NZ795437A - Epigenetic markers and related methods and means for the detection and management of ovarian cancer - Google Patents

Abstract

The present invention relates to methods of determining the presence or absence of an ovarian cancer in a woman, as well as to related methods to determine the response to therapy against ovarian cancer in a woman. Such methods are based on the detection – from cell-free DNA of said woman – of one or more methylated (or un-methylated) CpGs being associated with differentially methylated regions (DMRs) of the present invention; such as methylation (or un-methylation) at one or more or all of certain CpGs being associated with such DMRs. Accordingly, such methods have diagnostic, prognostic and/or predictive utility for detecting or managing ovarian cancer in women. The present invention further relates to nucleic acids comprising certain sequences that may be detected during the method, or nucleic acids (such as probes and/or primers) that are useful to detect such sequences, as wells as compositions, kits, computer program products and other aspects that are useful for or related to the practice or application of such methods. or more methylated (or un-methylated) CpGs being associated with differentially methylated regions (DMRs) of the present invention; such as methylation (or un-methylation) at one or more or all of certain CpGs being associated with such DMRs. Accordingly, such methods have diagnostic, prognostic and/or predictive utility for detecting or managing ovarian cancer in women. The present invention further relates to nucleic acids comprising certain sequences that may be detected during the method, or nucleic acids (such as probes and/or primers) that are useful to detect such sequences, as wells as compositions, kits, computer program products and other aspects that are useful for or related to the practice or application of such methods.

Description

The present invention relates to methods of determining the ce or absence of an ovarian cancer in a woman, as well as to related methods to determine the se to therapy against ovarian cancer in a woman. Such methods are based on the detection – from ree DNA of said woman – of one or more methylated (or un-methylated) CpGs being associated with entially methylated regions (DMRs) of the present invention; such as methylation (or un-methylation) at one or more or all of n CpGs being associated with such DMRs. Accordingly, such methods have diagnostic, prognostic and/or predictive utility for detecting or managing ovarian cancer in women. The present ion further relates to nucleic acids comprising certain sequences that may be detected during the method, or nucleic acids (such as probes and/or primers) that are useful to detect such sequences, as wells as compositions, kits, computer program products and other aspects that are useful for or related to the practice or application of such methods.

NZ 795437 ETIC MARKERS AND D METHODS AND MEANS FOR THE DETECTION AND MANAGEMENT OF N CANCER DESCRIPTION The present invention relates to methods of determining the presence or absence of an ovarian cancer in a woman, as well as to related methods to determine the se to therapy against ovarian cancer in a woman.

Such methods are based on the detection — from cell-free DNA of said woman — of one or more ated (or un- methylated) Cst being associated with differentially methylated regions (DMRs) of the present invention; such as ation (or hylation) at one or more or all of certain Cst being associated with such DMRs. Accordingly, such methods have diagnostic, prognostic and/or predictive y for detecting or managing ovarian cancer in women. The present invention further relates to nucleic acids comprising certain sequences that may be detected during the method, or nucleic acids (such as probes and/or primers) that are useful to detect such sequences, as wells as compositions, kits, computer program ts and other aspects that are useful for or related to the practice or application of such methods.

Three quarters of ovarian cancers are diagnosed once the tumour has spread into the abdomen and long- term survival rates of these women are low (10-30%) (Ref. 1). High-grade serous (HGS) ovarian cancer (OC) accounts for 70—80% of OC deaths and the survival s have not changed significantly over the past few decades (Ref. 2). Early diagnosis and personalised treatment still remain the t unmet needs in combating this devastating disease (Ref. 2).

A number of ovarian cancer biomarkers have been studied in the past. Amongst those, CA125, which was discovered more than 30 years ago (Ref. 3), is still the ‘gold standard’ despite the relatively low sensitivity for early epithelial ovarian cancer and the modest positive tive value (Ref. 4). The 35 most promising ovarian cancer biomarkers were evaluated in samples taken up to 6 months prior to OC diagnosis from 118 women and 951 age- matched controls from the Prostate, Lung, ctal, and n (PLCO) Cancer Screening Trial. At a fixed specificity of 95%, CA125 had the best sensitivity (Ref. 5). The performance of CA125 dropped dramatically when samples taken > 6 months prior to diagnosis were evaluated (Ref. 5). Recently it was trated that the performance of the Risk of Ovarian Cancer Algorithm (ROCA) demonstrates superior performance characteristics during screening, but this requires serial blood samples that are not available in patients presenting clinically (Refs. 6, 7). In addition, the dynamics of CA125 in women undergoing neoadjuvant chemotherapy (NACT) are of limited use in predicting disease response and outcome (Ref. 8).

The vast majority of protein-based tumour markers are produced not only by cancerous but also non- neoplastic normal cells; CA125 is produced by mesothelial cells (i.e. peritoneum and pleura) and hence benign or inflammatory ses can result in aberrant ions of serum CA125. [5] Recently, markers based on DNA shed from tumour cells, have shown great promise in monitoring treatment response and ting prognosis (Refs. 9-13). But efforts to characterise the cancer genome have shown that only a few genes are frequently mutated in most s with the gene mutation site differing across individuals for similar tumours. Hence, the detection of somatic mutations is limited to patients that harbour a predefined set of mutations. The necessity of prior knowledge regarding specific genomic composition of tumour tissues is one of the 40 limiting factors when using these ‘liquid ’ approaches for early detection or differential diagnosis of a pelvic mass. Current technology allows for the detection of a mutant allele fraction of 0.1% (which is one mutant molecule in a background of 1000 wild-type molecules) (Refs. 9, 14).

The development of cell-free DNA based early cancer detection tests poses two major challenges: (1) a very low abundance of cancer-DNA in the blood and (2) an extremely high level of “background DNA" (shed from white blood cells (Ref. 15)) in all population based cohorts which allow for the validation of potential screening markers years in advance of current sis.

Alteration of DNA methylation (DNAme) is (i) an early event in cancer development, (ii) more ntly observed than somatic mutations and (iii) centred around specific regions, i.e. CpG islands (Ref. 17). Together with its chemical and biological ity, the detection of aberrant DNA methylation patterns in serum or plasma provide a novel strategy for cancer diagnosis as evidenced by several proof of principle studies in the past (Refs. 9, 10, 13, 15, 18-20). The fact that technologies to detect DNA methylation allow for the detection of specific methylation patterns (for example, full methylation or un-methylation) of all of (for example, between 7 and 16) certain linked Cst in a region of 0 base-pairs as opposed to single point mutations (e.g. in the TP53 gene) is likely to improve both the performance characteristics of the test and the detection limit of the assay. Plasma SEPT9 methylation analyses — currently the only cell-free DNA which is available for cancer screening in the clinical setting — demonstrates a specificity of 79% and a sensitivity of 68% for detection of colon cancers (Ref. 21). Maternal plasma cell-free DNA testing for foetal trisomy has already become al ce as it has a higher sensitivity and a lower false positive rate compared to imaging-based techniques (Ref. 22). [8] The inventors have ed two different epigenome-wide approaches to identify the most ing DNAme-based markers, developed serum tests and validated their performance benchmarking against serum ovarian cancer marker CA125.

It has been ted that DNA methylation s have promise (and challenges) for early detection of s cancers such as ovarian cancer (Ref. 20). Indeed, there are a number of publications that disclose various epigenetic biomarkers and their association with various cancers, including women’s cancers such as ovarian cancer, and the use of such biomarkers (including in certain combinations) for the detection and/or management of one or more of such cancers: W02002/018631A2; /018632A2; W02007/019670A1; EP1862555A1; W02009/153667A2; W02012/104642A1; W02012/138609A2; W02012/143481A2; U52013/0041047A1; W02013/09661A1). In particular, single-CpG-resolution methylation analysis (including patterns/signatures) in certain specific markers or genes (such as DNA hypermethylation of the CpG sites on the A, GRM6, ZNF540, ZFP42, EOMES HOXA9, POU4F2, TWIST1, VIM, , RIMS4, PCDHAC1, Z, ASCL2, KCNQ1, C2CD4D, PRAC, WNT3A, TRH, FAM78A, , SLC13A5, NKX6-2, GP5 and HOTAIR genes) has identified cancers, or aggressive types thereof, such as renal cell carcinomas (Arai et al, 2012; Carcinogenesis 33:1487), bladder cancer (Reinert et al, 2012; PLos ONE 10:e46297), other cancers including breast cancer (Refs. 30, 31. re et al, 2015; Clinical Epigenomics , ovarian cancer (Teschendorff et al, 2009; PLos ONE 4: e8274) and/or association with chemotherapeutic response in ovarian cancer (Ref. 25).

Hence, there is still a need, from one or more of the above or perspectives, for improved methods to determine the presence or absence of ovarian cancer in a woman, ably in a non-invasive ; such as by the use of ree DNA of said woman (eg isolated from a sample of a circulatory fluid). Preferably, such methods will have ed ability to discriminate ovarian cancer from benign pelvic mass, and/or high-grade serious (HGS) ovarian cancer from less severe or aggressive forms of ovarian cancer; such as by having improved specificity and/or sensitivity for the phenotype/disease to be detected. Such methods would provide a significant shift in the clinical paradigm for early-detection, diagnosis (eg by an in-vitro method) and/or management of ovarian cancer; in particular of HGS ovarian cancer and or chemotherapy-responsive ovarian cancer; and in particular providing the 40 potential for dualisation of treatment for women suffering from ovarian cancer. ingly, it is an object of the present invention to provide alternative, improved, simpler; cheaper and/or integrated methods, means, compounds, compositions, kits and other aspects that address one or more of these or other problems (such as those set forth elsewhere herein). Such an object underlying the present invention is solved by the subject matter as disclosed or defined anywhere , for example by the subject matter of itemised embodiments or the claimed embodiments.

Generally, and by way of brief description, the main aspects of the present invention can be bed as follows: In a first aspect, and as may be further described, defined, d or othenNise disclosed herein, the ion relates to a method of determining the presence or absence of, or response to therapy against, an ovarian cancer in a woman, said method comprising the steps: 0 Providing a biological sample from said woman, said sample comprising cell-free DNA of said woman; fl 0 Determining, in at least one molecule of said cell-free DNA, the methylation status at one or more Cst located within one or more of the nucleotide ces comprised in one or more of the respective DMRs of the present invention independently selected from the group consisting of DMR#: #141, #204, #228, #144, #123, #129, #137, #148, #150, #154, #158, #164, #176, #178, #180, #186, #188, #190, #192, #200, #202, #208,#210, #213, #214, #219, #222, #223, #224, #225 and #226, or a nucleotide sequence present within about 2,000bp (such as within about 200bp) 5’ or 3’ thereof, or an a||e|ic variant and/or complementary sequence of any of said nucleotide sequences, m, the presence in at least one of said cell-free DNA molecules of one or more: (i) ated Cst associated with one or more of the hyper-methylated DMRs of the present invention; and/or (ii) un-methylated Cst associated with one or more of the hypo-methylated DMRs of the present invention, indicates the presence of, or a reduced response to therapy against, an ovarian cancer in said woman.

[14] In a second aspect, and as may be further described, defined, claimed or othenNise disclosed herein, the invention relates to a chemotherapeutic agent, such as one selected from the group consisting of: carboplatin, paclitaxel, docetaxel, cisplatin, liposomal doxorubicin, gemcitabine, tedin, etoposide, hosphamide, an angiogenesis inhibitor (such as bevacizumab) and a PARP inhibitor (such as olaparib), for use in a method of therapy of ovarian cancer in a woman, wherein said chemotherapeutic agent is administered to a woman within about 3 months of said woman having been predicted and/or determined, using a method of the first aspect, to n_ot respond to a therapy against ovarian cancer.

In a third aspect, and as may be further described, defined, d or otherwise disclosed herein, the invention s to a c acid comprising a nucleic acid ce consisting of at least about 10 contiguous bases (preferably at least about 15 contiguous bases for any DMR other than DMR #222) comprised in a sequence producible by bisulphite conversion of a sequence comprised within a DMR selected from the group consisting of DMR#: #141, #204, #228, #144, #123, #129, #137, #148, #150, #154, #158, #164, #176, #178, #180, #186, #188, #190, #192, #200, #202, #208,#210, #213, #214, #219, #222, #223, #224, #225 and #226, or an c variant and/or complementary ce of any of said nucleotide sequences.

In other aspects, the invention also relates to a nucleic acid probe, a nucleic acid PCR primer pair, a tion of nucleic acids of the invention, a kit and a computer m product, in each case as may be described, defined, claimed or otherwise disclosed herein, and in each case related to use within or in connection with a method of the ion and/or to detect one or more a nucleic acid of the invention.

The figures show: 40 [18] FIGURE 1 depicts the study design. Using two different epigenome-wide technologies, 711 human tissue samples have been analysed to fy a total of 31 regions whose ation status has been analysed in two sets consisting of 151 serum samples. Three markers have been validated in two ndent settings: (1) Serum Set 3 which consisted of 250 serum samples from women with various benign and malignant conditions of the female genital tract; and (2) NACT (NeoAdjuvant ChemoTherapy) Set consisting of serial samples from women with advanced stage ovarian cancer before and during chemotherapy. Samples obtainable from the UKCTOCS (United Kingdom Collaborative Trial of Ovarian Cancer Screening) sample collection may be included in a third tion set to include serum samples from those women in the l arm who developed n cancer within 2 years; for each case, a number of (such as three) control women who did not develop ovarian cancer within 5 years of sample donation can been matched to those women who did so develop ovarian cancer.

FIGURE 2 depicts the principles of methylation pattern discovery in tissue and analyses in serum. Reduced Representation Bisulfite Sequencing (RRBS) was used in tissue s in order to fy those CpG regions for which methylation patterns discriminate ovarian cancer from other s, in ular blood cells which were deemed to be the most abundant source of cell-free DNA. An example of region #141 is provided which is a 136 base-pair long region ning 7 linked Cst. A cancer pattern may consist of reads in which all linked Cst are methylated, indicated by “1111111” (Panel A). The tissue RRBS data have been processed h a bioinformatic pipeline in order to identify the most promising markers (Panel B). The principles of the serum DNA methylation assay are trated in Panel C.

FIGURE 3 depicts serum DNA methylation analysis in women with benign and malignant conditions of the female genital tract. Pattern frequencies for the different regions and CA125 levels analysed in Serum Set 3 samples are shown and horizontal bars denote the mean (Panels A-C; ns not significant; *p<0.05, **p<0.01, ***p<0.001; Mann-Whitney U test compared to HGS; H, Healthy; BPM, benign pelvic mass; BOT, borderline s; NET, non- epithelial tumours; OCM other cancerous malignancies; NHGS, non-high grade serous n cancers; HGS, high grade serous; OC ovarian cancers). Based on Set 1&2 analyses cut-off thresholds of 0.0008, 0.0001 and 0.0001 for regions #141, #204 and #228, respectively, to discriminate HGS OC from H or BPM women were chosen and validated in Set 3; combining Sets 1-3 the cut-off thresholds have been refined for s #204 and #228 so that the final cut-offs were 0.0008, 0.00003 and 0.00001, respectively; the sample was called positive if at least one of the three regions showed a pattern frequency above the cut-off; sensitivities and icities to discriminate HGS from H&BPM are shown in Panel E. The overlap between CA125 positive s (cut-off >351U/mL) and the three DNA methylation (DNAme) marker panel in cases and controls is shown in Panel F.

FIGURE 4 depicts the dynamics of serum DNA methylation markers and CA125 as a function of exposure to carboplatin-based chemotherapy. The changes in pattern frequency of the three s as well as CA125 is shown before compared to after 2 cycles of chemotherapy (Panels A-D). The changes of markers during chemotherapy and whether this can predict response (as described in Supplementary Information) to chemotherapy in all patients and in those who had no macroscopic residual disease after interval-debulking surgery (R0/1) is shown (Panel E).

Definitions of CA125 and DNA methylation positivity are provided in FIGURE 3.

FIGURE 5 depicts the thm which first determines sets of consecutive CpG sites of maximum size, from which multiple potentially overlapping subsets are derived, which still meet the selection criteria.

FIGURE 6 depicts cancer-specific differentially methylated region (DMR) discovery with Illumina 450K methylation arrays. (A) Schematic illustration of DMRs that are discovered by the single CpG and range approaches.

Each horizontal line of lollipops indicates neighbouring Cst in a single DNA molecule ted from the indicated tissue. Filled lollipop indicates a methylated CpG, and an ed lollipop indicates an unmethylated CpG. 450K methylation arrays measure the ratio (% of methylation) of methylated and unmethylated molecules at a given single CpG location. See Supplementary Information for s on the DMR discovery s. row” ('1‘) Single CpG 40 DMRs (high scoring); “left/right—arrow" ((--)) Range of DMR (high scoring); asterisk (*) Not fied as DMRs because of the methylation in WBCs, “hash” (#) Not fied as high scoring DMRs with single CpG approach because the methylation difference between OC and other control tissues (=colon, lung, liver, rectum, endometrium, fimbriae and benign ovarian tissue) is not large enough. Identified as DMRs with range approach because the pooling of neighbouring CpG information increases statistical robustness. (B) Example of the methylation data for a high scoring DMR. The #228 targeted BS reaction was designed for this DMR.

FIGURE 7 depicts a ure for the ion of cell-free DNA from a plasma or serum biological sample.

FIGURE 8 s pattern frequencies for the different s analysed in Serum Set 1 samples. H, Healthy; BPM, benign pelvic mass; NHGS, non-high grade serous ovarian cancers; HGS, high grade serous ovarian cancers.

Horizontal bar denotes mean. ns not significant; *p<0.05, Mann-Whitney U test compared to HGS.

FIGURE 9 depicts pattern frequencies for the ent regions analysed in Serum Set 2 samples. H, Healthy; BPM, benign pelvic mass; BOT, borderline tumour; NET, non-epithelial tumours; OCM, other cancerous malignancies; NHGS, non-high grade serous ovarian cancers; HGS, high grade serous ovarian cancers. Horizontal bar denotes mean. ns not significant; * p<0.05; ** p<0.01; *** p<0.001, Mann-Whitney U test compared to HGS.

[27] FIGURE 10 s coverage (number of reads) for the three different regions ed in Serum Set 3 samples. H, Healthy; BPM, benign pelvic mass; BOT, borderline tumour; NET, non-epithelial s; OCM, other cancerous malignancies; NHGS, non-high grade serous ovarian cancers; HGS, high grade serous ovarian cancers.

Horizontal bar denotes mean. ns not significant; * ; Mann-Whitney U test compared to HGS.

FIGURE 11 depicts CA125 levels measured in the NACT (the neoadjuvant chemotherapy) Serum Set samples. Samples taken before chemotherapy, after the first cycle of chemotherapy, and after the second cycle of chemotherapy. ns not significant; ** p<0.01; hitney U test compared to before chemotherapy.

FIGURE 12 depicts pattern frequencies for the top 3 reactions measured in NACT Serum Set samples.

Samples taken before chemotherapy, after the first cycle of herapy, and after the second cycle of herapy. * ; ** p<0.01; ** p<0.01; Mann-Whitney U test compared to before chemotherapy.

[30] FIGURE 13 depicts coverage (number of reads) for the top 3 reactions measured in NACT Serum Set samples. Samples taken before chemotherapy, after the first cycle of chemotherapy, and after the second cycle of chemotherapy. ns not cant; Mann-Whitney U test compared to before chemotherapy.

The present invention, and particular non-limiting aspects and/or embodiments thereof, can be described in more detail as follows: In a first aspect, the invention relates to a method of determining the presence or absence of, or response to therapy against, an ovarian cancer in a woman, said method comprising the steps: 0 ing a biological sample from said woman, said sample comprising cell-free DNA of said woman; fl 0 Determining, in at least one molecule of said cell-free DNA, the methylation status at one or more Cst d within one or more of the nucleotide sequences independently selected from the group consisting of: SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 and 31 (for example, within one or more of the nucleotide sequences sed in one or more of the respective DMRs of the present invention independently selected from the group consisting of DMR#: #141, #204, #228, #144, #123, #129, #137, #148, #150, #154, #158, #164, #176, #178, #180, #186, #188, #190, #192, #200, #202, #208,#210, #213, #214, #219, #222, #223, #224, #225 and #226), or a nucleotide sequence present within about 2,000bp (such as within about 200bp) 5’ or 3’ thereof, or an c variant and/or complementary ce of any of said nucleotide sequences, m, the presence in at least one of said cell-free DNA molecules of one or more: (i) methylated Cst associated with (such as located ) one or more of the hyper-methylated DMRs of the present invention (eg, as identified in 40 TABLE 1A), for example associated with (such as located within) one or more of said nucleotide sequences independently selected from: SEQ ID NOs: 1, 2, 3, 4, 10, 12, 14, 15, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29 and ; and/or (ii) un-methylated Cst associated with (such as located within) one or more of the hypo-methylated DMRs of the present invention (eg, as identified in TABLE 1B), for example associated with (such as located within) one or more of said nucleotide sequences independently selected from: SEQ ID NOs: 5, 6, 7, 8, 9, 11, 13, 16, 17, 22 and 31, indicates the presence of, or a d response to therapy against, an ovarian cancer in said woman.

The genomic sequence and genome coordinates (hg19) of one class of the regions of the genome used in the present ion as a source of epigenetic s, ie those where the presence of methylation at one or more Cst therein (or associated therewith, such as within about 2,000bp - such as within about 200bp - 5’ or 3’ thereof), and represent the hyper-methylated cancer-specific differentially methylated regions (DMRs) of the present ion, are set out in TABLE 1A. Any of such Cst (including those of an allelic variant and/or mentary sequence of any of the respective said nucleotide sequence/s) is one considered “associated with” the respective hyper-methylated -specific DMR of the present invention.

TABLE 1A: Identity, source, genome-coordinates and genomic sequences of the hyper-methylated DMRs of the present invention AmP 9°Ii n . . 5 QE ID Data Ampllcon genomlc sequence DMR coordinates Class N0. basis antC Gs are underlined) (hg19) P CATCCGGAGGCCCAGGGGTGAGGAC"TQCCAQGGAAGG 78004395- AGGCACAQATTCAGCCCATGACACCGCCACCTQGQTG 141 RRBS Hyper 1 178004530 GTGC"GTAGGGGGAAGCTCAGGCAC"CACQAGGACAGGA CCCGGGGAA"CCGC"G GATA"TCGG"GGAGAGCCGCAGC"GCC@CCGCGGGGCCC chr1:151810784— CAGGCGCAGCACGC"CTCGCGCGr‘GGGCCGCAGCTGGCAG 204 RRBS Hyper 2 151810937 CACAGGAAGTCAGG"GGAAGAGQGCGGCGTGGGQGCC gooGCGGCGCGGCGAGTGCGGGCTGG"A"CGGC chr2'219736276- TGGGCGAGC"GCTGCAGr‘GCGGcr‘GCCAGGQCC 228 450K 219736386 CCGcGGGCGGGCCCC"CCCQGCCCTCCGGCCFECCQGC Hyper 3 AcccCQGACCCCCTGGCCCCGCGGGCTCC CCTGACGTGGGTCCCCCAGGGQGQTGCCAAG chr19:58220413- GCTTAGAQCTTTQF‘GCAGGAGGGACGAQAC"CCCCTC 144 RRBS Hyper 4 58220552 Aged“TgrcocCCCAACTQGQCTTGCTATTCTGA "CCGG"GAACACACC"CAGA "CCCCGGAG"CCGGAGCTCAGGCCAGr‘GGCAGr‘CGACCCA chr17:70112132- GcccCQAGAC"ccc"CACGCQCTCCAAAACCAAAAQG 154 RRBS Hyper 10 70112268 ACACGAAGC"GGG"GAAGcgr‘AGCTr‘GCAGGAG CCAGGGAGA"GCGC"CT GAC"CGCGAGGWW“CCAGCAGC"CATTCGGGACGGCGG chr4:174427917- "GTCTAGTCCAG"CCAGGGr‘AAC"GGGC"C"C"GAGAGTC 164 RRBS 12 174428054 CGACC,1CCA go CTGGGAGQAGTGG TQAGT,1 ,1 ,1 ,1 CAGA Hyper "Gcr‘GGGAACCGr‘CGcr‘T GGCAGGAGCGCCCCAC"A"GCGCAAGCCCG"GGCC"GGAG chr19:13215409— AGCGC"GAAGG"GGGAGGGGGAAGAGGGGCAGAACCCCCG 178 RRBS Hyper 14 13215550 EGGAGQAGCGCACAGC"GCECCCCGTGGCQCW‘CGG GAATCGCTGGU‘CCGGCTU‘GG cTGCAGAAGCGCACTTTGC"GAACACCCCGAGGACG"GCC chr3:192125846- TCTCGCACAGGGAGQCCCGTC""TGCTGGGGCTGGAGQ 180 RRBS Hyper 15 192125980 GQCTTGGAGGCQACACTQGr‘QCTGTTGGACTCCCTC GCCTGCCGCTr‘CTGC GTCAGACGAGAGCCTGGGGTCAAFGTQAGGTGGAGQAQ chr9'79629064- 190 RRBS 79629172 QCTGGCAQGCAACCCTGAGCC"GCGCGGCC§G§CTA" Hyper 18 CCCCTGGCTCr‘CCGCTGCTGGcr‘GGACCC CGGr‘AGGr‘CA"CCAGCAGCAGGGCTCCAQTQGTCTE" chr12:75601294— EA"GCCCCAGAAGGCCAGCTCCchr‘QAAGAGQGCCg 192 RRBS Hyper 19 75601437 QCACAQ"CTGcGGGGCAGTGCAGCWGCQGTGQGflG "AAr‘TGAGCACA"AGGCGAAGACG 38999180- AATCAGCCCAGCAACCGGCGACCCCAAGCGCGGQACCGC 200 RRBS 138989294 AAAGGGAGTGCT"GCCCATCCGCGT""GAAAGCAGAU‘TT Hyper 20 ""C"@GCAGGAACACAGGAC"CACC"GCCAGTGG 202 RRBS chr1:2987508- Gr‘GCGAACAAGACCGGGCGTT"CGCCGCCGACGCGAAGGG Hyper 21 2987655 GC"G"C"G"GCGCGGCGTTGCGGGCCCTCCGCGCG"GGGG TGTGCGTGTTCGGGTTQQGTTCTGTGTGTGCACQ GCGGGCCTGC"CAGAG"CGGGACCACCG "GCA"ACAGA""AC"G"AGGACCAT""CC"G"GCC""T"A 210 450K f?£§§f§i§}3499 AAAAATCCA“whoTEEN“TAAATACACAAAAACCAAAGAT Hyper 23 "T""ACAAC"CC CCGC"CGGGAA"GGGAA"A"AGC"ACATA"GGGAAAACGC chr2106776938- 213 450K 106277040 gG"GCAGGGAGAAAACCAA"TCAGTGAGGAG§§GAGG§§C Hyper 24 AGGAC"GTGGAGTGTGCATCCGG chr3141516260- cTGC""AAAGGCGCAGAGGAGCAGCTGGGAAggAGAACAA 214 450K 141516353 AGgchCAGGcccccc"ggGAGGAAGGAAGGAGAGAGccc Hyper 25 CAGGAAACAGC"GA GGAT AAG ,TGG WGGHGEHAAA A An AENGTGAGA ATGGGGATGGQGA chr16:30484157- 219 450K GCTG c GGG CT T c ggG GGGAGGAGG Hyper 26 CAGGGGAAGGGACA"G"G"C" dw3311809437- TAGGC"ACAGGAAGAGGCA""TCC"A"AGA"GA§§GC"G" 222 450K Hyper 27 111809506 AAAA"""TAAGC"GAG""CC"CCAGGAAG" AA A A A“G G G G GGHHGT T" A"AA" A TA A A A TTT "AA dw10fl20489250 “G G GHG GHGG G 223 450K 0 CACGGAAGTG TGCAA ACAACC CT GTACATCAG Hyper 28 -120489333 CAGT-— GG"CCCCC"CCCCGAGCCA"GAAGAGCTGCCTG§§GCCAT chr111874037- 224 450K 1874133 C""GGCCC"ggCACCngTC"CTG"CACCCCAGGCCCCTG Hyper 29 TAACT"GC"TAACGC"T GAAGC""GACACTCC"GGCCCCAAACACTGCCTGGCTACA chr7142422193- 225 450K ' ACACGA"A"CCAGGGACAGA"ACC"TCCATGTACAGCAAG Hyper 30 142422278 — CTGTGG The genomic sequence and genome coordinates (hg19) of the other class of the regions of the genome used in the present invention as a source of epigenetic markers, ie those where the absence of methylation at one or more Cst therein, (or ated therewith, such as within about 2,000bp - such as within about 200bp - 5’ or 3’ thereof), and represent the hypo-methylated cancer-specific DMRs of the present invention, are set out in TABLE 1B.

Any of such Cst (including those of an allelic variant and/or complementary sequence of the respective said nucleotide ce/s) is one considered “associated with” the respective ethylated cancer-specific DMR of the present invention.

TABLE 1B: Identity, source, genome-coordinates and genomic sequences of the hypo-methylated DMRs of the present invention AmPlicon . . SEQ ID DMR Data . on c sequence . coordlnates Class N0. # basus (relevant Cst are underllned). (h919) 1271152- GCGAAGCAGGAGTAGC"GCCGGGCCCCAQAGCCTCQTC 123 RRBS 12712'71 @Tr‘cr‘GGTTQGGT""CTCQAGTTTTGCTACCAGCQA Hypo 5 GGCTG"GQGGCAAC"GGGTCAGCC"CCCGTCAGGAGAGA AAC"C"GC"GAG"GAGC"CACAAACAGGGCATAACCGAGA chr11 _ 69054638- 129 RRBS CGCGGGAATGCC"GGGTCGCCGQCAGTCACCGGGCAGGG Hypo 6 69054'757 CCGCCCTCCCCTGTGGGTCAGCAAAAACGG"GTCAAGTGA ACTCCGCCACACACACAGCTGTACCCGGCACAACACGCGG chr12:132896275 CCACAGGTCACC"CAGGTQCCF‘QGGTGCTCCTCCCGCA 137 RRBS Hyp0 7 -132896404 GccCCAggTAGACAGAAGACA""CCTQQGGCCTGGGTGCC CAGCCTCCCG GAGGTAATGGAAGCGGCCATCCTTGTCCTCGCTCCGCGCC 2359599- 148 RRBS 72359718 TGGC"GAAGQATCGGGGTCGAACACGTTCACGTCTTTGA Hypo 8 ACAQGGCGCTG"G"CATGGGTGTCCGGATGCTATACAT GCGGGCACCTGTAG"CCCAGCTACTCGGGAGGCTGAGGCG 150 RRBS chr7.156735029- _ _ _ Hyp0 9 GGAGAATGGCG"GAACCCGGGAGGCGGAGC"TGCAGCGAG 156735165 CQAGATCGCGCCACQCACTCCAGCCTGGGQACAGAGC GAGAC’ICCG’IC'IAAAAA GAcTc"GTC"CAAAAAAGAAAAAAAr1AGGGccGGGCGQG chr16:74441696- r"GGCTAQCWG"CATCCAGCACFTTGGGAGGCQAGG 158 RRBS Hypo 11 74441831 EGG"GGA"CA§AGG"§GGAGAT@ATACCATCCTGGG "AACACGGr‘GAAACCC "AACCCAT"TCW“"A""AAA"TGCA'IGAAGAAGGCCGGGQ chr6:119107203- GCGGr‘GGC"CACGCC"G"AA"CCCAGCACTTTGGGAGGCQ 176 RRBS Hyp0 13 119107340 gAGGgGGCGGATACGAGGTAGGAGATGAGACCACGG "GAAACCCCGTC"C"AC" CGTG"TAGCCAGGA"GG"C"CGACCTCC"GACCTCGTGAT chr22:21483239- GCCTQGCCTCCCAAAGTGCFEGGAFTAAAGGQ 186 RRBS Hyp0 16 21483384 ’1GAGCCACCGCGCQGGCQAGACTC"G"CT"AAAAAAAA AAGGCCr‘GGGCTGr‘GGCAcr‘TTGGGA AGAGTFECACTccGAAGAC"CCAGATTQAGAGTTGCGG chr19:18497131- AAACGU‘ACGAGGACCTGC"AACCAGGU‘GCGGGCCAACC 188 RRBS Hyp0 17 18497271 AGAGC"GGGAAGA"r1§AACAchccr1§chcGGcccc TGCAGTCGGATACTACGCC ATWGTCCGGGCACGGTGGCTAQCCTGTAA" chr8:55467518- CCCAGCAC""r"GGGAGGCQAGGQGGQGATAQAGG" 208 RRBS Hyp0 22 55467638 CAGGAGAr1§AGAcCATCTGGCGAACA"GG"GAAACCTC GGGGGGAC"G"CGr‘TAATTCACTGccr‘AATGACCGCGGCC chr1 226 450K 3086542 CGCGCGC"CQAG’IM’IQGGTGATG’IA’IGTGGACTGTGC Hypo 31 ACACCTCG’IGG In particular embodiments, the present invention may not include (or not e the use of) one or more of the specific epigenetic s (eg the presence of absence of methylation at one or more Cst therein, that are within (or associated therewith, such as within about p - such as within about 200bp - 5’ or 3’ of) one or more of the DMRs set forth in TABLE 1A or TABLE 1B), for example, the present invention may not encompass one, two, three, four, five, siX, seven, eight, nine, ten, or about 12, 15, 20, 25 28, 29, or 30 of the DMRs independently selected from the group consisting of DMR#: #141, #204, #228, #144, #123, #129, #137, #148, #150, #154, #158, #164, #176, #178, #180, #186, #188, #190, #192, #200, #202, #208,#210, #213, #214, #219, #222, #223, #224, #225 and #226. In certain of such embodiments, the present invention may not encompass DMR #144 (SEQ ID NO. 4).

As set out herein, the epigenetic marker (eg the presence/absence of methylation at a CpG) may be within the nucleotide sequence of a DMR of the present invention, or may be present within about 2,000bp (such as within about 200bp) 5’ or 3’ of such DMR sequence; ie is upstream or downstream of the DMR sequence disclosed herein.

This is because (CpG) “islands” are present throughout the genome and the cancer-specific pattern of ation/un-methylation described herein may equally be detectable elsewhere in such “island” such at one or more Cst located within about 2,000bp (eg about 200bp) 5’ or 3’ of the DMR sequence disclosed herein. Following the disclosure herein, the person of ordinary skill will readily recognise that tion of the human genome sequence can identify other Cst potentially useful epigenomic s within any of such “islands” such as around or ated with any of the DMRs of the t invention, and hence such other epigenomic markers (eg other Cst within about 2,000bp - such as within about 200bp - 5’ or 3’ of such DMR sequence) are specifically envisioned as being within the scope of the present invention. In certain embodiments, one or more of said Cst is located within about 1,750, 1,500, 1,250, 1,000, 750, 500, 250, 200, 150, 125, 100, 75, 60, 50, 40, 30, 25, 20, 15, 10 or 5 base pairs 5’ of a DMR described herein; or within about 1,750, 1,500, 1,250, 1,000, 750, 500, 250, 200, 150, 125, 100, 75, 60, 50, 40, 30, 25, 20, 15, 10 or 5 base pairs 3’ of a DMR described herein.

[37] In r embodiment, the DMR of the present invention may be a t of the respective ce given herein. For e, by the deletion, addition or substitution of one or more (such as 2, 3, 4, 5 or more than 5) base pairs compared to the respective sequences. As will be understood by the person of ordinary skill, such variants can exist in any tion of women, such as by being an allelic variant or a SNP.

As will also be appreciated by the person of ordinary skill, any of such ces may be represented by (or analysed as) a complementary ce to any of the sequences set out herein.

As used herein, “determining” may be understood in the broadest sense as any recognition, including detection, localisation, diagnosis, classifying, staging or quantification of n cancer. Determining may be performed as set out herein. In the context of the present invention, determining is, preferably, performed in t of the woman in-vitro, for example as an in vitro method of diagnosis. That is, the biological sample comprising cell- free DNA is obtained from the woman, and the method of determining (or, eg diagnosis) is ted on such sample that is isolated and ted from said woman. For example, the biological sample is processed in a laboratory and/or in plastic or glass receptacles to analyses that the ree DNA of said woman by a method of the present invention.

As will be appreciated, a method that determines the response to therapy against ovarian cancer in a woman can be understood as a method of monitoring the increase (or reduction) of ovarian cancer in a woman previously diagnosed (eg by other s or tests) with ovarian cancer; in particular providing a method of monitoring - in an dual-specific manner — the s of (chemo)therapy administered to said woman in reducing or othenNise treating the ovarian cancer, or other symptoms thereof.

It will be understood by the person of ordinary skill that “determining” the presence or absence of (or response to therapy against) n cancer may not be, in every and all circumstance, 100% accurate. Such determination (or diagnoses) may be ed as a likelihood of the present or absence of the ovarian cancer, and/or interpreted in the context of the false-positive and/or false-negative rates of such a method or test. As is conventional in diagnostic tests, such rates can also be represented by the sensitivity and/or icity of the test.

Accordingly, in particular embodiments of the present invention, the tests or methods hereof e a test for the determination of ovarian cancer that has a sensitivity and/or icity that is superior to that provided by a CA125 test, and/or has non-overlapping false-positives and/or false-negatives with a CA125 test. Also envisioned are embodiments of the present invention wherein a methods or test may be ed having: (i) a sensitivity (ie true- positive rate) of greater than about 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, in particular r than about 90%, 95% or 98%; and/or (ii) a specificity (ie, true-negative rate) of greater than about 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, in particular r than about 55%, 60%, 70% or 80%. For example, in one embodiment, a test or method of the present invention may have a specificity of greater than about 95% (such as about 98%) and a sensitivity of greater than about 60% (such as about 63%). In another embodiment, a test or method of the present invention may have a specificity of greater than about 85% (such as about 90%) and a sensitivity of greater than about 55% (such as about 58%). In yet another embodiment, a test or method of the present invention may have a specificity of greater than about 98% (such as r than about 99.5%) and a sensitivity of greater than about 70% (such as greater than about 75%), for e if applied to a general population. As will be appreciated, such test parameters can depend on the population of women being screened, and in particular the prevalence of OC in such population. In this regard are presented two examples: (1) in a population which has a dramatically increased prevalence of OC (eg BRCA mutation carriers who have an OC 40 lifetime risk of up to 60%), a lower specificity may be applicable as the rate of false positives will be substantially lower and a false-positive result would have substantial less impact in such women - who may eventually opt for risk reducing surgery anyway; and (2) in a general population g, the prevalence of OC in those women actually tested using the present invention may be “artificially increased” by conducting a pre-screen for CC (eg, by using ROCA or other diagnostic tests/methods as described elsewhere herein) and then conducting a test of the present invention only in the sub-population of women who have an intermediate or elevated OC risk as determined by such pre-screen (which may be about 8% of general female population), and in this sub-population of women, a lower specificity may also be applicable.

The term “ovarian cancer” is art recognised, and encompasses any cancer that forms in tissue associated with the ovary; in particular those that result in abnormal cells that have the y to invade or spread to other parts of the body. The most common type of ovarian cancer, comprising more than 95% of cases, is ovarian carcinoma.

There are five main subtypes of ovarian carcinoma, of which high-grade serous (HGS) is most common. The other main subtypes include: low-grade serous, endometrioid, clear cell and mucinous carcinomas. These tumours are believed to start in the cells covering the ovaries, though some may form at the Fallopian tubes. Other types of ovarian cancer include germ cell tumours and sex cord stromal tumours. For the e of the present invention, the term an cancer” can also include peritoneal cancer and Fallopian tube cancer, in each case in women, as both are high-grade serous, have analogous biology to ovarian cancer and have the same treatment ties as ovarian cancer.

The various aspects and embodiments of the present invention, may apply to any one (or more) of such specific types/subtypes of ovarian cancer, and in particular the discrimination of one types/subtypes of ovarian cancer from others or from other disorders (such as gynaecological disorders). For example, in certain embodiments, the present invention is used to discriminate ovarian cancer from benign pelvic mass, and/or high-grade serious (HGS) n cancer from less severe or aggressive forms of n cancer, and/or or chemotherapy-resistant from chemotherapy-responsive ovarian cancer.

[45] In other s or embodiments of the present ion, the test may determine (or diagnose) the presence or absence of a cancer in said woman other than ovarian cancer (instead of, or as well as, determining the presence or absence of, or the response to therapy against, ovarian cancer). Such other cancer may be another gynaecological cancer (such as uterine cancer, vaginal , cervical cancer, and vulvar cancer) or a cancer of the colon or breast. Such aspects or embodiments are particular envisioned for the present invention which makes use of one or more epigenetic markers (eg, one or more methylated Cst, in particular the related Cst thereof) located within (or within about 2,000bp - such as within about 200bp - 5’ or 3’ of) a nucleic acid sequence comprised in DMR #204 [SEQ ID No. 2], optionally where the present ion makes use of one or more r epigenetic markers within one or more other DMRs of the present ion (such as #141, #228 and/or #144 [SEQ ID NOs: 1, 3, and/or 4, respectively]; in particular #141, and #228).

[46] The ical sample to be provided in this aspect of the present invention may be obtained from the woman (eg, a woman having, suspected of having or being investigated for having, ovarian cancer) by any procedure, s or step that the person of ordinary skill will recognise. For example, a biological sample may be obtained by surgery, biopsy, swab, tion of biological fluids etc. The biological sample may be a sample of tissue and/or fluid of the woman. Examples of a biological fluid include whole blood or a blood on (eg, such as plasma or serum). In alternative es, the sample may be a biological fluid selected from the group consisting of: urine, , sweat, tears, phlegm, beast milk, breast aspirate, vaginal secretion, vaginal wash and colonic wash.

In one embodiment, the biological sample may be a liquid biological sample selected from the group consisting of: a blood sample, a plasma sample and a serum . In more particular embodiments, the sample is a plasma or serum sample from the woman, or is urine from the woman female. In certain embodiments, the sample 40 is substantially (or essentially) free from cells, and/or is not a whole blood sample.

Methods of collecting such biological samples will be known to the person of ordinary skill, in particular the collection of whole blood (eg by -puncture of a suitable vein of the woman), and the subsequent preparation of plasma or serum from the whole blood (such as described in the es hereof). In particular embodiments, the blood may be collected, stored and/or transported in a cell-free DNA blood collection tube, such as one with a formaldehyde-free vative that stabilises nucleated blood cells. Such stabilisation would be expected to prevent, or reduce, the release of genomic DNA (eg from nucleated blood cells), enhancing the ion of high-quality cell- free DNA which can be further used in the method or other aspects of the present ion. The use of such tubes in the present invention can, in certain embodiments, reduce the need for immediate plasma preparation. For example, ree DNA is stable for up to 14 days, at room temperature, allowing ient sample collection, ort and storage over such period. Suitable blood collection tubes include the Free DNA BCT®” of Streck Inc, such as their research grade or CE-marked versions of this product.

Accordingly, in certain embodiments, the whole blood collected, for example collected in such a free DNA blood collection tube, may be processed within about 14 days of collection, such as within about 10 days, 7 days, 5 days, 4 days, 3 days or 2 days, or between about 30 mins and 24 hours (such as within about 12 or 8 hours) of collection. Between collection and processing (for example during storage and/or transport) the sample may be kept at ambient (such as room) temperature, or may be maintained at a reduced temperature by refrigeration of use of cooling materials. Suitable reduced temperatures include about 10°C, 4°C or lower, such as about 0°C, -18°C or - 70°C, or lower such as about -200°C (as may be provided by storage in liquid nitrogen).

[50] Steps of subsequent sing can include, centrifugation or other methods to separate intact cells (such as red and nucleated blood cells) from the biological sample, preparation of plasma or serum from a blood sample and/or extraction of cell-free DNA from the biological. Suitable methods for extraction of cell free DNA, in particular from plasma or serum are described in the examples herein. For example, the QIAamp ating Nucleic Acid and/or DNeasy Blood and Tissue extraction product series of Qiagen, as well as automated systems for DNA extraction such as the QiaSymphony (Qiagen), Chemagen 360 (PerkinElmer). The same, analogous or modified ures may be used to subsequently process other biological fluids, such as urine, tears, breast aspirate or vaginal swabs, to isolate cell-free DNA therefrom.

The biological sample from the woman comprises cell-free DNA of said woman. The term “cell-free DNA” (or “chNA”) is art recognised, and includes the meaning of DNA that is found outside of a cell, such as in a biological fluid (eg blood, or a blood fraction) of an individual. In particular embodiments, the cell-free DNA may be circulating. lating” is also an art-recognised term, and includes the meaning that an entity or substance (eg chNA) is t in, detected or identified in, or isolated from, a circulatory system of the individual, such as the blood system or the lymphatic . In particular, when chNA is “circulating” it is not located in a cell, and hence may be present in the plasma or serum of blood, or it may be present in the lymph of tic fluid.

[52] The cell-free DNA present in the ical sample may arise from different sources (ie, tissues or cells) present in or of the woman. For example, chNA may derive from ted (such as white) blood cells and/or other “normal” cells of the body such as ying (or apoptotic/necrotic) epithelial or other cells. Such chNA can be deemed “somatic” chNA as it is derived from cells that are assumed to comprise a normal genomic complement, genetic and epigenetic make up of the woman. In addition to such somatic chNA, the biological sample may contain chNA derived from other sources, and hence the total chNA present in, or ted from, the biological sample (such as plasma or serum) may be an admixture of chNA derived from two or more different sources, each source providing chNA which may have a different c complement and/or genetic or epigenetic make up. In the present ion, the determination of the presence or absence (or response to therapy t) of ovarian cancer in a woman is based on a differential epigenetic make up — as described for the first time herein for the DMRs of the 40 present invention — of chNA d from cells of the ovarian cancer compared to that of the somatic chNA present in the biological sample. chNA derived from a tumour (such as an ovarian cancer cell) can be described as circulating tumour DNA (“ctDNA”). In the present invention, the determination of the presence or absence (or response to therapy against) of ovarian cancer is based on the (eg -molecule) analysis of certain epigenetic markers present on the ctDNA derived from ovarian cancer. However, the chNA t in the biological sample may WO 09212 contain chNA from sources other than, or in additional to, ctDNA d from ovarian . For example, the chNA may comprise an admixture of c chNA of the woman, and ctDNA derived from one or more other cancers (or tumorous tissues/cells) that may be present in the woman (such as breast cancer). Furthermore, if the woman is pregnant, the chNA may comprise chNA derived from the foetus and/or the placenta of such foetus (Lo et al 1997, Lancet 350:485), or if the woman has received a tissue, cell or blood transplant/transfusion donated by another individual, the chNA of the woman may comprise DNA derived from the cells of such other individual.

The amount of total chNA isolated from a biological sample, in ular from a blood or blood-fraction sample, may differ from woman to woman and sample to sample (such as, dependent on the storage, transport, temperature and other environmental conditions the s is subjected to, as described in the example). For e, between about 0 ng (ie, absence, or essentially absent) and 5000 ng chNA per mL of plasma/serum, such as about between about 2 ng/mL or 10 ng/mL and about 2000 or 1000 ng/mL, in particular between about 2 ng/mL or 10 ng/mL and about 500 ng/mL or between about 15 ng/mL or 20 ng/mL or 30 ng/ml or 40 ng/ml or 50 ng/mL and about 500 ng/ ml, 400 ng/mL or 300 mg/mL or 250 mg/mL or 200 mg/mL, such as (eg in cases when blood is ted in a free DNA blood collection tube) between about 2 ng/mL or 20 ng/mL and about 500 ng/mL. In any of such embodiments (in particular, when the total chNA is at an amount of between about 2 ng/mL or 20 ng/mL and about 500 ng/mL), the ctDNA (such as that derived from the ovarian cancer) comprises at (or more than) about 0.001%, 0.0025%, 0.005%, 0.0075%, 0.01%, , 0.05%, 0.075%, 0.1%, 0.25%, 0.5%, 0.75%, 1%, 2%, 3%, 4%, 5%, 7.5% or 10% of the total chNA, such as between about 0.001% and about 10%, or between about 0.1% and about 10%, or between about 0.5% and about 10%, or between about 0.5% and about 5%, or between about 1% and about 5%, and/or the frequency of an epigenetic marker of the present invention (such as one associated with DMR #141, #204, or #228) is at (or more than) about one molecule of the epigenetic marker to about 3, 5, 10, , 20, 25, 50, 60, 75, 100, 150, 200, 250, 500, 750, 1000, 1500, 2000, 3000, 4000, 5000, 10000 or more than 10000, such as about 100000 molecules of total chNA (or fragments) presenting in or isolated from such biological sample.

[54] Cell-free DNA present in, or isolated from, the biological sample (such as plasma or serum) is, typically, fragmented. In certain embodiments, the average fragment size of such chNA may be between about 50 bp and 5000 bp, for e between about 50 bp and 3000 bp, between about 50 bp and 3000 bp, between about 50 bp and 2000 bp, 50 bp and 2000 bp, such as n about 75 bp and 1000 bp or between about 75 bp and 750 bp, or between about 100 bp and 300 bp, such as n about 150 bp and 200 bp. The average fragment size (and amount/concentration) of chNA may be determined by any suitable methodology, as will be apparent to the person of ordinary skill, including by capillary electrophoresis analysis and/or size fractional analysis, such as the nt er and the High Sensitivity Large Fragment Analysis Kit (AATI, USA). Such characterisation can occur prior to the determination step, as its outcome may be used to influence the number of molecules to be analysed and/or the number of those molecules exhibiting the cancer-specific DNAme marker (as described elsewhere herein).

[55] The inventors have identified that, for certain of the DMRs of the t invention, one or more of the Cst therein have particular relevance for the association of such CpG’s/s’ methylation status to the ce or absence of, or response to therapy against, an ovarian cancer in a woman. The identify of those Cst (each, a “relevant CpG") is underlined in TABLE 1A and TABLE 1B, as applicable, and the genomic position (hg19) of the cytosine (C) of each such relevant Cst for such DMRs of the present invention is set forth in TABLE 1C.

TABLE 1C: Genome-coordinates of the Cs for each relevant Cst of the DMRs of the present invention DMR# Genome coordinates (hg 19) of the Cs for relevant Cst Class chr5:178004422178004442178004468 141 Hyper 178004504 chr1:151810811151810816151810835 204 151810843151810852151810890151810899— Hyper 151810904151810909 chr2:219736312219736319219736343 228 HWer 219736361 chr19:58220440582204465822046658220482- 144 HWer 5822049458220513-58220516 123 chr16:1271180127119212712121271239 Hypo 129 chr11:6905467869054700-69054709 Hypo 132896310132896333132896351 137 HW0 132896381 148 chr2:723596337235964872359682 Hypo 56735054156735078156735093 150 HW0 156735110156735118156735140 154 chr17:701121777011219370112221-70112237 Hyper 158 chr16:74441733744417717444178774441801 Hypo 164 74427997174428018-174428027 Hyper 176 chr6:119107242119107282-119107287 Hypo 178 chr19:13215489—1321549513215510-13215521 Hyper 180 chr3:192125900192125927192125945-192125949 Hyper 186 chr22:21483289—2148331721483329—21483332-21483337 Hypo 188 chr19:18497159—1849722618497239 Hypo chr9:79629090796291037962912879629135- 190 Hyper chr12:75601322756013317560136175601373- 192 HWer 7560137975601403-75601408 chr9:138999208138999213138999240 200 Hyper 138999264 chr1:2987558298757729875812987598 202 HWer 29876102987629 208 chr8:554675485546758155467592-55467606 Hypo 210 chr12:123713553 Hyper 213 chr2:106776975106777009-106777015 Hyper 214 chr3:141516291141516317 Hyper 219 chr16:30484193-30484218 Hyper 222 chr3:111809470 Hyper 223 chr10:120489294 Hyper 224 chr11:18740701874093 Hyper 225 chr7:142422236 Hyper 226 chr1:3086485308649230864963086509 Hypo An epigenetic marker of, or for use in, the present invention may comprise the presence/absence, as able, of methylation at a CpG associated with (such as located within) any of the DMRs of the t invention (or within about 2,000bp - such as within about 200bp - 5’ or 3’ thereof), and in particular the presence/absence, as applicable, of methylation at one of the relevant Cst associated with a given DMR of the present invention as set forth in TABLE 1C. However, as set out herein, the ination of the presence or absence of (or response to therapy against) an ovarian cancer in a woman may be enhanced if, in respect of one or more of such DMRs, the methylation status at a plurality of Cst for such DMR is determined.

Accordingly, the present invention specifically includes embodiments where the methylation status is ined at a number being two, three, four, five, six, seven, eight, nine, ten, about 12, about 15, about 20, about or more of said Cst located within said nucleotide sequence and in particular at such number of - or up to the maximum number of — any Cst (or the relevant Cst as set forth in TABLE 1C) associated with a given DMR of the present invention. In such embodiments, the presence in at least one of said cell-free DNA molecules of at least one, up to the respective said number (such as a number between about three and about fifteen) of methylated Cst or un-methylated Cst (as applicable) located within one or more of said nucleotide sequences indicates the presence of, or a reduced se to y against, an n cancer in said woman.

For example, the present invention includes embodiments where the methylation status is determined at two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14 or 15 Cst (such as between about four and about ten) located within a hyper-methylated DMR (eg, those set forth in TABLE 1A) of the t invention (or associated therewith, such as within about 2,000bp - such as within about 200bp - 5’ or 3’ thereof), and wherein the presence of at least one methylated such CpG associated with such a hyper-methylated DMR of the invention, such as all such Cst or at least all of the applicable relevant Cst in such DMR as set forth in TABLE 1C (such as at all two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14 or 15, up to the maximum number of such Cst ated with said DMR), indicates the presence of, or a reduced response to therapy against, an ovarian cancer in said woman.

Preferably, in such ments, the presence of methylation at all of the relevant Cst (see TABLE 1C) for a given methylated DMR (eg, those set forth in TABLE 1A) indicates the presence of, or a reduced response to therapy against, an ovarian cancer in said woman.

As another example, the present invention also includes embodiments where the methylation status is determined at two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14 or 15 Cst (such as between about four and about ten) located within a hypo-methylated DMR (eg, those set forth in TABLE 1B) of the present invention (or associated therewith, such as within about 2,000bp - such as within about 200bp - 5’ or 3’ thereof), and wherein them of at least one methylated such CpG associated with such a ethylated DMR of the invention, such as all such Cst or at least all of the applicable relevant Cst in such DMR as set forth in TABLE 1C (such as at all two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14 or 15, up to the maximum number of such Cst ated with said DMR), tes the presence of, or a reduced response to therapy against, an ovarian cancer in said woman. Preferably, in such embodiments, them of methylation at all of the relevant Cst (see TABLE 1C) for a given hypo-methylated DMR (eg, those set forth in TABLE 1B) indicates the presence of, or a reduced response to therapy against, an ovarian cancer in said woman.

As will be apparent to the person of ordinary skill, the m number of Cst for which such determination of methylation status may be made will be the number of Cst located within the sequence that is analysed. For example, for DMR #141 (SEQ ID No. 1), the wild-type sequence shows that 7 Cst are located therein (of which all 7 are underlined in TABLE 1A, are further identified in TABLE 1C and are the relevant Cst for such DMR), and hence such number of Cst would represent a maximum number of Cst in t of such ce for which the methylation status may be determined and hence used to investigate the presence of, or a 40 reduced response to therapy against, an n cancer in said woman.

The status of methylation at any of such Cst may be determined to be absent (un-methylated) or to be present (methylated), such as in the form of methylcytosine and/or hydroxymethylcytosine and/or cytosine, in particular 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5th) or 5-formylcytosine (5fC) (Li & Liu, 2011; Journal of Nucleic Acids, article ID 870726. Ito et al, 2011; Science 333:1300). In one embodiment, the present invention relates to the ination of the 5-methylation and/or oxymethylcytosine status at one or more Cs in said Cst, wherein the presence of one or more 5-methylcytosine and/or 5-hydroxymethylcytosine in the Cst (in particular; in the relevant Cst for a DMR, as set out in TABLE 1C) indicates the ce of, or a reduced response to therapy against, an ovarian cancer in said woman. Any of those Cst investigated which are determined not to se 5-methylcytosine, are typically un-methylated cytosine, but in certain embodiments one or more may comprise modifications other than 5-methylcytosine, such as 5th or 5fC. Investigation of the respective modification comprised in Cst is art know, including methylation-sensitive restriction enzyme or bisulphite conversion/analysis (eg for 5mC and/or 5th) and reduced bisulphite sequencing (redBS-Seq) (eg, for 5fC), as may be conducted by or products obtained from Cambridge Epigenetix Ltd (UK). Alternatively, single-molecule DNA sequencing/analysis ques (such as those utilised in the PacBio or re instruments described elsewhere herein) may be used to determine the status and form of the methylation present at the Cst that are interrogated as part of the present invention.

As well as the present invention including embodiments were the methylation status at one or more Cst (in particular, at one or more nt Cst) is ined located within a single DMR of the present ion (or associated therewith, such as within about 2,000bp - such as 200bp - 5’ or 3’ thereof), for example a DMR selected from the group consisting of #141, #204 and #228 (SEQ ID NOs.: 1, 2 and 3, respectively), it specifically ons other embodiments wherein such Cst are d within a plurality of DMRs of the present ion (or associated therewith, such as within about p - such as within 200bp - 5’ or 3’ thereof). Also as described herein, the determination of the presence or absence of (or response to therapy t) an n cancer in a woman may be enhanced if, in respect of such plurality DMRs, the methylation status of at least one (or more) Cst of such DMRs is determined, especially those embodiments where in respect of each of such plurality of DMRs, the methylation status of a plurality of Cst (such as two, three, four, five, six, seven, eight, nine, ten or more than ten, such as 11, 12, 13, 14 or 15, or between about four and about ten), and in particularly of the applicable relevant Cst for a DMR, is determined.

[63] Accordingly, in certain embodiments of the t invention, the methylation status at one or more Cst (in particular, of the applicable relevant Cst) located within a number of two, three, four, five, six, seven, eight, nine, ten or more than ten (such as 11, 12, 13, 14 or 15, or between about four and about ten) of said nucleotide sequences (in particular, within at least two, three or four nucleotide sequences) is ined; wherein, the ce in at least one of said cell-free DNA molecules of one or more (such as between about four and about ten): (i) methylated such Cst (eg the relevant Cst set out in TABLE 1C) located within one or more of said nucleotide sequences of the hyper-methylated DMRs (eg, those of TABLE 1A); and/or (ii) un-methylated such Cst (eg the relevant Cst set out in TABLE 1C) located within one or more of said nucleotide sequences of the hypo-methylated DMRs (eg, those of TABLE 1B), indicates the presence of, or a reduced response to therapy, against an ovarian cancer in said woman. In certain of such embodiments, one or more other Cst within the nucleotide sequence(s) may be either methylated or un-methylated (or their methylation status undetermined), wherein said pattern of methylation can also indicate the ce of (or reduced response to therapy against) n cancer in said woman. For example, one pattern of methylation that indicates the presence of (or reduced response to therapy against) ovarian cancer in said woman may be for a hyper-methylated DMRs (eg, those of TABLE 1A) that all (or all but one, two or three) of the relevant Cst set out in TABLE 1C for such DMR are methylated, and that all other 40 Cst are either methylated or un-methylated (or their methylation status is undetermined); ie that for DMR #228, a pattern of methylation of linked Cst therein of “X111X111” indicates the presence of (or reduced response to therapy against) ovarian cancer in said woman (where “1” represents the presence of a methylated CpG and “X” represents the ce of either a methylated or an un-methylated CpG; and the relative position of the non- relevant CpG for #228). In another e, one pattern of methylation that indicates the presence of (or reduced response to therapy against) ovarian cancer in said woman may be for a ethylated DMRs (eg, those of TABLE 1A) that all (or all but one, two or three) of the relevant Cst set out in TABLE 1C for such DMR are un-methylated, and that all other Cst are either methylated or un-methylated (or their methylation status is undetermined). In certain embodiments of the present invention, the pattern of methylation/un-methylation for a given DMR that is associated with the presence of (or reduced response to therapy t) n cancer in said woman is shown in Table 2B.

The present invention additionally provides for particularly advantageous nucleotide sequences associated with one or more Cst (in particularly at least one of the applicable relevant Cst), the methylation status of which is associated with the presence or absence of, or response to therapy against, an ovarian cancer in a woman. As described above, such nucleotide sequences include those selected from the group consisting of DMR#: #141, #204, #228, #144, #123, #129, #137, #148, #150, #154, #158, #164, #176, #178, #180, #186, #188, #190, #192, #200, #202, 210, #213, #214, #219, #222, #223, #224, #225 and #226; in particular #141 and/or #204 and/or #228 and/or #144 and/or #154 and/or #158 and/or #186 and/or #188 and/or #202 such as preferably #141 and/or #204 and/or #228 (SEQ ID NOs: 1, 2 and 3, respectively), or in certain other embodiments a nucleotide sequence present within about 2,000bp (such as within about 200bp) 5’ or 3’ f, and atively, in each case, an allelic variant and/or a complementary sequence of any of said nucleotide sequences.

Accordingly, in a particular embodiment, the method of the present invention said nucleotide sequence(s) is/are #141 and/or #204 and/or #228 (SEQ ID NOs: 1, 2 and/or 3); for example, at least one of said nucleotide sequences is #141; or an allelic variant and/or complementary sequence of any of said nucleotide sequences. In an alternative embodiment, the method of the present invention said tide sequence is #144 (SEQ ID NO 4), or an allelic variant and/or complementary sequence of any of said nucleotide sequences; which embodiment may also be include the determination of methylation status at Cst (in ularly at the applicable relevant Cst) located in one or more of the nucleotide sequence #141 and/or #204 and/or #228 (SEQ ID NOs: 1, 2 and/or 3). As set out elsewhere, also envisioned are ments where the Cst are located in a nucleotide sequence present within about 2,000bp (such as within about 200bp) 5’ or 3’ of each or any of the respective DMRs. In particular of such embodiments, said nucleotide ces and the relevant Cst thereof are, respectively, those set out in TABLE 1D, or an allelic variant and/or mentary sequence of any of said nucleotide sequences.

TABLE 1D: Genomic sequences of the non-primer portion of particular DMRs of the present ion Marker Genome coordinates DMR# coordinates (relevar?t C Gs arequnderlined)]Marker enomic se uence SEQ ID (hg 19) of the Cs for (h919) P relevant Cst ' chr5:178004422 ECCAQGGAAGGAGGCACAEATTCAGCCCA 3&312334141722604442- 141 TGACACCGCCACCTCGGCGTGGTGCTGTAGGG 156 -178004505 GGAAGCEAGGCACEAEG 178004460 — 471-178004504 chr1:151810811- 151810814 gooGcGGGGCCCCAGGQCAGCAQCTCTQ gfifligigiggig chr1:151810811 cGcG"GGGC§CAGCTGGCAGCACAGGAAGTC 204 151810845 157 -151810917 CAGG"GGMGAGQGQGQTGGGQGCCQG 151810887 CGCGGCGCGGC — 893 151810904 151810909 chr2:219736312- chr2:219736301 CGGCTGCCAGGQCCCCGCGGGCGGGCCCCTC 317 228 158 -219736362 CCQGCCCTCQGCCTGCCQGCACCCCQ 219736335 219736352-219736361 chr19:58220440 chr19:58220438 ———AA—— iiiigiégiigiigiggi 144 CAGGAGGGACGACGACTCCCCTCACGCCTTCG 159 -58220517 TGGCCCCAAc—Tcfice — — 58220482 — — 58220500 58220516 As shown in the examples, a particularly useful test is provided by those embodiments of the present invention in which the methylation status may be determined at one or more Cst associated withw of a plurality of the DMRs described herein. For e, more than one (such as two, three, four, five, six, seven, eight, nine or ten) of such nucleotides sequence may be investigated for the presence or absence of methylated Cst d therein. In particular, where at least one methylated CpG (such as a plurality of methylated GpCs) — in particular of the respective relevant Cst - is determined in any one of the plurality of such nucleotide ces associated with a hyper-methylated DMR analysed (such as DMR #141, #204, #228 and/or #144), then a determination may be made that ovarian cancer is present in said woman, or that n cancer in a woman is not responding to (chemo)therapy. Alternatively, where at least one un-methylated CpG (such as a plurality of un-methylated GpCs) — in particular of the respective relevant Cst - is determined in any one of the plurality of such nucleotide sequences associated with a hypo-methylated DMR analysed (such as those set forth in TABLE 1B), then a determination may be made that ovarian cancer is present in said woman, or that n cancer in a woman is not responding to (chemo)therapy. As will also be understood, the plurality of nucleotide sequences analysed for the ce or absence of methylated Cst located therein may include at least one nucleotide sequence associated with a hyper- methylated DMR (such as those set forth in TABLE 1A, and in particular DMR #141, #204, #228 and/or #144 as set forth in TABLE 1D) m at least one nucleotide sequence associated with a ethylated DMR (such as those set forth in TABLE 1B), wherein the determination of at least one methylated CpG (such as a plurality of ated GpCs) — in particular of the respective relevant Cst — located in said methylated DMR m the determination of at least one un-methylated CpG (such as a plurality of un-methylated GpCs) — in particular of the respective relevant Cst — located in said ethylated DMR may be used to determine that n cancer is present in said woman, or that n cancer in a woman is not responding to (chemo)therapy.

Accordingly, in a particular embodiment of the method of the present invention the methylation status may be determined at one or more of said Cst located within each of the tide sequences so analysed; wherein, the presence in at least one of said cell-free DNA molecules of one or more: (i) methylated Cst (in particular, the applicable relevant Cst set forth in TABLE 1C) located within any one of said tide sequences associated with the hyper-methylated DMRs (eg as set forth in TABLE 1A); and/or (ii) un-methylated Cst (in particular, the applicable relevant Cst set forth in TABLE 1C) located within one or more of said tide sequences associated with the hypo-methylated DMRs (eg as set forth in TABLE 1B), indicates the presence of, or a reduced response to therapy t, an ovarian cancer in said woman. For example, the method includes embodiments where the methylation status of one or more Cst (in particular, of the applicable relevant Cst set forth in TABLE 1C) d in ich of the nucleotide sequence #141 and #204 and #228 (SEQ ID NOs: 1, 2 and 3) - such as at least one (such as all) of such CpG in each of said ces — is determined for at least one molecule of said cell-free DNA, and wherein the ce in at least one of said cell-free DNA molecules of one or more methylated Cst located within any one of said nucleotide sequences (such as methylation at all GpCs, or all relevant Cst, therein, or methylation at all but one, two or three of such GpCs) tes the presence of, or a reduced response to therapy against, an ovarian cancer in said woman. In particular of such embodiments, one or more (such as all) of said nucleotide sequences (and the applicable relevant Cst) are, respectively, those set out in TABLE 1D, or an allelic variant and/or complementary ce of any of said nucleotide sequences. 40 [68] One particular feature described in the examples is the presence of patterns of methylation/un-methylation at Cst associated with the same DMR, in particular at the relevant Cst for such DMR. Such examples support the ion that the investigation, analysis and/or determination of such patterns of ation/un-methylation are particularly useful or advantageous tools for determining presence or e of, or response to therapy against, an ovarian cancer in a woman. In particular, to provide tests that have a performance that enables them to be used in diagnostic settings; such as having a sensitivity and/or specificity as set out herein. The number of Cst associated with a given DMR for which the methylation status is determined will depend on the length of nucleotide sequence analysed and the number of Cst present n. For a given nucleotide sequence associated with (such as within, or within about 2,000bp - such as within about 200bp - 5’ and/or 3’ of) a DMR of the present invention, the number of Cst for which the methylation status is determined can range from two or more (such as three, four and five, up to the maximum number of Cst within such nucleotide sequence, and/or up to about nine, ten, 11, 12, 13, 14, 15, 18, about 20, about 25 or about 30. In particular embodiments, the methylation status is determined at a number of between about 5 and about 15 of said Cst located within the nucleotide sequence(s), and in particular at such number of the relevant Cst for the nucleotide sequence(s) (eg, as set forth in TABLE 1C). In certain embodiments of the present ion, the number of (eg relevant) Cst for which the methylation status is determined the pattern of methylation/un-methylation for a given DMR that is ated with the presence of (or reduced response to therapy against) ovarian cancer in said woman is show in Table 2B.

Accordingly, in certain s of the present invention, the methylation status may be determined at a number of n about 2 and about 15 (for example, between about four and about ten, such as five, six, seven, eight or nine) of said Cst (in particular of the relevant Cst set forth in TABLE 1C) located within said nucleotide sequence(s) - in particular within the nucleotide sequence(s) selected from: #141, #204 and/or #228 (SEQ ID NOs: 1, 2 and/or 3), or an allelic variant and/or complementary ce thereof; wherein the presence in at least one of said cell-free DNA molecules of at least said number of methylated Cst (in particular of methylated relevant Cst set forth in TABLE 1C) d withinw of said nucleotide sequences indicates the presence of, or a reduced response to therapy against, an ovarian cancer in said woman.

[70] In specific of such embodiments, the methylation status may be determined at about 7 Cst (in particular, the 7 relevant Cst) located within nucleotide sequence #141 (SEQ ID NO 1) and/or at about 16 Cst (in particular, the 16 relevant Cst) d within nucleotide sequence #204 (SEQ ID NO 2) and/or at about 7 Cst (in particular, the 7 relevant Cst) located within tide sequence #228 (SEQ ID NO 3) and/or at about 11 Cst (in particular, the 11 relevant Cst) located within nucleotide sequence #144 (SEQ ID NO 4) — for example those Cst (in particular, the applicable relevant Cst) located within SEQ ID N05: 156, 157, 158 and/or 159, respectively - or in each case an c variant and/or mentary sequence of any of said nucleotide sequences. In particular embodiments, the methylation status of all Cst, or at least all of the relevant Cst, in the given nucleotide sequence may be determined. In one embodiment, the presence of ation at all of said Cst in a given nucleotide sequence for the hyper-methylated DMRs #141, #204, #228 and/or #144 can indicate the presence of (or reduced response to therapy against) ovarian cancer in said woman. In other embodiments, the presence of methylation at all but one, two or three of said Cst in one or more of said nucleotide sequence can indicate the presence of (or reduced response to y against) ovarian cancer in said woman. For example, all of the relevant Cst for DMR #141, #204, #228 and/or #144 may be determined to be methylated, and one or more other Cst therein they may be either methylated or un-methylated (or their methylation status rmined), wherein said 40 pattern of ation can also indicate the presence of (or d response to therapy t) ovarian cancer in said woman. In certain ments of the present invention, the number of (eg relevant) Cst for which the methylation status is determined the pattern of methylation/un-methylation for DMR #141, #204, #228 and/or #144 that is associated with the presence of (or reduced response to y against) ovarian cancer in said woman is show in Table 2B.

WO 09212 As will now be apparent to the person of ordinary skill, and as shown in the examples within a clinical setting to be superior and/or complementary to a CA125 test (FIGURES 3E and 3F), one particular embodiment of the present invention is based on the analysis and determination of the ation n of three sets of Cst (in particular; of the applicable relevant Cst), each set associated with the respective one or three DMRs: #141, #204 and #208; wherein the ce of a (marker) methylation pattern in any one of said DMRs determines the presence or e of, or se to therapy against, an ovarian cancer in a woman. Therefore, one specific embodiment of the method of the present invention includes where the methylation status is determined at about 7 Cst (in particular; the 7 relevant Cst) located within nucleotide ce #141 (SEQ ID NO 1) m at about 16 Cst (in particular, the 16 relevant Cst) located within nucleotide sequence #204 (SEQ ID NO 2) E at about 7 Cst (in particular, the 7 relevant Cst)located within nucleotide sequence #228 (SEQ ID NO 3) — for example located within SEQ ID N05: 156, 157 and/or 158, respectively - or in each case an allelic variant and/or mentary ce of any of said nucleotide ces; wherein, the presence in at least one of said cell-free DNA molecules of at least said number of methylated said Cst (in particular, said relevant Cst) located within any one of said nucleotide sequences indicates the presence of, or a reduced se to therapy against, an ovarian cancer in said woman. As bed above, in certain of such embodiments other Cst within such nucleotide sequence may (or may not) be analysed for their methylation ; and if their methylation status is determined then they such Cst may be determined to be either methylated or un-methylated, and the presence of, or a d response to therapy against, an ovarian cancer may be determined in said woman.

For one example of such embodiment, the determination of the presence of methylation (in at least one of said cell-free DNA molecules, such as more than 10, 20, 50, 100, 500 or 1000, or another number as set out below) at all 7 of the relevant Cst located within nucleotide sequence #141 (SEQ ID NO 1) indicates the presence of, or a reduced response to therapy t, an ovarian cancer in said woman, regardless of the methylation status of any other CpG therein and/or regardless of the methylation status of Cst located within nucleotide sequence #204 (SEQ ID NO 2) or nucleotide sequence #228 (SEQ ID NO 3). As a first alternative example of such embodiment, the determination of the presence of methylation (in at least one of said cell-free DNA molecules, such as more than 10, , 50, 100, 500 or 1000, or another number as set out below) at all 16 of the relevant Cst located within nucleotide sequence #204 (SEQ ID NO 2) indicates the presence of, or a reduced se to therapy against, an ovarian cancer in said woman, less of the methylation status of any other CpG therein and/or regardless of the methylation status of Cst located within nucleotide sequence #141 (SEQ ID NO 1) or tide sequence #228 (SEQ ID NO 3). As a second alternative example of such embodiment, the determination of the presence of methylation (in at least one of said cell-free DNA molecules, such as more than 10, 20, 50, 100, 500 or 1000, or another number as set out below) at all 7 of the relevant Cst located within nucleotide sequence #228 (SEQ ID NO 3) indicates the presence of, or a reduced response to therapy against, an ovarian cancer in said woman, less of the methylation status of any other CpG therein and/or regardless of the methylation status of Cst located within nucleotide sequence #141 (SEQ ID NO 1) or nucleotide sequence #204 (SEQ ID NO 2). As will be now be appreciated, in an alternative embodiment, the presence of, or a reduced response to therapy against, an ovarian cancer in said woman may be also indicated when the presence of ation is determined at all of the nt Cst located within each of nucleotide sequences 141 (SEQ ID NO 1), #204 (SEQ ID NO 2) m #228 (SEQ ID NO 3). In such an alternative embodiment (and as described elsewhere herein), the number of cell-free DNA molecules 40 in which any of such methylation ns is determined may be less than if only one of such DMRs is found to have such a methylation pattern. In certain embodiments of the present invention, the number of (eg relevant) Cst for which the methylation status is determined the pattern of methylation/un-methylation for DMR #141, #204, #228 and/or #144 that is associated with the presence of (or reduced response to therapy against) ovarian cancer in said woman is show in Table 23.

In any of the embodiments of the present invention, the biological sample can be further processed, such as comprising a step of isolating cell-free DNA therefrom. Such isolation can include particular steps of centrifugation (such as density gradient ultracentrifugation, Jonathan et al (2015), J Cancer Prev Curr Res 3:00064), treatment with ionic solutions and/or organic solvents to selectively solubilise/precipitate nucleic acids (such as cell-free DNA), on of (cell-free DNA) selective binding and tion es (such as magnetic beads) and/or filtration or chromatographic steps; and in particular, steps of lysis of sample, absorption to a silica membrane (or column or beads), removal of residual inates and/or on of pure nucleic acids, such as cell-free DNA. Other methods of chNA isolation can include rapid okinetic isolation directly from blood (Sonnenberg et al (2014), Clin Chem 60:500).

[74] In certain of such embodiments, the biological sample (such as plasma or serum) may be processed to isolate the ree DNA generally according to a process as set out in FIGURE 5. For example: Lysing samples: Free-circulating c acids in ical fluids are usually bound to proteins or enveloped in vesicles, which may utilise an efficient lysis step in order to release nucleic acids for selective binding to the column (or to Solid Phase Reversible Immobilisation — SPRI — agnetic] beads). Hence, samples may be lysed under highly denaturing conditions at elevated temperatures in the presence of proteinase K and appropriate buffer, such as Buffer ACL from Qiagen (cat. no. 19076), which together provide for inactivation of DNases and RNases and complete release of nucleic acids from bound proteins, lipids, and vesicles.

Adsorption to a silica ne: Binding conditions can be adjusted by adding an appropriate buffer, such as Buffer ACB (Qiagen) to allow binding of the circulating nucleic acids to the silica membrane. Lysates may then then be transferred onto a separation column (such as the QIAamp Mini column, Qiagen), and circulating nucleic acids adsorbed from a large volume onto the small silica membrane as the lysate is drawn h by vacuum pressure. Appropriate salt and pH conditions can ensure that proteins and other contaminants, which can inhibit PCR and other downstream enzymatic reactions, are not retained on the separation column. A vacuum manifold (e.g., the QIAvac 24 Plus with the QIAvac Connecting System) and a vacuum pump capable of producing a vacuum of —800 to —900 mbar (e.g., QIAGEN Vacuum Pump) may be used for the ol. A vacuum regulator can be used for easy monitoring of vacuum pressures and convenient vacuum release.

Removal of residual contaminants: Nucleic acids remain bound to the membrane, while contaminants can be efficiently washed away during a plurality of wash steps, such as 2 or 3 wash steps. In a single step, highly pure circulating nucleic acids can be eluted in an appropriate buffer (such as in Buffer AVE, Qiagen), brated to room ature.

Elution of pure nucleic acids: Elution can be performed using Buffer AVE. The elution volume may be 50 ul (or greater, such as 100u| or 150ul). If higher nucleic acid concentrations are required, the elution volume can be reduced, such as by using 20 ul (or 50ul). Low n volume leads to highly concentrated nucleic acid eluates. For downstream applications that use small starting volumes (e.g., some PCR and RT—PCR assays), a more trated eluate may increase assay sensitivity. For downstream ations that use a larger starting volume, the elution volume can be increased up to 150 ul. However, an increase in elution volume can decrease the concentration of nucleic acids in the eluate. Eluted nucleic acids can collected in 1.5 ml microcentrifuge tubes or in microtitre plates. If the purified circulating nucleic acids are to be stored for up to 24 hours, they can be stored at 2—8°C; and/or for storage longer than 24 hours at —15 to —30°C. 40 [79] In certain embodiments of the present invention, the cell-free DNA may be ted to an agent that differentially modifies said DNA based on the methylation status of one or more of the Cst. Such a modification can facilitate the detection of differences in the methylation status. However, as described elsewhere herein, methods are available to detect differences in the ation status of Cst without use of such a ing agent.

Accordingly, the present invention also es those embodiments of the method that include a step of treating said DNA with an agent that entially modifies said DNA based on the methylation status of one or more Cst located within. Such agents will be known to the person of ordinary skill and e the use of one or more methylation sensitive restriction enzyme and/or of a bisulphite-based reaction. The use of bisulphite or methylation- sensitive restriction enzymes to study differential methylation will be well known to the person of ry skill, who may apply teachings of standard texts or adaptation of published methods such as Poon et al , Nygren et al (2010) or Yegnasubramanian et al (2006, Nuc Acid Res ).

A methylation ive is a restriction enzyme that is sensitive to the DNA methylation . Cleavage of such a restriction enzyme’s ition sequence may be blocked, or impaired, when a particular base in the enzymes recognition site is ed, eg methylated. In particular embodiments of all aspects of the invention, the agent comprises a methylation-sensitive restriction , such as a methylation-sensitive restriction enzyme disclosed herein; ing such embodiments that comprise two, three, four, five or more of such methylation- ive restriction enzymes. In particular embodiments, the t agent comprises: at least one methylation sensitive ; at least one methylation sensitive restriction enzyme; and/or an agent selected from the group consisting of: AatII, AciI, AclI, AfeI, AgeI, AgeI-HF, AscI, AsiSI, AvaI, BceAI, BmgBI, BsaAI, BsaHI, BsiEI. BsiWI, BsmBI, BspDI, BerI, BssHII, BstBI, BstUI, ClaI, EagI, FauI, FseI, FspI, HaeII, HgaI, HhaI, HinPlI, HpaII, pr99I, prCH4IV, KasI, MluI, NaeI, NarI, NgoMIV, NotI, NotI-HF, NruI, Nt.BsmAI, Nt.CviPII, PaeR7I, PluTI, PmlI, PvuI, PvuI- HF, RerI, SacII, SalI, SalI-HF, SfoI, SgrAI, SmaI, SnaBI, TspMI and ZraI. In particular embodiments, said reagent is one selected from the group consisting of: BstUI, HhaI and HpaII.

Treatment of DNA with an agent comprising bisulphite (bisulfite) converts un-methylated cytosine residues to uracil, but leaves 5-methylcytosine es unaffected. Thus, bisulphite treatment introduces specific changes in the DNA sequence that depend on the methylation status of individual ne residues, yielding single nucleotide resolution information about the methylation status of a segment of DNA. Various analyses can be performed on the altered sequence to retrieve this information, including the use of PCR primers and/or probes and/or sequencing that can distinguish between such singe-nucleotide changes. As described above, other agents that may uses in methods to determine methylation at Cst include oxidative bisulphite (eg for analysis of 5th).

Bisulphite modification may be conducted using eg the EZ—96 DNA methylation kit (Zymo Research), and/or may include the steps of adding an effective amount of a bisulphite reagent to each sample, and incubating (eg in the dark) at about 50°C for 12-16 hours (e.g., using a thermal cycler). After such incubation, prior to analysis, a step of incubating the sample at 0-4°C (e.g., on ice or using a thermal cycler) for 10 minutes may be included.

[84] In particular embodiments of the present invention, said agent may be bisulphite and said determining step may comprise the detection of at least one bisulphite-converted cytosine (such as one in a CpG) within one or more of the nucleotide sequences selected from the group ting of a sequence produced or producible following hite conversion of a sequence comprised within a DMR selected from the group consisting of DMR#: #141, #204, #228, #144, #123, #129, #137, #148, #150, #154, #158, #164, #176, #178, #180, #186, #188, #190, #192, #200, #202, #208,#210, #213, #214, #219, #222, #223, #224, #225 and #226; such as a sequence consisting of at least about 10 contiguous bases (preferably at least about 15 uous bases for any SEQ ID other than SEQ ID NO: 58) comprised in a sequence selected from the group consisting of SEQ ID NOs (see TABLE 2A): 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 and 62 (such as SEQ ID NO: 32, 33, 34 and/or 35, or in particular of SEQ ID N05: 32 and 33 and 34, optionally also 40 35), or an allelic variant and/or complementary sequence of any of said nucleotide sequences. In particular ments, said number of uous bases is at least about 16, 18, 20, 22, 24, 26, 28, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 10, 140, 150 or 160 bases, such as n about 80 and about 160, such as between about 100 and about 160, in each case, independently, up to the maximum number of bases within the sequence selected from said group; wherein one or more of the bases identified by “Y” therein is a U or T (in particular, of a C within a CpG, such as of a relevant CpG of a hypo-methylated DMR) and, preferably, where one or more of another of the bases fied by “Y” therein is a C (in particular, of a C within a CpG, such as of a relevant CpG of a methylated DMR), or an allelic variant and/or complementary sequence of any of said nucleotide sequences. In particular embodiments, two, three, four, five, six, seven, eight, nine, ten or more than ten of the bases identified by “Y” therein is a U or T (preferably T), such as all of the bases identified by “Y” therein is a U or T (preferably T), or all but one, two, three, four, five, six, seven, eight, nine, ten or more than ten of the bases fied by “Y” therein is a U or T (preferably T), in particular where such other one, two, three, four, five, six, seven, eight, nine, ten or more than ten of the bases identified by another “Y” is a C within a CpG, such as of a relevant CpG of a hyper-methylated DMR).

[85] In ular of such embodiments, the method of the t ion may also include those wherein said agent is bisulphite and said determining step comprises the detection of at least one (non-natural) bisulphite- converted cytosine within a nucleotide sequence having a length of at least about 15 bp comprised in a bisulphite conversion of a sequence comprised within DMR #141 and/or #204 and/or #228 (SEQ ID N05: 32, 33 and/or 34, respectively), wherein one or more of the bases identified by “Y” therein is a U or T and, preferably, where one or more of the bases identified by “Y” (in particular, those within a CpG, such as one or more (or all) of a relevant CpG) n is a C, or an allelic variant and/or complementary sequence of any of said nucleotide sequences. Such a nucleotide sequence may be at least about 16bp, 18bp, 20bp, 25bp, 30bp, 35bp, 40bp, 45bp, 50bp, 55bp, 60bp or 70bp, for example up to about 90bp, 100bp or 150bp, such as between about 100bp and about 160bp.

In particular embodiments, the sequence detected may be one comprised in a hite conversion of a sequence comprised within DMR #141 and/or #204 and/or #228 and/or #144 (SEQ ID N05: 32, 33, 34 and/or 35, respectively), such as SEQ ID N05: 32 or 33 or 34, wherein all (or all but one, two, three, four or five) of the cytosines of Cst located (in particular of the nt CpG) in the analysed sequence are detected as a C (ie, such cytosines are determined to be methylated) and all other cytosines located in the analysed sequence (in particular, the cytosines not of a CpG therein) are detected a U or T (ie, such other cytosines/Cst are determined to be un- methylated).

As will now be apparent, such a detected BS converted ce will be a non-natural sequence, as any un- methylated cytosine (such as one outside a CpG) will have been converted to U by the bisulphite treatment, and detected as either a U or a T.

In other certain embodiments of the present invention, the methylation status of the one or more the Cst t in the cell-free DNA may be determined without use of an agent that differentially modifies said DNA based on such methylation. For example, single molecule sequencing/analysis of DNA may be used to determine such methylation status. es of such technologies include those utilised in the: (1) PacBio instruments (Pacific Biosciences) that use Single Molecule, Real-Time (SMRT) sequencing, based on zero-mode waveguides (ZMWs) and phospholinked nucleotides. ZMWs allow light to illuminate only the bottom of a well in which a DNA polymerase/template complex is immobilized. olinked nucleotides allow observation of the immobilized complex as the DNA polymerase produces a completely natural DNA strand. Such instruments can be used for the direct detection of epigenetic cations (Mol Genetics & cs, 2016; 291:1491); and (2) Nanopore instruments (Oxford re) that use nanopored membranes to detect variations in current flow, characteristic to the base/modified-base, as single strands of DNA pass through such nanopore (Nature 467:190). Accordingly, in 40 certain embodiments of the present invention the methylation status at said one or more Cst is determined using single le DNA sequencing or analysis, such as by SMRT or nanopore sequencing.

Analysis of the cell-free DNA present or ed from the biological sample may, in some embodiments, be subjected to an amplification process, for e prior to or as part of the step of determining the methylation status of the one or more Cst associated with the DMR.

Accordingly, certain embodiments of the present invention may include a method that also comprises a step of amplifying one or more regions of said cell-free DNA to produce DNA prior to or as part of said ining step, and preferably after any optional step of treating with said agent. If more than one region of cell-free DNA is to be ed, this may occur as a lex or pool (eg, conducted in a single mixed reaction), or each region may be amplified separately and/or individually, with the possibility that such independent amplified regions are subsequently mixed or pooled so enable pooled and/or multiplex analysis thereon. As will be apparent, any regions of DNA so amplified, in ular those amplified in in-vitro processes, will be synthetic (of in-vitro produced) DNA molecules.

Amplification of regions of cell-free DNA may occur by any suitable method, including polymerase chain reaction (PCR) and rolling circle amplification. Those embodiments of the present invention that comprise PCR ication can further comprises specific steps that are related to the ce of PCR, such as any of those described herein, or in particular the steps of: (A) providing a reaction mixture comprising a double-stranded target DNA, a pair of primers (for example, a pair of primers disclosed ) designed to amplify a region of such DNA (such as a DMR as described herein) wherein the first primer is complementary to a sequence on the first strand of the target DNA and the second primer is complementary to a sequence on the second strand of the target DNA, Taq rase, and a plurality of free nucleotides comprising adenine, thymine, cytosine and guanine; (B) g the reaction mixture to a first ermined temperature for a first predetermined time to separate the strands of the target DNA from each other; (C) cooling the reaction mixture to a second predetermined temperature for a second ermined time under conditions to allow the first and second primers to hybridise with their complementary sequences on the first and second s of the target DNA, and to allow the Taq polymerase to extend the primers; and (D) repeating steps (B) and (C) at least 20 times. The person of ordinary skill will readily be able to design such PCR s for use in the method of the invention, for example by use of primer design algorithms and programs such as Clone Manager Professional 9 (Sci-Ed Software), Vector NTI (Life Technologies), or web-based tools such as those found from bi.nlm.nih.gov/tools/primer-blast/ or molbiol-tools.ca/PCR.htm.

In embodiments utilising amplification of regions of cell-free DNA, include those wherein said amplified region(s) comprises at least one of the nucleotide sequences to be analysed for the methylation status of one or more Cst; such as the methylation status at a plurality of Cst (in particular of the relevant Cst) associated in any of DMRs of the t invention; in particular DMR #141, #204 and/or #228.

Any amplified region may also comprise other sequences, such as (non-natural) synthetic sequences that are used to identify the source (eg sample/woman) and/or the reaction. Such “molecular barcoding” is art-known.

[94] In particular embodiments, said amplification may comprise the use of the primer-pair(s) for the respective nucleotide sequence(s) as independently selected from the group of primer-pairs set forth in each row of TABLE 3.

For example, for that embodiment of the present invention utilising the DMRs #141, #204 and #228, the applicable regions of cell-free DNA may be amplified with the s comprising (eg, consisting of) the sequences set forth in SEQ ID N05 94 and 125; 95 and 126; and 96 and 127, respectively. In particular embodiments, for any of said primers comprising a Y, such primer may be a mixture of (degenerate) primers wherein the base at each Y is either a C or a T; and for those of said primers comprising a R, such primer may be a mixture of erate) primers wherein the base at each R is either a G or an A.

Analysis of the methylation status of the Cst within the nucleotide sequence of sts (such as associated with or located within a DMR of the present invention) can be conducted by any suitable methodology. 40 For example, the present invention includes those method wherein the methylation status of said Cst is determined by a technology selected from the group consisting of: ation specific PCR/MethylLight (eg, via use of real-time quantitative PCR), Epityper, nucleic acid chip-hybridisation, c acid mass-spectrometry, xMAP (Luminex) Methylated DNA precipitation (MeDIP, in which methylated DNA fragments are isolated/enriched via an antibody raised against 5-methylcytosine (5mC)), Raindance (and other droplet l PCR methodology — ddPCR) and nucleic acid sequencing, preferably, (single) strand sequencing, nanopore sequencing, hite sequencing, such as targeted bisulphite sequencing. Sequencing (such targeted bisulphite sequencing) may be conducted to enable ultra-high coverage. Also envisioned are embodiments wherein said determination step may be ted as a pool and/or essentially simultaneously when in respect of two, three, four or more of said tide sequences.

As described above, the present in invention include embodiments where the ation status at said one or more Cst may be determined using single le DNA sequencing or analysis, such as by SMRT or nanopore sequencing.

It will be apparent to the person of ordinary skill that bisulphite-modified DNA ation sites may be detected using eg methylation-specific PCR (such as using primers and/or probes that selectively bind to the bisulphite-modified sequences) and/or by the subsequent use of restriction enzymes the recognition site of which is created upon such bisulphite-modification. Methylation-specific PCR (“MSP”) is described by Herman et al (U56200756, EP0954608 and d family members); and a further development of MSP using probe-based PCR (known as “MethylLight”) is described by Laird et al (U56331393, EP1185695 and related family s).

Alternative methods of detecting differences in sequences that have been converted by bisulphite- modification include mass-spectrometry methodologies (eg MASS-Array of Sequenom) or bead-chip technologies such as the Infinium MethylationEPIC Array or Infinium HumanMethylation450 BeadChip logies of Illumina.

In certain of said embodiments, the methylation status of said Cst may be determined by bisulphite sequencing, such as by single-read and/or high coverage bisulphite sequencing, such as described in the examples.

As described in the example, one advantage of the present ion is that the analysis of cancer-specific DNAme ns from ctDNA is that a greater c range can be achieved than with alternative tests, such as CA125. The dynamic range desired for such a DNAme pattern-based test for n cancer is related to the number of molecules of said cell-free DNA (and/or amplified DNA) that are analysed in the method. For example, the more such molecules are investigated for the presence (or absence) of the cancer-specific epigenetic markers, the greater the dynamic range can be achieved; such as the detection of cancer-specific s in very rarely found ctDNA les present in the total chNA of the woman.

Accordingly, in certain embodiments, the method of the present invention includes those when the methylation status of said CpG(s) is determined in multiple molecules of said cell-free DNA and/or amplified DNA enting each of said nucleotide sequences.

As will be appreciated, the detection of more than one molecule ng the cancer-specific DNAme marker would increase the confidence in the determination of the presence of (or reduced se to therapy against) ovarian cancer that has been returned by the test. Accordingly, in particular of such embodiments, the method can include where the presence in at least a plurality of said cell-free DNA molecules of one or more methylated or methylated (as applicable) Cst located (in ular, the relevant Cst) within one or more of said nucleotide sequences indicates the ce of, or a reduced response to therapy against, an ovarian cancer in said woman. In such embodiments, the ity of cell-free DNA molecules with one or more of said methylated or methylated (as able) Cst located may be a number that is at least 2, 3, 4, 5, 6, 7, 18, 9 or 10, or at least about 15, 20, 25, , 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175 or 200, or a greater number such as greater than about 500, 1,000, 5,000, 7,500, 1,000, 2,500, 5,000 or greater than 5,000 molecules.

To achieve the desired performance characteristics of the test (such as in terms of sensitivity, specificity 40 and/or dynamic range), a greater number of total cell-free DNA molecules may need to be analysed than the number of those exhibiting the cancer-specific DNAme marker (ie, one or more methylated or un-methylated — as applicable - Cst). For example, in particular embodiments of the present invention, the methylation status of said CpG(s) is determined in a number of molecules of said cell-free DNA and/or amplified DNA representing each of said nucleotide sequences selected from the group ting of at least about: 1,000, 5,000, 10,000, 50,000, 100,000, 200,000, 500,000, 1,000,000, 1,500,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000 and 5,000,000 les, or more than 5,000,000 molecules.

The total number of DNA molecules to be analysed and/or that number of which, when exhibiting the cancer-specific DNAme marker, determines the ce of (or reduced se to therapy against) ovarian , can differ from test to test, sample to sample, woman to woman or population to population. For example, particular such numbers may apply when the woman carries a typical amount of or proportion of ctDNA and total chNA, and another when she, or the sample obtained from her, is atypical in response of total/ctDNA quality or amount/ ratio.

Accordingly, the method of the present invention includes those embodiments wherein a fraction or ratio of, or an absolute number of, cell-free DNA molecules in said sample having said ated or un-methylated (as applicable) CpG(s) located within said nucleotide sequence(s) is estimated. To aid the process of determining the presence or e of, or response to therapy against, an ovarian cancer in a woman, the present ion also includes certain embodiments comprising a step of comparing said fraction or ratio with a standard or cut-off value.

For example, if the measured fraction or ratio is r than such standard or cut-off value, then the test is interpreted to indicate the presence of an ovarian cancer in said woman; or it is interpreted to indicate a reduced response to a therapy against an ovarian cancer in said woman, such as tence of the 0C or no response of such CC to such therapy. Exemplary standard or cut-off values for such fraction or ratio of cancer-specific patterns/markers for n of the DMRs of the present invention include about 0.0008 for DMR #141 and/or about 0.00003 for DMR #204 and/or about 0.00001 for DMR #228.

As described above, improved performance of the test of the present invention is achieved by various means; including by the analysis of the methylation status of multiple Cst (eg a particular DNAme marker pattern) associated with multiple DMRs and/or the analysis of le cell-free DNA les for such multiple Cst at such le DMRs. Hence, an excess over a standard or cut-off value for the number of DNAme marker patterns found at my of the multiple DMRs can be a ularly advantageous embodiment for the test of the present invention.

Accordingly, the test of the present invention includes those particular embodiments wherein a fraction or ratio of cell-free DNA molecules with said methylated or hylated (as applicable) CpG(s) present in each of said nucleotide sequence(s) is estimated and compared to a respective standard or cut-off value; wherein any one of such fraction or ratios being greater than its tive standard or cut-off value indicates the presence of, or a reduced response to therapy against, an ovarian cancer in said woman. For example, if the methylation status of Cst d in each of DMRs #141 m #208 m #228 is determined in a test of the present invention, and the fraction or ratios of a SEQ ID No 63 at DMR #141 is greater than about 0.0008 g the fraction or ratios of a SEQ ID No 64 at DMR #204 is greater than about 0.00003 g the on or ratios of a SEQ ID No 65 at DMR #228 is greater than about 0.00001, then the presence of (or reduced response to therapy again) n cancer is determined for the woman. Alternatively, the use of multiple DMRs would enable a decision rule to be d that takes into account the multiple DMRs by using a different cut-off for some markers depending on how many markers are positive for existing cut-off values in a single sample. Generally, for example, lower individual cut-offs can be applied the more DMRs that are found to give a positive result. Another example could be to define a “hyperplane” of f values in N-dimensional space (N = number of markers measured), and for any combination of marker , it can be determined if they fall “below” (=positive) or “above” tive) the hyperplane. Finally, a logistic regression model could be applied that determines, for any combination of marker values, the likelihood of the outcome to be positive. 40 Accordingly, the invention also es embodiments that may incorporate such analysis approaches when two or more of the DMRs of the invention are ed.

As described herein, the present invention also provides advantages in that the standard or cut-off value used in respect of a particular DNAme marker can be adapted, for example in response to desired characteristics of the test or in response to the characteristics of the chNA isolated of the woman.

Accordingly, certain embodiments of the test of the present invention include those where said standard or cut-off value(s) is/are modified for a given sample based on one or more of the following factors: (i) the amount or concentration of total cell-free DNA present in said sample; and/or (ii) a baseline value of said fraction or ratio previously determined for said woman; and/or; (iii) a value of said fraction or ratio ined from multiple samples from a population of women representative of said woman; and/or (iv) the specificity and/or sensitivity and/or dynamic range desired for said method of determination. In particular embodiments, said standard or cut-off value(s) may be increased when chNA blood collection tubes such as Streck Tubes, are used. For example, in such embodiments, the applicable said standard or f value(s) may be increased by a factor of about 2, 5, 10, 20, 50, 100, 200, 500 or 1000, or by a factor that is greater than 1000.

[108] In particular of such embodiments, the standard or cut-off value may be reduced for a given sample that has an amount and/or concentration and/or quality of total ree DNA present in said sample that is r than a standard or cut-off value. Suitable methods for the inspection, estimation or determination of amount and/or concentration and/or quality of total cell-free DNA include those described elsewhere . For example, if the quality of the total chNA of the woman is lower than ed (such as a higher average fragment size than as described herein), and/or if the total chNA amount is higher (in each case indicating that somatic DNA may have been released from eg WBCs during sample collection, transport, storage and/or processing), then the standard or f value used for the respective fraction or ration for the DNAme marker can be reduced. This allows for more possibility to adapt the test to the individual situation or woman taking the test.

As a further embodiment of the test, it may be practiced multiple times on a given woman, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, about 15, about 20 or more than about 20 times (such as about 50 times). Such a repeated test can enhance the (early) detection of ovarian cancer in the woman and/or the long-term se to therapy against (or monitoring of) ovarian cancer. Accordingly, the test may include those embodiments when it is practiced on multiple samples; wherein each sample is collected from the same woman at different time points. For example, said multiple samples are collected from said woman with an interval between them selected from the group consisting of about: 2 days, 3 days, 4 days, 5 days, 7 days, 10, days, 14 days, 21 days, 24 days, 3weeks, 4 weeks, 5 weeks, 6 weeks, 6, weeks, 8 weeks, 3 months, 4 months, 5 , 6 months, 8 , 12 months, 18 months, 2 years, 3 years and 5 years.

In certain of such embodiments, it may be that the test of the present invention is conducted as part of a routine screen of one or more women, such as part of an annual screen for the presence or absence of ovarian cancer. For certain women (or groups thereof), the period of repeat g may be shorter. For example, women in high risk groups (such as those with BRAC 1/2 ve/ and/or a family history of ovarian cancer and/or belonging to certain sub-populations eg Ashkenazi women) may be tested more ntly, for e every 6, 3, 2, or 1 month.

Furthermore, those women for which n cancer has already been sed (and perhaps already d with chemotherapy) may be repeat-tested using the present invention at a frequency of about every 6, 3, 2, 1 month, or even more frequently such as once about every two weeks or about every week.

As has been shown for the based ROCA test, a deviation or change from an earlier t-specific standard or cut-off value can provide a further enhanced test for ovarian cancer. Accordingly, for those embodiments of the present invention where a woman is tested le times, the presence of, or a reduced response to therapy against, an ovarian cancer in a woman is indicated by - in comparison to a previous sample of said woman - the 40 presence of, or an increase in the absolute number of, or an increase in the fraction or ratio of, cell-free DNA molecules in said sample having said methylated or un-methylated (as applicable) CpG(s) located within said nucleotide sequence(s).

As shown by the examples herein, the test of the present invention can be used in combination with other tests for n cancer; in particular with those which reduced (or no) overlap of false positives and/or false negatives to the test of the present invention. Exemplary such tests, including those based on CA—125, HE4, transthyretin, oprotein A1, betamicroglobin and transferrin (such as ROCA, ROMA and OVA1) are described in more detail elsewhere herein. ingly, in n embodiments of the present invention, one or more additional steps may be conducted in respect of such other tests for ovarian cancer. In particular; one optional an additional step may comprise that of determining (eg by an in-vitro ure), from a blood sample from said woman, the amount present therein of one or more proteins independently selected from the group consisting of: CA—125, HE4, transthyretin, apolipoprotein A1, -microglobin and transferrin; wherein, either or both of: (i) the presence in at least one of said cell-free DNA molecules of one or more methylated or un-methylated (as applicable) Cst located within one or more of said nucleotide sequences (such as by an excess of any one of the DNAme marker patterns of the present invention being in excess of a standard or cut-off value); or (ii) an amount of said protein(s) present in said blood sample is greater than a standard or cut-off value for such amount or n; indicates the presence of, or a reduced response to therapy against, an ovarian cancer in said woman. As will be appreciated, such additional step related to the other test for n cancer may be ted either before or after conducting the DNAme- based aspects of the test. Indeed, the conduct of one (or other) of the tests may be dependent on the outcome of the first, for example to provide additional sensitivity and/or sensitivity to the other all determination, test or diagnosis.

In such embodiments, the protein may be determined by a ROCA, a ROMA and/or an OVA1 diagnostic test.

As described elsewhere herein, the test of the present invention may be applied to different types of ovarian cancer. For example, in certain embodiments the present invention the n cancer may be an invasive ovarian cancer, such as an invasive epithelial ovarian cancer; in particular one selected from the group ting of: high grade serious (HGS), endometroid, ell and mucinous ovarian cancers. In alternative embodiments, the cancer may be peritoneal cancer or Fallopian tube cancer.

In particular; the test of the present invention may be used (or ) for distinguishing the presence of ovarian cancer (such as one described elsewhere herein) from the presence of a benign pelvic mass in the woman.

In other embodiments, the test of the present invention may be used (or useful) for determining the response of a woman ing from ovarian cancer to a therapy comprising chemotherapeutic agent(s) against said ovarian cancer (such as one described elsewhere herein). For example, such a test may be conducted to predict the risk of death of said woman, in particular from risk of death by n cancer that is not responding to (chemo)therapy.

In certain of such embodiments, the test of the present invention may be practiced on said woman after one, two, three, four and/or five cycles of said (chemo)therapy.

And in further such embodiments, said sample may be obtained from said woman within a period after completion of said cycle or (chemo)therapy that is selected from the group consisting of about: 2 hours, 4 hours, 6 hours, 12 hours, 18 hours, 24 hours, 36 hours, 48 hours, 3 days, 4 days, 5 days, 6, days, 7 days, 8 days, 10 days, 12 days, 14 days, 16, days, 18 days, 21 days, 24 days, 4 weeks, 5 weeks, 6 weeks, and 8 weeks.

In particular such embodiments, it may be that a lived increase in the ratio or fraction of the DNAme marker is observed shortly after said )therapy. t being bound by theory, this may arise due to death/lysis of cancer cells in response to the (chemo)therapy and their shedding of ctDNA into the blood stream of 40 the woman. Accordingly, the test of the present invention may include the monitoring of such short lived (eg for 1, 2, 3, 5, 7, or 14 days) increase in DNAme marker(s) as an indication of (initial) response/success of the (chemo)therapy. The test may then be ed to monitor the reduction of the DNAme marker(s) in chNA after such increases, and whether the ratio or fraction of the DNAme marker increases at a later time (indicating a reduced response to therapy t, and/or the recurrence of, the ovarian cancer.

In such embodiments of the present invention, said therapy includes one or more chemotherapeutic agent(s), such as those one that is used and/or is approved (eg, by the European Medicines Agency in Europe and/or by the Food and Drug Administration in the US) for the treatment of a cancer, in particular for the treatment of ovarian cancer. In alternative such embodiments, the chemotherapeutic agent may be one in development on the date hereof, or in the future. Examples of such chemotherapeutic agent include one or more independently selected from the group consisting of: a platinum-based antineoplastic (such as carboplatin, cisplatin, oxaliplatin, nedplatin, picoplatin or satraplatin) and a taxane (such axel or docetaxel). In particular; the chemotherapeutic agent may be one selected from the group consisting of: carboplatin, paclitaxel, docetaxel, cisplatin, liposomal doxorubicin, gemcitabine, trabectedin, etoposide, cyclophosphamide an angiogenesis inhibitor (such as bevacizumab) and a PARP inhibitor (such as olaparib). Other PARP inhibitors in development e: veliparib (ABT-888) from Abbot, MK4827 from Merck, AG-014699 of Pfizer and Iniparib (351-201) of Sanofi-Aventis. Other angiogenesis inhibitors in pment e aflibercept, AMG386, nib, sorafenib, sunitinib and pazopanib. Antibody-drug conjugates in development include T—DM1, IMGN388, uzumab mertansine, AN-152, Sl(dst)-PE38, S, SAR566658, VBfi-845, Thio Hu3A5-VC—MMAE, CDX—014, MEDI-547, SGN-75 and MDX—1203. In particular embodiments, the chemotherapeutic agents may be carboplatin, cisplatin, paclitaxel or docetaxel, or may be combination therapies A particular form of (chemo)therapy that may be used in the treatment of ovarian cancer, and one following which the test may be conducted, is neoadjuvant (chemo)therapy (“NACT”).

One ular advantage of the test of the present invention is that it can provide individual-specific therapeutic options. For example, in certain embodiments of the test of the present invention, if said woman is ined to respond to (for example, has responded to) said (chemo)therapy, then said woman may be designated as being eligible for tumour de-baulking surgery. As will be recognised, if a woman is determined to respond to such chemotherapy then tumour de-baulking y is an intervention that could prove life-saving. In contrast, if a woman is determined to not respond to said )therapy, then said woman may not be le for such invasive tumour de-baulking surgery. However, in such ments, she may be designated as eligible for therapy with one or more second-line chemotherapeutic agent(s) against said ovarian cancer. The response to therapy with such second-line chemotherapeutic agent(s) may also be determined using a test of the present invention, and if such second-line chemotherapy leads to a response (such as determined sooner by a test of the present invention), then such woman may then be designated as being eligible for tumour de-baulking surgery.

[124] Said second-line )therapy includes one or more chemotherapeutic agent(s) independently selected from the group consisting of: carboplatin, paclitaxel (such as alone, and as a weekly ent), docetaxel, cisplatin, liposomal doxorubicin, abine, tedin, etoposide, cyclophosphamide, an angiogenesis inhibitor (such as bevacizumab) and a PARP tor (such as olaparib), or any of those chemotherapeutic agent(s) described above.

The second line chemotherapeutic agent may, in same embodiments, be the same as that used in said first therapy; but in such alternative embodiment said (same) subsequent chemotherapeutic agent is used at a different dosage, different administration route, ent treatment regimen and/or in ation therapy together with other treatment modalities. For example, carboplatin in combination with paclitaxel is commonly used as first line therapy, and carboplatin (alone) may be used as the second line therapy, such as if the patient is relapse-free for 12 .

In this way, the test of the t invention provides a faster and more accurate test for determining their 40 response to (chemo)therapy t n cancer, such that the most appropriate, or additional, eutic interventions can be made; ultimately increasing the success of treatment for ovarian cancer, an increase in progression free survival, overall survival and/or quality of life (such as may be measured by pain suffered or reported and/or pain-killer use).

In a first related , the invention relates to a method of ining the methylation status at one or more Cst of cell-free DNA comprising the steps: 0 Providing a biological sample, said sample comprising cell-free DNA; fl 0 Determining, in at least one le of said cell-free DNA, the methylation status at one or more Cst (such as one or more relevant Cst) d within one or more of nucleotide sequences, W, said one or more of the nucleotide sequences are independently ed from the group consisting of: SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 and 31 (for example, within one or more of the nucleotide ces comprised in one or more of the respective DMRs of the present invention independently selected from the group consisting of DMR#: #141, #204, #228, #144, #123, #129, #137, #148, #150, #154, #158, #164, #176, #178, #180, #186, #188, #190, #192, #200, #202, #208,#210, #213, #214, #219, #222, #223, #224, #225 and #226), or a nucleotide sequence present within about 2,000bp (such as within about 200bp) 5’ or 3’ thereof, or an allelic variant and/or complementary sequence of any of said nucleotide sequences.

In a second related aspect, the invention relates to a method of detecting one or more: (i) methylated Cst associated with (such as located within) one or more of the hyper-methylated DMRs of the present ion; and/or (ii) un-methylated Cst associated with (such as located ) one or more of the hypo-methylated DMRs of the t invention, in each case comprised in at least one molecule of cell-free DNA of a woman comprising the steps: 0 Providing a biological sample, said sample comprising cell-free DNA of said woman; fl 0 ining, in at least one molecule of said cell-free DNA, the ation status at one or more Cst (such as one or more nt Cst) located within one or more of the nucleotide sequences independently selected from the group consisting of: SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 and 31 (for example, within one or more of the nucleotide sequences comprised in one or more of the respective DMRs of the present invention independently selected from the group consisting of DMR#: #141, #204, #228, #144, #123, #129, #137, #148, #150, #154, #158, #164, #176, #178, #180, #186, #188, #190, #192, #200, #202, #208,#210, #213, #214, #219, #222, #223, #224, #225 and #226), or a nucleotide sequence present within about 2,000bp (such as within about 200bp 5’ or 3’) thereof, or an allelic variant and/or mentary sequence of any of said nucleotide sequences, m, the presence in at least one of said cell-free DNA molecules of one or more: (i) ated Cst associated with (such as located within) one or more of the methylated DMRs of the present invention (eg, as identified in TABLE 1A), for example associated with (such as located within) one or more of said nucleotide sequences independently selected from: SEQ ID NOs: 1, 2, 3, 4, 10, 12, 14, 15, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29 and ; thereby s said methylated CpG(s) in the cell-free DNA of said woman; and/or (ii) un-methylated Cst associated with (such as located within) one or more of the hypo-methylated DMRs of the present invention (eg, as identified in TABLE 13), for example associated with (such as located within) one or more of said nucleotide sequences independently selected from: SEQ ID NOs: 5, 6, 7, 8, 9, 11, 13, 16, 17, 22 and 31; thereby detects said un-methylated CpG(s) in the cell-free DNA of said woman.

In a third related aspect, the invention relates to a method of diagnosing and ng a woman having an ovarian cancer comprising the steps: 40 0 Providing a biological sample from said woman, said sample comprising cell-free DNA of said woman; 0 Detecting, in at least one molecule of said cell-free DNA, whether one or more methylated or un-methylated Cst (such as one or more relevant Cst) is located within one or more of the nucleotide sequences independently ed from the group consisting of: SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, , 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 and 31 (for example, within one or more of the nucleotide sequences comprised in one or more of the respective DMRs of the present invention independently selected from the group consisting of DMR#: #141, #204, #228, #144, #123, #129, #137, #148, #150, #154, #158, #164, #176, #178, #180, #186, #188, #190, #192, #200, #202, #208,#210, #213, #214, #219, #222, #223, #224, #225 and #226), or a nucleotide sequence present within about 2,000bp (such as within about 200bp) 5’ or 3’ thereof, or an allelic variant and/or complementary sequence of any of said nucleotide sequences; 0 sing the woman with an ovarian , such as an ovarian cancer that does not respond to a first therapy, when one or more of: (i) said methylated Cst associated with (such as located within) one or more of the hyper-methylated DMRs of the present invention (eg, as identified in TABLE 1A), for example associated with (such as located within) one or more of said nucleotide sequences independently selected from: SEQ ID NOs: 1, 2, 3, 4, 10, 12, 14, 15, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29 and 30 is detected; and/or (ii) un- methylated Cst associated with (such as located within) one or more of the ethylated DMRs of the present invention (eg, as identified in TABLE 13), for e associated with (such as located within) one or more of said nucleotide ces independently selected from: SEQ ID NOs: 5, 6, 7, 8, 9, 11, 13, 16, 17, 22 and 31 is detected; fl 0 Treating said diagnosed woman by: o Administering, or recommending administration of, an ive amount of a chemotherapeutic agent to a woman diagnosed as having an ovarian cancer, such as one that does n_ot respond to the first therapy; or 0 Conducting, or recommending the conduct of, tumour debaulking y to a woman diagnosed as having an ovarian cancer that does respond to the first therapy.

In such related aspect, the chemotherapeutic agent and/or the first therapy may be one as described elsewhere herein.

In certain embodiments of such related aspect(s), the methylation status of said CpG(s) may be determined according to one or more of the ponding embodiments of the other aspects of the present invention; including for e, that said cell-free DNA of the woman may be subjected to an agent that differentially es said DNA based on the ation status of one or more of the Cst, and/or that the methylation status of the one or more the Cst is determined without use of such an agent (such as, by single molecule sequencing/analysis of DNA). In certain embodiments of such related aspect(s), the methylation status of said CpG(s) may be determined by the detection of a nucleic acid of the third aspect, such as the detection of a (eg non-natural) nucleic acid comprising at least about 15 contiguous bases comprised in SEQ ID No. 32, 33, 34 and/or 35.

In further certain embodiments of such related aspect(s), the/a biological sample may be collected and/or further processed ing to one or more of the corresponding embodiments of the other aspects of the present invention. For example, the ical sample may be ed from a woman having or suspected of having ovarian , or suspected to not have responded to therapy against ovarian cancer. In any such embodiments, the biological sample may be, or may be obtained by, any of the corresponding embodiments of the other aspects of the present invention.

In further of such embodiments, the method of detecting said methylated or un-methylated (as applicable) CpG(s) (in particular, one or more relevant Cst) may se the step of determining the ce or absence of, or response to therapy against, an ovarian cancer in said woman, wherein the detection in at least one of said cell- 40 free DNA les of one or more methylated un-methylated (as applicable) said Cst located within one or more of said nucleotide sequences tes the presence of, or a reduced response to therapy against, an ovarian cancer in said woman.

In a second aspect, the invention relates to a chemotherapeutic agent for use in a method of therapy of ovarian cancer in a woman, wherein said chemotherapeutic agent is administered to a woman within about three months of said woman having been predicted and/or determined, using a method of the first aspect, to n_ot d to a therapy against ovarian cancer.

In a related second aspect, the invention also relates to a method of treating ovarian cancer, comprising administering an effective amount of a chemotherapeutic agent is administered to a woman within about three months of said woman having been ted and/or determined, using a method of the first aspect, to n_ot respond to a therapy against ovarian cancer.

In certain embodiments of such second , the chemotherapeutic agent is one that is used and/or is approved (eg, by the European Medicines Agency in Europe and/or by the Food and Drug Administration in the US) for the treatment of a , in ular for the treatment of ovarian cancer. Examples of such chemotherapeutic agent e one or more independently selected from the group consisting of: carboplatin, paclitaxel, docetaxel, cisplatin, liposomal doxorubicin, gemcitabine, trabectedin, etoposide, cyclophosphamide an enesis inhibitor (such as bevacizumab) and a PARP inhibitor (such as olaparib). In other embodiments, the chemotherapeutic agent may be any one of those described elsewhere herein.

In any embodiments of such second aspect, the chemotherapeutic agent is administered to said woman within about 3 months, or about 70, 56, 53, 49, 46, 42, 39, 35, 32, 28, 25, 21, 18, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 days or less, such as within about 24, 20, 18, 15, 12, 10, 8, 6, 5, 4, 3 or 2 hours, or within about 1 hour, of said prediction and/or determination. Also envisioned by the t invention, is that such chemotherapeutic agents can be used in combination formulations and/or combination treatment regimens with another chemotherapeutic agent, other pharmaceutical agents and /or medical intervention such as radiation treatment or surgery.

A chemotherapeutic agent may be administered to said woman by the applicable or tional mode of administration, such as intravenously, intramuscularly, intradermally, orally.

In such second aspect, said prediction and/or determination is made using a method of the first aspect.

That is, an embodiment of such method of the invention may be practiced, such as to determine or to predict (eg by an increased likelihood) that said woman has not responded (or will not respond) to a first therapy against the ovarian cancer she is suffering from; or that she has not responded (or will not respond) completely, sufficiently and/or within a predetermined period of time (such as about 12 months, 6 months, 4 months, 3 months, 2 months, or about 4 weeks or 2 weeks, or about 1 week).

A first y against the ovarian cancer may be surgery, such as tumour de-baulking surgery, or it may be treatment with a chemotherapeutic agent such as one described above. Whilst in one embodiment, the uent chemotherapeutic agent used after said tion and/or determination is ent to a chemotherapeutic agent used for said first therapy, in another aspect said subsequent chemotherapeutic agent is the same as that used in said first therapy; but in such ative embodiment said (same) uent chemotherapeutic agent is used at a different dosage, different administration route, different treatment regimen and/or in combination therapy together with other treatment modalities.

In the context of the invention, an effective amount of a chemotherapeutic agent can be any one that will elicit the biological, physiological, cological, eutic or medical response of the woman that is being sought by the pharmacologist, pharmacist, medical doctor, or other clinician, eg, lessening of the effects/symptoms of the ovarian cancer. 40 [141] In a third aspect, the invention relates to a nucleic acid comprising a nucleic acid ce consisting of at least about 10 contiguous bases (preferably at least about 15 contiguous bases for any DMR other than DMR #222) comprised in a particular (eg non-natural) sequence derived from one selected from the group consisting of one set out in TABLE 1A, TABLE 1B or TABLE 2A (for example, a sequence consisting of at least about 10 contiguous bases (preferably at least about 15 contiguous bases for any DMR other than DMR #222) sed in a sequence producible by (such as produced ing) hite conversion of a sequence comprised within a DMR selected from the group consisting of DMR#: #141, #204, #228, #144, #123, #129, #137, #148, #150, #154, #158, #164, #176, #178, #180, #186, #188, #190, #192, #200, #202, 210, #213, #214, #219, #222, #223, #224, #225 and #226; such as a sequence consisting of at least about 10 contiguous bases (preferably at least about 15 contiguous bases for any SEQ ID other than SEQ ID: NO:58) comprised in a sequence selected from the group consisting of: SEQ ID N05: 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 and 62 (such as SEQ ID NO: 32, 33, 34 and/or 35), or an allelic variant and/or complementary sequence of any of said tide sequences. In particular embodiments, said number of contiguous bases is at least about 16, 18, 20, 22, 24, 26, 28, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 10, 140, 150 or 160 bases, such as between about 80 and about 160, such as between about 100 and about 160, in each case, independently, up to the maximum number of bases within the sequence ed from said group.

TABLE 2A: DMR-correspondence and possible sequences of the hite-converted DMRs of the present invention . . . . SEN%ID DMR# Blsulphlte-converted ampllcon sequence (all Cst are underllned) "A""YGGAGGT"TAGGGGTGAGGAT""g§""Ag§GGAAGGAGGTATAggATTTAG""TATGA"ATX§ 141 "TA"""ggGgg"GGTG"TG"AGGGGGAAG""TAGGTA"""AngAGGATAGGA""ggGGGAA""g§T 32 GAHAHnYGGHGGAGAGHXEHAGHHGmAYGHXQXQGGGHAHHAGGXQTAGTAYGHHAHXEXEXEHGGG 204 "g§"AG""GG"AG"A"AGGAAG"""AGG"GGAAGAGYGGYGGYGTGGGYGG"”YGGYGYGGYGYGGY 33 EAGHG_§GGHHGGHAHX§GH G44AHA“GGGXQAGHHGm“GHAGHGYGGHAGHHAGGXEHHAYGYGGGXEGGHHHHHHHHXEGHHHTH 228 34 KEG“finGmAXEGHAHfinAXQGAHHAHHHGGTHHYGYGGGHHHHH AAHAGGHHAGAYGTGGGHfinAT“AGGGYGGYGHXEHTAAGGHHHAGAYGHHAHYGHGHAGGAGGGAX 144 —AYGAF1I—1r1r'lr'lTTr'lAEr'n—‘Ir'lr'lflr'lGGr'lr1r'lr1AAr1riflGEr'lr'lr'n"!Gr'lr1ATTr'lr'lr1GAr1r1EGI—‘IGAAF1AF1AF1 35 AHHAGA GYGAAGHAGGAGHAGHAGHXEGGHHAHAYGAGHHnnzgnnYGHHHHGGHHXEGGHHHHHHXEAGHTn 123 36 AGAHAHHAGHXEAGGHAGHGXEGGHAAHAGGGHHAGTT“HHXQHHAGGAGAGA AA""""G""GAG"GAG"""A"AAA"AGGGTA"AA"X§AGAYGYGGGAA"G"""GGG"X§"YGYG"AG 129 ———— 37 AHAHXEGGHAGGGHXEHHA“A“THAGHGGGHHAGHAAAAAXEGHGHTAAGHGA AnnnYGHHAHAHAHAHAGHHGHAHAYGGHAHAAHAYGYGGHTAHAGGTNAHHHHAGGHYGHTTXEGG 137 38 AGAA“nfinAXEHAGHHAHAXEHAGAHAGAAGAHAHTfinAXEGGHAHGGGTGHHHAGHHHHHXE GAGGHAAHGGAAGYGGHHAHfinfinGmTnAYGTHnYGYGHHAGGHAGAAGYGAHXEGGGHXQAAHAXE 148 39 AHHAXEHHfinTGAAHAXEGGXEHHGmGmNAHGGGHGHHAXEGAHGHHAHAHAH GYGGGTA”""GTAG"T""AG""A""YGGGAGG""GAGGYGGGAGAA"GGg§"GAA""YGGGAGGYGG 150 'lr'lGr'IAGEAGTEAGAI—‘IYGYGF'IF'IAF'IEF'IAF'IF'Ir1TAGr1r1r'IGGGEAI—‘IAGAGEAGATF'ITEI—‘IF'IF'IAA 40 nfinnYGGAGHAXEGAGHHTAGGTHAGTGGTAGHXEATHNAGTTnAYGAGAHHTHHHHAXETYGHHHH 154 AAAA""AAAAXQGAGT""AATAXQAAG"TGGG"GAAG"X§"AG"""G"AGGAG"”AGGGAGA"GX§" 41 GA“finAGHTnAAAAAAAGAAAAAAATAGGGTXEGGYGYGGHGGHAHAYGHHHGHHAHTTHAGHAHHH 158 "GGGAGG"X§AGGX§GG"GGAT"AX§AGGTXQGGAGA"X§A"A""AT"""GGG"AA"AX§GTGAAA" 42 GA“nYGYGAGGHfinTnNAGHAGHHTAN“AXEGGAXQGXEGHGHHNAGHHHAGTHHAGGGHAAHHGGG 164 I"II"II"II"II"IF1GAGAGI"!F1EAI’1I"!TI"!F1AI’1EGI"!F1I’1GGGAGEAGTGGI"!F1EAGI"!F1I’1AGAI’1GI’1I’1GGGAAI’1EI’1X 43 “AAA“NATTTnfinNAHHAAAHTGHAHGAAGAAGGHXEGGYGYGGHGGHAHAXEHHHGTAAHTHHAGH 176 Ar'lr'lr'lr'lGGGAGGF'IEAGGEGGEGAF'IF'IAEAGGF'Ir'lAGGAGAr'IEAGAI—‘IF'IAEGF'IGAAATF'IF'IEF'IF'IF'IF'I 44 178 GG"AGGAGg§""""A""ATGggTAAG""g§"GG""TGGAGAGg§"TGAAGGTGGGAGGGGGAAGAGG 45 GG"AGAATTT"YGYGGGAGYGAGYG"A"AG"TG"YGTTTYG"GG"YG""TYGGGAATYG""GG"""Y gGT"T"GG r'lTGr'IAGAAGETATI—‘ITF'IGr'lr'lGAAr'lAr'lr'lr'lYGAGGAEI—‘IGF'IF'Ir'lr'lr'lETAr'lAGGGAGYGI—‘Ir'lYGTr'Ir'Ir'Ir'IGr'I 180 r'lGGGGF'ITGGAGEGEF'IF'Ir'lGGAGGr'IYGAr'IAr'Ir'lEGTEr'II—‘IGF'IF'IGGATr'n"!r1TTEI—‘IF'IF'IGF'IEF'IF'IF'IF'IF'IG 46 ygnGnnAGTnAGGAnGGnnNYGAnnnnnnGAnTTygnGAnnAGnnygnnnngTnnnnnAAAGnGnn 186 "AAAGGXETGAG””A"YGYG""X§GG""X§AGA""T"1""G""""""""AAAAAAAAAAGG""""""GGG""""G"1 47 GGnAnnnnGGGA AGAG'I'IG'IA'IT"YGAAGA"""TAGA"""EAGAG’ITGYGGAAAYG"TAEAGGA'I""G'TIAA'TIAGG 188 r'lr'lGEGGF'ITAAF'IF'IAGAGF'IF'IGGGAAGAI"!r'lEAATAI—‘IEAF'IF'Ir'lflr'lr'lr'lEGTr'ITTr'IGr'IAGr'Ir'IEGAI—‘IAF'I 48 mAyGrm G""AGAX§AGAG"""GGGG""AA"G"YGAGG"GGAGX§AYG"TGG"AX§G"AA""""GAG"""GYGY 190 49 EGH“EGETHAFWrmrmGGrmrm“£quGrmGGrmGGAmm EGHAGGH“ArmHAGHAGTAGGGW“TAEHEGWfiyGfiyGATGfiTTHAGAAGGmAGW 192 YGAAGAGYGG""YG"A"AYG"""GYGGGGTAGTG’IAG"“I'IG’IEG'IGYGG'IAG’IAA"TGAG’IA’IA’IA 50 GGEAAGAE AAT"‘AGT""‘AG"‘AA"‘YGGX§A"‘"1'""‘AAGYGYGGYGA"YG"‘AAAGGGAG"‘G""""TGT"WA”""YGYGW”1 200 51 AGAT'1mHmHmHXEGHAGGAATAHAGGAHHTAHHHGHHAGHGG G"GEAA’IAAGA’YGGGE’W"flr‘fl"YGAYGYGAAGGGG"“IGT"TG'IGYGYGGE'I'IGEGG'W" 202 TerGYGYerGGGGu—wGu—wGENGr-uGETGr-ur-uEGGr-ur-uEGr-n—wr-ur-uGTGr-uGr-uGr-uAr-uYGYGGGr-ur-uTGTTr-uAG 52 AGTEGGA’I’IA’IYG AHAWAAWrmG“NEGGHAEGHGGWrquGnmGHAAWAGHAWWGGGAGGHEAGGEGG 208 53 AYGAGG""AGGAGATEAGA’TIA"T""GGEAA'IA"GG’IGAM'I'I’IE AHAGAHNAN—1GrqAGGAnNAN—1runrunGrqGrqNTnTTAAAATnNTrunnnnTTEnnTnAnTTnAT A An G T A AAn n 54 "E""EGGAA"1GGGAA'1ATAG'1I"A"‘A"‘A"1GGGAAAAYGYGGTG"‘AGGGAGAAAA"1 I'"AA"1T'1AG'1GA 213 55 GGAGXQGAGGX§"AGGA""G"GGAG"G"G"A"TX§G ""G""TAAAGGYG"AGAGGAG"AG""GGGAAXEAGAATAAAGXQG""AGG"""""""X§GAGGAAGG 2 14 56 AAGGAGAGAG"1""1""AGGAAA""AG"1"GA GGAHGAAGGAHHHNTGTATnAnnGmGAHGGHnAnGGyngGTTGnnnGGGnnnnnnnnnnnngTAG 219 57 G"AAGGGAGGAGG"AGGGGAAGGGA"A"GTG"Tr1 NAGGTnAnAGGAAGAGGTAnmmmmNATAGAHGAXEGHHGHAAAAHHNTAAGHHGAGHHHHHHTAGGA 222 58 AAGAGAGAG"GGT"GA"AA""AG"AGAGAGAGGTTT""AA"""AXQGAAGTG"""G"AA"A"AA""T 223 59 mmqunAnArmAGmTGn GGnrunmmnnnnnYGAGnnAnGAAGAGTHGrqmmGEGHHATrunquGTnTnETAnnTETnrm—qnGrm—qA 224 60 r1mmrqAGGnnnnnGnAAnnqunnTAAflnnn GAAGH r'lr'lGAnAnnranGGn r'lr'l r'IAAAr'IAr'IqunnquGTrqAnAAnAflAnAnTTAGGGAHAGAHAHTmm I”! 225 61 “A“GHAHAGHAAGFWGHGG GGGGGGA"1""G""YG"1 ""AA"1 """"A"‘TGT"1TAATGA"‘YGYGG"‘TYGYGYG"‘T"1YGAGTAA"‘YGGGTGA"‘G"1 226 62 ATGTGGAWGHGHAHAWWEHGG Each Y, independently either C or T/U In certain embodiments of such aspect, one or more of the bases identified by “Y” in such sequences of contiguous bases is a U or T (preferably, a T). As will now be apparent to the person of ordinary skill, such sequences (ie, those comprising a U and/or a T at one or more bases identified by “Y”) are non-natural sequence as the ce is produced following conversion of a cytosine in a natural sequence by bisulphite. In ular of such embodiments, such a nucleic acid of the t invention comprising two, three, four, five, six, seven, eight, nine or ten (up to the maximum number of “Ys” present in such sequence of contiguous bases) Us and/or Ts; and in more particular of such embodiments, such a c acids may comprise at least one, two, three, four, five, six, seven, eight, nine, ten or more than ten (up to the maximum number of Cst present in such sequence of contiguous bases) Cs at any of the bases identified by “Y” therein, such as those “Ys” within Cst (such as relevant Cst) d in such sequence of contiguous bases. In particular embodiments, two, three, four, five, six, seven, eight, nine, ten or more than ten of the bases identified by “Y” therein may be a U or T (preferably, a T), such as all of the bases identified by “Y” therein may be a U or T (preferably, a T), or all but one, two, three, four or five of the bases identified by “Y” therein is a U or T (preferably, a T) and ably all other Y’s therein (in particular; those in Cst) may be Cs.

In other embodiments, such a nucleic acid of the invention ses a nucleic acid sequence consisting of said number of contiguous bases - for example, at least about 10 uous bases (preferably at least about 15 contiguous bases for any SEQ ID other than SEQ ID: NO:89) - comprised in a particular (non-natural) sequence ed from the group consisting of those set forth in TABLE 2B: SEQ ID N05: 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 and 93 (such as SEQ ID NO: 63, 64, 65 and/or 66, or SEQ ID N05: 63 and 64 and 65), and in particular of such embodiments, said nucleic acid comprises a sequence ed from said group, or in each case an allelic variant and/or complementary sequence of any of said nucleotide sequences. As will be apparent, typically a bisulphite converted [un-methylated) cytosine would be detected as a T, particularly after an amplification (such as a PCR) step. However, certain detection logies (for example, those able to detect single molecules) may be able to directly detect a hite ted (unmethylated ) cytosine as a U. Accordingly, the sequences of TABLE 2B are also oned to encompass the analogous sequences where, instead of a T representing a bisulphite ted (un-methylated) cytosine, such T is instead a U. The location of such Ts (eg, C in the genome sequence outside of Cst) will readily be identifiable by the person of ordinary skill by comparison of the sequences presented in this TABLE 2B to the corresponding genomic sequence presented in TABLE 1A or TABLE 1B, as applicable.

TABLE 2B: Particular patterns of epigenetic markers associated with the presence of ovarian cancer detected by particular (non-natural) ces of the DMRs of the present invention Total Marker Detected sequence for No. of SEQ DMR No. 0C specific pattern coordlnates marker (relevant Cst relevant ID # of of meth lation (hg 19) y are underlined) Cst N0.

QF‘F‘AQGGAAGGAGGr1Ar1Ag ch r5: 178004422- GArmTAGWWAHGAHAACGHT 141 7 7 1 63 178004505 gm.HEGEHGGHGHHGfiGG GGGAAG......AGG..A......A..§ QF‘CGCGGGGTF‘WAoogw G..A_F........CGCGCGHGGGHE ch r1: 15181081 1- G"AGT"GG"AG"A"AGGAAGT 204 18 16 1111111111111111XX 64 151810917 “NAGGHGGAAGAGEGEGE "GGGQGW‘EGCGCGGYGYG— chr2' 219736301- YGGF‘"GF‘F‘AGGQTW‘CGCGG 228 GYGGGF'IF'Ir'lr'lr'lr'lr'lr'lEGr'lr'lr'lTT 9 7 X111X1111 65 219736362 EGHrmeanAmmg GGEGE..§WAAGGWHAG chr19:58220438- ACG""""CG"G"AGGAGGGAC 144 11 11 11111111111 66 58220517 EAEAH..............A§...WT§ EHGGWWAAWEGE Ch r 61 :1271180_ _GAG—G—GGG 123 r'IEGGr'Ir'Ir'Ir'Ir'Ir'IEAGr'Ir'Ir'Ir'IGr'I 7 7 0000000 67 1271240 "EAGG""G"GE chr11'69054672- "G"GGGAA"G"""GG 129 G"YG"YGE”AG""A“‘EGG’I 8 4 XO0XXO0X 68 69054732 AGGGHYGH....T..........G..G chr12:132896310- 137 7 7 0000000 69 132896382 111YG11111111G111G11111TGGTTG chr2:72359624- AAG11GA1111GGGGTYGAATAYG 148 11fiG—111111GAA1AT—GGGY 10 5 X0000XXXOX 70 72359687 _GGGAGG111 111GAGG1_GGGAGAA 11 GGF—GTGAAr“rm—GGGAGGEG chr7:156735054— 150 AG1111111GA1G11_GAG1111_GAGA11: 11 11 00000 71 156735141 fl1111A11E11A1111AGT1111G G11YGA1 1111AG 111111§AGA 70112163- r1r1r1r1r1ACGTCG 1r1r1r1AAAAr 154 7 6 X111111 72 70112238 AAAACGGAG11, 11AA11A§AAG 1111GGG GAAG g YGGGYGEG11GG111111A_G11111 chr16:74441727- G1111AT111111AG11A11111111GGGAG 158 9 7 XX0000000 73 74441802 GAGG1_G1GG11GGA1111AEA 1GGGAGA111_G YGGGAYGGYGG11G111111AG chr4:174427946- AG111111AGGG""AA”"GGGFVW" 164 7 4 XXX1111 74 174428028 T11GAGAG11TG_GA1WE G111111GGGAGc_GAG11GG1111§ YGGG11G11GG11GG111111AYG111111 chr6:119107238- G11AA11111111AG11A11111111GGGAG 176 9 4 XO0XO0XXX 75 119107313 GTEAGGEGGYGGATTAYGA GG11TAGGAGA11YG YG11 GG1 1GGAGAGYG1111GAA chr19'13215437- GG'.GGGAGGGGGAAGAGGGG1 178 AGAA1111 111YGc_GGGAGc_GAGg 10 5 XXX1111X1X 76 13215527 AG1111G11c_G1111 TYG11G1G1 @111111YG YG11G1 111YG11A11AGGGAGG chr3:192125880- G1111YG1111111111G1111GGGG11TGG 180 AGEGETTTGGAGGTEATA 9 6 XX1X11111 77 192125950 1110_G111G§ YG"GA"”AG"”YG"""EG"T chr22:21483273- 1111AAAG11G1111GGGA1111AAA 186 GG1_1G111GAG1“"A’mGr‘Gr‘EGG 8 6 XX000000 78 EAGA11111111G11—111111AAAAAA EAGAG'WGYGGAAAYGW‘AY 18497159- 11111G1111AA1111AGG1111G 188 YGGG1111AA 11AGAG 111GGGAA 9 4 0XXXX000X 79 18497245 GATTEAA A11TGA ETT chr9:79629090- @AGG"GGAGC_GAC_G GG11A 190 §G11AA11111111GAG111111GCGCG 8 8 11 80 79629145 GTr-‘EGEHHAW11"" ETEGTT11E11§A11G111111T chr12:75601322- AGAAGG1111AG11111111111111111§A 192 AGAGQG"11§11A11Ag111111G 11 11 11111111111 81 75601409 EGGGTAG11 11AG111111G11§G chr9:138999208- flGfiA’" 200 G111111111111G 7 7 1111111 82 138999265 AG11AGA111111111111 YG11YG11YGAYGYGAAGGGGT11 chr1:2987530- G111111G11GcGCGGYGT11GYGGG 202 1111CGCGCG11GGGG11GTGG 18 11 XXXXX11XX111111111 83 2987630 G11G11GETGTTEGGTTEGT 111111G11G111G111G11A11CGCG 208 chr8:55467547- A2""TG"AA"T"TAG"ATT" 6 6 000000 84 55467607 "GGGAGG"EAGGEGGEGA ""AEAGG’I’IAGGAGA'IE chr12:123713533- ""r“""AAAA’I’IT’I’ITT’I’ITTC 210 - 1 1 1 85 123713562 9 A chr2' 106776970' GAAAACGCGGHGHAGGGAGAA 213 AA""AA“"I'IAGTGAGGAGQG 4 4 1 11 1 86 106777018 AGGQHA chr3:141516288- GAACGAGAA"AAAGCGG""AG 214 3 3 111 87 141516321 GrmfirwngoAG — Chr16:30484192- GCG""G""G"TTGGGTT""TT 219 T—....C_GTAGGTAAGGGAG 2 2 11 88 30484232 h : 11 1 4 - 222 $122093? 69 NN 1 1 1 89 chr10:120489276- AGAGAGG’I"T’I’IAATTr‘ACGG 223 — 1 1 1 90 298 AA chr11:1874066- TrmGCGGnrqumTGGnTTTC 224 — 3 3 111 91 1874099 EHAT%_GHTHW. chr7:142422227- 225 Gr'lr'IAr'IAAr'IAEAI—‘IATF'Ir'IAG 1 1 1 92 142422245 chr1:3086483- A""G"GG"TTGTGTG""TTGA 226 G..AA—..T_GG — 7 7 0000000 93 3086511 In sequences, each Y, ndently, C or T/U In methylation pattern, each ndently: 1 = methylation, 0 = un-methylation and X = either methylation or un-methylation In a fourth aspect, the invention relates to a nucleic acid probe that is complementary to the particular (eg tural) sequence of a nucleic acid of the third aspect, preferably wherein said nucleic acid probe is labelled.

In n of such embodiments, the label is a able moiety such as detectable fluorescent moiety.

Examples of le fluorescent moieties include, but are not limited to, 6-carboxyfluorescein (6-FAM), VIC, HEX, Cy3, Cy5, TAMRA, JOE, TET, ROX, R—phycoerythrin, fluorescein, rhodamin, Alexa, or Texas Red. Said nucleic acid probe may further comprise enhancers and/or quencher molecules Iowa Black FQ, ZEN, Iowa Black RQ, TAMRA, Eclipse, BHQ-l.

Such a nucleic acid probe has utility to detect the nucleic acid of the invention to which it is mentary, such as in the/a method of the first aspect of the invention, such as by hybridisation (and detection thereof) between said probe and its mentary nucleic acid of the invention.

In particular embodiments of said aspect, a nucleic acid probe of the present invention ential may bind to its complementary nucleic acid of the ion depending on the methylation status of one or more CpCs within said nucleic acid ce. For example, a nucleic acid probe may be designed to bind only (or preferably) to: (i) a nucleic acid used in the method of the t invention when an un-methylated cytosine in a CpG has been converted to U or T (following bisulphite treatment of an un-methylated such CpG); compared to (ii) a nucleic acid used in the method of the present invention when said cytosine has not been converted following bisulphite treatment (ie, when such CpG comprises 5-methylcytosine). As will now be apparent to the person of ordinary skill, such specifically (or entially) for binding/hybridisation nucleic acid probes may be designed using routine methodology following the disclosure of the complementary sequences herein; and will readily be usable in array based and/or PCR—based detection technology, such as MethylLight, MSP, or BeadChip (eg Illumina Epic arrays).

In a fifth aspect, the invention relates to a PCR primer pair for ying a nucleic acid sequence consisting of at least 10 contiguous bases (such as the number of contiguous bases described elsewhere herein, and preferably at least 15 contiguous bases for any SEQ ID other than SEQ ID NO:58) comprised in a sequence selected from the group consisting of: SEQ ID N05: 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 and 62 (such as SEQ ID NO: 32, 33, 34 and/or 35), or a nucleotide sequence present within about p (such as within about 200bp) 5’ or 3’ thereof, or an allelic variant and/or complementary sequence of any of said nucleotide sequences.

In certain embodiments of such aspect, at least one primer of said pair may include a sequence corresponding to at least one (eg non-natural) bisulphite-converted CpG; such a primer pair having particular y in amplifying (eg by PCR amplification) bisulphite converted sequences. Indeed, in other embodiments, the primer pair may be a degenerate primer pair such that two version of at least one of said primer pair are t such that both the bisulphite-converted CpG (ie the CpG is un-methylated and converted to WT) and the non-converted CpG (ie the CpG comprises 5-methylcytosine and remains as C) are amplified/detected.

In particular ments, a primer pair of the present invention is one selected from the group primer- pairs set forth in each row of TABLE 3.

TABLE 3: Particular primer pairs and predicted amplicon size DMR# Primer ce 1 5?:ng Primer sequence 2 SEE)? Amspgémn 141 GAGGTTTAGGGGTGAGGAT" 94 TTCCCCRAATCCTAT 125 136 bp 204 EA’IA"TYGGTGGAGAGTYGTAGT"G" 95 ACCRATACCAACCCRCACTC 126 154 bp 228 G....T..A..GGGYGAGTTG....G..AG..G 96 fié-AAACCCRCRAAACCAAAAAA 127 111 bp 144 G’ITTGAYGTGGG'I'IT'ITTAG 97 zgfifigéifiicmcmmc 128 140 bp 123 EXGMGr‘AGGAGr‘AGT"G"YGGGT"T 98 232::EggéACRAAAAACTAAC 129 120 bp 129 é:;:;::;TGAG"GAG"T'IATMA’IA 99 Xgécm‘AACACCRTTTTTACTA 130 120 bp 137 QEQEfgggTATATATAGHNGHAWY 100 CRAAAAACTAAACACCCAAACC 131 130 bp 148 GAGG"AA"GGAAGYGG""A"“I'IT’IG 101 giggizgigmccmmcmcc 132 120 bp 150 GYGGGTA..T..GTAGTT.1..AG....A..T 102 :::T"TAAACRAAATCTCRCTC" 133 137 bp 154 :g;::GGAG""YGGAG’I’ITAGGT"AG 103 :fiigigiTCTCCCHAACTCCH 134 137 bp 158 :2;;:TGTT"”AAAAAAGAAAAAAAT 104 :2:;::EACCRTATF"ACCCAAA 135 136 bp 164 Sgr‘YGYGAGG’“"T’I’IAGTAGT'ITA 105 :fiSRACRATTCCCAACATCTA 136 138 bp 176 gfi;::ég:T"“I'I’IA'I'IAAATTG’IAT 106 :2:§§AAACRAAATTTCACCRT 137 138 bp 178 EETAGGAGYG""’"IA'I’IA'IGYGTAAG 107 ECAAAACCRAAACCAACRATTC 138 142 bp 180 :::gg:gé:GYG"A"T"”G'ITGAATAT 108 égéfiggRACMACRAAAAAA 139 135 bp 186 ES::;::§ET"AGGATGGT’I'IYGATT“I 109 ESCCAAAA’IACCACAACCCAAA 140 146 bp 188 AEAG""G’IA’ITTYGAAGA’I’I’ITAGA" 110 igiTAAAwTCCRAACTACAA 141 141 bp 190 G’ITAGAYGAGAG"TTGGGG’I’IM'IG" 111 ZEEXECAACCAACMCRMMA 142 109 bp 192 i:G"AGG""AT""AGTAGTAGGG"”" 112 SEESXECRCCTATATACTCAAT 143 144 bp 200 :éT’IAGT""AG’IAATYGGYGA’IT’I’IA 113 giggiéczxAATAAATCTATA 144 115 bp 202 M’IAAGA"YGGGYGTT" 114 EE‘EHAAHCCCRACHCHAMCAA 145 148 bp 208 §::2;TF"AA"TTTGFTYGGGTAYGGTGG 115 :fiéigggACCZ-WAW‘CRCCA 146 121 bp 210 G’IAAAAAATMAGGAA’IATG 116 g:g§:§g§:§:gACTA"AAAAC 147 92 bp 213 EggéGGGMTGGGMTATAGHTAN 117 ACACAC'ICCACAATCC 148 103 bp 214 QQG’W"AAAGGYG"AGAGGAG"AG"" 118 gé::;CC"AAAACTCTC 149 94 bp 219 :EéggéigcémTT"TGTAT"A""G"G 119 éfiCACA’IA'ICCCTTCCCCTAC 150 101 bp 222 120 23:33:32.2?2222222222 151 70 bp 223 AAGAGAGAG’IGGTTGA'IAA'WAG'DAG 121 igiégzéigigigmmmym 152 84 bp 224 EEET’I’I"TT’IT’IYGAG’ITA’IGAAGAG 122 :figigfigé-AATTACAAAA 153 97 bp 225 :flgg::A’IA’IT’I"TGG’I’IT’IAAA" 123 E::§ETATACA"AAAA 154 86 bp 226 ggggoATTGTYGWAATWAWGT" 124 :gigifiigATACACAA’ICCAC 155 91 bp Each Y, independently, C or T; each R, independently, G or A In a sixth aspect, the invention relates to a plurality of nucleic acids comprising least two, three, four, five, six, seven, eight, nine, ten or more (such as about 12, 15, 20, 25 or 30) nucleic acid sequences of the third aspect and/or of the nucleic acid probes of the fourth aspect and/or of the PCR primer pairs of the fifth aspect (for example, such PCR primers for amplifying at least 15 contiguous bases of SEQ ID NO: 32, 33, 34 and/or 35, in particular at least 3 pairs of primers for amplifying at least 15 uous bases of at least SEQ ID NO: 32, 33 and In certain embodiments of such aspect, said plurality of nucleic acids may be in any form that is applicable to the practice of the invention (or its storage or preparation), such as in the form of an ure or an array. For e, such arrays may se a microtitire plate or a hybridisation chip.

As will now be apparent to the person of ordinary skill, any of such nucleic acids (including the probes and/or PCR primer pairs) of the t invention may be synthetic (ie, synthesised by chemical and/or enzymatic means/methods practiced in-vitro), and/or may be isolated and/or are not natural occurring or are used or present in a non-natural composition or mixture. Furthermore, any of the methods of the present ion may produce (and hence a composition or any nucleic acid of the present invention may comprise) an in-vitro-produced nucleic acid molecule, such as a DNA product of a PCR reaction (eg a “PCR product”). One or more of such in-vitro-produced nucleic acid molecules may be non-natural because they comprise a nucleotide primer and/or probe that includes at least one non-natural substituted base, able label or bases, such a nucleic acid molecule having been generated by polymerase extension (or partial nuclease digestion) or bisulphite or enzymatic conversion of such c acid (eg a labelled primer and/or probe), and hence providing at least a fraction of such nucleic acid molecules that include a non-natural base or detectable label, such that even though the nucleic acid sequence of the nucleic acid les may othenNise comprise a naturally occurring sequence (or fragment f), such an in- vitro-produced nucleic acid molecule is non-natural by virtue of (at least) the non-natural base and/or detectable label that it includes.

In a seventh aspect, the invention relates to a kit (for example, one for determining the presence or absence of, or response to therapy against, an ovarian cancer in a woman), such as a kit of parts comprising two or more separate compartments, holders, s or containers (eg each holding a different component of the kit), n said kit comprises: 0 two, three, four, five, six, seven, eight, nine, ten or more (such as about 12, 15, 20, 25 or 30) nucleic acid sequences of the third aspect and/or of the nucleic acid probes of the fourth aspect and/or of the PCR primer pairs of the fifth aspect (for example, such PCR primers for amplifying at least 15 contiguous bases of SEQ ID N05: 32, 33, 34 and/or 35, in particular at least 3 pairs of primers for amplifying at least 15 contiguous bases of at least SEQ ID NO: 32, 33 and 34) and/or the population of nucleic acids of the sixth aspect; fl 0 optionally, said kit further sing: (i) a printed manual or computer readable memory comprising instructions to use said synthetic nucleic acid sequence(s), labelled nucleic acid s) and/or population of nucleic acids to practice a method of the first aspect and/or to produce or detect the nucleic acid sequence(s) of the third aspect;m (ii) one or more other item, component or reagent useful for the practice of a method of the first aspect and and/or the production or detection of the nucleic acid sequence(s) of third aspect, including any such item, component or reagent sed herein and/or useful for such practice, tion or detection.

In certain embodiments said kit further comprises one or more additional components. For example, such a kit may comprise one or more (such as two, three, four, all) of the following: 0 means to collect and/or store a biological sample, such as blood, to be taken from said woman, preferably wherein said means is a blood collection tube;m 0 means to extract DNA, preferably cell-free DNA, from the sample to be taken from said woman, preferably wherein said means is a ree DNA extraction kit;w 0 an agent to entially modify DNA based on the methylation status of one or more Cst located within said DNA, preferably wherein said agent is hite;m 0 one or more reagents to detect a nucleic acid ce, preferably for detecting the sequence of a bisulphite- converted tide sequence;m o a printed manual or er readable memory comprising ctions to fy, obtain and/or use one or more of said means, agent or reagent(s) in the context of a method of the first aspect.

In some embodiments, any method of the invention may be a computer-implemented method, or one that is assisted or supported by a computer. In some ments, information reflecting the ination, detection, presence or absence of one or more methylated or un-methylated (as applicable) Cst d within one or more of said nucleotide sequences comprised in at least one molecule of cell-free DNA of a woman in a sample is obtained by 40 at least one processor; and/or information reflecting the determination, detection, presence or absence of one or more methylated Cst located within one or more of said nucleotide sequences comprised in at least one molecule of cell-free DNA of a woman in a sample is provided in user readable format by another processor. The one or more sors may be coupled to random access memory operating under control of or in conjunction with a computer operating system. The processors may be included in one or more servers, clusters, or other computers or hardware ces, or may be implemented using cloud-based resources. The ing system may be, for example, a distribution of the LinuxTM ing , the UnixTM operating system, or other open-source or proprietary operating system or rm. sors may communicate with data storage devices, such as a database stored on a hard drive or drive array, to access or store program instructions other data. Processors may further communicate via a network interface, which in turn may communicate via the one or more networks, such as the Internet or other public or private networks, such that a query or other t may be received from a client, or other device or service. In some embodiments, the computer-implemented method (or the one that is assisted or supported by a computer) of detecting the ination, detection, presence or absence of one or more methylated Cst located within one or more of said tide sequences comprised in at least one molecule of cell-free DNA of a woman in a sample may be provided as a kit.

In an eighth aspect, the invention relates to a to a computer program product comprising: a computer readable medium encoded with a plurality of instructions for controlling a computing system to perform and/or manage an operation for determining the presence or absence of, or response to therapy against, an ovarian cancer in a woman, from a biological sample from said woman, said sample comprising cell-free DNA of said woman, and determining, in at least one molecule of said cell-free DNA, the methylation status at one or more Cst located within one or more nucleotide sequences in accordance with a method of the first aspect; said operation comprising the steps of: 0 receiving a first signal representing the number of les of said cell-free DNA comprising one or more methylated or un-methylated Cst (such as relevant Cst) d within one or more of the nucleotide sequences independently selected from the group consisting of: SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 and 31 (for example, within one or more of the nucleotide sequences comprised in one or more of the respective DMRs of the present invention independently selected from the group ting of DMR#: #141, #204, #228, #144, #123, #129, #137, #148, #150, #154, #158, #164, #176, #178, #180, #186, #188, #190, #192, #200, #202, #208,#210, #213, #214, #219, #222, #223, #224, #225 and #226), or a nucleotide sequence present within 200bp 5’ or 3’ thereof, or an c variant and/or complementary ce of any of said nucleotide sequences; fl 0 determining a classification of the presence or absence of, or response to therapy against, an n cancer in said woman based on their being at least one molecules of said cell-free DNA sing one or more: (i) said methylated Cst associated with (such as located within) one or more of the hyper-methylated DMRs of the present invention (eg, as identified in TABLE 1A), for example associated with (such as located within) one or more of said nucleotide sequences independently selected from: SEQ ID NOs: 1, 2, 3, 4, 10, 12, 14, 15, 18, 19, , 21, 23, 24, 25, 26, 27, 28, 29 and 30; and/or (ii) said un-methylated Cst associated with (such as located within) one or more of the hypo-methylated DMRs of the present invention (eg, as identified in TABLE 13), for example associated with (such as d within) one or more of said nucleotide sequences independently selected from: SEQ ID NOs: 5, 6, 7, 8, 9, 11, 13, 16, 17, 22 and 31.

In certain embodiments of a computer program product of the present invention the operation further comprises steps of: receiving a second signal representing the number of molecules of said cell-free DNA comprising said tide sequence(s); and estimating a fraction or ratio of molecules of said cell-free DNA comprising one or more methylated or un-methylated (as applicable) Cst located within one or more of the nucleotide ces 40 within all of said tide sequence(s).

In particular embodiments of the computer program product of the present invention, said classification is determined by comparing said a fraction or ratio to a standard or cut-off value; such as a standard or cut-off value described elsewhere herein. Such an embodiment has particular y where different populations of women (such as patient stratification; or even individualised therapy) is d. The establishment of the applicable standard or cut-off value for each tion of women will be apparent to the person of ordinary skill, such as by the collection and analysis of data from a statistically meaningful number of women within the desired population, and/or stratification of sub-populations from large population studies. In particular of such embodiments, the computer program may comprise, or the cut-off values may be ated by, a machine-learning algorithm that is trained on the DMR—based data generated from samples from women with OC vs. control samples, for example, the (sub)popu|ations of women described herein and/or from samples from other (sub)popu|ations such as UKCTOCS, by using any number and combination of the methylation patterns/DMRs as described herein. In other embodiments, the standard or cut-off value may be modified based on the amount of total DNA present in a sample (for example, if increased such as by contamination from genomic DNA leaking from WBCs) and/or if the average sample size of the extracted DNA is increased (for example, a fragment size of greater than about 1000bp), which can also indicate contamination from genomic DNA. By way of none limiting examples, such a standard or f value may be reduced by factor, such as by a factor of 2, 3, 4, 5, 6, 8 or 10 (in particular; by a factor of 3) if the DNA extracted from one or more samples used in a study or test exhibits characteristics (such as those described herein) of contamination from genomic DNA.

[160] In other particular embodiments, the computer program t of the present invention may be for an operation that further comprises the steps of: receiving a third signal representing: (i) the amount or concentration of total cell-free DNA present in said sample; and/or (ii) a baseline value of said on or ratio previously ined for said woman; and modifying said standard or cut-off value for a given sample based on said third . As will now be apparent to the person of ordinary skill, such patient-specific modification of the standard or cut-off value can provide increased personalisation of detection (such as by an increase in specificity and/or sensitivity for dual women), ously to that provided by the ROCA test.

The computer m product of the present invention may include embodiments wherein said first signal, and optional second signal, is determined from nucleotide sequence and/or methylation status information of a plurality of said les of said cell-free DNA and/or ied DNA representing each of said tide sequences, preferably wherein said plurality is a number selected from the group consisting of at least about: 50, 100, 1,000, 5,000, 10,000, 50,000, 100,000, 200,000, 500,000, 1,000,000, 1,500,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000 and 5,000,000 molecules, or more than 5,000,000 molecules. In particular of such embodiments, said operation may r comprise the steps of: for each of said molecule’s sequence and/or methylation status information, determining if said molecule comprises none, one or more: (i) methylated Cst associated with (such as located within) one or more of the hyper-methylated DMRs of the present invention (eg, as identified in TABLE 1A), for e associated with (such as located within) one or more of said nucleotide sequences independently selected from: SEQ ID NOs: 1, 2, 3, 4, 10, 12, 14, 15, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29 and 30;, or a nucleotide sequence present within about 2,000bp (such as 200bp) 5’ or 3’ thereof, or an allelic variant and/or complementary sequence of any of said tide sequences; and/or (ii) un-methylated Cst ated with (such as located within) one or more of the ethylated DMRs of the present invention (eg, as identified in TABLE 1B), for example associated with (such as located within) one or more of said nucleotide sequences independently selected from: SEQ ID NOs: 5, 6, 7, 8, 9, 11, 13, 16, 17, 22 and 31, or a nucleotide sequence present within about 2,000bp (such as 200bp) 5’ or 3’ thereof, or an allelic variant and/or complementary sequence of any of said nucleotide sequences; and calculating said first , and optional second signal, based on 40 said ination for all or a n of said plurality of molecules. In n embodiments, the number of said cell- free DNA and/or amplified DNA molecules to be ed may be ermined. For example, depending on the expected stage of ovarian cancer; age or general (or specific) health of the woman or the total number of cell-free DNA found in the biological sample of the woman, the said number may be of the higher (eg, greater than about 100,000, 500,000, 1,000,000, 1,500,000 or 2,000,000) or lower (eg less than about 100,000, 500,000, 1,000,000, 1,500,000 or 2,000,000) regions of said range. The number of DNA molecules analysed can be modified, predetermined and/or selected for reasons such as to achieve a particular sensitivity and/or specificity of the test; or may be increased for a second or subsequent test conducted for a woman who has had a borderline result for a previous test or where said woman may desire increased sensitivity and/or icity (ie confidence of the test result) before making a decision on further therapy.

The ability to increase the number of said DNA molecules analysed is one particular advantage of the test of the t invention, as it enables the dynamic range of the test to be increased (eg, to that d), including to a dynamic range that is greater than alternative (eg protein-based) tests for CC such as those based on the CA125.

In further embodiments of the computer program t of the present invention, said operation may further comprise the steps of: 0 receiving a signal representing the amount present, in a sample of blood taken from said woman, of one or more proteins independently selected from the group consisting of: CA—125, HE4, transthyretin, apolipoprotein A1, betamicroglobin and transferrin; m o comparing said a fraction or ratio to a standard or cut-off value for said protein; and o determining a fication of the presence or absence of, or response to therapy against, an ovarian cancer in said woman based on their being either of (i) at least one molecules of said cell-free DNA comprising one or more of said methylated or un-methylated (as applicable) Cst d within one or more of said nucleotide sequences; and/or (ii) an amount of said protein(s) present in said blood sample is greater than said standard or cut-off value for such amount or protein.

[164] As will be known to gynecological oncologists, each (or certain combinations) of said ns are associated with and used for the diagnosis of ovarian cancer. Accordingly, the present invention envisions that it is used in combination with such protein-based diagnostic tests. In ular, and as set out elsewhere , the combination of the test of the present invention shows independent sensitivity and/or specificity to CA125 (and/or other protein-based tests). Importantly, in the data ted below, there was no overlap between the DNAme- false positives and the CA125-false positives. ore, the application of a test of the present invention with one or more of such (independent) n-based diagnostic tests would be particularly advantageous to women in that such a combination would provide greater confidence in the result of such a combined test; for example that their (combination) result was not a false positive or false ve; ie that they have been tly sed for: (i) the presence of ovarian cancer (such as HGS ovarian cancer; or one that is not responding, or has not responded, to chemotherapy ent), or (ii) the absence of ovarian cancer (such as having a benign pelvic mass), or the e of HGS ovarian cancer (or having an ovarian cancer that is ding, or has responded, to chemotherapy treatment).

A number of such protein-based tests for ovarian cancer are used, including those which have been validated in clinical trials and are commercially available. In particular, suitable n-based tests that may be used in combination with the test of the present invention include tests for CA125 (in particular when ted in a routine manner for each woman, such as in the ROCA® test of Abcodia Ltd. Refs. 6, 7) and/or HE4 (such as the ELEXSYS®/COBAS® versions f of Roche Diagnostics), as well as when CA125 and HE4 are used in a combined test (such as the ROMA — Risk of Ovarian Malignancy Algorithm — test. Moore et al, 2009; Gynecological Oncology 112:49. Malkasian et al, 1988; Am J Obstet Gynecol 159:341) and/or when CA125 is used in a test that also involves 40 other proteins including transthyretin, apolipoprotein A1, betamicroglobin and/or transferrin (such as in the OVA1 test of Aspira Labs. Ueland et al, 2009: Obstet Gynecol 117:1289. Ware Miller et al, 2011; Obstet Gynecol 117:1298).

In other embodiments, the test of the present invention is used in combination with other DNA-based diagnostic tests for ovarian cancer. For example, determination of the woman’s germline mutational status of BRCA1 and/or BRCA2 gene or any other high risk genes including but not limited to RAD51, PALBZ, ATM, BRIP1, CHEK2, PTEN, CDH1. Also envisioned for such other DNA-based diagnostic tests for ovarian cancer, are those tests which may include the analysis of one or more -nucleotide polymorphisms (SNPs) that are ated with 0C. In other embodiments, the test of the present ion is used in combination with epidemiological-based models for ovarian cancer, such as those which use various combinations of family history, number of lifetime ovulatory cycles (eg a on of period taking oral contraceptive pill, number of pregnancies and time of breastfeeding) as well as body mass index and hormone replacement therapy use.

Any of such other diagnostic tests for ovarian cancer may be used to fy a sub-population of women who are at a higher/highest risk of developing ovarian cancer, and as bed above, can be used to “artificially increase” the prevalence of OC (ie, only in that identified group at highest risk). In such sub-populations, then the specificity of the ive test can be lower without a major impact on the rate of false ves.

In another aspect, the present invention also s to a use of a nucleic acid sequences of the third aspect of the present invention and/or a labeled nucleic acid probes of the fourth aspect of the t invention and/or a PCR primer pair of the fifth aspect of the present invention (for example, such PCR primers for amplifying at least 15 contiguous bases of SEQ ID NO: 32, 33, 34 and/or 35, in particular at least 3 pairs of primers for amplifying at least 15 contiguous bases of at least SEQ ID NO: 32, 33 and 34) and/or a ity of nucleic acids of the sixth aspect of the present invention and/or a kit of the seventh aspect of the present invention and/or a computer program t of the eighth aspect of the present invention, in each case for determining (such in-vitro, including in an in-vitro diagnostic test) the presence or absence of, or response to therapy against, an ovarian cancer in a woman. It being envisioned that all embodiments set forth herein for other aspects are also encompassed within this use of the present invention.

It is to be understood that application of the teachings of the present invention to a specific m or environment, and the inclusion of variations of the present invention or additional features thereto (such as further aspects and embodiments), will be within the capabilities of one having ordinary skill in the art in light of the teachings contained herein.

Terms as set forth herein are generally to be understood by their common meaning unless ted othenNise. Where the term "comprising" or “comprising of” is used herein, it does not exclude other elements. For the purposes of the t invention, the term "consisting of" is ered to be a particular embodiment of the term "comprising of". If hereinafter a group is defined to comprise at least a n number of embodiments, this is also to be understood to disclose a group that consists of all and/or only of these embodiments. Where used herein, r” is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example, “A and/or 8” is to be taken as specific disclosure of each of (i) A, (ll) B and (iii) A and B, just as if each is set out individually herein. Analogously, the terms “in particular”, “particular” or “certain” (and the like), when used in the context of any embodiment of the present invention, in each case is to be interpreted as a non limiting example of just one (or more) possible such embodiment(s) amongst others, and not that such cular” or “certain” embodiment is the only one envisioned by the present invention. In the context of the present invention, the terms “about” and “approximately” denote an interval of accuracy that the person skilled in the art will understand to still ensure the technical effect of the feature in question. The term typically indicates deviation from 40 the indicated numerical value by i20%, 115%, 110%, and for example 15%. As will be appreciated by the person of ordinary skill, the specific such deviation for a numerical value for a given cal effect will depend on the nature of the technical effect. For example, a natural or biological technical effect may generally have a larger such deviation than one for a man-made or engineering technical effect. Where an indefinite or definite article is used when referring to a singular noun, e.g. "a an" or "the", this includes a plural of that noun unless something else is WO 09212 specifically stated. The terms “of the [present] invention ll \\ in accordance with the [present] invention", or “according , to the [present] invention” as used herein are intended to refer to all aspects and embodiments of the invention described and/or claimed herein.

Unless context dictates ise, the descriptions and definitions of the features set out above are not limited to any particular aspect or ment of the ion and apply equally to all aspects and embodiments which are described.

All references, patents, and publications cited herein are hereby incorporated by reference in their entirety; ed that In case of conflict, the present ication, ing definitions, will control.

[173] In view of the above, it will be appreciated that the present invention also relates to the following items: Item 1. A method of determining the presence or absence of, or response to therapy t, an ovarian cancer in a woman, said method sing the steps: 0 providing a biological sample from said woman, said sample comprising cell-free DNA of said woman; and - determining, in at least one molecule of said cell-free DNA, the methylation status at one or more Cst located within one or more of the nucleotide sequences independently selected from the group consisting of: SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 and 31, or a nucleotide sequence t within about 2,000bp (such as within about 200bp) 5’ or 3’ thereof, or an allelic variant and/or complementary sequence of said nucleotide ce(s), wherein, the presence in at least one of said ree DNA molecules of one or more: (i) methylated Cst associated with (such as located within) one or more of said nucleotide sequences independently selected from: SEQ ID NOs: 1, 2, 3, 4, 10, 12, 14, 15, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29 and 30; and/or (ii) un- methylated Cst associated with (such as located within) one or more of said nucleotide sequences independently selected from: SEQ ID NOs: 5, 6, 7, 8, 9, 11, 13, 16, 17, 22 and 31, indicates the presence of, or a reduced response to therapy against, an ovarian cancer in said woman; preferably wherein said biological sample is liquid biological sample selected from the group consisting of: a blood sample, a plasma sample and a serum sample.

Item 2. The method of item 1, wherein said Cst for a given tide sequence are identifiable by a genome position for the cysteine thereof, independently selected from the list of genome positions corresponding to said nucleotide sequence set forth in TABLE 1C.

Item 3. The method of item 1 or 2, wherein the presence in at least one of said cell-free DNA molecules of one or more pattern of methylation and/or un-methylation as set forth in TABLE 23 for the respective nucleotide sequence(s), indicates the presence of, or a reduced se to therapy against, an ovarian cancer in said woman.

Item 4. The method of any one of items 1 to 3, wherein said nucleotide sequence(s) is/are associated with DMR(s) 40 #141 and/or #204 and/or #228 (eg, SEQ ID NOs: 1, 2, 3 and/or 4), or an c variant and/or complementary sequence of said nucleotide sequence(s).

Item 5. The method of item 4, wherein the methylation status is determined at one or more of said Cst located within each of said three nucleotide sequences; wherein, the presence in at least one of said cell-free DNA molecules of one or more methylated Cst, and/or of one or more pattern of methylation and/or un- methylation as set forth in TABLE 2B for the respective nucleotide sequence(s), located within any one of said nucleotide sequences indicates the presence of, or a reduced response to therapy against, an ovarian cancer in said woman.

Item 6. The method of item 5, n the methylation status is ined at about 7 Cst located within tide sequence SEQ ID NO 1 and at about 16 to 18 Cst located within nucleotide sequence SEQ ID NO 2 and about 7 to 9 Cst located within nucleotide sequence SEQ ID NO 3; wherein, the presence in at least one of said cell-free DNA molecules of at least said number of methylated said Cst, and/or of one or more pattern of methylation and/or un-methylation as set forth in TABLE 2B for the respective nucleotide sequence(s), located within any one of said nucleotide sequences indicates the presence of, or a reduced response to therapy against, an n cancer in said woman Item 7. The method of any one of items 1 to 6, comprising the step of treating said cell-free DNA with an agent that differentially modifies said ree DNA based on the methylation status of one or more Cst located within; ably a methylation sensitive restriction enzyme and/or bisulphite; preferably wherein said agent is bisulphite and said determining step ses the ion of at least one hite-converted un-methylated cytosine within one or more of the nucleotide sequences independently selected from those set forth in TABLE 2A (eg, independently selected the group consisting of: SEQ ID N05 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 and 62), wherein one or more of the bases identified by “Y” therein is a U or T and, ably, where one or more of the bases identified by “Y” in a CpG therein is a C, or an allelic variant and/or mentary sequence of said nucleotide sequence(s).

Item 8. The method of item 7, wherein said agent is bisulphite and said determining step comprises the detection of at least one bisulphite-converted un-methylated cytosine within a nucleotide sequence having a length of at least 15bp (such as at least 50bp) comprised in SEQ ID NO 32 and/or SEQ ID NO 33 and/or SEQ ID NO 34, wherein one or more of the bases identified by “Y” therein is a U or T and, preferably, where one or more of the bases identified by “Y” in a CpG therein is a C, or an allelic variant and/or complementary sequence of said nucleotide seq uence(s).

Item 9. The method of any one of items 1 to 8, wherein the methylation status of said CpG(s) is ined in multiple molecules of said cell-free DNA and/or amplified DNA representing each of said nucleotide sequences; preferably wherein: (a) the presence in at least a plurality of said ree DNA molecules of one or more methylated and/or un- methylated Cst (as able), and/or the presence in at least a plurality of said cell-free DNA molecules of one or more pattern of methylation and/or un-methylation as set forth in TABLE 2B for the respective nucleotide sequence(s), located within one or more of said nucleotide sequences, indicates the presence of, or a reduced response to therapy against, an ovarian cancer in said woman; and/or 40 (b) said plurality of cell-free DNA molecules with one or more of said methylated and/or un-methylated Cst (as applicable), and/or the presence in at least a ity of said cell-free DNA molecules of one or more pattern of methylation and/or un-methylation as set forth in TABLE 2B for the respective nucleotide sequence(s), located is at least 2, 3, 4, 5, 6, 7, 18, 9 or 10, or at least about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175 or 200, or a greater number such as greater than about 500, 1,000, ,000, 7,500, 1,000, 2,500, 5,000 or greater than 5,000 molecules; and/or (c) the methylation status of said CpG(s) is determined in a number of les of said cell-free DNA and/or ied DNA representing each of said nucleotide sequences selected from the group consisting of at least about: 1,000, 5,000, 10,000, 50,000, 100,000, 200,000, 500,000, 1,000,000, 1,500,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000 and 5,000,000 molecules, or more than 5,000,000 molecules.

Item 10.The method of item 9, wherein a fraction or ratio of, or an absolute number of, cell-free DNA molecules in said sample having said methylated and/or un-methylated CpG(s) (as applicable) d within said nucleotide ce(s), and/or having said pattern of methylation and/or un-methylation as set forth in TABLE 23 for the respective nucleotide sequence(s), is estimated.

Item 11.The method of item 10, further comprising a step of comparing said fraction or ratio with a rd or cut- off value; wherein a fraction or ratio greater than the standard or cut-off value indicates the ce of or a reduced response to therapy against, an n cancer in said woman; preferably wherein said standard or cut-off value(s) is/are modified for a given sample based on: o the amount or tration of total cell-free DNA present in said sample; and/or 0 a baseline value of said fraction or ratio previously determined for said woman; and/or 0 a value of said fraction or ratio determined from multiple samples from a population of women representative of said woman; and/or 0 the specificity and/or sensitivity desired for said method of determination; more preferably wherein said standard or cut-off value is/are reduced for a given sample that has an amount or concentration of total cell-free DNA present in said sample that is greater than a standard or cut-off value.

Item 12.A nucleic acid comprising at least 10 (preferable at least about 15, such as at least 50, for any SEQ ID other than SEQ ID NO:58) contiguous bases comprised in a ce selected from the group consisting of: SEQ ID N05 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 and 62, wherein said nucleic acid sequence includes one or more of the bases identified by “Y” therein is a U or T and, preferably, where one or more of the bases identified by “Y” therein is a C, or an allelic variant and/or mentary sequence of said nucleotide sequence; preferably wherein said c acid sequence comprises at least 15, (such as at least 50) contiguous bases sed in a ce of SEQ ID N05 32, SEQ ID N05 33 or SEQ ID N05 34, wherein said nucleic acid sequence includes one or more of the bases identified by “Y” therein is a U or T and, preferably, where one or more of the bases identified by “Y” therein is a C, or an allelic variant and/or complementary sequence of said nucleotide sequence; and more preferably wherein said nucleic acid sequence is sed in a sequence as set forth in TABLE 23 (eg, a sequence selected from the group consisting of: SEQ ID N05 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 and 93.

Item 13.A nucleic acid primer pair for amplifying a nucleic acid sequence consisting of at least 10 (preferable at 40 least about 15, such as at least 50, for any SEQ ID other than SEQ ID NO: 89) contiguous bases comprised in a ce selected from the group consisting of: SEQ ID NOs: SEQ ID N05 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 and 93, or a tide sequence present within about 2,000 bp (such as within about 200bp) 5’ or 3’ thereof, or an allelic variant and/or complementary sequence said tide sequence(s); WO 09212 preferably wherein: (a) at least one primer of said pair includes a sequence corresponding to at least one bisulphite-converted CpG present in said nucleotide sequence(s); and/or (b) said primer pair is selected from the group of primer-pairs set forth in each row of TABLE 3.

Item 14. A kit, ably for determining the presence or absence of, or response to therapy against, an n cancer in a woman, said kit comprising: 0 one or more c acid sequences of item 12 and/or primer pairs of item 13; and - optionally, said kit further comprising: (i) a printed manual or computer readable memory comprising instructions to use said c acid sequence(s) and/or primer ) to practice a method of any one of items 1 to 11 and/or to produce or detect the nucleic acid sequence(s) of item 12; and/or (ii) one or more other item, component or reagent useful for the practice of a method of any one of items 1 to 11 and and/or the production or detection of the nucleic acid sequence(s) of item 12, including any such item, component or reagent disclosed herein useful for such practice, production or detection.

Item 15.A computer program product sing: a computer le medium d with a plurality of instructions for controlling a ing system to perform and/or manage an operation for determining the presence or absence of, or response to therapy against, an ovarian cancer in a woman, from a biological sample from said woman, said sample comprising cell-free DNA of said woman, and determining, in at least one molecule of said cell-free DNA, the methylation status at one or more Cst located within one or more nucleotide sequences in accordance with a method as set forth in any one of items 1 to 11; said operation comprising the steps of: 0 receiving a first signal representing the number of molecules of said cell-free DNA comprising one or more methylated and/or un-methylated Cst (as applicable), and/or comprising one or more pattern of methylation and/or un-methylation as set forth in TABLE 23 for the respective nucleotide sequence(s), located within one or more of the nucleotide ces independently ed from the group consisting of: SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 and 31, or a nucleotide sequence present within about 2,000bp (such as within about 200bp) 5’ or 3’ thereof, or an allelic t and/or complementary sequence of said nucleotide sequence(s); and - determining a classification of the ce or absence of, or response to therapy against, an ovarian cancer in said woman based on their being at least one molecules of said cell-free DNA comprising one or more said methylated and/or un-methylated Cst (as applicable), and/or comprising one or more said pattern of methylation and/or un-methylation, located within one or more of said nucleotide sequences; preferably wherein said operation further comprises the steps of: 0 receiving a second signal representing the number of molecules of said cell-free DNA comprising said nucleotide sequence(s); and - estimating a fraction or ratio of molecules of said cell-free DNA comprising one or more said methylated 40 and/or un-methylated Cst (as able), and/or comprising one or more said pattern of methylation or un-methylation, located within one or more of the nucleotide sequences within all of said nucleotide sequences; and more preferably wherein said classification is determined by ing said a fraction or ratio to a standard or cut-off value.

Certain s and embodiments of the invention will now be rated by way of examples and with reference to the description, figures and tables set out herein. Such examples of the Methods, Results, Supplementary Information, Discussion, conclusions and other uses or s of the present invention are representative only, and should not be taken to limit the scope of the present invention to only such representative examples. Furthermore, any embodiments, text or other descriptions found in such examples are also to encompassed and ered as part of the description of the present invention.

Patients and sample collection:

[177] We have used a total of 703 tissue and 251 serum samples in seven sets (FIGURE 1). For Serum Sets 1-3 and the NACT Serum Set, women attending the hospitals in London and Prague were invited, consented and 20-40 mL blood obtained (VACUE'I'I'E® 2 Serum Sep Clot Activator tubes, Cat 455071, Greiner Bio One International GmbH), centrifuged at 3,000 rpm for 10 minutes with serum stored at -80°C. Serum CA125 was analysed for the validation sets using the CA125 Cobas assay platform (Roche Diagnostics, Burgess Hill, UK). For detailed information see the Supplementary Information.

Additionally, a seventh validation set may be provided from the UK Collaborative Trial of Ovarian Cancer ing (UKCTOCS) (Refs. 6, 7, 22). For example, all women (among those in the l arm) who d serum samples at recruitment and developed invasive epithelial OC within two years of recruitment and the ponding age and centre d women who did not develop ovarian cancer within five years of tment can be analysed. Blood samples from all S volunteers can be spun down for serum separation after being couriered at room temperature to a central laboratory, and aliquoted and stored in liquid nitrogen vapour phase until thawing and analysed such as described herein; even if only 1 mL of serum per UKCTOCS volunteer may be available.

Isolation and bisulphite modification of DNA: DNA was isolated from tissue and serum samples at GATC Biotech (Constance, Germany). Tissue DNA was quantified using NanoDrop and Qubit (both Thermo Fisher Scientific, USA); the size was assessed by agarose gel electrophoresis. Serum DNA was quantified using the Fragment Analyzer and the High Sensitivity Large Fragment Analysis Kit (AATI, USA). DNA was bisulfite converted at GATC Biotech.

DNAme analysis in tissue: Genome wide methylation analysis was performed either by the Illumina Infinium Human Methylation 450K ip array (Illumina Inc USA, WG-314—1003) as previously described (Refs. 24, 25) or using Reduced Representation Bisulfite Sequencing (RRBS) at GATC Biotech. For the 450k methylation data we developed a pipeline in order to select the most promising cancer-specific differentially methylated regions (DMRs) that are most likely to fulfil the strict specificity criteria of a serum based test (see mentary Information).

For RRBS, DNA was digested by the restriction endonuclease MspI that is specific for the CpG ning motif CCGG; a size selection of the library provides an enhanced coverage for the CpG-rich regions including CpG islands, promoters and enhancer ts (Refs. 26, 27). The digested DNA was adapter ligated, bisulfite modified and PCR amplified. The libraries were sequenced on Illumina’s HiSeq 2500 with 50 bp or 100 bp paired-end mode.

Using Genedata Expressionist® for Genomic Profiling v9.1, we have established a bioinformatics pipeline for the detection of cancer specific DMRs. The most promising DMRs have been taken fonNard for the pment and 40 validation of serum based clinical assays (see Supplementary Information).

Targeted ultra-high coverage bisulphite sequencing of serum DNA: Targeted bisulfite sequencing libraries were prepared at GATC Biotech. In brief, bisulfite modification was performed with 1 mL serum lent. Modified DNA was used to test up to three different markers using a two- step PCR approach. Ultra-high coverage cing was med on Illumina’s MiSeq or HiSeq 2500 with 75 bp or 125 bp paired-end mode (see Supplementary Information).

Statistical/data analyses: For DMR discovery the data analysis pipelines are described within the tive sections in the Supplementary Information. In brief, Genedata Expressionist® for Genomic Profiling was used to map reads to human genome version hg19, identify regions with tumor specific ation patterns, quantify the ence of those patterns, and calculate relative pattern frequencies per . Pattern frequencies were calculated as number of reads containing the pattern divided by total reads covering the n region. The 95%CI intervals for sensitivity and icity have been calculated according to the efficient-score method (Ref. 28). Differences in pattern frequencies or coverage have been analysed using Mann Whitney U test.

[188] RESULTS: Study design: The samples, techniques and purpose of the three phases of the study — marker discovery, assay development and test validation — are summarized in FIGURE 1.

DNA methylation marker ery in tissue:

[192] We have used two independent ome-wide approaches in order to discover DMRs which have the potential for diagnosing ovarian cancer with high sensitivity and specificity. (1) Illumina m Human Methylation450 BeadChip Array (450K) technology was used to interrogate the methylation status of ~485,000 genomic sites in 218 n cancer (Ref. 28) and 438 control samples (FIGURE 1; see also Supplementary Information). A set of 19 high scoring and ranking DMRs were selected for targeted-BS based serum assay development. FIGURE 6 shows an example of a selected top DMR (reaction #228). (2) Using RRBS, we first determined the methylation pattern frequencies in relevant genomic regions in different tissues. The algorithm that we have ped scans the whole genome and fies regions that contain at least 10 aligned paired-end reads.

These read bundles are split into smaller regions of interest which n at least 4 Cst in a stretch of, at most, 100 base pairs (bp). For each region and tissue/sample the absolute frequency (number of supporting reads) for all observed methylation patterns was determined (FIGURE 2A). This led to tens of millions of patterns per tissue/sample. The patterns were filtered in a multi-step procedure to fy the methylation patterns which specifically occur in tumour samples. In order to se sensitivity and specificity, respectively, of our pattern discovery procedure, we pooled reads from different tumour or white blood cell (WBC) samples, respectively, and scored patterns based on over-representation within tumour tissue. The results were summarized in the specificity score Sp, which reflects the cancer city of the patterns. After applying a cut-off of Sp 2 10, 2.6 n patterns for CC remained and were further filtered according to the various criteria demonstrated in FIGURE 2B (and Supplementary Information).

For the filtered unique cancer specific patterns for CC identified in the Array (n=19) and RRBS (n=45) approach, respectively, ite sequencing primers have been designed and technically validated, eventually leading to 31 candidate s, The genome coordinates (hg 19) and genomic sequence of each DMR is shown in TABLE 1A and TABLE 1B, and the possible bisulphite-converted ces thereof (where “Y” symbolises either a C or a U/T, preferably a C or a T) are shown in TABLE 2A (with Cst - sites of possible 5-methylcytosine - shown ined).

Serum DNAme assay establishment: We used ultra-deep BS sequencing (FIGURE 2C) to develop serum assays for the 31 candidate regions in 59 40 serum samples from Set 1 (FIGURE 1 and Supplementary Information and FIGURE 8). Based on sensitivity and specificity, nine markers have been selected for further validation in Set 2 . In Sets 1&2 combined, the specificity/sensitivity of the top four candidate s (FIGURE 9) referred to Regions #141, #144, #204 and #228 (#228 was only analysed in Set 2) to discriminate HGS OC from healthy women or those with a benign pelvic mass at pattern frequency thresholds of 0.0008, 0.0001, 0.0001 and 0.0001 was 95.7%/42.4%, 93.5%/48.5%, 100%/25.0% and 100%/36.8%, respectively. Interestingly region #144 has already been defined as a ing cell-free DNA marker for , in ular ovarian cancer (Refs. 30, 31). The combination of s #141, #204 and #228 (at least one of these regions with a pattern frequency above the aforementioned threshold) resulted in a 98.1% specificity and a 63.2% ivity. These regions are linked to genes COL23A1, C2CD4D and WNT6, respectively.

Clinical validation of the serum DNAme assay: We validated the combination of the three markers in Set 3 (FIGURE 3A-C) ide the CA125 serum marker (FIGURE 3D). The e coverage (i.e. DNA strands read by the sequencer for each sample and region) is > 500,000 (FIGURE 10). ng the above indicated cut-off thresholds for the three DNAme markers and 35 IU/mL for serum CA125 led to specificities of 90.7% and 87.1% and sensitivities of 41.4% and 82.8%, respectively (FIGURE 3E). Due to the fact that Reaction #228 was only analysed in Set 2, we combined Set 2 and Set 3 in order to redefine the olds. Whereas for #141 the threshold of 0.0008 remained unchanged, for #204 and #228 we further lowered the pattern frequency threshold to 0.00003 and 0.00001, respectively, leading to a specificity and sensitivity now of 91.8% and 58.3%, respectively (FIGURE 3E). Importantly, there was no overlap between the DNAme- and false positive controls (FIGURE 3F).

Serum DNAme to predict response to platinum-based uvant chemotherapy: We recruited 25 n cancer patients who received carboplatin-based neoadjuvant chemotherapy. ed with the pre-treatment sample, all three DNAme markers dropped substantially and more dramatically compared to CA125 after one and two cycles (FIGURE 4A-D and FIGUREs 11, 12, 13). Whereas CA125 dynamics was not able to discriminate chemotherapy-responders from non-responders (FIGURE 4E and Supplementary Information), serum DNAme cs (i.e. serum DNAme as defined in Set 2&3, before as compared to after two cycles) correctly identified 78% and 86% of responders and non-responders (Fisher’s exact test p=0.04) overall and 78% and 100% amongst those women who were left without residual disease after interval debulking surgery (Fisher’s exact test p=0.007) (FIGURE 4E).

[200] Serum DNAme for early diagnosis of ovarian cancer: In order to judge whether our marker panel is able to diagnose ovarian cancer early, samples ing OC diagnosis by up to 2 years ) and matched controls can be used from the control (no screening) - arm of the S cohort. As at the time of their collection, UKCTOCS samples were not obtained, treated or stored with the analysis cell-free DNA in mind. Hence, it is to be expected that upon DNA extraction it will be found that either or both the amount of DNA/mL serum as well as the average DNA fragment size may be higher (such as dramatically higher) in UKCTOCS samples compared with the other samples used in this study. As has been previously observed and ed (Anjum et al, 2014, Genome Med 6:47), without being bound by , such effect may be due to DNA from WBCs leaking into the serum during the 24-48 hour blood sample ort time — in particular in the warm season). This “contaminating” high quality [genomic rather than tumour] DNA would not only dilute the cancer signal but also skew the target sequence amplification towards WBC DNA. In order to adjust for these factors, an a priori decision may be made to reduce the threshold for the three regions by a factor, such as by a factor of 3, and/or to split the analyses in samples above (high) and below (low) the median amount of DNA.

Such adjustments can enable the three DNAme-marker panel to yet further confirm its validation above and its utility for the early detection of ovarian cancer. Indeed, it can then be used to identify cases with a specificity of 40 over 70%, 80%, or 90% (such as between about 70% and 80% or between about 80% and 90%) and a sensitivity of over 45% 50%, 55% or 60% (such as n about 50% and 55% or between about 55% and 60%) [indeed, the sensitivity may be even higher in CA125 negative (<35U/mL) samples] in samples with a lower than median amount of DNA and may remain literally unchanged within two years between sample collection and cancer diagnosis. Given the greater dynamic range of DNAme panel test and the results above, it can have higher sensitivity but lower specificity compared to that of CA125 using a cut-off of 35U/ml in the early detection of ovarian cancer, and/or to have no overlap of false positives. The DNAme panel has higher sensitivity but lower specificity compared to that of CA125 using a cut-off of 35U/ml in the early detection of ovarian cancer.

SUPPLEMENTARY INFORMATION: Subjects and sample collection: We analysed a total of 6 sets as ed in FIGURE 1: 1. Set: Ovarian cancer samples (Refs. 51, $2), WBC samples (Ref. S3) and Fallopian Tube samples (Ref. S4) have been described before. Ten benign pelvic tumours (2X endometriosis-ovarian cyst, 1X fibroma, 2X papillary serous cystadenoma, 1X mucinous cystadenoma, 2X serous cystadenoma, 1X us cystadeonoma with Brenner tumour and 1 dermoid cyst), 96 endometrial samples (Ref. 51) (Haukeland University Hospital, Bergen, 52 patients with primary and metastatic samples equalling 87, 8X benign endometrial (all hyperplasia) & 1 cell line) and 170 samples (38 colon (COAD controls), 50 liver (LIHC controls), 75 lung (LUSC and LUAD controls), 7 rectum (READ ls) from the publically ble The Cancer Genome Atlas (TCGA) repository were analysed. 2. RRBS Set: 11 prospectively collected invasive epithelial ovarian cancer samples (high grade serous n=8, low grade serous n=1, endometrioid n=1, mean age 54.7 years), one benign tumour (papillary serous cystadenoma, age = 86 years), 18 normal tissue samples (normal breast n=7 and normal ovarian n=11, mean age = 60.2 years), two normal trial tissues mean age = 68, and twenty three white blood cell samples (breast cancer ts n=10 & ovarian cancer ts n=13 [11 of which match corresponding OC tissue samples, 1 matches corresponding normal endometrial sample and 1 matches normal ovarian sample], mean age = 57.8) were assessed by RRBS.

All samples of the RRBS Set were collected prospectively at the University College London al in London (University College London Hospital, 235 Euston Rd, Fitzrovia, London NW1 ZBU) and at the Charles University Hospital in Prague (Gynecological Oncology Center, Department of Obstetrics and logy, Charles University in Prague, First Faculty of ne and General University Hospital, Prague, Apolinarska 18128 00 Prague 2, Czech Republic.). The study was approved by the local research ethics committees: UCL/UCLH Biobank for ng Health & Disease NC09.13) and the ethics committee of the General University Hospital, Prague approval No.: 22/13 GRANT — 7. RP — EPI-FEM-CARE tively. All patients provided written informed consent. 3. Serum Set 1: Serum samples from the following volunteers have been collected (at the time of diagnosis, prior to treatment): 0 Healthy volunteers (n=19, mean age 41.1 years). 0 Women with benign pelvic masses (n=22, mean age 41.3 years) with the following histologies: endometriosis (n=6), fibroids (n=5), hydrosalpinx (n=1), serous cystadenoma (n=5) and mucinous cystadenoma (n=5). 0 Patients with ovarian cancers (n=18, mean age 62.2 years): endometrioid (n=2) and clear cell (n=1) and high grade serous (n=15) ovarian cancers; 10 and 8 women had a stage MI and stage III/IV ovarian cancer, respectively.

All s of Serum Set 1 were collected prospectively at the University College London Hospital in London and at the Charles University Hospital in Prague. The study was ed by the local research ethics committees: UCL/UCLH Biobank for Studying Health & e 13) and the ethics committee of the General University Hospital, Prague approval No.: 22/13 GRANT — 7. RP — EPI-FEM-CARE respectively. All patients provided written 40 ed consent. 4. Serum Set 2: Serum samples from the following volunteers have been collected (at the time of diagnosis, prior to treatment): 0 Healthy eers (n=20, mean age 42.8 years). 0 Women with benign pelvic masses (n=34, mean age 40.0 years) with the following histologies: endometriosis (n=7), fibroids (n=8), pelvic inflammatory disease or pelvic s (n=9), serous cystadenoma (n=5) and mucinous cystadenoma (n=5). 0 Patients with borderline ovarian tumors (n=11, mean age 47.3 years): mucinous (n=6) and serous (n=5) borderline tumor. 0 Patients with ovarian cancers (n=27, mean age 62.9 years): endometrioid (n=3) and clear cell (n=3), mucinous (n=2) and high grade serous (n=19) ovarian cancers; 10 and 17 women had a stage 1/11 and stage III/IV ovarian cancer, respectively.

All samples of Serum Set 2 were collected prospectively at the sity College London Hospital in London and at the Charles University al in Prague. The study was approved by the local research ethics committees: UCL/UCLH Biobank for ng Health & Disease NC09.13) and the ethics committee of the General University Hospital, Prague approval No.: 22/13 GRANT — 7. RP — EPI-FEM-CARE respectively. All patients provided written informed t. 5. Serum Set 3: Serum samples from the ing volunteers have been collected (at the time of diagnosis, prior to treatment): 0 Healthy volunteers (n=21, mean age 50.8 years). 0 Women with benign pelvic masses (n=119, mean age 41.4 years) with the following histologies: endometriosis (n=21), fibroids (n=21), pelvic inflammatory disease or pelvic s (n=7), serous cystadenoma (n=20), mucinous enoma (n=20) and dermoid cysts (n=29). 0 Patients with borderline ovarian tumors (n=27, mean age 57.1 years): mucinous (n=7) and serous (n=20) borderline tumor. 0 Patients with non-epithelial tumors (n=5, mean age 55.8 : granulosa cell tumors. 0 Patients with non-ovarian cancers (n=37, mean age 58.3 years): cervical (n=10), endometrial (n=20) and ctal (n=7) s. 0 Patients with ovarian cancers (n=41, mean age 59.6 years): endometrioid (n=3) and clear cell (n=5), mucinous (n=4) and high grade serous (n=29) n cancers; 16 and 25 women had a stage 1/11 and stage III/IV ovarian cancer, respectively.

All samples of Serum Set 3 were collected prospectively at the University College London al in London and at the Charles University Hospital in Prague; CA125 analysis was med using the CA125 Cobas assay and platform (Roche Diagnostics, Burgess Hill, UK). The study was approved by the local research ethics committees. The study was approved by the local research ethics committees: UCL/UCLH Biobank for Studying Health & Disease (NC09.13) and the ethics committee of the General University Hospital, Prague approval No.: 22/13 GRANT — 7. RP — EPI-FEM-CARE respectively. All patients provided written ed consent.

Of note: For the Serum Sets 1-3 which have been prospectively collected within EpiFemCare there is a substantial age difference between women who presented with benign pelvic masses and women who presented with n cancer. We were completely aware of this as the main purpose was to benchmark DNAme markers against CA125 and to assess whether CA125 false positive controls are also DNAme-false positive. The main source of false positivity are endometriosis, pelvic inflammatory disease and ds — all conditions which are substantially more prevalent (or occur ively) in premenopausal (i.e. younger women) whereas ovarian cancer is far more 40 prevalent in older women. 6. NACT (“Neoadjuvant Chemotherapy") Set: Patients (n=25) at the Gynaecological Oncology Centre in Prague deemed not to be suitable for up-front surgery have been recruited. The average age was 62.8 years. High grade serous ovarian cancers were the most prevalent histology (n=23) and the ing two patients had clear cell ovarian cancers. Twenty-four patients received Carboplatin-Paclitaxel combination chemotherapy and one patient received Carboplatin only. All but two patients had interval debulking y. Among the 23 patients, 14 had no residual disease, 5 had macroscopic residual e and 4 had copic residual disease (i.e. tumor reaches the edge of at least one of the resected specimens - according to TNM classification). Twelve patients were deemed to be platinum-sensitive (no recurrence within 6 months after successful completion of neoadjuvant and adjuvant chemotherapy and interval debulking y) and eight patients were deemed to be platinum-refractory (n=2, no response to herapy or progression on chemotherapy) or platinum-resistant (n=6, ence within 6 months after successful completion of neoadjuvant and adjuvant chemotherapy and al debulking surgery). For 5 patients no data were available on platinum-sensitivity.

All serum samples of the NACT Set were collected prospectively at the Charles University Hospital in Prague.

Each patient provided three samples at the following time-points: 0 At the time of histological diagnosis, prior to chemotherapy. 0 Three weeks after the first cycle of chemotherapy (immediately prior to the second cycle). 0 Three weeks after the second cycle of chemotherapy (immediately prior to the third cycle).

CA125 analysis on the NACT Set was performed using the CA125 Cobas assay and platform (Roche Diagnostics, Burgess Hill, UK). The study was approved by the local research ethics committees: UCL/UCLH Biobank for ng Health & e (NC09.13) and the ethics committee of the General University Hospital, Prague approval No.: 22/13 GRANT — 7. RP — M-CARE respectively. All patients provided written informed consent.

Eighteen and seven patients presented with a stage IIIC and IV ovarian cancer respectively.

In addition to these siX sets, a seventh set could be used to provide further confirmation on the validation of the present assay provided by the other sets. Such a seventh set could comprise samples from the S collection. For example, among those women who were randomised into the control arm of UKCTOCS n 2001 and 2005, the subset of such women who developed an invasive epithelial ovarian cancer within 2 years of serum sample donation and had at least 4mL of non-haemolysed serum available, and such number of women stratified into those women which developed a high grade serous, mucinous, trioid, clear cell, carcinosarcoma or a carcinoma not othenNise specified, respectively. The average age at sample donation can be calculated in years; as can the number of such women, the number of women who were diagnosed within one year and those who were diagnosed between 1-2 years after sample donation, as well as the respective number of women who were diagnosed with a stage 1/11 and stage III/IV cancer, respectively. For each of the such cases, three women who did not p any cancer within the first five years after tment can be d with regards to age at tment, centre and month of recruitment (controls).

DNA methylation analyses in tissue samples: DNA isolation: DNA was isolated from tissue samples using the Qiagen DNeasy Blood and Tissue Kit (Qiagen Ltd, UK, 69506) and 600ng was bisulfite converted using the Zymo methylation Kits (Zymo Research Inc, USA, D5004/8).

[222] Illumina Infinium Human Methylation450 ip Array data analysis: Genome wide methylation is was performed using the Illumina Infinium Methylation 450K beadchip (Illumina Inc USA, WG1003). The raw data processing and quality control was performed in R/Bioconductor (versions 2.15.0/2.11) (Ref. S5) using minfi (Ref. S6) and BMIQ (Ref. S7) packages. fication of differentially methylated regions (DMRs) was carried out using Genedata Expressionist® for Genomic Profiling as described below. 40 [223] To correct for the dual probe to probe variation in the affinity/sensitivity to unnmethylated vs. methylated DNA we used fully methylated (SssI treated) and unmethylated (whole genome amplified; WGA) genomic DNA from WBC samples of different individuals. These cal controls were used for both filtering out probes that do not show sufficient specificity (i.e. cannot discriminate between methylated vs. unmethylated state) and to perform array-wide recalibration of the biological sample data to normalize for the probe to probe variation in background and c range, respectively. The removal of the non-specific probes was achieved by doing a T-test with 5551 vs WGA samples (using M-values) and removing the probe sets that have p-value <0.01 and effect size below <5 i.e. cannot discriminate between fully methylated and unmethylated DNA. The normalization was done for each sample individually for each probe set with the formula Mme: (Mmeasured- MWGA)/ (M5551. MWGA); M5551 and MWGA values used were average (arithmetic mean) values of the respective sample groups. For the ream analyses the individual sample $551 and WGA data were also normalized with the same formula. This leads to efficient removal of background noise from the probe to probe variation and increases the power to detect homogenously methylated or unmethylated genomic regions. T-test and normalization were performed in Genedata Expressionist® for Genomic Profiling software.

[224] The control sample set was selected to identify DMRs that are cancer specific and would also be specific in a serum based clinical assay. Therefore, in addition to the ovarian (including Fallopian Tube and endometrium) control tissues we used a large panel of tissues that are likely to shed DNA into the serum [i.e. white blood cells , lung, liver, rectum and , with WBCs being the most abundant source of normal germline DNA in serum samples. Two statistical approaches were used to identify DMRs from the 450K data: (1) a tical test to fy single probes showing differential methylation between n cancer and WBC s, and (2) a sliding window ANOVA approach that scans the whole genome and identifies sets of neighboring probes (Ranges) showing correlated methylation differences between ovarian cancer and WBC samples. Only the DMRs showing no methylation in WBCs were considered for downstream analysis steps. The identified DMRs where ranked and scored based on the following criteria: (1) Differences in methylation levels between ovarian cancer and the control tissues (with WBC difference being ized). (2) ility of designing a clinical assay (number of Cst in the region to allow ing an assay with sufficient sensitivity/specificity). (3) For ranges only: ility of the DMRs (number of probes within the Range).

In the sliding window approach, the algorithm performs a pooling of all features in a given sliding window (120bp) before it calculates an ANOVA p-value between sample groups. The pooling increases statistical robustness and also results in smoother ANOVA p-Values. The smoothed ANOVA p-Values are then used to detect regions containing one or more p-values ing the given Maximum P-Value threshold (1e-5). If a gap of more than 1000bp is detected between similar ation differences, two different regions are reported. Note, that the algorithm also reports single probes g significant methylation difference (if no ouring similar methylation difference is present), but groups of probes with similar profile do get lower es and are therefore preferentially reported. The sliding window ch was used for CC vs WBC samples to detect cancer DMRs (using normalized M-values) and arithmetic mean M-values of the probes per detected DMR (here after referred as “Range") were reported for all the relevant samples for downstream analysis. The Range discovery was performed in Genedata Expressionist® for Genomic ing v8.0 software. The Ranges varied in size between 1 and 45432bp, with average (arithmetic mean) size being 368bp. The Ranges showing methylation in WBC were removed by a T-test with WBC vs. WGA samples (p-value <1e-6 and/or directed effect >0.15; i.e. M(WBC) > M(WGA)+0.15). Next, a T-test for CC vs WBC was used and Ranges showing significant difference (p-value <1e-6) and difference (directed effect) of WBC upper quartile vs OC lower quartile >0.15 were selected as entially methylated regions. For different control tissue samples the methylation values were calculated for the same OC vs WBC Ranges metic mean M-values of the probes per ed DMR). 40 [226] For ranking of the DMRs the effect sizes of methylation of cancer samples versus different relevant controls tissues were calculated. In addition to “direct” control tissues (fimbrial/endometrial/benign ovarian tissues) also large tissues with high turnover (liver, lung, rectum and colon) were included; data were download from TCGA data portal (https://tcga-data.nci.nih.gov/tcga/) as level 3 data as detP ed alues; data normalization was carried out as described above. The effect sizes were always calculated with cancer lower quartile vs control tissue upper WO 09212 quartile values (based on SssI/WGA normalized M-values).

Two different scoring methods were used for the effect sizes. In Method 1 the OC vs WBC effect size gets the weight 6x, and all the control tissue 1/4x. In Method 2 the OC vs WBC effect size gets the weight 6x, and all the control tissue 1x. The Method 2 takes more into account the data from all the control tissues s Method 1 maximises the effect of the difference between WBC and cancers samples. However, for both methods only DMRs prefiltered for low methylation in WBCs were used (as described above). The final scores are the sum of the tissue scores and the feasibility and confidence scores (see next paragraph). If data were not ble for a certain probe for a certain tissue (i.e. was filtered out due to high detection p-value), the score for the tissue was 0.

For further ranking of the DMRs ility (for designing a functional clinical assay) and confidence (for ranges) scores were calculated. The feasibility score is based on number of CpG dinucleotides within (or close by; +/- 60bp) a probe/range. If the number of Cst is <5, the score is -0.5, if the number of Cst is between 5 and 9 the score is 0 and if the number of Cst is >=10 the score is 0.5. The number of Cst per range was calculated using EMBOSS ort tool in Galaxy (Refs. 58-510) using the range genomic coordinates as input. The confidence score for ranges is 0.5 if 2 or more probes are within the range, if only one probe the score is 0.

[229] Reduced Representation Bisulfite Sequencing (RRBS): w: RRBS libraries were ed by GATC Biotech AG using INVIEW RRBS-Seq according to etary SOPs. In brief, DNA was digested with the restriction endonuclease MspI that is specific for the CpG containing motif CCGG; a subsequent size selection provides enhanced coverage for the CpG-rich regions including CpG islands, promoters and enhancer elements (Refs. $11, $12). The digested DNA is then adapter ligated, ite modified and PCR—amplified. The ies were ced on Illumina’s HiSeq 2500 with 50 bp or 100 bp paired-end mode.

After sequencing raw data was trimmed using Trimmomatic (0.32) to remove r sequences and low quality bases at the beginning and end of reads. Subsequently, reads were trimmed with lore (0.3.3) to remove cytosines derived from library preparation which must not be included in the methylation analysis. Read pairs were mapped to the human genome (hg19) in Genedata Expressionist® for Genomic Profiling 8.0 applying Bisulfite Mapper based on BOWTIE v2.1.0 (Ref. 513) with the settings --no-discordant der -p 8 --end-to-end --no-mixed -D 50 -k 2 --fr --norc -X 400 -I 0 --phred33. Further analysis was done using Genedata Expressionist® for Genomic Profiling v9.1.

Computation of RRBS-determined methylation pattern frequencies: In order to allow the sensitive detection of methylation patterns with low abundance, the read data available for each sample type (e.g. breast cancer, ovarian cancer and white blood cells) were pooled across patients and sequencing runs. Candidate genomic regions for methylation pattern analysis were defined based on bundles of at least 10 paired-end reads covering at least 4 consecutive CpG sites which are located within a genomic range of at most 150bp. As illustrated in FIGURE 5, our algorithm first determines sets of consecutive CpG sites of maximum size, from which multiple potentially overlapping subsets are derived, which still meet the selection criteria. CpG sites located in the gap between the mate reads are d. For each d set of CpG sites, the absolute and relative frequencies of all methylation patterns observed in the corresponding reads are determined. The methylation patterns are represented in terms of binary strings in which the methylation state of each CpG site is denoted by 1 if methylated or 0 if unmethylated. The thm for selecting candidate regions and calculating methylation pattern frequencies was ented in our software rm Genedata Expressionist® for c Profiling. 40 [233] Procedure for the selection of tumour-specific RRBS-determined ation patterns: In order to ensure that the pattern exclusively occurs in tumour samples, all patterns present in white blood cells were excluded. A score for assessing the relevance of each n was determined by integrating multiple subordinate scores which quantitatively capture desired properties of candidate biomarker patterns. First, for each pattern a Tumour Specificity Score Sp = DL - TP - TE - AF was calculated, which consists of the four components Dilution Factor DL, Tumour ence TP, Tumour Enrichment Factor TE and Avoiding Factor AF. The formal definitions of the score components are given in the following: #total reads 1 DL 2—_*WBC #reads with pattern 103 #reads with pattern in tumor TP =—*10tumor #total reads in tumor #observed reads with pattern in tumor TE =+tumor #expected reads wrth pattern Ln tumor #expected reads with n in WBC AF 2—WBC #observed reads with pattern in WBC The Dilution Factor DL and Tumour Prevalence TP favour patterns which are supported by a high proportion of reads in tumour and low proportion of reads in WBC, respectively. A pattern observed in 1 out of 10 reads in tumour and in 1 out of 1000 reads in WBC scores 1 for both s. The Tumour Enrichment Factor TE and Avoiding Factor AF were ed to assess the overrepresentation of the pattern in tumour samples and its underrepresentation in WBC samples, respectively, relative to an expected number of pattern reads which is based on the observed overall methylation level in those tissues. In order to estimate the number of expected reads supporting the pattern, the methylation ncies are calculated for each CpG site individually. Next, the number of expected reads with a specific pattern is calculated as the product of the relative frequencies of the tumour specific methylation states observed for each CpG site in the pattern times the number of reads stretching across the pattern. A TE >1 indicates that a pattern is more frequent in tumour than expected when randomly distributing the observed methylation levels across reads. Besides favouring tumour icity our scoring procedure was also designed to make patterns with high variance of the highest priority (i.e., patterns for which a high number of transitions in the methylation state is observed between consecutive CpG sites). Such ns may be a product of the epigenetic reprogramming of tumour cells and in order to account for the potentially increased biological relevance of these patterns another score component was introduced. The normalized variance VP of a n p is defined as the pattern variance divided by the maximum variance, i.e., the pattern length minus 1. The scores for the tumour specificity SP and pattern ce VP were combined in the tumor-specific variance score SVP 2 VP -10g(5p). In order to facilitate the ranking of each candidate genomic region r based on the relevance of patterns p1,..., pN observed in the region the aggregation score A5, was calculated based on the following formula: A5,=Zn 1 i=1 1

[235] The aggregation score A5, corresponds to a weighted sum of the tumour-specific variance scores of the observed patterns. The weighting was included since an ordinary sum would introduce a bias towards regions, in which a high number of patterns have been observed due to a high read coverage and/or high CpG site density. All of the presented statistics for assessing the nce of methylation patterns and genomic regions were ented in ta Expressionist® for Genomic Profiling and R, respectively.

[236] DNA methylation analyses in serum samples: Serum separation: For Serum Sets 1-3 and the NACT Serum Set, women ing the hospitals in London and Prague have been invited, consented and 20-40 mL blood has been obtained (VACUE'I'I'E® 2 Serum Sep Clot Activator tubes, Cat 455071, Greiner Bio One ational GmbH), centrifuged at pm for 10 minutes and serum collected and stored at -80°C. We have applied non-stringent measures (i.e. allowed for up to 12 hours WO 09212 between blood draw and centrifugation) purposely in order to mimic the situation of UKCTOCS s which could be used to compare the results presented herein, which samples had been sent from the recruiting centre to UCL within 24-48 hours before centrifugation.

Serum DNA isolation and bisulfite modification: DNA was isolated using the DNeasy Blood and Tissue Kit (Qiagen Ltd, UK, 69506) at GATC Biotech (Constance, Germany). Serum DNA was quantified using the Fragment Analyzer and the High Sensitivity Large Fragment Analysis Kit (AATI, USA). DNA was bisulfite converted using the EZ-96 DNA ation Kit (Zymo Research Inc, USA, D5004/8) at GATC Biotech.

Targeted ultra-high coverage bisulfite sequencing: Targeted bisulfite sequencing was performed at GATC.

To this end, a two-step PCR approach was used similar to the recently published BisPCR2 (Ref. S14). Bisulfite modification was performed with 1mL serum equivalent. For each batch of samples, positive and non-template controls were processed in parallel. Bisulfite converted DNA was used to test up to three different markers using automated workflows. After ite modification the target regions were amplified using primers carrying the target specific sequence and a linker sequence. Amplicons were purified and quantified. All amplicons of the same sample were pooled equimolarly. In a second PCR, primers specific to the linker region were used to add sequences necessary for the sequencing and multiplexing of samples. Libraries were purified and quality controlled. Sequencing was performed on Illumina’s MiSeq or HiSeq 2500 with 75 bp or 125 bp paired-end mode. Trimming of adapter sequences and low quality bases was performed with matic as described for the RRBS data.

Assessment of RRBS-determined methylation pattern frequency in serum DNA: After sequencing, raw data were d using Trimmomatic (0.32) to remove adapter sequences and low quality bases at the beginning and end of reads. uently, reads were d with TrimGalore (0.3.3) to remove cytosines derived from library preparation which must not be included in the methylation analysis. r analysis was done using Genedata Expressionist® for Genomic Profiling 9.1. Read pairs were mapped to the human genome (hg19) applying Bisulfite Mapper based on BOWTIE v2.2.5 (13) with the settings --no-discordant -p 8 --norc --reorder -D 50 --fr --end-to-end - X 500 -I 0 d33 -k 2 ixed. Coverage was calculated per sample and target region using c Data Feature Quantification activity by calculating the arithmetic mean of the coverage in each region. As part of the data quality control, efficiency of the bisulfite conversion was estimated in each sample by quantifying the methylation levels of CpHpG and CpHpH sites (where H is Any Nucleotide Except G), with minimum ge of 10, within the target s. The median bisulfite conversion efficiency was 99.4%, with efficiency for no sample being lower than 97.7%. Methylation pattern frequencies in serum samples for target regions were determined as described above.

Relative pattern frequencies were calculated by dividing the number of reads containing the pattern by the total number of reads covering the pattern region.

DISCUSSION: Circulating tumour DNA analysis — using cancer—specific DNAme markers and/or patterns of the present invention - shows independent sensitivity/specificity to that of CA125 and has a greater dynamic range correlating with s in tumour burden and response to treatment.

Consistent with hed data (Ref. 8), CA125 change after 2 cycles of chemotherapy was not able to indicate responsiveness to chemotherapy (in this case carboplatin alone or in combination with paclitaxel). The fact that serum DNAme-dynamics — as analysed using a method of the present invention - correctly identified 7/9 and 6/7 neoadjuvant chemotherapy ders and non-responders, respectively, provides a proof of principle and a basis for 40 prospective clinical trials to dualise pre-operative systemic treatment in ed n cancer.

In healthy individuals, cell-free DNA is present at concentrations between 0 and 100 ng/mL and an e of 30 ng/mL (Ref. 32). DNA d from tumour cells is shorter than that from non-malignant cells in the plasma of cancer patients (Ref. 33). One m to be solved is the development of DNAme based markers (and an assay) for ovarian cancer detection, in particular early detection of n cancer. Samples available in order to carry out this WO 09212 task are from large population based ing studies. For example, the largest of such studies being UKCTOCS.

Serum samples from ~100,000 women need to be collected in order to secure sufficient numbers (i.e. between 40- 50) of women who develop ovarian cancer within 2 years of sample on. Within the S setting whole blood samples were cou riered to the central laboratory with median time to spin of 22 hours. Prospectively collected blood samples were spun down between 2-12 hours after collection in order to mimic the collection-setting typically used for large studies like UKCTOCS. It is expected for such an analysis of UKCTOCS samples that, and as has been already seen for other prospectively collected sets including UKCTOCS (Anjum et al, 2014), samples from such prospectively collected sets contain higher than average amounts of cell-free DNA and fragments being longer on average. Both factors are likely to reflect the leakage of WBC DNA into serum. e these complicating factors the three-DNAme marker panel can outperform CA125 in detecting ovarian , also for detecting ovarian cancer early.

False CA125-positivity can usually be explained by a CA125 producing benign condition (Ref. 34). The fact that in Serum Set 3 there was no overlap at all between false CA125 and false DNAme positive samples tes that the DNAme-false positivity is largely triggered by technical cts as a result of extremely low thresholds down to a pattern frequency of 0.000003 (i.e. 3 cancer patterns in the background of 1.000.000 DNA nts with a non- cancer pattern).

Based on the UKCTOCS ence screen (Ref. 23), the Risk of Ovarian Cancer Algorithm (ROCA) identified 0.65% of women at an elevated risk of which 13% (42/327) have eventually been diagnosed after having been assessed by ultrasound, additional imaging and clinical assessment. Applying the three-marker DNAme test of the present invention with a conservative estimate of specificity and sensitivity of 90% and 60%, respectively, in ROCA- elevated risk women would immediately enable sis and treatment of the 0.05% of women within a population with an ovarian cancer with a positive predictive value of 44% (Le. only 2.3 ions are necessary to diagnose/treat 1 n cancer patient).

At the UKCTOCS prevalence screen (Ref. 22), the Risk of Ovarian Cancer Algorithm (ROCA) identified elevated risk in 0.65% of women of whom 13% (42/327) were diagnosed after repeat CA125 testing, ultrasound, additional imaging and al assessment. Applying the three-marker DNAme test of the present invention with a vative estimate (i.e. excessive background DNA will not be an issue in prospective samples) of specificity and sensitivity of 90% and 60%, as a second line test to ROCA-elevated risk women could substantially decrease time to diagnosis in at least half the women with ovarian cancer.

[248] Overall and for the first time, the present invention provides serum DNAme markers and assays (and other means and methods) that can diagnose ovarian cancers (or are useful for such diagnosis), and it is likely that they are able to detect/diagnose OC up to two years in advance of tional methods of diagnosis, and are able to individualise ovarian cancer treatment. The recent advance of e-made blood collection tubes (such as those from Streck as described above) that stabilise ating DNA and prevent leakage of DNA from blood cells (Ref. 35) will facilitate al implementation of DNAme pattern detection in cell free DNA as a clinical tool in cancer medicine.

Note: The work leading to this invention has ed funding from the European Union Seventh Framework Programme (FP7/2007-2013) under Grant Agreement Number 305428 (Project EpiFemCare). 40 REFERENCES 1. Hennessy BT, Coleman RL, Markman M. Ovarian cancer. Lancet 2009;374(9698):1371-1382. 2. l DD, Bohm S, Ahmed AA et al. Rethinking ovarian cancer II: reducing mortality from high-grade serous ovarian cancer. Nat Rev Cancer 2015;15(11):668-679. 3. Bast RC, Jr., Klug TL, St JE et al. A radioimmunoassay using a monoclonal antibody to monitor the course of WO 09212 epithelial ovarian cancer. N EnglJ Med 1983;309(15):883-887. 4. Buys SS, Partridge E, Black A et al. Effect of screening on ovarian cancer mortality: the Prostate, Lung, Colorectal and Ovarian (PLCO) Cancer Screening Randomized Controlled Trial. JAMA 2011;305(22):2295-2303.

. Cramer DVV, Bast RC, Jr., Berg CD et al. Ovarian cancer biomarker performance in prostate, lung, colorectal, and ovarian cancer screening trial specimens. Cancer Prev Res (Phila) 2011;4(3):365-374. 6. Jacobs IJ, Menon U, Ryan A et al. n cancer screening and mortality in the UK Collaborative Trial of Ovarian Cancer Screening (UKCTOCS): a randomised lled trial. Lancet 2016;387(10022):945-956. 7. Menon U, Ryan A, Kalsi J et al. Risk Algorithm Using Serial Biomarker Measurements Doubles the Number of Screen-Detected Cancers Compared With a Single-Threshold Rule in the United Kingdom Collaborative Trial of Ovarian Cancer Screening. J Clin Oncol 2015;33(18):2062-2071. 8. Vallius T, Hynninen J, Auranen A et al. Serum HE4 and CA125 as predictors of response and outcome during neoadjuvant chemotherapy of advanced high-grade serous ovarian cancer. Tumour Biol 2014;35(12):12389-12395. 9. Dawson SJ, Tsui DVV, Murtaza M et al. Analysis of circulating tumor DNA to monitor metastatic breast cancer.

N EnglJ Med 2013;368(13):1199-1209. 10. a M, Dawson SJ, Tsui DW et al. vasive analysis of acquired resistance to cancer therapy by sequencing of plasma DNA. Nature 2013;497(7447):108-112. 11. Wang Y, Springer S, Mulvey CL et al. Detection of c mutations and HPV in the saliva and plasma of patients with head and neck squamous cell omas. Sci Transl Med 2015;7(293):293ra104. 12. Siravegna G, Mussolin B, Buscarino M et al. Clonal evolution and ance to EGFR blockade in the blood of ctal cancer patients. Nat Med 2015;21(7):827. 13. Bettegowda C, Sausen M, Leary RJ et al. Detection of circulating tumor DNA in early- and late-stage human malignancies. Sci Transl Med 2014;6(224):224ra24. 14. Lanman RB, Mortimer SA, Zill OA et al. Analytical and Clinical Validation of a Digital Sequencing Panel for Quantitative, Highly Accurate Evaluation of Cell-Free Circulating Tumor DNA. PLoS One 0(10):e0140712. 15. Sun K, Jiang P, Chan KC et al. Plasma DNA tissue g by genome-wide methylation sequencing for noninvasive prenatal, cancer, and transplantation assessments. Proc Natl Acad Sci U S A 2015;112(40):E5503-E5512. 16. Pepe MS, Feng Z, Janes H, Bossuyt PM, Potter JD. Pivotal evaluation of the cy of a biomarker used for classification or prediction: standards for study design. J Natl Cancer Inst 2008;100(20):1432-1438. 17. Baylin SB, Jones PA. A decade of eXploring the cancer epigenome - biological and translational implications.

Nat Rev Cancer 2011;11(10):726-734. 18. Forshew T, Murtaza M, Parkinson C et al. Noninvasive fication and ring of cancer mutations by targeted deep sequencing of plasma DNA. Sci Transl Med 2012;4(136):136ra68. 19. Leary RJ, Sausen M, Kinde I et al. Detection of chromosomal alterations in the circulation of cancer ts with whole-genome sequencing. Sci Transl Med 2012;4(162):162ra154. 20. Wittenberger T, Sleigh S, Reisel D et al. DNA methylation markers for early ion of women's cancer: promise and challenges. Epigenomics (3):311-327. 21. Potter NT, Hurban P, White MN et al. Validation of a real-time PCR-based qualitative assay for the detection of methylated SEPT9 DNA in human plasma. Clin Chem 2014;60(9):1183-1191. 22. Norton ME, Jacobsson B, Swamy GK et al. Cell-free DNA analysis for noninvasive examination of trisomy. N 40 Engl J Med 72(17):1589—1597. 23. Menon U, Gentry-Maharaj A, Hallett R et al. ivity and specificity of multimodal and ultrasound screening for ovarian , and stage distribution of detected cancers: results of the prevalence screen of the UK Collaborative Trial of Ovarian Cancer Screening (UKCTOCS). Lancet Oncol 2009;10(4):327-340. 24. Teschendorff AE, Yang Z, Wong A et al. Correlation of Smoking-Associated DNA Methylation Changes in Buccal Cells With DNA Methylation Changes in Epithelial Cancer. Jama Oncol 2015;1(4):476-485.

. Teschendorff AE, Lee SH, Jones A et al. HOTAIR and its surrogate DNA methylation ure indicate carboplatin resistance in ovarian cancer. Genome Med 2015;7(1):108. 26. Gu H, Smith ZD, Bock C, Boyle P, Gnirke A, Meissner A. Preparation of reduced representation ite sequencing libraries for genome-scale DNA methylation profiling. Nat Protoc 2011;6(4):468-481. 27. Lee YK, Jin S, Duan S et al. Improved reduced representation bisulfite sequencing for epigenomic profiling of clinical samples. Biol Proced Online 2014;16(1):1. 28. Newcombe RG. Two-sided confidence intervals for the single proportion: comparison of seven methods. Stat Med 1998;17(8):857-872. 29. Bartlett TE, Jones A, Goode EL et al. Intra-Gene DNA Methylation Variability Is a Clinically Independent Prognostic Marker in Women's Cancers. PLoS One 2015;10(12):e0143178.

. Sanchez-Vega F, Gotea V, Petrykowska HM et al. Recurrent patterns of DNA methylation in the ZNF154, CASP8, and VHL promoters across a wide spectrum of human solid lial tumors and cancer cell lines.

Epigenetics 2013;8(12):1355-1372. 31. Margolin G, Petrykowska HM, Jameel N, Bell DVV, Young AC, Elnitski L. Robust ion of DNA Hypermethylation of ZNF154 as a Pan-Cancer Locus with in Silico ng for Blood-Based Diagnostic Development.

J Mol Diagn 2016; 18(2):283-298. 32. ly E, CabouX E, Vineis P, Hainaut P. ating free DNA in plasma or serum as biomarker of carcinogenesis: cal aspects and biological significance. Mutat Res 2007;635(2-3):105-117. 33. Jiang P, Lo YM. The Long and Short of Circulating ree DNA and the Ins and Outs of Molecular Diagnostics. Trends Genet 2016;32(6):360-371. 34. Hirsch M, Duffy J, Davis CJ, Nieves PM, Khan KS. Diagnostic accuracy of cancer antigen 125 for endometriosis: a systematic review and meta-analysis. BJOG 2016.

. Kang Q, Henry NL, Paoletti C et al. Comparative analysis of circulating tumor DNA stability In KEDTA, Streck, and CellSave blood collection tubes. Clin Biochem 2016.

S1. Bartlett TE, Jones A, Goode EL, Fridley BL, Cunningham JM, Berns EM et al. Intra-Gene DNA Methylation Variability Is a Clinically Independent stic Marker in Women's Cancers. PLoS One 2015;10(12):e0143178.

S2. Teschendorff AE, Lee SH, Jones A, Fiegl H, Kalwa M, Wagner W et al. HOTAIR and its surrogate DNA methylation signature indicate carboplatin resistance in ovarian cancer. Genome Med 2015;7(1):108.

S3. ndorff AE, Yang Z, Wong A, Pipinikas CP, Jiao Y, Jones A et al. Correlation of Smoking-Associated DNA Methylation Changes in Buccal Cells With DNA Methylation Changes in Epithelial Cancer. Jama Oncol 2015 July;1(4):476-85.

S4. Bartlett TE, Chindera K, McDermott J, Breeze CE, Cooke WR, Jones A et al. Epigenetic reprogramming of fallopian tube fimbriae in BRCA mutation carriers s early n cancer evolution. Nat Commun 2016;7:11620.

S5. Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, Dudoit S et al. Bioconductor: open software development for computational y and bioinformatics. Genome Biol 2004;5(10):R80.

S6. Aryee MJ, Jaffe AE, a-Bravo H, Ladd-Acosta C, rg AP, Hansen KD et al. Minfi: a fleXible and comprehensive Bioconductor package for the analysis of Infinium DNA methylation microarrays. Bioinformatics 2014 40 May 15;30(10):1363-9.

S7. Teschendorff AE, Marabita F, Lechner M, Bartlett T, Tegner J, Gomez-Cabrero D et al. A ixture quantile normalization method for correcting probe design bias in na Infinium 450 k DNA ation data.

Bioinformatics 2013 January 15;29(2):189-96.

S8. Dedeurwaerder S, Defrance M, Calonne E, Denis H, Sotiriou C, Fuks F. Evaluation of the Infinium Methylation 450K technology. Epigenomics 2011 December;3(6):771-84.

S9 Goecks J, Nekrutenko A, Taylor J. Galaxy: a hensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences. Genome Biol 2010;11(8):R86.

S10. Giardine B, Riemer C, Hardison RC, Burhans R, Elnitski L, Shah P et al. Galaxy: a platform for ctive large-scale genome analysis. Genome Res 2005 October;15(10):1451-5.

S11. Gu H, Smith ZD, Bock C, Boyle P, Gnirke A, er A. Preparation of reduced representation bisulfite sequencing libraries for genome-scale DNA methylation profiling. Nat Protoc 2011 April;6(4):468-81.

S12. Lee YK, Jin S, Duan S, Lim YC, Ng DP, Lin XM et al. Improved reduced representation bisulfite sequencing for omic profiling of clinical samples. Biol Proced Online 6(1):1.

S13. Chen PY, Cokus SJ, Pellegrini M. BS Seeker: precise mapping for bisulfite sequencing. BMC Bioinformatics 2010;11:203.

S14. Bernstein DL, aran V, Le Lay JE, Sheaffer KL, Kaestner KH. The BisPCR(2) method for targeted bisulfite sequencing. Epigenetics Chromatin 2015;8:27.

Claims (1)

1. CLAIMS A method of determining the presence or absence of, or response to therapy against, an ovarian cancer in a woman, said method comprising the steps: 0 providing a biological sample from said woman, said sample sing ree DNA of said woman; and - determining, in at least one molecule of said cell-free DNA, the ation status at one or more Cst located within one or more of the nucleotide sequences independently selected from the group consisting of: SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 and 31, or a nucleotide sequence present within about 2,000bp 5’ or 3’ thereof, or an allelic 10 variant and/or complementary sequence of said nucleotide sequence(s), wherein, the presence in at least one of said cell-free DNA molecules of one or more: (i) methylated Cst associated with one or more of said nucleotide ces independently selected from: SEQ ID NOs: 1, 2, 3, 4, 10, 12, 14, 15, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29 and 30; and/or (ii) un-methylated Cst associated with one or more of said nucleotide sequences independently ed from: SEQ ID NOs: 5, 6, 7, 8, 9, 11, 13, 15 16, 17, 22 and 31, indicates the presence of, or a reduced response to therapy against, an ovarian cancer in said woman. The method of claim 1, wherein said biological sample is liquid biological sample ed from the group consisting of: a blood sample, a plasma sample and a serum sample. The method of claim 1 or 2, wherein said Cst for a given nucleotide sequence are fiable by a genome position for the ne (C) thereof, independently selected from the list of genome positions corresponding to said nucleotide sequence set forth in TABLE 1C. 25 The method of any one or claims 1 to 3, wherein the methylation status is determined at a number being two, three, four, five, six, seven, eight, nine, ten, about 12, about 15, about 20, about 25 or more of said Cst located within said nucleotide sequence; wherein, the presence in at least one of said cell-free DNA molecules of at least one, such as up to said number, of: (i) methylated Cst associated with one or more of said nucleotide sequences independently selected from: SEQ ID NOs: 1, 2, 3, 4, 10, 12, 14, 15, 18, 19, 20, 21, 23, 30 24, 25, 26, 27, 28, 29 and 30; and/or (ii) un-methylated Cst associated with one or more of said tide sequences independently selected from: SEQ ID NOs: 5, 6, 7, 8, 9, 11, 13, 16, 17, 22 and 31, indicates the presence of, or a reduced response to therapy t, an ovarian cancer in said woman. The method of any one of claims 1 to 4, wherein the presence in at least one of said cell-free DNA les 35 of one or more pattern of methylation and/or un-methylation as set forth in TABLE 23 for the respective nucleotide sequence(s), indicates the presence of, or a reduced response to therapy against, an ovarian cancer in said woman. The method of any one of claims 1 to 5, wherein the methylation status at one or more Cst located within a 40 number of two, three, four or more of said nucleotide sequences is ined; wherein, the presence in at least one of said cell-free DNA molecules of one or more: (i) methylated Cst associated with one or more of said tide sequences independently selected from: SEQ ID NOs: 1, 2, 3, 4, 10, 12, 14, 15, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29 and 30; and/or (ii) un-methylated Cst associated with one or more of said nucleotide sequences independently selected from: SEQ ID NOs: 5, 6, 7, 8, 9, 11, 13, 16, 17, 22 and 31, indicates the presence of, or a reduced response to therapy, t an ovarian cancer in said woman. The method of any one of claims 1 to 6, wherein said nucleotide sequence(s) is/are associated with DMR(s) #141 and/or #204 and/or #228 (eg, SEQ ID NOs: 1, 2 and/or 3), or an allelic variant and/or complementary sequence of said nucleotide sequence(s). The method of claim 7, wherein the methylation status is determined at one or more of said Cst located within each of said three nucleotide sequences; wherein, the presence in at least one of said cell-free DNA molecules of one or more methylated Cst, and/or of one or more pattern of methylation and/or un- 10 methylation as set forth in TABLE 2B for the tive nucleotide sequence(s), located within any one of said nucleotide sequences tes the presence of, or a reduced response to therapy against, an ovarian cancer in said woman. The method of claim 7 or 8, wherein the methylation status is determined at a number of between about 5 15 and about 18 of said Cst located within said nucleotide sequence(s); wherein, the presence in at least one of said cell-free DNA molecules of at least said number of methylated Cst, and/or of one or more pattern of methylation and/or un-methylation as set forth in TABLE 2B for the respective nucleotide sequence(s), located within any one of said nucleotide sequences indicates the presence of, or a reduced response to therapy against, an ovarian cancer in said woman. 10. The method of any one of claims 7 to 9, wherein the methylation status is determined at about 7 Cst located within nucleotide sequence SEQ ID NO 1 and/or at about 16 to 18 Cst located within nucleotide sequence SEQ ID NO 2 and/or at about 7 to 9 Cst located within tide sequence SEQ ID NO 3. 25 11. The method of any one of claims 7 to 10, wherein the methylation status is determined at about 7 Cst located within nucleotide sequence SEQ ID NO 1 and at about 16 to 18 Cst located within nucleotide sequence SEQ ID NO 2 and about 7 to 9 Cst located within tide sequence SEQ ID NO 3; wherein, the presence in at least one of said ree DNA molecules of at least said number of methylated said Cst, and/or of one or more n of methylation and/or un-methylation as set forth in TABLE 2B for the 30 respective nucleotide sequence(s), located within any one of said nucleotide ces indicates the presence of, or a reduced se to y against, an ovarian cancer in said woman. 12. The method of any one of claims 1 to 11, comprising the step of isolating said cell-free DNA from said biological sample. 13. The method of any one of claims 1 to 12, comprising the step of treating said cell-free DNA with an agent that differentially modifies said cell-free DNA based on the methylation status of one or more Cst located within; ably a methylation sensitive restriction enzyme and/or bisulphite. 40 14. The method of claim 13, n said agent is bisulphite and said determining step comprises the detection of at least one hite-converted un-methylated cytosine within one or more of the nucleotide sequences independently ed from those set forth in TABLE 2A (eg, independently selected the group consisting of: SEQ ID N05 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 and 62), wherein one or more of the bases identified by “Y” therein is a U or T and, WO 09212 preferably, where one or more of the bases identified by “Y” in a CpG therein is a C, or an allelic variant and/or complementary sequence of said nucleotide sequence(s). 15. The method of claim 13 or 14, wherein said agent is bisulphite and said determining step ses the detection of at least one bisulphite-converted un-methylated cytosine within a nucleotide sequence having a length of at least 50bp comprised in SEQ ID NO 32 and/or SEQ ID NO 33 and/or SEQ ID NO 34, wherein one or more of the bases identified by “Y” therein is a U or T and, preferably, where one or more of the bases identified by “Y” in a CpG therein is a C, or an allelic variant and/or complementary sequence of said nucleotide sequence(s). 16. The method of any one of claims 1 to 15, comprising the step of amplifying one or more s of said cell- free DNA to produce DNA prior to or as part of said ining step, and; preferably after said treating step. 17. The method of claim 16, n said amplified region(s) comprises at least one of said nucleotide sequences. 18. The method of claim 17, wherein said amplification comprises PCR using the primer-pair(s) for the respective nucleotide sequence(s) as independently selected from the group of primer-pairs set forth in each row of TABLE 3. 20 19. The method of any one of claims 1 to 18, n the methylation status of said Cst is determined by a technology ed from the group consisting of: methylation specific PCR/MethylLight, Epityper, nucleic acid chip-hybridisation, nucleic acid mass-spectrometry, Methylated DNA immunoprecipitation (MeDIP), Raindance and nucleic acid sequencing, preferably, e) strand sequencing, nanopore sequencing, bisulphite sequencing, such as targeted bisulphite sequencing; preferably wherein said determination step is conducted 25 as a pool when in respect of two, three, four or more of said nucleotide sequences. 20. The method of any one of claims 1 to 19, wherein the methylation status of said CpG(s) is determined in multiple molecules of said cell-free DNA and/or amplified DNA representing each of said nucleotide sequences. 30 21. The method of claim 20, wherein the presence in at least a plurality of said cell-free DNA molecules of one or more methylated and/or un-methylated Cst (as applicable), and/or the presence in at least a plurality of said cell-free DNA molecules of one or more pattern of methylation and/or un-methylation as set forth in TABLE 2B for the tive nucleotide sequence(s), located within one or more of said nucleotide sequences, indicates the ce of, or a reduced response to therapy against, an ovarian cancer in said woman. 22. The method of claim 20 or 21, wherein said plurality of cell-free DNA molecules with one or more of said ated and/or hylated Cst (as applicable), and/or the presence in at least a plurality of said cell- free DNA molecules of one or more pattern of methylation and/or un-methylation as set forth in TABLE 2B for the respective tide sequence(s), located is at least 2, 3, 4, 5, 6, 7, 18, 9 or 10, or at least about 15, 20, 40 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175 or 200, or a greater number such as greater than about 500, 1,000, 5,000, 7,500, 1,000, 2,500, 5,000 or greater than 5,000 les. 23. The method of any one of claims 20 to 22, wherein the methylation status of said CpG(s) is determined in a number of molecules of said cell-free DNA and/or amplified DNA representing each of said nucleotide sequences selected from the group consisting of at least about: 1,000, 5,000, 10,000, 50,000, 100,000, 200,000, 500,000, 1,000,000, 1,500,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 000 and 5,000,000 molecules, or more than 5,000,000 molecules. 24. The method of any one of claims 20 to 23, wherein a fraction or ratio of, or an absolute number of, cell-free DNA molecules in said sample having said methylated and/or un-methylated CpG(s) (as applicable) located within said tide sequence(s), and/or having said n of methylation and/or hylation as set forth in TABLE 23 for the respective nucleotide sequence(s), is estimated. 10 25. The method of claim 24, further comprising a step of comparing said fraction or ratio with a standard or cut- off value; wherein a fraction or ratio greater than the standard or cut-off value indicates the presence of or a reduced response to therapy against, an ovarian cancer in said woman. 26. The method of claim 25, wherein said standard or cut-off value is about 0.0008 for said methylated/un- 15 methylated CpG or said n of methylation and/or un-methylation associated with nucleotide sequence SEQ ID NO 1 and/or about 0.00003 for said methylated/un-methylated CpG or said n of ation and/or hylation associated with nucleotide sequence SEQ ID NO 2 and/or about 0.00001 for said ated/un-methylated CpG or said pattern of methylation and/or un-methylation associated with tide sequence SEQ ID NO 3. 27. The method of claim 25 or 26, wherein a fraction or ratio of cell-free DNA molecules with said methylated and/or un-methylated CpG(s) (as applicable) located within each of said nucleotide sequence(s), and/or with said pattern of ation and/or un-methylation as set forth in TABLE 23 for the respective nucleotide sequence(s), is estimated and compared to a respective standard or cut-off value; wherein any one of such 25 fraction or ratios being greater than its respective standard or cut-off value tes the presence of, or a reduced response to therapy against, an ovarian cancer in said woman. 28. The method of any one of claims 25 to 27, wherein said rd or cut-off value(s) is/are modified for a given sample based on: 30 o the amount or concentration of total cell-free DNA present in said sample; and/or 0 a baseline value of said fraction or ratio previously determined for said woman; and/or 0 a value of said fraction or ratio determined from multiple samples from a population of women representative of said woman; and/or 0 the specificity and/or sensitivity desired for said method of determination. 29. The method of claim 28, wherein said standard or cut-off value is/are reduced for a given sample that has an amount or concentration of total ree DNA present in said sample that is greater than a standard or cut-off value. 40 30. The method of any one of claims 1 to 29, which is practiced on multiple samples; wherein each sample is ted from the same woman at different time points. 31. The method of claim 30, wherein said multiple samples are collected from said woman with an interval between them selected from the group consisting of about: 2 days, 3 days, 4 days, 5 days, 7 days, 10, days, 14 days, 21 days, 24 days, 3weeks, 4 weeks, 5 weeks, 6 weeks, 6, weeks, 8 weeks, 3 months, 4 months, 5 months, 6 months, 8 months, 12 months, 18 months, 2 years, 3 years and 5 years. 32. The method of claim 30 or 31, wherein in comparison to a previous sample, the presence of, or an se in the te number of, or an increase in the on or ratio of, cell-free DNA molecules in said sample having said methylated and/or un-methylated CpG(s) (as able) located within said nucleotide sequence(s), and/or having said pattern of methylation and/or un-methylation as set forth in TABLE 23 for the respective nucleotide sequence(s), indicates the presence of, or a reduced response to therapy against, an ovarian cancer in said woman. 33. The method of any one of claims 1 to 32, comprising the step of determining tro), from a blood sample from said woman, the amount present therein of one or more proteins independently selected from the group consisting of: CA—125, HE4, transthyretin, apolipoprotein A1, -microglobin and transferrin; wherein, either or both of: 15 o the presence in at least one of said cell-free DNA molecules of one or more methylated and/or un- methylated Cst (as able) located within one or more of said nucleotide sequences, and/or the presence in at least one of said cell-free DNA molecules of one or more pattern of methylation and/or un- methylation as set forth in TABLE 23 for the respective nucleotide sequence(s); - an amount of said protein(s) present in said blood sample is greater than a standard or f value for 20 such amount or protein, tes the presence of, or a reduced response to therapy against, an ovarian cancer in said woman. 34. The method of claim 33, wherein said protein is ined by a ROCA, a ROMA and/or an OVA1 diagnostic test. 35. The method of any one of claims 1 to 34, wherein said ovarian cancer is an invasive ovarian cancer, such as an invasive epithelial ovarian cancer; in particular one selected from the group consisting of: high grade serious (HGS), endometroid, cell-cell and mucinous n cancers; and/or is a peritoneal cancer or a Fallopian tube . 36. The method of any one of claims 1 to 35, for distinguishing the presence of ovarian cancer from the presence of a benign pelvic mass. 37. The method of any one of claims 1 to 36, for determining the response of a woman suffering from ovarian 35 cancer to a therapy comprising chemotherapeutic agent(s) against said ovarian cancer. 38. The method of claim 37, wherein the risk of death of said woman is predicted. 39. The method of claim 37 or 38, ced on said woman after one, two, three, four and/or five cycles of said 40 (chemo)therapy. 40. The method of any one of claims 37 to 39, wherein said sample is obtained from said woman within a period after completion of said cycle or (chemo)therapy that is selected from the group consisting of about: 2 hours, 4 hours, 6 hours, 12 hours, 18 hours, 24 hours, 36 hours, 48 hours, 3 days, 4 days, 5 days, 6, days, 7 days, 8 days, 10 days, 12 days, 14 days, 16, days, 18 days, 21 days, 24 days, 4 weeks, 5 weeks, 6 weeks, and 8 weeks. 41. The method of any one of claims 37 to 40, wherein said (chemo)therapy includes one or more chemotherapeutic agent(s) independently selected from the group consisting of: a platinum-based antineoplastic and a taxane. 42. The method of claim 41, wherein at least one of said chemotherapeutic agents is carboplatin, cisplatin, paclitaxel or xel 43. The method of any one of claims 37 to 42, wherein said therapy is a uvant (chemo)therapy. 44. The method of any one of claims 37 to 43, wherein if said woman is determined to respond to said (chemo)therapy, then said woman is designated as being eligible for tumour de-baulking surgery. 45. The method of any one of claims 37 to 43, wherein if said woman is determined to not respond to said (chemo)therapy, then said woman is ated as eligible for therapy with one or more second-line chemotherapeutic agent(s) against said ovarian . 20 46. The method of claim 45, wherein said second-line (chemo)therapy es one or more chemotherapeutic agent(s) independently selected from the list consisting of: paclitaxel, carboplatin, cisplatin, liposomal doxorubicin, gemcitabine, trabectedin, etoposide, cyclophosphamide, an angiogenesis inhibitor and a PARP inhibitor. 25 47. A chemotherapeutic agent, such as one ed from the list consisting of: carboplatin, paclitaxel, docetaxel, cisplatin, liposomal doxorubicin, gemcitabine, tedin, etoposide, cyclophosphamide an angiogenesis inhibitor and a PARP inhibitor; for use in a method of therapy of ovarian cancer in a woman, n said chemotherapeutic agent is administered to a woman within about 3 months of said woman having been determined, using a method of any one of claims 37 to 43, to not respond to a therapy against 30 ovarian . 48. A nucleic acid comprising at least 10 (preferable at least about 15, such as at least 50, for any SEQ ID other than SEQ ID NO:58) contiguous bases comprised in a ce selected from the group consisting of: SEQ ID N05 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 35 59, 60, 61 and 62, wherein said nucleic acid sequence includes one or more of the bases identified by “Y” therein is a U or T and, preferably, where one or more of the bases identified by “Y” therein is a C, or an allelic variant and/or complementary sequence of said nucleotide ce. 49. The nucleic acid ce of claim 48, comprising at least 50 contiguous bases comprised in a sequence of 40 SEQ ID NO 32, SEQ ID NO 33 or SEQ ID NO 34, wherein said nucleic acid sequence includes one or more of the bases identified by “Y” therein is a U or T and, preferably, where one or more of the bases identified by “Y” therein is a C, or an allelic variant and/or complementary sequence of said nucleotide sequence. 50. The nucleic acid ce of claim 48 or 49, which is comprised in a sequence as set forth in TABLE 23 (eg, a sequence selected from the group consisting of: SEQ ID N05 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 and 93. 51. A nucleic acid probe complementary to a nucleic acid sequence recited in any one of claims 48 to 50, preferably for detection of said nucleic acid. 52. The nucleic acid probe of claim 51, that differentially binds to said nucleic acid sequence depending on the methylation status of one or more Cst within said nucleic acid sequence. 10 53. The nucleic acid probe of claim 51 or 52, comprising a label, preferably a label being a detectable scent moiety. 54. A nucleic acid primer pair for amplifying a nucleic acid sequence consisting of at least 10 (preferable at least about 15, such as at least 50, for any SEQ ID other than SEQ ID NO:89) uous bases comprised in 15 a sequence) selected from the group consisting of: SEQ ID NOs: SEQ ID N05 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92 and 93, or a nucleotide sequence present within about 2,000 bp 5’ or 3’ thereof, or an allelic variant and/or complementary sequence said nucleotide sequence(s), preferably wherein at least one primer of said pair includes a sequence corresponding to at least one bisulphite-converted CpG present in said nucleotide sequence(s). 55. The primer pair of claim 54, selected from the group of primer-pairs set forth in each row of TABLE 3. 56. A plurality of nucleic acids comprising at least two or three nucleic acid sequences of any one of claims 48 to 50 and/or at least two or three nucleic acid probes of any one of claims 51 to 53 and/or at least two or 25 three primer pairs of claim 54 or 55. 57. The plurality of nucleic acids of claim 56, as an admixture or array of said nucleic acid sequences and/or nucleic acid probes and/or primer pairs. 30 58. A kit, preferably for determining the presence or absence of, or response to therapy against, an ovarian cancer in a woman, said kit comprising: 0 one or more nucleic acid sequences of any one of claims 48 to 50 and/or nucleic acid probes of any one of claims 51 to 53 and/or primer pairs of claim 54 or 55 and/or the plurality of nucleic acids of claim 56 or 57; and 35 - optionally, said kit further comprising: (i) a printed manual or er readable memory comprising instructions to use said nucleic acid ce(s), nucleic acid s), primer pair(s) and/or plurality of nucleic acids to ce a method of any one of claims 1 to 46 and/or to produce or detect the nucleic acid sequence(s) of any one of any one of claims 48 to 50; and/or 40 (ii) one or more other claim, component or reagent useful for the practice of a method of any one of claims 1 to 46 and and/or the tion or detection of the nucleic acid ce(s) of any one of claims 48 to 50, ing any such item, component or reagent disclosed herein useful for such practice, production or detection. 59. The kit of claim 58, further comprising one or more of the following components. 0 means to collect and/or store a biological sample, such as blood, to be taken from said woman, preferably wherein said means is a blood collection tube; and/or 0 means to extract DNA, preferably cell-free DNA, from the sample to be taken from said woman, preferably wherein said means is a cell-free DNA extraction kit; and/or 0 an agent to differentially modify DNA based on the methylation status of one or more Cst located within said DNA, preferably wherein said agent is bisulphite; and/or 0 one or more reagents to detect a nucleic acid sequence, preferably for detecting the sequence of a bisulphite-converted nucleotide sequence; and/or 10 0 a printed manual or computer readable memory comprising instructions to identify, obtain and/or use one or more of said means, agent or reagent(s) in the context of a method of any one of claims 1 to 46. 60. A computer program product comprising: a computer readable medium encoded with a plurality of instructions for controlling a ing system to perform and/or manage an operation for determining the 15 presence or absence of, or response to therapy against, an ovarian cancer in a woman, from a biological sample from said woman, said sample comprising cell-free DNA of said woman, and determining, in at least one le of said cell-free DNA, the methylation status at one or more Cst located within one or more nucleotide sequences in accordance with a method as set forth in any one of claims 1 to 46; said operation comprising the steps of: 20 0 ing a first signal representing the number of les of said cell-free DNA sing one or more methylated and/or un-methylated Cst (as applicable), and/or comprising one or more pattern of methylation and/or un-methylation as set forth in TABLE 23 for the respective tide sequence(s), located within one or more of the tide sequences independently selected from the group consisting of: SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 25 27, 28, 29, 30 and 31, or a nucleotide sequence present within about 2,000bp 5’ or 3’ f, or an allelic variant and/or mentary ce of said nucleotide sequence(s); and - determining a classification of the presence or absence of, or response to therapy against, an ovarian cancer in said woman based on their being at least one molecules of said ree DNA comprising one or more said methylated and/or un-methylated Cst (as applicable), and/or comprising one or more said 30 pattern of methylation and/or un-methylation, located within one or more of said nucleotide sequences. 61. The computer program product of claim 60, wherein said operation r comprising the steps of: 0 receiving a second signal representing the number of les of said cell-free DNA comprising said nucleotide sequence(s); and 35 - estimating a fraction or ratio of molecules of said cell-free DNA comprising one or more said methylated and/or un-methylated Cst (as applicable), and/or comprising one or more said pattern of methylation or un-methylation, located within one or more of the nucleotide sequences within all of said nucleotide SEQUGHCGS. 40 62. The computer program t of claim 61, wherein said classification is determined by comparing said a fraction or ratio to a standard or cut-off value. 63. The computer program product of claim 62, n said operation further comprising the steps of: 0 ing a third signal representing: (i) the amount or concentration of total ree DNA present in said sample; and/or (ii) a baseline value of said fraction or ratio previously determined for said woman; and - ing said standard or cut-off value for a given sample based on said third signal. 64. The computer program t of any one of claims 60 to 63, wherein said first signal, and optional second signal, is determined from nucleotide sequence and/or methylation status ation of a plurality of said les of said cell-free DNA and/or ied DNA representing each of said nucleotide sequences, preferably wherein said plurality is a number selected from the group consisting of at least about: 1,000, 5,000, 10,000, 50,000, 100,000, 200,000, 500,000, 1,000,000, 1,500,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000 and 5,000,000 molecules, or more than 5,000,000 molecules. 65. The computer program product of claim 64, wherein said operation further comprises the steps of: o for each of said molecule’s sequence and/or methylation status information, determining if said molecule comprises none, one or more methylated and/or un-methylated Cst (as applicable), and/or comprises none, one or more pattern of ation or un-methylation as set forth in TABLE 23 for the respective 15 nucleotide sequence(s), located within one or more of the nucleotide ces ndently selected from the group consisting of: SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 and 31, or a nucleotide sequence present within about 2,000bp 5’ or 3’ thereof, or an allelic variant and/or complementary sequence of said nucleotide sequence(s); and - calculating said first signal, and optional second signal, based on said determination for all or a portion of 20 said plurality of molecules. 66. The computer program product of any one of claims 60 to 65, n said operation further comprises the steps of: 0 receiving a signal representing the amount present, in a sample of blood taken from said women, of one 25 or more proteins ndently selected from the group consisting of: CA—125, HE4, transthyretin, apolipoprotein A1, -microglobin and transferrin; and - comparing said a fraction or ratio to a standard or cut-off value for said protein; and - determining a classification of the presence or absence of, or response to therapy against, an ovarian cancer in said woman based on their being either or both of: (i) at least one molecules of said cell-free 30 DNA comprising one or more said methylated and/or un-methylated Cst (as applicable), and/or comprising one or more said pattern of methylation or hylation, located within one or more of said nucleotide sequences; and/or (ii) an amount of said protein(s) present in said blood sample is greater than said standard or f value for such amount or protein. 35 67. A use of a nucleic acid sequences of any one of claims 48 to 50 and/or a nucleic acid probes of any one of claims 51 to 53 and/or a primer pair of claim 54 or 55 and/or a plurality of nucleic acids of claim 56 or 57 and/or a kit of claim 58 or 59 and/or a computer program t of any one of claims 60 to 66, in each case for determining the presence or absence of, or response to therapy t, an ovarian cancer in a woman. Ezhmm £2 3% mfiafi E mmgfimm m £ng gnwmmg $83“. “WEE” Egg gaxu mmmgcw sagas": cymimm Emma; 3 “imam 3% Ruiz “mm w fiég 3%, 393m m 3%. fifiwm gnaw 339$. mmfigau fimfimumam ”3&5 «55%? gamma «$5 figmfigwm mzmfimfizugfi ymmmé E E33 m 33$ WW 33$ mmgfi magi flags, 3» ”Em ”Egg 3%: gas, §§$ “wag ”33% Emmfiawéez flfigfia Emigm 33% Ma»; 53mm E m E33 m 5 Shmm Em Kwaé fignggg fig Emfié gwwhgfl fiaéggfigm fimfifi Exam?” £3212“? 9?me 3% an: figfiafi hamnmuwmu m www-mm wmmi “33%”ng 3““ch wmfiwgu mfifizm :9 3&3”,ng mmgm gawkmbfl «$3 fig 3 Em w Egg fix ,» gag Ewfimm 3» wwm ymw 3W ”afifimm Eu. fi, :wvmé fimmmmm «53a Eghwm 3mm 3% figmfi Smumfiwam «Ema. gags figs.» $3 “mm $33 fifii a, mg... mmmx mg: cwgm twggmfiéaz figé gumbmggm gag mmmg géfig "fig figgw fifififim £333 ”3me 5. igaumfi Eucmu mmEQ “g mafia ma mmfiga ammumam v.33 £5334 wymwmgmgzm Mmfimfi “35$ 35E; $5 F .3th Eggfi ME, “Em 3&3”;me mmmgg 3% cmmfifi Eéamfiencw mmmxg fig, gmiw wmxcxug $33me .9"— taughfi 8”ng $3, $3 xmmwé €me 3n: figgm SUBSTITUTE SHEET (RULE 26) :rz'r‘éé‘!"»'2=:w game‘s m’ylivmmg m, . ., .wfifi’s,‘~,’r§ Uneag‘gifiptvsfém: wwimga KGWCGWCCEWCG RRBS reads White Bland Celts (W8C) wag,“ :zahéiigiEEE‘,‘‘ ficwfalh .‘ ‘ meme - ‘"'~’~'~::-=n Mam azarzatvmzrw: . . , mmmmwmmmwwmmwmmmmwwmW Fatima,_ memy FWCWWW g QC WM: E 0105003 0%7 ‘ 0%“ ‘E “(300001? 49% 0% i ”HUN? (3% pvity 84 specifiaity filtering and ranking Fig.2 22.55 WWHEWW ymi‘mmg WW 5}; Wm {55% W " WW1; WWWWWW iW flfl’fiflgfid WWW EiWWW KNEW WWWW M5 5 WWWWWW 53W?WWW 3W “:2: "I? {3% W? WWWWW QWWWWW Q‘WWKW r-WWWW £55 WWt‘iWWW W5 QMWWWE WWWWWMKWWWWEK WWWWWW‘WWWWY‘W 3%: 5‘ atgg‘g W ”*2Vita 1*; fiafiwm Wmmww 00 93% M:x~4--rw.v/wfl~w¢ WmmwmammwinVWRWWWmtmmm»mWmmMWxmummmfimmwmvmwuwwmmmw»mkmwmwammvmmmm mmmm Pattam date-mm arid quantifimfim A B 0.100 *** *** ** ns * HS 0030 *** *** *** n5 * n5 E 3'3033. g g-ggg 0'025 E 0'01"" 02015“ e E a.» 4 E _ 0.010? 4% 0.000- E ‘3; e % s "-006 g 3 ‘6 5 “ 0.005.: % 0.004~ 0 a; ,4 a E m; .5 ‘— 'T' , = 0.002 a ‘ Vs . v a; S « a: V 0.000 ‘_ _"'"'" 1970‘: IE 0.000 ‘ ~ “291"” 4 ‘ H BPM BOT NET 00M NHGS HGS H BPM BOT NET OCM NHGS HGS (n=119lln=27) (5) (n=37) (n=121 ("=29) (n=21)(n=119)(n=27) (5) (n=37) (n=12)(n=29) C D 0.04}0.06- * ns ns ns ns sooo *** *** '15 ** *** "S g 7000] 3 1 g 0.003 4 ‘g i E 3000 E § . W “ 0% 0.002 ":5 5 2000 - N __ 4 < % i U 1 "'0‘" E. 1000 9 4 .__. m g , a“ I. J; _ I. ,“ .9 H BPM BOT NET 00M NHGS HGS H BPM BOT NET 0cm NHGS HGS ("=21)(n=119)(n=27l (5) (FM ln=12)(n=29l (n=21)(n=119)(n=27) (5) (n=37) (n=29) Specificity Sensitivity CA125(cut-off35|UImL) 122/140 (87.1%:95%C| 00.1-92.0%) 24129 (82.8%:95%C| 63.5-93.5%) Three DNAme-Marker Panel (thresholds based on Sets 1 & 2) 127/140 (90.7%:95%C| 84.3—94.8%) 12I29 (41 .4%:95%C| 24.1—60.9%) Three Marker Panel “Set 2 & 3 173/194 (91.8%:95%Cl Bar—95.1%) 28I48 (58.3%:95%C| 43.2—72.1%) (thresholds based on Sets 1, 2 & 3) H & BPM HGS CA125 negative CA125 positive CA125 negative CA125 positive Three DNAme-Marker negative 108 13 4 9 Panel (new thresholds) positive 14 0 1 15