleotide 5’ overhang, with the cleavage occurring after the 18th base pair from the PAM sequence on the non-targeted strand and after the 23rd base on the targeted strand. A Gas protein can have full cleavage activity to create a double-strand break in the HSDI 7BI3 gene (e.g., a double-strand break with blunt ends), or it can be a nickase that creates a -strand break in the HSDI 7BI3 gene.

] Examples of Gas proteins include Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csnl or Csx12), Cale, Caled, CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl , Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csxl, Csx15, Csfl, Csf2, Csf3, Csf4, and Cu1966, and homologs or modified versions thereof.

An exemplary Cas n is a Cas9 protein or a protein derived from a Cas9 protein from a type II CRISPR/Gas system. Cas9 ns are from a type II CRISPR/Gas system and lly share four key motifs with a conserved architecture. Motifs 1, 2, and 4 are Rqu-like , and motif 3 is an HNH motif. Exemplary Cas9 proteins are from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, lderiales bacterium, monas naphthalenivorans, Polaromonas sp., Crocosphaera ii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium icum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium num, Clostridium difi‘icile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, hiobacillus caldus, Acidithi0bacillusferr00xidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus i, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, na variabilis, Nodularia spumigena, Nostoc sp., Arthrospira , Arthrospira sis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, or Acaryochloris marina. Additional examples of the Cas9 family members are described in entirety for all purposes. Cas9 from S. pyogenes (SpCas9) (assigned SwissProt accession number Q99ZW2) is an exemplary Cas9 protein. Cas9 from S. aureus (SaCas9) (assigned UniProt accession number J7RUA5) is another exemplary Cas9 protein. r example of a Gas protein is a Cpfl (CRISPR from Prevotella and Francisella 1) protein. Cpfl is a large n (about 1300 amino acids) that contains a Rqu- like nuclease domain homologous to the corresponding domain of Cas9 along with a counterpart to the characteristic arginine-rich cluster of Cas9. However, Cpfl lacks the HNH nuclease domain that is present in Cas9 proteins, and the ke domain is contiguous in the Cpfl sequence, in contrast to Cas9 where it contains long inserts including the HNH domain. See, e.g., Zetsche et al. (2015) Cell 163 (3):759-77 1, herein incorporated by reference in its entirety for all purposes. Exemplary Cpfl proteins are from Francisella tularensis I, Francisella tularensis subsp. novicida, Prevotella albensis, Lachnospiraceae bacterium MC201 7 I Butyrivibrio proteoclasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44_1 7, Smithella sp. SCADC, Acidaminococcus sp.

BV3L6, Lachnospiraceae bacterium M42020, atus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira , Lachnospiraceae bacterium , Porphyromonas ricanis 3, Prevotella disiens, and Porphyromonas macacae.

WO 36758 Cpfl fiom Francisella novicida U112 (FnCpfl; assigned UniProt accession number AOQ7Q2) is an exemplary Cpfl protein.

Cas ns can be wild type proteins (i.e., those that occur in nature), d Cas proteins (i.e., Cas protein ts), or fiagments of wild type or d Cas ns. Cas ns can also be active variants or fragments with respect to catalytic activity of wild type or modified Cas proteins. Active variants or fiagments with respect to catalytic activity can comprise at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the wild type or modified Cas protein or a portion thereof, wherein the active variants retain the ability to cut at a desired cleavage site and hence retain nick-inducing or -strand-break-inducing activity. Assays for nick-inducing or double-strand-break- inducing activity are known and generally measure the overall activity and specificity of the Gas n on DNA substrates containing the cleavage site.

Cas proteins can be modified to se or decrease one or more of nucleic acid binding y, nucleic acid binding specificity, and enzymatic activity. Cas proteins can also be modified to change any other activity or property of the protein, such as stability. For example, one or more se domains of the Gas protein can be modified, deleted, or inactivated, or a Gas protein can be truncated to remove domains that are not essential for the function of the protein or to optimize (e.g., enhance or reduce) the activity of the Gas protein.

Cas proteins can comprise at least one nuclease domain, such as a DNase domain.

For example, a wild type Cpfl n generally comprises a Rqu-like domain that cleaves both strands of target DNA, perhaps in a dimeric configuration. Cas proteins can also comprise at least two nuclease domains, such as DNase domains. For example, a wild type Cas9 protein generally comprises a Rqu-like nuclease domain and an HNH-like nuclease domain. The Rqu and HNH domains can each cut a ent strand of double-stranded DNA to make a double-stranded break in the DNA. See, e.g., Jinek et al. (2012) Science 337:816-821, herein incorporated by reference in its entirety for all purposes.

One or more of the nuclease domains can be deleted or d so that they are no longer functional or have reduced nuclease activity. For example, if one of the nuclease s is deleted or mutated in a Cas9 protein, the resulting Cas9 protein can be referred to as a nickase and can generate a single-strand break at a guide RNA target sequence within a double-stranded DNA but not a double-strand break (i.e., it can cleave the complementary strand or the non- WO 36758 complementary strand, but not both). If both of the nuclease domains are deleted or mutated, the resulting Cas protein (e.g., Cas9) will have a reduced ability to cleave both strands of a double- ed DNA (e.g., a nuclease-null or nuclease-inactive Cas protein, or a catalytically dead Cas protein (dCas)). An example of a mutation that converts Cas9 into a nickase is a D10A (aspartate to e at position 10 of Cas9) mutation in the Rqu domain of Cas9 from S. pyogenes. Likewise, H939A (histidine to e at amino acid position 839) or H840A (histidine to alanine at amino acid position 840) in the HNH domain of Cas9 from S. pyogenes can convert the Cas9 into a e. Other examples of mutations that convert Cas9 into a nickase include the corresponding ons to Cas9 from S. thermophilus. See, e.g., Sapranauskas et al. (2011) Nucleic Acids Research 39:9275-9282 and which is herein incorporated by reference in its entirety for all purposes. Such mutations can be generated using s such as site-directed mutagenesis, PCR-mediated mutagenesis, or total gene synthesis. Examples of other mutations creating nickases can be found, for example, in entirety for all purposes.

Cas proteins (e.g., nuclease-active Cas proteins or nuclease-inactive Cas proteins) can also be operably linked to heterologous polypeptides as fusion proteins. For example, a Gas protein can be fused to a cleavage domain, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional sor domain. See incorporated by reference in its entirety for all purposes. Examples of transcriptional activation domains include a herpes simplex virus VP16 activation domain, VP64 (which is a tetrameric derivative of VP16), a NFKB p65 activation domain, p53 activation domains 1 and 2, a CREB (cAMP response element binding protein) activation domain, an E2A tion domain, and an NFAT (nuclear factor of activated T-cells) activation domain. Other examples include activation domains from Oct1, Oct-2A, SP1, AP-2, CTF1, P300, CBP, PCAF, SRCl, PvALF, ERF-2, OsGAI, HALF-1, C1, AP1, ARF-S, ARF-6, ARF-7, ARF-8, CPRFl, CPRF4, MYC-RP/GP, C4, and HSF1. See, e.g., US 2016/0237456, 537, and WO 45121, each of which is incorporated by reference in its entirety for all es. In some cases, a transcriptional activation system can be used comprising a dCas9-VP64 fusion protein paired with MS2-p65-HSF1. Guide RNAs in such systems can be designed with aptamer sequences appended to ngNA tetraloop and stem-loop 2 designed to bind dimerized MS2 bacteriophage coat proteins. See, e.g., Konermann et al. (2015) Nature 517(7536):583-5 88, herein orated by nce in its ty for all purposes. Examples of transcriptional repressor domains include inducible cAMP early repressor (ICER) domains, Kruppel-associated box A (KRAB-A) repressor domains, YY1 glycine rich repressor domains, Sp1 -like repressors, E(spl) repressors, IKB repressor, and MeCP2. Other examples include transcriptional repressor domains from A/B, KOX, TGF-beta-inducible early gene (TIEG), v-erbA, SID, SID4X, MBD2, MBD3, DNMTl, , DNMT3B, Rb, ROM2, See, e.g., EP3045537 and W0 201 21, each of which is orated by reference in its entirety for all es. Cas proteins can also be fused to a heterologous polypeptide providing increased or decreased stability. The fused domain or heterologous polypeptide can be located at the N-terminus, the C-terminus, or internally within the Gas protein.

As one example, a Gas protein can be fused to a heterologous polypeptide that provides for subcellular localization. Such heterologous ptides can include, for example, one or more nuclear localization signals (NLS) such as the SV40 NLS for targeting to the nucleus, a mitochondrial localization signal for targeting to the mitochondria, an ER retention signal, and the like. See, e.g., Lange et al. (2007) J. Biol. Chem. 282:5101-5105, herein incorporated by reference in its entirety for all purposes. Such subcellular zation signals can be located at the N-terminus, the C-terminus, or anywhere within the Gas protein. An NLS can comprise a stretch ofbasic amino acids, and can be a monopartite sequence or a bipartite Cas proteins can also be operably linked to a cell-penetrating domain. For example, the cell-penetrating domain can be derived from the HIV-1 TAT protein, the TLM cell- penetrating motif from human hepatitis B virus, MPG, Pep-1, VP22, a cell penetrating peptide from Herpes x virus, or a polyarginine peptide sequence. See, e.g., herein incorporated by reference in its ty for all purposes. The cell-penetrating domain can be located at the N-terminus, the inus, or anywhere within the Gas protein.

Cas proteins can also be operably linked to a heterologous polypeptide for ease of tracking or ation, such as a fluorescent protein, a purification tag, or an epitope tag.

Examples of fluorescent proteins e green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent proteins (e.g., eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., eCFP, Cerulean, CyPet, AmCyanl, Midoriishi- Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFPl, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRedl, AsRed2, eqFP611, erry, mStrawberry, Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, Monomeric Kusabira-Orange, mTangerine, thomato), and any other suitable fluorescent protein. Examples of tags include glutathione-S-transferase (GST), chitin g protein (CBP), e binding protein, doxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1 , AU5, E, ECS, E2, FLAG, hemagglutinin (HA), nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, histidine (His), biotin carboxyl r protein (BCCP), and calmodulin.

Cas proteins can also be tethered to exogenous donor sequences or d nucleic acids. Such tethering (i.e., physical linking) can be achieved through covalent interactions or noncovalent interactions, and the ing can be direct (e.g., through direct fusion or chemical ation, which can be achieved by modification of cysteine or lysine residues on the protein or intein modification), or can be achieved through one or more intervening linkers or adapter molecules such as streptavidin or aptamers. See, e.g., Pierce et al. (2005) Mini Rev. Med. Chem. (1):41-55; Duckworth et al. (2007) Angew. Chem. Int. Ed. Engl. 46(46):8819-8822; fer and Dixon (2009) Australian J. Chem. 62(10):1328-1332; Goodman et al. (2009) Chembiochem. (9):1551-1557; and Khatwani et al. (2012) Bioorg. Med. Chem. 20(14):4532-4539, each of which is herein orated by reference in its entirety for all purposes. Noncovalent gies for synthesizing protein-nucleic acid conjugates include biotin-streptavidin and nickel-histidine methods. Covalent protein-nucleic acid conjugates can be synthesized by connecting appropriately functionalized nucleic acids and proteins using a wide variety of chemistries.

Some of these chemistries involve direct attachment of the oligonucleotide to an amino acid residue on the protein surface (e.g., a lysine amine or a cysteine , while other more complex schemes require ranslational modification of the protein or the involvement of a catalytic or reactive protein domain. Methods for covalent attachment ofproteins to nucleic acids can include, for e, chemical cross-linking of oligonucleotides to protein lysine or cysteine es, expressed n-ligation, chemoenzymatic methods, and the use ofphotoaptamers.

The exogenous donor sequence or labeled nucleic acid can be tethered to the C-terminus, the N- terminus, or to an internal region within the Gas protein. Preferably, the exogenous donor sequence or labeled nucleic acid is tethered to the C-terminus or the N-terminus of the Gas protein. Likewise, the Gas protein can be tethered to the 5’ end, the 3 ’ end, or to an internal region within the exogenous donor sequence or labeled nucleic acid. That is, the exogenous donor sequence or labeled nucleic acid can be tethered in any orientation and ty.

Preferably, the Gas protein is tethered to the 5’ end or the 3’ end of the exogenous donor sequence or labeled nucleic acid.

Cas proteins can be provided in any form. For example, a Gas protein can be provided in the form of a protein, such as a Gas protein complexed with a gRNA. Alternatively, a Gas n can be provided in the form of a nucleic acid encoding the Gas protein, such as an RNA (e.g., ger RNA (mRNA)) or DNA. Optionally, the nucleic acid encoding the Gas protein can be codon optimized for efficient translation into n in a ular cell or organism. For example, the nucleic acid encoding the Gas protein can be modified to substitute codons having a higher frequency of usage in a bacterial cell, a yeast cell, a human cell, a non- human cell, a mammalian cell, a rodent cell, a mouse cell, a rat cell, or any other host cell of interest, as compared to the naturally occurring polynucleotide sequence. When a nucleic acid encoding the Gas protein is introduced into the cell, the Gas protein can be transiently, conditionally, or constitutively expressed in the cell.

Nucleic acids encoding Cas ns can be stably integrated in the genome of the cell and operably linked to a promoter active in the cell. Alternatively, c acids encoding Cas ns can be operably linked to a promoter in an expression construct. Expression constructs include any nucleic acid constructs capable of directing expression of a gene or other nucleic acid sequence of interest (e.g., a Gas gene) and which can transfer such a nucleic acid sequence of interest to a target cell. For example, the c acid ng the Gas protein can be in a targeting vector comprising a nucleic acid insert and/or a vector sing a DNA encoding a gRNA. Alternatively, it can be in a vector or plasmid that is te from the targeting vector comprising the nucleic acid insert and/or separate from the vector comprising the DNA encoding the gRNA. Promoters that can be used in an expression construct include promoters active, for e, in one or more of a eukaryotic cell, a human cell, a non-human cell, a mammalian cell, a non-human mammalian cell, a rodent cell, a mouse cell, a rat cell, a hamster cell, a rabbit cell, a pluripotent cell, an embryonic stem (ES) cell, or a zygote. Such promoters can be, for example, conditional promoters, ble promoters, constitutive promoters, or tissue-specific promoters. Optionally, the promoter can be a bidirectional promoter driving expression ofboth a Gas protein in one direction and a guide RNA in the other direction. Such ctional promoters can consist of (1) a complete, conventional, unidirectional Pol III promoter that contains 3 external control ts: a distal sequence element (DSE), a proximal sequence element (PSE), and a TATA box; and (2) a second basic Pol III promoter that includes a PSE and a TATA box fused to the 5' terminus of the DSE in reverse orientation. For example, in the H1 er, the DSE is adjacent to the PSE and the TATA box, and the promoter can be rendered bidirectional by creating a hybrid promoter in which ription in the reverse direction is controlled by appending a PSE and TATA box derived from the U6 promoter. See, e.g., US 2016/0074535, herein incorporated by references in its entirety for all purposes. Use of a bidirectional promoter to express genes encoding a Gas protein and a guide RNA simultaneously allow for the generation of compact expression cassettes to facilitate delivery. (2) Guide RNAs A “guide RNA” or “gRN ” is an RNA molecule that binds to a Gas n (e.g., Cas9 n) and targets the Gas protein to a specific location within a target DNA (e.g., the HSDI 7BI3 gene). In particular, disclosed herein are guide RNAs effective to direct a Gas enzyme to bind to or cleave an HSDI 7BI3 locus or HSDI 7BI3 gene. One exemplary guide RNA is a guide RNA effective to direct a Gas enzyme to bind to or cleave an HSDI 7BI3 gene, wherein the guide RNA ses a DNA-targeting segment that hybridizes to a guide RNA ition sequence (i.e., targets a guide RNA target sequence) within the HSDI 7BI3 gene that es or is proximate to a position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. By target a guide RNA target sequence is meant hybridize to the complementary strand ce that is the reverse complement of the guide RNA target sequence on the non-complementary strand. For example, the guide RNA target sequence can be within about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of a position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. Other exemplary guide RNAs comprise a DNA-targeting segment that targets a guide RNA target sequence within the HSDI 7BI3 gene that is within a region corresponding to exon 6 and/or intron 6 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. Other exemplary guide RNAs comprise a rgeting segment that targets a guide RNA target sequence within the HSDI 7BI3 gene that is within a region corresponding to exon 6 and/or intron 6 and/or exon 7 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. Other exemplary guide RNAs comprise a DNA-targeting segment that hybridizes to a guide RNA recognition ce (i.e., targets a guide RNA target sequence) within the HSDI 7BI3 gene that es or is proximate to the start codon of the HSDI 7BI3 gene or es or is proximate to the stop codon of the HSDI 7BI3 gene. For example, the guide RNA target sequence can be within about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon or within about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the stop codon. For example, the guide RNA target sequence can be within a region corresponding to exon 1 of SEQ ID NO: 1 or 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1 or 2. Likewise, the guide RNA target sequence can be within a region corresponding to exon 7 of SEQ ID NO: 1 or 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1 or 2. The HSDI 7BI3 gene can be an HSDI 7BI3 gene from any organism. For example, the HSDI 7BI3 gene can be a human HSDI 7BI3 gene or an ortholog from r sm, such as a non-human mammal, a rodent, a mouse, or a rat.

Examples of guide RNA target sequences at the 5’ end of the human HSDI 7BI3 gene comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOS: 20-81 and are set forth in the table below. Examples of guide RNA DNA-targeting segments ponding to SEQ ID NOS: 20-81 are set forth in in the table below and are identical to SEQ ID NOS: 20-81 except with uracils instead of thymines. A guide RNA DNA-targeting segment can comprise, consist essentially of, or consist of any the DNA-targeting t sequences set forth in the table below. Examples of guide RNA target sequences adjacent to the transcription start site (TSS) of the human HSDI 7BI3 gene comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOS: 20-41 and are set forth in the table below. Exemplary guide RNA target sequences adjacent to the TSS include SEQ ID NOS: 21-23, 33, and 35. SEQ ID NOS: 33 and 35 are closest to the TSS. Exemplary chNAs and ngNAs (comprising scaffold version 1, 2, 3, or 4) ponding to the guide RNA target sequences at the 5’ end of the human HSDI 7BI3 gene comprise, consist essentially of, or consist of any of the sequences set forth in the table below.

Guide RNA Target Sequences at 5’ End of the Human HSDI7313 Gene SE 0 ID NO . DNA- PAM Gulde RNA Target Sequence gRNA Tar etin chNA -_—__---m -_—__--- -_—__--- -_—__--- -_———---m -_—__--- -_—__--- -_—__--- -_—__--- -_—__--- -_—__--- -_——---m- -_—__--- -_—__--- -_—__--- -_—__--- -_—__--- -_—__--- -_—__--- -_—__--- -_———--m -_—__--- -_—__--- -_—__---m -_—__--- -_——---m- -_——---m_ -_—__--- SEQ ID NO DNAPAM Guide RNA Target Sequence gRNA Targeting chNA Target Seq v1 v2 v3 v4 Se . ment TGGAAGCCAGCTTTGGAAGC 1013 1243 -- ACAAGGCCTGCTTCCAAAGC 1014 1244 GCCTTGTTCACGTGTTCTAA -_—__--- -_—__--- ____---“ Examples of guide RNA target sequences at the 3’ end of the human HSDI 7BI3 gene comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOS: 82-225 and are set forth in the table below. Examples of guide RNA DNA-targeting segments ponding to SEQ ID NOS: 82-225 are set forth in SEQ ID NOS: 1485-1628, respectively, which are identical to SEQ ID NOS: 82-225 except with s instead of thymines. A guide RNA DNA-targeting segment can comprise, consist essentially of, or consist of any the sequences set forth in SEQ ID NOS: 1485-1628. Exemplary chNAs and ngNAs (comprising scaffold version 1, 2, 3, or 4) corresponding to the guide RNA target sequences at the 3’ end of the human HSDI 7BI3 gene se, consist ially of, or consist of any of the sequences set forth in the table below.

Guide RNA Target Sequences at 3’ End of the Human HSDI7313 Gene SE 0 ID NO PAM Guide RNA Target Sequence gRNA ngNA m Targets“! -_—————m- -_—————-z- SEQ ID NO PAM Guide RNA Target Sequence gRNA ngNA Targets“! -_—___M- -_—___M -_—___M SEQ ID NO PAM Guide RNA Target Sequence gRNA ngNA Targets“! -_—___M- -_—___M -_—___M -_—___M -_—___M -_—___M- SEQ ID NO PAM Guide RNA Target Sequence gRNA ngNA Targets“! -_—___M -_—___M Examples of guide RNA target sequences proximate to a position corresponding to position 12666 of SEQ ID NO: 2 comprise, consist essentially of, or consist of the sequences set forth in SEQ ID NOS: 226-239 and are set forth in the table below. Examples of guide RNA DNA-targeting segments corresponding to SEQ ID NOS: 226-239 are set forth in SEQ ID NOS: 1629-1642, respectively, which are identical to SEQ ID NOS: 9 except with s instead of thymines. A guide RNA DNA-targeting segment can comprise, consist essentially of, or consist of any the sequences set forth in SEQ ID NOS: 1629-1642. Exemplary guide RNA target sequences proximate to a position ponding to position 12666 of SEQ ID NO: 2 include SEQ ID NOS: 230 and 231. Exemplary chNAs and ngNAs (comprising scaffold n 1, 2, 3, or 4) corresponding to the guide RNA target sequences proximate to a position corresponding to position 12666 of SEQ ID NO: 2 comprise, consist ially of, or consist of any of the sequences set forth in the table below.

WO 36758 Guide RNA Target Sequences Near rs72613567 Variation to (hp) Distance Variation gRNA Target chNA Seq v1 v3 v4 ATCATGCATACATCTCTGGC 107 226 476 706 936 1 166 1396 TCATTTTGATTTTG 227 477 707 937 1 167 1397 ATTCAATTTGAAGCAGTGGT 228 478 708 938 1 168 1398 GAATATTCAATTTGAAGCAG 229 479 709 939 1169 1399 --—&——————CATACGATTTAAAATCGCTG 230 480 710 940 1 170 1400 -_-______ -_-______ ] Examples of guide RNA target ces in the mouse Hsd] 7b13 gene proximate to a position corresponding to on 12666 of SEQ ID NO: 2 when the mouse Hsd] 7b13 gene is lly aligned with SEQ ID NO: 2 comprise, consist essentially of, or consist of the sequences set forth in Table 12 in Example 4. Examples of guide RNA target sequences at the 5’ end of the mouse Hsd] 7b13 gene comprise, consist essentially of, or consist of the sequences set forth Table 12 in Example 4. Examples of guide RNA DNA-targeting segments corresponding to those guide RNA target sequences are also set forth in Table 12 in Example 4. A guide RNA DNA-targeting segment can comprise, consist essentially of, or consist of any those sequences.

Exemplary chNAs and ngNAs (comprising scaffold version 1, 2, 3, or 4) corresponding to the guide RNA target sequences in Table 12 in Example 4 can comprise, consist essentially of, or consist of any of the chNA or ngNA sequences set forth in Table 12 in e 4.

Guide RNAs can se two segments: a “DNA-targeting segment” and a “protein- binding segment.” “Segment” includes a section or region of a molecule, such as a contiguous h of nucleotides in an RNA. Some gRNAs, such as those for Cas9, can comprise two separate RNA molecules: an “activator-RN ” (e. ” (e. g., trachNA) and a “targeter-RN g., CRISPR RNA or chNA). Other gRNAs are a single RNA molecule (single RNA polynucleotide), which can also be called a “single-molecule gRNA,” a “single-guide RNA,” or an “ngNA.” See, e.g., 2014/093622, herein incorporated by nce in its entirety for all purposes. For Cas9, for example, a single- guide RNA can comprise a chNA fused to a trachNA (e.g., via a linker). For Cpfl, for example, only a chNA is needed to achieve binding to and/or cleavage of a target sequence.

The terms “guide RNA” and “gRN ”include both double-molecule (i.e., modular) gRNAs and single-molecule gRNAs.

An exemplary two-molecule gRNA comprises a chNA-like (“CRISPR RNA” or “targeter-RN ” ” or “chN or “chNA repeat”) molecule and a ponding trachNA-like (“trans-acting CRISPR RN ” or “activator-RNA” or N ”) molecule. A chNA comprises both the rgeting segment (single-stranded) of the gRNA and a stretch of nucleotides (i.e., the chNA tail) that forms one half of the dsRNA duplex of the protein-binding segment of the gRNA. An example of a chNA tail, located downstream (3 ’) of the DNA- targeting segment, comprises, consists essentially of, or consists of GUUUUAGAGCUAUGCU (SEQ ID NO: 1421). Any of the DNA-targeting segments disclosed herein can be joined to the ’ end of SEQ ID NO: 1421 to form a chNA.

A ponding trachNA (activator-RNA) comprises a stretch of nucleotides that forms the other half of the dsRNA duplex of the protein-binding segment of the gRNA. A stretch of nucleotides of a chNA are complementary to and hybridize with a h of nucleotides of a trachNA to form the dsRNA duplex of the protein-binding domain of the gRNA. As such, each chNA can be said to have a corresponding A. An example of a trachNA sequence ses, consists ially of, or consists of AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC GAGUCGGUGCUUU (SEQ ID NO: 1422).

In systems in which both a chNA and a trachNA are needed, the chNA and the corresponding trachNA hybridize to form a gRNA. In systems in which only a chNA is needed, the chNA can be the gRNA. The chNA additionally provides the single-stranded DNA-targeting segment that s a guide RNA target sequence by izing to the opposite strand (i.e., the mentary strand). If used for modification within a cell, the exact sequence of a given chNA or trachNA molecule can be designed to be specific to the species in which the RNA molecules will be used. See, e.g., Mali et al. (2013) Science 339:823-826; Jinek et al. (2012) Science 337 :81 6-821; Hwang et al. (2013) Nat. Biotechnol. 31 :227-229; Jiang et al. (2013) Nat. Biotechnol. 31 :233-239; and Cong et al. (2013) Science 339:819-823, each of which is herein incorporated by reference in its entirety for all purposes.

The DNA-targeting segment (chNA) of a given gRNA ses a nucleotide sequence that is complementary to a sequence (i.e., the complementary strand of the guide RNA recognition sequence on the strand opposite of the guide RNA target sequence) in a target DNA.

The DNA-targeting segment of a gRNA interacts with a target DNA (e.g., the HSDI 7BI3 gene) in a sequence-specific manner Via hybridization (i.e., base pairing). As such, the nucleotide sequence of the DNA-targeting segment may vary and determines the location within the target DNA with which the gRNA and the target DNA will interact. The DNA-targeting segment of a subject gRNA can be modified to hybridize to any desired sequence within a target DNA.

Naturally occurring chNAs differ depending on the CRISPR/Cas system and organism but often contain a ing segment ofbetween 21 to 72 tides length, flanked by two direct repeats (DR) of a length of between 21 to 46 tides (see, e.g., incorporated by reference in its entirety for all purposes). In the case of S. pyogenes, the DRs are 36 nucleotides long and the targeting segment is 30 nucleotides long. The 3’ located DR is complementary to and hybridizes with the corresponding trachNA, which in turn binds to the Gas protein.

] The DNA-targeting segment can have a length of at least about 12 nucleotides, at least about 15 nucleotides, at least about 17 nucleotides, at least about 18 nucleotides, at least about 19 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 tides, or at least about 40 nucleotides. Such DNA-targeting ts can have a length from about 12 nucleotides to about 100 nucleotides, from about 12 nucleotides to about 80 nucleotides, from about 12 nucleotides to about 50 tides, from about 12 nucleotides to about 40 nucleotides, from about 12 nucleotides to about 30 nucleotides, from about 12 nucleotides to about 25 tides, or from about 12 nucleotides to about 20 nucleotides. For example, the DNA targeting segment can be from about 15 nucleotides to about nucleotides (e.g., from about 17 nucleotides to about 20 nucleotides, or about 17 nucleotides, about 18 nucleotides, about 19 nucleotides, or about 20 nucleotides). See, e.g., US 2016/0024523, herein incorporated by reference in its ty for all purposes. For Cas9 from S. pyogenes, a typical DNA-targeting segment is between 16 and 20 nucleotides in length or between 17 and 20 tides in length. For Cas9 from S. aureus, a typical DNA-targeting segment is between 21 and 23 nucleotides in length. For Cpfl, a typical DNA-targeting segment is at least 16 nucleotides in length or at least 18 nucleotides in length.

] TrachNAs can be in any form (e.g., full-length trachNAs or active partial trachNAs) and of varying lengths. They can include primary transcripts or processed forms.

For example, trachNAs (as part of a single-guide RNA or as a separate le as part of a lecule gRNA) may comprise or consist of all or a portion of a wild type trachNA sequence (e.g., about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of a wild type trachNA sequence). Examples of wild type trachNA sequences from S. pyogenes include 171-nucleotide, 89-nucleotide, 75-nucleotide, and 65-nucleotide versions. See, e.g., Deltcheva et al. (2011) Nature 471 :602-607; incorporated by reference in its ty for all purposes. Examples of As within singleguide RNAs (ngNAs) include the trachNA segments found within +48, +54, +67, and +85 versions of ngNAs, where “+n” indicates that up to the +n nucleotide of wild type A is ed in the ngNA. See US 8,697,359, herein incorporated by reference in its entirety for all purposes.

The percent complementarity n the DNA-targeting sequence and the complementary strand of the guide RNA recognition sequence within the target DNA can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%). The percent complementarity between the DNA-targeting sequence and the complementary strand of the guide RNA recognition sequence within the target DNA can be at least 60% over about 20 uous nucleotides. As an example, the percent mentarity n the DNA-targeting sequence and the complementary strand of the guide RNA recognition sequence within the target DNA is 100% over the 14 contiguous tides at the 5’ end of the complementary strand of the guide RNA recognition sequence within the complementary strand of the target DNA and as low as 0% over the remainder. In such a case, the DNA-targeting sequence can be considered to be 14 nucleotides in length. As another example, the percent complementarity between the DNA- targeting sequence and the complementary strand of the guide RNA recognition sequence within the target DNA is 100% over the seven contiguous nucleotides at the 5’ end of the complementary strand of the guide RNA recognition sequence within the complementary strand of the target DNA and as low as 0% over the remainder. In such a case, the DNA-targeting sequence can be considered to be 7 nucleotides in length. In some guide RNAs, at least 17 nucleotides within the DNA-targeting sequence are complementary to the target DNA. For example, the DNA-targeting sequence can be 20 nucleotides in length and can comprise 1, 2, or 3 mismatches with the complementary strand of the guide RNA ition sequence.

Preferably, the mismatches are not adjacent to a protospacer adjacent motif (PAM) sequence (e. g., the mismatches are in the 5’ end of the DNA-targeting sequence, or the mismatches are at least 2, 3, 4, 5, 6, 7, 8, 9,10,11,12,13,14,15,16,17,18, or 19 base pairs away from the PAM sequence).

The protein-binding segment of a gRNA can comprise two stretches of tides that are complementary to one another. The mentary nucleotides of the protein-binding segment hybridize to form a double-stranded RNA duplex ). The n-binding t of a subject gRNA interacts with a Gas protein, and the gRNA directs the bound Cas protein to a specific nucleotide sequence within target DNA via the DNA-targeting segment.

Single-guide RNAs have the DNA-targeting segment and a scaffold sequence (i.e., the protein-binding or Cas-binding sequence of the guide RNA). For example, such guide RNAs have a 5’ DNA-targeting segment and a 3’ scaffold ce. Exemplary scaffold sequences comprise, consist essentially of, or consist of: GAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCU (version 1; SEQ ID NO: 1420); GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA ACUUGAAAAAGUGGCACCGAGUCGGUGC (version 2; SEQ ID NO: 256); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA GGCACCGAGUCGGUGC (version 3; SEQ ID NO: 257); and GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUU AUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (version 4; SEQ ID NO: 258). Guide RNAs ing any of the guide RNA target sequences disclosed herein (e.g., SEQ ID NOS: 20- 239 and 259-268) can include, for example, a DNA-targeting segment on the 5’ end of the guide RNA fused to any of the exemplary guide RNA scaffold sequences on the 3’ end of the guide RNA. That is, any of the DNA-targeting segments disclosed herein can be joined to the 5’ end of any one of SEQ ID NOS: 1420, 256, 257, or 258 to form a single guide RNA (chimeric guide RNA). Guide RNA versions 1, 2, 3, and 4 as disclosed elsewhere herein refer to DNA-targeting segments joined with scaffold versions 1, 2, 3, and 4, respectively.

Guide RNAs can e modifications or sequences that provide for additional desirable features (e.g., modified or ted ity; subcellular targeting; tracking with a cent label; a binding site for a protein or protein complex; and the like). Examples of such modifications include, for example, a 5’ cap (e.g., a ylguanylate cap (m7G)); a 3’ enylated tail (i.e., a 3’ poly(A) tail); a riboswitch sequence (e.g., to allow for regulated stability and/or regulated accessibility by proteins and/or protein complexes); a stability control sequence; a sequence that forms a dsRNA duplex (i.e., a hairpin); a modification or sequence that targets the RNA to a subcellular location (e.g., s, mitochondria, chloroplasts, and the like); a modification or sequence that provides for tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates cent ion, a sequence that allows for fluorescent detection, and so forth); a modification or sequence that provides a binding site for ns (e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone transferases, histone deacetylases, and the like); and combinations thereof. Other examples of modifications include engineered stem loop duplex ures, engineered bulge regions, engineered hairpins 3’ of the stem loop duplex structure, or any combination thereof. See, e.g., US 2015/0376586, herein incorporated by reference in its entirety for all purposes. A bulge can be an unpaired region of nucleotides within the duplex made up of the chNA-like region and the minimum trachNA-like . A bulge can comprise, on one side of the duplex, an unpaired '-XXXY-3' where X is any purine and Y can be a nucleotide that can form a wobble pair with a nucleotide on the opposite strand, and an unpaired nucleotide region on the other side of the duplex.

In some cases, a transcriptional activation system can be used comprising a dCas9- VP64 fusion protein paired with MS2-p65-HSF1. Guide RNAs in such systems can be designed with aptamer sequences appended to ngNA tetraloop and stem-loop 2 designed to bind dimerized MS2 bacteriophage coat proteins. See, e.g. Konermann et al. (2015) Nature 517(7536):583-588, herein incorporated by reference in its ty for all purposes.

Guide RNAs can be provided in any form. For example, the gRNA can be provided in the form of RNA, either as two molecules (separate chNA and A) or as one molecule (ngNA), and optionally in the form of a complex with a Gas protein. For example, gRNAs can be prepared by in vitro transcription using, for example, T7 RNA polymerase (see, e.g., WO 2014/089290 and WO 65596, each of which is herein incorporated by reference in its entirety for all purposes). Guide RNAs can also be prepared by chemical sis.

The gRNA can also be provided in the form ofDNA encoding the gRNA. The DNA encoding the gRNA can encode a single RNA molecule (ngNA) or separate RNA molecules (e. g., separate chNA and trachNA). In the latter case, the DNA encoding the gRNA can be provided as one DNA molecule or as separate DNA molecules encoding the chNA and trachNA, respectively.

When a gRNA is provided in the form ofDNA, the gRNA can be transiently, conditionally, or constitutively expressed in the cell. DNAs encoding gRNAs can be stably integrated into the genome of the cell and operably linked to a promoter active in the cell.

Alternatively, DNAs encoding gRNAs can be operably linked to a promoter in an expression construct. For e, the DNA encoding the gRNA can be in a vector comprising a heterologous nucleic acid. The vector can r comprise an exogenous donor sequence and/or the vector can further comprise a nucleic acid encoding a Gas protein. Alternatively, the DNA encoding the gRNA can be in a vector or a plasmid that is separate from the vector comprising an exogenous donor sequence and/or the vector sing the nucleic acid encoding the Gas protein. Promoters that can be used in such expression constructs include ers active, for example, in one or more of a eukaryotic cell, a human cell, a non-human cell, a mammalian cell, a non-human mammalian cell, a rodent cell, a mouse cell, a rat cell, a hamster cell, a rabbit cell, a pluripotent cell, an embryonic stem (ES) cell, an adult stem cell, a developmentally restricted itor cell, an induced pluripotent stem (iPS) cell, or a ll stage embryo. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Such promoters can also be, for example, bidirectional ers. Specific examples of suitable promoters include an RNA polymerase III promoter, such as a human U6 er, a rat U6 polymerase III er, or a mouse U6 polymerase III promoter.

Also disclosed herein are compositions comprising one or more guide RNAs (e.g., 1, 2, 3, 4, or more guide RNAs) disclosed herein and a carrier sing the stability of the isolated nucleic acid or protein (e.g., prolonging the period under given conditions of storage (e.g., - ,20°C, 4°C, or ambient temperature) for which degradation products remain below a threshold, such below 0.5% by weight of the starting nucleic acid or protein; or increasing the stability in vivo). Non-limiting examples of such carriers e actic acid) (PLA) microspheres, poly(D,L-lactic-coglycolic-acid) (PLGA) microspheres, liposomes, es, inverse micelles, lipid cochleates, and lipid microtubules. Such compositions can further comprise a Gas protein, such as a Cas9 protein, or a c acid encoding a Gas protein. Such compositions can further comprise one or more (e.g., 1, 2, 3, 4, or more) exogenous donor sequences and/or one or more (e. g., 1, 2, 3, 4, or more) targeting vectors and/or one or more (e.g., 1, 2, 3, 4, or more) expression vectors as disclosed ere herein. (3) Guide RNA Recognition Sequences and Guide RNA Target Sequences The term “guide RNA recognition sequence” es nucleic acid sequences present in a target DNA (e.g., the HSDI 7BI3 gene) to which a DNA-targeting segment of a gRNA will bind, provided sufficient conditions for binding exist. The term guide RNA recognition ce as used herein encompasses both strands of the target double-stranded DNA (i.e., the sequence on the complementary strand to which the guide RNA hybridizes and the ponding sequence on the non-complementary strand adjacent to the pacer adjacent motif . The term “guide RNA target ce” as used herein refers specifically to the sequence on the non-complementary strand adjacent to the PAM (i.e., upstream or 5’ of the PAM). That is, the guide RNA target sequence refers to the ce on the non-complementary strand corresponding to the sequence to which the guide RNA hybridizes on the complementary strand. A guide RNA target sequence is equivalent to the rgeting segment of a guide RNA, but with thymines instead of uracils. As one example, a guide RNA target sequence for a Cas9 enzyme would refer to the sequence on the non-complementary strand adjacent to the 5’- NGG-3’ PAM. Guide RNA recognition sequences include sequences to which a guide RNA is designed to have complementarity, where hybridization between the complementary strand of a guide RNA recognition sequence and a DNA targeting sequence of a guide RNA promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided that there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. Guide RNA recognition sequences or guide RNA target sequences also include cleavage sites for Gas proteins, described in more detail below. A guide RNA recognition sequence or guide RNA target sequence can comprise any polynucleotide, which can be located, for e, in the nucleus or cytoplasm of a cell or within an organelle of a cell, such as a ondrion or chloroplast.

The guide RNA recognition sequence within a target DNA can be targeted by (i.e., be bound by, or hybridize with, or be complementary to) a Gas protein or a gRNA. Suitable DNA/RNA binding conditions include physiological conditions normally present in a cell. Other suitable DNA/RNA g conditions (e.g., conditions in a cell-free system) are known (see, e.g., Molecular Cloning: A tory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001), herein incorporated by reference in its entirety for all purposes). The strand of the target DNA that is complementary to and hybridizes with the Gas protein or gRNA can be called the “complementary strand,” and the strand of the target DNA that is complementary to the “complementary strand” (and is therefore not complementary to the Gas protein or gRNA) can be called “non-complementary strand” or ate strand.” The Gas protein can cleave the nucleic acid at a site within or outside of the nucleic acid sequence present in the target DNA to which the DNA-targeting segment of a gRNA will bind. The age site” includes the position of a nucleic acid at which a Gas protein produces a single-strand break or a double-strand break. For example, formation of a CRISPR complex (comprising a gRNA hybridized to the mentary strand of a guide RNA recognition sequence and complexed with a Gas protein) can result in cleavage of one or both strands in or near (e. g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the nucleic acid ce present in a target DNA to which a DNA-targeting segment of a gRNA will bind. If the ge site is outside of the nucleic acid sequence to which the DNA-targeting segment of the gRNA will bind, the cleavage site is still considered to be within the “guide RNA recognition sequence” or guide RNA target sequence. The cleavage site can be on only one strand or on both strands of a nucleic acid. ge sites can be at the same position on both strands of the nucleic acid (producing blunt ends) or can be at different sites on each strand (producing staggered ends (i.e., overhangs)). Staggered ends can be produced, for example, by using two Cas proteins, each of which produces a single-strand break at a ent cleavage site on a different strand, thereby producing a double-strand break. For example, a first nickase can create a -strand break on the first strand of double-stranded DNA (dsDNA), and a second nickase can create a single-strand break on the second strand of dsDNA such that nging sequences are created. In some cases, the guide RNA recognition sequence or guide RNA target sequence of the nickase on the first strand is separated from the guide RNA recognition sequence or guide RNA target sequence of the nickase on the second strand by at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, , 25, 30, 40, 50, 75, 100, 250, 500, or 1,000 base pairs.

Site-specific binding and/or cleavage of target DNA by Gas proteins can occur at ons determined by both (i) base-pairing complementarity between the gRNA and the target DNA and (ii) a short motif, called the protospacer adjacent motif (PAM), in the target DNA.

The PAM can flank the guide RNA target sequence on the non-complementary strand opposite of the strand to which the guide RNA hybridizes. Optionally, the guide RNA target sequence can be flanked on the 3’ end by the PAM. Alternatively, the guide RNA target sequence can be flanked on the 5’ end by the PAM. For example, the cleavage site of Gas proteins can be about 1 to about 10 or about 2 to about 5 base pairs (e.g., 3 base pairs) upstream or downstream of the PAM sequence. In some cases (e.g., when Cas9 from S. pyogenes or a y related Cas9 is used), the PAM ce of the non-complementary strand can be G-3', where N1is any DNA nucleotide and is immediately 3' of the guide RNA recognition sequence of the non- complementary strand of the target DNA (i.e., immediately 3 ’ of the guide RNA target sequence). As such, the PAM sequence of the complementary strand would be 2-3', where N2 is any DNA nucleotide and is immediately 5' of the guide RNA ition sequence of the complementary strand of the target DNA. In some such cases, N1 and N2 can be complementary and the N1- N2 base pair can be any base pair (e.g., N1=C and N2=G; N1=G and N2=C; N1=A and N2=T; or N1=T, and N2=A). In the case of Cas9 from S. aureus, the PAM can be NNGRRT or NNGRR, where N can be A, G, C, or T, and R can be G or A. In some cases (e. g., for FnCpfl ), the PAM ce can be upstream of the 5’ end and have the sequence 5’- TTN-3’.

Examples of guide RNA target sequences or guide RNA target ces in addition to a PAM sequence are provided below. For example, the guide RNA target sequence can be a -nucleotide DNA sequence immediately preceding an NGG motif recognized by a Cas9 protein. Examples of such guide RNA target sequence plus a PAM sequence are GN19NGG (SEQ ID NO: 248) or NzoNGG (SEQ ID NO: 249). See, e.g., incorporated by reference in its entirety for all purposes. The e at the 5’ end can facilitate transcription by RNA polymerase in cells. Other examples of guide RNA target sequences plus a PAM sequence can include two guanine nucleotides at the 5’ end (e.g., GG; SEQ ID NO: 250) to facilitate efficient transcription by T7 polymerase in vitro. See, e.g., WO 2014/065596, herein incorporated by reference in its entirety for all purposes. Other guide RNA target sequences plus a PAM sequence can have n 4-22 nucleotides in length of SEQ ID NOS: 248-250, including the 5’ G or GG and the 3’ GG or NGG. Yet other guide RNA target sequences can have between 14 and 20 nucleotides in length of SEQ ID NOS: 248-250.

The guide RNA recognition ce or guide RNA target sequence can be any c acid sequence endogenous or exogenous to a cell. The guide RNA recognition sequence or guide RNA target sequence can be a sequence coding a gene product (e.g., a protein) or a non- coding sequence (e.g., a tory sequence) or can include both.

As one example, the guide RNA recognition sequence or guide RNA target sequence can be within a region corresponding to exon 6 and/or intron 6, exon 6 and/or exon 7, or exon 6 and/or intron 6 and/or exon 7 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2 . As another example, the guide RNA recognition sequence or guide RNA target sequence can e or is proximate to a position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. For example, the guide RNA recognition ce or guide RNA target ce can be within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2. As yet another example, the guide RNA recognition ce or guide RNA target sequence can include or be proximate to the start codon of an HSDI 7BI3 gene or the stop codon of an HSDI 7BI3 gene. For example, the guide RNA recognition sequence or guide RNA target sequence can be within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon or the stop codon. Examples of such guide RNA target sequences and of guide RNAs targeting such guide RNA target sequences are disclosed elsewhere herein.

F. Exogenous Donor Sequences or Targeting Vectors The methods and compositions disclosed herein can utilize exogenous donor sequences (e.g., ing vectors or repair templates) to modify an HSDI 7BI3 gene, either without cleavage of the HSDI 7BI3 gene or following cleavage of the HSDI 7BI3 gene with a nuclease agent. An exogenous donor sequence refers to any nucleic acid or vector that includes the elements that are ed to enable site-specific recombination with a target sequence.

Using exogenous donor sequences in combination with se agents may result in more precise modifications within the HSDI 7BI3 gene by promoting homology-directed .

In such methods, the nuclease agent cleaves the HSDI 7BI3 gene to create a single- strand break (nick) or double-strand break, and the exogenous donor sequence recombines the HSDI 7BI3 gene via mologous end joining (NHEJ)-mediated ligation or through a homology-directed repair event. Optionally, repair with the exogenous donor sequence removes or disrupts the nuclease cleavage site so that alleles that have been ed cannot be re-targeted by the nuclease agent. ] ous donor sequences can comprise deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), they can be single-stranded or double-stranded, and they can be in linear or circular form. For example, an exogenous donor sequence can be a single-stranded oligodeoxynucleotide (ssODN). See, e.g., Yoshimi et al. (2016) Nat. Commun. 1, herein incorporated by reference in its entirety for all purposes. An exemplary exogenous donor sequence is between about 50 nucleotides to about 5 kb in length, is between about 50 nucleotides to about 3 kb in length, or is between about 50 to about 1,000 nucleotides in length.

Other exemplary exogenous donor sequences are between about 40 to about 200 nucleotides in length. For example, an exogenous donor sequence can be between about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200 nucleotides in length. Alternatively, an ous donor sequence can be between about 50 to about 100, about 100 to about 200, about 200 to about 300, about 300 to about 400, about 400 to about 500, about 500 to about 600, about 600 to about 700, about 700 to about 800, about 800 to about 900, or about 900 to about 1,000 nucleotides in length. Alternatively, an ous donor sequence can be between about 1 kb to about 1.5 kb, about 1.5 kb to about 2 kb, about 2 kb to about 2.5 kb, about 2.5 kb to about 3 kb, about 3 kb to about 3.5 kb, about 3.5 kb to about 4 kb, about 4 kb to about 4.5 kb, or about 4.5 kb to about 5 kb in . Alternatively, an exogenous donor sequence can be, for example, no more than 5 kb, 4.5 kb, 4 kb, 3.5 kb, 3 kb, 2.5 kb, 2 kb, 1.5 kb, 1 kb, 900 nucleotides, 800 nucleotides, 700 nucleotides, 600 nucleotides, 500 nucleotides, 400 nucleotides, 300 nucleotides, 200 nucleotides, 100 nucleotides, or 50 nucleotides in length.

In one e, an exogenous donor sequence is an ssODN that is between about 80 nucleotides and about 200 nucleotides in length (e.g., about 120 nucleotides in length). In another example, an exogenous donor sequences is an ssODN that is between about 80 nucleotides and about 3 kb in length. Such an ssODN can have homology arms, for example, that are each between about 40 nucleotides and about 60 nucleotides in length. Such an ssODN can also have homology arms, for example, that are each between about 30 nucleotides and 100 tides in length. The homology arms can be symmetrical (e.g., each 40 nucleotides or each 60 nucleotides in length), or they can be asymmetrical (e.g., one homology arm that is 36 tides in length, and one homology arm that is 91 nucleotides in length).

Exogenous donor ces can include modifications or sequences that provide for additional ble features (e.g., modified or regulated stability; tracking or detecting with a fluorescent label; a g site for a protein or protein complex; and so forth). Exogenous donor sequences can comprise one or more fluorescent labels, purification tags, epitope tags, or a combination thereof. For example, an exogenous donor sequence can comprise one or more fluorescent labels (e.g., fluorescent proteins or other fluorophores or dyes), such as at least 1, at least 2, at least 3, at least 4, or at least 5 fluorescent labels. Exemplary fluorescent labels include fluorophores such as fluorescein (e.g., 6-carboxyfluorescein (6-FAM)), Texas Red, HEX, Cy3, Cy5, Cy5.5, Pacific Blue, 5-(and-6)-carboxytetramethylrhodamine ), and Cy7. A wide range of fluorescent dyes are available commercially for labeling oligonucleotides (e.g., from Integrated DNA Technologies). Such fluorescent labels (e.g., internal fluorescent labels) can be used, for e, to detect an exogenous donor ce that has been directly integrated into a cleaved HSDI 7BI3 gene having protruding ends ible with the ends of the exogenous donor sequence. The label or tag can be at the 5’ end, the 3’ end, or internally within the exogenous donor sequence. For example, an exogenous donor sequence can be conjugated at 5’ end with the IR700 fluorophore from Integrated DNA Technologies (5’IRDYE®700).

Exogenous donor sequences can also comprise c acid inserts including segments ofDNA to be ated in the HSDI 7BI3 gene. Integration of a nucleic acid insert in the HSDI 7BI3 gene can result in addition of a nucleic acid ce of interest in the HSDI 7BI3 gene, deletion of a c acid sequence of interest in the HSDI 7BI3 gene, or replacement of a nucleic acid sequence of st in the HSDI 7BI3 gene (i.e., deletion and insertion). Some exogenous donor sequences are designed for insertion of a nucleic acid insert in the HSDI 7BI3 gene without any corresponding deletion in the HSDI 7BI3 gene. Other exogenous donor sequences are designed to delete a nucleic acid sequence of interest in the HSDI 7BI3 gene without any corresponding ion of a nucleic acid insert. Yet other exogenous donor sequences are designed to delete a nucleic acid sequence of interest in the HSDI 7BI3 gene and replace it with a nucleic acid .

The nucleic acid insert or the corresponding nucleic acid in the HSDI 7BI3 gene being deleted and/or replaced can be various lengths. An ary nucleic acid insert or corresponding nucleic acid in the HSDI 7BI3 gene being deleted and/or replaced is between about 1 nucleotide to about 5 kb in length or is between about 1 nucleotide to about 1,000 nucleotides in length. For e, a nucleic acid insert or a corresponding nucleic acid in the HSDI 7BI3 gene being deleted and/or replaced can be between about 1 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200 nucleotides in length. Likewise, a nucleic acid insert or a ponding nucleic acid in the HSDI 7BI3 gene being deleted and/or replaced can be between about 1 to about 100, about 100 to about 200, about 200 to about 300, about 300 to about 400, about 400 to about 500, about 500 to about 600, about 600 to about 700, about 700 to about 800, about 800 to about 900, or about 900 to about 1,000 nucleotides in length. Likewise, a nucleic acid insert or a corresponding nucleic acid in the HSDI 7BI3 gene being deleted and/or replaced can be between about 1 kb to about 1.5 kb, about 1.5 kb to about 2 kb, about 2 kb to about 2.5 kb, about 2.5 kb to about 3 kb, about 3 kb to about 3.5 kb, about 3.5 kb to about 4 kb, about 4 kb to about 4.5 kb, or about 4.5 kb to about 5 kb in length.

The nucleic acid insert can comprise genomic DNA or any other type ofDNA. For example, the nucleic acid insert can comprise cDNA.

The nucleic acid insert can comprise a ce that is homologous to all or part of the HSDI 7BI3 gene (e.g., a portion of the gene ng a particular motif or region of a HSD17B13 protein). For example, the nucleic acid insert can comprise a sequence that comprises one or more point mutations (e.g., 1, 2, 3, 4, 5, or more) or one or more nucleotide insertions or deletions ed with a sequence targeted for replacement in the HSDI 7BI3 gene.

The nucleic acid insert or the corresponding nucleic acid in the HSDI 7BI3 gene being deleted and/or replaced can be a coding region such as an exon; a ding region such as an intron, an untranslated region, or a regulatory region (e.g., a promoter, an enhancer, or a transcriptional repressor-binding element); or any combination thereof.

The nucleic acid insert can also comprise a conditional allele. The conditional allele can be a multifunctional allele, as described in US 2011/0104799, herein incorporated by reference in its entirety for all purposes. For e, the conditional allele can comprise: (a) an ing sequence in sense orientation with respect to transcription of a target gene; (b) a drug selection cassette (DSC) in sense or nse ation; (c) a nucleotide sequence of interest (NS1) in antisense orientation; and (d) a conditional by ion module (COIN, which utilizes an exon-splitting intron and an invertible gene-trap-like module) in reverse orientation. See, e.g., US 2011/0104799. The conditional allele can further comprise recombinable units that recombine upon exposure to a first recombinase to form a conditional allele that (i) lacks the actuating sequence and the DSC; and (ii) contains the NS1 in sense orientation and the COIN in antisense orientation. See, e.g., US 2011/0104799.

Nucleic acid inserts can also comprise a polynucleotide encoding a selection marker.

Alternatively, the nucleic acid inserts can lack a polynucleotide encoding a ion marker.

The selection marker can be contained in a selection cassette. ally, the selection cassette can be a self-deleting cassette. See, e.g., US 8,697,851 and US 2013/0312129, each of which is herein incorporated by reference in its entirety for all purposes. As an example, the eleting cassette can comprise a Crei gene (comprises two exons encoding a Cre inase, which are separated by an intron) operably linked to a mouse Prm] promoter and a neomycin resistance gene operably linked to a human ubiquitin promoter. Exemplary selection markers include neomycin phosphotransferase (neo‘), ycin B phosphotransferase (hyg‘), cin-N- acetyltransferase (puro’), cidin S deaminase (bsrr), xanthine/guanine phosphoribosyl transferase (gpt), or herpes simplex virus thymidine kinase (HSV-k), or a combination thereof The polynucleotide encoding the selection marker can be operably linked to a promoter active in a cell being targeted. Examples ofpromoters are described elsewhere herein.

The nucleic acid insert can also comprise a reporter gene. Exemplary reporter genes include those ng luciferase, B-galactosidase, green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (eYFP), blue cent protein (BFP), enhanced blue fluorescent protein (eBFP), DsRed, ZsGreen, MmGFP, mPlum, mCherry, thomato, mStrawberry, J-Red, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, Cerulean, TSapphire , and ne phosphatase. Such reporter genes can be operably linked to a promoter active in a cell being targeted. Examples ofpromoters are described elsewhere herein.

The nucleic acid insert can also comprise one or more expression cassettes or deletion tes. A given te can se one or more of a nucleotide sequence of interest, a polynucleotide encoding a selection marker, and a reporter gene, along with various regulatory components that influence expression. es of selectable markers and reporter genes that can be ed are discussed in detail elsewhere herein.

The nucleic acid insert can comprise a nucleic acid flanked with site-specific recombination target sequences. Alternatively, the c acid insert can comprise one or more site-specific ination target sequences. Although the entire c acid insert can be flanked by such site-specific recombination target sequences, any region or individual polynucleotide of interest within the nucleic acid insert can also be flanked by such sites. Site- specific recombination target sequences, which can flank the nucleic acid insert or any polynucleotide of interest in the nucleic acid insert can include, for e, loxP, lox511, lox2272, 10x66, 10x71, loxM2, lox5171, FRT, FRT11, FRT71, attp, att, FRT, rox, or a combination thereof. In one example, the site-specific recombination sites flank a polynucleotide encoding a selection marker and/or a reporter gene contained within the nucleic acid insert. Following integration of the nucleic acid insert in the HSDI 7BI3 gene, the sequences between the site-specific ination sites can be removed. Optionally, two exogenous donor sequences can be used, each with a nucleic acid insert comprising a site- specific recombination site. The exogenous donor sequences can be targeted to 5’ and 3’ regions flanking a nucleic acid of interest. Following integration of the two nucleic acid inserts into the target genomic locus, the nucleic acid of interest between the two ed site-specific recombination sites can be removed.

Nucleic acid inserts can also comprise one or more restriction sites for ction endonucleases (i.e., restriction enzymes), which include Type 1, Type II, Type III, and Type IV endonucleases. Type I and Type III restriction endonucleases recognize specific recognition sequences, but typically cleave at a variable position fiom the nuclease binding site, which can be hundreds ofbase pairs away from the cleavage site (recognition sequence). In Type 11 systems the restriction activity is independent of any methylase activity, and cleavage typically occurs at specific sites within or near to the binding site. Most Type II enzymes cut romic sequences, r Type IIa enzymes recognize non-palindromic recognition sequences and cleave outside of the recognition sequence, Type IIb s cut sequences twice with both sites outside of the ition sequence, and Type IIs enzymes recognize an asymmetric ition sequence and cleave on one side and at a defined distance of about 1-20 nucleotides fiom the recognition sequence. Type IV restriction enzymes target methylated DNA. Restriction enzymes are further described and classified, for example in the REBASE database (webpage at rebase.neb.com; Roberts et al., (2003) Nucleic Acids Res. 31 :418-420; Roberts et al., (2003) Nucleic Acids Res. 31 :1805-1812; and Belfort et al. (2002) in Mobile DNA 11, pp. 761-783, Eds.

Craigie et al., (ASM Press, Washington, DC)). (1) Donor Sequencesfor Non-Hamologous-End-Joining-Mediated Insertion Some exogenous donor sequences have short single-stranded regions at the 5’ end and/or the 3 ’ end that are complementary to one or more overhangs created by nuclease- mediated or Cas-protein-mediated cleavage at the target genomic locus (e.g., in the HSDI 7BI3 gene). These ngs can also be referred to as 5’ and 3’ homology arms. For example, some exogenous donor sequences have short -stranded regions at the 5’ end and/or the 3’ end that are complementary to one or more overhangs created by Cas-protein-mediated cleavage at ’ and/or 3’ target sequences at the target genomic locus. Some such exogenous donor ces have a complementary region only at the 5’ end or only at the 3’ end. For e, some such exogenous donor sequences have a complementary region only at the 5’ end complementary to an overhang d at a 5’ target sequence at the target genomic locus or only at the 3 ’ end complementary to an overhang created at a 3 ’ target ce at the target genomic locus. Other such exogenous donor ces have complementary regions at both the 5’ and 3’ ends. For example, other such exogenous donor sequences have complementary regions at both the 5’ and 3’ ends e.g., complementary to first and second ngs, respectively, generated by Cas-mediated cleavage at the target genomic locus. For example, if the exogenous donor ce is double-stranded, the single-stranded complementary regions can extend from the 5’ end of the top strand of the donor sequence and the 5’ end of the bottom strand of the donor sequence, creating 5’ overhangs on each end. Alternatively, the single-stranded complementary region can extend fiom the 3 ’ end of the top strand of the donor sequence and from the 3 ’ end of the bottom strand of the template, creating 3’ overhangs.

The complementary regions can be of any length ent to promote ligation between the exogenous donor sequence and the HSDI 7BI3 gene. Exemplary complementary regions are between about 1 to about 5 nucleotides in length, between about 1 to about 25 nucleotides in length, or between about 5 to about 150 nucleotides in length. For example, a complementary region can be at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 tides in length. atively, the complementary region can be about 5 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150 nucleotides in length, or longer.

Such complementary regions can be complementary to overhangs created by two pairs of nickases. Two double-strand breaks with red ends can be created by using first and second nickases that cleave opposite strands ofDNA to create a first double-strand break, and third and fourth nickases that cleave opposite strands ofDNA to create a second double- strand break. For example, a Gas protein can be used to nick first, second, third, and fourth guide RNA target sequences corresponding with first, second, third, and fourth guide RNAs.

The first and second guide RNA target sequences can be positioned to create a first cleavage site such that the nicks created by the first and second nickases on the first and second strands of DNA create a -strand break (i.e., the first cleavage site comprises the nicks within the first and second guide RNA target sequences). se, the third and fourth guide RNA target sequences can be positioned to create a second cleavage site such that the nicks d by the third and fourth nickases on the first and second strands ofDNA create a double-strand break (i.e., the second cleavage site comprises the nicks within the third and fourth guide RNA target ces). Preferably, the nicks within the first and second guide RNA target sequences and/or the third and fourth guide RNA target sequences can be off-set nicks that create overhangs. The offset window can be, for example, at least about 5 bp, 10 bp, 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp or more. See Ran et al. (2013) Cell 154:1380-1389; Mali et al. (2013) Nat. Biotech.3 1 :833-83 8; and Shen et al. (2014) Nat. Methods 11:399-404, each of which is herein orated by reference in its entirety for all es. In such cases, a double- stranded exogenous donor sequence can be designed with -stranded complementary regions that are complementary to the overhangs created by the nicks within the first and second guide RNA target sequences and by the nicks within the third and fourth guide RNA target sequences. Such an exogenous donor sequence can then be inserted by non-homologous-end- joining-mediated ligation. (2) Donor Sequencesfor Insertion by Homology-Directed Repair Some exogenous donor sequences (i.e., targeting vectors) se gy arms.

If the exogenous donor sequence also comprises a nucleic acid insert, the homology arms can flank the nucleic acid insert. For ease of reference, the homology arms are ed to herein as ’ and 3’ (i.e., upstream and downstream) homology arms. This terminology relates to the relative on of the homology arms to the nucleic acid insert within the ous donor sequence. The 5’ and 3’ homology arms correspond to regions within the HSDI 7BI3 gene, which are referred to herein as “5’ target sequence” and “3’ target sequence,” respectively.

A homology arm and a target sequence spond” or are “corresponding” to one another when the two regions share a sufficient level of sequence identity to one another to act as substrates for a homologous recombination reaction. The term “homology” includes DNA sequences that are either identical or share sequence identity to a corresponding sequence. The sequence identity between a given target sequence and the corresponding homology arm found in the exogenous donor sequence can be any degree of sequence identity that allows for homologous recombination to occur. For example, the amount of ce identity shared by the homology arm of the exogenous donor sequence (or a fragment thereof) and the target sequence (or a fragment thereof) can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% ce identity, such that the sequences undergo homologous recombination. er, a corresponding region of homology between the homology arm and WO 36758 2018/014454 the corresponding target sequence can be of any length that is sufficient to promote homologous recombination. Exemplary homology arms are between about 25 tides to about 2.5 kb in length, are between about 25 nucleotides to about 1.5 kb in length, or are between about 25 to about 500 tides in length. For example, a given homology arm (or each of the homology arms) and/or corresponding target sequence can comprise corresponding regions of homology that are between about 25 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 150, about 150 to about 200, about 200 to about 250, about 250 to about 300, about 300 to about 350, about 350 to about 400, about 400 to about 450, or about 450 to about 500 nucleotides in length, such that the homology arms have sufficient homology to undergo homologous recombination with the corresponding target ces within the HSDI 7BI3 gene. Alternatively, a given homology arm (or each homology arm) and/or corresponding target sequence can comprise corresponding regions of homology that are between about 0.5 kb to about 1 kb, about 1 kb to about 1.5 kb, about 1.5 kb to about 2 kb, or about 2 kb to about 2.5 kb in length. For example, the homology arms can each be about 750 nucleotides in length. The homology arms can be symmetrical (each about the same size in length), or they can be asymmetrical (one longer than the other).

] The homology arms can pond to a locus that is native to a cell (e.g., the targeted locus). Alternatively, for example, they can pond to a region of a heterologous or exogenous segment ofDNA that was integrated into the genome of the cell, including, for example, enes, expression cassettes, or logous or exogenous regions ofDNA.

Alternatively, the homology arms of the targeting vector can correspond to a region of a yeast artificial chromosome (YAC), a bacterial artificial chromosome (BAC), a human artificial chromosome, or any other engineered region contained in an appropriate host cell. Still further, the homology arms of the ing vector can correspond to or be derived from a region of a BAC library, a cosmid library, or a P1 phage library, or can be derived fiom synthetic DNA.

When a nuclease agent is used in ation with an exogenous donor sequence, the ’ and 3’ target sequences are preferably located in sufficient proximity to the nuclease cleavage site so as to promote the occurrence of a homologous recombination event between the target ces and the homology arms upon a single-strand break (nick) or double-strand break at the nuclease cleavage site. The term “nuclease cleavage site” includes a DNA sequence at which a nick or double-strand break is created by a nuclease agent (e.g., a Cas9 protein complexed with a guide RNA). The target ces within the HSDI 7BI3 gene that correspond to the 5’ and 3’ homology arms of the exogenous donor sequence are “located in sufficient proximity” to a se cleavage site if the distance is such as to promote the occurrence of a homologous recombination event n the 5’ and 3’ target sequences and the homology arms upon a single-strand break or double-strand break at the nuclease cleavage site. Thus, the target sequences corresponding to the 5’ and/or 3’ homology arms of the exogenous donor sequence can be, for example, within at least 1 nucleotide of a given nuclease cleavage site or within at least 10 nucleotides to about 1,000 nucleotides of a given nuclease cleavage site. As an e, the nuclease cleavage site can be immediately adjacent to at least one or both of the target sequences.

The spatial relationship of the target sequences that correspond to the homology arms of the exogenous donor sequence and the nuclease cleavage site can vary. For example, target sequences can be located 5’ to the nuclease ge site, target sequences can be located 3’ to the se cleavage site, or the target sequences can flank the nuclease ge site.

IV. Therapeutic and Prophylactic ations ] Also provided are therapeutic methods and methods of treatment or prophylaxis of a chronic liver e in a t having or at risk for the disease using the methods disclosed herein for modifying or altering expression of an endogenous HSDI 7BI3 gene. Also provided are therapeutic methods and methods of treatment or prophylaxis of a liver disease such as an alcoholic liver disease or a nonalcoholic liver disease in a subject having or at risk for the disease using the methods disclosed herein for modifying or altering expression of an endogenous HSDI 7BI3 gene. Also provided are therapeutic methods and s of treatment or prophylaxis of a chronic liver disease in a t having or at risk for the disease using methods for sing expression ofHSD17B13 mRNA transcripts or using methods for providing recombinant nucleic acids encoding HSD17B13 proteins, providing mRNAs encoding HSD17B13 proteins, or providing HSD17B13 proteins to the subject. Also provided are therapeutic methods and s of treatment or prophylaxis of a liver disease such as an alcoholic liver disease or a nonalcoholic liver disease in a subject having or at risk for the disease using methods for decreasing expression ofHSD17B13 mRNA transcripts or using methods for providing recombinant nucleic acids encoding HSD17B13 proteins, providing mRNAs encoding HSD17B13 proteins, or providing HSD17B13 proteins to the t. The methods can comprise introducing one or more c acids or proteins into the subject, into the liver of the subject, or into a cell (e. g., liver cell) of the subject (e.g., in vivo or ex viva).

Chronic liver diseases include diseases of the liver which last over a period of six months and can include, for e, diseases of the liver involving ssive destruction and regeneration of the liver parenchyma that can lead to fibrosis and cirrhosis. c liver diseases can be alcoholic liver diseases or nonalcoholic liver diseases. Liver pathologies encompassed by chronic liver diseases can include, for e, inflammation (e.g., chronic hepatitis), liver cirrhosis, and hepatocellular carcinoma. Types of chronic liver disease are disclosed elsewhere herein and include, for example, fatty liver e, oholic fatty liver disease, alcoholic fatty liver disease, cirrhosis, and hepatocellular carcinoma. ms and signs of chronic liver es are known and can include, for example, enlarged liver, fatigue, pain in the upper right abdomen, abdominal swelling (ascites), enlarged blood vessels just beneath the skin’s surface, enlarged breasts in men, enlarged spleen, red palms, and yellowing of the skin and eyes (jaundice). Testing for chronic liver diseases can involve blood tests, imaging of the liver, and biopsy of the liver. An dual is at increased risk of a chronic liver disease if the subject has at least one known risk-factor (e.g., genetic factor such as a disease-causing mutation) placing individuals with that risk factor at a statistically significant greater risk of developing the disease than individuals without the risk factor. Risk factors for chronic liver diseases are also well known and can include, for example, excessive alcohol use, obesity, high cholesterol, high levels of triglycerides in the blood, polycystic ovary syndrome, sleep apnea, type 2 diabetes, underactive d hyroidism), underactive pituitary gland (hypopituitarism), and metabolic syndromes including raised blood lipids.

The term ct” includes human and other mammalian subjects (e.g., feline, canine, , mouse, or rat) or non-mammalian subjects (e.g., poultry) that receive either prophylactic or therapeutic ent. Such ts can be, for example, a subject (e.g., a human) who is not a carrier of the HSDI 7BI3 rs72613567 variant (or is only a heterozygous carrier of the HSDI 7BI3 rs72613567 variant) and has or is susceptible to developing a chronic liver disease. Various methods are possible for detecting the presence of the HSDI 7BI3 rs72613567 variant in a biological sample comprising genomic DNA, for detecting the presence or levels of any one of or a combination ofHSDI 7BI3 Transcripts C, D, E, F, F’, G, and H, and ularly D, in a biological sample comprising mRNA or cDNA, or for detecting the presence or levels of any one of or a combination ofHSD17B13 protein Isoforms C, D, E, F, F’, G, or H, and particularly D, in a biological sample comprising protein. Methods for detecting the presence of a sequence in genomic DNA and for detecting the presence of a particular mRNA transcript or n m are well-known. It is understood that gene sequences within a population and mRNAs and proteins encoded by such genes can vary due to polymorphisms such as single-nucleotide polymorphisms. The sequences provided herein for the HSDI 7BI3 gene and for each HSDI 7BI3 Transcript and HSD17B13 Isoform are only exemplary sequences for the HSDI 7BI3 gene and for each HSDI 7BI3 Transcript and HSD17B13 m. Other sequences for the HSDI 7BI3 gene and for each HSDI 7BI3 Transcript and HSD17B13 Isoform are also possible.

For example, a method for ing an HSDI 7BI3 3567 variant in a cell or in a subject such as a human subject can comprise, for example, obtaining a biological sample from the subject comprising an HSDI 7BI3 gene, and performing an assay on the biological sample that determines that a position of the HSDI 7BI3 gene corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene and SEQ ID NO: 2 are optimally aligned is occupied by a e or that a e is inserted n positions corresponding to positions 12665 and 12666 when the HSDI 7BI3 gene and SEQ ID NO: 1 are optimally aligned. It is understood that determining that a position of the HSDI 7BI3 gene corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene and SEQ ID NO: 2 are optimally aligned is occupied by a thymine means that the identity of a sufficient number of nucleotides is determined in the positions flanking the positions ponding to positions 12665 and 12666 of SEQ ID NO: 1 that it can be determined that a thymine is inserted between the positions corresponding to positions 12665 and 12666 of SEQ ID NO: 1. Such assays can comprise, for example determining the ty of positions of the HSDI 7BI3 gene corresponding to position 12666 of SEQ ID NO: 2 (or positions 12665 and 12666 of SEQ ID NO: 1) and one or more surrounding positions (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 positions flanking one side or each side of position 12666 of SEQ ID NO: 2 or positions 12665 and 12666 of SEQ ID NO: 1) when the HSDI 7BI3 gene and SEQ ID NO: 2 (or SEQ ID NO: 1) are optimally aligned. The assay in such a method can comprise, for example, sequencing a portion of the HSDI 7BI3 gene including a position corresponding to position 12666 or positions 12666 and 12667 of SEQ ID NO: 2 when the HSDI 7BI3 gene and SEQ ID NO: 2 are optimally aligned. Likewise, the assay can comprise cing a portion of the HSDI 7BI3 gene including positions corresponding to ons 12665 and 12666 of SEQ ID NO: 1 when the HSDI 7BI3 gene and SEQ ID NO: 1 are optimally aligned. Alternatively, the assay in such a method can comprise contacting the biological sample with a primer or probe that specifically izes to the HSDI 7BI3 3567 variant and not the corresponding wild type HSDI 7BI3 sequence (e.g., under stringent ions), and determining whether hybridization has occurred.

Such methods can comprise genome editing or gene therapy. For example, an endogenous HSDI 7BI3 gene that is not the HSDI 7BI3 rs72613567 variant can be modified to comprise the variation associated with the HSDI 7BI3 rs72613567 variant (i.e., an insertion of a thymine between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the HSDI 7BI3 gene is lly aligned with SEQ ID NO: 1, or an insertion of an adenine at the corresponding position on the opposite strand). As another example, an endogenous HSDI 7BI3 gene that is not the HSDI 7BI3 rs72613567 variant can be knocked out or inactivated. Likewise, an endogenous HSDI 7BI3 gene that is not the HSDI 7BI3 rs72613567 variant can be knocked out or vated, and an HSDI 7BI3 gene comprising the modification associated with the HSDI 7BI3 3567 variant (e.g., the full HSDI 7BI3 rs72613567 variant or a minigene comprising the modification) can be introduced and expressed. Similarly, an endogenous HSDI 7BI3 gene that is not the HSDI 7BI3 rs72613567 variant can be knocked out or inactivated, and a inant DNA encoding any one of or any combination of 13 Isoforms C, D, F, G, and H (or fiagments thereof) can be introduced and expressed, an mRNA encoding any one of or any combination ofHSD17B13 Isoforms C, D, F, G, and H (or fragments thereof) can be introduced and expressed (e.g., intracellular protein replacement therapy), or any one of or any combination 7B13 Isoforms C, D, F, G, and H (or fragments thereof) can be introduced (e.g., protein replacement therapy). In ular embodiments, the combination of HSD17B13 Isoforms (or DNA or mRNA encoding) is a combination comprising HSD17B13 Isoform D (e.g., D, DC, DF, DG, DH, DCF, DCG, DCH, DFG, DFH, DGH, DCFG, DCFH, DCGH, DFGH, or .

Other such methods can comprise introducing and expressing a recombinant HSDI 7BI3 gene comprising the modification associated with the HSDI 7BI3 rs72613567 variant (e. g., the full HSDI 7BI3 rs72613567 variant or a minigene sing the modification), introducing and expressing recombinant nucleic acids (e.g., DNA) encoding any one of or any combination ofHSD17B13 Isoforms C, D, F, G, and H or nts thereof, introducing and expressing one or more mRNAs encoding any one of or any combination ofHSD17B13 ms C, D, F, G, and H or fragments thereof (e.g., intracellular protein replacement therapy), or introducing any one of or any combination ofHSD17B13 ms C, D, F, G, and H or fragments thereof (e.g., protein replacement therapy) without knocking out or inactivating an endogenous HSDI 7BI3 gene that is not the HSDI 7BI3 rs72613567 variant. In particular embodiments, the combination ofHSD17B13 isoforms (or DNA or mRNA encoding) is a combination comprising HSD17B13 Isoform D (e.g., D, DC, DF, DG, DH, DCF, DCG, DCH, DFG, DFH, DGH, DCFG, DCFH, DCGH, DFGH, or DCFGH). Optionally, such methods can also be done in combination with methods in which an HSDI 7BI3 transcript whose expression decreases in carriers of the HSDI 7BI3 rs72613567 variant (e.g., Transcripts A, B, E, and F’) is targeted for reduced expression, such as through use of nse RNA, siRNA, or shRNA. In ular embodiments, the HSDI 7BI3 transcripts targeted for reduced expression are a combination sing Transcript A (e.g., A, AB, AE, AF’, ABE, ABF’, AEF’, or ABEF’).

] An HSDI 7BI3 gene or ne or a DNA encoding any one of or any combination ofHSD17B13 Isoforms C, D, F, G, and H or fragments thereof can be introduced and expressed in the form of an expression vector that does not modify the genome, it can be introduced in the form of a targeting vector such that it cally integrates into an HSDI 7BI3 locus, or it can be introduced such that it genomically integrates into a locus other than the HSDI 7BI3 locus, such as a safe harbor locus. The genomically integrated HSDI 7BI3 gene can be operably linked to an HSDI 7BI3 er or to another promoter, such as an endogenous er at the site of integration. Safe harbor loci are chromosomal sites where transgenes can be stably and reliably sed in all tissues of interest t adversely affecting gene structure or expression. Safe harbor loci can have, for example, one or more or all of the following characteristics: (1) distance of greater than 50 kb from the 5’ end of any gene; distance of greater than 300 kb from any cancer-related gene; distance of greater than 300 kb from any microRNA; outside a gene transcription unit, and outside of ultra-conserved regions. Examples of suitable safe harbor loci include adeno-associated virus site 1 (AAVSl), the chemokine (CC motif) receptor 5 (CCR5) gene locus, and the human orthologue of mouse ROSA26 locus.

WO 36758 Combinations of HSD17B13 n isoforms or nucleic acids encoding 13 protein isoforms that can be introduced and expressed include, for example, C, D, F, G, H, CD, CF, CG, CH, DF, DG, DH, FG, FH, GH, CDF, CDG, CDH, CFG, CFH, CGH, DFG, DFH, DGH, FGH, CDFG, CDFH, CFGH, DFGH, and CDFGH. In particular methods, HSD17B13 Isoform D or a nucleic acid encoding Isoform D (alone or in combination with other isoforms) is introduced or sed. Exemplary ces for each of these isoforms and transcripts are ed elsewhere herein. It is understood, however, that gene sequences and within a population, mRNA sequences transcribed from such genes, and proteins translated from such mRNAs can vary due to polymorphisms such as single-nucleotide polymorphisms. The sequences provided herein for each transcript and isoform are only exemplary sequences. Other sequences are also possible. ations of HSD17B13 Transcripts whose expression can be targeted for reduction through antisense RNA, shRNA, or siRNA include, for e, A, B, E, F’, AB, AE, AF’, BE, BF’, ABE, ABF’, AEF’, BEF’, and ABEF’. In particular methods, HSD17B13 Transcript A (alone or in combination with other transcripts) is targeted. For example, the antisense RNA, siRNA, or shRNA can hybridize to a sequence within SEQ ID NO: 4 (HSDI 7BI3 Transcript A). Optionally, the antisense RNA, siRNA, or shRNA hybridizes to a sequence present in SEQ ID NO: 4 (HSDI 7BI3 Transcript A) that is not present in SEQ ID NO: 7 (HSDI 7BI3 Transcript D). ally, the antisense RNA, siRNA, or shRNA hybridizes to a sequence within exon 7 or a sequence spanning the exon 6-exon 7 ry of SEQ ID NO: 4 (HSDI 7BI3 Transcript A).

For example, some such methods comprise a method of treating a subject who is not a carrier of the HSDI 7BI3 rs72613567 variant (or is only a heterozygous carrier of the HSDI 7BI3 3567 variant) and has or is susceptible to developing a chronic liver disease, comprising ucing into the subject or introducing into a liver cell in the subject: (a) a nuclease agent (or nucleic acid encoding) that binds to a nuclease target sequence within an HSDI 7BI3 gene, wherein the nuclease target sequence includes or is proximate to a position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2; and (b) an exogenous donor sequence comprising a 5’ homology arm that izes to a target sequence 5’ of the position ponding to position 12666 of SEQ ID NO: 2, a 3’ homology arm that hybridizes to a target sequence 3 ’ of the position corresponding to position 12666 of SEQ ID NO: 2, and a nucleic acid insert comprising a thymine flanked by the 5’ homology arm and the 3’ homology arm. The nuclease agent can cleave the HSDI 7BI3 gene in a liver cell in the subject, and the exogenous donor sequence can recombine with the HSDI 7BI3 gene in the liver cell, wherein upon recombination of the exogenous donor sequence with the HSDI 7BI3 gene, the thymine is inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1.

Examples of nuclease agents (e.g., a Cas9 protein and a guide RNA) that can be used in such methods are disclosed elsewhere herein. Examples of suitable guide RNAs and guide RNA target sequences are disclosed ere herein. Examples of exogenous donor sequences that can be used in such methods are disclosed elsewhere herein.

] As another example, some such methods comprise a method of ng a subject who is not a carrier of the HSDI 7BI3 rs72613567 variant (or is only a zygous carrier of the HSDI 7BI3 rs72613567 variant) and has or is susceptible to developing a c liver disease, comprising introducing into the subject or introducing into a liver cell in the t an exogenous donor sequence comprising a 5’ homology arm that hybridizes to a target sequence 5’ of the position corresponding to position 12666 of SEQ ID NO: 2, a 3’ gy arm that hybridizes to a target sequence 3’ of the position corresponding to position 12666 of SEQ ID NO: 2, and a nucleic acid insert comprising a thymine flanked by the 5 ’ gy arm and the 3’ homology arm. The exogenous donor sequence can recombine with the HSDI 7BI3 gene in the liver cell, wherein upon ination of the ous donor sequence with the HSDI 7BI3 gene, the thymine is inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1. Examples of exogenous donor sequences that can be used in such methods are disclosed elsewhere herein.

Some such methods comprise a method of ng a subject who is not a carrier of the HSDI 7BI3 rs72613567 variant (or is only a heterozygous carrier of the HSDI 7BI3 rs72613567 variant) and has or is susceptible to developing a chronic liver disease, comprising introducing into the subject or introducing into a liver cell in the subject: (a) a nuclease agent (or nucleic acid encoding) that binds to a nuclease target sequence within an HSDI 7BI3 gene, wherein the se target sequence comprises the start codon for the HSDI 7BI3 gene or is within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon or is selected from SEQ ID NOS: 20-81. The nuclease agent can cleave and disrupt expression of the HSDI 7BI3 gene in a liver cell in the subject. Some such s comprise a method of ng a subject who is not a carrier of the HSDI 7BI3 rs72613567 variant (or is only a heterozygous carrier of the HSDI 7BI3 rs72613567 variant) and has or is susceptible to developing a c liver disease, comprising introducing into the subject or introducing into a liver cell in the subject: (a) a nuclease agent (or nucleic acid encoding) that binds to a nuclease target sequence within an HSDI 7BI3 gene, wherein the nuclease target sequence comprises the start codon for the HSDI 7BI3 gene or is within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon or is selected from SEQ ID NOS: 20-81; and (b) an expression vector comprising a recombinant HSDI 7BI3 gene comprising a e inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the recombinant HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1. The expression vector can be one that does not genomically integrate. Alternatively, a targeting vector (i.e., exogenous donor ce) can be introduced comprising a recombinant HSDI 7BI3 gene comprising a thymine inserted between nucleotides ponding to positions 12665 and 12666 of SEQ ID NO: 1 when the recombinant HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1. The nuclease agent can cleave and disrupt sion of the HSDI 7BI3 gene in a liver cell in the subject, and the expression vector can express the recombinant HSDI 7BI3 gene in the liver cell in the subject. atively, the genomically integrated, recombinant HSDI 7BI3 gene can express in the liver cell in the subject. Examples of nuclease agents (e.g., a nuclease-active Cas9 protein and guide RNA) that can be used in such methods are disclosed elsewhere herein.

Examples of suitable guide RNAs and guide RNA target ces are disclosed elsewhere herein. Step (b) can atively comprise introducing an expression vector or targeting vector comprising a nucleic acid (e.g., DNA) encoding an HSD17B13 protein that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSD17B13 Isoform C, D, F, G, or H or a fragment thereof and/or comprising a sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSDI 7BI3 Transcript C, D, F, G, or H or a nt thereof. se, step (b) can alternatively comprise introducing an mRNA encoding an HSD17B13 protein that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSD17B13 Isoform C, D, F, G, or H or a fragment thereof and/or having a complementary DNA (or a portion thereof) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSDI 7BI3 ript C, D, F, G, or H or a fragment thereof.

Likewise, step (b) can alternatively se introducing a protein comprising a sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSD17B13 Isoform C, D, F, G, or H or a fragment thereof. In specific methods, the transcript can be HSDI 7BI3 Transcript D (e.g., SEQ ID NO: 7), or the isoform can be HSD17B13 Isoform D (e.g., SEQ ID NO: 15). In other specific methods, a combination of HSD17B13 Isoforms, or expression vectors or ing vectors encoding a combination of HSD17B13 Isoforms, or mRNAs encoding a combination ofHSD17B13 Isoforms can be introduced (e.g., D, DC, DF, DG, DH, DCF, DCG, DCH, DFG, DFH, DGH, DCFG, DCFH, DCGH, DFGH, or DCFGH).

] In some such methods, a second nuclease agent is also introduced into the t or into the liver cell in the subject, wherein the second nuclease agent binds to a second nuclease target ce within the HSDI 7BI3 gene, wherein the second nuclease target sequence comprises the stop codon for the HSDI 7BI3 gene or is within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the stop codon or is selected from SEQ ID NOS: , wherein the nuclease agent cleaves the HSDI 7B]3 gene in the liver cell within both the first nuclease target sequence and the second nuclease target sequence, wherein the liver cell is modified to comprise a deletion between the first nuclease target sequence and the second se target sequence. For example, the second nuclease agent can be a Cas9 protein and a guide RNA. Suitable guide RNAs and guide RNA target sequences in proximity to the stop codon are disclosed elsewhere herein.

Such methods can also comprise a method of ng a subject who is not a carrier of the HSDI 7BI3 rs72613567 variant (or is only a heterozygous carrier of the HSDI 7BI3 rs72613567 variant) and has or is susceptible to developing a chronic liver disease, comprising ucing into the subject or introducing into a liver cell in the subject: (a) a DNA-binding protein (or nucleic acid encoding) that binds to a DNA-binding protein target sequence within an HSDI 7BI3 gene, wherein the DNA-binding n target sequence ses the start codon for the HSDI 7BI3 gene or is within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon or is selected from SEQ ID NOS: 20-81. The DNA-binding protein can alter (e.g., reduce) expression of the HSDI 7BI3 gene in a liver cell in the subject.

Such methods can also se a method of treating a subject who is not a carrier of the HSDI 7BI3 rs72613567 t (or is only a heterozygous carrier of the HSDI 7BI3 rs72613567 variant) and has or is susceptible to developing a chronic liver disease, comprising ucing into the subject or introducing into a liver cell in the subject: (a) a nding protein (or nucleic acid encoding) that binds to a DNA-binding protein target sequence within an HSDI 7BI3 gene, wherein the DNA-binding protein target sequence comprises the start codon for the HSDI 7BI3 gene or is within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon or is selected from SEQ ID NOS: 20-81; and (b) an expression vector comprising a recombinant HSDI 7BI3 gene comprising a thymine ed between tides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the recombinant HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1. The expression vector can be one that does not genomically integrate. Alternatively, a targeting vector (i.e., exogenous donor sequence) can be introduced comprising a recombinant HSDI 7BI3 gene comprising a thymine inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the inant HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1. The DNA- g protein can alter (e.g., reduce) expression of the HSDI 7BI3 gene in a liver cell in the subject, and the expression vector can express the recombinant HSDI 7BI3 gene in the liver cell in the subject. Alternatively, the genomically integrated, recombinant HSDI 7BI3 gene can express in the liver cell in the subject. Examples of nding proteins suitable for use in such methods are disclosed elsewhere . Such DNA-binding proteins (e.g., Cas9 protein and guide RNA) can be fused or operably linked to a transcriptional repressor domain. For example, the DNA-binding protein can be a catalytically inactive Cas9 protein fused to a transcriptional repressor domain. Such a DNA-binding protein fused to a transcriptional repressor domain can be used, for example, to decrease expression of a wild type HSDI 7BI3 gene or an HSDI 7BI3 gene that is not the rs72613567 t (e.g., to decrease expression of HSDI 7BI3 Transcript or Isoform A). Examples of suitable guide RNAs and guide RNA target sequences are disclosed elsewhere herein. Step (b) can alternatively se introducing an expression vector or targeting vector comprising a nucleic acid (e.g., DNA) encoding an HSD17B13 protein that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSD17B13 m C, D, F, G, or H or a fragment thereof and/or comprising a sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSDI 7BI3 Transcript C, D, F, G, or H or a fragment thereof. se, step (b) can atively comprise introducing an mRNA encoding an HSD17B13 protein that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSD17B13 Isoform C, D, F, G, or H or a fragment thereof and/or having a complementary DNA (or a portion thereof) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSDI 7BI3 Transcript C, D, F, G, or H or a nt thereof. Likewise, step (b) can alternatively se introducing a protein comprising a sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSD17B13 Isoform C, D, F, G, or H or a fragment thereof. In specific methods, the transcript can be HSDI 7BI3 Transcript D (e.g., SEQ ID NO: 7), or the isoform can be 13 Isoform D (e.g., SEQ ID NO: 15). In other specific methods, a combination ofHSD17B13 Isoforms, or expression s or targeting vectors encoding a combination ofHSD17B13 Isoforms, or mRNAs encoding a combination of HSD17B13 Isoforms can be introduced (e.g., D, DC, DF, DG, DH, DCF, DCG, DCH, DFG, DFH, DGH, DCFG, DCFH, DCGH, DFGH, or .

] Such methods can also comprise a method of treating a subject who is not a carrier of the HSDI 7BI3 rs72613567 variant (or is only a heterozygous carrier of the HSDI 7BI3 rs72613567 t) and has or is susceptible to developing a c liver disease, comprising introducing into the subject or introducing into a liver cell in the subject: an antisense RNA, an siRNA, or an shRNA that hybridizes to a sequence within a region of one or more ofHSDI 7BI3 Transcripts A, B, E, and F’ (and particularly A) that optionally is not present in one or more HSDI 7BI3 Transcripts C, D, F, G, and H (and particularly D). Optionally, the nse RNA, siRNA, or shRNA hybridizes to a sequence within SEQ ID NO: 4 (HSDI 7BI3 Transcript A), and the antisense RNA, siRNA, or shRNA can decrease expression ofHSDI 7BI3 Transcript A in a cell. Optionally, the antisense RNA, siRNA, or shRNA hybridizes to a sequence present in SEQ ID NO: 4 (HSDI 7BI3 Transcript A) that is not present in SEQ ID NO: 7 (HSDI 7BI3 Transcript D). Optionally, the antisense RNA, siRNA, or shRNA hybridizes to a sequence within exon 7 or a sequence spanning the exon 6-exon 7 boundary of SEQ ID NO: 4 (HSDI 7BI3 Transcript A). For example, the antisense RNA, siRNA, or shRNA can hybridize to ce within a region in exon 7 or a region spanning the exon 6-exon 7 boundary of SEQ ID NO: 4 (HSDI 7BI3 Transcript A) and decrease expression ofHSDI 7BI3 Transcript A in a liver cell in the subject. Optionally, such methods can further comprise introducing into the subject an expression vector comprising a recombinant HSDI 7BI3 gene comprising a thymine inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the recombinant HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1. The expression vector can be one that does not genomically integrate. Alternatively, a targeting vector (i.e., exogenous donor sequence) can be introduced comprising a recombinant HSDI 7BI3 gene comprising a thymine inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the inant HSDI 7BI3 gene is lly aligned with SEQ ID NO: 1. In methods in which an expression vector is used, the expression vector can express the recombinant HSDI 7BI3 gene in the liver cell in the subject. Alternatively, in methods in which a recombinant HSDI 7BI3 gene is genomically integrated, the recombinant HSDI 7BI3 gene can express in the liver cell in the subject. Such methods can alternatively comprise introducing an expression vector or targeting vector comprising a c acid (e.g., DNA) encoding an HSD17B13 protein that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSD17B13 m C, D, F, G, or H or a fragment thereof and/or comprising a sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% cal to HSDI 7BI3 Transcript C, D, F, G, or H or a fragment thereof. Likewise, such methods can alternatively comprise introducing an mRNA encoding an 13 protein that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSD17B13 Isoform C, D, F, G, or H or a fragment thereof and/or having a complementary DNA (or a portion f) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSDI 7BI3 Transcript C, D, F, G, or H or a nt thereof. Likewise, such methods can atively comprise introducing a protein comprising a sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSD17B13 Isoform C, D, F, G, or H or a fragment thereof. In specific methods, the transcript can be HSDI 7BI3 Transcript D (e.g., SEQ ID NO: 7), or the m can be HSD17B13 Isoform D (e.g., SEQ ID NO: 15). In other specific methods, a combination ofHSD17B13 Isoforms, or sion vectors or targeting vectors encoding a ation ofHSD17B13 Isoforms, or mRNAs encoding a combination of HSD17B13 Isoforms can be introduced (e.g., D, DC, DF, DG, DH, DCF, DCG, DCH, DFG, DFH, DGH, DCFG, DCFH, DCGH, DFGH, or DCFGH).

Other such methods can comprise method of treating a subject who is not a carrier of the HSDI 7BI3 rs72613567 variant (or is only a heterozygous carrier of the HSDI 7BI3 rs72613567 variant) and has or is susceptible to developing a chronic liver disease, comprising introducing into the subject or introducing into a liver cell in the subject an expression , wherein the expression vector comprises a inant HSDI 7BI3 gene comprising a thymine inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the recombinant HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1, wherein the expression vector expresses the recombinant HSDI 7BI3 gene in a liver cell in the subject. The expression vector can be one that does not genomically integrate. Alternatively, a targeting vector (i.e., exogenous donor sequence) can be introduced sing a recombinant HSDI 7BI3 gene comprising a thymine inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the recombinant HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1. In methods in which an expression vector is used, the expression vector can s the recombinant HSDI 7BI3 gene in the liver cell in the subject. Alternatively, in methods in which a recombinant HSDI 7B]3 gene is genomically integrated, the inant HSDI 7B]3 gene can express in the liver cell in the subject. Such methods can alternatively comprise introducing an expression vector or targeting vector comprising a nucleic acid (e.g., DNA) encoding an HSD17B13 protein that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSD17B13 Isoform C, D, F, G, or H or a fragment thereof and/or comprising a sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% cal to HSDI 7BI3 Transcript C, D, F, G, or H or a fragment thereof. Likewise, such methods can alternatively comprise introducing an mRNA encoding an 13 n that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSD17B13 Isoform C, D, F, G, or H or a fragment thereof and/or having a complementary DNA (or a portion thereof) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to HSDI 7BI3 Transcript C, D, F, G, or H or a fragment thereof. Likewise, such methods can alternatively comprise introducing a n comprising a sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to 13 Isoform C, D, F, G, or H or a fragment thereof. In specific s, the ript can be HSDI 7BI3 Transcript D (e.g., SEQ ID NO: 7), or the isoform can be 13 m D (e.g., SEQ ID NO: 15). In other specific methods, a combination ofHSD17B13 Isoforms, or expression vectors or targeting vectors encoding a combination ofHSD17B13 Isoforms, or mRNAs encoding a combination of 13 Isoforms can be introduced (e.g., D, DC, DF, DG, DH, DCF, DCG, DCH, DFG, DFH, DGH, DCFG, DCFH, DCGH, DFGH, or .

Suitable expression vectors and recombinant HSDI 7BI3 genes for use in any of the above methods are sed elsewhere herein. For example, the recombinant HSDI 7BI3 gene can be the full 3567 variant gene or can be an HSDI 7BI3 minigene in which one or more nonessential ts of the gene have been deleted with respect to a corresponding wild type HSDI 7BI3 gene. As an example, the deleted segments can comprise one or more intronic sequences, and the minigene can comprise an intron corresponding to intron 6 of SEQ ID NO: 2 when optimally aligned with SEQ ID NO: 2. An example of a full rs72613567 variant gene is one that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 2 when optimally aligned with SEQ ID NO: 2.

Some such methods comprise a method of modifying a cell (e.g., a liver cell) in a subject having or susceptible to developing a chronic liver disease. In such methods, the nuclease agents and/or exogenous donor sequences and/or inant expression vectors can be introduced into the cell via administration in an effective regime meaning a , route of administration and frequency of administration that delays the onset, reduces the ty, inhibits further deterioration, and/or ameliorates at least one sign or symptom of a c liver disease being treated. The term “symptom” refers to a subjective evidence of a disease as perceived by the subject, and a “sign” refers to objective evidence of a disease as ed by a physician. If a subject is already suffering from a disease, the regime can be referred to as a therapeutically effective regime. If the subject is at elevated risk of the disease relative to the l population but is not yet experiencing symptoms, the regime can be referred to as a prophylactically effective regime. In some instances, therapeutic or prophylactic efficacy can be ed in an individual patient relative to historical controls or past experience in the same subject. In other instances, therapeutic or prophylactic efficacy can be demonstrated in a preclinical or clinical trial in a population of treated subjects relative to a control population of untreated subjects. ry can be any suitable method, as disclosed elsewhere herein. For e, the nuclease agents or ous donor sequences or recombinant expression vectors can be delivered by vector ry, viral delivery, particle-mediated delivery, nanoparticle-mediated delivery, liposome-mediated delivery, exosome-mediated delivery, lipid-mediated delivery, lipid-nanoparticle-mediated delivery, cell-penetrating-peptide-mediated delivery, or table- -mediated delivery. Some specific examples include ynamic delivery, virus- mediated delivery, and lipid-nanoparticle-mediated delivery.

Administration can be by any suitable route including, for example, parenteral, intravenous, oral, subcutaneous, intra-arterial, intracranial, hecal, intraperitoneal, topical, intranasal, or intramuscular. A specific example which is often used, for example, for protein replacement ies is intravenous infusion. The frequency of administration and the number of s can be depend on the half-life of the nuclease agents or exogenous donor ces or recombinant expression vectors, the condition of the subject, and the route of administration among other factors. Pharmaceutical compositions for administration are preferably sterile and ntially isotonic and manufactured under GMP conditions. Pharmaceutical compositions can be provided in unit dosage form (i.e., the dosage for a single administration). ceutical compositions can be formulated using one or more physiologically and pharmaceutically acceptable carriers, diluents, excipients or auxiliaries. The formulation depends on the route of administration chosen. The term “pharmaceutically acceptable” means that the carrier, diluent, excipient, or auxiliary is compatible with the other ingredients of the formulation and not substantially deleterious to the recipient thereof.

Other such methods comprise an ex vivo method in a cell fiom a subject having or susceptible to developing a chronic liver e. The cell with the ed genetic modification can then be transplanted back into the subject.

Any of the therapeutic or prophylactic methods disclosed herein can further comprise administering a therapeutic ed to prevent or alleviate one or more symptoms associated with progression to more clinically advanced stages of chronic liver disease (e.g., progression from simple steatosis to more clinically ed stages of chronic liver disease, or progression from simple steatosis to one or more of steatohepatitis, fibrosis, cirrhosis, and hepatocellular carcinoma). For examples, such treatments could be d on preventing or reducing inflammation or preventing or reducing fibrosis. es of such therapeutics in development are provided below.

WO 36758 OCA — Obeticholic acid Phase III (Intercept) NR1H4 Improved NAS, reversed s in Agonist (FXR) Phase Iib GS-9674 (Gilead) . . . . Potential to e fibrosis S1mtuzumab d) Phase II LOXL2 (NASH/PSC) ACACA NDI-010976 (Gilead) Phase I Inhibitor Prevent lipogenesis ACACB GFTSOS / Elafibranor . Break down fatty acids, block fat & Phase III (Genfit) glucose production, dec inflammation 02 UC . . . .

Aramchol (Galmed) Phase II Inhibitor fatty ac1d-b11e 391d conjugate, bOOStS ABCA1) 1ver fat metabollsm Chemoklne receptors are 1nvolved 1n. . .

Cenicriviroc (Tobira) Phase IIb Inhibitor 1nflammatlon and s git-MUG? (Galect1n Phase II erapeut1cs) Inhibitor LGALS3 Galectin-3 is upregulated in fibrosis TD139 (Galecto Biotech) SHP626 (Shire) SLC10A2 Interferes with bile acid recycling ”(5472.“ ‘ (B°ehrmger Phase I Inhibitor AOC3 Anti-inflammatory Ingelhe1m) RP103 — Cysteam1ne b1tartrate Deplet1ng Phase II CTNS Cyste1ne-dep1et1ng; 1a1 ant1- (Raptor) agent ox1dant All patent filings, websites, other publications, accession numbers and the like cited above or below are incorporated by reference in their entirety for all purposes to the same extent as if each dual item were specifically and individually indicated to be so incorporated by reference. If different versions of a sequence are associated with an accession number at different times, the version associated with the accession number at the effective filing date of this application is meant. The effective filing date means the r of the actual filing date or filing date of a priority application ing to the accession number if applicable. Likewise, if different versions of a publication, website or the like are published at different times, the version most recently published at the effective filing date of the application is meant unless otherwise indicated. Any feature, step, element, ment, or aspect of the invention can be used in combination with any other unless specifically indicated otherwise. Although the present invention has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be apparent that certain changes and modifications may be ced within the scope of the ed claims.

BRIEF DESCRIPTION OF THE SEQUENCES The nucleotide and amino acid sequences listed in the anying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three-letter code for amino acids. The nucleotide sequences follow the standard convention ofbeginning at the 5’ end of the sequence and proceeding forward (i.e., from left to right in each line) to the 3 ’ end.

Only one strand of each nucleotide sequence is shown, but the complementary strand is understood to be included by any reference to the displayed strand. The amino acid sequences follow the standard convention ofbeginning at the amino us of the sequence and proceeding forward (i.e., from left to right in each line) to the carboxy terminus. 1 DNA HSD17B13 Wild Type c Sequence (Human Genome Assembly GRCh38) Transcripts More Prevalent in Subjects with Wild Type HSDI 7313 Gene: ript A Exon 1 = 1-275 Exon 2 = 4471-4578 Exon 3 = 5684-5815 Exon 4 = 7308-7414 Exon 5 = 8947-9084 Exon 6v1 = 12548-12664 Exon 7 =17599-19118 Transcript B Exon 1 = 1-275 Exon 2 = skipped Exon 3 = 5684-5815 Exon 4 = 7308-7414 Exon 5 = 8947-9084 Exon 6v1 = 12548-12664 Exon 7 =17599-19118 Transcript E Exon 1 = 1-275 Exon 2 = 4471-4578 Exon 3 = 5684-5815 Exon 3’ = 6210-6281 Exon 4 = 7308-7414 Exon 5 = 8947-9084 Exon 6v1 = 12548-12664 Exon 7 =17599-19118 ript F’ Exon 1 = 1-275 Exon 2 = 4471-4578 Exon 3 = 815 Exon 4 = 7308-7414 Exon 5 = 8947-9084 Exon 6V3 = 12548-13501 (Read-through from exon 6 into intron 6 = 12665- 13501) Exon 7 = skipped HSD17B13 Genomic Sequence Variant (Human Genome Assembly GRCh38; rs72613567—insertion ofT at chr4: 87310241 -87310240): Insertion ofT at position 12666 Transcripts More Prevalent in ts with rs72613567HSDI 7313 Gene Variant: Transcript C Exon 1 = 1-275 Exon 2 = 4471-4578 Exon 3 = 5684-5815 Exon 4 = 7308-7414 Exon 5 = 8947-9084 Exon 6 = skipped Exon 7 -19119 ript D Exon 1 = 1-275 Exon 2 = 4471-4578 Exon 3 = 5684-5815 Exon 4 = 7308-7414 Exon 5 = 8947-9084 Exon 6v2 = 12548-12665 (Includes additional residue 12665 at 3’ end) Exon 7 =17600-19119 Transcript F Exon 1 = 1-275 Exon 2 = 4471-4578 Exon 3 = 5684-5815 Exon 4 = 7308-7414 Exon 5 = 8947-9084 Exon 6v3 = 13502 (Read-through from exon 6 into intron 6 = 12665- 13502) Exon 7 = skipped Transcript G Exon 1 = 1-275 Exon 2 = skipped Exon 3 = 5684-5815 Exon 4 = 7308-7414 Exon 5 = 8947-9084 Exon 6v2 = 12548-12665 (Includes additional residue 12665 at 3’ end) Exon 7 =17600-19119 Transcript H Exon 1 = 1-275 Exon 2 = 4471-4578 Exon 3 = 5684-5815 Exon 3’ = 6210-6281 Exon 4 = 7308-7414 Exon 5 = 8947-9084 Exon 6v2—— 12548-12665 (Includes onal residue 12665 at 3’ end) Exon 7 ——1-760019119 _-Endogenous HSD17B13 Promoter (-499 to 100 relative to transcription start site (TSS)) -41 42-81 82-225 226-239 248-250 256-258 259-263 264-268 270-489 490-499 500-719 720-729 950-959 960-1179 1180-1189 1190-1409 1410-1419 1423-1642 1643-1652 WO 36758 EXAMPLES Example 1. Variant 17beta-hydroxysteroid dehydrogenase 13 protects against chronic liver disease. ] c liver e and cirrhosis are leading causes of morbidity and ity in the U.S. (Kochanek et al. (2016) Natl Vital Stat Rep 65: 1-122, herein incorporated by reference in its entirety for all purposes). The most common gies of sis are alcoholic liver disease, chronic hepatitis C, and oholic fatty liver disease (NAFLD), together accounting for ~80% ents awaiting liver transplant (Wong et al. (2015) Gastroenterology 148:547- 555, herein incorporated by reference in its entirety for all purposes). Notably, the estimated prevalence ofNAFLD in the US. is between 19 and 46 percent (Browning et al. (2004) Hepatology 40:1387-1395; Lazo et al. (2013) Am JEpidemiol 178:38-45; and Williams et al. (2011) Gastroenterology 140: 124-13 1, each of which is herein incorporated by reference in its entirety for all purposes) and is rising over time (Younossi et al. (2011) Clin Gastroenterol Hepatol 9:524-530 e1; quiz e60 (2011), herein incorporated by reference in its entirety for all purposes), likely in conjunction with increased rates of obesity. To date, there remains much uncertainty about the inter-individual variation in NAFLD progression and outcomes; knowledge of underlying genetic factors could improve risk stratification and provide the foundation for novel therapeutic strategies. Here, we show that carriers of a splice variant in HSDI 7BI3 (encoding hydroxysteroid—17-beta dehydrogenase 13) have reduced risk of lic and nonalcoholic liver disease, and reduced risk ofNAFLD progression. Association studies of whole exome sequence data linked to electronic health records from 46,544 European ancestry ipants in the DiscovEHR study led to the identification of a splice variant in HSDI 7BI3 (rs72613567) associated with reduced alanine transaminase and aspartate transaminase levels; these s were replicated in three te cohorts comprising 12,528 individuals. In the discovery cohort, variant HSDI 7313 was associated with d risk of alcoholic and nonalcoholic liver disease, cirrhosis, and hepatocellular oma. In a bariatric surgery cohort, the variant was associated with reduced risk of histopathological steatohepatitis in individuals with steatosis. RNA sequencing of human liver samples fiom the bariatric surgery cohort revealed that homozygous carriers of the splice variant predominantly express a novel ript coding for a truncated HSDI 7BI3 isoform. These findings shed new light on the role of HSDI 7313 in promoting liver disease progression, and its potential as a therapeutic target for steatohepatitis and cirrhosis.

] Previous genome wide association studies (GWAS) have identified a limited number of genes and variants associated with chronic liver disease. The most robustly validated genetic association to date is to a common missense variant in the patatin-like phospholipase domain containing 3 gene (PNPLA3 p.Ile148Met, rs73 8409), initially found to be associated with increased risk of nonalcoholic fatty liver e (NAFLD) (Romeo et al. (2008) Nat Genet 40: 1461-1465 and Speliotes et al. (2011) PLoS Genet 7:e1001324, each of which is herein orated by reference in its entirety for all purposes), and subsequently found to be associated with disease severity (Rotman et al. (2010) Hepatology 52:894-903 and Sookoian et al. (2009) JLipid Res 50:21 1 1-21 16, each of which is herein incorporated by nce in its entirety for all purposes) and progression (Trepo et al. (201 6) JHepatol doi:10.1016/j.jhep.2016.03.01 1, herein incorporated by reference in its entirety for all es).

Variation in the embrane 6 superfamily member 2 (TM6SF2) gene has also been shown to confer sed risk for NAFLD (Kozlitina et al. (2014) Nat Genet 46:352-356, Liu et al. (2014) Nat Commun 5:4309, and Sookoian et al. (2015) Hepatology 61 :515-525, each of which is herein incorporated by reference in its entirety for all es). The normal functions of these two proteins are not well understood, though both have been proposed to be involved in hepatocyte lipid metabolism. How variants in PNPLA3 and TM6SF2 contribute to increased risk of liver disease has yet to be elucidated. GWAS have also fied several genetic factors to be associated with serum e aminotransferase (ALT) and aspartate aminotransferase (AST) (Chambers et al. (2011) Nat Genet 43 :1 13 1 -1 138 and Yuan et al. (2008) Am JHum Genet 83 :520-528, each of which is herein incorporated by reference in its ty for all purposes), quantitative markers of hepatocyte injury and liver fat accumulation that are frequently measured clinically. To date, there are no described protective genetic variants for chronic liver disease.

The discovery ofprotective genetic variants in other settings, such as loss-of-function variants in PCSK9 that reduce the risk of cardiovascular disease, has been the catalyst for development of new s of therapeutics.

] The DiscovEHR collaboration between the Regeneron Genetics Center and the Geisinger Health System (GHS) couples exome sequencing to de-identified electronic health record (EHR) data to enable genetic discoveries and precision medicine (Dewey et al. (2016) Science 354(6319) doi:10.1 126/science.aaf6814, herein incorporated by reference in its entirety for all purposes). The DiscovEHR cohort is comprised of patients recruited from primary and specialty medical care cohorts across the GHS integrated healthcare system, including bariatric y patients with liver biopsy specimens (Gorden et al. (2013) Hum Hered 75:34-43, herein incorporated by reference in its entirety for all purposes). In this study, we undertook a comprehensive functional genomics approach to assess the bution of exome ce variation to quantitative traits, disease diagnoses, and histopathologic phenotypes relevant to chronic liver disease and cirrhosis in 49,188 individuals of European descent from the DiscovEHR cohort, with -up studies using whole exome cing of 9,883 individuals of European ancestry.

Using whole exome sequence data linked to EHR-derived phenotypes, we first carried out an association study of serum ALT and AST measures in 46,544 duals of European descent from the DiscovEHR cohort (“GHS discovery cohort”). Clinical characteristics of the cohort are described in Table 1A. There were 41,908 individuals with cumented transaminase es (including 40,561 individuals with both ALT and AST measures). We used a linear mixed model (Yang et al. (201 1) Am JHum Genet 88:76-82, herein incorporated by reference in its entirety for all purposes) to detect associations between log1o- transformed median ALT and AST levels (adjusted for sex, age, age2, body mass index (BMI) and the first four principle components of ancestry) and 9 biallelic single ts with minor allele frequency greater than 0.1%. Using an exome-wide significance threshold ofP < 1.0x10'7, we identified 35 variants in 19 genes significantly associated with ALT or AST, including eight variants in seven genes that were associated with both ALT and AST (Fig. 1 and Table 2).

Table 1A. Demographics and clinical characteristics of sequenced European-ancestry individuals from the ery and replication cohorts.

Discovery Bariatric Dallas Heart Penn Medicine Characteristic Cohort Surgery Cohort Study Biobank = 46,544 = 2,644 = 1,35 = 8,526 52.9 (44.1 — 46.0 (38.0 — Age (years) — median (IQR) 62.9 (49.6 — 73.8) 68.0 (60.0 — 76.0) 61.2) 54.0) Female sex — number (%) 26,875 (57.7) 2,119 (80.1) 724 (53.4) 3,242 (38.0) Body mass index — median 47.4 (42.0 — 29.9 (35.4 — 44.8) 28 (25—32) 30 (25—32) (IQR) 53.7) Transaminase level /L — median QR Alanine aminotransferase 23.0 (17.5 — 20.0 (15.0 — 22.0 (17.0 - 29.0) 22.0 (17.0 — 30.0) (ALT) 29.5) 27.0) Aspartate aminotransferase 23.0 (20.0 — 21.0 (18.0 — 23.0 (20.0 - 27.5) 24.0 (20.0 — 30.5) (AST) 27.0) 25.0) Presence of liver disease . ICD-9 code — N % Alcoholic liver disease 197 0.4 7 0.3 Alcoholic sis 130 (0.3) 3 (0.1) Iglonalcohohc, non-v1ra111ver 1,938 (4.2) 1,543 (58.4) 1sease Nonalcoholic cirrhosis 382 (0.8) 24 (0.9) cellular carcinoma 76 (0.2) 1 (0.04) No liver disease 1 (0.04) Table 1B. Demographics and clinical teristics of genotyped multi-ethnic cases and controls from the Dallas Liver and Pediatric Liver Studies.

Dallas Pediatric Dallas ric Dallas Liver Dallas Liver Liver Study Liver Study Characteristic Study Cases Study Controls Controls (N = 517) (N = 4,279) Age (years) — median (IQR) 55 (48 — 60) 44 (36 — 53) 12 (10 — 15) 12 (11 — 14) Female sex — number (%) 277 (54) 2,494 (58) 65 (32) 126 (52) Body mass index — median (27 — 35) 30 (26 — 35) 30 (27 — 34) 31 (28 — 35) (IQR) e n orted ethnici Afiican American 33 (6) 2,291 (54) European American 158 (31) 1,266 (30) ic American 326 (63) 722 (17) 203 (100) 244 (100) Presence of liver disease . ICD-9 code — N % Alcoholic liver disease 223 (43) Alcoholic cirrhosis 215 (42) Nonalcoholic, non-viral liver 212 (20) disease Nonalcoholic cirrhosis 100 (19) Hepatocellular carcinoma 44 (9) No liver disease 4,279 (100) —244 (100) HA< Mm .tonoo 3.5:? HA< ”223 bug/08% a»: mm»— 853%“ II HA< mom E HA< ”.3on momfiomgnbong 3 85.39% £32 EEEHHEEEE mHm< omsfiasmqsb a a Eaagfiaagéééfii HEfiEEEEEEEI .s..§;. IEEHHEEEEEEEI fiEEIEEEEEEE éééé figgggggggg figgggggggg gfiggééééaé .Hm< momfiomgnbofifin 830m can 0E8“? ..

HEB Ion—355$ EEIEIIEE iii. H13. . ”4.52:6. gfififiégééééé floo— ... H13. 8368mm. fiE e. ass... 3...... . a ”22? on: mnoufioommn 32:83 mast? “anomawmm a? 02820:: 33%. Susana Bwfim H 023-0805 <0 CHOOGHOHHOOUO<<HH<EEEIIEH .N IélHEEHIEH H HOGKDGOGHGGGG 0388:“ mats“: H IEIIEE gigfigééééééggélléa HmaglifiéééglfiSEg-EHEIIEHGH<OOOO<Héfiéfiggééééééiélléfififiéggégééégiélléal Eaélléav Eéélléagafifigaéaééégiéllél iéllé l Eééllél 3:352, 7.338 IiIi 2m moanomcfl * “32330562 93:55 To replicate these associations, we analyzed the 35 AST- or ALT-associated variants ascertained via whole exome cing in three separate European-ancestry s: 2,644 bariatric surgery patients from DiscovEHR (“GHS bariatric surgery cohort”), 1,357 individuals from the Dallas Heart Study, and 8,526 individuals from the Penn Medicine Biobank (Table 1A). In meta-analysis of the replication cohorts, thirteen variants in nine genes were significantly ated (Bonferroni significance threshold of P<1 .43x10'3) with ALT or AST (Table 3). These included previously reported liver disease-associated genes and variants, such as PNPLA3 p.Ile148Met (Romeo et al. (2008) Nat Genet 40: 1461 -1465, herein incorporated by reference in its entirety for all purposes), TM6SF2 p.Glu167Lys tina et al. (2014) Nat Genet 46:352-356, herein incorporated by reference in its entirety for all purposes), and SERPINAI p.Glu366Lys (Z allele associated with alphaanti-trypsin deficiency) (Brantly et al. (1988) Am JMed 84:13-31, herein incorporated by reference in its entirety for all purposes), SAMM50, and ERLINI. SERPINAI encodes alphaantitrypsin, whose functional ncy is known to cause hereditary liver disease; the association with SAMM50 may be mediated via linkage disequilibrium with variation in PNPLA3, and ERLINI has been implicated in liver fat deposition. Several ts in GPT and GOT], the genes ng ALT and AST, respectively, were significantly associated with either ALT or AST levels but have not been previously reported to be associated with liver disease. SLC39A12 has not previously been linked to transaminases or liver disease. Meta-analysis also replicated novel associations in our ery cohort between decreased levels ofALT (beta (SE) -0.009 (0.001); P=4.16x10'12) and AST (beta (SE) -0.005 (0.001); x10'1°) and a splice variant in HSDI 7313, the gene encoding hydroxysteroid 17-beta dehydrogenase 13, an uncharacterized member of the 17-beta hydroxysteroid dehydrogenase family. This variant, rs72613567, corresponds to the insertion of an A nucleotide adjacent to the donor splice site (TA allele). ation meta-analysis P-values for these associations were 3.85x10'5 and 9.3 8x105, and joint meta-analysis P-values were 0'15 and 6.82x10'13 for ALT and AST, respectively (Table 3). A prior GWAS identified a nearby locus at 4q22 (rs6834314) as being associated with ALT levels (Chambers et al. (2011) Nat Genet 43:1131-1138, herein incorporated by reference in its entirety for all purposes); to our knowledge, there are no previous s describing any ation with rs72613567. 2315.8»:- I 8.8: 2 2 M: 8N 8 N9 8 : . . . . . . . . 955896 m2 as m: m8 m3 m8 m8 . . . . . . . . . m 9 N m 99.899 2.88.9 mNS 9 N 9 8 8 «:5».- 98 iii a»: 88.8 98.8 88.8. 98.8 R98. 98.8 a98.8 98.8. 988 83. 98.8 mNN8. 98.8 88.8. 98.8 8N8 988 mNN8. 98.8 88.8. 98.8 Bot .8»: 9&8 Si: 8.29. 8.2: 2.2: . N88“ NEEN 8.88 . . 8.8» 553-33— . 9. . . . .

N 8 m 8.88.9 r N882. 9 8.88.9 F 9 measus> u .115 it a»: 88 88.8 98.8 06:83:: “mu-nN:59 . 53— £8 So988 8.8. 98.8 98. 98.8 :9. 9:8 $8. 9 . . . 98.8 .8898 9S $9.8. 98.8 88.8. 98.8 89.8. 9:8 39.8. 98.8 28.8. 98.8 Emma OE-Ho9.5 8865:me fleaflUm— San . 3.5 <92%, 0“ z E, 023-0886 uEaEm -8.5335 :35 $§E§$EE mlU 82. 9.8 ”8.8 98.8 88.8. 98.8 89.8. 98.8 8N8. 98.8 88.8. 98.8 98.8. 98.8 E98.8 88.8. 98.8 98.8 E98.8 888. 98.8 .mtonoo 59.353: 589:: 388% a . << “.699828 1586 “£89998 :38? “3882.8 .n 58886 $93? hbmooqsésomoSm d .8 d d «:on d .8 n m NDRE MNQNNQMW 03% NDKE nousommom flnmlfl“ wmwfiuafia $23353 83: @53an SNm Emma 88889: 333$ mm.9 ENE HE whammfimznu awNmomilnu 33anan .m 08.893 D Sash 8.95 Nana E wNoohchN mew #8821: m: 33%: Nboomhm: 553m: HNNomhm: amgmhm: :Hthm: ~3thme F358 tonoo o — u .L'IV 3:15.85 55.59. 9. H E5: E 33. 988 Ed. 888 $8. 98.8 8.8. 98.8 8.8. 98.8 :88. 98.8 :88. 98.8 :88. 98.8 :88. 98.8 :88. 98.8 88.8. 98.8 88.8. 98.8 88.8. 98.8 .8»: auzv 3.23.: QH NcumHowd NcumHde NcumHmvd NcumHmN.m NcumHmvd NcumHHN.m $723.: NcumFod Ncumood Etna—.59: .115 52. £8 :3. 98.8 83. 92.8 33. 92.8 “8.8. 98.8 “8.8. 98.8 ~88. 98.8 ~88. 98.8 ~88. 98.8 9 8.8. 98.8 88.8. 98.8 ”8.8. 98.8 58.8. 98.8 58.8. 98.8 2 M :9 mm Sm mm 8.“ mm 8+ mm $9 mm 8.9 mm a: mm Rd mm 8.~ mm 93 mm S.“ mm >3 mm 39 98.8 8m Sn >8 8 to to to as a8 :o ”8 ”8 o. 8. 98.8 8. 9:8 8. 98.8 8. 98.8 8. 98.8 8. 98.8 8. 98.8 8. 98.8 8. 98.8 8. 98.8 8. 98.8 8. 98.8 3. a»: 9.8 9.5%.": 580 mac a “EIV‘IV vw‘tv sss‘lv VIV‘IV ZIV‘IV vw‘tv vw‘tv VIV‘IV VIV‘IV ves‘ov vw‘tv VIV‘IV ZIV‘IV D385 :35 95 83. 9.8 33. 98.8 :3. 98.8 38. 98.8 8.8. 98.8 8.8. 98.8 28.8. 98.8 28.8. 98.8 28.8. 98.8 28.8. 98.8 ~88. 98.8 88.8. 98.8 88.8. 98.8 88.8. 98.8 IIIIIIIII sag? 333$ 55H hobs» lohw H mNhNNNh HE may awhmfl ahHwVBmE HE wwahmHHE HwE HwE «maNawNE wowomNNE hmmmeNE thabNE @5thme momthme Nmmwwhm: hHH HmDVNHhHH aamamHoH HawacaHoH mmmonHoH waNHHchH wwoNHaHoH mwwRaHoH mHH achvam mun-III.- WO 36758 3:15.85 9.u I E5: E $8.8 $8.8 28.8 98.8 98.8 98.8 98.8 98.8 88.8 98.8 ”8.8 98.8 88.8 98.8 88.8. 98.8 88.8. 98.8 83. 98.8 83 98.8 8.8. 98.8 8.8 98.8 .8»: auzvII I I II Etna—.59: .115 a59m :88 88.8 «8.8 68.8 288 98.8 288 98.8 «8.8 98.8 ~88 98.8 58.8 98.8 88.8. 98.8 8. 98.8 E. 98.8 33 98.8 “8.8. 98.8 88.8 . . 98.8 «88 98.8 23 98.8 28.8 98.8 28.8 98.8 “8.8 98.8 ”8.8 98.8 8.8 98.8 58.8. 98.8 aa8.. aE.. aand «8. . 98.8 88. 98.8 .5.30 £533: D385 :35 95 83. 9.8 ~88 98.8 :88 988 Red 988 Red 988 58.8 98.8 388 98.8 :88 98.8 8.8. 98.8 88.8. 98.8 :3. $88 :3 98.8 8.8. 98.8 «8.8 98.8 << 5255...: “38958 989328 «2392 “a“afl n $585. NNVQMDNM I58 a :88»? $22? 888? 853533 awmaamwhmnu Emu-m- bwawwwva $3th hthNmSV 35»ng 3 5me NNHwamSV Hmwmamvw 323% :3ng whmthS 283:3 waoNSSH ohm 3:15.85 I 8 a . . . . m: mm . . . . a. a m u a final 78 ”22? E5: 8853. 88.8 $8.8 98.8 98.8 E98.8 . £38. M5305 8an 8:20.82 .8»: auzvI 8.2% 8.2:. . . . . fiasco 588.5: 9. 9. 8.33 080802 mom a»: 88 ~88 $8.8 $8.8 88.8 28¢ 88.8 .388 . m%% . bowSm can ofinflfi . . uranium momfiommnnbofifin ME . Svfim mmw . . . . . . . . . 88E fiasco 88.38% £33888 £35 . . $an “.548 ©2585 “mm 55863. . $8.8 98.8 E88 8.8 E88 . Awwuwv. £300 80:8» mmw 8on . . S .m 8 #3 @035 nnbofifin deb x “mtoaoo . . . . . . . . . uonov . $4 uranium 838282 088% m mmw H13. 82% D385 :35 mo 4% 95 85 . 20:35 “38:8 ”22? can 0383? mmsoinogm . consumawmm ”Houseman: 80:8 #2 “S? Eobomnom 2: @2588 $32528 323me 88308 2: 22? $8 88m? 8832: Mann—2m «38%? 388? ofi 8888:“ — n— magma n— £§En¥fiofi 080802 325053 mofigi .3 dam bwawwwva V 35»ng nounosaom SEA 532% mwmbnnn-fiofi moanomcfl “£2. was * i. *3. .355 “32330562 285% HSDI 7313 is 30 kb upstream ofHSDI 7B] 1, a member of the same gene , and both genes lie within a single large haplotype block in ans. We did not observe any association between coding or splice variants in HSDI 7B] 1 and transaminase levels in the discovery cohort (Fig. 5A and 5B; most cant discovery P-values 1.3 6x10'1 for ALT and 4.32x10'2 for AST) or in the joint meta-analysis of the discovery cohort and three replication cohorts (most significant P-values 6.25x10'3 and 1.17x10'5 for ALT and AST, respectively).

Furthermore, linkage disequilibrium of rs7261 3567 with variants in HSDI 7B] 1 was modest across all ancestry groups, including in European Americans that largely comprise our discovery group, and also in Hispanic and Afiican Americans represented in the Dallas Heart Study (r2 < 0.4 with all ascertained variants in HSDI 7B] 1 in all ancestry groups; data not shown). tively, these findings suggest HSDI 7313 as the gene in the genomic region that is most likely to be functionally related to transaminase levels.

Next, we sought to establish whether variants associated with ALT or AST levels were also associated with chronic liver disease. In the discovery , we used EHR diagnosis codes to broadly define cases of alcoholic and oholic (non-viral) liver disease, as well as the following disease sequelae: alcoholic cirrhosis, nonalcoholic cirrhosis, and hepatocellular carcinoma (HCC). A common control group (“no liver disease”) was defined as individuals with no diagnosis codes for any type of liver disease (Table 1). We tested the twelve transaminase- associated variants fiom the discovery and replication cohorts for association with chronic liver disease, using a Bonferroni significance threshold of P<0.05/24 (P<2.08x10'3) to account for the thirteen variants and two broad chronic liver disease categories olic and nonalcoholic) tested (Table 4). Overall, we found cant ations between six variants in five genes (HSDI 7BI3, SERPINAI , , , and SAMM50) and chronic liver disease phenotypes. The SERPINAI, TM6SF2, PNPLA3, and SAMM50 associations confirm previously reported associations. Variants in GPT, GOT], , and SLC39A12 were not significantly ated with any liver disease phenotype. The HSDI 7BI3 ation with liver disease reported here is novel and the first potentially protective genetic variant described. 033% usi=33amom No-mGw.v S-m5.~ Simmd SQHNE SEE Ho-mmv.N 5mm? Ho-m°v.N No-mwo.H wanna—am: No-mHmo.H ,: «ES—~23 maxi? #3....qu,, Xian—av: 5-93.5 Ho-me.m aired smfls No-mNa.m 5mm; wa-chd: manage: SAHARA: Slam—t: NTHSfi. 02820:: 9:33—55 ofiwfim .5»: mcuflfiméu. 8%.ng Hazard Siomd Nommva Ho-m°m.N Home? HTHHmét HTHN—lt vauflmmfiu. mausomme 52 3o 93 8.32 was £3..qu,, No-mww.N Siomd Sioed ado? 5&8. m ado: Siam; glaucét hcuflmcét éu. €35:me .m.3xwo.m 3.2.32 V 023-0805 032:., 3.- , No-mww.w 8%.»; 5&3. 5mg.» edema 20:35 .5»: m 0223 3.2.32 Zia: consumawmm we .tonoo Smm nousMoOmmax Gabe haNmeSNma awNmomHEma awawaahvfima £38? 388:? «5.3%? w 83w we mbma wovmwmbma thsbmma Eobomnom Eng/8&6 m ofi ~mk 3&6 REE 5&6 .v ~QM~.~ N~VQMDNM :96 :8 ~V>-m-m~m Swabs 3x593 3x593 emém magma Bash 2: E <HUHUNam ONO”: mofigi 8558 womboqonm «auuomuhmuMm—D H mewuv HuOuGSmhmvfiw Hambmvfiw OuOuowHthmvfiw OéJENVNwfiS OUHHOOwamthSUS 992328on Buoubvagwgu: ghmafia bwamwvuaa BuouombwamwquN OU<UNNwamvquN moanomcfl The alternate (TA) allele ofHSDI 7BI3 rs72613567 was observed at higher frequency in controls compared to participants with any of the chronic liver disease phenotypes evaluated (Fig. 2A and Table 5). After adjustment for age, age2, sex, BMI, and ry, we observed 38% lower odds of alcoholic liver disease (odds ratio [OR] 0.62; 95% confidence interval [CI] 0.48-0.81, P=1.8x10'4) and 16% lower odds of nonalcoholic (non-viral) liver disease (OR 0.84, 95% C10.78-0.91, P=1.3x10'5) per TA allele. When restricting to cases with sis, the TA allele was associated with 44% lower odds of alcoholic (OR 0.56, 95% CI 0.41 -0.78, P=3.4x10' 4) and 26% lower odds of nonalcoholic (OR 0.74, 95% -0.88, P=4.5x10'4) cirrhosis. The TA allele was nominally associated with 33% lower odds ofHCC per allele (OR 0.67, 95% CI 0.45-1.00, P=4.7x10'2). Unadjusted genotypic ORs suggested a co-dominant effect; for example, for alcoholic cirrhosis, the OR was 0.59 (95% C10.40-0.86) for heterozygous T/TA carriers and 0.26 (95% C10.08-0.82) for homozygous TA/TA carriers, and for nonalcoholic cirrhosis, the OR was 0.75 (95% C10.61-0.93) for heterozygous and 0.55 (95% C10.34-0.91) for homozygous carriers.

Thus in the ery cohort, the alternate (TA) allele ofHSDI 7BI3 3567 was associated with lower odds of all rived chronic liver e phenotypes evaluated, in a consistent allele dosage-dependent manner (Fig. 2A): all categories of alcoholic liver disease, heterozygous odds ratio (ORhet) [95% confidence interval] 0.58 [0.42-0.79], homozygous OR (ORhom) 0.46 [0.23-0.94], c OR(ORa11e1ic) 0.62 [0.48-0.81], P = 1.82x104; all categories of nonalcoholic liver disease, ORhet 0.84 [0.76-0.92], ORhom 0.73 [0.59-0.89], ORaneuc 0.84 [0.78-0.91], P = 1.31x10'5. The TA allele was also ated with lower odds of the most advanced forms of these chronic liver es (as defined by EHR-derived diagnostic codes), namely alcoholic and nonalcoholic cirrhosis and HCC. The TA allele was associated with 42% and 73% lower odds of alcoholic cirrhosis for heterozygotes and homozygotes, respectively (ORhet 0.59 [0.40-0.86], ORhom 0.26 [0.08-0.82], ORallelic 0.56 [0.41-0.78], P = 0'4), 26% and 49% lower odds of nonalcoholic cirrhosis for heterozygotes and homozygotes, respectively (ORhet 0.75 [0.61-0.93], ORhom 0.55 [0.34-0.91], ORaneuc 0.74 [0.62- 0.88], P = 4.48x10'4). The TA allele was also nominally associated with lower odds ofHCC.

Next, we sought to confirm and extend these findings in the multi-ethnic Dallas Liver Study (DLS) and the Dallas ric Liver Study (DPLS), including African American, an American, and Hispanic American adults and children (Table 1B). In the DLS, the WO 36758 TA allele was associated with lower odds of any liver disease in an allele-dosage dependent manner (ORhet0.74 [0.57-0.97], ORhom 0.41 [0.21-0.83], ORallelic 0.70 [0.5-0.88], P = 1.77x10'3, Fig. 8). Similar allele dosage-dependent effects were observed across EHR-derived liver disease subtypes, including tive associations with ed, cirrhotic forms of alcoholic (ORaneuc 0.72 [0.53-0.99], P = 4.37x10'2) and nonalcoholic nc 0.65 [0.40-1.07], P = 8.96x10'2) liver disease. In subset analyses of individuals grouped by self-reported ethnicity, the association with liver disease remained significant in Hispanic Americans, in particular, because of the high rate of liver disease in this subpopulation (n = 326 cases and 722 controls, c 0.51 0.74], P = 3.98x10‘4); similar numerical trends, which did not achieve statistical significance, were also noted in the Afiican an (11 = 33 cases and 2,291 controls, ORaneuc 0.74 [0.25-2.47], P = 0.67) and European American (11 = 158 cases and 1,266 controls, ORaneuc 0.87 [0.65-1.15], P = 0.32) subsets of the DLS. In the DPLS, a separate study of Hispanic an pediatric liver disease patients and obese controls (Table 1B), the TA allele was also associated with lower odds of liver disease (ORaneuc 0.59 [0.36-0.97], P = 3.6x10'2). Thus, the HSD17BI3 rs72613567:TA allele was associated with reduced odds of multiple forms of chronic liver disease, including sis, in adults and children in three independent populations.

] NAFLD describes a spectrum of disease ranging fiom fatty liver t ce of significant inflammation (designated as “simple steatosis” upon histopathological examination) to more clinically impactful manifestations (designated as “nonalcoholic steatohepatitis” , with histopathological evidence of lobular inflammation, hepatocyte ballooning, and/or fibrosis). To understand the relationship between the HSDI 7313 TA allele and histologically defined NAFLD and NASH, we performed tests of association of rs72613567 in 2,391 whole exome sequenced individuals with liver biopsy samples fiom the GHS bariatric surgery cohort.

Among these individuals, there were 555 (23%) with no evidence of steatosis, steatohepatitis, or fibrosis (“normal”), 830 (35%) with simple steatosis, and 1006 (42%) with NASH (i.e. evidence of lobular inflammation, cyte ballooning, or s). The HSDI 7313 TA allele was not significantly associated with simple steatosis (OR 1.11, 95% C10.94-1.32, P=0.21) or NASH (OR 0.86, 95% C10.72-1.02, P=0.09) compared to normal liver (Fig. 2B and Table 5). When comparing prevalence of normal liver, simple steatosis, and NASH by genotype, it was observed that the prevalence of normal liver did not appear to differ by genotype (23%, 24%, and 23% for T/T, T/TA, and TA/TA carriers, respectively, P = 0.5 by Chi-squared test for trend in proportions), but that the prevalence ofNASH decreased (45%, 40%, and 31% for T/T, TN“A, and TA/TA carriers, respectively, P = 1.6x10'4) and that of simple sis sed (33%, %, and 47% for T/T, TN“A, and TA/TA carriers, respectively, P = 1.1x10'3) with each TA allele (Fig. 9). Among individuals with steatosis, the TA allele was associated with statistically significantly lower odds ofNASH, as compared to simple steatosis, in an allele dosage- dependent manner. On the background of simple steatosis, the TA allele was associated with 23% lower odds ofNASH (OR 0.77, 95% CI 0.66-0.90, 10'4), suggesting a role for HSDI 7313 in mediating the progression ofNAFLD to more advanced stages ofNASH and fibrosis. Genotypic association results were consistent with a co-dominant effect; in the NASH vs. simple steatosis comparison, the OR was 0.84 (95% C10.69-1.02) for heterozygous TN“A carriers, and 0.48 (95% C10.34-0.68) for homozygous TA/TA carriers. 88888 was 3- 3- 3- 3- No- 8. mg. mfim. m: m. $3.. Me». mm. m v s-m:.~ H H v w 88% mEEQonoEoH-m mo am 223-8.. . . . . . . . . . . la 93 Ed . . . . . £3-89 83-8.8 8; 8 £8888: 0:28:50: so . . . . .

. . . . . N8 So as . . . . . 8 £3-83 33-8.8 033% . . . . .

. . . . . S5 88 3: 33 . . . . . e $38.8 £3-38 £881.. 5,: . . . . . . . 83. 8 F5. E? oEN 8 mm 8882 0:28:50: EE E? mg: EN am EE mam m 88% ”3 5 as, $3 88888 863%on 52— m« 085mm. we .55.:qu cZ 8388 $2 Mm: l‘ 68% F5. I.-DO In @0268 .tonoo EE 5< man HEB 53 was bowhsm EE .m 3m" 28? ntong 0:3st 2: .55...qu 23:82 03qu 098mm.

E *5: 23:82 macs-:6 uncaoufiaoz bug/08% 53— unmacwfirczmac6 «dinosaum «88650 28% mas—83m :53 2: .8885 uoqoa [ha/mask] uoqoa Klsfims 31112sz We next sought to understand how the HSDI 7313 TA allele affects expression of known and novel transcripts of the gene. We used RNA sequencing to assess HSDI 7BI3 mRNA expression in ogically normal liver samples from 22 homozygous reference (T/T), 30 heterozygous (T/TA), and 17 homozygous alternate ) carriers of the HSDI 7BI3 rs72613567 splice variant (Fig. 3). In on to the two known HSDI 7BI3 transcripts, A and B, two novel transcripts were identified: transcript C lacking exon 6, and transcript D characterized by the insertion of a G nucleotide at the 3 ’ end of exon 6, leading to premature protein truncation. Novel transcripts were validated by RT-PCR, and the D transcript was additionally validated by long read cDNA cing. The expression levels of these transcripts varied according to HSDI 7BI3 rs72613567 genotype; levels of transcripts A and B decreased, while those of transcripts C and D increased in an allele-dose-dependent manner in T/TA heterozygotes and TA/TA homozygotes (Fig. 3). Transcript A, encoding a 300 amino acid protein, was the predominant transcript in T/T in T/T homozygotes (Fig. 3A), while transcript D, encoding the urely truncated protein, was the predominant transcript in TA/TA gotes (Fig. 3D). These expression ns suggest a functional role for HSDI 7BI3 3567 in ining 13 isoform expression. Four additional transcripts (E-H) with very low levels of expression were also identified (Fig. 6A-6D). Protein ce alignment of all identified HSDI 7BI3 isoforms is shown in Fig. 7A-7B.

HSD17B13 has been previously described as a lipid-droplet associated n in human hepatocytes (Su et al. (2014) Proc Natl Acad Sci USA 437-11442, herein incorporated by reference in its entirety for all purposes). We evaluated protein isoform expression and localization in a perpetual human liver cell line (HepG2 hepatoma cells) stably transduced with irus expressing known and novel isoforms A-D ofHSD17B13.

HSD17B13 isoform A localized to lipid droplets in untreated and oleic acid-treated cells.

Isoform A was mainly detected on membranes surrounding BODIPY-labeled lipid droplets, and co-localized with the lipid droplet coat protein perilipin (PLIN). Similar subcellular localization was observed for HSD17B13 isoform D at the lipid droplet surface; however, lipid ts appeared larger following oleic acid treatment. In contrast, isoforms B and C co-localized with the endoplasmic reticulum marker calnexin.

In summary, using exome sequence data linked to EHR and liver biopsy data from 49,188 individuals from the DiscovEHR study population, and in follow-up studies of exome WO 36758 sequence data from 9,883 additional individuals with ALT and AST measurements, we ered a novel association between a splice t in HSDI 7BI3, transaminase levels, and chronic liver disease phenotypes. In our study, variant HSDI 7BI3 d the risk of nonalcoholic and alcoholic liver e, and cirrhosis. This, to our knowledge, is the first report of an exonic variant with a protective association with c liver disease phenotypes. The HSDI 7313 TA allele was not associated with simple steatosis, but reduced the risk of histopathologic steatohepatitis in individuals with steatosis, suggesting a role for HSDI 7313 in progression to more clinically advanced stages of chronic liver disease. The consistency of protective associations in four independent cohorts (GHS discovery, GHS bariatric, DLS, and DPLS) across several different liver disease categories, characterized using EHR sis codes as well as histopathological definitions of liver disease, together with the striking allele dosage- dependence of the associations, support the notion that the reported HSDI 7BI3 variant ts from progression to more clinically advanced stages of chronic liver disease. The observed allele dosage-dependence also argues that more profound regulation ofHSD17B13 function may result in more profound effects on disease risk and progression.

Other 17beta-hydroxysteroid dehydrogenase family members are known to be involved in sex steroid and fatty acid metabolism (Moeller and Adamski (2009) Mol Cell Endocrinol 301 :7-19, herein incorporated by reference in its ty for all purposes), but little is known about the function ofHSD17B13. HSDI 7313 is expressed primarily in the liver (Liu et al. (2007) Acta Biochim Pol 54:213-218, herein incorporated by reference in its entirety for all purposes), where it localizes to lipid droplets (Su et al. (2014) Proc Natl Acad Sci USA 111:11437-11442, herein incorporated by reference in its entirety for all purposes), consistent with a role for HSDI 7313 in the pathogenesis of fatty liver disease. Our data are tent with recent findings that HSDI 7BI3 overexpression increased lipogenesis in mouse liver, and increased the number and size of lipid droplets in cultured hepatocytes (Su et al. (2014) Proc Natl Acad Sci USA 111:11437-11442, herein incorporated by reference in its entirety for all purposes). Two previous studies have also shown that hepatic expression ofHSD17B13 protein is increased in ts with fatty liver (Su et al. (2014) Proc Natl Acad Sci USA 111:11437- 11442 and Kampf et al. (2014) FASEB J 28:2901 -2914, each of which is herein incorporated by reference in its entirety for all purposes). Two genes with variants that have been reported to be associated with increased risk of liver disease — PNPLA3 and TM6SF2 — also have physiological roles in hepatocyte lipid metabolism. The t in HSDI 7313 that we describe here is the first protective variant for liver disease, and may provide an avenue to new therapeutic strategies ing chronic liver disease, similar to genetic variants that have guided the way to new therapeutics in other domains.

Overall, our data support HSDI 7313 as a novel therapeutic target to reduce the risk of c liver e in humans. Importantly, our data indicate that ing ofHSDI 7313 could reduce progression from NAFLD to later stages ofNASH, fibrosis, and cirrhosis, which are associated with significant morbidity and mortality, and for which there are currently no effective treatments.

Methods Study Participants. Human genetics studies were conducted as part of the DiscovEHR oration of the Regeneron Genetics Center and the Geisinger Health System (GHS). The study was approved by the GHS Institutional Review Board. The two DiscovEHR study populations (discovery cohort and bariatric surgery cohort) originated fiom the first 50,726 consented participants 2 18 years of age from the MYCODE® Community Health Initiative of GHS (Dewey et al. (2016) Science 354(6319) doi:10.1126/science.aaf6814, herein incorporated by reference in its entirety for all purposes). The GHS discovery cohort consisted of 46,544 an individuals recruited from outpatient y care and specialty clinics between 2007 and 2016, excluding all those recruited to the bariatric surgery cohort. The GHS bariatric surgery cohort consisted of 2,644 European individuals who had been ed for bariatric surgery.

Replication studies included 1,357 European individuals fiom the Dallas Heart Study and 8,527 European individuals from the Penn Medicine Biobank. The Dallas Heart Study is a probability-based population cohort study of Dallas County residents aged 30 to 65 years (Victor et al. (2004) Am J Cardiol 93 : 1473-1480, herein incorporated by nce in its entirety for all purposes. The Penn Medicine Biobank includes participants recruited fiom the University of Pennsylvania Health System and ted for biospecimen storage, access to EHR data, and permission to recontact.

Replication studies of the ations with chronic liver disease included 517 individuals from the Dallas Liver Study (DLS) and 447 individuals from the Dallas Pediatric Liver Study . The DLS is a biobank ofpatients with liver disease of non-viral etiology.

WO 36758 Recruitment began in January 2015 and is ongoing. Participants were recruited from liver clinics at UT Southwestern and Parkland Health and Hospital System, Dallas. The biobank was approved by the UT Southwestern Institutional Review Board. Participants provided written informed consent. Participants completed a questionnaire on ethnic/racial background, medical y, lifestyle factors, and family history of liver disease and other diseases. Additional clinical information was extracted fiom medical records by a trained technician. We included all n American, European American, and Hispanic American patients with DNA ble at the time of the present study (n=517). The DPLS is a biobank of children recruited from pediatric liver clinics at UT Southwestern and Parkland Health and Hospital , Dallas, and from an obesity clinic at Children’s Medical , . The biobank was approved by the UT Southwestern Institutional Review Board. The legal guardians of the participants provided written informed consent. Clinical information was extracted from medical records by a trained technician. As more than 95% of the patients were Hispanic Americans, we only included Hispanic American patients and controls in the present study (n=203 patients and 244 controls).

] Sample ation and Sequencing. Sample preparation and whole exome sequencing were med at the Regeneron Genetics Center as previously bed (Dewey et al. (2016) e 354(6319) doi: 10.1 126/science.aaf6814, herein incorporated by reference in its entirety for all purposes). In brief, exome capture was performed using NimbleGen probes according to the cturer’s recommended protocol (Roche NimbleGen). The captured DNA was PCR amplified and fied by qRT-PCR (Kapa Biosystems). The multiplexed samples were sequenced using 75 bp paired-end sequencing on an Illumina v4 HiSeq 2500 to a coverage depth sufficient to provide greater than 20x haploid read depth of over 85% of targeted bases in 96% of samples (approximately 80x mean haploid read depth of targeted bases). Raw sequence data from each Illumina Hiseq 2500 run were uploaded to the DNAnexus platform (Reid et al. (2014) BMC Bioinformatics 15, 30 doi:10.1186/147115-30) for sequence read alignment and variant identification. In brief, raw ce data were converted from BCL files to sample-specific FASTQ-files, which were aligned to the human reference build GRCh37.p13 with BWA-mem (Li and Durbin (2009) ormatics 25: 1754-1760, herein incorporated by reference in its ty for all purposes). Single nucleotide variants (SNV) and insertion/deletion (indel) sequence variants were identified using the Genome Analysis Toolkit (McKenna et al. (2010) Genome Res 20: 1297-1 303, herein incorporated by reference in its entirety for all purposes).

Targeted Genotyping of rs72613567 in the Dallas Liver and Pediatric Liver Studies. HSDI 7BI3 rs72613567 was genotyped by TAQMAN® assay in the Dallas Liver Study and Dallas Pediatric Liver Study, and by exome sequencing in the Dallas Heart Study.

TAQMAN® calls were verified by Sanger sequencing of 5 individuals with each genotype.

Clinical Measurements and Chronic Liver Disease Definitions in the Discovery Cohort. al laboratory measurements for ALT and AST were extracted from EHRs of participants fiom the GHS discovery cohort and ric surgery . Median ALT and AST values were calculated for all participants with two or more measurements, and were log1o transformed to normalize the distribution prior to association analyses.

International Classification ofDiseases, Ninth Revision (ICD-9) disease codes were ted fiom EHRs and collapsed into clinical disease categories for non-viral, nonalcoholic (ICD-9 571.40, , 571.49, 571.5, 571.8, 571.9) or lic (ICD-9 571.0, 571.1, 571.2, 571.3) liver disease case definitions. Additional case definitions based on single diagnosis codes included: alcoholic cirrhosis (ICD-9 , oholic cirrhosis (ICD-9 571.5), and HCC (ICD-9 155.0). For these case definitions, a common control group without liver disease was defined as participants with no case ia or single-encounter or problem-list diagnosis code ting any type of liver disease.

Liver Histopathologic Phenotype Definitions in the Bariatric Surgery Cohort.

The GHS bariatric surgery cohort consisted of 2,644 individuals of European descent, with intra- operative liver biopsy specimens available fiom 2,391 of these individuals. Liver biopsy specimens were formalin-fixed and stained with hematoxylin and eosin for routine histology, and Masson’s trichrome stain for assessment of fibrosis, as previously described (Gerhard et al. (2011) Patient SafSurg 5, 1, doi:10.1186/17545-1, herein incorporated by reference in its entirety for all purposes). Histologic diagnoses were determined by hepatopathologists using previously established criteria (Brunt et al. (1999) Am J Gastroenterol 94:2467-2474, herein incorporated by nce in its entirety for all purposes). Histologic diagnoses were used to defined the following phenotypes: 1) Normal: no evidence of steatosis, NASH, or fibrosis; 2) Simple sis: Steatosis (regardless of grade) with no evidence ofNASH or fibrosis; 3) NASH/fibrosis: Any presence of lobular ation or cyte ballooning (regardless of , or any presence of fibrosis (regardless of stage); 4) Fibrosis: Any presence of fibrosis (regardless of stage).

Exome-Wide Association is of Liver Enzymes. In the GHS discovery cohort, we tested 502,219 biallelic variants with missing data rate < 1%, Hardy-Weinberg equilibrium p-value > '6, and minor allele ncy > 0.1% for association with transaminase levels. Loglo-transformed median ALT and AST were adjusted for age, age2, sex, BMI, and the first four principal ents of ancestry. To account for relatedness among study participants, we also fit a genetic relatedness matrix as a random-effects covariate. Both pal components and the genetic relatedness matrix were constructed fiom 39,858 non- MHC markers in approximate linkage equilibrium and with minor allele frequency > 0.1%. We used linear mixed models as implemented in the GCTA package (Yang et al. (201 1) Am JHum Genet 88:76-82, herein incorporated by references in its entirety for all purposes) to test for association n trait als and single nucleotide variants. The tests were well-calibrated, as shown by exome-wide quantile-quantile plots and genomic control lambda values (Fig. 1).

Replication Meta-Analysis of Liver Enzyme Associations. We attempted to replicate associations in the GHS discovery cohort in three separate European-ancestry cohorts: the GHS bariatric surgery cohort, the Dallas Heart Study, and the Penn ne Biobank (described above). ALT and AST measures in the GHS bariatric surgery cohort and from Penn Medicine Biobank were loglo-transformed and adjusted for age, age2, sex, BMI, and the first four principal components of ancestry. ALT and AST measures from the Penn Medicine Biobank samples were loglo-transformed and adjusted for age, age2, sex, BMI, and the first four principal ents of ancestry. Genetic relatedness matrices were included as random-effects covariates, and analysis was performed using linear mixed models in GCTA. In the Dallas Heart study, loglo-transformed ALT and AST measures were adjusted for age, age2, sex, and the first ten principal components of ancestry, and analysis was performed using linear regression implemented in PLINK. Summary statistics for the three replication cohorts were meta-analyzed using METAL (replication meta-analysis) (Willer et al. (2010) Bioinformatics 26:2190-2191, herein incorporated by reference in its ty for all purposes). Summary statistics for the discovery cohort and the three ation cohorts were meta-analyzed similarly (joint metaanalysis Association Analysis with Chronic Liver e Phenotypes. We analyzed nine significant and replicated single nucleotide variants fiom the liver enzyme ExWAS for associations with binary liver disease phenotypes defined fiom the GHS discovery cohort, as described above. We used a Bonferroni significance threshold of P<0.05/26 (P<1.92x10'3) to account for the thirteen variants and two broad chronic liver disease categories olic and nonalcoholic) tested. Variant HSDI 7313 was further tested for association with histopathologically defined liver phenotypes from the GHS bariatric surgery cohort, as described above. Odds ratios were estimated with the use of Firth’s penalized likelihood method of logistic sion after adjustment for age, agez, sex, BMI, and the first four principal components of ancestry. Unadjusted genotypic odds ratios were also ted for HSDI 7BI3 rs72613567.

Odds ratios for liver disease in the DLS were estimated by logistic regression, adjusted for age, agez, gender, BMI, and self-reported ethnicity. Participants from the Dallas Heart Study with available rs72613567 genotypes were used as normal controls (n=4,279). Odds ratios in the DPLS were estimated by logistic regression.

Software. c association analyses were med using GCTA software, version 1.25.0 (Yang et al. (201 1) Am JHum Genet 88:76-82, herein incorporated by reference in its entirety for all purposes), and PLINK, version 1.9.0. Quantile-quantile and Manhattan plots were generated using R software, version 3.2.1 (R Project for Statistical Computing).

Regional association plots were generated using oom (Pruim et al. (2010) Bioinformatics 6-2337, herein incorporated by reference in its entirety for all purposes).

RNA Sequencing Studies. RNA quality and concentration was ted by running total RNA on an Agilent RNA Nano Bioanalyzer chip; all samples had an RNA integrity number (RIN) greater than 8. Polyadenlylated RNA transcripts were isolated using two rounds of enrichment with oligo(dT)25 beads (Thermo Fisher Scientific). Samples were purified and concentrated with an XP beads (Beckman Coulter) and heat-fragmented to approximately 140 base pairs. First-strand synthesis was completed with SuperScript III reverse transcriptase (Thermo Fisher Scientific) using random hexamers; dTTP was replaced with dUTP during second-strand synthesis. Samples were processed according to our standard DNA y preparation method referenced above for exomes with the addition of a uracil DNA-glycosylase step to te strand-specific sequencing libraries. Samples were pooled and ced using 75 bp -end sequencing on an Illumina v4 HiSeq 2500.

Identification of Novel HSDI7313 Transcripts. Reads were mapped to the Human.B38 using ARRAYSTUDIO® software (OMICSOFT®, Cary, NC) allowing two mismatches. Two approaches were employed to identify novel HSDI 7BI3 transcripts. Novel exon junctions were discovered based on Gencode V24. De nova transcript assembly was run using Trinity (v2.2.0) in default setting. Custom gene models were built to incorporate novel transcripts ofHSDI 7313, and transcript quantification was estimated by read alignment to the custom gene model. Protein sequence alignment of all identified HSD17B13 isoforms is shown in Fig. 7A and 7B.

RT-PCR Validation of Novel Transcripts. RT-PCR on total RNA from human liver s was performed using the SUPERSCRIPTTM One-Step RT-PCR System with PlatinumTM Taq DNA Polymerase (Thermofisher). Each 50 uL RT-PCR reaction contained 1X Reaction Mix, 500 nM each forward and reverse primers (PST516: ATGAACATCATCCTAGAAATCCTTC (SEQ ID NO: 251) and PST517 : ATCATGCATACATCTCTGGCTGGAG (SEQ ID NO: 252)), 1 “L of RT/Platinum Taq, and 75 ng RNA. Cycling conditions were: one cycle of 45°C for 30 min; one cycle of 94°C for 2 min; 40 cycles of 94°C for 20 s, 53°C for 30 s, and 72°C for 90 5; one cycle of 72°C for 5 min; then a 10°C hold. Products were purified using the QIAquick PCR ation Kit (Qiagen) and submitted for direct Sanger sequencing using the primer DE002 (ATCAGAACTTCAGGCCTTGG (SEQ ID NO: 253)). To identify the B and C transcripts, the RT-PCR products were run out on a 2% agarose gel stained with SYBR GOLDSYBR® Gold Nucleic Acid Gel Stain (Thermofisher), and bands of the expected molecular weight were d and purified using the QIAquick Gel Extraction Kit (Qiagen), then subjected to g with the TOPO® TA Cloning Kit (Thermofisher). cing of the TOPO clones was med using, M13F and M13R sequencing primers. Sequence analysis was performed using the Sequencher DNA analysis software (Gene Codes Corporation).

PacBio Validation of Novel ripts. Full-length HSDI 7BI3 transcripts were amplified directly from 50ng of total RNA with the SuperScript III One-step RT-PCR System with Platinum Taq High Fidelity o Fisher Scientific) using pecific primers in the first (GCAAAGCCATGAACATCATCC (SEQ ID NO: 254) and last exons (TCTTGATGTAGTGGGAGTCGGATT (SEQ ID NO: 255)) to generate an amplicon of~2.2 kb (maximum predicted size transcript). Amplicons were d on an Agilent Bioanalyzer.

PacBio-compatible barcoded adapters were ligated to the amplicons and cleaned with PacBio PB beads (Pacific Biosciences). Libraries were pooled in equal amounts and ced on one SMRT cell for 180 min on the PacBio RSII platform. The data were demultiplexed using PacBio re smrtanalysis V2.3 tool labelzmw and then analyzed with ConsensusTools onAnalysis. ing amplicons were compared to HSDI 7BI3 RefSeq genes to determine isoform and genotype status.

Subcellular Localization of HSD17B13 Isoforms. HepG2 cells were cultured in Eagle's Minimum ial Medium supplemented with 10% fetal bovine serum. HSD17B13 Transcripts A, B, C, and D were sub-cloned into Myc-DDK backbone lentivirus constructs, and irus were generated. HepG2 cells were infected with lentivirus carrying the various HSD17B13 transcripts. Stable cell lines expressing each HSD17B13 transcript were selected with 1-3 mg/ml Geneticin G-418 sulfate in complete culture medium for two weeks. ed HepG2 cells were treated with or t 200 M oleic acid overnight then fixed. HSD17B13 ms were labeled with mouse anti-Myc antibody. Lipid droplets were labeled with BODIPY FL dye (Sigma). Lipid coat protein and endoplasmic reticulum were labeled with rabbit anti-PLIN antibody (Sigma) and rabbit anti-calnexin antibody (Cell Signaling Technology), respectively. Secondary antibodies for immunofluorescence were Alexa Fluor 488 donkey abbit IgG and Alexa Fluor 594 donkey anti-mouse IgG (Jackson ImmunoResearch).

Example 2. Effect of 3567:TA on HSD17B13 mRNA and HSD17B13 Protein Expression.

The effect of the HSD17B13 rs72613567:TA allele on expression ofknown and novel transcripts of the gene was ed. RNA sequencing was used to assess HSD17B13 mRNA expression in histologically normal liver samples from 22 T/T homozygous, 30 T/TA zygous, and 17 TA/TA homozygous carriers of the HSD17B13 rs72613567 splice variant.

In addition to the two known HSD17B13 transcripts, A and B, two novel transcripts were identified: Transcript C, which lacked exon 6, and Transcript D which contained an insertion of a guanine nucleotide at the 3 ’ end of exon 6, which would be predicted to result in premature truncation of the protein. The ripts were validated by RT-PCR and Sanger sequencing (data not shown). The D transcript was also validated using long read cDNA sequencing. The expression levels of these transcripts varied according to HSD17B13 rs72613567 genotype; levels of transcript A decreased, while the level of transcripts D increased in an allele dosage- dependent manner with each TA allele (see s 3A, 3D, and 10B). Transcript A, which encodes the full-length 300 amino acid protein, was the predominant transcript in T/T homozygotes, while transcript D, which encodes the prematurely truncated protein, was the predominant transcript in TA/TA homozygotes. In human liver biopsy tissue, the truncated isoform D protein was minimally present in heterozygotes and TA/TA homozygotes, and isoform A protein abundance was reduced in an allele dosage-dependent manner (see Figures 10B and 10C). These data are consistent with HSD17B13 rs72613567 altering mRNA splicing, resulting in the synthesis of a ted form of the protein with substantially reduced expression in human liver.

Referring to Figures 10A-10E, expression, subcellular localization, and enzymatic activity of a novel HSD17B13 transcript is shown. Expression ofHSD17B 1 3 transcripts A and D in homozygous reference (T/T), heterozygous (T/TA), and gous alternate (TA/TA) carriers of the HSD17B13 3567 splice variant is shown in Figures 3A and 3D. Coding regions in gene models are indicated in the striped boxes and untranslated regions in the black boxes. The asterisk in transcript D indicates the insertion ofG from rs72613567 at the 3’ end of exon 6, which leads to premature truncation of the protein. mRNA expression is yed in FPKM units ents Per Kilobase of transcript per n mapped reads). A Western blot from HepG2 cells pressing HSD17B13 transcripts A and D shows that HSD17B13 transcript D was translated to a truncated protein with lower molecular weight ed to HSD17B13 transcript A (see Figure 10A). Similar results were observed with an HSD17B13 western blot from fresh frozen human liver and HEK293 cell samples (see Figure 10B). Human liver samples were from homozygous reference (T/T), heterozygous (T/TA), and homozygous alternate (TA/TA) carriers of the 13 rs72613567 splice variant. Cell samples were from HEK293 cells overexpressing non-tagged 13 transcripts A and D. HSD17B13 Transcript D was translated to a truncated protein IsoD with lower molecular weight than HSD17B13 IsoA. HSD17B13 IsoD n levels were lower than IsoA protein levels from both human liver (left) and cell (right) samples (see Figure 10C). Protein level ized to actin is shown in the bar columns in Figure 10C; ** P<0.001, *P<0.05. Both HSD17B13 Isoforms A and D were localized on lipid droplet membrane in HepG2 stably overexpressing 13 ripts A or D were labelled with BODIPY to show lipid droplets and anti-Myc to show HSD17B13 localization (data not shown). tic activity ofHSD17B13 isoforms A and D to 17-beta estradiol (estradiol), leukotriene B4 (LTB4), and 13-Hydroxyoctadecadienoic acid (13(S)—HODE) was also assessed (see Figure 10D). HSD17B13 Isoform D showed <10% enzymatic activity of the corresponding values for Isoform A. HSD17B13 Isoform D when overexpressed in HEK293 cells did not show much conversion of estradiol (substrate) to estrone (product) when ed in the culture media, while pressed HSD17B13 Isoform A showed robust conversion (see Figure 10E). 13 is expressed primarily in the liver (Liu et al., Acta Biochim. Pol., 2007, 54, 213-8, herein incorporated by nce in its entirety for all purposes), where it localizes to lipid droplets (Su et al., Proc. Natl. Acad. Sci. USA, 2014, 111, 11437-42, herein incorporated by reference in its entirety for all purposes), consistent with a role in the pathogenesis of fatty liver disease. The expression ofHSD17 1B3 and its localization was evaluated in an immortalized human liver cell line stably transduced with lentivirus expressing HSD17B13 Transcripts A and D. HSD17B13 Isoform A was mainly detected on membranes surrounding BODIPY-labeled lipid droplets (data not shown). Similar lular localization was ed for HSD17B13 Isoform D at the lipid droplet surface (see Figure 10D).

To understand the functional consequences of premature truncation ofHSD17B13 n due to rs72613567zTA, the tic activity of Isoforms A and D was evaluated in vitro using recombinant protein. Greater than 300 putative substrates were examined, of which estradiol, leukotriene B4, and 13-Hydroxyoctadecadienoic acid were enzymatically converted by HSD17B13, resulting in oxidation of a hydroxyl to a ketone group. 13 Isoform D showed greatly reduced activity towards the three ates (see Figure 10D).

Compared to GFP control, HSD17B13-Transcript-A-overexpressing cells had lower concentration of estradiol as well as higher concentration of estrone in the cell culture medium, suggesting enzyme activity against estradiol (see Figure 10E). HSD17B13-Transcript-D- overexpressing cells had similar ratio of e/estradiol to GFP control cells, suggesting that HSD17B13 Transcript D has significant loss of on. The mass spectrometry analysis revealed rapid conversion of e into hydroxyestrone and other products accounting for the low accumulation of estrone compared to consumed estradiol.

Through large-scale exome sequencing, a novel association was identified between a splice variant in HSD17B13 and decreased serum minase levels, as well as reduced risk of oholic and alcoholic forms of liver disease, including advanced tic forms of liver disease and HCC. To our knowledge, this is the first report of a protein-altering variant that has a protective association with liver disease. The HSD17B13 rs72613567:TA allele was not associated with simple steatosis, but reduced the risk ofprogression to NASH. The consistency of the dosage-dependent protective associations in four independent cohorts (DiscovEHR, an independent bariatric surgery cohort in EHR, DLS, and DPLS) across several different liver e categories and ities support the notion that the reported HSD17B13 variant protects from ssion to more clinically advanced stages of chronic liver e. The ed allele dosage-dependence also argues that more profound regulation ofHSD17B13 function may result in more profound effects on disease risk and progression.

The association findings described herein were primarily based on observations in European and Hispanic Americans who have elevated BMI. HSD17B13 is in close proximity with HSD17B11, a member ofthe same gene family with high sequence similarity to HSD17B13 but broader tissue distribution. Overall, the data presented herein support the position that HSD17B13 is a potential therapeutic target for prevention and ent of fatty liver disease in humans. The data presented herein te that targeting ofHSD17B13 could reduce progression of liver disease from sis to later stages ofNASH, fibrosis, and sis, which are associated with significant morbidity and mortality, and for which there are currently no effective treatments.

Example 3. Variant 17Beta-Hydroxysteroid Dehydrogenase 13 Protects Against Chronic Liver Disease.

To identify genetic factors contributing to chronic liver disease, we utilized exome sequence data and electronic health records from 46,544 participants in the DiscovEHR human genetics study. We identified genetic variants associated with established biomarkers of hepatic injury (serum e aminotransferase (ALT) and aspartate aminotransferase (AST)) to nominate candidates that might be associated with chronic liver disease. Candidate ts replicating in three additional cohorts (12,527 individuals) were subsequently evaluated for association with clinical diagnoses of chronic liver disease in EHR and two independent cohorts (total of 37,892 individuals). We also examined the association with histopathological severity of liver disease in an independent bariatric y cohort (n=2,391 human liver samples).

A splice variant (rs72613567:TA) in HSD17B13, encoding the hepatic lipid droplet protein 17-beta ysteroid dehydrogenase 13, was reproducibly associated with reduced ALT x10'12) and AST (P=6.2x10'1°) levels. In DiscovEHR, this variant was associated with reduced risk of alcoholic and nonalcoholic liver disease (by 38%, 95% confidence interval (CI) 19%-52%; and by 16%, 95% CI 9%-22%, respectively, for each rs72613567:TA allele) and cirrhosis (by 44%, 95% CI 22-59%; and by 26%, 95% CI % for alcoholic and nonalcoholic cirrhosis, respectively, for each rs72613567:TA allele) in an allele - dependent manner; associations were ed in two independent cohorts. rs72613567:TA was associated with decreased severity of histological features of nonalcoholic steatohepatitis (NASH) (23% reduction, 95% CI 10%-34% for each 3567:TA allele among individuals with fatty liver disease). rs72613567:TA s in an le and truncated protein with reduced enzymatic activity against steroid substrates.

A loss-of-function variant in HSD17B13 was associated with reduced risk of alcoholic and oholic liver disease, and progression fiom steatosis to NASH.

Study Design and Participants Human genetics studies were conducted as part of the DiscovEHR collaboration of the Regeneron Genetics Center and Geisinger Health System (GHS). The two DiscovEHR study populations (discovery cohort and bariatric surgery cohort) originated fiom the first 50,726 consented participants 2 18 years of age from the MyCode® Community Health Initiative of GHS. The GHS discovery cohort consisted of 46,544 European individuals ted from outpatient primary care and specialty clinics between 2007 and 2016, excluding all those recruited to the bariatric surgery cohort. The GHS ric surgery cohort ted of 2,644 European individuals who had been referred for bariatric surgery.

Replication studies of associations with liver transaminases included 1,357 European duals from the Dallas Heart Study and 8,527 an individuals fiom the Penn Medicine Biobank. The Dallas Heart Study is a probability-based population cohort study of Dallas County residents aged 30 to 65 years (Victor et al., Am. J. l., 2004; 93, 1473-80, herein incorporated by reference in its entirety for all purposes). The Penn Medicine Biobank includes participants recruited fiom the University of Pennsylvania Health System and consented for biospecimen storage, access to EHR data, and permission to recontact.

Replication s of the associations with chronic liver disease included 517 individuals from the Dallas Liver Study (DLS) and 447 individuals from the Dallas ric Liver Study (DPLS). The DLS is a biobank ofpatients with liver disease of non-viral etiology.

Recruitment began in January 2015 and is ongoing. Participants were recruited from liver clinics at UT Southwestern and Parkland Health and Hospital System, . Participants completed a questionnaire on ethnic/racial background, medical history, lifestyle factors, and family history of liver disease and other diseases. Additional clinical information was extracted from medical records by a trained technician. We included all African American, European American, and Hispanic an patients with DNA available at the time of the present study (n=517) with controls from the Dallas Heart Study. The DPLS is a biobank of Hispanic children recruited from pediatric liver clinics at UT estern and Parkland Health and Hospital , , and from an obesity clinic at Children’s Medical Center, Dallas. Clinical information was extracted from medical records by a trained technician. As more than 95% of the ts were Hispanic Americans, we only included Hispanic American patients and ls in the present study (n=205 patients and 234 controls).

Clinical Measurements and c Liver Disease Definitions in the Discovery Cohort Clinical laboratory measurements for ALT and AST were extracted from EHRs of participants from the GHS discovery cohort and ric surgery cohort. Median ALT and AST values were ated for all participants with two or more measurements, and were log1o- transformed to normalize the distribution prior to association es.

International Classification of Diseases, Ninth Revision (ICD-9) disease diagnosis codes were extracted from EHRs and collapsed into clinical disease categories for non-viral, nonalcoholic (ICD-9 571.40, 571.41, , 571.5, 571.8, 571.9) or alcoholic (ICD-9 571.0, 571.1, 571.2, 571.3) liver disease case definitions. Additional case definitions based on single diagnosis codes ed: alcoholic cirrhosis (ICD-9 571.2), nonalcoholic cirrhosis (ICD-9 571.5), and HCC (ICD-9 155.0). For these case definitions, a common control group without liver disease (“no liver disease”) was defined as participants with no case criteria or single- ter or problem-list diagnosis code indicating any type of liver disease.

WO 36758 Liver Histopathologic ype Definitions in the Bariatric Surgery Cohort The GHS bariatric surgery cohort consisted of 2,644 individuals of European descent.

Wedge biopsies of the liver were obtained intraoperatively during bariatric surgery from 2,391 of these individuals. The biopsies were tently obtained 10 cm to the left of falciform ligament prior to any liver retraction or surgery on the stomach. The biopsy was divided into sections, with the primary section delivered to the clinical pathologists for liver histology (fixed in 10% neutral buffered formalin and stained with hematoxylin and eosin for routine histology and Masson’s trichrome for assessment of fibrosis) and remaining sections stored within a research k (frozen in RNAlater and/or liquid nitrogen). Liver histology was conducted by an experienced pathologist and subsequently re-reviewed by a second experienced ogist using the NASH Clinical Research Network scoring system er et al., Hepatology, 2005, 41, 1313-21, herein incorporated by reference in its entirety for all purposes) as follows: steatosis grade 0 (<5% parenchymal involvement), 1 (5 to <33 %), 2 (34 to <66 %), and 3 (>67 %); lobular inflammation grade 0 (no foci), grade 1 (mild, <2 foci per 200X field), grade 2 (moderate, 2-4 foci per 200X field), grade 3 (severe, >4 foci per 200X field); fibrosis Stage 0 (none), Stage 1 (perisinusoidal or periportal fibrosis), Stage 2 (perisinusoidal and periportal fibrosis), Stage 3 (bridging fibrosis), and Stage 4 osis). These histologic diagnoses were used to defined the following ypes: 1) Normal: no ce of steatosis, NASH, or fibrosis; 2) Simple steatosis: Steatosis (regardless of grade) with no evidence ofNASH or s; 3) NASH: Any presence of lobular inflammation or hepatocyte ballooning (regardless of grade), or any presence of fibrosis (regardless of stage); 4) Fibrosis: Any presence of fibrosis (regardless of stage).

Sample Preparation, Sequencing, and Genotyping DNA sample ation and whole exome sequencing for the ipants in the DiscovEHR study, the Dallas Heart Study, and the Penn Medicine Biobank were performed at the Regeneron cs (Dewey et al., Science In Press, 2016, herein incorporated by reference in its entirety for all purposes). 13 rs72613567 was genotyped by Taqman assay (and verified by Sanger sequencing in 5 individuals of each genotype) in the Dallas Liver Study and Dallas Pediatric Liver Study.

In particular, exome capture was performed using NimbleGen probes according to the manufacturer’s recommended protocol (Roche NimbleGen). The captured DNA was PCR ed and quantified by qRT-PCR (Kapa Biosystems). The multiplexed samples were sequenced using 75 bp paired-end sequencing on an Illumina V4 HiSeq 2500 to a ge depth sufficient to provide greater than 20x haploid read depth of over 85% of targeted bases in 96% of samples (approximately 80x mean haploid read depth of targeted bases). Raw sequence data from each Illumina Hiseq 2500 run were uploaded to the DNAnexus platform (Reid et al., BMC Bioinformatics, 2014, 15, 30, herein incorporated by reference in its ty for all purposes) for sequence read alignment and variant identification. In brief, raw sequence data were ted from BCL files to sample-specific FASTQ-files, which were aligned to the human reference build .p13 with BWA-mem (Li et al., Bioinformatics, 2009, 25, 1754-60, herein orated by reference in its entirety for all purposes). Single nucleotide ts (SNV) and insertion/deletion (indel) ce variants were identified using the Genome Analysis Toolkit (McKenna et al., Genome Res., 2010, 20, 1297-303, herein incorporated by reference in its entirety for all purposes).

Exome-Wide Association Analysis r Enzymes and Chronic Liver Disease ypes We used linear mixed models to test 502,219 biallelic variants that had missing data rate of < 1%, Hardy-Weinberg equilibrium P-value > 1.0x10'6, and minor allele fiequency > 0.1% for association with transaminase levels. For variants with exome wide significant associations with transaminases 0'7) in the GHS ery cohort, we performed association analyses and meta-analysis, in the European-ancestry replication studies bed above. We used a Bonferroni significance threshold ined by the number of variants tested to define replicated associations. Meta-analysis of discovery and replication studies was also med. All P-values reported in the text correspond to the allelic model.

We subsequently tested transaminase-associated single nucleotide variants for associations with chronic liver disease phenotypes. We used a Bonferroni significance threshold determined by the number of variants and broad chronic liver disease categories tested to ine significance of associations. We further tested replicated novel variants for association with histopathologically defined liver phenotypes fiom the GHS bariatric surgery cohort. We also performed a phenome-wide study of associations of replicated novel variants with 405 quantitative clinical measurements and 3,168 clinical diagnoses.

In particular, we tested 502,219 lic ts with missing data rate < 1%, Hardy- Weinberg equilibrium P-value > 1.0x10'6, and minor allele frequency > 0.1% for association with transaminase levels. Loglo-transformed median ALT and AST were adjusted for age, age2, sex, BMI, and the first four principal components of ancestry. To account for relatedness among study participants, we also fit a genetic relatedness matrix as a random-effects covariate. Both principal components and the genetic relatedness matrix were constructed from 39,858 non- MHC s in approximate linkage equilibrium and with minor allele fiequency > 0.1%. We used linear mixed models as implemented in the GCTA package (Yang et al., Am. J. Hum.

Genet, 2011, 88, 76-82, herein incorporated by reference in its entirety for all purposes) to test for association between trait residuals and single nucleotide variants. All P-values reported in the text correspond to the allelic model.

We attempted to replicate associations in the GHS discovery cohort in three te European-ancestry cohorts: the GHS bariatric surgery cohort, the Dallas Heart Study, and the Penn Medicine Biobank (described . ALT and AST measures from the GHS bariatric y cohort and from Penn Medicine Biobank were loglo-transformed and adjusted for age, age2, sex, BMI, and the first four principal components of ry. Genetic relatedness matrices were included as random-effects covariates, and analysis was performed using linear mixed models in GCTA. In the Dallas Heart study, loglo-transformed ALT and AST measures were adjusted for age, age2, sex, BMI, and the first ten principal components of ancestry, and analysis was med using linear regression implemented in PLINK. Summary statistics for the three replication cohorts were meta-analyzed using METAL (Willer et al., Bioinformatics, 2010, 26, 2190-1, herein incorporated by reference in its entirety for all purposes) (replication meta- analysis). Summary statistics for the discovery cohort and the three ation cohorts were nalyzed similarly (joint meta-analysis). ation Analysis with Chronic Liver Disease Phenotypes We analyzed thirteen significant and replicated single nucleotide variants from the liver enzyme ExWAS for associations with chronic liver disease phenotypes defined from the GHS discovery cohort, as described above. We used a Bonferroni cance threshold of P<0.05/26 (P<1.92x10'3) to account for the thirteen variants and two broad chronic liver disease categories olic and nonalcoholic) tested. The 13 3567 variant was further tested for association with histopathologically defined liver ypes from the GHS bariatric surgery cohort, as described above. Odds ratios were estimated with the use of Firth’s penalized likelihood method of logistic regression after adjustment for age, age2, sex, BMI, and the first four pal components of ancestry. Genotypic odds ratios were estimated for HSD17B13 rs72613567 using the same covariates.

Odds ratios for liver disease in the DLS were estimated by ic regression, adjusted for age, age2, sex, body mass index, and self-reported ethnicity. Participants from the Dallas Heart Study with available 3567 genotypes were used as normal controls (n=4,279). Odds ratios in the DPLS were estimated by logistic regression.

Phenome-Wide Association Study ofHSDI7313 rs72613567 We performed a phenome-wide study of ations ofHSD17B13 rs72613567 with 405 quantitative EHR-derived anthropometric, vital sign, laboratory, electrocardiographic, echocardiographic, and bone densitometry ements, and also with 3,168 EHR-derived clinical diagnoses. Median laboratory values for individuals with serial outpatient measures were calculated following removal of likely spurious values that were > 3 standard deviations from the intra-individual median value; maximum and minimum values were also calculated. We then calculated trait residuals for all laboratory traits after adjustment for age, age2, sex, and the first ten principal components of ancestry, and applied appropriate ormations prior to association analysis. ICD-9 based diagnosis codes were collapsed to hierarchical clinical disease groups and corresponding controls using a modified version of the groupings proposed by Denny et al (Denny et al., Nature Biotechnology, 2013, 31, 1102-10 and Denny et al., Bioinformatics, 2010, 26, 1205-10, each of which is herein incorporated by reference in its entirety for all purposes). ICD-9 based ses required one or more of the following: a problem list entry of the diagnosis code or an encounter diagnosis code d for two separate clinical encounters on separate calendar days.

Analyses of ation with transformed quantitative clinical measurement als were performed using linear regression, and analyses of association with al diagnoses were performed using logistic regression adjusted for age, age2, sex, and the first four principal components. s were coded using both additive (0 for reference allele homozygotes, 1 for heterozygotes, and 2 for alternative allele homozygotes) and recessive (0 for reference allele homozygotes and heterozygotes, 1 for ative allele homozygotes) models.

Software Genetic association analyses were performed using GCTA software, version 1.25.07 and PLINK, version 1.9.0. Quantile-quantile and tan plots were generated using R software, version 3.2.1 (R t for tical ing). al association plots were generated using LocusZoom (Pruim et al., Bioinformatics, 2010, 26, 2336-7, herein incorporated by reference in its entirety for all purposes).

RNA Sequencing Studies RNA quality and tration was evaluated by running total RNA on an Agilent RNA Nano Bioanalyzer chip; all samples had an RNA integrity number (RIN) greater than 8.

Polyadenlylated RNA transcripts were isolated using two rounds of enrichment with oligo(dT)25 beads (Thermo Fisher ific). Samples were purified and concentrated with RNAclean XP beads (Beckman Coulter) and heat-fragmented to approximately 140 base pairs. First-strand synthesis was completed with SuperScript III reverse transcriptase (Thermo Fisher Scientific) using random hexamers; dTTP was replaced with dUTP during second-strand synthesis. Samples were processed according to our standard DNA library preparation method referenced above for exomes with the addition of a uracil DNA-glycosylase step to generate strand-specific sequencing libraries.

Identification and Validation ofNovel HSDI7B]3 Transcripts Reads were mapped to the Human.B38 using ArrayStudio® software (OmicSoft®, Cary, NC) allowing two mismatches. Two approaches were employed to identify novel HSD17B13 transcripts. Novel exon junctions were discovered based on Gencode v24 using ArrayStudio. De nova transcript assembly was carried out using Trinity 0) in default setting. Custom gene models were built to orate novel transcripts of HSD17B13, and ript quantification was estimated by read alignment to the custom gene model. Protein ce alignment of all identified HSD17B13 isoforms is shown in Figures 7A and 7B. RT- PCR was performed on total RNA from human liver samples was performed using the SuperScriptTM One-Step RT-PCR System with PlatinumTM Taq DNA Polymerase (Thermo Fisher). Each 50 “L RT-PCR reaction contained 1X Reaction Mix, 500 nM each forward and reverse primers (PST516: ATGAACATCATCCTAGAAATCCTTC (SEQ ID NO: 251) and PST517: ATCATGCATACATCTCTGGCTGGAG (SEQ ID NO: 252)), 1 “L of RT/Platinum Taq, and 75 ng RNA. Cycling conditions were: one cycle of 45°C for 30 minutes; one cycle of 94°C for 2 minutes; 40 cycles of 94°C for 20 seconds, 53°C for 30 seconds, and 72°C for 90 seconds; one cycle of 72°C for 5 minutes; then a 10°C hold. Products were d using the QIAquick PCR Purification Kit (Qiagen) and submitted for direct Sanger sequencing using the primer DE002 (ATCAGAACTTCAGGCCTTGG (SEQ ID NO: 253)). To identify the B and C transcripts, the RT-PCR products were run out on a 2% agarose gel stained with SYBR GoldSYBR® Gold c Acid Gel Stain (ThermoFisher), and bands of the expected lar weight were excised and purified using the QIAquick Gel Extraction Kit (Qiagen), then subjected to cloning with the TOPO® TA Cloning Kit (ThermoFisher). Sequencing of the TOPO clones was med using M13F and M13R sequencing primers. Sequence analysis was performed using the Sequencher DNA analysis software (Gene Codes Corporation).

Full-length HSD17B13 ripts were amplified directly fiom 50 ng of total RNA with the SuperScript III One-step RT-PCR System with Platinum Taq High Fidelity (ThermoFisher Scientific) using gene-specific primers in the first (GCAAAGCCATGAACATCATCC (SEQ ID NO: 254)) and last exons (TCTTGATGTAGTGGGAGTCGGATT (SEQ ID NO: 255)) to generate an amplicon of about 2.2 kb (maximum predicted size transcript). Amplicons were d on an Agilent Bioanalyzer. PacBio-compatible barcoded adapters were ligated to the amplicons and cleaned with PacBio PB beads (Pacific ences). ies were pooled in equal amounts and ced on one SMRT cell for 180 minutes on the PacBio RSII platform.

The data was demultiplexed using PacBio software smrtanalysis V2.3 tool labelzmw and then analyzed with ConsensusTools AmpliconAnalysis. Resulting amplicons were compared to HSD17B13 RefSeq genes to determine isoform and genotype status.

Subcellular Localization ofHSDI7313 Isoforms ] HepG2 cells were cultured in Eagle's Minimum Essential Medium supplemented with % fetal bovine serum. HSD17B13 transcripts A and D were sub-cloned into Myc-DDK ne lentivirus constructs, and lentivirus were generated. HepG2 cells were infected with lentivirus carrying the HSD17B13 transcripts. Stable cell lines expressing each HSD17B13 transcript were selected with 1-3 mg/ml Geneticin G-418 sulfate in complete culture medium for two weeks. Following fixation, HSD17B13 isoforms were detected with mouse anti-Myc dy. Lipid droplets were labeled with BODIPY FL dye (Sigma). Secondary dies for immunofluorescence were Alexa Fluor 488 donkey anti-rabbit IgG and Alexa Fluor 594 donkey ouse IgG (Jackson ImmunoResearch).

Quantification ofHSDI7133 Protein Expression in Human Liver Biopsy Tissue and Stable Cell Lines Human liver and cell pellet samples were homogenized in ld 1x RIPA lysis buffer (EMD Millipore) in the presence ofprotease and phosphatase inhibitor mixtures (ThermoFisher). Supernatant was collected and used for protein concentration using BCA protein assay (ThermoFisher). Human tissue and cell lysates were loaded and separated on SDS/PAGE gels (Bio-Rad) and transferred to PVDF membranes (Bio-Rad). The membranes were d for 1 hour with 5% (wt/vol) milk in 1x TBS mented with 0.1% Tween20 (Bio-Rad). Membranes were ted with antibody at 4°C overnight t HSD17B13 (1:200, Thermo-Fisher) and B-Actin (1:500, Cell Signaling Technology). Bound antibody was detected using HRP-conjugated anti-rabbit antibody (1 : 10,000, Jackson ImmunoResearch) and enhanced using chemi-luminescence reagent (ThermoFisher). Band intensities were quantified using Image J software.

Real-Time uantitative PCR RNA was extracted from cell using TRIzol® (Invitrogen, Carlsbad, CA). strand cDNA was synthesized using Superscript 111 RT (Invitrogen) and utilized for Semi-Quantitative PCR based on intron-spanning primers. A QuantStudio 6 Flex Real-Time PCR System was used to measure the expression level of transcripts. Primers 7B13 and TBP were ordered from HDT (Integrated DNA Technologies). Relative gene expression was analyzed with the AACt method, providing a fold-change of expression ized to the house-keeping gene TBP (ACt).

Lipid Droplet Isolation and Characterization by Western Blotting ] Lipid droplets were prepared from HepG2 cells stably expressing HSD17B13 transcript A (IsoA) or transcript D (IsoD) as previously reported (Brasaemle DL, Wolins NE. ion of lipid droplets from cells by density gradient centrifugation, Current ols in cell biology 2006; Chapter 3:Unit 3 15 and Ding et al., Nature Protocols, 2013, 8, 43-51, each of which is herein incorporated by nce in its entirety for all purposes). In brief, HepG2 cells stably expressing HSD17B13 IsoA, IsoD, or the parental line were incubated overnight with 1 mM oleic acid. The following lipid loading, cells were scraped and resuspended in hypotonic lysis buffer (20 mM Tris, pH 7.5, 1 mM EDTA) supplemented with 1X HaltTM protease/phosphatase inhibitors o) and lysed by cavitation at 50 bar for 8 minutes.

Lysates were centrifuged at 1000g/4°C for 10 minutes, and the post-nuclear supernatant (PNS) was mixed with sucrose to a final volume of 2 mL and concentration of 20% in ultracentrifuge tubes. Then 1.5 mL of 5% sucrose and another 1.5 mL of hypotonic lysis buffer was layered on top of the lysate. Tubes were centrifuged at 182,000g/4°C for 40 minutes, and the lipid droplet (LD) layers were transferred to new tubes. The remaining volume in the tube was aspirated, and the pelleted (total membrane, TM) was resuspended in 0.5 mL nic lysis buffer. The PNS, LD, and TM fractions were mixed with 1x radioimmunoprecipitation (RIPA) buffer (EMD) + TM LDS Sample Buffer (Thermo) and B-mercaptoethanol and sonicated for 3 hours at 37°C. The TM lysate was diluted 25-fold to normalize to the PNS. Lysates were run on 4-20% SDS-PAGE gels (Biorad), transferred using the Trans-Blot (Biorad) onto low fluorescence PVDF membranes, and blocked for 1 hour in Odyssey TBS ng Buffer. nes were incubated overnight with the following antibodies: a-HSD17B13 (Abgent, cat # AP5729a 1:500); LD : a-ADRP (Proteintech, 1521-AP, 1:2500); LD marker: a-TIP47 (Proteintech, 10694 12000); lysosome marker: a-LAMPl (Novus, NBP2-25183, 1:1000); cytosolic marker: a-GAPDH (Proteintech, 60004Ig, 1:2000); endoplasmic reticulum marker: a-calreticulin (Abcam, ab92516, 1:1000); mitochondrial marker: a-COX IV (Abcam, ab33985, 1:500); cytoskeleton marker: a-actin , A5441, 1:4000). The next day membranes were washed 4 times with Tris-buffered saline + 0.1% Tween, then incubated for 1 hour at room temperature with blocking buffer containing IRDye® it ) and e ) secondary antibodies (Li-Cor) at 1:5,000 and 1:10,000 dilutions, respectively. Gels were washed again with TBST and imaged using the Odyssey.

Quantification ofIntracellular Triglyceride Content ] The triglyceride (TG) content from the stable cells was ined using a TG quantification kit (Abcam). In the assay, TG are converted to free fatty acids and ol. The glycerol is then oxidized to generate a t which is quantified (spectrophotometry at 2t= 570 Substrate Screening ofSteroid and Bioactive Lipid Libraries Against Purified Recombinant HSDI7313 Reactions were med in a final volume of 40 uL of assay buffer (0.2 M Tris- HCl, pH 7.5) which contained 500 “M NAD+, 5 uM bioactive lipid or 50 [AM steroid (all in a final concentration of 5% DMSO), and 100 ng recombinant human HSD17B13. Reactions were incubated for 3 hours, at 23°C, after which an equal volume NADH-G10 Detection Reagent ga) was added. Following a 1 hour incubation at 23°C, the relative light units (RLUs) were measured on an Envision Plate Reader (Perkin Elmer). Raw RLU values were normalized as percent of control (50 14M estradiol) following subtraction of negative control (5% DMSO) using the following formula: Percent of control (POC) = 100 x (Sample (RLU) — Negative CTRLaverage) / (Positive CTRLaverage — Negative CTRLaverage).

In Vitro and Cellular Characterization ofHSDI7313 Enzymatic Activity Recombinant human HSD17B13 n was d from E. coli (Genscript) transformed with plasmid DNA harboring HSD17B13 transcript A or transcript D. The HSD17B13 variants contained a 10xHis tag at the C us and were purified fiom soluble fraction using a Ni2+ affinity ation. Enzymatic activity was determined through measurement ofNADH production using the NAD(P)H-Glo Detection System (Promega). ons were performed for 3 hours at 25°C in 0.2 M Tris-HCl, pH 7.5, 0.5mM NAD+, 75 “M of substrate (Sigma) and 500 ng purified enzyme in a final volume of 100 “L. After incubation, “L of the reaction was combined with 20 “L luciferase reagent (Promega), incubated at room temperature for 1 hour and read on an Envision Plate Reader (Perkin Elmer).

HEK293 cells overexpressing HSD17B13 transcript A, transcript D or green fluorescent protein (GFP, control) were used to igate the activity ofHSD17B13 against estradiol in a cell-based assay. Estradiol (1 uM) was fed to each cell type. After 48 hours, the WO 36758 media was collected and the concentration of estradiol and its ted product estrone were identified and quantified by LC-MS.

Association ofExonic Variants with Aspartate and Alanine Aminotransferases We tested 502,219 biallelic single genetic variants for association with serum ALT or AST levels in 46,544 individuals of an descent from the DiscovEHR study (“GHS discovery cohort”; basic demographics in Table 6). A total of 35 variants in 19 genes were found to be associated with ALT or AST at P<1.0x10'7 (Figures 1A and 1B, and Table 7). We performed replication studies in three s of European-ancestry individuals: 1) bariatric y patients (n=2,644) fiom DiscovEHR (“GHS bariatric y ”); 2) 1,357 individuals from the Dallas Heart Study; and 3) 8,526 individuals from the Penn Medicine Biobank. In meta-analysis of the replication cohorts, thirteen variants in nine genes were significantly associated with serum levels ofALT or AST (Bonferroni significance threshold of P<1.43x10'3 for 35 variants , Table 8). These included variants that were previously reported to be associated with elevated transaminase levels, such as PNPLA37, TM6SF211, SERPINA122, SAMMSO23, and ERLIN124. SERPINAl encodes alphaantitrypsin, whose functional deficiency causes liver disease; the association with SAMM50 is mediated via linkage disequilibrium with variation in PNPLA3, and ERLINl has been implicated in liver fat tion. We also identified variants that were not previously reported to be associated with liver disease. These included several variants in GPT and GOTl, the genes encoding ALT and AST, respectively, and SLC39A12, which encodes solute r family 39 member 12.

] We also identified a reproducible association between a variant in HSD17B13, the gene encoding hydroxysteroid 17-beta ogenase 13, an acterized member of the 17- beta hydroxysteroid dehydrogenase family, and sed levels of ALT (discovery P=4.2x10'12, replication P=1.7x10'4) and AST (discovery P=6.2x10'1°, replication P=1.7x10'4, Table 8). The associated variant, rs72613567, is an insertion of an adenine adjacent to the donor splice site of exon six (TA allele), and had an allele cy of 26.0% in the GHS discovery cohort.

Previously, Chambers et al. identified a nearby locus at 4q22 (rs6834314) associated with ALT levels (Chambers et al., Nat. Genet, 2011, 43, 1131-1138, doi: 10.103 8/ng.970, herein incorporated by reference in its entirety for all purposes); rs72613567 has not heretofore been reported to be associated with transaminase . HSD17B13 is 30 kb upstream ofHSD17B1 1, another member of the same gene family. We did not observe exome-wide significant associations between coding or splice variants in HSD17B11 and transaminase levels in the discovery cohort (Figures 5A and 5B) or in the joint meta-analysis of the discovery cohort and three replication cohorts. Furthermore, linkage disequilibrium of rs72613567 with variants in HSD17B11 was modest across all ancestry groups (r2<0.4 with all ained variants in HSD17B11 in all ancestry groups). Collectively, these findings suggest 13 as the gene in the genomic region that is most likely to be functionally related to transaminase levels.

Table 6. aphics and clinical teristics of sequenced European- ancestry individuals from the discovery and replication cohorts.

Discovery Bariatric Dallas Heart Penn Medicine teristic Cohort Surgery Cohort Study Biobank = 46,544 = 2,644 = 1,35 = 8,526 Age (years) — median (IQR) 62.9 (49.6 — 73.8) fig?”' 38'° ' 68.0 (60.0 — 76.0) Female sex—number (%) 26,875 (57.7) 2,119 (80.1) 724 (53.4) 3,242 (38.0) Body mass index — median 47.4 (42.0 - 29.9 (35.4 - 44.8) 28 (25-32) 30 (25-32) (IQR) 53.7) Transaminase level /L —median QR —— e aminotransferase 23.0 (17.5 - 20.0 (15.0 - 22-0 (17.0 - 29.0) 22.0 (17.0 — 30.0) (ALT) 29.5) 27.0) Aspartate aminotransferase 23.0 (20.0 - 21.0 (18.0 - 23-0 (20.0 - 27-5) 24.0 (20.0 — 30.5) (AST) 27.0) 25.0) Presence of liver disease . ICD-9 code — N % —— Alcoholic liver disease 197 (0.4) 7 (0.3) _— Alcoholic cirrhosis 130 (0.3) 3 (0.1) _— 1sease Nonalcoholic cirrhosis 382 (0.8) 24 (0.9) _— Hepatocciiuiar carcinoma 76 (0.2) 1 (0.04) _— ,628 (65.8) 1(0-04) _— Table 7. Single nucleotide variants associated with serum transaminase levels at P < 1.011(10'7 in the discovery cohort.

- H 220970028 rs2642438 AMRCI m ..T1u165A1a 0.008 0.001 n—--——I_M lam-m lam-m lam-m lam-m.) lam—m.) lam-m fl—--I_-l——m fl_-I_____ lam-m awn—Man “WI—M -—--——MI_-) -—--——M -mm.) -—--——m-_-) -—--——m-.) -—--——M -—--——-M -—--——M n 88231392 *rs72613567 HSD17BI3_— —0.005 (0.001) 18242311 4176 SLC39A12 m p.Ser36Gly -0.006 (0.001) -—--——M -—--——M -—--——m-_-) -—--——M -—--——M Table 7 (cont) ———(U/L) III-m—D i REF ALT ALT REF ALT ALT 220970028 4.67E—08 0.7067 41,414 3,515 17,262 20,637 23.88 24.52 24.92 a 88231392 4.16E—12 0.2634 41,414 22,441 16,130 2,843 25.02 24.26 fl—--____---n-_ fl—--_____---_ fl—“—_____--- fl—--_____---_ fl—“—____---_ fl—--______--- fl—--_____---_ fl—“—_____--- fl—--_____---_ fl—“—____---_ a 145732305 1.00E—18 0.0004 41,414 41,385 -n 24.67 14.24 748532 <-—--—----_ “—n117122202 “—n117124731 4.31E-09 ---—101595996 2.97E-08 ---—101606861 2.71E-os 0.0608 ---—101610533 2.77E-08 0.0608 ---—101611294 2.15E-08 0.0611 41,414 ---—101912064 2.43E—21 0.4755 41,414 ---—101977883 1.93E—13 0.5072 41,414 10,048 ---—113917085 4.61E—10 0.7073 41,414 3,627 ---—113940329 2.54E—10 0.7097 41,412 3,567 16,910 ---—94844947 9.28E—21 0.0171 41,414 40,006 1,399 n--- ---—19379549 4.76E—09 0.0759 41,413 35,388 5,780 245 ---—44324727 1.34E—50 0.2351 41,414 24,257 14,837 2,320 ---—44324730 1.11E—50 0.2349 41,414 24,273 14,824 2,317 24.06 ---—44342116 08 0.5986 41,412 6,691 19,833 14,888 24.15 ---—44368122 8.85E—30 0.1682 41,413 28,626 11,618 1,169 24.23 25.36 28.45 395451 7.98E—16 0.3963 41,414 15,036 19,920 6,458 24.15 24.6 26.09 231392 6.24E—10 0.2638 40,753 22,068 15,870 2,815 24.47 24.1 23.96 III—18242311 1.09E—10 0.2881 40,753 20,645 16,738 3,370 24.47 24.15 23.85 I-II[.13 101157378 20 0.0002 40,753 40,733 20 N:5N\o 14.7 2 S —--101 165533 2.43E—24 0.0002 40,753 40,73 17 N4.2on 4;4.5 Z S—-101912064 4.82E—09 0.4754 40,753 11,138 20,486 9,129 24.59 24.26 23.99 : 71870 9.61E—08 0.5833 40,722 7,123 19,686 13,913 24.03 24.22 24.53 ---—94844947 2.44E-20 0.0172 40,753 39,361 1,384 24.24 25.76 34.5 ---—19379549 6.54E—08 0.0760 40,752 34,811 5,698 243 24.21 24.74 25.43 --—-44324727 G 8.31E—46 0.2343 40,753 23,889 14,622 2,242 23.96 24.48 26.62 2 23.96 24.47 26.63 24.64 26.24 * Indicates variants having exome-wide cant associations with both ALT and AST.

Abbreviations: AAF, alternate allele frequency; Alt, alternate allele; ALT, alanine ransferase; AST, aspartate aminotransferase; Ref, nce allele; SE, standard error.

Table 8. Replication and joint meta-analysis of 35 exome—wide significant single nucleotide variants from the discovery cohort in three separate European-ancestry s.

Ill-mu _--E- l-ll--l--- l-ll----E- amnamn- amnn-ll--l H ll-----E- ll-----E- ll--l---- ll-----E- rd ll “m rd ll-----E- rd ll-----E- -0.009 1.93E— rd 101977883 I. rs2230804 CHUK a p.Val268Ile 41,414 (0.001) -0.008 4.61E— -0.008 2.54E— rd 113940329 I. rs2792751 GPAM n 3Val 41,412 (0.001) h fl . . Beta rd 94844947 flflflfiflflflllflflflflm fllfllflflflflflfllflflllfllflflfl rs28929474 SERPINAI a p.Glu366Lys (8'83?) 9'22?) 41,414 rd 19379549 2926 TM6SF2 E p.Glu167Lys (33(1):) 4'3)? 41,413 0.023 1.3413— N J;432472\I (1 rs738409 PNPLA3 E p.Ilel48Met 41,414 (0.002) N 44324730 rs738408 PNPLA3 p.Pr0149Pro (8:83;) 1'15?) 41,414 0.007 8.26E— N 44342116 [X (3 rs2294918 PNPLA3 a p.Lys434Glu 41,412 (0.001) 0.019 8.85E— N 44368122 [X (3 rs3761472 SAMM50 E p.Asp110Gly 41,413 (0.002) 0.011 7.98E— N 44395451 r51007863 PARVB E p.Trp37Arg 41,414 (0.001) 4 —0.005 6.24E— 88231392 -0.006 1.0913— rd 11 (1 rs10764176 SLC39A12 a p.Ser36Gly 40,753 (0.001) 43 —0.221 1.96E— rd 101157378 GOT] 89del 40,753 (0.024) 0.271 2.43E— rd 533 rs374966349 GOT] E p.Gln208Glu 40,753 (0.027) 0005 4.82E- rd 101912064 rs2862954 ERLINI E p.Ile291Val 40,753 (0.001) AST rd 22271870 87481951 -fl p.Leu322Phe (3-331) 9333- 40,722 0.027 2.44E- rd 94844947 rs28929474 SERPINAI E p.Glu366Lys 40,753 (0.003) 0.008 6.54E— rd 19379549 rs58542926 TM6SF2 E 67Lys 40,192 (0.002) 0.014 8.31E— N 44324727 (1 rs738409 PNPLA3 E p.Ilel48Met 40,753 (0.001) 8 23E N 44324730 rs73 8408 PNPLA3 p.Pr0149Pro (33(1):) 40,753 N 44368122 [X (D 472 SAMM50 E p.Asp110Gly (33%;) “: 40,752 N 44395451 r51007863 PARVB p.Trp37Arg ) 1'31”: 40,753 Table 8 (cont) GHS Bariatric Sure Cohort Dallas Heart Stud U. Penn 220970028 0.005 0.005 3 10B 01 2475 0011 0008 1.76E-01 1357 0.007 0.004 _102B 01 6 88231392 -0.010 0.005 5.57E-02 2475 -0.016 0.008 6.60E-02 1357 -0.013 0.004 133E 03 144997604 0492 0.165 284B 03 2475 A A -0.051 0.072 479E 01—. 6158 145008502 -0.1610.165 329E 01 2475 -0.247 0.143 8.48E-02 145692918 0009 0.020 648B 01 2475 0.032 0.036 3.76E-01 1356 —0.053 0.018 3.72E-03 A — 2475 A _ 6158 GHS Bariatric Sure Oc5"c3 Dallas Heart Stud U. Penn E Iaaauaaaana!aaaaaaaaaaaaaaaaaaaaaaaa Beta (SE) N Beta (SE) Beta (SE) 145730221 -0.009 0.020 6.45E-01 2475 4.351-0 I!1357 -0.060 0.018 5.60E-04 IIMLII61 145731636 -0.314 0.165 02 2475 2.35E-02 1356 -0.148 0.143 3 .04E-01 O\ H LII \l 145732114 -0.273 0.048 09 2474 1.3 -0 H LII7 -0.197 0.041 06 145732151 -0.115 0.058 4.82E-02 N475 2.8 - H WU.) 5 ON -0.049 0.041 2.27E—01 H 145732180 -0.273 0.050 4.26E-08 NN47 6.58E-CO LIILII DJ 1357 -0.197 0.041 1.31E—06 145732305 -0.161 0.165 3.29E-01 47 fin? NA -0.509 0.203 02 145748532 -0.161 0.165 3.29E-01 2475 NA -0.307 0.143 3 .21E-02 117122202 -0.004 0.005 4.09E-01 i475 6.18E-01 1357 -0.007 0.004 5.29E-02 117124731 -0.004 0.005 3.90E-01 2475 01 1356 -0.007 0.004 4.24E-02 101595996 -0.002 0.010 8.01E-01 2475 6.88E-01 1357 -0.017 0.00 1 .55E-02 101606861 -0.003 0.010 7.74E-01 2475 6.28E-01 1357 -0.017 0.00 1 .70E-02 101610533 -0.003 0.010 7.93E-01 2475 6.28E-01 1357 -0.017 0.00 1 .76E-02 101611294 -0.001 0.010 9.11E-01 2475 5.40E-01 1357 -0.016 0.00 2.77E-02 101912064 -0.010 0.005 2.91E-02 2475 01 1356 -0.009 0.004 2.06E-02 HHH 101977883 -0.006 0.005 2.05E-01 2475 9.94E-01 1357 -0.011 0.004 3 .91E—03 H 113917085 0003 0.005 5.80E-01 2475 1.15E-01 1357 -0.008 0.004 5.12E-02 113940329 0003 0.005 5.61E-01 2475 1.33E-01 1357 -0.008 0.004 4.77E-02 H 94844947 0.035 0.020 7.97E-02 2475 2.92E-01 1357 0.054 0.013 1 .63E—05 19379549 0.040 0.010 2.40E-05 2475 9.50E-02 1357 0.013 0.008 7.51E-02 4324727 0.019 0.006 5.54E-04 2475 5.43E-01 1357 0.016 0.004 2.05E-04 4324730 0.019 0.006 5.51E-04 2475 5.43E-01 1357 0.016 0.004 04 4342116 0.001 0.005 7.7 - N47LII 01 1357 0.005 0.004 2.16E—01 HHH 4368122 0.009 0.006 1.6 - N47LII 9.37E-01 1 DJ LII 0.018 0.005 4.02E-04 H 4395451 0.003 0.005 5.22E-0H N475 3.13E-01 1357 0.009 0.004 2.50E-02 H 88231392 0010 0.003 3.12E-03 2469 5.32E-02 1357 -0.007 0.004 5.56E-02 18242311 0010 0.003 2.91E-03 2469 5.80E-01 1357 -0.009 0.004 1 2 101157378 0205 0.0 2 8.5 -04 N NA -0.243 0.088 5.97E—03 101165533 NA A fin? NA 0.339 0.079 1 5 101912064 0004 0.003 01 N469 2.21E-01 1357 -0.004 0.003 1.94E-01 [.1 22271870 0001 0.003 7.85E-01 2466 01 1357 -0.002 0.003 5.46E—01 94844947 0.023 0.013 7.79E-02 246\D 6.98E-02 1357 0.055 0.011 4.01E—07 19379549 0.023 0.006 IIIIIIIHHIIIHHIII881.99E-04 2469 3.42E-01 1356 0.004 0.007 01 44324727 0.014 0.004 1.27E-04 I246 5.44E-01 1357 0.015 0.004 4.87E—05 H N 44324730 0.014 0.004 1.32E-04 2469 5.44E-01 1357 0.015 0.004 4.96E—05 ONONONONONONONONONONONONONONONO‘O‘O‘ONONONONONONONO‘O‘O‘O‘O‘ONON HHHHHHHHHHHHHHHHHHHH ONONONONONONONONONONLIILnLnLnLnLnLIILIILIILIILIILIILnLIILIILIILIILIILIILIILIILII 44368122 0.008 0.004 02 2469 -0.001 0.008 9.45E-01 1357 0.016 0.004 2.64E-04 ON 1 O\05050)050511-050anmmococococococococococococococococococococqq 51 0.003 0.003 4.12E-01 2469 0.006 0.006 2.95E-01 1357 0.009 0.003 6.17E—03 6166 Table 8 (cont) 4:14:17: - - ~ 220970028 0 007 (0 003)' ' 2 31E—02' 3 38E-09 (0.001) ' —0.010 88231392 *3.85E 05 _0.013(0.003) _ 1.17E 15_ (0.001) H —0.155 g n 144997604 0121 (0.066) 6.56E-02 2.68E-10 (0.025) '0'264 145008502 —0 210 (0 108)' ' 5 23E—02' 5 54E-18 (0.031) ' n —0.032 145692918 0025 (0.013) 4.69E—02 2.25E-12 (0.005) 4:14:14: - - (0.033) 145731636 -0.256 (0.086) 2.79E—03 ('8 (32397) 1.94E-16 145732114 0231 (0.029) *7.24E-16 ('8 (31225) 6.06E-78 145732151 0074 (0.032) 1.88E—02 ('8 81726) 7.03E-11 145732180 0221 (0.029) *1.41E-14 (8312;) 1.04E-77 145732305 0299 (0.128) 1.93E—02 (8337:) 6.44E-20 145748532 0244 ) 2.40E-02 £32879 2.93E-12 117122202 0005 (0.003) 8.42E-02 '83’817 3.08E-09 117124731 0005 (0.003) 6.15E—02 ($817) 1.00E-09 2 101595996 0012 (0.005) 02 (833;) 09 2 101606861 0012 (0.005) 3.25E—02 (833;) 2.99E-09 2 101610533 0012 (0.005) 3.43E—02 (833;) 3.23E-09 2 101611294 —0.011(0.005) 5.21E—02 (833;) 4.09E-09 3 064 0009 ) *1.14E-03 (83311) 1.76E-23 2 101977883 -0.008 (0.003) 4.33E—03 ($819) 3.59E-15 2 113917085 0007 (0.003) 2.07E—02 68$?) 3.28E-11 2 113940329 0007 (0.003) 2.00E-02 68$?) 1.77E-11 1* 94844947 0.047 (0.010) *2.82E-06 (333:) 1.59E-25 1‘ 49 0.024 (0.006) *1.37E-05 (33(1):) 1.15E-12 2 44324727 0.016 (0.003) *7.45E-07 (3'33) 3.55E-55 2 44324730 0.016 ) *7.73E-07 33(2)} 3.10E-55 2 44342116 0.004 (0.003) 01 (3'33?) 6.24E-08 WO 36758 4:14:14:Jomt Meta Analys1s- - **Replication Meta-Analysis (N=3) | .3 i- H U N 44368122 0 012 (0 004)' ' *7 69E 04' 1 08E-31 (0.002) ' N 0.010 N 44395451 0.007 (0.003) 1.78E 02 1.16E-16 (0.001) -0.006 V. 88231392 0.009 (0.002) * _ 8.38E 05 6.82E 13_ (0.001) O '0'006 v—1 18242311 —0 009 (0 002)' ' *1 16E 04' 1 10E-13 (0.001) ' 0 '0'220 v—1 101157378 —0 218 (0 051)' ' *1 66E 05' 1 68E-24 (0 022) ' 0 0.278 101165533 0.339 (0 079) *1 85E 05 _ 3.25E 28_ v—1 (0.025) v—1 101912064 0005 (0 002) 2.51E-02 ($815) 3.68E-10 v—1 0.004 v—1 22271870 0.000 (0 002) 8.43E—01 1.13E-06 (0.001) v—1 94844947 0.042 (0 008) *9.54E-08 33(2): 6.71E-26 v—1 49 0.014 (0.004) *1.20E-03 3'33; 5.92E-10 N 0.014 N 44324727 0.013 (0.002) *5.511: 08 _ 3.14E 52_ (0.001) N 44324730 0.013 (0.002) -08 (33(1)?) 3.55E-52 N 0.011 N 44368122 0.010 (0.003) : 04 _ 1.91E 25_ (0.001) 2 44395451 0.006 (0.002) 7.34E-03 (3'33?) 3.62E-15 * Indicates P-values meeting the Bonferroni significance threshold ofP < 1.43 x 103.

** Replication meta-analysis includes the three replication s: GHS ric Surgery Cohort, Dallas Heart Study, and Penn ne Biobank.

*** Joint meta-analysis includes the discovery cohort and the three replication cohorts: GHS Discovery Cohort, GHS Bariatric Surgery Cohort, Dallas Heart Study, and Penn Medicine Biobank.

Abbreviations: AAF, alternate allele frequency; Alt, alternate allele; ALT, alanine aminotransferase; AST, aspartate aminotransferase; Ref, reference ; SE, standard error; ann, annotation; mis, missense; syn, synonymous; spl, splice donor; stop, stop gained; fs, frameshift; inf, inframe indel.

Association ic Variants with Clinical Diagnoses ofChronic Liver Disease Next, we analyzed the onship between the thirteen transaminase-associated variants in the nine genes found in the discovery and replication s and chronic liver disease, including alcoholic and nonalcoholic (non-viral) liver disease, as well as the most advanced forms of chronic liver disease: alcoholic cirrhosis, oholic cirrhosis, and hepatocellular carcinoma (HCC). Using a roni cance threshold of x10'3 for the thirteen variants tested, we found significant associations n six variants in five genes B13, Al, TM6SF2, PNPLA3, and SAMMSO) and chronic liver disease phenotypes (Table 9). The SERPINAl, TM6SF2, PNPLA3, and SAMMSO associations confirm previously reported associations. In the discovery cohort, HSD17B13 rs72613567:TA was associated with lower odds of all EHR-derived categories ofboth alcoholic and nonalcoholic liver disease in an allele dosage-dependent manner (Figure 2A): all categories of alcoholic liver disease, heterozygous odds ratio ) (95% confidence interval) 0.58 0.80), homozygous OR (ORhom) 0.47 0.97), allelic OR(ORa11e1ic) 0.62 (0.48-0.81), P=1.8x10'4; all categories of nonalcoholic liver disease, ORhet 0.83 (0.75-0.92), ORhom 0.70 0.87), ORaneuc 0.84 (0.78-0.91), P=1.3x10'5. HSD17B13 rs72613567:TA was also associated with lower odds of alcoholic and nonalcoholic cirrhosis, with 42% and 73% lower odds of alcoholic cirrhosis for heterozygotes and homozygotes, respectively, (ORhet 0.58 (0.39-0.86), ORhom 0.27 (0.09-0.85), ORaneuc 0.56 (0.41-0.78), P=3.4x10'4) and 26% and 49% lower odds of nonalcoholic cirrhosis for zygotes and homozygotes, respectively (ORhet 0.74 (0.60-0.93), ORhom 0.51 (0.31-0.85), ORanenc 0.74 (0.62-0.88), P=4.5x10'4). HSD17B13 rs72613567:TA was also nominally associated with lower odds of HCC.

We sought to confirm and extend these findings in the multi-ethnic Dallas Liver Study (DLS) and the Dallas Pediatric Liver Study (DPLS, Table 10). In the DLS, the TA allele was associated with lower odds of any liver disease in an allele-dosage dependent manner (ORhet 0.74 (0.57-0.97), ORhom 0.41 (0.21-0.83), ORallelic 0.70 (0.5-0.88), P=1.8x10'3, Figure 8). Similar effects were observed across EHR-derived liver disease subtypes, including protective associations with advanced, cirrhotic forms of alcoholic (ORaneuc 0.72 (0.53-0.99), P=4.4x10'2) and nonalcoholic (ORaneuc 0.65 (0.40-1.07), P=9.0x10'2) liver disease. In subset analyses of duals grouped by self-reported ethnicity, the association with liver disease was significant in Hispanic Americans (n=326 cases and 722 controls, ORaneuc 0.51 (0.35-0.74), P=4.0x10'4); similar numerical trends, which did not achieve statistical significance, were also noted in the Afiican American (n=33 cases and 2,291 controls, ORaneuc 0.74 (0.25-2.47), P=0.67) and European an (n=158 cases and 1,266 controls, ORaneuc 0.87 1.15), P=0.32) subsets of the DLS. In the DPLS, a separate study of Hispanic American ric liver disease patients and obese controls, the TA allele was also associated with lower odds of liver disease (ORallelic 0.61 (0.37-0.99), P=4.6x10'2). Thus, HSD17B13 rs72613567:TA was associated with reduced odds of multiple forms of c liver disease, including cirrhosis, in adults and children in three independent populations.

Table 9. Association of twelve exome-wide significant and replicating single nucleotide variants with liver disease phenotypes in the ery cohort.

Alcoholic liver disease Alcoholic cirrhosis CHR:BP:Ref:Alt Gene 0R 0R P-va ue1 P-va uel 95% CI 95% 0'62 0'56 4'88231392'T'TA' ' ' HSDI 7313 rs72613567 *1 82E 04 *3 35E 04' (0.48-0.81) ' (0.41-0.78) ' 3.83 6.33 8.145730161.C.T, , , 13201815297 8.88E 02 2.88E—02 (1.054394) (1.714143) 0.77 1.13 8.145732114.G.C, , , rs141505249 8.43E 01 9.30E—01 (0.06-10.73) (ODS-15.39) 0.73 1.07 8.145732180.G.C, , , rsl47998249 8.17E 01 9.60E—01 1.76) (0.07-17.16) 0.85 0.92 .18242311.A.G, , , SLC39A12 1'le764176 1.64E 01 5.80E—01 (0.68-1.07) (0.70422) :101157378:CGTT:C GOT] 393E—01 (0.38- 3.00E-01 (0.25-86.41) :101165533:G:C GOT] rs374966349 6 24E 01 (0.20 — 4.70E—01 (0.13-37.68) 59 04) 2.49 3.35 14.94844947.C.T, , , SERPINAI rs28929474 2.30E 03 -04 (1.49417) (1.93-5.83) 1.47 1.35 19.19379549.C.T, , , TM6SF2 2926 2.76E 02 1.80E-01 (1.06404) (0.89404) 1.76 2.07 22.44324727.C.G. , , PNPLA3 rs738409 *4.98E-07 -07 (1434.18) (1.60457) 1.77 2.07 22.44324730.C.T. , , PNPLA3 rs738408 *4.70E-07 *1.03E-07 (1434.18) (1.61-2.67) 1.90 2.28 22.44368122.A.G. , , SAMM50 rs3761472 *1.36E-07 *1.83E-08 38) (1.75498) * Indicates P-values meeting the Bonferroni significance threshold ofP < 2.08x10'3.

Table 9 ) Nonalcoholic liver Nonalcoholic Hepatocellular disease c1rrhos1s ma CI-lR:BP:Ref:Alt Gene 0R 0R 0R P-value P-value P-value 95% C 95% C 95% C 0.84 *1.31E- 0.74 *4.48E- 0.67 4.88231392.T.TA. . . HSDI7BI3 rs72613567 4.66E—02 0.78-0.91 .88 0454.00 0.23 1.86E- 1.25 3.66 8.145730161.C.T, .. rs201815297 (0.04_1.14)(0.24_6.38) 7.98E-01 (0.70_19.01)2.01E-01 1.02 9.70E- 0.36 1.84 8.145732114.G.C, .. rs141505249 (0.49_2.11)-(0.02_5.37) 3.82E-01 (0154323688301 1.03 9.30E- 0.34 1.74 8.145732180.G.C, .. rs147998249 (0.49—2.17)-(0.02—5.59) 3.67E-01 (0114703721301 3.43E- 1.03 1.29 42311.A.G, , , SLC39A12 rs10764176 ((8:96) .(0.88_1.21)7.15E-01 (0.93_1.79)1.37E-01 8.27 9.81 2 37 2 50E_ :101157378:CGTT:C 0071 (0 61'_9 27)' (1.44— 5.92E-02 (0.52— 2.43E—01 ' '01 47.49 183.54 511%,; Table 10. Demographics and al characteristics of genotyped multi-ethnic cases and controls from the Dallas Liver and Pediatric Liver s.

Dallas ric Dallas ric Dallas Liver Dallas Liver Liver Study Liver Study Characteristic Study Cases Study ls Controls (N = 517) (N = 4,279) Age (years) — median (IQR) 55 (48 — 60) 44 (36 — 53) 12 (1o — 15) 12 (11 — 14) Female sex — number (%) 277 (54) 2,494 (58) 65 (32) 126 (52) Body mass index — median 3o (27 — 35) 3o (26 — 35) 3o (27 — 34) 31 (28 — 35) (IQR) Self-re n orted ethnici Afiican American 33 (6) 2,291 (54) Euro . ean American 158 31 1,266 30 Hispanic American 326 (63) 722 (17) 203 (100) 244 (100) Presence of liver disease . ICD-9 code — N % Alcoholic liver disease 223 (43) Alcoholic sis 215 (42) Nonalcoholic, non-viral liver 212 (20) disease Nonalcoholic cirrhosis 100 (19) Hepatocellular carcinoma 44 (9) No liver disease 4,279 (100) —244 (100) Association ofHSDI7313 rs72613567:TA with Liver Pathology NAFLD describes a disease spectrum ranging fiom liver fat accumulation without evidence of significant inflammation (simple steatosis), to more ally impactful NASH. To confirm the association between the HSD17B13 rs72613567:TA and EHR-derived liver disease diagnoses codes, and to further understand its association with histopathological progression of steatosis to NASH, we performed tests of association in the GHS bariatric surgery cohort. In this cohort of 2,391 of the whole exome sequenced individuals assessed by liver biopsy at the time of bariatric surgery, a total of 555 (23%) individuals had no evidence of steatosis, steatohepatitis, or fibrosis (“normal”), 830 (35%) had simple steatosis, and 1006 (42%) had NASH. When comparing prevalence of normal liver, simple steatosis, and NASH by genotype, it was observed that the prevalence of normal liver did not appear to differ by genotype (23%, 24%, and 23% for T/T, TN“A, and TA/TA carriers, respectively, P = 0.5 by Chi-squared test for trend in proportions), but that the prevalence ofNASH decreased (45%, 40%, and 31% for T/T, TN“A, and TA/TA carriers, respectively, P = 1.6x10'4) and that of simple steatosis increased (33%, %, and 47% for T/T, TN“A, and TA/TA carriers, respectively, P = 1.1x10'3) with each TA allele (Figure 9). Among duals with steatosis, the TA allele was associated with statistically significantly lower odds ofboth NASH and fibrosis, as compared to simple steatosis (ORanenc 0.77 (0.66-0.90), P=6.5x10'4 for NASH; c 0.74 (0.62-0.88), P=4.15x10'4 for s; Figure 2B), in an allele dosage-dependent manner. Altogether, these data suggest a role for HSD17B13 in mediating NAFLD progression from simple steatosis to more advanced stages ofNASH and fibrosis.

Association ofHSDI7313 rs72613567:TA with Clinical Quantitative Traits and Diagnoses To more comprehensively examine the clinical consequences of the HSD17B13 splice variant, we performed a phenome-wide study of associations ofHSD17B1 3 rs72613567:TA with 405 quantitative rived anthropometric, vital sign, laboratory, electrocardiographic, echocardiographic, and bone ometry measurements, and also with 3,168 EHR-derived al diagnoses. Using Bonferroni significance thresholds of 1.23x10'4 and 1.58x10'5 for associations with tative clinical measurements and clinical diagnoses, respectively, we identified statistically significant associations of the HSD17B13 3567:TA allele with higher et , in addition to the associations with hepatic transaminases (Table 11). There were no statistically significant ations with al diagnoses other than c liver disease (OR (95% CI) =0.88 (0.84-0.93); P = 9.14x10'6; AAF = 0.263; N Cases total = 4031, TH“ = 2331, T/TA = 1449, TA/TA = 251; N Controls Total = 35701, T/T = 19238, T/TA = 13984, TA/TA = 2479).

Table 11. e-Wide Study of Associations of HSD17B13 rs72613567:TA with Quantitative Clinical Measurements.

—Mfl_Nm.

Alanine Aminotransferase medianzAd'usted Residual Lo_ 3055 A artate Aminotransferase medianzAd'usted Residual Lo_ 3026 Alanine Aminotransferase maszd'usted ' esidual Lo_ 3043 A artate Aminotransferase maszd'usted Residual Lo_ 2979 Platelets medianzAd'usted ' esidual Lo_ 3218 Alanine Aminotransferase minzAd'usted '_esidualLo -0.008 0.002 2.47E-07 0.264 44029 23864 17111 3054 Platelets minzAd'usted 'esidual 1.919 0.443 1.47E-05 0.264 46181 25020 17943 3218 Platelets maszd'usted '_esidualLo 0.004 0.001 3.03E-05 0.264 46165 25014 17936 3215 A artate Aminotransferase minzAd'usted ResidualLo_ -0.004 0.001 5.00E-05 0.264 43327 23471 16831 3025 Boldin and italicization indicates P-values meetin the Bonferroni si_ ificance threshold ofP < 1.23x10'4.

Abbreviations: AAF, alternate allele fre- uenc ; SE, standard error.

WO 36758 Effect ofHSD17313 rs72613567:TA on HSD17313 mRNA andHSD17313 Protein Expression ] We next ed the effect of the HSD17B13 rs72613567:TA allele on expression ofknown and novel transcripts of the gene. We used RNA sequencing to assess HSD17B13 mRNA expression in histologically normal liver samples from 22 T/T homozygous, 30 T/TA heterozygous, and 17 TA/TA homozygous carriers of the 13 rs72613567 splice variant.

In addition to the two known HSD17B13 transcripts, A and B, two novel transcripts were identified: transcript C, which lacked exon 6, and transcript D which contained an insertion of a guanine nucleotide at the 3 ’ end of exon 6, which would be predicted to result in premature truncation of the protein. Four additional transcripts (E-H) were sed at very low levels (Figures 3A-3D and 6A-6D). The transcripts were validated by RT-PCR and Sanger sequencing. The D transcript was also validated using long read cDNA sequencing. Protein sequence ent of all identified HSD17B13 isoforms (A-H) is shown in Figures 7A and 7B.

The expression levels of these ripts varied according to HSD17B13 rs72613567 genotype; levels of transcripts A and B decreased, while those of transcripts C and D increased in an allele dosage-dependent manner with each TA allele (Figures 3A-3D). Transcript A, which encodes the full-length 300 amino acid protein, was the predominant transcript in T/T homozygotes, while transcript D, which encodes the prematurely truncated protein, was the predominant transcript in TA/TA homozygotes. In human liver biopsy , the truncated isoform D protein was minimally present in zygotes and TA/TA homozygotes, and m A protein abundance was reduced in an allele dosage-dependent manner (Figures 10B and 10C).

Heterologous expression of isoforms A and D in HEK 293 cells indicated reduced abundance of isoform D relative to mRNA expression, suggesting instability of the D isoform when compared to isoform A (Figures C). These data are consistent with HSD17B13 rs72613567 altering mRNA splicing, ing in the synthesis of a truncated form of the protein with substantially reduced expression in human liver.

Expression 7313 in Human Liver Cells HSD17B13 is expressed ily in the liver (Liu et al., Acta Biochim. Pol. 2007, 54, 213-218, herein incorporated by reference in its entirety for all purposes), where it localizes to lipid droplets (Su et al., Proc. Natl. Acad. Sci. USA, 2014, 111, 11437-11442, doi: 10. 1073/pnas. 1410741 1 1 1, herein incorporated by reference in its entirety for all purposes), consistent with a role in the pathogenesis of fatty liver disease. We evaluated the expression of HSD17B13 and its localization in an immortalized human liver cell line stably transduced with lentivirus expressing HSD17B13 transcript A or D. HSD17B13 isoform A was mainly detected on membranes surrounding -labeled lipid ts (data not shown). Similar subcellular zation was observed for HSD17B13 isoform D at the lipid droplet surface (data not shown and Figure 12). No differences in intracellular triglyceride content were observed with oleic acid treatment of cell lines overexpressing GFP control or HSD17B13 isoforms A or D (Figures 13A-13D).

Effect ofrs72613567:TA on HSDI7313 ty in vitro and in Cellular Models To understand the functional consequences of premature truncation of the HSD17B13 protein due to rs72613567zTA, we evaluated the enzymatic activity of isoforms A and D in vitro using inant protein and nicotinamide adenosine dinucleotide as cofactor. We tested 265 unique putative ates, and identified steroid substrates and bioactive lipids (e.g. leukotriene B4) as enzymatic substrates of 3. We focused subsequent terization ofHSD17B13 enzymatic activity on enzymatic conversion of iol (Vmax and Km values in Figure 14), which resulted in oxidation of a hydroxyl to a ketone group. HSD17B13 isoform D showed greatly reduced activity towards estradiol in vitro (Figure 10D) and in ased enzymatic conversion assays (Figure 10E) when compared to HSD17B13 isoform A.

By linking large-scale exome sequencing to EHR-derived clinical phenotypes, we identified a novel association between a splice variant in HSD17B13 and decreased serum transaminase levels, as well as reduced risk of nonalcoholic and alcoholic forms of liver disease.

These associations were observed consistently in four independent s, and across several different liver disease ries, ing advanced cirrhotic forms of liver disease and HCC.

The HSD17B13 rs72613567:TA allele was not associated with simple steatosis, but was associated with reduced risk ofNASH and s, suggesting that this variant allele protects from ssion to more clinically advanced stages of chronic liver disease. In a phenome-wide association study, HSD17B13 rs72613567:TA was not significantly ated with clinical diagnoses or measurements other than chronic liver disease and associated clinical measurements (hepatic transaminases and platelet counts), suggesting that the clinical effects of the variant allele may be specific to chronic liver e.

] Other hydroxysteroid 17-beta dehydrogenase family members are involved in sex steroid and fatty acid metabolism (Moeller, Mol. Cell. Endocrinol, 2009, 301, 7-19, doi: 10. .mce.2008. 10.040, herein incorporated by reference in its entirety for all purposes), but little is known about the function ofHSD17B 1 3. HSD17B13 overexpression was shown previously to increase lipogenesis in mouse liver, and to increase the number and size of lipid droplets in cultured hepatocytes (Su et al., Proc. Natl. Acad. Sci. USA, 2014, 111, 11442, doi: 10. 1073/pnas. 1410741 1 1 1, herein incorporated by reference in its entirety for all purposes).

Two previous studies also showed that hepatic sion ofHSD17B13 protein is increased in patients with fatty liver (Su et al., Proc. Natl. Acad. Sci. USA, 2014, 111, 11437-11442, doi:10.1073/pnas.1410741111 and Kampf et al., FASEB J., 2014, 28, 2901-2914, doi:10.1096/fj.14-250555, each of which is herein incorporated by reference in its entirety for all purposes). Our data t that both HSD17B13 isoforms are expressed on the lipid droplet membrane, but do not appear to modulate intracellular l fat t, a finding that mirrors the lack of an association between the HSD17B13 rs72613567:TA and simple steatosis in . Although the physiological substrates ofHSD17B13 are not known, enzymatic studies demonstrate that the HSD17B13 isoform encoded by the HSD17B13 rs72613567:TA allele is catalytically defective against estradiol. While at this time it is not clear if any of the substrates tested are al for liver disease, it is intriguing that HSD17B13 has enzymatic activity t several bioactive lipid species (e.g. leukotriene B4) that have previously been implicated in lipid- mediated inflammation (Li et al., Nature Medicine, 2015, 21, 239-247, doi: 10. 103 8/nm.3 800, herein incorporated by nce in its entirety for all purposes).

This HSD17B13 variant may provide an avenue to new therapeutic strategies targeting chronic liver disease, similar to genetic variants that have guided the way to new therapeutics in other s. Our data indicate that HSD17B13 modulates progression of liver disease fiom steatosis to later stages ofNASH, fibrosis, and cirrhosis, which are associated with cant morbidity and mortality, and for which there are currently no effective treatments.

Example 4. Modification of Mouse Hsd17b13 Locus Using CRISPR/Cas9 Ex Vivo and In Vivo.

As a proof of concept for targeting Hsd] 7b13 using the CRISPR/Cas9 , mouse Hsd] 7b;3 guide RNAs targeting either the exon 1 region or the exon 6/7 region of the mouse Hsd] 7b13 locus were tested. The guide RNA target sequences are provided in Table 12. The guide RNA DNA-targeting segments corresponding to SEQ ID NOS: 259-268 are set forth in SEQ ID NOS: 1643-1652, respectively, which are identical to SEQ ID NOS: 259-268 except with uracils instead of es. The NCBI Gene ID for mouse Hsd] 7b13 (hydroxysteroid (17- beta) dehydrogenase 13 is 243168 (SEQ ID NO: 269). The mouse genomic locus is on chromosome 5, 071.6 (103955442..1039773 88, complement).

Table 12. Guide RNA Target Sequences for Mouse SEQ ID NO Region of Gmde RNA Target Sequence. gRNA Hsd17b13 ngNA ngNA ngNA ngNA Target erRNA v1 v2 v3 v4 GGCAGACCGTTCTCATCACG 1180 1410 CTTTACCAGTGACTCCAGGT 1181 1411 Exonl GTCACAGATTTCCTTCTCCG 1182 1412 Exons 6/7 The guide RNAs were first tested ex vivo in primary mouse hepatocytes isolated from hybrid wild type mice (75% C57BL/6NTac 25% 129S6/SvaTac). Livers from mice were perfused with 50 mL liver perfusion medium containing 1X PenStrep, followed by 50 mL liver digestion medium (HBSS, 100 mM CaClz, 500 mM HEPES, collagenase). Once livers appeared digested, they were placed into wash medium containing 1X PenStrep and L-glutamine. The livers were torn to release the hepatocytes from the liver through gentle shaking. Once cells were ed, they were put through a 70 um mesh filter and spun at 50 g for 4 minutes at 4°C.

The pellets were washed 2X with wash buffer. The pellets were then re-suspended in 20 mL of 38-40% Percoll and spun at 200g x 10 min at 4°C. The pellet was washed 2X and re-suspended in plating medium (Williams E Media, 1X ep, 1X L-glutamine, 5% FBS). Cells were plated at 300,000 cells per well in 24-well collagen-coated tissue culture plates. After the cells were d to attach for 6-18 hrs, the plating medium was replaced with medium t FBS.

Reagents used are shown in Table 13.

Table 13. Reagents for Isolation of Primary Hepatocytes.

Material Liver Perfusion Media HBSS (1x) Hepatocyte Wash Media Williams E media Penstrep (100x) L—glutamine (200mM) FBS supplement HEPES Collagen Acetic acid Liberase TM Primary Hepatocyte Thawing and Plating Supplements Primary Hepatocyte Maintenance Supplements Perccll Ribonucleoprotein complexes (RNPs) containing Cas9 and a mouse Hsd] 7b13 gRNA were added to the freshly isolated primary mouse hepatocytes. For ex vivo experiments in primary mouse hepatocytes, modular guide RNAs having a te chNA and trachNA were used. The chNA SEQ ID NOS are set forth in Table 12, and the trachNA sequence is set forth in SEQ ID NO: 1422. Each Cas9/gRNA RNP complex was transfected at a final concentration of 2 nM using MAXTM. After 48 hrs, DNA lysates were prepared from the cells, and next-generation sequencing was performed for each guide RNA tested to determine insertion/deletion (indel) frequency over the predicted cut sites.

Figure 15 shows editing levels (% reads with indels) in the mouse Hsd] 7b13 gene with each of the guide RNAs in primary mouse cytes, including each of the five guide RNAs targeting the exon 1 region and each of the five guide RNAs ing the exon 6/7 region.

Editing efficiency refers to the total number of insertions or deletions observed over the total number of sequences read in the PCR reaction from a pool of lysed cells as determined by next tion sequencing. Nearly all of the guide RNAs showed an editing efficiency of at least Next, the five mouse Hsd] 7b13 guide RNAs were tested in vivo in mice with a cally integrated Cas9 gene (Cas9-ready mice). For in vivo experiments in mice, chimeric single guide RNAs were used. The DNA-targeting sequence for each guide RNA is equivalent to the guide RNA target sequence set forth in Table 12, with uracils replacing the thymines.

Each single guide RNA ed the rget sequence upstream (5’) of the gRNA scaffold set forth in SEQ ID NO: 1420. The ngNA SEQ ID NOS are set forth in Table 12 (column for ngNA v1). Other ngNA ions using different guide RNA scaffold are included in Table 12 but were not tested. For each guide RNA, three Cas9-ready male mice were dosed per group.

Guide RNAs were introduced via adeno-associated virus (AAV8) ng an ngNA expression cassette by tail vein injection (1E11 per mouse in 100 uL PBS). Wild type mice that do not express any Cas9 were dosed with all five guide RNAs as a negative control. Three weeks post- injection, the animals were euthanized, and blood serum was harvested along with liver and other tissues. The tissues were sed into DNA lysates that were then analyzed by NGS sequencing.

As shown in Figure 16, NGS sequencing showed significant editing in liver for all five guide RNAs (percent editing of at least 20% for each). Editing efficiency refers to the total number of insertions or deletions observed over the total number of sequences read in the PCR reaction from a pool of lysed cells. Minimal or no statistically significant levels of gene g were observed in other tissues (data not shown).

Serum chemistry analysis for the liver enzymes ALT, AST, cerides, total cholesterol, HDL, LDL, non-esterified fatty acids (NEFA), and albumin showed little difference between s treatment groups (data not shown).

Hsd] 7b13 expression was ted by assessing equal mass amounts ofRNA from liver by RT-qPCR. The genomic DNA was degraded so that it would not count towards the qPCR reaction. The RNA was reverse transcribed and then an assay specific to Cas9 was used to detect Cas9 transcripts. Each individual Hsd] 7b13 guide RNA showed at least 50% ablation of Hsd] 7b13 mRNA expression. See Figure 17A. In contrast, no significant decreases were observed in expression of a non-target HSD family member. See Figure 17B.

We

Claims (60)

claim:

1. A guide RNA effective to direct a Gas enzyme to bind to or cleave an HSDI 7BI3 gene, wherein the guide RNA comprises a DNA-targeting segment that targets a guide RNA target sequence within the HSDI 7BI3 gene.

2. The guide RNA of claim 1, wherein the guide RNA target sequence includes or is proximate to a position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2.

3. The guide RNA of claim 2, wherein: (a) the guide RNA target ce comprises any one of SEQ ID NOS: 226- 239 and 264-268; and/or (b) the rgeting t comprises any one of SEQ ID NOS: 1629- 1642 and 1648-1652; and/or (c) the guide RNA comprises any one of SEQ ID NOS: 706-719; 936-949; 1166-1179, 1396-1409, 725-729, 955-959, 1185-1189, and 1415-1419.

4. The guide RNA of claim 2 or 3, wherein: (a) the guide RNA target sequence is within a region corresponding to exon 6 and/or intron 6 and/or exon 7 of SEQ ID NO: 2 when the HSDI 7BI3 gene is lly aligned with SEQ ID NO: 2; and/or (b) the guide RNA target sequence is within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 tides of the position corresponding to on 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2, optionally wherein the guide RNA target sequence includes the position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2.

5. The guide RNA of claim 1, wherein the guide RNA target sequence includes or is proximate to the start codon of the HSDI 7BI3 gene.

6. The guide RNA of claim 5, wherein: (a) the guide RNA target sequence ses any one of SEQ ID NOS: 20-81 and 259-263; and/or (b) the DNA-targeting segment comprises any one of SEQ ID NOS: 1423- 1484 and 1643-1647; and/or (c) the guide RNA comprises any one of SEQ ID NOS: 500-561, 730-791, 960-1021, 1190-1251, 720-724, 950-954, 184, and 1410-1414.

7. The guide RNA of claim 5 or 6, wherein: (a) the guide RNA target sequence is within a region corresponding to exon 1 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally d with SEQ ID NO: 2; and/or (b) the guide RNA target sequence is within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the start codon.

8. The guide RNA of claim 1, wherein the guide RNA target sequence includes or is ate to the stop codon of the HSDI 7BI3 gene.

9. The guide RNA of claim 8, wherein: (a) the guide RNA target sequence comprises any one of SEQ ID NOS: 82- 225; and/or (b) the DNA-targeting segment comprises any one of SEQ ID NOS: 1485- 1 628; and/or (c) the guide RNA comprises any one of SEQ ID NOS: 562-705, 792-935, 1022-1165, and 1252-1395.

10. The guide RNA of claim 8 or 9, n: (a) the guide RNA target sequence is within a region corresponding to exon 7 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2; and/or (b) the guide RNA target sequence is within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the stop codon.

11. The guide RNA of any one of claims 1-10, wherein the HSDI 7BI3 gene is a human HSDI 7BI3 gene or a mouse Hsd] 7b13 gene, optionally wherein the HSDI 7BI3 gene is the human HSDI 7BI3 gene and comprises SEQ ID NO: 2.

12. The guide RNA of any one of claims 1-11, wherein the guide RNA comprises a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) RNA (chNA) comprising the DNA-targeting segment and a trans-activating CRISPR RNA (trachNA).

13. The guide RNA of claim 12, wherein the guide RNA is a modular guide RNA in which the chNA and the trachNA are separate molecules that hybridize to each other, optionally wherein the chNA comprises the sequence set forth in SEQ ID NO: 1421 and the trachNA comprises the sequence set forth in SEQ ID NO: 1422.

14. The guide RNA of claim 12, n the guide RNA is a single-guide RNA in which the chNA is fused to the trachNA Via a linker, optionally wherein the guide RNA comprises the sequence set forth in any one of SEQ ID NOS: 1420 and 256-258.

15. Use of the guide RNA of any one of claims 1-14 in a method of modifying an HSDI 7BI3 gene in a cell or a method for altering sion of an HSDI 7BI3 gene in a cell.

16. An isolated nucleic acid comprising a DNA encoding the guide RNA of any one of claims 1-14.

17. An antisense RNA, an siRNA, or an shRNA that hybridizes to a sequence within SEQ ID NO: 4 (HSDI 7BI3 Transcript A) and decreases expression ofHSDI 7BI3 Transcript A in a cell.

18. The antisense RNA, the siRNA, or the shRNA of claim 17, wherein: (a) the nse RNA, the siRNA, or the shRNA hybridizes to a sequence present in SEQ ID NO: 4 (HSDI 7BI3 Transcript A) that is not present in SEQ ID NO: 7 (HSDI 7BI3 ript D); and/or (b) the nse RNA, the siRNA, or the shRNA hybridizes to a sequence spanning the exon 6-exon 7 boundary of SEQ ID NO: 4 (HSDI 7BI3 Transcript A).

19. Use of the antisense RNA, the siRNA, or the shRNA of claim 17 or 18 in a method for altering expression of an HSDI 7BI3 gene in a cell.

20. An isolated nucleic acid comprising a DNA ng the antisense RNA, the siRNA, or the shRNA of claim 17 or 18.

21. A vector comprising the isolated nucleic acid of claim 16 or 20 and a heterologous nucleic acid.

22. A composition comprising the guide RNA of any one of claims 1-14 and a r increasing the stability of the guide RNA, optionally wherein the composition further comprises a Gas protein, optionally wherein the Gas protein is Cas9.

23. A composition sing the antisense RNA, the siRNA, or the shRNA of claim 17 or 18 and a carrier increasing the stability of the antisense RNA, the siRNA, or the shRNA.

24. A cell comprising the guide RNA of any one of claims 1-14.

25. A cell comprising the antisense RNA, the siRNA, or the shRNA of claim 17 or 18.

26. The cell of claim 24 or 25, wherein the cell is a human cell, optionally wherein the cell is a liver cell.

27. The cell of claim 24 or 25, wherein the cell is a rodent cell, a mouse cell, or a rat cell, optionally wherein the cell is a pluripotent cell or a liver cell.

28. A method of modifying an HSDI 7BI3 gene in a cell, comprising contacting the genome of the cell with: (a) a Gas protein; and (b) a guide RNA that forms a complex with the Gas n and targets a guide RNA target sequence within the HSDI 7BI3 gene, wherein the guide RNA target sequence includes or is proximate to a on corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2, wherein the Gas protein cleaves the HSDI 7BI3 gene.

29. The method of claim 28, wherein: WO 36758 (a) the guide RNA target sequence ses any one of SEQ ID NOS: 226- 239 and 264-268; and/or (b) the DNA-targeting segment comprises any one of SEQ ID NOS: 1629- 1642 and 1648-1652; and/or (c) the guide RNA comprises any one of SEQ ID NOS: 706-719; 936-949; 1166-1179, 1396-1409, 725-729, 955-959, 1185-1189, and 419.

30. The method of claim 28 or 29, wherein: (a) the guide RNA target sequence is within a region corresponding to exon 6 and/or intron 6 and/or exon 7 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2; and/or (b) the guide RNA target sequence is within about 1000, 500, 400, 300, 200, 100, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 nucleotides of the position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2, optionally wherein the guide RNA target sequence includes the position corresponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2.

31. The method of any one of claims 28-30, further comprising contacting the genome with an exogenous donor sequence comprising a 5’ homology arm that izes to a target sequence 5’ of the on corresponding to position 12666 of SEQ ID NO: 2 and a 3’ homology arm that hybridizes to a target sequence 3 ’ of the position corresponding to position 12666 of SEQ ID NO: 2, n the exogenous donor sequence recombines with the HSDI 7BI3 gene.

32. The method of claim 31, wherein the exogenous donor sequence further comprises a nucleic acid insert flanked by the 5’ homology arm and the 3’ homology arm.

33. The method of claim 32, wherein the nucleic acid insert comprises a e, and wherein upon recombination of the exogenous donor sequence with the HSDI 7BI3 gene, the thymine is inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1.

34. The method of any one of claims 31-33, wherein: (a) the exogenous donor sequence is between about 50 nucleotides to about 1 kb in length, optionally wherein the exogenous donor sequence is between about 80 nucleotides to about 200 nucleotides in length; and/or (b) the exogenous donor sequence is a single-stranded oligodeoxynucleotide.

35. A method of modifying an HSDI 7BI3 gene in a cell, comprising: contacting the genome of the cell with: (a) a Gas protein; and (b) a first guide RNA that forms a x with the Gas protein and s a first guide RNA target sequence within the HSDI 7BI3 gene, wherein the first guide RNA target sequence comprises the start codon for the HSDI 7BI3 gene or is within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon, wherein the Gas protein cleaves or alters expression of the HSDI 7BI3 gene.

36. The method of claim 35, wherein: (a) the first guide RNA target sequence comprises any one of SEQ ID NOS: 20-81 and 259-263, optionally wherein the first guide RNA target sequence ses any one of SEQ ID NOS: 20-41, any one of SEQ ID NOS: 21-23, 33, and 35, or any one of SEQ ID NOS: 33 and 35; and/or (b) the first guide RNA ses a DNA-targeting segment that comprises any one of SEQ ID NOS: 1423-1484 and 1643-1647, optionally wherein the first guide RNA comprises a DNA-targeting segment that comprises any one of SEQ ID NOS: 1447-1468, any one of SEQ ID NOS: 1448-1450, 1460, and 1462; or any one of SEQ ID NOS: 1460 and 1462; and/or (c) the first guide RNA comprises any one of SEQ ID NOS: 500-561, 730- 791, 21, 1190-1251, 720-724, 950-954, 1180-1184, and 1410-1414, optionally wherein the first guide RNA comprises any one of SEQ ID NOS: 524-545, 754-775, 05, and 1214- 1235, or any one of SEQ ID NOS: 295-297, 525-527, 755-757, 985-987, 1215-1217, 307, 309, 537, 539, 767, 769, 997, 999, 1227, and 1229, or any one of SEQ ID NOS: 307, 309, 537, 539, 767, 769, 997, 999, 1227, and 1229.

37. The method of any claim 35 or 36, wherein: (a) the Gas protein is a nuclease-active Cas protein; or (b) the Gas protein is a nuclease-inactive Cas protein fused to a transcriptional activator domain or a transcriptional repressor domain.

38. The method of any one of claims 35-37, further sing contacting the genome of the cell with a second guide RNA that forms a complex with the Gas protein and targets a second guide RNA target sequence within the HSDI 7BI3 gene, wherein the second guide RNA target sequence comprises the stop codon for the HSDI 7BI3 gene or is within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the stop codon, n the cell is modified to comprise a deletion between the first guide RNA target sequence and the second guide RNA target sequence.

39. The method of claim 38, wherein: (a) the second guide RNA target ce comprises any one of SEQ ID NOS: 82-225; and/or (b) the second guide RNA comprises a DNA-targeting segment that comprises any one of SEQ ID NOS: 1485-1628; and/or (c) the second guide RNA comprises any one of SEQ ID NOS: 562-705, 792- 935, 1022-1165, and 1252-1395.

40. A method for decreasing expression of an HSDI 7BI3 gene in a cell, sing: contacting the genome of the cell with an antisense RNA, an siRNA, or an shRNA that hybridizes to a sequence within SEQ ID NO: 4 (HSDI 7BI3 ript A) and decreases expression ofHSDI 7BI3 Transcript A.

41. The method of claim 40, wherein the antisense RNA, the siRNA, or the shRNA hybridizes to a sequence present in SEQ ID NO: 4 (HSDI 7BI3 Transcript A) that is not present in SEQ ID NO: 7 (HSDI 7BI3 Transcript D), optionally wherein the antisense RNA, the siRNA, or the shRNA hybridizes to a sequence spanning the exon 6-exon 7 boundary of SEQ ID NO: 4 (HSDI 7BI3 Transcript A).

42. The method of any one of claims 35-41, further comprising introducing an sion vector into the cell, wherein the expression vector comprises a recombinant HSDI 7BI3 gene comprising a thymine inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the recombinant HSDI 7BI3 gene is optimally d with SEQ ID NO: 1, optionally wherein the recombinant HSDI 7BI3 gene is a human gene.

43. The method of claim 42, wherein the recombinant HSDI 7BI3 gene is an HSDI 7BI3 minigene in which one or more nonessential segments of the gene have been d with respect to a corresponding wild type HSDI 7BI3 gene, optionally wherein the d segments comprise one or more intronic sequences, optionally wherein the HSDI 7BI3 minigene comprises an intron corresponding to intron 6 of SEQ ID NO: 2 when optimally aligned with SEQ ID NO: 2.

44. The method of any one of claims 35-41, further comprising introducing an expression vector into the cell, wherein the expression vector ses a nucleic acid encoding an HSD17B13 protein that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15 (HSD17B13 Isoform D), optionally n the nucleic acid encoding the HSD17B13 protein is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 7 (HSD17BI3 Transcript D) when optimally aligned with SEQ ID NO: 7.

45. The method of any one of claims 35-41, further comprising introducing an HSD17B13 protein or fragment thereof into the cell, wherein the HSD17B13 n or fragment thereof is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15 (HSD17B13 Isoform D).

46. The method of any one of claims 28-45, wherein the Gas protein is Cas9.

47. A method for modifying a cell, comprising introducing an expression vector into the cell, wherein the expression vector comprises a recombinant HSDI 7BI3 gene comprising a thymine inserted n tides corresponding to ons 12665 and 12666 of SEQ ID NO: 1 when the recombinant HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1, optionally wherein the recombinant HSDI 7BI3 gene is a human gene.

48. The method of claim 47, wherein the recombinant HSDI 7BI3 gene is an HSDI 7BI3 minigene in which one or more ential segments of the gene have been deleted with respect to a corresponding wild type HSDI 7BI3 gene, optionally wherein the deleted ts comprise one or more intronic sequences, ally wherein the HSDI 7BI3 minigene comprises an intron corresponding to intron 6 of SEQ ID NO: 2 when optimally aligned with SEQ ID NO: 2.

49. A method for modifying a cell, comprising introducing an expression vector into the cell, wherein the expression vector comprises a nucleic acid encoding an HSD17B13 protein that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15 (HSD17B13 Isoform D), optionally wherein the nucleic acid ng the HSD17B13 protein is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 7 (HSD17BI3 Transcript D) when optimally aligned with SEQ ID NO: 7.

50. A method for modifying a cell, comprising introducing an HSD17B13 protein or fragment thereof into the cell, wherein the HSD17B13 protein or fragment thereof is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15 (HSD17B13 Isoform D).

51. The method of any one of claims 28-50, wherein the cell is a rodent cell, a mouse cell, or a rat cell, optionally wherein the cell is a pluripotent cell or a liver cell.

52. The method of any one of claims 28-50, wherein the cell is a human cell, optionally wherein the cell is a liver cell.

53. The method of any one of claims 28-52, wherein the cell is ex vivo or in vivo.

54. A method of treating a subject who is not a r of the HSDI 7BI3 rs72613567 variant and has or is susceptible to developing a chronic liver disease, comprising introducing into the subject: (a) a Gas protein or a nucleic acid encoding the Gas protein; (b) a guide RNA or a nucleic acid encoding the guide RNA, wherein the guide RNA forms a complex with the Gas protein and s a guide RNA target sequence within an HSDI 7BI3 gene, wherein the guide RNA target sequence includes or is proximate to a position ponding to position 12666 of SEQ ID NO: 2 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 2; and (c) an exogenous donor sequence comprising a 5’ homology arm that izes to a target sequence 5’ of the position corresponding to position 12666 of SEQ ID NO: 2, a 3’ homology arm that hybridizes to a target sequence 3’ of the position corresponding to position 12666 of SEQ ID NO: 2, and a nucleic acid insert sing a thymine flanked by the 5’ homology arm and the 3’ homology arm, wherein the Gas protein cleaves the HSDI 7BI3 gene in a liver cell in the subject and the exogenous donor sequence recombines with the HSDI 7BI3 gene in the liver cell, n upon recombination of the exogenous donor sequence with the HSDI 7BI3 gene, the e is inserted between nucleotides ponding to positions 12665 and 12666 of SEQ ID NO: 1 when the HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1.

55. A method of treating a subject who is not a carrier of the HSDI 7BI3 rs72613567 variant and has or is susceptible to developing a chronic liver disease, comprising ucing into the subject: (a) a Gas protein or a nucleic acid encoding the Gas protein; (b) a first guide RNA or a nucleic acid encoding the first guide RNA, wherein the first guide RNA forms a complex with the Gas protein and targets a first guide RNA target sequence within an HSDI 7BI3 gene, wherein the first guide RNA target sequence ses the start codon for the HSDI 7BI3 gene or is within about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1,000 nucleotides of the start codon or is selected fiom SEQ ID NOS: 20-81; and (c) an expression vector comprising a recombinant HSDI 7BI3 gene comprising a e inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the recombinant HSDI 7BI3 gene is optimally aligned with SEQ ID NO: wherein the Gas protein cleaves or alters expression of the HSDI 7BI3 gene in a liver cell in the subject and the expression vector expresses the recombinant HSDI 7BI3 gene in the liver cell in the subject.

56. A method of treating a subject who is not a carrier of the HSDI 7BI3 rs72613567 variant and has or is susceptible to developing a chronic liver disease comprising introducing into the subject: an antisense RNA, an siRNA, or an shRNA that hybridizes to a sequence within SEQ ID NO: 4 (HSDI 7BI3 Transcript A) and ses expression of HSDI 7BI3 Transcript A in a liver cell in the subject.

57. A method of treating a t who is not a carrier of the HSDI 7BI3 rs72613567 variant and has or is susceptible to developing a chronic liver disease comprising introducing an expression vector into the subject, n the expression vector comprises a recombinant HSDI 7BI3 gene comprising a thymine inserted between nucleotides corresponding to positions 12665 and 12666 of SEQ ID NO: 1 when the recombinant HSDI 7BI3 gene is optimally aligned with SEQ ID NO: 1, wherein the expression vector expresses the recombinant HSDI 7BI3 gene in a liver cell in the t.

58. A method of treating a subject who is not a r of the HSDI 7BI3 rs72613567 variant and has or is susceptible to developing a chronic liver disease comprising introducing an expression vector into the t, wherein the expression vector comprises a nucleic acid encoding an HSD17B13 protein that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15 (HSD17B13 Isoform D), wherein the sion vector expresses the c acid encoding the HSD17B13 protein in a liver cell in the subject.

59. A method of treating a subject who is not a carrier of the HSDI 7BI3 rs72613567 variant and has or is susceptible to developing a chronic liver disease comprising introducing a messenger RNA into the subject, wherein the messenger RNA encodes an HSD17B13 n that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15 (HSD17B13 Isoform D), wherein the mRNA expresses the HSD17B13 protein in the liver cell in the subject.

60. A method of treating a subject who is not a carrier of the HSDI 7BI3 rs72613567 variant and has or is susceptible to developing a chronic liver e comprising introducing an HSD17B13 protein or nt thereof into the liver of the subject, wherein the WO 36758 HSD17B13 protein or fragment thereof is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15 (HSD17B13 Isoform D. 8&3on mmfimmxm mficgfi Qwfim $ng mfinzm om2§<w , 3mg: .vafisw qummmmm Q uuuuuuuuuuuu 3 Ya?“ 3‘ Em m m wzmmm m mxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxfl. N. 3 m mEomoEofio fimfimm: 9 8&3on mmfimmxm www.mflwsmmocgfi my fi mfimzm mmngquammw a a £3 flow _ a o Emmam J :mN mEOmOEEEQ Emtmmm m 3 am E W;3% _l mama Emmfl 3%” $-23 gummfi NEE ”mama 0%? amd‘mwozwd Amgéogmd MEHEWEO www-mgwxd Aggdrg K. a P ......................... ll Tl Til Til g TEEiii ggaging ........... Taiiiiai .. A8 a fimmvmo Wm T: 33330 ganmgfid T: awfimgmg 33-33% fig: agnmgzwo Eggfid T: @3333 $3-39me @E ”gnaw gay. E: mam Ewe E: 6%“ $me a? 3% gag fix 8% @me ”3 E w mm mm m 32 ma E Q a m among E «E «E 5 «5. «E E «E «E E «E «E» Awmmmmug momamammm $2ch“gag.ngchmwmafigfiagfi ammmwgfigaz.wzvmwngamfiuggga 323..mewwwmwfiggggmmé 9%ch magma 293202 figwfiggEmamggmuasmmgagamx (3:529 3% 5%.“ $33 Egg 3%: $3333 figg E flawmgmg @3ng Ammd-mm_a§ .. .. .. w mo viii “iii g 6 0 ‘mm abgmm T: magi? “www.mmgm: An: afimmdgd 55.3% T: $3.33 agagwwg Mg: mggdgd @33de Egg E am g gm E 3. m3 am mm mg gm mm 33 mg an mm 3 E mm E a” m E NE mm aagmm .5. «E «Eh E é «EM. E «E «E E «E «EH Engage?“gamwgwmmgfimmagm E3 gmufimgazfimgngIfiz wmmsfiw gfiflgma mmgnmw 1mg cwwgmmgfimfigw.wiwgugmmmefi {bag {HRH mm mm fl; .mm <3, @E h 9 5?? {HEP “mm ; mm <5 .mm «5 .mm ueggsajdxa vmam uogssejdxe VNaLu mm coxw mm “mm. L Ea E 5 mm cm Egg? comwmmaxm El mm ”272G Reccmbination rate ) 9:. Q CD C) O (XI? {.0 fl. N mhwflmfimi m.mw fimfimmmi mmmmmmfimmi 133i mmnmm 3% metmmxi TEE Eu ”mm mekmmfii .me cgflwfi “.mmmmmfimmi wa mqfimi. (engm—-d)0Lfiogm WO 36758 Recombination rate- 9:. cm ..... Emma Ems» fimflfizm “.mmaxatmm ..... y m :muamxi .mmmmmahwmm iv IIIIIIIEIII mwmtmmxlw EETEETE mm.ww 3% Eu mm 3% a .mm %E...V cgflwfi ”(mmmmmnmmm Nmm ..... (enleA—ud)0‘vfiogm "FA/TA "FA/TA Transcajpt 58 65} T/TA Fifi "UTA HQ. ”WT TIT 00 L0 T?” N ”3. 0. W. 6:2 Y'" V“ C.) CD uagssajdxa VNELU uoggsmdxa VNaLu TNTA TAI'TA 5A ptG ript 56 T/TA