NZ794663A

NZ794663A - Serpina1 iRNA compositions and methods of use thereof

Info

Publication number: NZ794663A
Application number: NZ794663A
Authority: NZ
Inventors: Christopher Brown; Klaus Charisse; Kevin Fitzgerald; Donald Foster; Vasant R Jadhav; Maja Janas; Muthusamy Jayaraman; In Alexander V Kel; Martin A Maier; Muthiah Manoharan
Original assignee: Alnylam Pharmaceuticals Inc
Priority date: 2016-11-23
Filing date: 2017-11-21
Publication date: 2022-11-25

Abstract

The invention relates to RNAi agents, e.g., double stranded RNAi agents, targeting the Serpina1 gene, and methods of using such RNAi agents to inhibit expression of Serpina1 and methods of treating subjects having a Serpina1 associated disease, such as a liver disorder.

Description

The invention relates to RNAi agents, e.g., double stranded RNAi agents, targeting the Serpina1 gene, and methods of using such RNAi agents to inhibit expression of Serpina1 and methods of treating subjects having a Serpina1 associated e, such as a liver disorder.

NZ 794663 SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF Related Applications This application claims the t of priority to U.S. Provisional Application No. ,907 (Attorney Docket No. 0PRO1), filed on November 23, 2016; U.S.

Provisional Application No. 62/548,589 (Attorney Docket No. ALN-260PRO2), filed on August 22, 2017; U.S. Provisional Application No. 62/549,099 (Attorney Docket No. ALN- 1), filed on August 23, 2017; and U.S. Provisional Application No. 62/561,514 (Attorney Docket No. ALN-260PRO3), filed on September 21, 2017. The entire contents of each of the foregoing applications are hereby incorporated herein by reference.

This application is related to U.S. ional ation No. 61/826,125, filed on May 22, 2013, U.S. Provisional Application No. 61/898,695, filed on November 1, 2013; U.S. Provisional Application No. 61/979,727, filed on April 15, 2014; U.S. Provisional Application No. 61/989,028, filed on May 6, 2014; U.S. Patent Application No. 14/284,745, now issued as U.S. Patent No. 9,574,192, issued on February 21, 2017; U.S. Patent Application No. 15/399,820, filed on January 6, 2017; and International Patent Application No. , filed on May 22, 2014. The entire contents of each of the foregoing applications are hereby incorporated herein by reference.

The present application is a divisional application of New Zealand Application No. 753666, the entirety of which is orated herein by reference.

Sequence Listing The instant application contains a Sequence g which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on November 16, 2017, is named 121301-07820_SL.txt and is 129,236 bytes in size.

Background of the Invention Serpinal encodes 1-antitrypsin which predominantly complexes with and inhibits the activity of neutrophil elastase produced by hepatocytes, mononuclear monocytes, alveolar macrophages, enterocytes, and myeloid cells. Subjects having ions in one or both copies of the Serpinal gene may suffer from alphaantitrypsin deficiency and are at risk of ping pulmonary emphysema and/or c liver disease due to greater than normal elastase activity in the lungs and liver.

In affected subjects, the ency in alphaantitrypsin is a deficiency of wild-type, functional alphaantitrypsin. In some cases, a subject having a variation in one or both copies of the Serpina1 gene is carrying a null allele. In other cases, a subject having a ion in one or both copies of the Serpina1 gene is carrying a deficient allele.

For example, a subject having a deficient allele of Serpinal, such as the P12 allele, may be producing misfolded proteins which cannot be properly transported from the site of synthesis to the site of action within the body. Such subjects are typically at risk of developing lung and/or liver disease. Subjects having a Serpinal null allele, such as the PINULL(Granite Falls), are typically only at risk of developing lung e.

Liver disease resulting from alpha—l antitrypsin deficiency is the result of variant forms of alpha—l—antitypsin produced in liver cells which misfold and are, thus, not readily transported out of the cells. This leads to a buildup of misfolded protein in the liver cells and can cause one or more diseases or disorders of the liver including, but not limited to, chronic liver disease, liver ation, cirrhosis, liver fibrosis, and/or cellular carcinoma.

There are currently very limited options for the treatment of ts with liver disease arising from alpha—l—antitrypsin deficiency, ing tis vaccination, supportive care, and avoidance of injurious agents (e.g., l and NSAIDs). Although replacement alpha— l—antitrypsin therapy is available, such treatment has no impact liver disease in these subjects and, although liver transplantation may be effective, it is a difficult, expensive and risky procedure and liver organs are not readily available.

Accordingly, there is a need in the art for effective treatments for Serpinal—associated es, such as a chronic liver e, liver inflammation, cirrhosis, liver fibrosis, and/or hepatocellular carcinoma.

Summary of the Invention As described in more detail below, disclosed herein are compositions comprising agents, e.g., RNAi agents, e.g., double stranded iRNA agents, targeting Serpinal. Also disclosed are methods using the itions of the invention for inhibiting Serpinal expression and for treating Serpinal ated diseases, e.g., chronic liver disease, liver inﬂammation, cirrhosis, liver fibrosis, and/or hepatocellular carcinoma.

The present invention is based, at least in part on the discovery of effective nucleotide or chemical motifs for dsRNA agents ing Serpinal which are advantageous for tion of target gene expression, while having reduced off—target gene silencing effects, as well as compositions comprising such agents suitable for therapeutic use. More specifically, it has been discovered inter alia that dsRNA agents targeting Serpinal where the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i.e., at position 2—9 of the 5’—end of the nse strand, counting from the 5'— end) and/or the dsRNA agent has a melting temperature in the range of from about 40°C to about 80°C can be more effective in mediating RNA interference than a parent dsRNA agent lacking the ilizing modification.

Accordingly, in one aspect, the present invention provides a double stranded RNA (dsRNA) agent that inhibits sion of a serine peptidase inhibitor, clade A, member 1 (Serpinal) target gene sequence, comprising a sense strand and an antisense strand, wherein the antisense strand has sufficient complementarity to the target sequence to mediate RNA interference, wherein said antisense strand comprises at least one thermally destabilizing modification within the first 9 nucleotide ons of the 5' region or a precursor thereof, wherein said sense strand comprises an asialoglycoprotein receptor (ASGPR) ligand, and wherein each of the sense strand and the antisense strand are independently 14 to 40 nucleotides in length.

In another aspect, the present invention provides a double stranded RNA (dsRNA) agent that inhibits expression of a serine peptidase inhibitor, clade A, member 1 (Serpinal) gene, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides ing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 1, and the antisense strand ses at least 15 contiguous tides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 15, wherein said antisense strand comprises at least one thermally ilizing modification of the double stranded region within the first 9 nucleotide positions of the 5' region or a precursor thereof, wherein said sense strand comprises an glycoprotein receptor (ASGPR) , and wherein each of the sense strand and the antisense strand are independently 14 to 40 nucleotides in length.

In yet r aspect, the present invention provides a double stranded RNA (dsRNA) agent that inhibits expression of a serine peptidase inhibitor, clade A, member 1 (Serpinal) gene, comprising a sense strand and an antisense strand forming a double stranded region, said antisense strand comprising a region of complementarity to an mRNA encoding Serpinal, wherein the region of complementarity ses at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide ce of SEQ ID NO: 15, wherein said antisense strand ses at least one thermally destabilizing cation within the first 9 nucleotide positions of the 5' region or a precursor thereof, wherein said sense strand comprises an asialoglycoprotein receptor ) ligand, wherein each of the sense strand and the antisense strand are independently 14 to 40 nucleotides in length.

In one ment, the dsRNA agent comprises at least four nucleotides comprising a ro modification.

In one embodiment, the dsRNA agent has the following characteristics: a) the thermally destabilizing modification is located in position 4—8 of the 5' region of the antisense strand; b) and each of the sense and antisense strands independently comprise at least two nucleotides comprising a 2’—ﬂuoro modification; and c) an ASGPR ligand ed to either end of the sense strand.

In another embodiment, the nse strand has at least two of the ing characteristics: a) the thermally destabilizing modification is located in position 4 to 8 of the antisense strand; b) at least two nucleotides comprise a 2’—ﬂuoro modification; c) a phosphorothioate internucleotide linkages n nucleotide positions 1 and 2 (counting from the 5’ end); d) a length of 18 to 35 nucleotides.

In one embodiment, the sense strand has at least one of the following characteristics: a) the ASGPR ligand attached to either end of the sense strand; b) at least two nucleotides comprise a 2’—ﬂuoro modification; c) the sense strand and the antisense strand form a double stranded region spanning at least 19 nucleotide positions and wherein the lly destabilizing modification is located within said double stranded region.

In one embodiment, the thermally destabilizing modification is selected from the group ting of £\O/\’; Sic/NEE: B Sic/NJ 0?; and , , 7 W4" 0:9: n B is nucleobase.

In one embodiment, the destabilizing modification is located in position 7 of the antisense strand.

In one embodiment, the ASGPR ligand is one or more GalNAc derivatives attached through a bivalent or ent branched linker.

In one embodiment, the ASGPR ligand is: In one embodiment, the dsRNA agent is conjugated to the ligand as shown in the following schematic (I) OH HO OH HO 0H O H o H\/\/ WH N HOAcHN M o o o o 0 HO%0 N’V‘N o AcHN WH H wherein X is O or S.

In one aspect, the present invention es a double stranded RNA (dsRNA) agent that inhibits expression of a serine peptidase inhibitor, clade A, member 1 nal) target gene sequence, comprising a sense strand and an antisense strand, n the antisense strand has sufficient mentarity to a target sequence to mediate RNA interference, wherein the nse strand comprises at least one thermally ilizing modification within the first 9 nucleotide positions of the 5' region, wherein each of the sense strand and the antisense strand are independently 14 to 40 nucleotides in , and wherein the dsRNA has a melting temperature of from about 40°C to about 80°C.

In another aspect, the t invention es a double stranded RNA (dsRNA) agent that inhibits expression of a serine peptidase inhibitor, clade A, member 1 (Serpinal) target gene ce, comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 1, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:15, wherein the antisense strand comprises at least one lly destabilizing modification within the first 9 nucleotide positions of the 5' region, wherein each of the sense strand and the nse strand are independently 14 to 40 nucleotides in length, and wherein the dsRNA has a melting temperature of from about 40°C to about 80°C.

In yet another aspect, the present invention provides a double stranded RNA (dsRNA) agent that inhibits expression of a serine peptidase inhibitor, clade A, member 1 (Serpinal) target gene ce, comprising a sense strand and an antisense strand, said antisense strand comprising a region of complementarity to an mRNA encoding Serpinal, wherein the region of complementarity comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:15, wherein the antisense strand comprises at least one thermally destabilizing modification within the first 9 nucleotide positions of the 5' region, wherein each of the sense strand and the antisense strand are ndently 14 to 40 nucleotides in , and wherein the dsRNA has a melting temperature of from about 40°C to about 80°C.

In one embodiment, the dsRNA agent has a g temperature of from about 55°C to about 67°C. In another embodiment, the dsRNA agent has a melting temperature of from about 60°C to about 67°C.

In one embodiment, the dsRNA agent further comprises an asialoglycoprotein receptor (ASGPR) ligand.

In one embodiment, the ASGPR ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

In one ment, the ASGPR ligand is: HO 0WYHN/\/\N o AcHN H In one embodiment, the dsRNA agent is conjugated to the ligand as shown in the following schematic wherein X is O or S.

In one embodiment, the dsRNA agent further has at least one of the following characteristics: (i) the antisense strand comprises 2, 3, 4, 5 or 6 nucleotides comprising a 2’— ﬂuoro modifications (ii) the antisense strand comprises 1, 2, 3 or 4 phosphorothioate intemucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 nucleotides comprising a 2’—ﬂuoro modification; (v) the sense strand comprises 1, 2, 3 or 4 orothioate internucleotide linkages; (vi) the dsRNA comprises at least four tides comprising a 2’—ﬂuoro modification; (vii) the dsRNA comprises a double stranded region region of 12—40 nucleotide pairs in length; and (viii) a blunt end at 5’end of the antisense strand.

In some embodiment, each strand of the dsRNA agent may have 15—30 nucleotides, 19—30 tides; or the sense strand may have 21 nucleotides, and the antisense strand may have 23 nucleotides.

In one embodiment, the antisense strand comprises a region of complementarity comprising at least 15 uous tides differing by no more than 3 nucleotides from nucleotides 1440—1480 of SEQ ID NO:1; or nucleotides 1441—1479 of SEQ ID NO:1; or nucleotides 1442—1478 of SEQ ID NO:1; or nucleotides 1443—1477 of SEQ ID NO:1; or nucleotides 1444—1476 of SEQ ID NO:1; or nucleotides 1445—1475 of SEQ ID NO:1; or nucleotides 1446—1474 of SEQ ID NO:1; or nucleotides 1447—1473 of SEQ ID NO:1; or nucleotides 1448—1473 of SEQ ID NO:1; or tides 1448—1472 of SEQ ID NO:1; or nucleotides 1448—1471 of SEQ ID NO:1; or nucleotides 1448—1470 of SEQ ID NO:1; or nucleotides 1447—1469 of SEQ ID NO:1; or nucleotides 1446—1478 of SEQ ID NO:1; or nucleotides 1449—1471 of SEQ ID NO:1; or nucleotides 472 of SEQ ID NO:1; or nucleotides 1440—1475 of SEQ ID NO:1; or nucleotides 1445—1480 of SEQ ID NO:1; or nucleotides 1445—1475 of SEQ ID NO:1.

In one embodiment, the region of complemntarity comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence 5’ — UUUUGUUCAAUCAUUAAGAAGAC — 3’ (SEQ ID NO: 419).

In one embodiment, the sense strand comprises the nucleotide sequence 5’ — CUUCUUAAUGAUUGAACAAAA — 3’ (SEQ ID NO: 417) and the antisense strand comprises the nucleotide sequence 5’ — UUUUGUUCAAUCAUUAAGAAGAC — 3’ (SEQ ID NO: 419).

In one embodiment, the sense strand comprises the nucleotide sequence ’ — csusucuuAfanGfAfuugaacaaaa — 3’ (SEQ ID NO: 33) and the antisense strand comprises the nucleotide sequence 5’ — usUfsuugu(Tgn)caaucanuAfagaagsasc — 3’ (SEQ ID NO: 34), wherein a, g, c, and u are ethyl (2'—OMe) A, G, C, and U, respectively; Af, Gf, Cf and Uf are 2'—ﬂuoro A, G, C and U, respectively; s is a phosphorothioate linkage; and (Tgn) is a thymidine—glycol nucleic acid (GNA) S—Isomer.

In one aspect, the present invention provides a double ed RNA (dsRNA) molecule that inhibits expression of a serine peptidase inhibitor, clade A, member 1 nal) gene, comprising a sense strand and an antisense strand forming a double ed region, wherein the sense strand comprises the nucleotide sequence 5’ — csusucuuAfanGfAfuugaacaaaaL96 — 3’ (SEQ ID NO: 35) and the antisense strand comprises the nucleotide ce 5’ — usUfsuugu(Tgn)caaucanuAfagaagsasc — 3’ (SEQ ID NO: 34), wherein a, g, c, and u are 2'—O—methyl (2'—OMe) A, G, C, and U, respectively; Af, Gf, Cf and Uf are ro A, G, C and U, respectively; s is a phosphorothioate linkage; (Tgn) is a thymidine—glycol nucleic acid (GNA) S—Isomer; and L96 is N—[tris(GalNAc—alkyl)— amidodecanoyl)]—4—hydroxyprolinol.

In one aspect the ion provides a dsRNA agent that inhibits expression of a serine peptidase inhibitor, clade a, member 1 (Serpinal) gene, comprising a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a target Serpinal ce, e.g., nucleotides 480 of SEQ ID NO: 1, to mediate RNA interference and wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i. e. , at position 2—9 of the 5’—end of the antisense strand, counting from the 5'—end), and the dsRNA further has at least one (e.g., one, two, three, four, five, six seven, eight or all nine) of the following characteristics: (i) a melting temperature (Tm) of from about 40°C to about 80°C; (ii) the antisense ses 2, 3, 4, 5 or 6 2’—fluoro modifications; (iii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iv) the sense strand is conjugated with a ligand; (v) the sense strand comprises 2, 3, 4 or 5 2’—fluoro modifications; (vi) the sense strand ses 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (vii) the dsRNA comprises at least four 2’—ﬂuoro modifications; (viii) the dsRNA comprises a duplex region of 12—40 nucleotide pairs in length; and (ix) a blunt end at 5’end of the antisense strand.

In some ments, the invention provides a a dsRNA agent that inhibits expression of a serine peptidase inhibitor, clade a, member 1 (Serpinal) gene, comprising a sense strand and an nse strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a target Serpinal ce, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA erence and wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i. e., at position 2—9 of the 5’—end of the antisense strand, counting from the 5'—end), and the dsRNA further has at least one (e.g., one, two, three, four, five, six seven, eight or all nine) of the ing characteristics: (i) a melting ature (Tm) of from about 40°C to about 80°C; (ii) the antisense comprises 6, 7, 8, 9, 10, ll or 12 2’—OMe cations; (iii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iv) the sense strand is conjugated with a ligand; (v) the sense strand comprises 6, 7, 8, 9, 10, ll or 12 2’—OMe modifications; (vi) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (vii) the dsRNA ses at least 1, 2, 3, 4 or 5 2’—deoxy modification(s); (viii) the dsRNA ses a duplex region of 12—40 nucleotide pairs in length; and (ix) a blunt end at 5’end of the antisense strand.

In some embodiments, the dsRNA has a melting temperature with a lower end of the range from about 40°C, 45°C, 50°C, 55°C, 60°C or 65°C, and upper end of the arranger from about 70°C, 75°C or 80°C. In some embodiments, the dsRNA has a melting temperature in the range from about 55°C to about 70°C. In some embodiments, the dsRNA has a melting temperature in the range from about 57°C to about 67°C. In some particular embodiments, the dsRNA has a melting ature in the range from about 60°C to about 67°C. In some additional embodiments, the dsRNA has a melting temperature in the range from about 62°C to about 66°C.

It has also ben ered that dsRNA agents having a melting temperature of at least 60°C are more effective in vivo and in vitro. Thus, in some embodiments, the dsRNA has a melting temperature of at least 60°C.

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a target al sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference and wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i. e., at position 2—9 of the 5’—end of the antisense strand, counting from the 5'—end), the dsRNA has a melting temperature (Tm) of from about 40°C to about 80°C, and the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—ﬂuoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 orothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—ﬂuoro modifications; (v) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide es; (vi) the dsRNA comprises at least four 2’—ﬂuoro modifications; (vii) the dsRNA comprises a duplex region of 12—40 nucleotide pairs in length; and (viii) a blunt end at 5’end of the antisense strand.

In some embodiments, the dsRNA agent has a duplex region of 12—40 nucleotide pairs in length, wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i. e., at position 2—9 of the 5’—end of the nse strand, counting from the 5'—end), and the dsRNA has a Tm of from about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following teristics: (i) the antisense comprises 2, 3, 4, or 6 2’—fluoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 orothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand ses 2, 3, 4 or 5 2’—fluoro modifications; (v) the sense strand ses 1, 2, 3 or 4 phosphorothioate internucleotide es; (vi) the dsRNA comprises at least four 2’—ﬂuoro modifications; and vii) a blunt end at 5’end of the antisense strand.

In some embodiments, the dsRNA agent has a duplex region of 19, 21, 22 or 23 nucleotide base pairs in length, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex d in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the antisense strand), and wherein the dsRNA has a melting temperature of about 40°C to about 80°C.

In some embodiments, the dsRNA agent has a duplex region of 19, 21, 22 or 23 nucleotide base pairs in length, n the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the antisense strand), and wherein the dsRNA has a melting temperature of about 40°C to about 80°C (e.g., 40°C, 50°C, 60°C, 70°C or 80°C).

In some particular embodiments, the thermally destabilizing modification of the duplex is at position 5, 6, 7, or 8 of the nse strand, counting from 5’—end of the nse strand.

In some particular embodiments, the thermally destabilizing modification of the duplex is at position 6 of the antisense strand, counting from 5’—end of the antisense strand.

In some particular embodiments, the thermally destabilizing modification of the duplex is at position 7 of the antisense strand, counting from 5’—end of the antisense .

In some embodiments, the dsRNA agent comprises a sense strand and an antisense , each strand haVing 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to e RNA interference and n the antisense strand ses at least one thermally destabilizing modification of the duplex within the seed region (i. e., at position 2—9 of the 5’—end of the antisense strand, counting from the 5'—end), wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and the antisense strand further comprises one or both of the ing characteristics: (i) 2, 3, 4, 5 or 6 2’—fluoro modifications; and (ii) 1, 2, 3 or 4 phosphorothioate internucleotide linkages; and the sense strand comprises one, two or three of the ing characteristics: (i) a ligand conjugated with the sense ; (ii) 2, 3, 4 or 5 2’—fluoro modifications; and (iii) 1, 2, 3 or 4 phosphorothioate internucleotide linkages.

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand haVing 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference and wherein the antisense strand comprises at least one lly destabilizing modification of the duplex within the first 9 nucleotide positions counting from the 5'—end, and a ligand is conjugated with the sense strand, and n the dsRNA has a melting temperature of about 40°C to about 80°C.

In some embodiments, the dsRNA agent ses a sense strand and an antisense strand, each strand haVing 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a al target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference and wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions counting from the 5'—end, a ligand is conjugated with the sense strand, and the dsRNA comprises at least four 2’—ﬂuoro modifications.

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand haVing 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target ce, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to e RNA interference, wherein the dsRNA comprises at least four 2’—fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5’—end, said sense strand comprises a ligand, and wherein the dsRNA has a melting temperature of about 40°C to about 80°C. In some further ments of this, the ligand is an ASGPR ligand.

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 tides, wherein the antisense strand has sufficient complementarity to a Serinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference, wherein said antisense strand comprises at least one thermally ilizing modification of the duplex located in position 4—8, counting from the 5’—end, wherein said sense strand comprises a ligand, wherein each of the sense and antisense strands comprise at least two 2’—ﬂuoro modifications, and n the dsRNA has a melting temperature of about 40°C to about 80°C. In some further embodiments of this, the ligand is an ASGPR ligand.

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference, wherein the dsRNA comprises at least four 2’—fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 tide positions, counting from the 5’—end, and wherein said sense strand comprises a ligand, wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the nse further comprises at least two of the following characteristics: (i) the thermally destabilizing modification of the duplex is located in position 4 to 8 of the antisense strand; (ii) at least two 2’—fluoro modifications; (iii) orothioate ucleotide linkages between nucleotide positions 1 and 2 (counting from the 5’ end); and antisense strand has a length of 18 to 35 tides. In some further ments the ligand is an ASGPR ligand.

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has ient complementarity to a al target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference, wherein the dsRNA ses at least four 2’—fluoro, wherein said antisense strand comprises at least one thermally destabilizing cation of the duplex within the first 9 nucleotide positions, counting from the 5’—end, and wherein said sense strand comprises a ligand, wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and the sense strand has at least one of the following teristics: (i) the ligand is attached to either end of the sense strand; (ii) sense strand comprises at least two 2’— ﬂuoro modifications; and (iii) the sense strand and the antisense strand show sufficient complementarity to form a double stranded region spanning at least 19 nucleotide positions and wherein the thermally destabilizing modification of the duplex is located within said double stranded region.

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 tides, wherein the nse strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 480 of SEQ ID NO: 1, to mediate RNA interference, wherein the dsRNA comprises at least four 2’—fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 tide positions, counting from the 5’—end, and wherein said sense strand comprises a ligand, wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the thermally destabilizing modification of the duplex is selected from the group ting of: B 0V B 5510",? \[* NH {:10/\,Q/ 0:9 . 9 . 0:: B £0 1°/o * 310% 0?; and , , 7 W4" 0:9: wherein B is a modified or unmodified nucleobase and the asteric on each stucture represents either R, S or racemic..

In some embodiments, the dsRNA agent ses a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to e RNA interference, wherein said nse strand comprises at least one thermally destabilizing modification of the duplex located in position 4—8, counting from the 5’—end, wherein said sense strand comprises a ligand, and wherein each of the sense and antisense strands comprise at least two 2’—fluoro modifications, wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and n the thermally destabilizing modification of the duplex is selected from the group consisting of: 0?; and , , 7 W4" 0:9: wherein B is a modified or unmodified nucleobase and the asteric on each stucture represents either R, S or racemic..

In some ments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, n the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference, wherein the dsRNA comprises at least four 2’—fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex located at position 7, counting from the 5’—end of the antisense strand, wherein said sense strand ses a , and wherein the dsRNA has a melting temperature of about 40°C to about 80°C.

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference, wherein said antisense strand comprises at least one thermally destabilizing cation of the duplex located at position 7, ng from the , wherein said sense strand comprises a ligand, and wherein each of the sense and antisense strands comprise at least two 2’—fluoro modifications, wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the thermally destabilizing cation of the duplex is selected from the group consisting of: 0?; and , , 7 W4" 0:9: wherein B is a modified or unmodified nucleobase and the asteric on each stucture ents either R, S or racemic.

In some ments, the dsRNA agent ses a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference, n the dsRNA comprises at least four 2’—fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the , wherein said sense strand comprises a ligand, wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the ligand ses one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 tides, wherein the antisense strand has sufficient complementarity to a Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference, wherein the dsRNA comprises at least four 2’—fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5’—end, and wherein said sense strand comprises a ligand, wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the ligand is an ASGPR ligand of structure: O H H HO O\/\/\n/N\/\/N In some embodiments, the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one thermally destabilizing tide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the nse strand); n the sense strand is conjugated with a ligand, comprises 3 or 4 2’—ﬂuoro modifications, and comprises 0, 1 or 2 phosphorothioate cleotide linkages; wherein the antisense strand comprises 3, 4, 5 or 6 2’—ﬂuoro modifications, comprises 2, 3 or 4 phosphorothioate internucleotide linkages; wherein the dsRNA has a melting ature of about 40°C to about 80°C; and wherein the dsRNA optionally further has at least one (e.g., one, two or all three) of the following characteristics: (i) the dsRNA comprises a duplex region of 12—25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5’—end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3’—end of the antisense strand.

In some embodiments, the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 tides in length; the antisense strand ns at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the antisense strand); wherein the sense strand is conjugated with a ligand, comprises 2’—ﬂuoro modifications at positions 7, 10 and 11 or at positions 7, 9, 10 and 11 (counting from 5 ’—end of the sense strand), and optionally ses phosphorothioate internucleotide linkages n nucleotide positions 1 and 2, and between nucleotide positions 2 and 3; wherein the antisense strand comprises 3, 4, 5 or 6 2’—fluoro cations, ses 2, 3 or 4 phosphorothioate intemucleotide linkages; wherein the dsRNA has a melting temperature of about 40°C to about 80°C; and wherein the dsRNA optionally further has at least one (e.g., one, two or all three) of the following characteristics: (i) the dsRNA comprises a duplex region of 12—25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5’—end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3’—end of the antisense strand.

In some embodiments, the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in ; the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing tide is in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the antisense strand); wherein the sense strand is conjugated with a ligand, comprises 3 or 4 2’—ﬂuoro modifications, and comprises 0 or 2 phosphorothioate internucleotide linkages; wherein the nse strand ses 2’—ﬂuoro modifications at positions 2, 6, 8, 9, 14 or 16, or at positions 2, 6, 14 or 16, or at ons 2, 14 and 16; and the antisense ses phosphorothioate internucleotide linkages between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23; wherein the dsRNA has a melting temperature of about 40°C to about 80°C; and wherein the dsRNA ally further has at least one (e.g., one, two or all three) of the following characteristics: (i) the dsRNA comprises a duplex region of 12—25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5’—end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3’—end of the antisense strand.

In some embodiments, the sense and antisense strands are ndently 19, 20, 21, 22, 23, 24 or 25 tides in length; the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the antisense strand); wherein the sense strand is conjugated with a ligand, comprises 3 or 4 2’—ﬂuoro modifications, and comprises 0 or 2 phosphorothioate internucleotide linkages; wherein the antisense strand comprises 2’—ﬂuoro modifications at positions 2, 6, 8, 9, 14 or 16, or at positions 2, 6, 14 or 16, or at ons 2, l4 and 16; and the antisense comprises phosphorothioate internucleotide linkages between tide ons 21 and 22, between nucleotide positions 22 and 23, between nucleotide positions 1 and 2, between nucleotide positions 2 and 3; wherein the dsRNA has a melting temperature of about 40°C to about 80°C; and wherein the dsRNA optionally further has at least one (e.g., one, two or all three) of the following characteristics: (i) the dsRNA comprises a duplex region of 12—25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5’—end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3’—end of the antisense .

In some embodiments, the sense and nse strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one lly destabilizing nucleotide is in the seed region of the antisense strand (i.e., at on 2—9 of the 5’—end of the nse strand); wherein the sense strand is conjugated with a ligand, comprises 2’—ﬂuoro modifications at ons 7, 10 and ll or at positions 7, 9, 10 and ll (counting from 5 ’—end of the sense strand), and optionally comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3; wherein the antisense strand ses 2’—ﬂuoro modifications at positions 2, 6, 8, 9, 14 or 16, or at positions 2, 6, 14 or 16, or at positions 2, l4 and 16; and the antisense comprises phosphorothioate ucleotide linkages between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23; wherein the dsRNA has a melting temperature of about 40°C to about 80°C; and wherein the dsRNA optionally further has at least one (e.g., one, two or all three) of the following characteristics: (i) the dsRNA comprises a duplex region of 12—25 nucleotide pairs in ; (ii) the dsRNA comprises a blunt end at 5’—end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3’—end of the antisense strand.

In some embodiments, the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length, wherein the antisense strand contains at least one thermally destabilizing nucleotide, and where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i. e., at position 2—9 of the 5’—end of the antisense strand), wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following teristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—fluoro modifications; (ii) the nse comprises 1, 2, 3 or 4 phosphorothioate intemucleotide es; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—fluoro modifications; (V) the sense strand ses 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2’—ﬂuoro modifications; (vii) the dsRNA comprises a duplex region of 18, 19, 21, 22, 23, 24 or 24 nucleotide pairs in length; and (viii) the dsRNA comprises a blunt end at 5’—end of the sense strand. In some ular embodiments, sense strand is 19, 20 or 21 or 22 nucleotides in length and the antisense strand is 20, 21 or 22 nucleotides in length.

In some embodiments, the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one lly destabilizing nucleotide, where the at least one thermally destabilizing tide is in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the nse strand); wherein the sense strand is conjugated with a ligand, comprises 2’—ﬂuoro modifications at positions 7, 10 and 11 or at positions 7, 9, 10 and 11 (counting from 5 ’—end of the sense strand), and optionally comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3; wherein the nse strand comprises 2’—ﬂuoro modifications at positions 2, 6, 8, 9, 14 or 16, or at positions 2, 6, 14 or 16, or at positions 2, 14 and 16; and the nse ses phosphorothioate intemucleotide linkages between tide positions 21 and 22, between nucleotide positions 22 and 23, between nucleotide positions 1 and 2, between nucleotide positions 2 and 3; wherein the dsRNA has a melting temperature of about 40°C to about 80°C; and wherein the dsRNA optionally further has at least one (e.g., one, two or all three) of the following characteristics: (i) the dsRNA comprises a duplex region of 12—25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5’—end of the antisense ; and (iii) the dsRNA has at least a two nucleotide ng at the 3’—end of the antisense strand.

In some embodiments, one end of the dsRNA is a blunt end and the other end has an overhang, wherein the antisense strand contains at least one lly destabilizing nucleotide, and where the at least one lly destabilizing nucleotide is in the seed region of the antisense strand (i. e., at position 2—9 of the 5’—end of the antisense strand), wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense ses 2, 3, 4, 5 or 6 2’—ﬂuoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate intemucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—ﬂuoro cations; (V) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four ro modifications; (vii) and the dsRNA comprises a duplex region of 12—40 nucleotide pairs in length. In some embodiments, the overhang is on the 3’—end of the antisense strand and the blunt end is at the 5’—end of the antisense strand. In some particular embodiments, the overhang is 2, 3 or 4—nucleotides in length.

In some embodiments, the dsRNA agent has a duplex region of 19, 21, 22 or 23 nucleotide base pairs in length, wherein one end of the dsRNA is a blunt end and the other end has an overhang, n the antisense strand contains at least one thermally destabilizing modification of the duplex d in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the antisense strand), wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and n the dsRNA optionally further has at least one (e.g., one, two, three, five or all six) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—fluoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate cleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand ses 2, 3, 4 or 5 2’—ﬂuoro modifications; (v) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; and (vi) the dsRNA comprises at least four 2’—ﬂuoro modifications, and optionally the 2 tide overhang is on the 3’—end of the antisense strand and the blunt end is at the 5’—end of the antisense strand.

In some embodiments, the overhang is on the 3’—end of the antisense strand and the blunt end is at the 5’—end of the antisense strand.

In some embodiments, the dsRNA agent of the invention may also have two blunt ends, at both ends of the dsRNA duplex.

In some embodiments, the dsRNA has a blunt end at both ends of the duplex, wherein the antisense strand contains at least one thermally destabilizing nucleotide, and where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i. e., at position 2—9 of the 5’—end of the antisense strand), wherein the dsRNA has a g temperature of about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the ing characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—ﬂuoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—ﬂuoro modifications; (v) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four ro modifications; and (vii) the dsRNA ses a duplex region of 12—40 nucleotide pairs in length.

In some ments, the dsRNA agent has a duplex region of 19, 21, 22 or 23 nucleotide base pairs in length and has a blunt end at both ends of the duplex, wherein one end of the dsRNA is a blunt end and the other end has an overhang, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the antisense strand), wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and n the dsRNA optionally further has at least one (e.g., one, two, three, five or all six) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—ﬂuoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate intemucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand ses 2, 3, 4 or 5 2’—ﬂuoro modifications; (V) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; and (vi) the dsRNA comprises at least four 2’—fluoro modifications.

In some embodiments, the dsRNA agent of the invention comprises a 21 nucleotides (nt) sense strand and a 23 nucleotides (nt) antisense, wherein the antisense strand ns at least one thermally destabilizing nucleotide, where the at least one lly ilizing nucleotide occurs in the seed region of the antisense strand (i. e., at position 2—9 of the 5’—end of the antisense strand), n one end of the dsRNA is blunt, while the other end is comprises a 2 nt overhang, wherein the dsRNA has a melting ature of about 40°C to about 80°C, and wherein the dsRNA optinally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, or 6 2’—fluoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate intemucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—fluoro modifications; (v) the sense strand comprises 1, 2, 3 or 4 phosphorothioate ucleotide linkages; (vi) the dsRNA comprises at least four 2’—ﬂuoro modifications; and (vii) the dsRNA comprises a blunt end at 5’—end of the antisense strand.

Preferably, the 2 nt overhang is at the 3’—end of the antisense.

In some embodiments, the dsRNA agent of the invention sing a sense and nse strands, wherein: the sense strand is 25—30 nucleotide residues in length, wherein starting from the 5' terminal nucleotide (position 1), positions 1 to 23 of said sense strand comprise at least 8 ribonucleotides; antisense strand is 36—66 nucleotide residues in length and, starting from the 3' terminal tide, at least 8 ribonucleotides in the positions paired with positions 1— 23 of sense strand to form a duplex; wherein at least the 3 ' terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3' terminal nucleotides are unpaired with sense strand, thereby g a 3' single stranded ng of 1—6 nucleotides; wherein the 5' terminus of antisense strand comprises from 10— consecutive nucleotides which are unpaired with sense strand, thereby forming a 10—30 nucleotide single stranded 5' overhang; wherein at least the sense strand 5' terminal and 3' terminal nucleotides are base paired with tides of antisense strand when sense and antisense strands are aligned for maximum complementarity, thereby forming a substantially duplexed region between sense and antisense strands; and antisense strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of antisense strand length to reduce Serpinal target gene expression when said double stranded nucleic acid is uced into a mammalian cell; and wherein the antisense strand contains at least one thermally destabilizing nucleotide, where at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i. e. at on 2—9 of the 5’—end of the antisense ), and wherein the dsRNA has a melting temperature of about 40°C to about 80°C. For example, the thermally ilizing tide occurs between positions opposite or complimentary to ons 14—17 of the 5’—end of the sense strand, and wherein the dsRNA optinally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—ﬂuoro cations; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—ﬂuoro modifications; (V) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; and (vi) the dsRNA comprises at least four oro modifications; and (vii) the dsRNA comprises a duplex region of 12—30 nucleotide pairs in length.

In some embodiments, the dsRNA agent of the invention comprises a sense and antisense strands, wherein said dsRNA agent comprises a sense strand having a length which is at least 25 and at most 29 nucleotides and an antisense strand having a length which is at most 30 nucleotides with the sense strand comprises a modified nucleotide that is susceptible to enzymatic degradation at position ll from the 5’end, wherein the 3’ end of said sense strand and the 5’ end of said antisense strand form a blunt end and said antisense strand is 1—4 nucleotides longer at its 3’ end than the sense strand, wherein the duplex region which is at least 25 nucleotides in length, and said nse strand is sufficiently complementary to a l target mRNA along at least 19 nt of said antisense strand length to reduce target gene expression when said dsRNA agent is introduced into a mammalian cell, and wherein dicer cleavage of said dsRNA preferentially results in an siRNA comprising said 3’ end of said antisense strand, thereby reducing expression of the target gene in the mammal, wherein the antisense strand contains at least one lly destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (Le. at position 2—9 of the 5’—end of the nse strand), wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and n the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the nse comprises 2, 3, 4, 5 or 6 2’—fluoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—ﬂuoro modifications; (v) the sense strand comprises 1, 2, 3 or 4 phosphorothioate ucleotide linkages; and (vi) the dsRNA comprises at least four 2’—ﬂuoro modifications; and (vii) the dsRNA has a duplex region of 12—29 nucleotide pairs in length.

In some ments, the antisense strand comprises phosphorothioate intemucleotide linkages between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand ns at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i. e., at position 2—9 of the 5’—end of the antisense strand), n the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—ﬂuoro modifications; (ii) the antisense comprises 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—ﬂuoro modifications; (v) the sense strand comprises 1, 2, 3 or 4 phosphorothioate intemucleotide linkages; (vi) the dsRNA comprises at least four 2’—ﬂuoro modifications; (vii) the dsRNA ses a duplex region of 12—40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5’—end of the antisense strand.

In some embodiments, the antisense strand comprises phosphorothioate intemucleotide linkages between nucleotide positions 1 and 2, between nucleotide ons 2 and 3, between nucleotide ons 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing cation of the duplex located in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the antisense strand), n the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—fluoro cations; (ii) the sense strand is conjugated with a ligand; (iii) the sense strand ses 2, 3, 4 or 5 2’—fluoro modifications; (iv) the sense strand ses 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (v) the dsRNA comprises at least four 2’— ﬂuoro modifications; (vi) the dsRNA comprises a duplex region of 12—40 nucleotide pairs in length; (vii) the dsRNA comprises a duplex region of 12—40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5’—end of the antisense strand.

In some embodiments, the sense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between tide positions 2 and 3, wherein the nse strand ns at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the antisense strand), wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense ses 2, 3, 4, 5 or 6 2’—fluoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is ated with a ligand; (iv) the sense strand ses 2, 3, 4 or 5 2’—fluoro modifications; (V) the sense strand ses 3 or 4 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2’—ﬂuoro modifications; (vii) the dsRNA comprises a duplex region of 12—40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5’—end of the antisense strand.

In some embodiments, the sense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, the nse strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, n the nse strand contains at least one thermally destabilizing modification of the duplex d in the seed region of the antisense strand (i. e., at position 2—9 of the 5’—end of the nse strand), wherein the dsRNA has a melting temperature of about 40°C to about 80°C, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—ﬂuoro modifications; (ii) the sense strand is conjugated with a ligand; (iii) the sense strand comprises 2, 3, 4 or 5 2’—fluoro modifications; (iv) the sense strand comprises 3 or 4 phosphorothioate internucleotide linkages; (v) the dsRNA comprises at least four 2’—ﬂuoro modifications; (vi) the dsRNA comprises a duplex region of 12—40 nucleotide pairs in ; and (vii) the dsRNA has a blunt end at 5’—end of the nse strand.

In one aspect the invention provides a dsRNA agent capable of inhibiting the expression of a al target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, comprising a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the al target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference and wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i. e., at position 2—9 of the 5’—end of the antisense strand, counting from the 5'—end), and the dsRNA further has at least one (e.g., one, two, three, four, five, six seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—ﬂuoro modifications; (ii) the nse comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 ro modifications; (v) the sense strand comprises 1, 2, 3 or 4 orothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2’—ﬂuoro modifications; (vii) the dsRNA comprises a duplex region of 12—40 nucleotide pairs in length; and (viii) a blunt end at 5’end of the antisense strand.

In some particular embodiments, the thermally destabilizing modification of the duplex is at position 7 of the antisense strand, counting frm 5’—end of the antisense strand.

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 tides, wherein the antisense strand has ient mentarity to the target sequence to e RNA erence and wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i. e., at position 2—9 of the 5’—end of the antisense strand, counting from the 5'—end), and the antisense strand further comprises one or both of the following characteristics: (iii) 2, 3, 4, 5 or 6 2’—fluoro modifications; and (iv) 1, 2, 3 or 4 phosphorothioate internucleotide linkages; and the sense strand comprises one, two or three of the following characteristics: (iv) a ligand conjugated with the sense strand; (V) 2, 3, 4 or 5 2’—fluoro modifications; and (vi) 1, 2, 3 or 4 phosphorothioate internucleotide linkages.

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference and wherein the antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 tide ons counting from the 5'—end, and a ligand is conjugated with the sense strand.

In some embodiments, the dsRNA agent comprises a sense strand and an nse strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., tides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference and wherein the antisense strand comprises at least one thermally destabilizing cation of the duplex within the first 9 nucleotide positions counting from the 5'—end, a ligand is conjugated with the sense strand, and the dsRNA comprises at least four 2’—ﬂuoro modifications.

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has ient complementarity to the Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to e RNA interference, wherein the dsRNA comprises at least four 2’—ﬂuoro, wherein said antisense strand ses at least one thermally destabilizing modification of the duplex within the first 9 tide positions, counting from the 5’—end, and wherein said sense strand comprises a ligand. In some further embodiments of this, the ligand is an ASGPR ligand.

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target ce, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex located in position 4—8, counting from the ’—end, wherein said sense strand comprises a ligand, and wherein each of the sense and nse s comprise at least two 2’—ﬂuoro modifications. In some further embodiments of this, the ligand is an ASGPR ligand.

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference, wherein the dsRNA comprises at least four 2’—ﬂuoro, wherein said antisense strand ses at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the , and wherein said sense strand comprises a ligand, and wherein the antisense further comprises at least two of the following characteristics: (i) the thermally destabilizing modification of the duplex is located in position 4 to 8 of the antisense strand; (ii) at least two 2’—fluoro modifications; (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2 (counting from the 5’ end); and antisense strand has a length of 18 to 35 nucleotides. In some further embodiments the ligand is an ASGPR ligand.

In some embodiments, the dsRNA agent ses a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has ient complementarity to the Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA erence, wherein the dsRNA comprises at least four ro, wherein said antisense strand comprises at least one lly destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5’—end, and wherein said sense strand comprises a , and the sense strand has at least one of the following characteristics: (i) the ligand is attached to either end of the sense strand; (ii) sense strand comprises at least two 2’—ﬂuoro modifications; and (iii) the sense strand and the antisense strand show sufficient complementarity to form a double ed region spanning at least 19 nucleotide positions and wherein the thermally destabilizing modification of the duplex is d within said double stranded region.

In some embodiments, the dsRNA agent comprises a sense strand and an nse strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference, n the dsRNA comprises at least four 2’—ﬂuoro, wherein said antisense strand comprises at least one lly destabilizing modification of the duplex within the first 9 nucleotide positions, counting from the 5’—end, and wherein said sense strand comprises a ligand, and wherein the thermally destabilizing modification of the duplex is selected from the group consisting of: 140V"? B ) b 0?; and , , 7 W4" 0:9: wherein B is a modified or unmodified nucleobase and the asteric on each stucture represents either R, S or racemic.

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to e RNA interference, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex located in position 4—8, counting from the ’—end, wherein said sense strand comprises a ligand, and n each of the sense and antisense strands se at least two 2’—ﬂuoro modifications, and wherein the thermally ilizing modification of the duplex is selected from the group consisting of: Sic/W; : B Etc/\J 0): , 9 , 0:: ‘qovﬁJ B 310% b 0:," and , "(m 0); wherein B is a modified or unmodified nucleobase and the asteric on each stucture represents either R, S or racemic.

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the nse strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference, n the dsRNA comprises at least four 2’—ﬂuoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex located at position 7, counting from the 5’—end of the antisense strand, and wherein said sense strand comprises a ligand.

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to the Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference, wherein said nse strand comprises at least one thermally destabilizing modification of the duplex located at position 7, counting from the 5’— end, n said sense strand comprises a , and wherein each of the sense and antisense strands comprise at least two 2’—ﬂuoro cations, and wherein the thermally destabilizing modification of the duplex is selected from the group consisting of: £\O/\’; Sic/NEE: B Sic/NJ 0:9 . 9 . 0:: 0?; and , , 7 W4" 0:9: wherein B is a modified or unmodified nucleobase and the asteric on each stucture represents either R, S or racemic..

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the nse strand has sufficient mentarity to a Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference, wherein the dsRNA ses at least four 2’—fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 tide positions, counting from the 5’—end, and wherein said sense strand ses a ligand, wherein the ligand comprsies one or more GalNAc derivatives attached through a bivalent or trivalent branched .

In some embodiments, the dsRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient mentarity to a Serpinal target sequence, e.g., nucleotides 1440—1480 of SEQ ID NO: 1, to mediate RNA interference, wherein the dsRNA comprises at least four 2’—fluoro, wherein said antisense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 tide positions, counting from the 5’—end, and wherein said sense strand comprises a ligand, wherein the ligand is an ASGPR ligand of structure: HO \/\/\n/ \/\/ In some embodiments, the sense and antisense s are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally ilizing nucleotide is in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the nse strand); wherein the sense strand is conjugated with a ligand, comprises 3 or 4 2’—ﬂuoro modifications, and comprises 0, l or 2 phosphorothioate intemucleotide linkages; wherein the antisense strand comprises 3, 4, 5 or 6 2’—ﬂuoro cations, comprises 2, 3 or 4 phosphorothioate internucleotide linkages; and wherein the dsRNA optionally further has at least one (e.g., one, two or all three) of the following characteristics: (i) the dsRNA comprises a duplex region of 12—25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at ’—end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3’—end of the antisense strand.

In some embodiments, the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the antisense strand); wherein the sense strand is conjugated with a ligand, ses 2’—ﬂuoro modifications at positions 7, 10 and ll or at positions 7, 9, 10 and ll (counting from 5 ’—end of the sense strand), and optionally comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide ons 2 and 3; wherein the antisense strand ses 3, 4, 5 or 6 2’—fluoro modifications, comprises 2, 3 or 4 phosphorothioate cleotide linkages; and n the dsRNA optionally further has at least one (e.g., one, two or all three) of the following characteristics: (i) the dsRNA ses a duplex region of 12—25 nucleotide pairs in ; (ii) the dsRNA comprises a blunt end at 5’—end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3’—end of the antisense strand.

In some embodiments, the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one thermally destabilizing tide, where the at least one lly destabilizing nucleotide is in the seed region of the antisense strand (i.e., at on 2—9 of the 5’—end of the antisense strand); wherein the sense strand is conjugated with a ligand, comprises 3 or 4 2’—ﬂuoro modifications, and comprises 0 or 2 phosphorothioate internucleotide linkages; wherein the antisense strand comprises 2’—ﬂuoro modifications at positions 2, 6, 8, 9, 14 or 16, or at positions 2, 6, 14 or 16, or at positions 2, 14 and 16; and the antisense comprises phosphorothioate internucleotide linkages between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23; and wherein the dsRNA optionally further has at least one (e.g., one, two or all three) of the following characteristics: (i) the dsRNA comprises a duplex region of 12—25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at ’—end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3’—end of the antisense strand.

In some embodiments, the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one thermally destabilizing tide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the antisense strand); wherein the sense strand is conjugated with a ligand, comprises 3 or 4 2’—ﬂuoro modifications, and comprises 0 or 2 phosphorothioate internucleotide linkages; wherein the antisense strand comprises 2’—ﬂuoro modifications at ons 2, 6, 8, 9, 14 or 16, or at positions 2, 6, 14 or 16, or at positions 2, 14 and 16; and the antisense comprises phosphorothioate internucleotide linkages between nucleotide positions 21 and 22, n nucleotide positions 22 and 23, between nucleotide positions 1 and 2, between nucleotide positions 2 and 3; and wherein the dsRNA ally further has at least one (e.g., one, two or all three) of the following characteristics: (i) the dsRNA comprises a duplex region of 12— nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5’—end of the nse strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3’—end of the antisense strand.

In some ments, the sense and antisense s are ndently 19, 20, 21, 22, 23, 24 or 25 tides in ; the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the antisense strand); wherein the sense strand is conjugated with a ligand, comprises 2’—ﬂuoro modifications at positions 7, 10 and 11 or at positions 7, 9, 10 and 11 (counting from 5 ’—end of the sense strand), and optionally ses phosphorothioate internucleotide es between tide positions 1 and 2, and between nucleotide positions 2 and 3; wherein the antisense strand comprises 2’—ﬂuoro modifications at positions 2, 6, 8, 9, 14 or 16, or at positions 2, 6, 14 or 16, or at positions 2, 14 and 16; and the antisense ses phosphorothioate ucleotide linkages between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23; and wherein the dsRNA optionally further has at least one (e.g., one, two or all three) of the following characteristics: (i) the dsRNA comprises a duplex region of 12— nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5’—end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3’—end of the nse strand.

In some embodiments, the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length; the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i.e., at on 2—9 of the 5’—end of the antisense strand); wherein the sense strand is ated with a ligand, comprises 2’—ﬂuoro modifications at ons 7, 10 and 11 or at positions 7, 9, 10 and 11 (counting from 5 ’—end of the sense ), and optionally comprises phosphorothioate ucleotide linkages between nucleotide positions 1 and 2, and between tide positions 2 and 3; wherein the antisense strand comprises 2’—ﬂuoro modifications at positions 2, 6, 8, 9, 14 or 16, or at positions 2, 6, 14 or 16, or at positions 2, 14 and 16; and the antisense comprises phosphorothioate internucleotide linkages between nucleotide positions 21 and 22, between nucleotide positions 22 and 23, n nucleotide positions 1 and 2, between nucleotide positions 2 and 3; and wherein the dsRNA optionally further has at least one (e.g., one, two or all three) of the following characteristics: (i) the dsRNA comprises a duplex region of 12—25 nucleotide pairs in length; (ii) the dsRNA comprises a blunt end at 5’—end of the antisense strand; and (iii) the dsRNA has at least a two nucleotide overhang at the 3’—end of the antisense strand.

In a particular embodiment, the dsRNA agents of the t ion se: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand attached to the 3’—end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; and (iii) 2’—F modifications at positions 7, 10, and 11 (counting from the 5’ end); and (b) an antisense strand : (i) a length of 23 nucleotides; (ii) 2’—F modifications at positions 2, 6 to 8, 9, 14, and16 (counting from the 5’ end); (iii) phosphorothioate internucleotide linkages between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); and (iv) a thermally destabilizing modification of the duplex at position 7 (counting from the 5’ end); wherein the dsRNA agents have a two nucleotide overhang at the 3’—end of the antisense strand, and a blunt end at the 5’—end of the antisense strand.

In another particular embodiment, the dsRNA agents of the present invention comprise: (a) a sense strand having: (0 a length of 21 nucleotides; (ii) an ASGPR ligand attached to the 3’—end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; (iii) 2’—F modifications at positions 7, 9, 10, and ll (counting from the 5’ end); and (W) phosphorothioate ucleotide linkages n nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); (b) an antisense strand having: (0 a length of 23 nucleotides; (ii) 2’—F modifications at positions 2, 6, l4, and 16 (counting from the 5’ end); (iii) phosphorothioate internucleotide linkages n nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); and (W) a thermally destabilizing modification of the duplex at position 7 ing from the 5’ end); wherein the dsRNA agents have a two tide overhang at the 3’—end of the antisense strand, and a blunt end at the 5’—end of the antisense strand.

In another ular embodiment, the dsRNA agents of the present invention comprise: (a) a sense strand having: (0 a length of 21 nucleotides; (ii) an ASGPR ligand attached to the , wherein said ASGPR ligand comprises three GalNAc tives attached h a trivalent branched linker; (iii) 2’—F modifications at positions 7, 9, 10, and ll ing from the 5’ end); and (W) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and n nucleotide positions 2 and 3 (counting from the 5’ end); (b) an antisense strand having: (0 a length of 23 nucleotides; (ii) 2’—F modifications at positions 2, l4, and 16 (counting from the 5’ end); (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between tide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); and (iv) a thermally destabilizing modification of the duplex at position 6 or 7 ing from the 5’ end); wherein the dsRNA agents have a two nucleotide overhang at the 3’—end of the antisense , and a blunt end at the 5’—end of the antisense strand.

In another particular embodiment, the dsRNA agents of the present invention comprise: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand attached to the 3’—end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; (iii) 2’—F modifications at positions 7, 9, 10, and ll (counting from the 5’ end); and (iv) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); (b) an antisense strand : (i) a length of 23 nucleotides; (ii) 2’—F modifications at positions 2, 6, 8, 9, l4, and 16 (counting from the 5’ end); (iii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between nucleotide positions 21 and 22, and between tide positions 22 and 23 (counting from the 5’ end); and (iv) a thermally destabilizing modification of the duplex at position 7 (counting from the 5’ end); wherein the dsRNA agents have a two nucleotide overhang at the 3’—end of the nse strand, and a blunt end at the 5’—end of the nse strand.

In another particular embodiment, the dsRNA agents of the present ion comprise: (a) a sense strand having: (i) a length of 21 nucleotides; (ii) an ASGPR ligand attached to the 3’—end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched ; (iii) 2’—F modifications at ons 7, 9, 10, and ll (counting from the 5’ end); and (iv) phosphorothioate internucleotide es between nucleotide positions 1 and 2, and between tide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (i) a length of 23 nucleotides; (ii) 2’—F modifications at positions 2, l4, and 16 (counting from the 5’ end); (iii) phosphorothioate internucleotide linkages between tide positions 1 and 2, between nucleotide positions 2 and 3, between tide positions 21 and 22, and between tide positions 22 and 23 (counting from the 5’ end); and (iv) a thermally destabilizing cation of the duplex at position 7 (counting from the 5’ end); wherein the dsRNA agents have a two tide overhang at the 3’—end of the antisense strand, and a blunt end at the 5’—end of the antisense strand.

In r particular embodiment, the dsRNA agents of the present invention comprising an antisense strand having: (i) 2’—F modifications at positions 2, l4, and 16 (counting from the 5’ end); and (2) a thermally destabilizing modification of the duplex at position 6 or 7 (counting from the 5’ end).

In another particular embodiment, the dsRNA agents of the present invention comprise: (a) a sense strand having: (i) an ASGPR ligand, wherein said ASGPR ligand; (ii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 ing from the 5’ end); (b) an antisense strand : (i) 2’—F modifications at positions 2, l4, and 16 ing from the 5’ end); (ii) a thermally destabilizing modification of the duplex at position 6 or 7 (counting from the 5’ end); In another particular embodiment, the dsRNA agents of the present invention comprise: (a) a sense strand having: (i) an ASGPR ligand attached to the 3’—end, wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker; (ii) phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3 (counting from the 5’ end); and (b) an antisense strand having: (ii) 2’—F modifications at positions 2, l4, and 16 (counting from the 5’ end); (iii) phosphorothioate internucleotide linkages between nucleotide ons 1 and 2, between nucleotide ons 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23 (counting from the 5’ end); and (iv) a thermally destabilizing modification of the duplex at on 6 or 7 (counting from the 5’ end); wherein the dsRNA agents have a two nucleotide overhang at the 3’—end of the antisense strand, and a blunt end at the 5’—end of the nse strand.

In some embodiments, the dsRNA agent further comprises at least one ASGPR ligand. For example, the ASGPR ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker, such as: 0 H H HO O\/\/\n/N\/\/N O O ACHN OVVTHMH o In one example, the ASGPR ligand is attached to the 3’ end of the sense strand.

The region of a Serpinal mRNA targeted by any of the dsRNA agents described herein may be nucleotides 1440—1480 of SEQ ID NOzl; or nucleotides 1441—1479 of SEQ ID NOzl; or nucleotides 1442—1478 of SEQ ID NOzl; or nucleotides 1443—1477 of SEQ ID NOzl; or nucleotides 1444—1476 of SEQ ID NOzl; or nucleotides 1445—1475 of SEQ ID NOzl; or nucleotides 1446—1474 of SEQ ID NOzl; or nucleotides 1447—1473 of SEQ ID NOzl; or tides 473 of SEQ ID NOzl; or nucleotides 1448—1472 of SEQ ID NOzl; or tides 1448—1471 of SEQ ID NOzl; or tides 1448—1470 of SEQ ID NOzl; or nucleotides 1447—1469 of SEQ ID NOzl; or nucleotides 478 of SEQ ID NOzl; or nucleotides 471 of SEQ ID NOzl; or nucleotides 1450—1472 of SEQ ID NOzl; or nucleotides 1440—1475 of SEQ ID NOzl; or nucleotides 480 of SEQ ID NOzl; or nucleotides 1445—1475 of SEQ ID NO:1.

The present invention also provides vetors, cells, and pharmaceutical compositions comprising the dsRNA agents of the on.

The pharmaceutical compositions of the invention may be an unbuffered solution, e.g., saline or water; or a buffered solution, e.g.,a buffered solution c omprising acetate, citrate, prolamine, carbonate, or phosphate or any combination f, or phosphate buffered saline (PBS).

In one , the present invention provides a method of inhibiting Serpinal expression in a cell. The method includes contacting the cell with any of the foregoing dsRNA agents or pharmaceutical composition of the invention, thereby inhibiting expression of the Serpinal gene in the cell.

In one embodiment, the cell is in a subject, such as a human subject.

In one ment, the Serpinal expression is inhibited by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, or about 100%.

In one aspect, the present invention provides a method of treating a subject having a Serpinal associated disease. The method includes administering to the t a therapeutically effective amount of any of the ing dsRNA agents or pharmaceutical composition of the invention, thereby treating said subject.

In one embodiment, the t is a human.

In one embodiment, the Serpinal associated disease is a liver disorder.

In one embodiment, the liver disorder is selected from the group consisting of c liver disease, liver inﬂammation, cirrhosis, liver fibrosis, and/or hepatocellular carcinoma.

In another aspect, the present invention provides a method of inhibiting development of hepatocellular carcinoma in a subject having a Serpinal deficiency variant. The method includes administering to the subject a therapeutically effective amount of any of the foregoing dsRNA agents or pharmaceutical composition of the invention, y ting pment of hepatocellular carcinoma in the subject.

In yet another aspect, the present invention provides a method of reducing the accumulation of misfolded al in the liver of a subject having a Serpinal deficiency variant. The method includes administering to the subject a therapeutically effective amount of any of the foregoing dsRNA agents or pharmaceutical composition of the invention, thereby reducing the accumulation of misfolded Serpinal in the liver of the subject.

The dsRNA agent may administered to the subject at a dose of about 0.01 mg/kg to about 10 mg/kg or about 0.5 mg/kg to about 50 mg/kg; or a dose of about 10 mg/kg to about mg/kg.

The dsRNA agent may administered to the subject subcutaneously; or intravenously.

The dsRNA agent may administered to the subject in two or more doses.

The t invention is further illustrated by the ing detailed description and drawings.

Brief Description of the Drawings Figure 1A schematically depicts the modified sense and antisense strand nucleotide sequences of AD—61444; AD—75994; and AD—75995. Figure 1A discloses SEQ ID NOs: 36— 37, 36, 38, 36 and 39, respectively, in order of ance.

Figure 1B is a graph depicting the in viva effect of administration of the indicated dsRNA agents on the level of expression of AAT (Serpina). The level of expression of AAT shown is relative to the pre—bleed level of expression of AAT.

Figure 1C schematically depicts the modified sense and nes strand nucleotide sequences of AD—6l444; AD—77404; and 12. Figure 1C discloses SEQ ID NOs: 36— 37, 36—37, 36 and 39, respectively, in order of appearance.

Figure 1D is a graph depicting the in viva effect of administration of the indicated dsRNA agents on the level of expression of AAT (Serpina).

Figure 2A is a graph depicting the off—target effect of AD—6l444 in Hep3B cells tranfected with 10 nM of the dsRNA agent 16 hours after treatment.

Figure 2B is a graph depicting the off—target effect of 12 in Hep3B cells tranfected with 10 nM of the dsRNA agent 16 hours after treatment.

Figure 3A is a graph depicting the efficacy and durability of AAT silencing in nonhuman primates (NHP) administered a single 0.3 mg/kg dose of the indicated agents. The level of expression of AAT shown is relative to the pre—bleed level of expression of AAT ined at days —7 and —l pre—dose.

Figure 3B is a graph depicting the durability of AAT silencing in nonhuman primates administered a single 1 mg/kg dose of the indicated agents. The level of expression of AAT shown is relative to the pre—bleed level of expression of AAT determined at days —7 and —l pre—dose.

Figure 3C is a graph depicting the durability of AAT silencing in nonhuman primates administered a single 3 mg/kg dose of the indicated agents. The level of expression of AAT shown is relative to the pre—bleed level of expression of AAT determined at days —7 and —l Figure 3D is a graph depicting the durability of AAT ing in nonhuman primates administered a single 10 mg/kg dose of the indicated agents. The level of expression of AAT shown is relative to the pre—bleed level of expression of AAT ined at days —7 and —l pre—dose. ed Description of the Invention The present ion provides compositions comprising agents, e.g., RNAi agents, e.g., double stranded iRNA agents, targeting Serpinal. Also disclosed are methods using the itions of the invention for inhibiting Serpinal expression and for treating al associated diseases, such as liver disorders, e.g., chronic liver disease, liver inﬂammation, cirrhosis, liver fibrosis, and/or hepatocellular carcinoma.

The t invention is based, at least in part on the discovery of effective nucleotide or chemical motifs for dsRNA agents targeting Serpinal which are advantageous for inhibition of target gene expression, while having d off—target gene silencing effects, as well as compositions comprising such agents suitable for therapeutic use. More specifically, it has been discovered inter alia that dsRNA agents targeting Serpinal where the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i.e., at position 2—9 of the 5’—end of the antisense strand, counting from the 5'— end) and/or the dsRNA agent has a melting ature in the range of from about 40°C to about 80°C can be more ive in mediating RNA interference than a parent dsRNA agent lacking the destabilizing modification. 1. tions In order that the present invention may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the d values are also intended to be part of this invention.

The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one t or more than one element, 6.g. a plurality of elements.

The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to".

The term "or" is used herein to mean, and is used interchangeably with, the term "and/or," unless context clearly indicates otherwise.

As used herein, "Serpinal" refers to the serpin peptidase inhibitor, clade A, member 1 gene or protein. al is also known as alpha—1—antitrypsin, oc—l—antitrypsin, AAT, protease inhibitor 1, PI, PIl, anti—elastase, and antitrypsin.

The term Serpinal es human Serpinal, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession Nos. GI: 189163524 (SEQ ID NO:1), GI:189163525 (SEQ ID NO:2), GI:189163526 (SEQ ID NO:3), GI:189163527 (SEQ ID NO:4), GI:189163529 (SEQ ID NO:5), GI:189163531 (SEQ ID NO:6), GI:189163533 (SEQ ID NO:7), GI:189163535 (SEQ ID NO:8), 163537 (SEQ ID NO:9), 163539 (SEQ ID NO:10), and/or GI:189163541 (SEQ ID NO:11); rhesus Serpinal, the amino acid and nucleotide sequence of which may be found in, for example, GenB ank ion Nos. GI:402766667 (SEQ ID NO:12), GI:297298519 (SEQ ID NO:13), and/or GI: 297298520 (SEQ ID NO: 14); mouse Serpinal, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. GI:357588423 and/or GI:357588426; and rat, the amino acid and nucleotide sequence of which may be found in, for example, GenBank Accession No. GI:77020249. Additional examples of Serpinal mRNA sequences are readily available using, e.g., GenBank and OMIM.

Over 120 alleles of Serpinal have been identified and the "M" alleles are considered the wild—type or "normal" allele (e.g., "PIMl—ALA213" (also known as PI, MlA), "PIMl— VAL213" (also known as PI, MIV), "PIM2", "PIM3", and . Additional variants may be found in, for example, the A(1)ATVar database (see, e.g., Zaimidou, S., et al. (2009) Hum Murat. 230(3):308—13 and www.goldenhelix.org/A1ATVar).

As used herein, the term nal deficiency allele" refers to a variant allele that produces proteins which do not fold properly and may aggregate intracellularly and are, thus, not ly transported from the site of synthesis in the liver to the site of action within the body.

Exemplary Serpinal deficiency alleles include, the "Z allele", the "S allele", the "PIM(Malton) allele", and the "PIM(Procida) allele".

As used herein, the terms "Z allele", "PIZ" and "Z—AAT" refer to a variant allele of al in which the amino acid at position 342 of the protein is changed from a glutamine to a lysine as a result of the relevant codon being changed from GAG to AAG. A subject homozygous for a Z allele can be referred to as "PIZZ." Z—AAT mutations account for 95% of Serpinal deficiency patients and are estimated to be present in 100,000 Americans and about 3 million individuals worldwide. The Z allele reaches rphic frequencies in ians and is rare or absent in Asians and blacks. The homozygous ZZ phenotype is ated with a high risk of both emphysema and liver disease. Z—AAT protein does not fold correctly in the endoplasmic reticulum, g to loop—sheet polymers which aggregate and reduce secretion, elicitation of the unfolded protein response, apoptosis, asmic reticulum overload response, autophagy, mitochondrial stress, and altered hepatocyte function.

As used herein, the terms "PIM(Malton)" and "M(Malton)—AAT" refer to a variant allele of Serpinal in which one of the adjacent phenylalanine residues at position 51 or 52 of the mature protein is deleted. Deletion of this one amino acid shortens one strand of the beta— sheet, B6, ting normal processing and secretion in the liver which is associated with cyte inclusions and impaired ion of the protein from the liver.

As used herein, the term "PIS" refers to a variant allele of Serpinal in which a glutamic acid at on 264 is substituted with valine. Although the majority of this variant protein is degraded intracellularly, there is a high frequency of the PIS allele in the Caucasian population and, thus, compound heterozygotes with a Z or null allele are nt.

As used herein, "target ce" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a Serpinal gene, including mRNA that is a product of RNA processing of a primary transcription product.

As used herein, the term "strand comprising a sequence" refers to an ucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.

"G," "C," "A" and "U" each generally stand for a nucleotide that contains guanine, cytosine, adenine, and uracil as a base, respectively. "T" and "dT" are used interchangeably herein and refer to a deoxyribonucleotide wherein the base is thymine, e.g., deoxyribothymine, 2’—deoxythymidine or ine. However, it will be understood that the term "ribonucleotide" or "nucleotide" or "deoxyribonucleotide" can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing ties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without tion, a nucleotide comprising inosine as its base may base pair with tides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of the invention by a nucleotide containing, for example, inosine. ces comprising such replacement moieties are embodiments of the invention.

"Polynucleotides," also referred to as "oligonucleotides," are formed through the covalent e of adjacent sides to one another, to form a linear polymeric oligonucleotide. Within the polynucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the polynucleotide. Polynucleotides may be either RNA or DNA and are, for example less than about 100, 200, 300, or about 400 tides in length.

The terms , "RNAi agent," "iRNA agent,", "RNA interference agent" as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA—induced silencing complex (RISC) y. iRNA s the sequence—specific degradation of mRNA through a process known as RNA interference (RNAi). The iRNA modulates, e.g., inhibits, the expression of Serpinal in a cell, e. g., a cell within a subject, such as a mammalian subject.

As used herein, the phrase "mediates RNAi" refers to the ability to silence, in a sequence specific manner, a target RNA. While not wishing to be bound by theory, it is believed that silencing uses the RNAi ery or process and a guide RNA, e.g., an siRNA agent of 21 to 23 nucleotides.

In one embodiment, an RNAi agent of the invention includes a single stranded RNA that interacts with a target RNA sequence, e. g., a Serpinal target mRNA sequence, to direct the cleavage of the target RNA. t wishing to be bound by theory it is believed that long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15 :485). Dicer, a ribonuclease— ke enzyme, processes the dsRNA into 19—23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA—induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, ng the complementary antisense strand to guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15: 188). Thus, in one aspect the invention relates to a single stranded RNA (sssiRNA) generated within a cell and which promotes the formation of a RISC complex to effect silencing of the target gene, i.e., a Serpinal gene.

Accordingly, the term "siRNA" is also used herein to refer to an RNAi as described above.

In another ment, the RNAi agent may be a single—stranded RNAi agent that is introduced into a cell or organism to inhibit a target mRNA. Single— stranded RNAi agents (ssRNAi) bind to the RISC clease, Argonaute 2, which then cleaves the target mRNA.

The single—stranded siRNAs are generally 15—30 nucleotides and are ally modified.

The design and testing of single—stranded RNAi agents are described in U.S. Patent No. 8,101,348 and in Lima er al., (2012) Cell 150: 4, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucleotide ces described herein may be used as a single—stranded siRNA as described herein or as ally modified by the methods described in Lima er al., (2012) Cell 150;:883—894.

In another embodiment, an "iRNA" for use in the compositions and methods of the invention is a double—stranded RNA and is referred to herein as a "double stranded RNAi agent," "double—stranded RNA (dsRNA) molecule," "dsRNA " or "dsRNA". The term "dsRNA", refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti—parallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations with respect to a target RNA, i. 6., an Serpinal gene. In some embodiments of the invention, a —stranded RNA (dsRNA) triggers the degradation of a target RNA, e.g., an mRNA, through a post—transcriptional gene— ing mechanism referred to herein as RNA interference or RNAi.

In general, the majority of nucleotides of each strand of a dsRNA agent are cleotides, but as described in detail herein, each or both strands can also include one or more bonucleotides, e.g., a deoxyribonucleotide and/or a modified nucleotide. In addition, as used in this specification, an "RNAi agent" may include cleotides with chemical modifications; an RNAi agent may include substantial modifications at multiple nucleotides. As used herein, the term "modified nucleotide" refers to a nucleotide having, independently, a modified sugar moiety, a modified intemucleotide linkage, and/or a modified nucleobase. Thus, the term modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to intemucleoside linkages, sugar moieties, or nucleobases. The cations suitable for use in the agents of the invention include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a siRNA type molecule, are encompassed by "RNAi agent" for the purposes of this specification and claims.

The duplex region may be of any length that permits ic degradation of a d target RNA through a RISC pathway, and may range from about 9 to 36 base pairs in length, e.g., about 15—30 base pairs in length, for example, about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, —19, 15—18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, -29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21—26, 21—25, 21—24, 21—23, or 21—22 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.

The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two s are part of one larger molecule, and therefore are connected by an rrupted chain of nucleotides between the 3’—end of one strand and the 5’—end of the respective other strand forming the duplex ure, the connecting RNA chain is referred to as a "hairpin loop." A hairpin loop can comprise at least one unpaired nucleotide. In some embodiments, the hairpin loop can comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides.

Where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not, but can be covalently connected. Where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3’—end of one strand and the 5’—end of the respective other strand g the duplex structure, the connecting structure is referred to as a "linker." The RNA s may have the same or a different number of nucleotides. The m number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, an RNAi may comprise one or more nucleotide overhangs.

In one embodiment, an RNAi agent of the ion is a dsRNA, each strand of which comprises 19—23 nucleotides, that interacts with a target RNA sequence, e.g., a Serpinal target mRNA sequence, to direct the cleavage of the target RNA. Without g to be bound by theory, long double stranded RNA uced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15 :485). Dicer, a ribonuclease—III—like enzyme, ses the dsRNA into 19—23 base pair short interfering RNAs with characteristic two base 3' ngs (Bernstein, et al., (2001) Nature 409:363).

The siRNAs are then incorporated into an RNA—induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al. Cell 107:309). Upon binding to , (2001) the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15 :188).

As used , the term "nucleotide overhang" refers to at least one unpaired nucleotide that protrudes from the duplex structure of an iRNA, e.g., a dsRNA. For example, when a 3'—end of one strand of a dsRNA extends beyond the 5'—end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least one nucleotide; atively the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. A tide overhang can comprise or consist of a nucleotide/nucleoside , including a deoxynucleotide/nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the tide(s) of an overhang can be present on the 5'—end, 3'—end or both ends of either an antisense or sense strand of a dsRNA.

In one embodiment, the antisense strand of a dsRNA has a 1—10 nucleotide, e.g., a l, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’—end and/or the 5’—end. In one embodiment, the sense strand of a dsRNA has a 1—10 nucleotide, e.g., a l, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3’—end and/or the 5’—end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.

In certain embodiments, the overhang on the sense strand or the antisense , or both, can e extended lengths longer than 10 nucleotides, e.g., 10—30 nucleotides, 10—25 nucleotides, 10—20 nucleotides or 10—15 nucleotides in length. In certain ments, an extended overhang is on the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 3’end of the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 5’end of the sense strand of the duplex. In certain embodiments, an extended overhang is on the antisense strand of the duplex. In n embodiments, an extended overhang is present on the 3’end of the antisense strand of the duplex. In certain ments, an extended overhang is present on the 5’end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the extended overhang is replaced with a nucleoside osphate.

The terms "blunt" or "blunt ended" as used herein in reference to a dsRNA mean that there are no unpaired nucleotides or nucleotide s at a given terminal end of a dsRNA, i.e., no nucleotide overhang. One or both ends of a dsRNA can be blunt. Where both ends of a dsRNA are blunt, the dsRNA is said to be blunt ended. To be clear, a "blunt ended" dsRNA is a dsRNA that is blunt at both ends, i.e., no nucleotide overhang at either end of the molecule. Most often such a molecule Will be double—stranded over its entire length.

The term "antisense " or " guide strand" refers to the strand of an iRNA, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., a Serpinal mRNA.

As used herein, the term n of complementarity" refers to the region on the antisense strand that is substantially complementary to a ce, for example a target sequence, e.g., a Serpinal nucleotide sequence, as d herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., Within 5, 4, 3, or 2 nucleotides of the 5’— and/or 3’—terminus of the iRNA, The term "sense strand" or "passenger strand" as used herein, refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.

As used herein, the term "cleavage region" refers to a region that is located immediately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage region ses three bases on either end of, and immediately nt to, the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site.

In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and ll of the antisense strand, and the cleavage region comprises nucleotides ll, 12 and As used herein, and unless otherwise indicated, the term ementary," when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an ucleotide or polynucleotide comprising the second nucleotide ce, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 500C or 700C for 12—16 hours followed by washing. Other conditions, such as logically relevant conditions as may be encountered inside an organism, can apply. For example, a complementary sequence is sufficient to allow the relevant function of the nucleic acid to d, e.g., RNAi. The skilled person will be able to ine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.

Sequences can be "fully complementary" with respect to each when there is base— pairing of the nucleotides of the first nucleotide sequence with the nucleotides of the second nucleotide sequence over the entire length of the first and second tide sequences.

However, where a first sequence is ed to as antially complementary" with respect to a second sequence herein, the two sequences can be fully complementary, or they may form one or more, but generally not more than 4, 3 or 2 mismatched base pairs upon hybridization, while retaining the ability to hybridize under the conditions most relevant to their ultimate application. r, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and r oligonucleotide 23 tides in length, wherein the longer ucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, may yet be referred to as "fully complementary" for the purposes described herein.

"Complementary" sequences, as used herein, may also include, or be formed entirely from, non—Watson—Crick base pairs and/or base pairs formed from non—natural and modified nucleotides, in as far as the above requirements with respect to their y to ize are fulfilled. Such non—Watson—Crick base pairs includes, but not limited to, G:U Wobble or Hoogstein base pairing.

The terms "complementary," "fully complementary" and "substantially complementary" herein may be used with respect to the base matching n the sense strand and the nse strand of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as will be understood from the context of their use.

As used , a polynucleotide that is "substantially complementary to at least part of" a messenger RNA (mRNA) refers to a polynucleotide that is ntially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding Serpinal) including a 5’ UTR, an open reading frame (ORF), or a 3’ UTR. For example, a polynucleotide is complementary to at least a part of a Serpinal mRNA if the sequence is substantially complementary to a non—interrupted portion of an mRNA encoding Serpinal.

In some embodiments, a dsRNA agent of the invention is "sufficiently complementary" to a Serpinal target RNA, e.g., a target mRNA, such that the dsRNA agent silences production of protein encoded by the target mRNA. In another embodiment, the dsRNA agent of the ion is "exactly complementary" or fully complementary to a target RNA, e.g., the target RNA and the dsRNA duplex agent anneal, for example to form a hybrid made exclusively of Watson—Crick base pairs in the region of exact complementarity. A ciently complementary" target RNA can include an internal region (e.g., of at least 10 tides) that is exactly complementary to a target RNA. Moreover, in some embodiments, the dsRNA agent of the invention specifically discriminates a single— nucleotide difference. In this case, the dsRNA agent only mediates RNAi if exact complementary is found in the region (e.g., within 7 nucleotides of) the single—nucleotide difference.

The term ‘BNA’ refers to d nucleic acid, and is often referred as constrained or inaccessible RNA. BNA can contain a 5—, 6— membered, or even a 7—membered bridged structure with a "fixed" C3’—endo sugar puckering. The bridge is typically incorporated at the 2’—, 4’—position of the ribose to afford a 2’, 4’—BNA nucleotide (e.g., LNA, or ENA).

Examples of BNA nucleotides include the following nucleosides: ‘"~"*‘m‘""'BNA ' Me BNA cEtBNA cMOE BNA mnyl-assaxbo—BNA The term ‘LNA’ refers to locked nucleic acid, and is often referred as constrained or inaccessible RNA. LNA is a modified RNA nucleotide. The ribose moiety of an LNA nucleotide is modified with an extra bridge (6.g. a ene bridge or an ethylene bridge) connecting the 2' hydroxyl to the 4' carbon of the same ribose sugar. For instance, the bridge can "lock" the ribose in the 3'—endo North) conformation: Base HO OH I O / Base OH O The term ‘ENA’ refers to ethylene—bridged nucleic acid, and is often referred as constrained or inaccessible RNA.

The term "inhibiting," as used herein, is used interchangeably with "reducing," "silencing," "downregulating,:9 ressing" and other similar terms, and includes any level of inhibition.

The phrase "inhibiting expression of a Serpinal," as used herein, includes inhibition of expression of any al gene (such as, e.g., a mouse al gene, a rat Serpinal gene, a monkey Serpinal gene, or a human Serpinal gene) as well as variants, (e.g., naturally ing variants), or mutants of a Serpinal gene. Thus, the Serpinal gene may be a Wild— type Serpinal gene, a variant Serpinal gene, a mutant Serpinal gene, or a transgenic al gene in the context of a genetically manipulated cell, group of cells, or organism.

"Inhibiting expression of a Serpinal gene" includes any level of tion of a Serpinal gene, e.g., at least partial suppression of the expression of a Serpinal gene, such as an inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%,at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%. at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

The sion of a Serpinal gene may be assessed based on the level of any variable associated with Serpinal gene expression, e.g., Serpinal mRNA level, al protein level, or serum AAT levels. tion may be assessed by a decrease in an absolute or relative level of one or more of these variables compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a se ne level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).

The phrase "contacting a cell with a double stranded RNAi agent," as used herein, includes ting a cell by any possible means. Contacting a cell with a double ed RNAi agent es contacting a cell in vitro with the RNAi agent or contacting a cell in vivo with the RNAi agent. The contacting may be done directly or indirectly. Thus, for example, the RNAi agent may be put into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent may be put into a situation that Will permit or cause it to subsequently come into contact with the cell.

Contacting a cell in vitro may be done, for example, by incubating the cell with the RNAi agent. Contacting a cell in viva may be done, for example, by injecting the RNAi agent into or near the tissue Where the cell is located, or by injecting the RNAi agent into another area, the tream or the subcutaneous space, such that the agent Will subsequently reach the tissue Where the cell to be contacted is located. For example, the RNAi agent may contain and/or be coupled to a ligand, e.g., a GalNAc3 ligand, that directs the RNAi agent to a site of interest, e.g., the liver. Combinations of in vitro and in viva s of contacting are also possible. In connection with the methods of the invention, a cell might also be contacted in vitro with an RNAi agent and subsequently transplanted into a subject.

A "patient" or "subject," as used herein, is intended to include either a human or non— human animal, preferably a mammal, e.g., a monkey. Most ably, the subject or t is a human.

A "Serpinal associated disease," as used herein, is intended to include any disease, disorder, or condition associated with the Serpinal gene or n. Such a disease may be caused, for example, by misfolding of a Serpinal protein, intracellular accumulation of Serpinal protein (e.g., misfolded Serpinal protein), excess production of the Serpinal protein, by Serpinal gene variants, Serpinal gene mutations, by abnormal cleavage of the Serpinal protein, by abnormal interactions between al and other proteins or other endogenous or exogenous substances. A Serpinal associated disease may be a liver disease and/or a lung disease.

A "liver disease", as used herein, includes a disease, er, or condition ing the liver and/or its function. A liver disorder can be the result of accumulation of Serpinal protein in the liver and/or liver cells. Examples of liver disorders include liver disorders ing from, viral infections, parasitic infections, genetic predisposition, autoimmune diseases, exposure to radiation, re to hepatotoxic compounds, mechanical injuries, various environmental toxins, l, inophen, a combination of alcohol and acetaminophen, inhalation anesthetics, niacin, chemotherapeutics, antibiotics, analgesics, antiemetics and the herbal supplement kava, and ations thereof.

For e, a liver disorder associated with Serpinal deficiency may occur more often in subjects with one or more copies of certain alleles (e.g., the P12, PiM(Malton), and/or PIS alleles). Without Wishing to be bound by theory, it is thought that alleles associated with a greater risk of developing an alpha—l rypsin liver disease encode forms of Serpinal which are subject to misfolding and are not properly secreted from the hepatocytes. The cellular responses to these misfolded proteins can include the unfolded protein response (UPR), endoplasmic reticulum—associated degradation (ERAD), apoptosis, ER overload response, autophagy, mitochondrial stress and altered hepatocyte function. The injuries to the cytes can lead to ms such as, but not d to, mation, cholestasis, fibrosis, cirrhosis, prolonged obstructive jaundice, increased transaminases, portal hypertension and/or hepatocellular carcinoma. Without Wishing to be bound by theory, the highly variable clinical course of this disease is suggestive of ers or d hits" as contributors to developing symptoms or progressing in severity.

For example, subjects with a PIZ allele can be more sensitive to Hepatitis C infections or alcohol abuse and more likely to develop a liver disorder if exposed to such factors.

Additionally cystic fibrosis (CF) subjects carrying the P12 allele are at r risk of developing severe liver disease with portal hypertension. A deficiency of Serpinal can also cause or contribute to the development of early onset emphysema, necrotizing panniculitis, bronchiectasis, and/or prolonged neonatal jaundice. Some patients having or at risk of having a deficiency of alpha— l—antitrypsin are identified by screening When they have family members affected by an l—antitrypsin deficiency.

Exemplary liver disorders include, but are not limited to, liver inflammation, chronic liver disease, cirrhosis, liver fibrosis, hepatocellular carcinoma, liver necrosis, steatosis, cholestatis and/or reduction and/or loss of hepatocyte function.

"Cirrhosis" is a pathological condition associated with chronic liver damage that includes extensive fibrosis and regenerative nodules in the liver.

"Fibrosis" is the eration of fibroblasts and the formation of scar tissue in the liver.

The phrase "liver function" refers to one or more of the many logical functions performed by the liver. Such functions include, but are not limited to, regulating blood sugar levels, endocrine regulation, enzyme systems, interconversion of metabolites (e.g., ketone bodies, sterols and steroids and amino acids); manufacturing blood proteins such as fibrinogen, serum n, and cholinesterase, erythropoietic function, detoxification, bile formation, and vitamin storage. Several tests to examine liver function are known in the art, including, for example, measuring alanine amino erase (ALT), alkaline phosphatase, bin, prothrombin, and albumin.

"Therapeutically ive amount," as used , is intended to include the amount of an RNAi agent that, when administered to a patient for treating a Serpinal—associated disease, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease). The "therapeutically effective amount" may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, stage of pathological processes ed by Serpinal expression, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

"Prophylactically effective amount," as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject who does not yet ence or display symptoms of an Serpinal—associated e, but who may be predisposed to the disease, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Ameliorating the e includes slowing the course of the disease or reducing the severity of later—developing disease. The "prophylactically effective amount" may vary depending on the RNAi agent, how the agent is stered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or itant treatments, if any, and other individual characteristics of the patient to be treated.

A "therapeutically—effective " or "prophylacticaly effective amount" also includes an amount of an RNAi agent that es some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. RNAi gents ed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.

The term "sample," as used herein, includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as ﬂuids, cells, or s t within a subject.

Examples of biological ﬂuids include blood, serum and serosal fluids, plasma, urine, lymph, cerebrospinal fluid, ocular , saliva, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from particular organs, parts of , or ﬂuids or cells within those organs. In certain embodiments, samples may be derived from the liver (6.g. , whole liver or certain ts of liver or certain types of cells in the liver, such as, e.g., hepatocytes). In red embodiments, a "sample derived from a subject" refers to blood or plasma drawn from the subject. In further embodiments, a "sample derived from a subject" refers to liver tissue (or subcomponents thereof) derived from the subject. 11. iRNAs 0f the Invention bed herein are improved double stranded RNAi agents which inhibit the expression of a Serpinal gene in a cell, such as a cell within a subject, e.g., a mammal, such as a human having a Serpinal associated disease, e.g., a liver disease, e.g., chronic liver e, liver inﬂammation, cirrhosis, liver fibrosis, and/or hepatocellular carcinoma.

Accordingly, the invention es double stranded RNAi agents with chemical modifications capable of ting the expression of a target gene (i. e., a Serpinal gene) in vivo. In certain aspects of the invention, substantially all of the nucleotides of an iRNA of the invention are modified. In other embodiments of the invention, all of the nucleotides of an iRNA of the invention are modified. iRNAs of the invention in which "substantially all of the tides are modified" are largely but not wholly modified and can include not more than , 4, 3, 2, or 1 unmodified nucleotides.

The RNAi agent comprises a sense strand and an antisense strand. Each strand of the RNAi agent may range from 12—30 nucleotides in . For example, each strand may be between 14—30 nucleotides in length, 17—30 nucleotides in length, 19—30 nucleotides in length, —30 nucleotides in length, 27—30 nucleotides in , 17—23 nucleotides in length, l7—2l nucleotides in length, l7—l9 nucleotides in length, 19—25 nucleotides in length, 19—23 nucleotides in length, l9—2l nucleotides in length, 2l—25 nucleotides in length, or 21—23 nucleotides in length.

The sense strand and antisense strand lly form a duplex double stranded RNA ("dsRNA"), also referred to herein as an "RNAi agent." The duplex region of an RNAi agent may be 12—30 nucleotide pairs in length. For e, the duplex region can be between 14— tide pairs in length, 17—30 tide pairs in length, 27—30 tide pairs in length, 17 — 23 nucleotide pairs in length, l7—2l nucleotide pairs in length, l7—l9 nucleotide pairs in length, 19—25 nucleotide pairs in length, 19—23 nucleotide pairs in length, 19— 21 nucleotide pairs in length, 2l—25 nucleotide pairs in length, or 21—23 nucleotide pairs in length. In another example, the duplex region is selected from l5, l6, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.

In one embodiment, the RNAi agent may contain one or more overhang regions and/or capping groups at the 3’—end, 5’—end, or both ends of one or both strands. The overhang can be 1—6 nucleotides in length, for ce 2—6 nucleotides in length, 1—5 nucleotides in length, 2—5 nucleotides in length, 1—4 nucleotides in length, 2—4 nucleotides in length, 1—3 nucleotides in length, 2—3 nucleotides in length, or 1—2 nucleotides in length. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence. The first and second s can also be joined, e.g., by additional bases to form a hairpin, or by other non—base linkers.

In one embodiment, the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified nucleotide including, but no limited to 2’— sugar modified, such as, 2—F, 2’—O—methyl, thymidine (T), 2\—O—methoxyethyl—5— methyluridine (Teo), 2\—O—methoxyethyladenosine (Aeo), 2\—O—methoxyethyl—5— methylcytidine (m5Ceo), and any combinations thereof. For example, TT can be an ng sequence for either end on either . The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.

The 5’— or 3’— overhangs at the sense strand, antisense strand or both strands of the RNAi agent may be phosphorylated. In some embodiments, the overhang (s) contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different. In one embodiment, the overhang is present at the 3’—end of the sense strand, antisense strand, or both strands. In one embodiment, this 3’— overhang is t in the antisense strand. In one embodiment, this 3’—overhang is present in the sense strand.

The RNAi agent may contain only a single overhang, which can then the interference ty of the RNAi, without affecting its overall stability. For example, the single—stranded overhang may be d at the 3'—terminal end of the sense strand or, alternatively, at the 3'—terminal end of the antisense strand. The RNAi may also have a blunt end, located at the 5’—end of the antisense strand (or the 3’—end of the sense strand) or vice versa. lly, the antisense strand of the RNAi has a nucleotide overhang at the 3’—end, and the 5’—end is blunt. While not wishing to be bound by theory, the asymmetric blunt end at the 5’—end of the antisense strand and 3’—end overhang of the antisense strand favor the guide strand loading into RISC process.

Any of the nucleic acids featured in the invention can be synthesized and/or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S.L. er al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference. Modifications include, for example, end modifications, e.g., 5’—end modifications (phosphorylation, conjugation, inverted linkages) or 3’—end modifications gation, DNA tides, inverted linkages, etc); base modifications, e.g., replacement with stabilizing bases, ilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2’—position or 4’—position) or replacement of the sugar; and/or backbone modifications, including modification or replacement of the phosphodiester es. Specific es of iRNA compounds useful in the embodiments described herein include, but are not limited to RNAs containing modified backbones or no natural intemucleoside linkages. RNAs having modified nes include, among others, those that do not have a phosphorus atom in the backbone.

For the purposes of this specification, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in their intemucleoside backbone can also be considered to be oligonucleosides. In some embodiments, a ed iRNA will have a phosphorus atom in its intemucleoside backbone.

Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These e those having morpholino linkages d in part from the sugar portion of a nucleoside); siloxane backbones; e, sulfoxide and sulfone backbones; etyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate nes; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide nes; amide backbones; and others having mixed N, O, S and CH2 component parts.

Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Patent Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; ,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; ,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 070; 5,663,312; 5,633,360; 437; and, 5,677,439, the entire ts of each of which are hereby incorporated herein by nce.

In other embodiments, suitable RNA mimetics are contemplated for use in iRNAs, in which both the sugar and the internucleoside linkage, i. e., the ne, of the nucleotide units are replaced with novel groups. The base units are ined for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA nds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza en atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds le for use in the iRNAs of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497—1500.

Some embodiments featured in the invention include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular —NH—— CH2—, ——CH2——N(CH3)——O——CH2——[known as a methylene (methylimino) or MMI backbone], —— CH2——O——N(CH3)——CH2——, ——CH2——N(CH3)——N(CH3)——CH2-- and --N(CH3)--CH2--CH2-- [wherein the native phosphodiester backbone is ented as ——O——P——O——CH2——] of the above—referenced US. Patent No. 5,489,677, and the amide backbones of the above— referenced US. Patent No. 5,602,240. In some embodiments, the RNAs featured herein have lino backbone structures of the above—referenced US. Patent No. 5,034,506.

Modified RNAs can also contain one or more substituted sugar moieties. The iRNAs, e.g., dsRNAs, featured herein can include one of the following at the 2'—position: OH; F; O—, S—, or N—alkyl; O—, S—, or N—alkenyl; O—, S— or N—alkynyl; or O—alkyl—O—alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or tituted C1 to C10 alkyl or C2 to C10 alkenyl and l. Exemplary suitable modifications include O[(CH2)HO] InCH3, O(CH2).HOCH3, O(CH2)HNH2, O(CH2) I1CH3, O(CH2)nONH2, and HON[(CH2)HCH3)]2, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2' position: C1 to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O— alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, $02CH3, ONOz, N02, N3, NHz, cycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic ties of an iRNA, or a group for improving the pharmacodynamic properties of an iRNA, and other substituents having similar properties. In some ments, the modification includes a 2'—methoxyethoxy (2'—O——CH2CHZOCH3, also known as 2'—O—(2—methoxyethyl) or 2'—MOE) (Martin et al., Helv. Chim. Acta, 1995, — 504) i.e., an alkoxy—alkoxy group. r exemplary modification is 2'— dimethylaminooxyethoxy, i. e., a O(CH2)ZON(CH3)2 group, also known as 2'—DMAOE, as described in examples herein below, and 2'—dimethylaminoethoxyethoxy (also known in the art as 2'—O—dimethylaminoethoxyethyl or 2'—DMAEOE), i.e., 2'—O——CH2——O——CH2——N(CH2)2.

Further exemplary modifications include : 5’—Me—2’—F nucleotides, 5’—Me—2’—OMe nucleotides, 5’—Me—2’—deoxynucleotides, (both R and S s in these three families); 2’— alkoxyalkyl; and 2’—NMA hylacetamide).

Other modifications include 2'—methoxy (2'—OCH3), 2'—aminopropoxy (2'— OCHZCHZCHZNHZ) and 2'—ﬂuoro (2'—F). r modifications can also be made at other positions on the RNA of an iRNA, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2—5 linked dsRNAs and the 5' position of 5' terminal nucleotide. iRNAs can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.

Representative US. patents that teach the ation of such modified sugar structures include, but are not limited to, US. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; ,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; ,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and ,700,920, certain of which are commonly owned with the instant application. The entire contents of each of the foregoing are hereby incorporated herein by reference.

An iRNA of the ion can also e nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used , "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and l nucleobases such as 5—methylcytosine (5—me—C), 5—hydroxymethyl cytosine, xanthine, hypoxanthine, 2—aminoadenine, 6—methyl and other alkyl derivatives of adenine and guanine, yl and other alkyl derivatives of adenine and e, 2—thiouracil, 2—thiothymine and 2—thiocytosine, 5—halouracil and cytosine, 5—propynyl uracil and cytosine, 6—azo uracil, cytosine and thymine, 5—uracil (pseudouracil), 4—thiouracil, 8—halo, 8—amino, 8—thiol, 8— thioalkyl, 8—hydroxyl anal other tituted es and guanines, 5—halo, particularly 5— bromo, 5—trifluoromethyl and other 5—substituted uracils and cytosines, 7—methylguanine and 7—methyladenine, 8—azaguanine and 8—azaadenine, 7—deazaguanine and aadenine and 3— deazaguanine and 3—deazaadenine. Further nucleobases include those disclosed in US. Pat.

No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley—VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858—859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., (1991) Angewandte Chemie, International Edition, 30:613, and those disclosed by Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289—302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric nds featured in the invention. These include 5—substituted pyrimidines, 6— azapyrimidines and N—2, N—6 and 0—6 substituted purines, ing 2—aminopropyladenine, —propynyluracil and 5—propynylcytosine. 5—methylcytosine tutions have been shown to increase nucleic acid duplex stability by 0.6—1.2 °C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276— 278) and are exemplary base tutions, even more particularly when combined with 2'—O— methoxyethyl sugar cations.

Representative US. s that teach the preparation of certain of the above noted modified nucleobases as well as other modified bases include, but are not limited to, the above noted US. Patent Nos. 3,687,808, 4,845,205; 5,130,30; 5,134,066; 5,175,273; ,367,066; 5,432,272; 5,457,187; 255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; ,587,469; 121, 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 887; 368; 6,528,640; 062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference.

An iRNA of the invention can also be modified to include one or more locked nucleic acids (LNA). A locked nucleic acid is a nucleotide having a ed ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in the 3'—endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off—target effects (Elmen, J. et al., (2005) c Acids Research 33(l):439—447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833—843; Grunweller, A. et al., (2003) Nucleic Acids Research 3l(l2):3185—3l93).

An iRNA of the ion can also be modified to e one or more ic sugar moities. A "bicyclic sugar" is a furanosyl ring modified by the bridging of two atoms.

A"bicyclic nucleoside" ("BNA") is a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'—carbon and the 2'—carbon of the sugar ring.

Thus, in some embodiments an agent of the invention may include one or more locked nucleic acids (LNA). A locked c acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons. In other words, an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4'— 2' bridge. This structure effectively "locks" the ribose in the 3'—endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA ity in serum, and to reduce off—target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(l):439—447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833—843; Grunweller, A. et al., (2003) Nucleic Acids Research 3 l(l2):3 185—3 193). Examples of bicyclic nucleosides for use in the cleotides of the invention e without limitation nucleosides comprising a bridge between the 4' and the 2' l ring atoms. In certain embodiments, the antisense polynucleotide agents of the invention include one or more bicyclic nucleosides comprising a 4' to 2' bridge. es of such 4' to 2' bridged bicyclic nucleosides, include but are not limited to 4'—(CH2)—O—2' (LNA); 4'—(CH2)—S—2'; 4'— (CH2)2—O—2' (ENA); 4'—CH(CH3)—O—2' (also referred to as "constrained ethyl" or "cEt") and 4'—CH(CH2OCH3)—O—2' (and analogs f; see, e.g., U.S. Pat. No. 7,399,845); 4'— C(CH3)(CH3)—O—2' (and analogs thereof; see e.g., US Patent No. 8,278,283); 4'—CH2— N(OCH3)—2' (and analogs f; see e. g., US Patent No. 8,278,425); 4'—CH2—O—N(CH3)— 2' (see, e.g.,U.S. Patent Publication No. 2004/017l570); 4'—CH2—N(R)—O—2', wherein R is H, Cl—Cl2 alkyl, or a protecting group (see, e.g., U.S. Pat. No. 7,427,672); 4'—CH2— C(H)(CH3)—2' (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118—134); and 4'— CH2—C(=CH2)—2' (and analogs thereof; see, e.g., US Patent No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference.

Additional representative US. Patents and US Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: US. Patent Nos. 6,268,490; 6,525,191; 461; 6,770,748; 6,794,499; 6,998,484; 207; 7,034,133;7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008/0039618; and US 012281, the entire contents of each of which are hereby incorporated herein by reference.

Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example 0t—L—ribofuranose and [3—D— ribofuranose (see W0 99/14226).

An iRNA of the invention can also be modified to include one or more constrained ethyl nucleotides. As used herein, a rained ethyl nucleotide" or "cEt" is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4'—CH(CH3)—0—2' bridge. In one embodiment, a constrained ethyl nucleotide is in the S conformation referred to herein as "S—cEt." An iRNA of the ion may also include one or more "conformationally restricted nucleotides" ("CRN"). CRN are nucleotide analogs with a linker connecting the C2’and C4’ s of ribose or the C3 and —C5' carbons of ribose . CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA. The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring ing.

Representative publications that teach the preparation of n of the above noted CRN include, but are not limited to, US Patent Publication No. 2013/01903 83; and PCT publication herein by reference.

In some embodiments, an iRNA of the invention comprises one or more monomers that are UNA (unlocked nucleic acid) tides. UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, g an ed " residue. In one example, UNA also encompasses monomer with bonds between C1'—C4' have been removed (i. e. the covalent carbon—oxygen—carbon bond between the Cl' and C4' carbons). In another example, the C2'—C3' bond (i.e. the nt carbon—carbon bond n the C2' and C3' carbons) of the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133—134 (2008) and Fluiter et al., M01. Biosyst., 2009, 10, 1039 hereby incorporated by reference).

Representative U.S. publications that teach the preparation of UNA include, but are not limited to, US Patent No. 8,314,227; and US Patent Publication Nos. 2013/0096289; 011922; and 2011/0313020, the entire contents of each of which are hereby incorporated herein by reference. ially stabilizing modifications to the ends of RNA les can include N— (acetylaminocaproyl)—4—hydroxyprolinol (Hyp—C6—NHAc), N—(caproyl—4—hydroxyprolinol 6), N—(acetyl—4—hydroxyprolinol (Hyp—NHAc), thymidine—2'—0—deoxythymidine (ether), N—(aminocaproyl)—4—hydroxyprolinol (Hyp—C6—amino), 2—docosanoyl—uridine—3"— phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No.

Other modifications of an iRNA of the invention include a 5’ phosphate or 5’ phosphate mimic, e.g., a 5’—terminal phosphate or phosphate mimic on the antisense strand of an RNAi agent. Suitable phosphate mimics are disclosed in, for example US Patent Publication No. 2012/0157511, the entire contents of which are orated herein by reference.

A. iRNAs Comprising Thermally Destabilizing Modifications.

As bed herein, it has been discovered inter alia that rget s of dsRNA agents targeting Serpinal can be reduced or inhibited by incorporating lly ilizing nucleotides at certain positions in the antisense strand of the dsRNA. With these thermally destabilizing modifications at certain positions in antisense strand, the dsRNA agents were able to retain gene silencing activity r to the parent dsRNA while having reduced off—target gene silencing. Further, the number of off—target genes that are down—regulated or up—regulated is also reduced by dsRNA agents comprising these thermally destabilizing modifications when compared to the parent dsRNA.

As such, in one aspect, the invention provides a double stranded RNAi (dsRNA) agent capable of inhibiting expression of a Serpinal target gene. Generally, the dsRNA agents of the invention show high get gene silencing while reducing or minimizing off— target gene ing and/or toxicity. Without limitations, the dsRNA agents of the invention can be substituted for the dsRNA agents and can be used for in RNA interference based gene silencing techniques, including, but not limited to, in vitro or in viva applications.

Generally, the dsRNA agent comprises a sense strand (also referred to as passenger ) and an antisense strand (also referred to as guide strand). Each strand of the dsRNA agent can range from 12—40 nucleotides in length. For example, each strand can be between 14—40 nucleotides in length, 17—37 nucleotides in , 25—37 nucleotides in length, 27—30 nucleotides in length, 17—23 nucleotides in length, 17—21 tides in length, l7—l9 nucleotides in length, 19—25 nucleotides in length, 19—23 nucleotides in length, 19—21 nucleotides in length, 21—25 nucleotides in , or 21—23 nucleotides in length. Without limitations, the sense and antisense strands can be equal length or unequal length.

In some embodiments, the nse strand is of length 18 to 35 nucleotides. In some embodimens, the antisense strand is 21—25, 19—25, 19—21 or 21—23 nucleotides in length. In some particular embodiments, the antisense strand is 23 nucleotides in length.Similar to the antisense strand, the sense strand can be, in some embodiments, 18—35 nucloeitdes in length.

In some embodimens, the sense strand is 21—25, 19—25, 19—21 or 21—23 nucleotides in length.

In some particular embodiments, the antisense strand is 21 nucleotides in length.

In some embodiments, the sense and antisense strands are independently 19, 20, 21, 22, 23, 24 or 25 nucleotides in length, wherein the nse strand contains at least one thermally destabilizing nucleotide, and where the at least one thermally ilizing nucleotide is in the seed region of the antisense strand (i. e., at position 2—9 of the 5’—end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—ﬂuoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—ﬂuoro modifications; (V) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2’—ﬂuoro modifications; (vii) the dsRNA comprises a duplex region of 18, 19, 21, 22, 23, 24 or 24 tide pairs in length; and (viii) the dsRNA comprises a blunt end at 5 ’—end of the sense strand. In some particular embodiments, sense strand is 19, 20 or 21 or 22 nucleotides in length and the antisense strand is 20, 21 or 22 nucleotides in length.

The sense strand and antisense strand typically form a duplex dsRNA. The duplex region of a dsRNA agent may be 12—40 nucleotide pairs in . For example, the duplex region can be between 14—40 nucleotide pairs in , 17—30 nucleotide pairs in length, 25— 35 nucleotides in length, 27—35 nucleotide pairs in , 17—23 nucleotide pairs in length, 17—21 nucleotide pairs in , 17—19 nucleotide pairs in length, 19—25 nucleotide pairs in length, 19—23 tide pairs in length, 19— 21 tide pairs in length, 21—25 nucleotide pairs in , or 21—23 nucleotide pairs in length. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotide pairs in length.

In some embodiments, the dsRNA agent of the invention has a duplex region of 12—40 nucleotides pairs in length, wherein the antisense strand contains at least one thermally destabilizing nucleotide, and where the at least one lly destabilizing nucleotide is in the seed region of the antisense strand (i. e., at position 2—9 of the 5’—end of the antisense ), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—ﬂuoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—fluoro modifications; (v) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; and (vi) the dsRNA comprises at least four 2’— ﬂuoro modifications; and (vii) the dsRNA comprises a blunt end at 5’—end of the antisense strand. In some particular embodiments, the duplex region is 18, 19, 20, 21, 22 or 23 nucleotides pairs in length. In a particular embodiment, the duplex region is 21 nucleotide pairs in length.

In some embodiments, the dsRNA agent of the invention comprises one or more overhang regions and/or capping groups of dsRNA agent at the 3’—end, or 5’—end or both ends of a strand. The overhang can be 1—10 nucleotides in , 1—6 nucleotides in length, for ce 2—6 nucleotides in length, 1—5 nucleotides in length, 2—5 nucleotides in length, 1—4 nucleotides in length, 2—4 nucleotides in length, 1—3 nucleotides in length, 2—3 nucleotides in length, or 1—2 nucleotides in length. The overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered. The overhang can form a ch with the target mRNA or it can be mentary to the gene sequences being targeted or can be other sequence. The first and second strands can also be joined, e.g., by additional bases to form a n, or by other non—base linkers.

In some embodiments, the nucleotides in the overhang region of the dsRNA agent of the invention can each independently be a modified or unmodified nucleotide including, but not limited to 2’—sugar modified, such as, 2—F 2’—Omethyl, thymidine (T), 2’—O— methoxyethyl—5—methyluridine (Teo), ethoxyethyladenosine (Aeo), 2’—O— methoxyethyl—5—methylcytidine (m5Ceo), and any ations thereof. For example, TT can be an overhang sequence for either end on either strand. The overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be other sequence.

The 5’— or 3’— overhangs at the sense strand, antisense strand or both strands of the dsRNA agent of the invention may be phosphorylated. In some embodiments, the overhang region contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or ent. In some embodiments, the overhang is t at the 3’—end of the sense strand, antisense strand or both strands. In some embodiments, this 3’—overhang is present in the antisense strand. In some embodiments, this 3’—overhang is present in the sense strand.

The dsRNA agent of the ion may comprise only a single overhang, which can strengthen the interference activity of the dsRNA, without affecting its overall ity. For example, the —stranded overhang is located at the 3'—terminal end of the sense strand or, alternatively, at the 3'—terminal end of the antisense strand. The dsRNA may also have a blunt end, located at the 5’—end of the antisense strand (or the 3’—end of the sense strand) or vice versa. Generally, the antisense strand of the dsRNA has a nucleotide overhang at the 3’— end, and the 5’—end is blunt. While not bound by theory, the asymmetric blunt end at the 5’— end of the antisense strand and 3’—end overhang of the antisense strand favor the guide strand loading into RISC process. For example the single overhang ses at least two, three, four, five, six, seven, eight, nine, or ten nucleotides in length. In some ments, the dsRNA has a 2 nucleotide overhang on the 3’—end of the antisense strand and a blunt end at the 5’—end of the antisense strand.

In some embodiments, one end of the dsRNA is a blunt end and the other end has an overhang, wherein the nse strand contains at least one thermally destabilizing nucleotide, and where the at least one lly destabilizing nucleotide is in the seed region of the antisense strand (i. e., at position 2—9 of the 5’—end of the nse strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—ﬂuoro modifications; (ii) the antisense ses 1, 2, 3 or 4 phosphorothioate intemucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—fluoro modifications; (v) the sense strand comprises 1, 2, 3 or 4 phosphorothioate intemucleotide linkages; (vi) the dsRNA comprises at least four 2’—ﬂuoro modifications; (vii) and the dsRNA comprises a duplex region of 12—40 nucleotide pairs in length. In some embodiments, the overhang is on the 3’—end of the antisense strand and the blunt end is at the ’—end of the nse strand. In some ular embodiments, the overhang is 2, 3 or 4— nucleotides in length.

In some embodiments, the dsRNA agent has a duplex region of 19, 21, 22 or 23 nucleotide base pairs in length, wherein one end of the dsRNA is a blunt end and the other end has an ng, wherein the antisense strand contains at least one lly destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, five or all six) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—ﬂuoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—ﬂuoro modifications; (v) the sense strand comprises 1, 2, 3 or 4 phosphorothioate ucleotide linkages; and (vi) the dsRNA comprises at least four 2’—ﬂuoro modifications, and optionally the 2 nucleotide overhang is on the 3’—end of the antisense strand and the blunt end is at the 5’—end of the antisense strand.

In some embodiments, the overhang is on the 3’—end of the antisense strand and the blunt end is at the 5’—end of the nse strand.

In some embodiments, the dsRNA has a blunt end at both ends of the duplex, wherein the antisense strand contains at least one thermally destabilizing tide, and where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (i. e., at position 2—9 of the 5’—end of the antisense ), and n the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—ﬂuoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—ﬂuoro modifications; (V) the sense strand ses 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2’—ﬂuoro modifications; and (vii) the dsRNA comprises a duplex region of 12—40 nucleotide pairs in length.

In some embodiments, the dsRNA agent has a duplex region of 19, 21, 22 or 23 nucleotide base pairs in length and has a blunt end at both ends of the , wherein one end of the dsRNA is a blunt end and the other end has an overhang, wherein the antisense strand contains at least one thermally destabilizing cation of the duplex located in the seed region of the antisense strand (i.e., at on 2—9 of the 5’—end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, five or all six) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—ﬂuoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate intemucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 oro modifications; (V) the sense strand comprises 1, 2, 3 or 4 phosphorothioate intemucleotide linkages; and (vi) the dsRNA comprises at least four 2’—ﬂuoro cations.

In some embodiments, the antisense strand ses at least one (e.g., one, two, three, four, five or more) thermally destabilizing modification of the duplex within the first 9 nucleotide positions of the 5’ region of the antisense strand. In some embodiments, thermally destabilizing modification of the duplex is located in positions 2—9, or preferably positions 4— 8, from the 5’—end of the antisense . In some r embodiments, the thermally destabilizing modification of the duplex is located at position 6, 7 or 8 from the 5’—end of the antisense strand. In still some further embodiments, the thermally ilizing modification of the duplex is located at position 7 from the 5’—end of the antisense strand. The term "thermally ilizing modification(s)" includes modification(s) that would result with a dsRNA with a lower overall melting temperature (Tm) (preferably a Tm with one, two, three or four degrees lower than the Tm of the dsRNA without having such modification(s).

The thermally destabilizing modifications can include, but are not limited to, abasic modification; mismatch with the opposing nucleotide in the opposing strand; and sugar modification such as 2’—deoxy modification or acyclic nucleotide, e.g., unlocked nucleic acids (UNA) or glycol nucleic acid (GNA).

Exemplified abasic cations include, but are not limited to the follwoing: \\ , \ ll? \0 we a?O we B? 9 9 <9 <9 0\ l : : : ‘o ‘o o FA* * ' Ru R R' R * R * JVVV JWV 0 i i .

O O Y '7-{0 O\ /O Ox; 571,0 X "((3 Mod3 Mod4 Mod5 (2'-0Me - (3 'OMe), (5 'Me). (Hyp-spacer) Spacer) X = OMe, F wherein B is a modified or unmodified nucleobase.

Exemplified sugar modifications include, but are not limited to the following: \ \\ b B \ﬁNH W V"? "OH" o o R O unlocked nucleic acid 2'-deoxy glycol nucleic acid R: H, OH, O-alkyl R: H, OH, O-alkyl \‘b Rm * B o o 0 B 0—,, ,/ o 0 O o R ed c acid : R: H, OH, CH3, CHZCH3, O—alkyl, NH2, NHMe, NMe2 R O ' R‘ = H, OH, CH3, CHZCHS, O-alkyl, NH2, NHMe, NMe2 ? = H, OH, CH3, CHZCHa, O—alkyl, NH2, NHMe, NMez glycol nucleic acid R; R = H, methyl, ethyl R= H, OH, O-alkyl R = H, OH, CH3, CH20H3, O-alkyl, NH2, NHMe, NMe2 = H, OH, CH3, CHZCHa, O—alkyl, NH2, NHMe, NMez wherein B is a modified or unmodified nucleobase.

In some embodiments the thermally destabilizing modification of the duplex is lO ed from the group consisting of: 140V"? B 310% b 0?; and 7 W4" 0:: wherein B is a modified or unmodified nucleobase.

The term "acyclic nucleotide" refers to any nucleotide having an c ribose sugar, for example, where any of bonds between the ribose carbons (e.g., Cl’—C2’, C2’—C3’, C3’— C4’, C4’—O4’, or Cl’—O4’) is absent and/or at least one of ribose carbons or oxygen (e.g., Cl’, C2’, C3’, C4’ or 04’) are independently or in combination absent from the nucleotide.

"PM W?" ".W' O O O B B B 0* O R1 R2 ZR2 R1 R2 In some ments, acyclic nucleotide 1s , , , 9% B NE; W O O ,0 R‘ E 7"" \ . . . . . . or wherein B is a modified or fied nucleobase, R1 and R2 independently are H, halogen, 0R3, or alkyl; and R3 is H, alkyl, cycloalkyl, aryl, aralkyl, aryl or sugar). The term "UNA" refers to unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar" residue. In one example, UNA also encompasses monomers with bonds between Cl'—C4' being removed (i. e. the covalent carbon—oxygen—carbon bond between the Cl' and C4' s). In another example, the C2'—C3' bond (Le. the covalent carbon—carbon bond between the C2' and C3' carbons) of the sugar is removed (see Mikhailov et. al., Tetrahedron Letters, 26 (17): 2059 (1985); and Fluiter et al., Mol. Biosyst., 10: 1039 , which are hereby incorporated by reference in their entirety). The acyclic tive provides greater ne flexibility without affecting the Watson—Crick pairings. The acyclic nucleotide can be linked via 2’—5’ or 3’—5’ linkage.

The term ‘GNA’ refers to glycol c acid which is a polymer similar to DNA or RNA but differing in the composition of its "backbone" in that is composed of repeating glycerol units linked by phosphodiester bonds: tij—GXA The lly destabilizing modification of the duplex can be mismatches (i.e., noncomplementary base pairs) between the thermally destabilizing nucleotide and the opposing nucleotide in the opposite strand within the dsRNA duplex. ary mismatch base pairs include GzG, GA, GU, GzT, A:A, AzC, CzC, CzU, CzT, U:U, TzT, U:T, or a ation thereof. Other mismatch base pairings known in the art are also amenable to the present invention. A mismatch can occur between nucleotides that are either naturally occurring nucleotides or modified nucleotides, Le. the mismatch base pairing can occur between the nucleobases from respective nucleotides independent of the cations on the ribose sugars of the nucleotides. In certain embodiments, the dsRNA agent contains at least one nucleobase in the mismatch pairing that is a 2’—deoxy nucleobase; e.g., the 2’—deoxy nucleobase is in the sense strand.

In some embodiments, the thermally destabilizing modification of the duplex in the seed region of the antisense strand includes nucleotides with impaired W—C H—bonding to mentary base on the target mRNA, such as: \N/ \NH \N/ H2N)\\N IN \N| EEEIE lfut/[N> KN/ N mN/ N J. "J" "L. "L.

HN/ \N/ o O 0 N2) H J] ENCO N O \ \N o N o N/ N \ N I Y | | N>\ I R g O N N / N O N N N N ,1" .1. ,1" Jw 4~ \ N \ \ \ N I/ \> \ N I \> m m I \> I \> N’ N N N N N N N N/ N N/ N W1" AN AN "L. A" A" More examples of abasic nucleotide, acyclic nucleotide modifications (including UNA and GNA), and mismatch modifications have been described in detail in WC 201 1/133876, which is herein incorporated by reference in its entirety.

The lly destabilizing modifications may also include universal base with reduced or abolished capability to form hydrogen bonds with the opposing bases, and phosphate modifications.

In some embodiments, the thermally destabilizing modification of the duplex includes nucleotides with nonical bases such as, but not d to, nucleobase modifications with impaired or completely abolished capability to form hydrogen bonds with bases in the opposite . These base modifications have been evaluated for ilization of the l region of the dsRNA duplex as described in incorporated by reference in its entirety. Exemplary nucleobase modifications are: N N N NH \N \N <’ / I i GO < I A N N/ T N T N NHZ inosine nebularine 2-aminopurine N02 F N02 CH3 / N | / \ —CH2-COOH O=F:’-R O=F:’—NH-R O=F:’ O—R . C.) (.3 C.) C.) .

R=alky| The alkyl for the R group can be a C1—C6alkyl. Specific alkyls for the R group include, but are not lmited to methyl, ethyl, propyl, isopropyl, butyl, pentyl and hexyl.

In addition to the antisense strand sing a thermally destabilizing modification, the dsRNA can also comprise one or more stabilizing modifications. For example, the dsRNA can comprise at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) izing modifications. Without limitations, the stabilizing modifications all can be present in one strand. In some embodiments, both the sense and the antisense strands se at least two stabilizing modifications. The stabilizing modification can occur on any nucleotide of the sense strand or nse strand. For instance, the stabilizing modification can occur on every nucleotide on the sense strand and/or antisense strand; each stabilizing modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both izing modification in an alternating pattern. The alternating pattern of the stabilizing modifications on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the stabilizing modifications on the sense strand can have a shift relative to the alternating pattern of the stabilizing modifications on the antisense strand.

In some embodiments, the nse strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications. Without limitations, a stabilizing modification in the antisense strand can be present at any positions. In some embodiments, the antisense comprises stabilizing modifications at positions 2, 6, 8, 9, l4 and 16 from the 5’—end. In some other embodiments, the antisense comprises stabilizing modifications at positions 2, 6, l4 and 16 from the 5’—end. In still some other embodiments, the antisense comprises stabilizing modifications at positions 2, l4 and 16 from the 5’—end.

In some embodiments, the antisense strand comprises at least one stabilizing modification adjacent to the destabilizing modification. For example, the stabilizing modification can be the nucleotide at the 5’—end or the 3’—end of the destabilizing modification, i.e., at on —l or +1 from the position of the destabilizing modification. In some embodiments, the antisense strand comprises a stabilizing modification at each of the ’—end and the 3’—end of the destabilizing cation, i. 6., positions —l and +1 from the position of the destabilizing modification.

In some embodiments, the antisense strand ses at least two stabilizing modifications at the 3’—end of the destabilizing modification, i.e., at positions +1 and +2 from the on of the destabilizing modification.

In some embodiments, the sense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) stabilizing modifications. t tions, a stabilizing modification in the sense strand can be present at any positions. In some embodiments, the sense strand comprises stabilizing modifications at positions 7, 10 and ll from the . In some other embodiments, the sense strand comprises stabilizing modifications at positions 7, 9, 10 and ll from the 5 ’—end. In some embodiments, the sense strand comprises stabilizing modifications at positions opposite or complimentary to positions 11, 12 and 15 of the antisense strand, counting from the 5’—end of the antisense strand. In some other embodiments, the sense strand comprises stabilizing modifications at positions opposite or mentary to positions 11, 12, 13 and 15 of the antisense strand, ng from the 5’—end of the antisense strand. In some embodiments, the sense strand comprises a block of two, three or four stabilizing modifications.

In some embodiments, the sense strand does not comprise a stabilizing modification in position opposite or complimentary to the thermally destabilizing modification of the duplex in the antisense strand.

Exemplary thermally stabilizing modifications include, but are not limited to 2’—ﬂuoro modifications.

In some embodiments, the dsRNA of the invention comprises at least four (e.g., four, five, six, seven, eight, nine, ten or more) ro nucleotides. Without limitations, the 2’— ﬂuoro nucleotides all can be present in one . In some embodiments, both the sense and the antisense strands comprise at least two 2’—ﬂuoro tides. The 2’—ﬂuoro modification can occur on any nucleotide of the sense strand or nse strand. For instance, the 2’— ﬂuoro modification can occur on every tide on the sense strand and/or antisense strand; each 2’—ﬂuoro modification can occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both 2’—ﬂuoro modifications in an alternating n. The alternating pattern of the 2’—ﬂuoro modifications on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the 2’—ﬂuoro modifications on the sense strand can have a shift relative to the alternating pattern of the 2’—ﬂuoro modifications on the antisense .

In some embodiments, the antisense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) 2’—ﬂuoro nucleotides. Without limitations, a 2’—fluoro modification in the antisense strand can be present at any positions. In some embodiments, the antisense comprises 2’—ﬂuoro nucleotides at positions 2, 6, 8, 9, 14 and 16 from the . In some other embodiments, the antisense comprises 2’—ﬂuoro nucleotides at ons 2, 6, 14 and 16 from the . In still some other embodiments, the antisense comprises 2’—fluoro tides at positions 2, 14 and 16 from the 5 ’—end.

In some embodiments, the antisense strand ses at least one 2’—ﬂuoro nucleotide adjacent to the destabilizing modification. For example, the 2’—fluoro nucleotide can be the nucleotide at the 5’—end or the 3’—end of the destabilizing modification, i.e., at position —1 or +1 from the on of the destabilizing modification. In some embodiments, the antisense strand comprises a 2’—ﬂuoro nucleotide at each of the 5’—end and the 3’—end of the destabilizing modification, i.e., positions —1 and +1 from the position of the destabilizing modification.

In some embodiments, the antisense strand comprises at least two 2’—ﬂuoro nucleotide at the 3’—end of the ilizing modification, i.e., at positions +1 and +2 from the position of the ilizing modification.

In some embodiments, the sense strand comprises at least two (e.g., two, three, four, five, six, seven, eight, nine, ten or more) 2’—ﬂuoro nucleotides. Without limitations, a 2’— ﬂuoro modification in the sense strand can be present at any positions. In some embodiments, the antisense comprises 2’—ﬂuoro nucleotides at positions 7, 10 and ll from the 5’—end. In some other embodiments, the sense strand comprises 2’—ﬂuoro nucleotides at positions 7, 9, 10 and ll from the 5 ’—end. In some embodiments, the sense strand comprises oro nucleotides at positions opposite or complimentary to positions ll, 12 and 15 of the antisense strand, counting from the 5’—end of the antisense strand. In some other embodiments, the sense strand comprises 2’—ﬂuoro nucleotides at positions opposite or complimentary to positions ll, l2, l3 and 15 of the nse , counting from the 5 ’— end of the nse strand. In some embodiments, the sense strand comprises a block of two, three or four 2’—ﬂuoro nucleotides.

In some embodiments, the sense strand does not comprise a ro nucleotide in position opposite or complimentary to the thermally destabilizing modification of the duplex in the antisense strand.

In some embodiments, the dsRNA agent of the invention comprises a 21 nucleotides (nt) sense strand and a 23 tides (nt) antisense, wherein the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide occurs in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the antisense strand), wherein one end of the dsRNA is blunt, while the other end is comprises a 2 nt ng, and wherein the dsRNA ally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense ses 2, 3, 4, 5 or 6 ro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—ﬂuoro modifications; (v) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2’—ﬂuoro modifications; and (vii) the dsRNA comprises a blunt end at 5’—end of the antisense strand. Preferably, the 2 nt ng is at the 3’—end of the antisense.

In some embodiments, the dsRNA agent of the invention comprising a sense and antisense strands, wherein: the sense strand is 25—30 nucleotide residues in length, wherein starting from the 5' al nucleotide (position 1), positions 1 to 23 of said sense strand comprise at least 8 ribonucleotides; nse strand is 36—66 tide residues in length and, starting from the 3' terminal nucleotide, at least 8 ribonucleotides in the positions paired with positions 1— 23 of sense strand to form a duplex; wherein at least the 3 ' terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3' terminal nucleotides are unpaired with sense strand, thereby forming a 3' single stranded overhang of 1—6 nucleotides; wherein the 5' terminus of antisense strand comprises from 10— consecutive nucleotides which are unpaired with sense strand, thereby forming a 10—30 nucleotide single stranded 5' ng; wherein at least the sense strand 5' al and 3' terminal nucleotides are base paired with nucleotides of antisense strand when sense and antisense strands are aligned for maximum complementarity, thereby forming a ntially duplexed region between sense and antisense strands; and antisense strand is sufficiently complementary to a target RNA along at least 19 ribonucleotides of antisense strand length to reduce target gene expression when said double stranded nucleic acid is introduced into a mammalian cell; and wherein the antisense strand contains at least one thermally ilizing tide, where at least one thermally ilizing nucleotide is in the seed region of the antisense strand (i. e. at position 2—9 of the 5’—end of the antisense ), For example, the thermally destabilizing nucleotide occurs between positions opposite or mentary to positions 14—17 of the 5’—end of the sense strand, and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—ﬂuoro modifications; (ii) the antisense ses 1, 2, 3 or 4 phosphorothioate intemucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—ﬂuoro cations; (v) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; and (vi) the dsRNA comprises at least four 2’—fluoro modifications; and (vii) the dsRNA comprises a duplex region of 12—30 nucleotide pairs in length.

In some embodiments, the dsRNA agent of the invention comprises a sense and antisense s, wherein said dsRNA agent comprises a sense strand having a length which is at least 25 and at most 29 nucleotides and an antisense strand having a length which is at most 30 nucleotides with the sense strand comprises a modified tide that is susceptible to enzymatic degradation at position ll from the 5’end, wherein the 3’ end of said sense strand and the 5’ end of said antisense strand form a blunt end and said antisense strand is 1—4 nucleotides longer at its 3’ end than the sense , wherein the duplex region which is at least 25 nucleotides in length, and said antisense strand is iently complementary to a target mRNA along at least 19 nt of said antisense strand length to reduce target gene expression when said dsRNA agent is introduced into a mammalian cell, and wherein dicer cleavage of said dsRNA preferentially results in an siRNA comprising said 3’ end of said antisense , thereby reducing expression of the target gene in the mammal, wherein the antisense strand contains at least one thermally destabilizing nucleotide, where the at least one thermally destabilizing nucleotide is in the seed region of the antisense strand (Le. at position 2—9 of the 5’—end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following teristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—fluoro modifications; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—ﬂuoro modifications; (V) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; and (vi) the dsRNA comprises at least four 2’—fluoro modifications; and (vii) the dsRNA has a duplex region of 12—29 nucleotide pairs in length.

In some embodiments, every nucleotide in the sense strand and antisense strand of the dsRNA agent may be modified. Each nucleotide may be ed with the same or different cation which can e one or more alteration of one or both of the non—linking ate oxygens and/or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2’ hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with "dephospho" linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose—phosphate As nucleic acids are polymers of ts, many of the modifications occur at a position which is repeated within a nucleic acid, e.g., a modification of a base, or a phosphate , or a non—linking O of a phosphate moiety. In some cases the modification will occur at all of the subject positions in the nucleic acid but in many cases it will not. By way of example, a modification may only occur at a 3’ or 5’ terminal on, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand. A modification may occur in a double strand region, a single strand region, or in both. A modification may occur only in the double strand region of a RNA or may only occur in a single strand region of a RNA. E.g., a phosphorothioate modification at a non—linking 0 position may only occur at one or both termini, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini. The ’ end or ends can be phosphorylated.

It may be possible, e.g., to enhance ity, to include ular bases in overhangs, or to include modified nucleotides or tide surrogates, in single strand overhangs, e.g., in a 5’ or 3’ overhang, or in both. E. g., it can be desirable to include purine tides in overhangs. In some embodiments all or some of the bases in a 3’ or 5’ overhang may be modified, e.g., with a modification described herein. Modifications can include, e.g., the use of modifications at the 2’ position of the ribose sugar with modifications that are known in the art, e.g., the use of deoxyribonucleotides, 2’—deoxy—2’—fluoro (2’—F) or 2’—O—methyl modified instead of the ribosugar of the nucleobase, and modifications in the phosphate group, e.g., phosphorothioate modifications. ngs need not be homologous with the target sequence.

In some embodiments, each residue of the sense strand and nse strand is independently modified with LNA, HNA, CeNA, 2’—methoxyethyl, 2’— O—methyl, 2’—O—allyl, 2’—C— allyl, 2’—deoxy, or 2’—fluoro. The strands can contain more than one modification. In some embodiments, each residue of the sense strand and nse strand is independently modified with ethyl or 2’—fluoro. It is to be understood that these modifications are in addition to the at least one thermally destabilizing modification of the duplex present in the antisense strand.

At least two different modifications are typically present on the sense strand and antisense . Those two modifications may be the 2’—deoxy, 2’— O—methyl or ro modifications, acyclic nucleotides or others. In some embodiments, the sense strand and antisense strand each comprises two differently modified nucleotides selected from 2’—O— methyl or 2’—deoxy. In some embodiments, each residue of the sense strand and antisense strand is independently modified with 2'—O—methyl nucleotide, 2’—deoxy nucleotide, 2’— deoxyfluoro nucleotide, 2'—O—N—methylacetamido (2'—O—NMA) nucleotide, a 2—0— ylaminoethoxyethyl (2'—O—DMAEOE) nucleotide, 2'—O—aminopropyl (2'—O—AP) nucleotide, or 2'—ara—F nucleotide. Again, it is to be understood that these modifications are in addition to the at least one thermally destabilizing modification of the duplex present in the antisense strand.

In some embodiments, the dsRNA agent of the invention comprises modifications of an alternating pattern, particular in the Bl, B2, B3, Bl’, B2’, B3’, B4’ regions. The term "alternating motif ’ or "alternative pattern" as used herein refers to a motif having one or more modifications, each modification occurring on alternating nucleotides of one strand.

The alternating nucleotide may refer to one per every other nucleotide or one per every three nucleotides, or a similar pattern. For example, if A, B and C each represent one type of modification to the nucleotide, the alternating motif can be "ABABABABABAB. . .," "AABBAABBAABB...," "AABAABAABAAB...," "AAABAAABAAAB...," "AAABBBAAABBB...," or "ABCABCABCABC. . .," etc.

The type of modifications contained in the alternating motif may be the same or ent. For example, if A, B, C, D each represent one type of cation on the nucleotide, the alternating pattern, i. e., modifications on every other nucleotide, may be the same, but each of the sense strand or antisense strand can be selected from several possibilities of modifications within the alternating motif such as "ABABAB. . .", "ACACAC. . ." "BDBDBD. . ." or "CDCDCD. . .," etc.

In some ments, the dsRNA agent of the invention comprises the modification pattern for the alternating motif on the sense strand ve to the cation pattern for the alternating motif on the antisense strand is shifted. The shift may be such that the ed group of tides of the sense strand corresponds to a differently modified group of nucleotides of the antisense strand and vice versa. For example, the sense strand when paired with the antisense strand in the dsRNA duplex, the ating motif in the sense strand may start with "ABABAB" from 5’—3’ of the strand and the alternating motif in the antisense strand may start with "BABABA" from 3’—5’of the strand within the duplex region. As another example, the alternating motif in the sense strand may start with "AABBAABB" from 5’—3’ of the strand and the ating motif in the nse strand may start with "BBAABBAA" from 3’—5’of the strand within the duplex , so that there is a te or partial shift of the cation patterns between the sense strand and the nse .

The dsRNA agent of the invention may further comprise at least one phosphorothioate or methylphosphonate intemucleotide linkage. The phosphorothioate or methylphosphonate intemucleotide linkage modification may occur on any nucleotide of the sense strand or antisense strand or both in any position of the strand. For instance, the intemucleotide linkage modification may occur on every nucleotide on the sense strand and/or antisense strand; each internucleotide linkage modification may occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand comprises both intemucleotide linkage modifications in an alternating pattern. The alternating pattern of the intemucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the internucleotide linkage modification on the sense strand may have a shift ve to the alternating pattern of the intemucleotide linkage modification on the antisense strand.

In some embodiments, the dsRNA agent comprises the phosphorothioate or methylphosphonate internucleotide linkage modification in the overhang region. For example, the overhang region comprises two nucleotides having a phosphorothioate or methylphosphonate internucleotide linkage between the two nucleotides. Internucleotide linkage modifications also may be made to link the overhang nucleotides with the terminal paired nucleotides within duplex . For e, at least 2, 3, 4, or all the overhang nucleotides may be linked through phosphorothioate or methylphosphonate intemucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate intemucleotide linkages linking the overhang nucleotide with a paired tide that is next to the overhang nucleotide. For instance, there may be at least two phosphorothioate intemucleotide linkages between the terminal three nucleotides, in which two of the three nucleotides are overhang nucleotides, and the third is a paired nucleotide next to the overhang nucleotide. Preferably, these terminal three nucleotides may be at the 3’—end of the antisense strand.

In some embodiments, the sense strand of the dsRNA agent comprises l—lO blocks of two to ten phosphorothioate or methylphosphonate internucleotide linkages separated by l, 2, 3, 4, 5, 6, 7, 8, 9, 10, ll, l2, l3, l4, 15 or 16 phosphate intemucleotide linkages, wherein one of the phosphorothioate or methylphosphonate ucleotide linkages is placed at any on in the oligonucleotide sequence and the said sense strand is paired with an antisense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either orothioate or methylphosphonate or ate linkage.

In some embodiments, the antisense strand of the dsRNA agent comprises two blocks of two phosphorothioate or methylphosphonate internucleotide linkages separated by l, 2, 3, 4, 5, 6, 7, 8, 9, 10, ll, l2, l3, l4, l5, l6, 17, or 18 phosphate internucleotide linkages, wherein one of the phosphorothioate or phosphonate internucleotide linkages is placed at any position in the ucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate ucleotide linkages or an antisense strand comprising either orothioate or methylphosphonate or phosphate linkage.

In some embodiments, the antisense strand of the dsRNA agent comprises two blocks of three phosphorothioate or methylphosphonate internucleotide linkages separated by l, 2, 3, 4, 5, 6, 7, 8, 9, 10, ll, l2, l3, l4, 15 or 16 ate internucleotide linkages, wherein one of the phosphorothioate or phosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

In some embodiments, the antisense strand of the dsRNA agent comprises two blocks of four orothioate or methylphosphonate ucleotide linkages separated by l, 2, 3, 4, 5, 6, 7, 8, 9, 10, ll, l2, 13 or 14 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

In some embodiments, the antisense strand of the dsRNA agent comprises two blocks of five phosphorothioate or methylphosphonate internucleotide es separated by l, 2, 3, 4, 5, 6, 7, 8, 9, 10, ll or 12 phosphate internucleotide linkages, wherein one of the orothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said nse strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate e.

In some embodiments, the antisense strand of the dsRNA agent comprises two blocks of six phosphorothioate or methylphosphonate internucleotide linkages separated by l, 2, 3, 4, 5, 6, 7, 8, 9 or 10 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate ucleotide es is placed at any on in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or ate linkage.

In some embodiments, the antisense strand of the dsRNA agent comprises two blocks of seven phosphorothioate or methylphosphonate internucleotide es separated by l, 2, 3, 4, 5, 6, 7 or 8 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide ce and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or phosphate linkage.

In some embodiments, the antisense strand of the dsRNA agent comprises two blocks of eight phosphorothioate or methylphosphonate internucleotide linkages separated by l, 2, 3, 4, 5 or 6 phosphate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate ucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand comprising any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand comprising either phosphorothioate or methylphosphonate or ate linkage.

In some embodiments, the antisense strand of the dsRNA agent comprises two blocks of nine phosphorothioate or methylphosphonate internucleotide linkages separated by l, 2, 3 or 4 ate internucleotide linkages, wherein one of the phosphorothioate or methylphosphonate internucleotide linkages is placed at any position in the oligonucleotide sequence and the said antisense strand is paired with a sense strand sing any combination of phosphorothioate, methylphosphonate and phosphate internucleotide linkages or an antisense strand sing either phosphorothioate or phosphonate or phosphate linkage.

In some embodiments, the dsRNA agent of the invention further comprises one or more orothioate or methylphosphonate internucleotide linkage modification within l— of the termini position(s) of the sense and/or antisense strand. For example, at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides may be linked through phosphorothioate or methylphosphonate ucleotide linkage at one end or both ends of the sense and/or antisense strand.

In some embodiments, the dsRNA agent of the invention further comprises one or more phosphorothioate or methylphosphonate ucleotide linkage modification within l— of the internal region of the duplex of each of the sense and/or antisense strand. For example, at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides may be linked through phosphorothioate phosphonate internucleotide linkage at on 8—16 of the duplex region counting from the 5’—end of the sense strand; the dsRNA agent can optionally further comprise one or more phosphorothioate or methylphosphonate internucleotide linkage modification within 1—10 of the termini position(s).

In some embodiments, the dsRNA agent of the invention further comprises one to five orothioate or methylphosphonate internucleotide linkage modification(s) within position 1—5 and one to five phosphorothioate or methylphosphonate internucleotide linkage modification(s) within position 18—23 of the sense strand ing from the 5’—end), and one to five phosphorothioate or methylphosphonate internucleotide linkage modification at positions 1 and 2 and one to five within positions 18—23 of the antisense strand (counting from the 5’—end).

In some embodiments, the dsRNA agent of the ion further comprises one phosphorothioate internucleotide linkage cation within position 1—5 and one phosphorothioate or methylphosphonate internucleotide linkage cation within position 18—23 of the sense strand (counting from the 5’—end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate or methylphosphonate internucleotide linkage modifications within positions 18—23 of the antisense strand (counting from the 5’—end).

In some embodiments, the dsRNA agent of the invention further comprises two phosphorothioate ucleotide linkage cations within position 1—5 and one phosphorothioate internucleotide linkage modification within position 18—23 of the sense strand (counting from the 5’—end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18—23 of the antisense strand (counting from the 5’—end).

In some ments, the dsRNA agent of the invention further comprises two phosphorothioate internucleotide linkage modifications within on 1—5 and two phosphorothioate internucleotide linkage modifications within position 18—23 of the sense strand (counting from the 5’—end), and one phosphorothioate internucleotide linkage modification at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within ons 18—23 of the antisense strand ing from the 5’—end).

In some embodiments, the dsRNA agent of the invention further comprises two orothioate internucleotide linkage modifications within position 1—5 and two phosphorothioate internucleotide linkage modifications within position 18—23 of the sense strand (counting from the 5’—end), and one orothioate internucleotide linkage modification at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18—23 of the antisense strand (counting from the 5’—end).

In some embodiments, the dsRNA agent of the invention further comprises one phosphorothioate ucleotide linkage modification within position 1—5 and one orothioate internucleotide e modification within on 18—23 of the sense strand (counting from the 5’—end), and two phosphorothioate intemucleotide e modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18—23 of the antisense strand (counting from the 5’—end).

In some embodiments, the dsRNA agent of the invention further comprises one phosphorothioate internucleotide linkage modification within position 1—5 and one within position 18—23 of the sense strand (counting from the 5’—end), and two phosphorothioate intemucleotide linkage modification at positions 1 and 2 and one phosphorothioate intemucleotide linkage modification within positions 18—23 of the antisense strand (counting from the 5’—end).

In some embodiments, the dsRNA agent of the invention further comprises one phosphorothioate internucleotide linkage modification within on l—5 (counting from the 5’—end) of the sense strand, and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and one phosphorothioate internucleotide linkage modification within positions 18—23 of the antisense strand (counting from the 5’—end).

In some embodiments, the dsRNA agent of the invention further comprises two phosphorothioate ucleotide linkage modifications within position l—5 (counting from the ) of the sense strand, and one phosphorothioate internucleotide linkage cation at positions 1 and 2 and two phosphorothioate intemucleotide linkage modifications within positions 18—23 of the nse strand (counting from the 5’—end).

In some embodiments, the dsRNA agent of the invention further comprises two phosphorothioate internucleotide linkage cations within position 1—5 and one within position 18—23 of the sense strand (counting from the 5’—end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and one phosphorothioate intemucleotide linkage modification within positions 18—23 of the antisense strand (counting from the 5’—end).

In some ments, the dsRNA agent of the invention further comprises two phosphorothioate internucleotide linkage modifications within on 1—5 and one phosphorothioate internucleotide linkage modification within position 18—23 of the sense strand (counting from the 5’—end), and two orothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications within positions 18—23 of the antisense strand (counting from the 5’—end).

In some embodiments, the dsRNA agent of the ion further ses two phosphorothioate internucleotide linkage modifications within on 1—5 and one phosphorothioate internucleotide linkage modification within position 18—23 of the sense strand (counting from the 5’—end), and one phosphorothioate intemucleotide linkage modification at positions 1 and 2 and two phosphorothioate intemucleotide linkage modifications within positions 18—23 of the antisense strand (counting from the 5’—end).

In some embodiments, the dsRNA agent of the invention r comprises two orothioate internucleotide linkage modifications at position 1 and 2, and two phosphorothioate internucleotide linkage modifications at position 20 and 21 of the sense strand (counting from the 5’—end), and one phosphorothioate intemucleotide linkage modification at positions 1 and one at position 21 of the antisense strand (counting from the ’—end).

In some embodiments, the dsRNA agent of the invention further ses one phosphorothioate internucleotide e cation at position 1, and one phosphorothioate internucleotide linkage modification at position 21 of the sense strand (counting from the 5’—end), and two phosphorothioate ucleotide e modifications at positions 1 and 2 and two phosphorothioate internucleotide e modifications at positions 20 and 21 the antisense strand (counting from the 5’—end).

In some embodiments, the dsRNA agent of the invention further comprises two phosphorothioate internucleotide linkage modifications at position 1 and 2, and two phosphorothioate internucleotide linkage modifications at on 21 and 22 of the sense strand (counting from the ), and one phosphorothioate intemucleotide linkage modification at positions 1 and one phosphorothioate cleotide linkage modification at position 21 of the antisense strand (counting from the 5’—end).

In some embodiments, the dsRNA agent of the invention further comprises one phosphorothioate internucleotide linkage modification at position 1, and one phosphorothioate ucleotide linkage modification at position 21 of the sense strand (counting from the 5’—end), and two orothioate internucleotide e modifications at positions 1 and 2 and two phosphorothioate internucleotide linkage modifications at positions 21 and 22 the antisense strand ing from the 5’—end).

In some embodiments, the dsRNA agent of the invention further comprises two phosphorothioate internucleotide linkage modifications at position 1 and 2, and two phosphorothioate internucleotide linkage modifications at position 22 and 23 of the sense strand (counting from the 5’—end), and one phosphorothioate intemucleotide linkage modification at positions 1 and one phosphorothioate intemucleotide linkage modification at position 21 of the antisense strand (counting from the ).

In some embodiments, the dsRNA agent of the invention further comprises one phosphorothioate internucleotide linkage modification at position 1, and one phosphorothioate internucleotide linkage modification at position 21 of the sense strand (counting from the 5’—end), and two orothioate internucleotide linkage modifications at positions 1 and 2 and two phosphorothioate internucleotide e modifications at positions 23 and 23 the antisense strand (counting from the 5’—end).

In some embodiments, the antisense strand comprises orothioate internucleotide linkages n nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i. e., at position 2—9 of the 5’—end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—fluoro modifications; (ii) the antisense comprises 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—ﬂuoro modifications; (V) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2’—fluoro modifications; (vii) the dsRNA comprises a duplex region of 12—40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5’—end of the antisense strand.

In some embodiments, the nse strand comprises phosphorothioate ucleotide es between nucleotide positions 1 and 2, between nucleotide positions 2 and 3, between tide positions 21 and 22, and n nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at on 2—9 of the 5’—end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the ing characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—ﬂuoro modifications; (ii) the sense strand is conjugated with a ligand; (iii) the sense strand comprises 2, 3, 4 or 5 2’—ﬂuoro modifications; (iv) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (v) the dsRNA comprises at least four 2’—ﬂuoro modifications; (vi) the dsRNA comprises a duplex region of 12—40 nucleotide pairs in length; (vii) the dsRNA comprises a duplex region of 12—40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5’—end of the antisense In some embodiments, the sense strand comprises phosphorothioate internucleotide linkages between nucleotide ons 1 and 2, and between nucleotide positions 2 and 3, wherein the antisense strand contains at least one lly destabilizing modification of the duplex located in the seed region of the antisense strand (i.e., at position 2—9 of the 5’—end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six, seven or all eight) of the ing characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—ﬂuoro cations; (ii) the antisense comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand comprises 2, 3, 4 or 5 2’—ﬂuoro cations; (v) the sense strand comprises 3 or 4 phosphorothioate internucleotide linkages; (vi) the dsRNA comprises at least four 2’—ﬂuoro modifications; (vii) the dsRNA comprises a duplex region of 12—40 nucleotide pairs in length; and (viii) the dsRNA has a blunt end at 5’—end of the antisense strand.

In some embodiments, the sense strand comprises orothioate internucleotide linkages between nucleotide positions 1 and 2, and between nucleotide positions 2 and 3, the antisense strand comprises phosphorothioate internucleotide linkages between nucleotide positions 1 and 2, n nucleotide ons 2 and 3, between nucleotide positions 21 and 22, and between nucleotide positions 22 and 23, wherein the antisense strand contains at least one thermally destabilizing modification of the duplex located in the seed region of the antisense strand (i. e., at position 2—9 of the 5’—end of the antisense strand), and wherein the dsRNA optionally further has at least one (e.g., one, two, three, four, five, six or all seven) of the following characteristics: (i) the antisense comprises 2, 3, 4, 5 or 6 2’—ﬂuoro cations; (ii) the sense strand is conjugated with a ligand; (iii) the sense strand comprises 2, 3, 4 or 5 2’—ﬂuoro modifications; (iv) the sense strand comprises 3 or 4 phosphorothioate internucleotide es; (v) the dsRNA comprises at least four 2’—ﬂuoro modifications; (vi) the dsRNA comprises a duplex region of 12—40 nucleotide pairs in length; and (vii) the dsRNA has a blunt end at 5’—end of the antisense strand.

In some embodiments, the dsRNA agent of the invention comprises mismatch(es) with the target, within the duplex, or combinations thereof. The mismatch can occur in the overhang region or the duplex region. The base pair can be ranked on the basis of their propensity to promote iation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next or or similar analysis can also be used). In terms of promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (I=inosine). Mismatches, e.g., non—canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings.

In some embodiments, the dsRNA agent of the invention ses at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5’— end of the antisense strand can be chosen independently from the group of: A:U, G:U, I:C, and ched pairs, 6. g. non—canonical or other than canonical pairings or pairings which e a sal base, to promote the iation of the antisense strand at the 5’—end of the duplex.

In some embodiments, the nucleotide at the 1 position within the duplex region from the 5’—end in the antisense strand is selected from the group consisting of A, dA, dU, U, and dT. Alternatively, at least one of the first 1, 2 or 3 base pair within the duplex region from the 5’— end of the antisense strand is an AU base pair. For example, the first base pair within the duplex region from the 5’— end of the antisense strand is an AU base pair.

It has also ben discovered that introducing 4’—modified and/or 5’—modified nucleotide to the 3’—end of a odiester (PO), phosphorothioate (PS), and/or phosphorodithioate (P82) e of a dinucleotide at any position of single ed or double ed oligonucleotide can exert steric effect to the internucleotide linkage and, hence, protecting or stabilizing it t nucleases.

In some embodiments, 5’—modified nucleoside is introduced at the 3’—end of a dinucleotide at any position of single stranded or double stranded siRNA. For instance, a 5’— alkylated nucleoside may be uced at the 3’—end of a dinucleotide at any position of single stranded or double stranded siRNA. The alkyl group at the 5’ position of the ribose sugar can be racemic or chirally pure R or S isomer. An exemplary 5’—alkylated nucleoside is ’—methyl nucleoside. The 5’—methyl can be either racemic or chirally pure R or S isomer.

In some embodiments, 4’—modified nucleoside is introduced at the 3’—end of a dinucleotide at any position of single stranded or double stranded siRNA. For instance, a 4’— alkylated nucleoside may be introduced at the 3’—end of a eotide at any position of single stranded or double stranded siRNA. The alkyl group at the 4’ position of the ribose sugar can be racemic or chirally pure R or S isomer. An exemplary 4’—alkylated nucleoside is 4’—methyl nucleoside. The 4’—methyl can be either racemic or chirally pure R or S isomer.

Alternatively, a 4’—0-alkylated nucleoside may be uced at the 3’—end of a dinucleotide at any position of single stranded or double stranded siRNA. The 4’—0—alkyl of the ribose sugar can be racemic or chirally pure R or S isomer. An exemplary 4’—0—alkylated nucleoside is 4’—0—methyl nucleoside. The 4’—0—methyl can be either racemic or chirally pure R or S isomer.

In some ments, 5’—alkylated nucleoside is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves y of the dsRNA. The yl can be either racemic or chirally pure R or S . An ary 5’—alkylated nucleoside is 5’—methyl nucleoside. The 5’—methyl can be either racemic or chirally pure R or S isomer.

In some embodiments, 4’—alkylated nucleoside is introduced at any position on the sense strand or antisense strand of a dsRNA, and such modification maintains or improves potency of the dsRNA. The 4’—alkyl can be either racemic or chirally pure R or S isomer. An exemplary 4’—alkylated nucleoside is 4’—methyl nucleoside. The 4’—methyl can be either racemic or chirally pure R or S isomer.

In some embodiments, 4’—0—alkylated nucleoside is uced at any position on the sense strand or antisense strand of a dsRNA, and such cation maintains or improves potency of the dsRNA. The 5’—alkyl can be either racemic or chirally pure R or S isomer. An exemplary 4’—0—alkylated nucleoside is 4’—0—methyl side. The 4’—0—methyl can be either racemic or ly pure R or S isomer.

In some embodiments, the dsRNA agent of the invention can comprise 2’—5’ linkages (with 2’—H, 2’—OH and 2’—OMe and with P=O or P=S). For example, the 2’—5’ linkages modifications can be used to promote nuclease resistance or to inhibit binding of the sense to the antisense strand, or can be used at the 5’ end of the sense strand to avoid sense strand activation by RISC.

In another embodiment, the dsRNA agent of the ion can comprise L sugars (e.g., L ribose, L—arabinose with 2’—H, 2’—OH and 2’—OMe). For e, these L sugars modifications can be used to promote nuclease resistance or to inhibit binding of the sense to the antisense strand, or can be used at the 5’ end of the sense strand to avoid sense strand activation by RISC.

Various publications describe multimeric siRNA which can all be used with the dsRNA of the invention. Such publications include /091269, US Patent No. 7858769, W02010/141511, W02007/117686, W02009/014887 and W02011/031520 which are hereby incorporated by their entirely.

As discussed in detail below, the dsRNA agent that contains conjugations of one or more carbohydrate moieties to a dsRNA agent can optimize one or more properties of the dsRNA agent. In many cases, the carbohydrate moiety will be attached to a modified subunit of the dsRNA agent. 6. g. the ribose sugar of one or more ribonucleotide subunits of a dsRNA agent can be replaced with another moiety, e.g., a non—carbohydrate (preferably cyclic) r to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS). A cyclic carrier may be a carbocyclic ring , i.e., all ring atoms are carbon atoms, or a heterocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur. The cyclic carrier may be a clic ring system, or may contain two or more rings, 6. g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.

The ligand may be attached to the polynucleotide via a carrier. The carriers include (i) at least one "backbone ment point," preferably two "backbone attachment points" and (ii) at least one "tethering attachment point." A one attachment point" as used herein refers to a functional group, 6. g. a hydroxyl group, or generally, a bond available for, and that is suitable for oration of the carrier into the backbone, e. g. the phosphate, or modified ate, e.g., sulfur containing, backbone, of a ribonucleic acid. A "tethering attachment point" (TAP) in some embodiments refers to a constituent ring atom of the cyclic carrier, 6. g. , a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety. The moiety can be, e.g., a carbohydrate, e. g. monosaccharide, disaccharide, trisaccharide, accharide, oligosaccharide and polysaccharide. Optionally, the selected moiety is connected by an intervening tether to the cyclic carrier. Thus, the cyclic carrier will often include a functional group, e.g., an amino group, or generally, provide a bond, that is le for incorporation or ing of r chemical entity, e.g., a ligand to the constituent ring.

In one embodimennt the dsRNA agent of the invention is conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [l,3]dioxolane, oxazolidinyl, olidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and decalin; preferably, the acyclic group is selected from l backbone or diethanolamine backbone.

The double stranded RNA (dsRNA) agent of the invention may ally be conjugated to one or more ligands. The ligand can be attached to the sense strand, antisense strand or both strands, at the 3’—end, 5’—end or both ends. For instance, the ligand may be conjugated to the sense strand, in particular, the 3’—end of the sense strand.

In some embodiments dsRNA agents of the invention are 5’ phosphorylated or include a phosphoryl analog at the 5’ prime terminus. 5'—phosphate modifications include those which are ible with RISC ed gene silencing. Suitable modifications include: 5'—monophosphate ((HO)2(O)P—O—5'); 5'—diphosphate (O)P—O—P(HO)(O)—O— 5'); 5'—triphosphate ((HO)2(O)P—O—(HO)(O)P—O—P(HO)(O)—O—5'); 5'—guanosine cap (7— methylated or non—methylated) (7m—G—O—5'—(HO)(O)P—O—(HO)(O)P-O—P(HO)(O)—O—5'); 5'— ine cap (Appp), and any modified or fied nucleotide cap structure (N—O—5'— )P-O-(HO)(O)P—O—P(HO)(O)—O—5'); 5'—monothiophosphate (phosphorothioate; (HO)2(S)P—O—5'); 5'—monodithiophosphate horodithioate; (HO)(HS)(S)P—O—5'), 5'— phosphorothiolate ((HO)2(O)P—S—5'); any additional combination of oxygen/sulfur replaced monophosphate, diphosphate and triphosphates (e. g. 5'—alpha—thiotriphosphate, 5'—gamma— thiotriphosphate, etc.), 5'—phosphoramidates ((HO)2(O)P—NH—5', (HO)(NH2)(O)P—O—5'), 5'— alkylphosphonates (R=alkyl=methyl, ethyl, isopropyl, propyl, etc., e. g. RP(OH)(O)—O—5'—, 5'— alkenylphosphonates (i.e. vinyl, substituted vinyl), (OH)2(O)P—5'—CH2—), 5'— alkyletherphosphonates (R=alkylether=methoxymethyl (MeOCH2—), ethoxymethyl, etc., e. g.

RP(OH)(O)—O—5'—). In one example, the modification can in placed in the antisense strand of a dsRNA agent.

III. iRNAs ated t0 Ligands Another modification of the RNA of an iRNA of the invention involves chemically linking to the iRNA one or more ligands, moieties or conjugates that e the activity, cellular distribution, or cellular uptake of the iRNA e.g., into a cell. Such es include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl.

Acid. Sci. USA, 1989, 86: 6553—6556). In other embodiments, the ligand is cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053—1060), a thioether, e.g., beryl—S— tritylthiol aran et al., Ann. N. Y. Acad. Sci ., 1992, 6—309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765—2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533—538), an aliphatic chain, e. g., dodecandiol or undecyl residues (Saison— Behmoaras et al., EMBO J, 1991, 10:1111—1118; Kabanov et al., FEBS Lett., 1990, 259:327— 330; SVinarchuk et al., Biochimie, 1993, 75 :49—54), a phospholipid, e. g., di—hexadecyl—rac— glycerol or triethyl—ammonium 1,2—di—O—hexadecyl—rac—glycero—3—phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651—3654; Shea et al., Nucl. Acids Res., 1990, 18:3777— 3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969—973), or tane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651—3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229—237), or an octadecylamine or hexylamino—carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923—937).

In certain embodiments, a ligand alters the distribution, ing or lifetime of an iRNA agent into which it is incorporated. In red embodiments a ligand provides an enhanced affinity for a selected , e. g., molecule, cell or cell type, compartment, e.g., a ar or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. Preferred ligands do not take part in duplex pairing in a duplexed nucleic acid.

Ligands can include a naturally ing nce, such as a protein (e.g., human serum albumin (HSA), low—density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N—acetylglucosamine, N— acetylgalactosamine, or onic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e. g., a synthetic polyamino acid. Examples of polyamino acids e polyamino acid is a polylysine (PLL), poly L—aspartic acid, poly L—glutamic acid, styrene—maleic acid anhydride copolymer, poly(L—lactide—co—glycolied) copolymer, l ether—maleic anhydride copolymer, N—(2—hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), nyl alcohol (PVA), polyurethane, poly(2—ethylacryllic acid), ropylacrylamide polymers, or polyphosphazine. Example of polyamines include: hylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide—polyamine, peptidomimetic polyamine, dendrimer polyamine, ne, amidine, ine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.

Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e. g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N— —galactosamine, N—acetyl—gulucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent ose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, terol, a steroid, bile acid, folate, Vitamin B 12, Vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.

In one embodiment, the ligand is is an asialoglycoprotein or . As used herein an " an asialoglycoprotein or ligand" or "ASGPR ligand" is aligand, such as a carbohydrate ligand (discussed below), that targets a dsRNA agent of the invention to hepatocytes. In certain ments, the ligand is a one or more galactose, e.g., an N— acetyl—galactosamine c) or one or more GalNAc derivatives.

Other es of ligands e dyes, intercalating agents (6.g. acridines), cross— linkers (e. g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), cial cleases (e.g.

EDTA), lipophilic molecules, e.g., cholesterol, cholic acid, tane acetic acid, l—pyrene butyric acid, dihydrotestosterone, l,3—Bis—O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, bomeol, menthol, l,3—propanediol, heptadecyl group, palmitic acid, myristic acid,O3—(oleoyl)lithocholic acid, O3—(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine)and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG—40K), MPEG, 2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, s (e.g. biotin), transport/absorption facilitators (e.g., aspirin, n E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine—imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.

Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co—ligand, or dies e.g., an dy, that binds to a specified cell type such as a hepatic cell. Ligands can also include hormones and hormone receptors. They can also include non—peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N—acetyl—galactosamine, N—acetyl— gulucosamine multivalent mannose, or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-KB.

The ligand can be a substance, e.g., a drug, which can increase the uptake of the iRNA agent into the cell, for e, by disrupting the cell’s cytoskeleton, e.g., by ting the cell’s microtubules, microfilaments, or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.

In some embodiments, a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator). PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins, etc.

Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin. ucleotides that comprise a number of phosphorothioate es are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases, or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands). In addition, aptamers that bind serum components (6. g. serum proteins) are also le for use as PK modulating ligands in the embodiments described herein.

Ligand—conjugated iRNAs of the invention may be synthesized by the use of an oligonucleotide that bears a t reactive functionality, such as that derived from the attachment of a linking molecule onto the ucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially—available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.

The oligonucleotides used in the conjugates of the present ion may be conveniently and routinely made through the well—known technique of solid—phase synthesis.

Equipment for such synthesis is sold by several vendors including, for e, Applied Biosystems® (Foster City, Calif.). Any other s for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives.

In the ligand—conjugated iRNAs and ligand—molecule bearing ce—specific linked nucleosides of the present invention, the oligonucleotides and oligonucleosides may be assembled on a suitable DNA sizer utilizing rd tide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand—nucleotide or side—conjugate sors that already bear the ligand molecule, or non—nucleoside ligand—bearing building blocks.

When using nucleotide—conjugate precursors that already bear a linking moiety, the synthesis of the sequence—specific linked nucleosides is typically completed, and the ligand molecule is then reacted with the linking moiety to form the ligand—conjugated oligonucleotide. In some embodiments, the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand—nucleoside conjugates in addition to the rd phosphoramidites and non—standard phosphoramidites that are commercially available and ely used in oligonucleotide synthesis.

A. Lipid Conjugates In certain embodiments, the ligand or conjugate is a lipid or based molecule.

Such a lipid or lipid—based molecule preferably binds a serum protein, e.g., human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non—kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For e, naproxen or aspirin can be used. A lipid or lipid—based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, or (c) can be used to adjust binding to a serum protein, e. g., HSA.

A lipid based ligand can be used to inhibit, e. g., control the binding of the conjugate to a target tissue. For example, a lipid or lipid—based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be d from the body. A lipid or lipid—based ligand that binds to HSA less strongly can be used to target the conjugate to the .

In certain embodiments, the lipid based ligand binds HSA. Preferably, it binds HSA with a sufficient affinity such that the conjugate will be preferably distributed to a non—kidney tissue. However, it is preferred that the affinity not be so strong that the HSA—ligand binding cannot be ed.

In other embodiments, the lipid based ligand binds HSA weakly or not at all, such that the conjugate will be preferably distributed to the kidney. Other moieties that target to kidney cells can also be used in place of, or in addition to, the lipid based ligand.

In another aspect, the ligand is a moiety, e. g., a vitamin, which is taken up by a target cell, e. g., a proliferating cell. These are particularly useful for ng disorders terized by unwanted cell proliferation, e.g., of the malignant or non—malignant type, e. g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include are B vitamin, e. g., folic acid, B 12, riboﬂavin, biotin, pyridoxal or other vitamins or nutrients taken up by target cells such as liver cells. Also included are HSA and low density lipoprotein (LDL).

B. Cell Permeation Agents In another aspect, the ligand is a cell—permeation agent, preferably a l cell— permeation agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, ing a peptidylmimetic, invertomers, non—peptide or pseudo—peptide linkages, and use of D—amino acids. The helical agent is ably an alpha—helical agent, which ably has a lipophilic and a lipophobic phase.

The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three— dimensional structure similar to a natural peptide. The attachment of peptide and omimetics to iRNA agents can affect pharmacokinetic distribution of the iRNA, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5—50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.

A e or omimetic can be, for e, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., ting primarily of Tyr, Trp, or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). An exemplary hydrophobic MTS—containing peptide is RFGF having the amino acid ce AAVALLPAVLLALLAP (SEQ ID NO:29). An RFGF analogue (e.g., amino acid ce AALLPVLLAAP (SEQ ID NO:30) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety can be a "delivery" peptide, which can carry large polar molecules including peptides, oligonucleotides, and n across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO:3 l) and the hila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO:32) have been found to be capable of functioning as delivery peptides. A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage—display library, or one—bead—one—compound (OBOC) combinatorial library (Lam er al., , 354:82—84, 1991). Examples of a peptide or omimetic tethered to a dsRNA agent via an orated monomer unit for cell targeting purposes is an arginine—glycine—aspartic acid (RGD)—peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase ity or direct conformational properties. Any of the structural modifications described below can be utilized.

An RGD peptide for use in the compositions and methods of the ion may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s). RGD—containing peptides and peptidiomimemtics may e D— amino acids, as well as tic RGD mimics. In addition to RGD, one can use other moieties that target the integrin ligand. Preferred conjugates of this ligand target PECAM—l or VEGF.

A "cell permeation peptide" is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a ian cell, such as a human cell. A microbial cell—permeating peptide can be, for example, an 0t—helical linear peptide (e.g., LL—37 or n Pl), a disulfide bond—containing peptide (e.g., 0t —defensin, B—defensin or bactenecin), or a peptide ning only one or two dominating amino acids (e.g., PR—39 or indolicidin).

A cell permeation peptide can also include a nuclear localization signal (NLS). For example, a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV—1 gp41 and the NLS of SV40 large T antigen (Simeoni er al., Nucl. Acids Res. 31:2717—2724, 2003).

C. Carbohydrate Conjugates In some embodiments of the compositions and methods of the invention, an iRNA further comprises a carbohydrate. The carbohydrate conjugated iRNA is advantageous for the in viva delivery of nucleic acids, as well as compositions suitable for in viva eutic use, as described herein. As used , "carbohydrate" refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part f a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be , branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars , di—, tri—, and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and ccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di— and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or In certain embodiments, a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide.

In one embodiment, a ydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of: 0 H H HO O AcHN O\/\/\n/N\/\/N O" < o H H AcHN \/A\/Ajr \/"\/ 7r"\/0%" o o 0 Ho o ACHN O\/\/\n/N/\/\N H H 0 Formula 11, HO HO HO '0 O\/\O/\/O\/\N Ho Ho H HO ’0 HO O O\/\O/\/O\/\N,(\/ #4O HO HO H O O HO '0 O\/\O/\/O\/\N O H Formula 111, HO NM HO O\//\o/\\/O NHAc Formula IV, Formula V, Formula VI, v\)Formula VII, O OmFormula VIII 0 O\/\)J\ /\/\/\/NH HO N AcHN H \n/ o OM /\/\/\/N HO N AcHN H \n/ o o O §N\/\/\/\H JJx HO N AcHN H Formula IX, HOﬁe O HO /O\/\N ACHN H O O HO \/\O/\/o\/\N O AcHN H Formula X, 0 OH _ o "303 O\/\o/\/O\/\N 0 OH H HO 0 (‘3 \/\O/\/O\/\NTI/\/O\%V OH 0 0 o\/\O/\/o\/\N O H Formula XI, I'DOs O\/\/\n/N\/\/ o OH O HO ’0 0 H H 0 OH O O HO '0 O\/\/\"/HN/\/\ o Formula XII, HO OH o H AcHN H o HO OH HO N AcHN "W‘n’0 O HO OH H O HO&&/O JLO IZ Formula X111, IO OI I0 OI I>00 I 2 :0O {fO O I>0 NH I2 /\/\/\"w~' 0 Formula XIV, I0 oI IO OI IO )>OI Z O O >OI 2 "MW 0 Formula XV, II>00 O 0IOZI rgiNH 0 Formula XVI, 0 a XVII, IO O OI IO O IIO O aNH IO :03/ 0 Formula XVIII, IO 0 OI IgO O IIO O aNH IO :0E 0 Formula XIX, I .OOI OI O 0 0 Formula XX, 0 Formula XXI, 0 Formula XXII, Formula XXIII; O wherein Y is O or S and n is 3 —6 la XXIV); HO 0 NHAc ,Wherein Y is O or S and n is 3—6 (Formula XXV); NHAco Formula XXVI; a XXVII; Formula XXIX; OH OH OERO [ﬂ/O HWJL :/ OH OH 0 O H r :P; HO OWYNWLN OGO ACHN 343‘ f3 OH OH 4 O .

ACHN OWN/3‘0\ O 0 (s) OH OH 4 o HO OWN OH ACHN O FormulaXXX; Formula XXXI; #19 6 OH OH 0‘P‘0 AcHN and O , E/Q ,o OH OH 4 o .

HO O\/\/\n/N OH 0 Formula XXXII; Formula XXXIH. a XXXIV.

In another embodiment, a carbohydrate ate for use in the compositions and methods of the invention is a monosaccharide. In one embodiment, the monosaccharide is an N—acetylgalactosamine, such as O O HO OWHMH o ACHN 0 Formula 11.

Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to, (Formula XXXVI), when one of X or Y is an oligonucleotide, the other is a hydrogen.

In certain embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a monovalent linker. In some embodiments, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a bivalent linker. In yet other embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a trivalent linker.

In one embodiment, the double stranded RNAi agents of the invention comprise one GalNAc or GalNAc derivative attached to the iRNA agent, e.g., the 5’end of the sense strand of a dsRNA agent, or the 5’ end of one or both sense strands of a dual targeting RNAi agent as described herein. In another embodiment, the double stranded RNAi agents of the invention comprise a plurality (e.g., 2, 3, 4, 5, or 6) GalNAc or GalNAc derivatives, each independently ed to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers.

In some embodiments, for example, when the two s of an iRNA agent of the ion are part of one larger molecule connected by an uninterrupted chain of nucleotides between the 3’—end of one strand and the 5’—end of the tive other strand forming a hairpin loop comprising, a plurality of unpaired nucleotides, each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc tive attached via a monovalent linker.

In some embodiments, the carbohydrate conjugate further comprises one or more additional s as bed above, such as, but not limited to, a PK modulator or a cell permeation peptide.

Additional carbohydrate conjugates and linkers suitable for use in the t invention include those bed in PCT Publication Nos. 2014/179627, the entire contents of each of which are incorporated herein by reference.

D. Linkers In some embodiments, the conjugate or ligand described herein can be attached to an iRNA oligonucleotide with various s that can be cleavable or non—cleavable.

The term "linker" or "linking group" means an organic moiety that connects two parts of a nd, e.g., covalently attaches two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SOZ, SOZNH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or tituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, rylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, eteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, lheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, lheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, 8(0), 802, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted aryl, or tuted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic, or substituted aliphatic. In one embodiment, the linker is between about 1—24 atoms, 2—24, 3—24, 4—24, 5—24, 6—24, 6—18, 7—18, 8—18, 7—17, 8—17, 6—16, 7—17, or 8—16 atoms.

A cleavable g group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is g together. In a preferred embodiment, the cleavable linking group is d at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or more, or at least 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second nce condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).

Cleavable linking groups are susceptible to cleavage , e.g., pH, redox potential, or the presence of ative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by ion; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and atases.

A cleavable linkage group, such as a ide bond can be susceptible to pH. The pH of human serum is 7.4, while the average ellular pH is slightly lower, ranging from about 7.1—7.3. Endosomes have a more acidic pH, in the range of 5.5—6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.

A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of ble g group incorporated into a linker can depend on the cell to be targeted. For example, a liver—targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be d more efficiently in liver cells than in cell types that are not esterase— rich. Other cell—types rich in esterases include cells of the lung, renal cortex, and testis.

Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.

In general, the suitability of a candidate cleavable linking group can be ted by testing the ability of a degradative agent (or condition) to cleave the candidate linking group.

It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non—target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be tive of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole s. It can be useful to make initial evaluations in cell—free or culture conditions and to confirm by further evaluations in whole animals. In preferred embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions ed to mimic extracellular conditions). i. Redox cleavable linking groups In certain ments, a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of ively cleavable linking group is a disulphide linking group (—S—S—). To determine if a candidate cleavable linking group is a suitable "reductively cleavable linking group," or for example is suitable for use with a particular iRNA moiety and particular targeting agent one can look to methods described herein. For e, a candidate can be ted by incubation with threitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro ions selected to mimic intracellular conditions) as compared to blood (or under in vitro ions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media. ii. Phosphate-based cleavable g groups In other embodiments, a cleavable linker comprises a phosphate—based cleavable linking group. A phosphate—based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are s such as phosphatases in cells. Examples of phosphate—based g groups are -O-P(O)(ORk)—O—, —O—P(S)(ORk)—O—, —O—P(S)(SRk)—O—, —S—P(O)(ORk)—O—, —O— P(O)(ORk)—S—, —S—P(O)(ORk)—S—, —O—P(S)(ORk)—S—, —S—P(S)(ORk)—O—, —O—P(O)(Rk)—O—, —O— P(S)(Rk)—O—, )(Rk)-O-, )(Rk)-O-, -S-P(O)(Rk)-S-, -O-P(S)( Rk)-S-. Preferred embodiments are -O-P(O)(OH)-O-, -O-P(S)(OH)—O—, —O—P(S)(SH)—O—, —S—P(O)(OH)—O—, —O— P(O)(OH)—S—, —S—P(O)(OH)—S—, —O—P(S)(OH)—S—, —S—P(S)(OH)—O—, —O—P(O)(H)—O—, —O— P(S)(H)—O—, —S—P(O)(H)—O, —S—P(S)(H)-O-, -S-P(O)(H)-S-, and -O-P(S)(H)-S-. A red embodiment is —O—P(O)(OH)—O—. These candidates can be evaluated using methods analogous to those described above. iii. Acid cleavable linking groups In other embodiments, a ble linker comprises an acid cleavable linking group.

An acid cleavable linking group is a linking group that is cleaved under acidic conditions. In preferred embodiments acid cleavable linking groups are d in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.5, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples of acid cleavable linking groups include but are not limited to hydrazones, , and esters of amino acids. Acid cleavable groups can have the general formula — C=NN—, C(O)O, or —OC(O). A preferred embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or l. These candidates can be evaluated using methods analogous to those described above. iv. Ester-based linking groups In other embodiments, a cleavable linker comprises an ester—based cleavable linking group. An based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester—based cleavable linking groups e, but are not limited to, esters of alkylene, lene and alkynylene groups. Ester cleavable linking groups have the general formula —C(O)O—, or —OC(O)—. These ates can be ted using methods analogous to those described above. v. e-based cleaving groups In yet other embodiments, a cleavable linker comprises a peptide—based cleavable linking group. A peptide—based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide—based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., ides, tripeptides etc.) and polypeptides. Peptide—based cleavable groups do not include the amide group (—C(O)NH—).

The amide group can be formed between any ne, alkenylene or alkynelene. A peptide bond is a special type of amide bond formed n amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide—based cleavable g groups have the general formula — NHCHRAC(O)NHCHRBC(O)—, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.

In some embodiments, an iRNA of the invention is conjugated to a ydrate through a linker. Non—limiting examples of iRNA carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to, OH OH HO%O\/\/\n/N\/\/N0 H H H021} O O 0 OH OH %0 H HO \/\/Hz0 "VET (Formula XXXVII), o o 0 Ho 0 N/\/\N:0 mm WAD H (Formula XXXVIII), HO OH o H OM /\/\/\/N O HO N T AcHN H X—O OM H H0 0H0 0 x=1-30 H o =1-15 y HO OMNWNJ‘O AcHN H (Formula , HO 0H 4%OM ’\/\/\/N0O H HO N ‘n’ AcHN H o x—o HOEm/vi ""0—Y H H O H AcHN NWNTO NWLNMOWO’YNWO H o o x o y HO OH ﬁe O H O "1-30 HO MNWNJLO Y=1_15 ACHN H (Formula XL), HO OH HO&Q/O\/\)I\N/\/V\,NTOoo H ACHN H o N""0,Y "04$ 0 H N H H N H ‘g o y o X HO&Q/O\/\)‘N\/WNJLOH0 0H0 x=0-30 0 H o y = 1—15 ACHN H (Formula XLI), mgq/ O O H HO MNWN‘H’O X-O ACHN O HO OH Hoommx x = 0-30 0 o H o ACHN H (Formula XLII), I2Eﬁg; 3:E ‘2EE 32:>< N‘<>< || || _._._. .945» 0010 N‘<>< || || _._._. .945» 0010 (Formula XLIV), when one of X or Y is an oligonucleotide, the other is a hydrogen.

In certain embodiments of the compositions and methods of the invention, a ligand is one or more "GalNAc" (N—acetylgalactosamine) derivatives attached through a bivalent or trivalent branched linker.

In one embodiment, a dsRNA of the invention is conjugated to a bivalent or trivalent lO branched linker selected from the group of structures shown in any of formula (XLV) — (XLVI) : Formula XXXXV Formula XLVI P2A_Q2A_R2A I T2A_L2A T3A_L3A 2A 3A q )P3A_Q3A_R3A,q P2B-Q2B-R2B ,q2B B \fP3B-Q3B-R EFT313 3B_3BL P4A_Q4A_R4A I T4A_L4A B_R4B T4B_L4B a XLVII a XLVIII wherein: q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for each occurrence 0—20 and wherein the repeating unit can be the same or different; PZA’ PZB, PSA’ P33, P4A’ P43, PSA’ PSB, Psc’ TZA’ TZB, T3A’ T33, T4A’ T43, T4A’ TSB, Tsc are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH2, CHzNH or CHzO; QZA, QZB, Q3A, Q33, Q4A, Q43, QSA, QSB, Q5C are independently for each occurrence absent, alkylene, substituted alkylene Wherin one or more enes can be interrupted or terminated by one or more of O, S, S(O), S02, N(RN), C(R’)=C(R"), CEC or C(O); RZA, RZB, R3A, R33, R", R43, RSA, RSB, R5C are each independently for each occurrence absent, gH, O, S, CH2, C(O)O, C(O)NH, NHCH(Ra)C(O), —C(O)-CH(Ra)—NH—, CO, CH=N— H I _N\NJL~V \r‘" 0, EN H , , LZA, LZB, L3A, L33, L4A, L43, LSA, L5B and L5C represent the ligand; i. 6. each ndently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; andRa is H or amino acid side chain.Trivalent conjugating GalNAc tives are particularly useful for use with RNAi agents for inhibiting the expression of a target gene, such as those of formula (XLIX): a XLIX PSA-QSA-RSA i T5A_L5A P5B—Q5B—R ]?T5B SB_LSB P5C_Q5C_R5C ]?T5C_L5C Formula (Vll wherein LSA, L5B and L5C represent a monosaccharide, such as GalNAc derivative.

Examples of suitable bivalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the structures recited above as formulas 11, VII, XI, X, and XIII.

Representative US. Patents that teach the preparation of RNA ates include, but are not limited to, US. Patent Nos. 4,828,979; 4,948,882; 5,218,105; 465; 313; ,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; ,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 263; 4,876,335; 4,904,582; 4,958,013; 830; ,112,963; 5,214,136; 5,082,830; 963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; ,262,536; 5,272,250; 5,292,873; 5,317,098; 241, 5,391,723; 5,416,203, 5,451,463; ,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 481; 5,587,371; ,595,726; 5,597,696; 5,599,923; 5,599,928;5,688,941; 6,294,664; 6,320,017; 6,576,752; 6,783,931; 6,900,297; 7,037,646; and 8,106,022, the entire ts of each of which are hereby incorporated herein by reference.

It is not ary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications can be incorporated in a single compound or even at a single nucleoside within an iRNA. The present ion also includes iRNA compounds that are chimeric compounds.

"Chimeric" iRNA compounds or "chimeras," in the context of this invention, are iRNA compounds, preferably dsRNAi agents, that contain two or more ally distinct regions, each made up of at least one r unit, i.e., a nucleotide in the case of a dsRNA compound. These iRNAs typically n at least one region wherein the RNA is modified so as to confer upon the iRNA increased resistance to nuclease degradation, increased cellular uptake, or increased binding affinity for the target c acid. An additional region of the iRNA can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the ency of iRNA inhibition of gene expression.

Consequently, comparable results can often be obtained with shorter iRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

In certain ces, the RNA of an iRNA can be modified by a gand group. A number of non—ligand molecules have been conjugated to iRNAs in order to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for ming such ations are available in the scientific literature. Such non—ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. et al., Biochem. Biophys. Res. C0mm., 2007, 365(1):54—61; Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e. g., hexyl—S— thiol (Manoharan et al., Ann. N. Y. Acad. Sci ., 1992, 660:306; Manoharan et al., .

Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, :533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison—Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e. g., di—hexadecyl—rac—glycerol or triethylammonium —O—hexadecyl—rac—glycero—3—H—phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995 , 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biachim. Biaphys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino—carbonyl—oxycholesterol moiety (Crooke et al., J. Pharmacal. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such RNA conjugates have been listed above. Typical conjugation protocols e the synthesis of RNAs bearing an inker at one or more ons of the sequence. The amino group is then reacted with the le being ated using appropriate coupling or activating reagents. The conjugation reaction can be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate.

IV. Delivery of an iRNA 0f the Invention The delivery of an iRNA of the invention to a cell e.g., a cell within a subject, such as a human t can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an iRNA of the invention either in vitra or in viva. In viva delivery may also be performed directly by administering a composition comprising an iRNA, e. g., a dsRNA, to a subject. Alternatively, in viva delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA. These alternatives are discussed further below.

In general, any method of delivering a nucleic acid molecule (in vitra or in viva) can be adapted for use with an iRNA of the invention (see e.g., Akhtar S. and Julian RL. (1992) Trends Cell. Biol. 2(5): 139—144 and 2595, which are incorporated herein by reference in their entireties). For in viva delivery, factors to consider in order to deliver an iRNA molecule e, for example, biological stability of the delivered le, prevention of non—specific effects, and accumulation of the red molecule in the target tissue. The non—specific effects of an iRNA can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site zes local concentration of the agent, limits the exposure of the agent to systemic tissues that can otherwise be harmed by the agent or that can degrade the agent, and permits a lower total dose of the iRNA molecule to be administered. Several studies have shown successful knockdown of gene products when a dsRNAi agent is administered locally. For example, intraocular delivery of a VEGF dsRNA by itreal injection in cynomolgus monkeys (Tolentino, MJ, et al (2004) Retina 24:132—138) and subretinal injections in mice , SJ ., et al (2003) Mal. Vis. 9:210—216) were both shown to prevent neovascularization in an mental model of age—related macular degeneration. In addition, direct intratumoral injection of a dsRNA in mice reduces tumor volume (Pille, J et al (2005) Mal. Ther.11:267—274) and can prolong survival of tumor—bearing mice (Kim, WJ., et al (2006) Mal. Ther. 14:343—350; Li, S., et al (2007) Mal.

Ther. 15:515—523). RNA erence has also shown success with local delivery to the CNS by direct injection (Dorn, G., et al. (2004) Nucleic Acids 32:e49; Tan, PH., et al (2005) Gene Ther. 66; Makimura, H., et al (2002) BMC Neurosci. 3:18; Shishkina, GT., et al (2004) Neuroscience 129:521—528; Thakker, ER., et al (2004) Proc. Natl. Acad. Sci. U.S.A. 101:17270—17275; Akaneya,Y., et al (2005) J. Neurophysiol. —602) and to the lungs by intranasal administration (Howard, KA., et al (2006) Mol. Ther. 14:476—484; Zhang, X., et al (2004) J. Biol. Chem. 279:10677—10684; Bitko, V., et al (2005) Nat. Med. 11:50—55). For administering an iRNA systemically for the prevention of an infection, the RNA can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the dsRNA by endo— and exo—nucleases in vivo. cation of the RNA or the pharmaceutical carrier can also permit targeting of the iRNA to the target tissue and avoid undesirable off—target s. iRNA molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance ar uptake and prevent degradation. For example, an iRNA directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J et al (2004) Nature 432: 8). ation of an iRNA to an aptamer has been shown to inhibit tumor growth and mediate tumor regression in a mouse model of prostate cancer (McNamara, JO, et al (2006) Nat.

Biotechnol. 24: 1005—1015). In an alternative embodiment, the iRNA can be delivered using drug ry systems such as a rticle, a dendrimer, a polymer, liposomes, or a cationic delivery system. Positively charged ic delivery systems facilitate binding of an iRNA molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an iRNA by the cell. Cationic lipids, dendrimers, or polymers can either be bound to an iRNA, or induced to form a vesicle or micelle (see e.g., Kim SH, et al (2008) Journal of Controlled Release 129(2): 107—1 16) that encases an iRNA.

The ion of vesicles or micelles further prevents degradation of the iRNA when administered ically. Methods for making and administering cationic— iRNA complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, DR, et al (2003) J. Mol. Biol 327:761—766; Verma, UN, et al (2003) Clin. Cancer Res. 9:1291—1300; Arnold, AS et al (2007) J. Hypertens. 25: 197—205, which are incorporated herein by reference in their entirety). Some non—limiting examples of drug delivery s useful for ic delivery of iRNAs include DOTAP (Sorensen, DR., et al (2003), supra; Verma, UN, et al (2003), supra), Oligofectamine, "solid nucleic acid lipid particles" (Zimmermann, TS, et al (2006) Nature 441:111—114), cardiolipin (Chien, PY, et al (2005) Cancer Gene Ther. 12:321—328; Pal, A, et al (2005) Int J. Oncol. 26:1087—1091), polyethyleneimine (Bonnet ME, et al (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed.

Biotechnol. 71659), Arg—Gly—Asp (RGD) peptides (Liu, S. (2006) Mol. Pharm. 3:472—487), and idoamines ia, DA, et al (2007) Biochem. Soc. Trans. 35 :61—67; Yoo, H., et al (1999) Pharm. Res. 16: 1799—1804). In some embodiments, an iRNA forms a complex with cyclodextrin for systemic administration. Methods for administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in US. Patent No. 7,427,605, which is herein incorporated by reference in its entirety.

A. Vector encoded iRNAs of the Invention iRNA targeting the Serpinal gene can be sed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. , 12:5—10; Skillem, A, et al., International PCT Publication No. WO 00/22113, Conrad, ational PCT Publication No. WO 14, and Conrad, U.S. Patent No. 6,054,299). sion can be transient (on the order of hours to weeks) or sustained (weeks to months or longer), ing upon the specific construct used and the target tissue or cell type. These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non— integrating vector. The transgene can also be ucted to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

The individual strand or strands of an iRNA can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co—introduced (e.g., by transfection or infection) into a target cell. Alternatively each individual strand of a dsRNA can be transcribed by promoters both of which are located on the same expression plasmid. In one embodiment, a dsRNA is expressed as inverted repeat polynucleotides joined by a linker polynucleotide ce such that the dsRNA has a stem and loop structure. iRNA expression vectors are generally DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells, can be used to produce recombinant constructs for the expression of an iRNA as described herein. Eukaryotic cell expression vectors are well known in the art and are available from a number of cial sources. Typically, such vectors are provided containing convenient restriction sites for insertion of the desired nucleic acid segment. Delivery of iRNA expressing vectors can be systemic, such as by intravenous or uscular administration, by administration to target cells ex—planted from the patient followed by reintroduction into the patient, or by any other means that allows for uction into a desired target cell.

Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) irus vectors; (b) retrovirus s, including but not limited to lentiviral vectors, y murine leukemia virus, etc.; (c) adeno— associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) oma virus vectors; (h) picomavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e. g. canary pox or fowl pox; and (j) a —dependent or gutless adenovirus. Replication—defective viruses can also be advantageous. Different vectors will or will not become incorporated into the cells’ genome. The constructs can include viral sequences for transfection, if desired.

Alternatively, the construct can be incorporated into vectors capable of episomal ation, 6. g. EPV and EBV vectors. Constructs for the recombinant expression of an iRNA will generally require regulatory elements, e.g., promoters, enhancers, etc, to ensure the expression of the iRNA in target cells. Other aspects to consider for vectors and constructs are known in the art.

V. Pharmaceutical Compositions of the Invention The present ion also includes ceutical compositions and ations which include the iRNAs of the invention. In one embodiment, ed herein are pharmaceutical compositions containing an iRNA, as described , and a pharmaceutically acceptable carrier. The pharmaceutical compositions containing the iRNA are useful for treating a disease or disorder associated with the expression or activity of a Serpinal gene, e.g., a Serpinal ency—associated disorder, e.g., a Serpinal deficiency liver disorder. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by intravenous (IV) delivery. Another example is compositions that are formulated for direct delivery into the brain parenchyma, e. g. infusion into the brain, such as by continuous pump infusion.

The pharmaceutical compositions comprising RNAi agents of the invention may be, for example, solutions with or without a , or itions containing pharmaceutically acceptable carriers. Such compositions include, for example, aqueous or crystalline compositions, liposomal formulations, ar formulations, emulsions, and gene therapy vectors.

In the methods of the invention, the RNAi agent may be administered in a solution. A free RNAi agent may be administered in an unbuffered solution, e.g., in saline or in water.

Alternatively, the free siRNA may also be administred in a suitable buffer solution. The buffer solution may comprise acetate, e, prolamine, carbonate, or phosphate, or any combination f. In a preferred embodiment, the buffer solution is phosphate ed saline (PBS). The pH and osmolarity of the buffer solution containing the RNAi agent can be adjusted such that it is le for administering to a subject.

In some embodiments, the buffer solution further comprises an agent for lling the osmolarity of the solution, such that the osmolarity is kept at a desired value, e.g., at the physiologic values of the human plasma. Solutes which can be added to the buffer solution to control the osmolarity include, but are not limited to, proteins, peptides, amino acids, non— metabolized rs, vitamins, ions, sugars, metabolites, organic acids, , or salts. In some embodiments, the agent for controlling the osmolarity of the solution is a salt. In certain embodiments, the agent for controlling the osmolarity of the solution is sodium chloride or potassium chloride.

The pharmaceutical compositions of the invention may be administered in s sufficient to inhibit expression of a Serpinal gene. In general, a suitable dose of an iRNA of the ion will be in the range of about 0.001 to about 200.0 rams per kilogram body weight of the recipient per day, generally in the range of about 1 to 50 mg per kilogram body weight per day. For example, the dsRNA can be administered at about 0.01 mg/kg, about 0.05 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 1.5 mg/kg, about 2 mg/kg, about 3 mg/kg, about 10 mg/kg, about 20 mg/kg, about 30 mg/kg, about 40 mg/kg, or about 50 mg/kg per single dose.

The pharmaceutical composition can be administered once daily, or the iRNA can be administered as two, three, or more sub—doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In that case, the iRNA ned in each sub—dose must be pondingly smaller in order to achieve the total daily dosage. The dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation which provides sustained release of the iRNA over a l day period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a ular site, such as could be used with the agents of the present invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.

In other embodiments, a single dose of the pharmaceutical itions can be long lasting, such that subsequent doses are administered at not more than 3, 4, or 5 day intervals, or at not more than 1, 2, 3, or 4 week intervals. In some embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered once per week. In other embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered bi—monthly.

The skilled artisan will appreciate that n factors can inﬂuence the dosage and timing required to effectively treat a subject, including but not d to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a ition can include a single treatment or a series of treatments. tes of effective dosages and in viva half—lives for the individual iRNAs encompassed by the invention can be made using conventional methodologies or on the basis of in viva testing using an appropriate animal model, as described elsewhere herein. es in mouse genetics have generated a number of mouse models for the study of various human diseases, such as a liver disorder that would benefit from reduction in the expression of Serpinal. Such models can be used for in viva testing of iRNA, as well as for determining a eutically effective dose. Suitable mouse models are known in the art and include, for example, a mouse containing a transgene expressing human Serpinal.

The pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary, e. g., by inhalation or insufﬂation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes enous, intraarterial, subcutaneous, intraperitoneal or intramuscular ion or infusion; subdermal, e. g., via an implanted device; or intracranial, e. g., by arenchymal, intrathecal or intraventricular, administration. The iRNA can be delivered in a manner to target a particular tissue, such as the liver (e.g., the cytes of the .

Pharmaceutical compositions and formulations for topical administration can include transdermal patches, ointments, s, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like can be necessary or desirable. Coated condoms, gloves and the like can also be useful. Suitable topical formulations e those in which the iRNAs featured in the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (e. g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g., dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). iRNAs featured in the invention can be encapsulated within liposomes or can form complexes o, in particular to cationic liposomes. Alternatively, iRNAs can be complexed to , in particular to ic lipids.

Suitable fatty acids and esters include but are not limited to arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, c acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl l— monocaprate, l—dodecylazacycloheptan—2—one, an mitine, an acylcholine, or a €1-20 alkyl ester (e. g., isopropylmyristate IPM), monoglyceride, eride or pharmaceutically acceptable salt thereof). l formulations are described in detail in US. Patent No. 014, which is incorporated herein by reference.

A. iRNA Formulations Comprising Membranous Molecular Assemblies An iRNA for use in the compositions and methods of the invention can be formulated for delivery in a membranous molecular assembly, e. g., a liposome or a e. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, e. g., one bilayer or a plurality of bilayers. Liposomes include unilamellar and amellar vesicles that have a membrane formed from a ilic material and an s interior. The s portion contains the iRNA composition. The lipophilic material isolates the s interior from an aqueous exterior, which typically does not include the iRNA composition, although in some es, it may. Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomal bilayer fuses with bilayer of the cellular membranes. As the merging of the liposome and cell progresses, the internal aqueous contents that include the iRNA are red into the cell where the iRNA can specifically bind to a target RNA and can e RNAi. In some cases the liposomes are also specifically targeted, e.g., to direct the iRNA to particular cell types.

A liposome containing a RNAi agent can be prepared by a variety of methods. In one example, the lipid component of a liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or lipid conjugate. The ent can have a high critical micelle concentration and may be nonionic. Exemplary ents include cholate, CHAPS, octylglucoside, deoxycholate, and lauroyl sarcosine. The RNAi agent preparation is then added to the micelles that include the lipid component. The cationic groups on the lipid interact with the RNAi agent and condense around the RNAi agent to form a me. After condensation, the detergent is d, e.g., by dialysis, to yield a liposomal preparation of RNAi agent.

If necessary a carrier compound that assists in condensation can be added during the condensation reaction, 6. g. controlled addition. For example, the carrier compound can be a polymer other than a nucleic acid (e.g., spermine or dine). pH can also adjusted to favor condensation.

Methods for producing stable polynucleotide delivery vehicles, which incorporate a polynucleotide/cationic lipid complex as structural components of the delivery vehicle, are further described in, e.g., WO 96/37194, the entire contents of which are incorporated herein by reference. Liposome formation can also include one or more aspects of exemplary methods described in Felgner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413—7417, 1987; US. Pat. No. 4,897,355; US. Pat. No. 5,171,678; Bangham, er al. M. Mol. Biol. 23:238, 1965; Olson, et al. Biochim. Biophys. Acta 557:9, 1979; Szoka, et al. Proc. Natl. Acad. Sci. 75: 4194, 1978; Mayhew, et al. Biochim. Biophys. Acta 775:169, 1984; Kim, et al. Biochim.

Biophys. Acta 728:339, 1983; and ga, er al. Endocrinol. 115:757, 1984. Commonly used techniques for ing lipid aggregates of appropriate size for use as delivery vehicles include sonication and —thaw plus extrusion (see, e.g., Mayer, et al. m. Biophys.

Acta 858: 161, 1986). Microfluidization can be used when tently small (50 to 200 nm) and relatively m aggregates are desired (Mayhew, er al. Biochim. Biophys. Acta 775: 169, 1984). These methods are readily adapted to packaging RNAi agent preparations into liposomes.

Liposomes fall into two broad classes. Cationic liposomes are positively charged mes which interact with the negatively charged nucleic acid molecules to form a stable complex. The positively charged nucleic iposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 5).

Liposomes which are sitive or negatively—charged, entrap nucleic acids rather than complex with it. Since both the nucleic acid and the lipid are similarly charged, repulsion rather than complex formation . heless, some nucleic acid is entrapped within the aqueous interior of these liposomes. pH—sensitive liposomes have been used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture.

Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled e, 1992, 19, 269-274).

One major type of liposomal composition includes phospholipids other than naturally— derived phosphatidylcholine. Neutral liposome compositions, for e, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC).

Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic mes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or terol.

Examples of other methods to introduce liposomes into cells in vitro and in vivo include U.S. Pat. No. 5,283,185; U.S. Pat. No. 5,171,678; WO 94/00569; WO 93/24640; WO 91/16024; Felgner, J. Biol. Chem. 269:2550, 1994; Nabel, Proc. Natl. Acad. Sci. 90:11307, 1993; Nabel, Human Gene Ther. 3:649, 1992; Gershon, Biochem. 32:7143, 1993; and s EMBO J. , 1992.

Non—ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non—ionic surfactant and cholesterol. Non—ionic liposomal formulations sing NovasomeTM I (glyceryl dilaurate/cholesterol/polyoxyethylene—10—stearyl ether) and NovasomeTM ll (glyceryl distearate/cholesterol/polyoxyethylene—10—stearyl ether) were used to deliver cyclosporin—A into the dermis of mouse skin. Results indicated that such nic mal systems were effective in facilitating the deposition of cyclosporine A into ent layers of the skin (Hu et al. S. T.P.Pharma. Sci., 1994, 4(6) 466).

Liposomes also include cally stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically ized liposomes are those in which part of the e—forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside GMl, or (B) is derivatized with one or more hilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is t in the art that, at least for sterically ized liposomes containing gangliosides, sphingomyelin, or rivatized lipids, the enhanced circulation half—life of these ally stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765). s liposomes comprising one or more glycolipids are known in the art.

Papahadjopoulos et al. (Ann. N. Y. Acad. Sci ., 1987, 507, 64) reported the ability of monosialoganglioside GMl, galactocerebroside sulfate and phosphatidylinositol to improve blood half—lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc.

Natl. Acad. Sci. U.S.A., 1988, 85, 6949). U.S. Pat. No. 028 and WO 88/04924, both to Allen et al., se liposomes comprising (1) sphingomyelin and (2) the ganglioside GM1 or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2—sn—dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al).

In one ment, cationic liposomes are used. Cationic liposomes possess the advantage of being able to fuse to the cell membrane. Non—cationic liposomes, although not able to fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver RNAi agents to macrophages.

Further advantages of liposomes include: liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can orate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated RNAi agents in their internal compartments from metabolism and degradation (Rosoff, in "Pharmaceutical Dosage Forms," Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.

A positively charged synthetic cationic lipid, 2,3—dioleyloxy)propyl]—N,N,N— trimethylammonium chloride (DOTMA) can be used to form small liposomes that interact spontaneously with nucleic acid to form lipid—nucleic acid complexes which are capable of fusing with the negatively charged lipids of the cell membranes of tissue culture cells, resulting in delivery of RNAi agent (see, e.g., Felgner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413—7417, 1987 and U.S. Pat. No. 4,897,355 for a ption of DOTMA and its use with DNA).

A DOTMA ue, 1,2—bis(oleoyloxy)—3—(trimethylammonia)propane (DOTAP) can be used in combination with a phospholipid to form mplexing vesicles.

LipofectinTM da Research Laboratories, Gaithersburg, Md.) is an effective agent for the delivery of highly anionic nucleic acids into living tissue culture cells that comprise positively charged DOTMA liposomes which interact spontaneously with negatively d polynucleotides to form complexes. When enough vely charged liposomes are used, the net charge on the resulting complexes is also positive. Positively charged complexes prepared in this way spontaneously attach to negatively charged cell surfaces, fuse with the plasma ne, and efficiently deliver functional nucleic acids into, for example, tissue culture cells. Another commercially available cationic lipid, 1,2—bis(oleoyloxy)—3,3— (trimethylammonia)propane P") (Boehringer Mannheim, Indianapolis, Indiana) differs from DOTMA in that the oleoyl moieties are linked by ester, rather than ether linkages.

Other reported cationic lipid nds include those that have been conjugated to a variety of moieties including, for example, carboxyspermine which has been conjugated to one of two types of lipids and includes compounds such as 5—carboxyspermylglycine dioctaoleoylamide ("DOGS") (TransfectamTM, Promega, Madison, Wisconsin) and dipalmitoylphosphatidylethanolamine 5—carboxyspermyl—amide ("DPPES") (see, e.g., U.S.

Pat. No. 5,171,678).

Another cationic lipid conjugate includes derivatization of the lipid with cholesterol ("DC—Chol") which has been formulated into liposomes in ation with DOPE (See, Gao, X. and Huang, L., m. Biophys. Res. . 179:280, 1991). Lipopolylysine, made by conjugating polylysine to DOPE, has been reported to be ive for transfection in the presence of serum (Zhou, X. et al., Biochim. Biophys. Acta 1065:8, 1991). For certain cell lines, these liposomes containing conjugated cationic lipids, are said to exhibit lower toxicity and provide more efficient transfection than the DOTMA—containing compositions.

Other commercially ble cationic lipid products include DMRIE and DMRIE—HP (Vical, La Jolla, California) and ctamine (DOSPA) (Life Technology, Inc., rsburg, Maryland). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.

Liposomal formulations are particularly suited for topical administration, liposomes present l ages over other ations. Such advantages include reduced side effects related to high systemic absorption of the administered drug, increased lation of the administered drug at the desired target, and the y to administer RNAi agent into the skin. In some implementations, liposomes are used for delivering RNAi agent to epidermal cells and also to enhance the penetration of RNAi agent into dermal tissues, e.g., into skin. For example, the liposomes can be applied topically. Topical delivery of drugs formulated as liposomes to the skin has been documented (see, e. g., Weiner et al., Journal of Drug Targeting, 1992, vol. 2,405—410 and du Plessis et al., Antiviral Research, 18, 1992, 259—265; Mannino, R. J. and Fould—Fogerite, S., Biotechniqnes 6:682—690, 1988; Itani, T. et al. Gene 56:267—276. 1987; Nicolau, C. et al. Meth. Enz. 149:157—176, 1987; Straubinger, R.

M. and Papahadjopoulos, D. Meth. Enz. 101:512—527, 1983; Wang, C. Y. and Huang, L., Proc. Natl. Acad. Sci. USA 84:7851—7855, 1987).

Non—ionic liposomal s have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non—ionic surfactant and cholesterol. Non—ionic liposomal formulations comprising Novasome I (glyceryl dilaurate/cholesterol/polyoxyethylene—10—stearyl ether) and Novasome ll (glyceryl distearate/ terol/polyoxyethylene—10—stearyl ether) were used to r a drug into the dermis of mouse skin. Such formulations with RNAi agent are useful for treating a dermatological disorder.

Liposomes that include iRNA can be made highly deformable. Such ability can enable the liposomes to penetrate through pore that are smaller than the average radius of the liposome. For example, transfersomes are a type of deformable liposomes. erosomes can be made by adding surface edge activators, usually surfactants, to a standard liposomal composition. Transfersomes that include RNAi agent can be delivered, for example, subcutaneously by infection in order to deliver RNAi agent to keratinocytes in the skin. In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the inﬂuence of a suitable transdermal nt. In addition, due to the lipid properties, these transferosomes can be ptimizing (adaptive to the shape of pores, e.g., in the skin), self—repairing, and can frequently reach their s without fragmenting, and often self—loading.

Other formulations amenable to the present invention are described in United States ional application serial Nos. 61/018,616, filed January 2, 2008; 61/018,611, filed January 2, 2008; 61/039,748, filed March 26, 2008; 61/047,087, filed April 22, 2008 and 61/051,528, filed May 8, 2008. PCT application no , filed October 3, 2007 also describes formulations that are amenable to the present invention.

Transfersomes are yet another type of liposomes, and are highly able lipid aggregates which are attractive candidates for drug ry vehicles. Transfersomes can be described as lipid droplets which are so highly deformable that they are easily able to ate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g., they are self—optimizing ive to the shape of pores in the skin), self—repairing, frequently reach their targets without fragmenting, and often self—loading. To make transfersomes it is possible to add surface edge—activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome—mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

Surfactants find wide ation in formulations such as emulsions ding microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hilic group (also known as the "head") provides the most useful means for categorizing the ent surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

If the surfactant molecule is not d, it is classified as a nonionic surfactant.

Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene tants are the most popular members of the ic surfactant class.

If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl onates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.

If the surfactant molecule carries a positive charge when it is ved or sed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.

If the surfactant molecule has the ability to carry either a ve or negative charge, the surfactant is fied as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N—alkylbetaines and phosphatides.

The use of tants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

The iRNA for use in the methods of the invention can also be provided as micellar formulations. "Micelles" are defined herein as a particular type of molecular assembly in which amphipathic molecules are arranged in a spherical structure such that all the hydrophobic ns of the molecules are directed inward, leaving the hilic ns in contact with the surrounding s phase. The converse arrangement exists if the environment is hydrophobic.

A mixed ar formulation suitable for delivery through transdermal membranes may be prepared by mixing an aqueous solution of the siRNA ition, an alkali metal C3 to C22 alkyl sulphate, and a micelle forming compounds. Exemplary micelle forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile t, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleates, monolaurates, borage oil, evening of primrose oil, menthol, trihydroxy oxo yl glycine and pharmaceutically acceptable salts thereof, glycerin, polyglycerin, lysine, sine, triolein, polyoxyethylene ethers and analogues thereof, polidocanol alkyl ethers and analogues thereof, eoxycholate, deoxycholate, and mixtures thereof. The micelle forming compounds may be added at the same time or after on of the alkali metal alkyl sulphate. Mixed micelles will form with substantially any kind of mixing of the ingredients but vigorous mixing in order to provide smaller size micelles.

In one method a first micellar composition is prepared which contains the siRNA composition and at least the alkali metal alkyl te. The first micellar composition is then mixed with at least three micelle forming compounds to form a mixed micellar composition. In another method, the micellar composition is ed by mixing the siRNA composition, the alkali metal alkyl sulphate and at least one of the micelle forming compounds, followed by addition of the remaining micelle forming compounds, with vigorous mixing.

Phenol and/or m—cresol may be added to the mixed micellar composition to stabilize the formulation and protect against bacterial growth. Alternatively, phenol and/or m—cresol may be added with the micelle g ingredients. An isotonic agent such as glycerin may also be added after formation of the mixed micellar ition.

For ry of the micellar formulation as a spray, the formulation can be put into an aerosol dispenser and the ser is charged with a propellant. The propellant, which is under pressure, is in liquid form in the dispenser. The ratios of the ingredients are adjusted so that the aqueous and propellant phases become one, i.e., there is one phase. If there are two phases, it is necessary to shake the dispenser prior to dispensing a portion of the contents, e.g., through a metered valve. The dispensed dose of ceutical agent is propelled from the metered valve in a fine spray.

Propellants may include hydrogen—containing chlorofluorocarbons, hydrogen— containing fluorocarbons, dimethyl ether and diethyl ether. In certain embodiments, HFA 134a (l,l,l,2 tetrafluoroethane) may be used.

The specific concentrations of the essential ingredients can be determined by relatively straightforward experimentation. For absorption through the oral cavities, it is often desirable to se, e.g., at least double or triple, the dosage for through ion or administration through the gastrointestinal tract.

B. Lipid particles iRNAs, e.g., dsRNAs of in the invention may be fully encapsulated in a lipid ation, e.g., a LNP, or other nucleic acid—lipid particle.

As used herein, the term "LNP" refers to a stable nucleic acid—lipid particle. LNPs contain a cationic lipid, a non—cationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG—lipid ate). LNPs are ely useful for ic applications, as they exhibit extended circulation lifetimes following intravenous (iv) injection and accumulate at distal sites (e.g., sites physically separated from the administration site). LNPs include "pSPLP," which includc an encapsulated sing agent—nucleic acid complex as set forth in PCT ation No. WO 00/03683. The particles of the present ion typically have a mean diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, most typically about 70 nm to about 90 nm, and are substantially nontoxic. In addition, the nucleic acids when present in the nucleic acid— lipid particles of the present invention are resistant in aqueous solution to ation with a nuclease. Nucleic acid—lipid particles and their method of preparation are disclosed in, e.g., U.S. Patent Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; U.S. Publication No. 2010/0324120 and PCT ation No. WO 96/40964.

In one embodiment, the lipid to drug ratio (mass/mass ratio) (e.g., lipid to dsRNA ratio) will be in the range of from about 1:1 to about 50: 1, from about 1:1 to about 25: 1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the above recited ranges are also contemplated to be part of the invention.

The cationic lipid can be, for example, N,N—dioleyl—N,N—dimethylammonium chloride (DODAC), N,N—distearyl—N,N—dimethylammonium bromide (DDAB), N—(I —(2,3— dioleoyloxy)propyl)—N,N,N—trimethylammonium chloride (DOTAP), N—(I —(2,3— dioleyloxy)propyl)—N,N,N—trimethylammonium chloride (DOTMA), N,N—dimethyl—2,3— dioleyloxy)propylamine (DODMA), Linoleyloxy—N,N—dimethylaminopropane (DLinDMA), l,2—Dilinolenyloxy—N,N—dimethylaminopropane (DLenDMA), 1,2— Dilinoleylcarbamoyloxy—3—dimethylaminopropane C—DAP), 1,2—Dilinoleyoxy—3— (dimethylamino)acetoxypropane (DLin—DAC), 1,2—Dilinoleyoxy—3—morpholinopropane (DLin—MA), 1,2—Dilinoleoyl—3—dimethylaminopropane (DLinDAP), 1,2—Dilinoleylthio—3— dimethylaminopropane S—DMA), 1—Linoleoyl—2—linoleyloxy—3—dimethylaminopropane (DLin—2—DMAP), 1,2—Dilinoleyloxy—3—trimethylaminopropane chloride salt (DLin—TMA.Cl), 1,2—Dilinoleoyl—3—trimethylaminopropane chloride salt (DLin—TAP.Cl), 1,2—Dilinoleyloxy—3— (N—methylpiperazino)propane (DLin—MPZ), or 3—(N,N—Dilinoleylamino)—1,2—propanediol (DLinAP), 3—(N,N—Dioleylamino)—1,2—propanedio (DOAP), 1,2—Dilinoleyloxo—3—(2—N,N— dimethylamino)ethoxypropane (DLin—EG—DMA), l,2—Dilinolenyloxy—N,N— dimethylaminopropane (DLinDMA), 2,2—Dilinoleyl—4—dimethylaminomethyl—[1,3]—dioxolane (DLin—K—DMA) or analogs thereof, (3aR,5s,6aS)—N,N—dimethyl—2,2—di((92,122)—octadeca— 9,12—dienyl)tetrahydro—3aH—cyclopenta[d][1,3]dioxol—5—amine (ALN100), (62,92,282,312)— heptatriaconta—6,9,28,3 1—tetraen—19—yl ethylamino)butanoate (MC3), 1,1'—(2—(4—(2—((2— (bis(2—hydroxydodecyl)amino)ethyl)(2—hydroxydodecyl)amino)ethyl)piperazin— 1— yl)ethylazanediyl)didodecan—2—ol (Tech G1), or a mixture thereof. The ic lipid can comprise from about 20 mol % to about 50 mol % or about 40 mol % of the total lipid present in the le.

In another embodiment, the nd 2,2—Dilinoleyl—4—dimethylaminoethyl—[1,3]— dioxolane can be used to prepare lipid—siRNA nanoparticles. Synthesis of 2,2—Dilinoleyl—4— ylaminoethyl—[1,3]—dioxolane is described in United States provisional patent application number 61/107,998 filed on October 23, 2008, which is herein incorporated by reference.

In one embodiment, the lipid—siRNA particle includes 40% 2, 2—Dilinoleyl—4— dimethylaminoethyl—[1,3]—dioxolane: 10% DSPC: 40% Cholesterol: 10% PEG-C—DOMG (mole percent) with a particle size of 63.0 i 20 nm and a 0.027 siRNA/Lipid Ratio.

The ionizable/non—cationic lipid can be an anionic lipid or a neutral lipid including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), itoylphosphatidylglycerol , dioleoyl—phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl— phosphatidylethanolamine 4—(N—maleimidomethyl)—cyclohexane—l— carboxylate (DOPE—mal), dipalmitoyl phosphatidyl lamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl—phosphatidyl—ethanolamine (DSPE), 16—O—monomethyl PE, 16—O—dimethyl PE, 18—1 —trans PE, 1 —stearoyl—2—oleoyl— phosphatidyethanolamine (SOPE), cholesterol, or a mixture thereof. The non—cationic lipid can be from about 5 mol % to about 90 mol %, about 10 mol %, or about 58 mol % if cholesterol is included, of the total lipid present in the particle.

The conjugated lipid that inhibits aggregation of particles can be, for example, a polyethyleneglycol (PEG)—lipid including, Without tion, a PEG—diacylglycerol (DAG), a PEG—dialkyloxypropyl (DAA), a PEG—phospholipid, a PEG—ceramide (Cer), or a mixture thereof. The PEG—DAA conjugate can be, for example, a PEG—dilauryloxypropyl (Ciz), a PEG—dimyristyloxypropyl (Ci4), a PEG—dipalmityloxypropyl (Ci6), or a PEG— distearyloxypropyl (C]g). The conjugated lipid that prevents aggregation of particles can be from 0 mol % to about 20 mol % or about 2 mol % of the total lipid t in the le.

In some embodiments, the nucleic acid—lipid particle further includes cholesterol at, e.g., about 10 mol % to about 60 mol % or about 48 mol % of the total lipid t in the particle.

In one embodiment, the lipidoid ND98-4HCl (MW 1487) (see US. Patent Application No. 12/056,230, filed 3/26/2008, which is incorporated herein by reference), Cholesterol (Sigma—Aldrich), and PEG—Ceramide C16 (Avanti Polar Lipids) can be used to prepare lipid— dsRNA nanoparticles (i.e., LNP01 particles). Stock solutions of each in ethanol can be prepared as follows: ND98, 133 mg/ml; Cholesterol, 25 mg/ml, PEG—Ceramide C16, 100 mg/ml. The ND98, terol, and PEG—Ceramide C16 stock solutions can then be combined in a, e.g., 42:48: 10 molar ratio. The combined lipid solution can be mixed with aqueous dsRNA (e.g., in sodium acetate pH 5) such that the final ethanol concentration is about 35—45% and the final sodium e concentration is about 100—300 mM. Lipid— dsRNA nanoparticles typically form spontaneously upon mixing. Depending on the desired particle size distribution, the resultant nanoparticle e can be extruded through a rbonate ne (e.g., 100 nm cut—off) using, for example, a thermobarrel extruder, such as Lipex Extruder (Northern Lipids, Inc). In some cases, the extrusion step can be omitted. Ethanol l and simultaneous buffer exchange can be accomplished by, for example, dialysis or tial flow filtration. Buffer can be exchanged with, for example, phosphate buffered saline (PBS) at about pH 7, e.g., about pH 6.9, about pH 7.0, about pH 7.1, about pH 7.2, about pH 7.3, or about pH 7.4.

H H WJJ\/\ /\/N\/\ /\/N N\/\/\/\/\/\/ m 3 Ni WO H H omerl Formulal LNP01 formulations are described, e.g., in International Application Publication Additional ary lipid—dsRNA formulations are described in Table A.

Table A. cationic lipid/non-cationic Ionizable/Cationic Lipid lipid/cholesterol/PEG-lipid conjugate LipidzsiRNA ratio DLinDMA/DPPC/Cholesterol/PEG-CDMA l,2-Dilinolenyloxy-N,N-dimethylaminopropane (57.1/7.1/34.4/1.4) (DLinDMA) siRNA ~ 7:1 2,2-Dilinoleyldimethylaminoethyl-[ l , 3] - XTC/DPPC/Cholesterol/PEG-CDMA dioxolane (XTC) 57.1/7.1/34.4/1.4 lipid2siRNA ~ 7:1 PC/Cholesterol/PEG-DMG 2,2-Dilin01ey1dimethylamin0ethy1-[ 1 ,3] - LNP05 57.5/7.5/31.5/3.5 dioxolane (XTC) lipid2siRNA ~ 6:1 XTC/DSPC/Cholesterol/PEG-DMG 2,2-Dilin01ey1dimethylamin0ethy1-[ 1 ,3] - LNP06 57.5/7.5/31.5/3.5 dioxolane (XTC) lipid2siRNA ~ 11:1 XTC/DSPC/Cholesterol/PEG-DMG 2,2-Dilin01ey1dimethylamin0ethy1-[ 1 ,3] - LNP07 60/7.5/31/1.5, ane (XTC) siRNA ~ 6:1 XTC/DSPC/Cholesterol/PEG-DMG 2,2-Dilin01ey1dimethylamin0ethy1-[ 1 ,3] - LNP08 60/7.5/31/1.5, dioxolane (XTC) lioid:siRNA ~ 11:1 XTC/DSPC/Cholesterol/PEG-DMG 2,2-Dilin01ey1dimethylamin0ethy1-[ 1 ,3] - LNP09 50/10/38.5/1.5 dioxolane (XTC) Lioid:siRNA 10:1 (3aR,5s,6aS)-N,N-dimethy1—2,2-di((9Z,122)- ALN100/DSPC/Cholesterol/PEG-DMG LNP10 octadeca-9,12-dienyl)tetrahydr0-3aH- 50/10/38.5/1.5 cyclopenta[d] [1,3]di0X01—5-amine (ALN100) Lipid:siRNA 10:1 (6292,2813 1Z)-heptatriac0nta-6,9,28,3 1- MC-3/DSPC/Cholesterol/PEG-DMG LNP11 tetraen-19 -y1 4-(dimethylamin0)butan0ate 50/10/38.5/1.5 (MC3) Li oidzsiRNA 10:1 1,1'-(2-(4-(2-((2-(bis(2- Tech G1/DSPC/Ch01ester01/PEG-DMG hydroxydodecyl)amin0)ethyl)(2- LNP12 50/10/38.5/1.5 hydroxydodecyl)amin0)ethy1)piperazin siRNA 10:1 1)eth lazanedi l)did0decan01 (Tech G1) XTC/DSPC/Chol/PEG-DMG LNP13 XTC 50/10/38.5/1.5 Lioid:siRNA: 33:1 MC3/DSPC/Ch01/PEG-DMG LNP14 MC3 40/5 Lipid:siRNA: 11:1 PC/Chol/PEG-DSG/GalNAc-PEG-DSG LNP15 MC3 50/10/35/4.5/0.5 Liid:siRNA: 11:1 PC/Chol/PEG-DMG LNP16 MC3 50/10/38.5/1.5 Liid:siRNA: 7:1 MC3/DSPC/Chol/PEG-DSG LNP17 MC3 50/10/38.5/1.5 Liid:siRNA: 10:1 MC3/DSPC/Chol/PEG-DMG LNP18 MC3 50/10/38.5/1.5 Liid:siRNA: 12:1 MC3/DSPC/Chol/PEG-DMG LNP19 MC3 50/10/35/5 Lipid:siRNA: 8:1 MC3/DSPC/Chol/PEG-DPG LNP20 MC3 50/10/38.5/1.5 Lipid:siRNA: 10:1 C12-200/DSPC/Chol/PEG-DSG LNP21 C12-200 50/10/38.5/1.5 Lipid:siRNA: 7:1 XTC/DSPC/Chol/PEG-DSG LNP22 XTC 50/10/38.5/1.5 Lipid:siRNA: 10:1 DSPC: distearoylphosphatidylcholine DPPC: dipalmitoylphosphatidylcholine PEG—DMG: PEG—didimyristoyl glycerol (Cl4—PEG, or PEG—C14) (PEG with avg mol wt of 2000) PEG—DSG: PEG—distyryl glycerol (ClS—PEG, or PEG—C18) (PEG with avg mol wt of 2000) PEG—cDMA: rbamoyl—l,2—din1yristyloxypropylamine (PEG with avg mol wt of 2000) LNP ilinolenyloxy—N,N—din1ethylan1inopropane (DLinDMA)) comprising formulations are described in International Publication No. WO2009/127060, filed April 15, 2009, which is hereby incorporated by reference.

XTC comprising formulations are described, e.g., in US. Provisional Serial No. 61/148,366, filed January 29, 2009; US. Provisional Serial No. 61/156,851, filed March 2, 2009; US. Provisional Serial No. filed June 10, 2009; US. Provisional Serial No. 61/228,373, filed July 24, 2009; US. Provisional Serial No. 61/239,686, filed September 3, 2009, and ational Application No. , filed January 29, 2010, which are hereby incorporated by reference.

MC3 comprising formulations are bed, e.g., in US. Publication No. 2010/0324120, filed June 10, 2010, the entire contents of which are hereby incorporated by reference.

ALNY—100 comprising formulations are described, e.g., International patent application number PCT/US09/63933, filed on November 10, 2009, which is hereby orated by reference.

C12—200 sing formulations are described in US. Provisional Serial No. 61/175 ,770, filed May 5, 2009 and International Application No. PCT/US10/33777, filed May 5, 2010, which are hereby incorporated by reference.

Synthesis of ionizable/cationic lipids Any of the nds, e.g., cationic lipids and the like, used in the nucleic acid—lipid particles of the invention can be prepared by known organic synthesis techniques, including the methods bed in more detail in the Examples. All substituents are as defined below unless indicated otherwise.

"Alkyl" means a straight chain or branched, noncyclic or cyclic, saturated aliphatic hydrocarbon containing from 1 to 24 carbon atoms. Representative ted ht chain alkyls include methyl, ethyl, n—propyl, n—butyl, n—pentyl, n—hexyl, and the like; while saturated branched alkyls include isopropyl, sec—butyl, isobutyl, tert—butyl, isopentyl, and the like.

Representative saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and the like; while unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl, and the like.

"Alkenyl" means an alkyl, as defined above, containing at least one double bond between adjacent carbon atoms. Alkenyls include both cis and trans isomers. Representative straight chain and ed alkenyls include ethylenyl, propylenyl, 1—butenyl, 2—butenyl, ylenyl, 1—pentenyl, 2—pentenyl, yl—1—butenyl, 2—methyl—2—butenyl, 2,3—dimethyl— 2—butenyl, and the like.

"Alkynyl" means any alkyl or alkenyl, as defined above, which additionally contains at least one triple bond between nt carbons. Representative straight chain and ed ls include acetylenyl, propynyl, 1—butynyl, 2—butynyl, ynyl, 2—pentynyl, 3— methyl—1 butynyl, and the like.

"Acyl" means any alkyl, alkenyl, or alkynyl n the carbon at the point of attachment is tuted with an oxo group, as defined below. For example, —C(=O)alkyl, — C(=O)alkenyl, and —C(=O)alkynyl are acyl groups. ocycle" means a 5— to 7—membered monocyclic, or 7— to lO—membered bicyclic, heterocyclic ring which is either saturated, unsaturated, or aromatic, and which contains from 1 or 2 heteroatoms independently selected from nitrogen, oxygen and sulfur, and wherein the nitrogen and sulfur atoms can be optionally oxidized, and the nitrogen heteroatom can be optionally quatemized, including bicyclic rings in which any of the above heterocycles are fused to a benzene ring. The heterocycle can be attached via any heteroatom or carbon atom.

Heterocycles include heteroaryls as defined below. Heterocycles include morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, zynyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl, tetrahydroprimidinyl, tetrahydrothiophenyl, ydrothiopyranyl, tetrahydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, and the like.

The terms "optionally substituted alkyl", "optionally tuted alkenyl", "optionally substituted alkynyl", "optionally tuted acyl", and "optionally substituted heterocycle" means that, when substituted, at least one hydrogen atom is replaced with a substituent. In the case of an oxo substituent (=0) two hydrogen atoms are replaced. In this , substituents include oxo, halogen, heterocycle, —CN, —ORx, —NRny, —NRxC(=O)Ry, —NRxSO2Ry, -C(=O)Rx, —C(=O)ORx, —C(=O)NRny, —SOnRx and —SOnNRny, wherein n is 0, l or 2, Rx and Ry are the same or ent and independently hydrogen, alkyl or heterocycle, and each of said alkyl and heterocycle substituents can be further substituted with one or more of oxo, halogen, —OH, —CN, alkyl, —ORx, heterocycle, —NRny, —NRxC(=O)Ry, —NRxSO2Ry, -C(=O)Rx, -C(=O)ORx, -C(=O)NRny, -SOnRx and —SOnNRny.

"Halogen" means fluoro, chloro, bromo and iodo.

In some embodiments, the methods of the invention can require the use of protecting groups. Protecting group methodology is well known to those skilled in the art (see, for example, Protective Groups in Organic Synthesis, Green, T.W. er al., Wiley—Interscience, New York City, 1999). Brieﬂy, protecting groups within the context of this invention are any group that reduces or eliminates ed reactivity of a functional group. A protecting group can be added to a functional group to mask its reactivity during certain reactions and then removed to reveal the original onal group. In some embodiments an "alcohol protecting group" is used. An ol protecting group" is any group which decreases or eliminates unwanted reactivity of an alcohol functional group. Protecting groups can be added and removed using techniques well known in the art.

Compositions and formulations for oral stration include powders or granules, microparticulates, rticulates, suspensions or solutions in water or non—aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, ﬂavoring agents, diluents, emulsifiers, dispersing aids or binders can be desirable. In some embodiments, oral formulations are those in which dsRNAs featured in the invention are administered in conjunction with one or more penetration er surfactants and chelators. Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof.

Suitable bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, lic acid, glycodeoxycholic acid, holic acid, taurodeoxycholic acid, sodium tauro—24,25—dihydro—fusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, ic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1—monocaprate, 1— lazacycloheptan—2—one, an acylcamitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g., sodium). In some embodiments, combinations of penetration enhancers are used, for example, fatty acids/salts in combination with bile acids/salts. One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene—9—lauryl ether, polyoxyethylene—20—cetyl ether. DsRNAs featured in the invention can be delivered orally, in granular form including d dried particles, or complexed to form micro or nanoparticles. DsRNA complexing agents include poly—amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; ized gelatins, albumins, es, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE—derivatized polyimines, pollulans, celluloses and starches.

Suitable complexing agents include chitosan, N—trimethylchitosan, poly—L—lysine, polyhistidine, polyornithine, polyspermines, ine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g., p—amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE—methacrylate, DEAE— hexylacrylate, DEAE—acrylamide, DEAE—albumin and DEAE—dextran, polymethylacrylate, polyhexylacrylate, poly(D,L—lactic acid), poly(DL—lactic—co—glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG). Oral formulations for dsRNAs and their preparation are described in detail in US. Patent 906, US Publn. No. 20030027780, and US. Patent No. 014, each of which is incorporated herein by nce.

Compositions and formulations for parenteral, intraparenchymal (into the , intrathecal, intraventricular or intrahepatic administration can include sterile s solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

Pharmaceutical compositions of the present invention include, but are not limited to, ons, emulsions, and liposome—containing formulations. These itions can be generated from a variety of components that include, but are not limited to, preformed liquids, mulsifying solids and self—emulsifying semisolids. Particularly preferred are formulations that target the liver when treating hepatic disorders such as hepatic carcinoma.

The pharmaceutical ations of the present invention, which can conveniently be presented in unit dosage form, can be prepared according to conventional ques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical r(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately ng into association the active ingredients with liquid rs or finely divided solid carriers or both, and then, if necessary, shaping the product.

The compositions of the present invention can be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention can also be formulated as suspensions in s, non—aqueous or mixed media. Aqueous suspensions can further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, ol and/or dextran. The suspension can also contain stabilizers.

C. onal ations i. Emulsions The compositions of the present invention can be prepared and formulated as emulsions. ons are typically heterogeneous systems of one liquid dispersed in another in the form of droplets usually ing 0.10m in diameter (see e.g., s Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 2, p. 335; Higuchi er al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and sed with each other. In general, emulsions can be of either the water—in—oil (w/o) or the oil—in—water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water—in—oil (w/o) emulsion. atively, when an oily phase is finely divided into and sed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil—in—water (o/w) emulsion.

Emulsions can contain additional components in addition to the dispersed phases, and the active drug which can be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti— oxidants can also be present in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil—in—water—in—oil (o/w/o) and water—in—oil—in—water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not.

Multiple emulsions in which individual oil ts of an o/w emulsion enclose small water ts constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion.

Emulsions are terized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the al or continuous phase and maintained in this form h the means of emulsifiers or the viscosity of the ation. Either of the phases of the emulsion can be a semisolid or a solid, as is the case of emulsion—style nt bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that can be incorporated into either phase of the emulsion. Emulsifiers can broadly be classified into four categories: synthetic surfactants, naturally ing emulsifiers, absorption bases, and finely dispersed solids (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, cott Williams & s (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199).

Synthetic tants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rieger, in ceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, NY, 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a le tool in categorizing and ing surfactants in the preparation of formulations. Surfactants can be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery s, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 285).

Naturally occurring emulsifiers used in emulsion formulations include lanolin, x, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic atum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum te, ts and nonpolar solids such as carbon or glyceryl tristearate.

A large variety of non—emulsifying materials are also included in emulsion formulations and contribute to the properties of ons. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker , 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199).

Hydrophilic colloids or hydrocolloids include naturally ing gums and synthetic rs such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for e, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, ers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize ons by forming strong interfacial films around the sed—phase droplets and by increasing the viscosity of the external phase.

Since emulsions often n a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that can readily support the growth of microbes, these formulations often incorporate vatives. Commonly used preservatives included in on formulations e methyl paraben, propyl n, quaternary ammonium salts, benzalkonium chloride, esters of p—hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation.

Antioxidants used can be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.

The application of emulsion formulations via dermatological, oral and parenteral routes and methods for their manufacture have been reviewed in the literature (see 6.g.

Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker , 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because of ease of formulation, as well as efficacy from an tion and bioavailability standpoint (see 6.g. Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in ceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral—oil base laxatives, oil—soluble vitamins and high fat ive preparations are among the materials that have commonly been stered orally as o/w emulsions. ii. Microemulsions In one embodiment of the present invention, the compositions of iRNAs and nucleic acids are formulated as microemulsions. A microemulsion can be defined as a system of water, oil and amphiphile which is a single optically pic and dynamically stable liquid solution (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; , in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant on and then adding a sufficient amount of a fourth component, generally an intermediate chain—length alcohol to form a arent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of e—active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185—215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the in—oil (w/o) or an oil— in—water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

The phenomenological ch utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (see e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; , in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker , 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water—insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.

Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non—ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (M0310), hexaglycerol monooleate (P0310), hexaglycerol pentaoleate (P0500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (M0750), decaglycerol sequioleate (S0750), decaglycerol decaoleate (DA0750), alone or in combination with cosurfactants.

The cosurfactant, y a short—chain l such as l, anol, and 1—butanol, serves to se the interfacial fluidity by penetrating into the surfactant film and consequently creating a ered film because of the void space generated among surfactant molecules. Microemulsions can, however, be prepared without the use of cosurfactants and alcohol—free self—emulsifying microemulsion systems are known in the art. The aqueous phase can typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene s, and derivatives of ethylene . The oil phase can include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8—C12) mono, di, and tri—glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8—C10 glycerides, vegetable oils and ne oil.

Microemulsions are particularly of interest from the standpoint of drug lization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (see e.g., U.S.

Patent Nos. 6,191,105; 7,063,860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 390; Ritschel, Meth. Find. Exp. Clin.

Pharmacol., 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug tion due to surfactant—induced alterations in membrane ﬂuidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (see e.g., U.S. Patent Nos. 6,191,105; 860; 7,070,802; 7,157,099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J.

Pharm. Sci, 1996, 85, 138—143). 0ften microemulsions can form spontaneously when their components are brought together at t temperature. This can be particularly advantageous when formulating thermolabile drugs, peptides or iRNAs. Microemulsions have also been ive in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of iRNAs and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of iRNAs and nucleic acids.

Microemulsions of the present invention can also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the iRNAs and nucleic acids of the present invention. Penetration enhancers used in the microemulsions of the present invention can be classified as belonging to one of five broad categories—— surfactants, fatty acids, bile salts, chelating agents, and non—chelating non—surfactants (Lee et al., al Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above. iii. Microparticles An RNAi agent of the invention may be incorporated into a particle, e. g. a microparticle. Microparticles can be produced by spray—drying, but may also be produced by other s including lization, evaporation, ﬂuid bed drying, vacuum drying, or a combination of these techniques. iv. Penetration Enhancers In one embodiment, the present invention s various penetration enhancers to effect the efficient delivery of nucleic acids, particularly iRNAs, to the skin of animals. Most drugs are present in on in both ionized and nonionized forms. However, y only lipid soluble or lipophilic drugs readily cross cell nes. It has been ered that even non—lipophilic drugs can cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non—lipophilic drugs across cell membranes, penetration enhancers also e the bility of lipophilic drugs.

Penetration enhancers can be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non—chelating rfactants (see e. g., Malmsten, M. Surfactants and polymers in drug ry, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.

Surfactants (or "surface—active ") are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the acial tension between the aqueous solution and another liquid, with the result that absorption of iRNAs through the mucosa is enhanced. In on to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene—9—lauryl ether and polyoxyethylene—20—cetyl ether) (see e.g., Malmsten, M. Surfactants and polymers in drug ry, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such as FC—43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).

Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n—decanoic acid), ic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1—monooleoyl—rac— glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1—monocaprate, 1— dodecylazacycloheptan—2—one, acylcarnitines, acylcholines, C1_20 alkyl esters thereof (e.g., methyl, pyl and t—butyl), and mono— and di—glycerides thereof (i. e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (see e.g., Touitou, E., et al.

Enhancement in Drug Delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug r Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier s, 1990, 7, 1—33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651— 654).

The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat—soluble vitamins (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Brunton, Chapter 38 in: Goodman & 's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman er al. Eds., McGraw— Hill, New York, 1996, pp. 934—935). Various l bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium e), ocholic acid (sodium dehydrocholate), deoxycholic acid (sodium holate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), holic acid (sodium taurocholate), taurodeoxycholic acid (sodium eoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro—24,25—dihydro—fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene—9—lauryl ether (POE) (see e.g., Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in eutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782—783; Muranishi, Critical s in Therapeutic Drug Carrier s, 1990, 7, 1—33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579—583).

Chelating agents, as used in connection with the present invention, can be d as compounds that remove metallic ions from on by forming complexes therewith, with the result that absorption of iRNAs through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase tors, as most characterized DNA nucleases e a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315—339). Suitable chelating agents include but are not limited to disodium nediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5— methoxysalicylate and homovanilate), N—acyl tives of collagen, laureth—9 and N—amino acyl derivatives of beta—diketones (enamines)(see e.g., Katdare, A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in eutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1—33; Buur er al., J. Control Rel., 1990, 14, 43-51).

As used herein, non—chelating non—surfactant penetration enhancing compounds can be d as compounds that trate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of iRNAs through the alimentary mucosa (see e.g., Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1—33).

This class of penetration enhancers includes, for example, unsaturated cyclic ureas, l— and 1—alkenylazacyclo—alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non—steroidal anti—inﬂammatory agents such as diclofenac sodium, indomethacin and butazone (Yamashita er al., J. Pharm.

Pharmacol., 1987, 39, 621—626).

Agents that enhance uptake of iRNAs at the cellular level can also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi er al, US. Pat. No. 5,705,188), cationic ol derivatives, and polycationic molecules, such as polylysine (Lollo er al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of dsRNAs. Examples of commercially available transfection reagents include, for example LipofectamineTM (Invitrogen; Carlsbad, CA), Lipofectamine 2000TM (Invitrogen; Carlsbad, CA), 293fectinTM (Invitrogen; Carlsbad, CA), CellfectinTM (Invitrogen; Carlsbad, CA), DMRIE—CTM (Invitrogen; Carlsbad, CA), FreeStyleTM MAX (Invitrogen; Carlsbad, CA), LipofectamineTM 2000 CD (Invitrogen; Carlsbad, CA), LipofectamineTM (Invitrogen; Carlsbad, CA), RNAiMAX (Invitrogen; Carlsbad, CA), OligofectamineTM rogen; Carlsbad, CA), OptifectTM (Invitrogen; Carlsbad, CA), X—tremeGENE Q2 Transfection t (Roche; Grenzacherstrasse, Switzerland), DOTAP Liposomal Transfection Reagent acherstrasse, Switzerland), DOSPER Liposomal Transfection Reagent (Grenzacherstrasse, Switzerland), or Fugene acherstrasse, Switzerland), Transfectam® Reagent ga; Madison, WI), TransFastTM Transfection Reagent ga; Madison, WI), 0 t (Promega; Madison, WI), foTM—50 t (Promega; Madison, WI), DreamFectTM (OZ Biosciences; lle, France), EcoTransfect (OZ Biosciences; Marseille, France), assa D1 Transfection Reagent (New England Biolabs; Ipswich, MA, USA), LyoVecTM/LipoGenTM (Invitrogen; San Diego, CA, USA), PerFectin Transfection Reagent (Genlantis; San Diego, CA, USA), NeuroPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), GenePORTER Transfection reagent (Genlantis; San Diego, CA, USA), GenePORTER 2 Transfection reagent (Genlantis; San Diego, CA, USA), Cytofectin Transfection Reagent (Genlantis; San Diego, CA, USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), TroganPORTERTM transfection Reagent (Genlantis; San Diego, CA, USA ), RiboFect (Bioline; Taunton, MA, USA), PlasFect (Bioline; Taunton, MA, USA), UniFECTOR (B—Bridge International; Mountain View, CA, USA), SureFECTOR (B—Bridge International; Mountain View, CA, USA), or HiFectTM (B—Bridge International, Mountain View, CA, USA), among .

Other agents can be utilized to enhance the penetration of the stered nucleic acids, including glycols such as ne glycol and propylene glycol, pyrrols such as 2— pyrrol, azones, and terpenes such as limonene and menthone. v. Carriers n compositions of the present invention also incorporate carrier compounds in the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid, or analog thereof, which is inert (i. 6., does not possess biological activity per se) but is recognized as a nucleic acid by in viva processes that reduce the ilability of a nucleic acid having biological activity by, for e, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial ion of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate dsRNA in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, tidic acid or 4—acetamido—4'isothiocyano—stilbene— 2,2'—disulfonic acid (Miyao er al., DsRNA Res. Dev., 1995, 5, 115—121; Takakura er al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177—183. vi. Excipients In contrast to a carrier nd, a "pharmaceutical carrier" or "excipient" is a pharmaceutically able solvent, ding agent or any other pharmacologically inert e for delivering one or more nucleic acids to an animal. The excipient can be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc, when combined with a nucleic acid and the other components of a given pharmaceutical composition. l pharmaceutical carriers include, but are not limited to, g agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or ypropyl methylcellulose, etc); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl ose, polyacrylates or calcium hydrogen phosphate, etc); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, hylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc).

Pharmaceutically acceptable organic or nic excipients suitable for non— eral administration which do not riously react with c acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, ls, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

Formulations for topical administration of nucleic acids can include sterile and non— sterile aqueous solutions, non—aqueous ons in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions can also contain s, diluents and other suitable ves. Pharmaceutically acceptable organic or inorganic excipients suitable for renteral administration which do not riously react with nucleic acids can be used.

Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene s, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like. vii. Other Components The compositions of the present invention can additionally contain other adjunct components conventionally found in pharmaceutical itions, at their tablished usage levels. Thus, for example, the compositions can contain additional, compatible, pharmaceutically—active materials such as, for e, antipruritics, astringents, local anesthetics or anti—inﬂammatory , or can contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the itions of the present ion. The ations can be sterilized and, if desired, mixed with auxiliary agents, e. g., lubricants, preservatives, stabilizers, wetting agents, fiers, salts for inﬂuencing osmotic pressure, buffers, colorings, ﬂavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.

Aqueous suspensions can contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.

The suspension can also contain stabilizers.

In some embodiments, pharmaceutical compositions featured in the invention include (a) one or more iRNA compounds and (b) one or more agents which function by a non—RNAi mechanism and which are useful in treating a bleeding disorder. Examples of such agents include, but are not lmited to an anti—inﬂammatory agent, anti—steatosis agent, anti—viral, and/or anti—fibrosis agent. In addition, other substances ly used to protect the liver, such as silymarin, can also be used in conjunction with the iRNAs described . Other agents useful for treating liver diseases include telbivudine, vir, and protease inhibitors such as telaprevir and other disclosed, for example, in Tung et al., U.S. Application Publication Nos. 2005/0148548, 2004/0167116, and 2003/0144217; and in Hale et al., U.S.

Application Publication No. 2004/0127488. ty and eutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e. g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit high therapeutic indices are preferred.

The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of compositions ed herein in the invention lies generally within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the methods featured in the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to e a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC50 (i.e., the concentration of the test compound which achieves a aximal inhibition of symptoms) as ined in cell culture. Such information can be used to more accurately determine useful doses in . Levels in plasma can be measured, for e, by high performance liquid chromatography.

In addition to their administration, as discussed above, the iRNAs featured in the invention can be administered in combination with other known agents effective in treatment of pathological processes mediated by Serpinal expression. In any event, the administering physician can adjust the amount and timing of iRNA administration on the basis of s observed using standard measures of efficacy known in the art or described .

VI. Methods For Inhibiting al Expression The present invention provides methods of inhibiting expression of a Serpinal in a cell. The methods include contacting a cell with an RNAi agent, e.g., a double stranded RNAi agent, in an amount effective to inhibit expression of the Serpinal in the cell, thereby inhibiting expression of the Serpinal in the cell.

Contacting of a cell with a double stranded RNAi agent may be done in vitro or in viva. Contacting a cell in vivo with the RNAi agent includes contacting a cell or group of cells within a subject, e.g., a human subject, with the RNAi agent. Combinations of in vitro and in viva methods of contacting are also le. Contacting may be direct or ct, as discussed above. Furthermore, contacting a cell may be accomplished via a targeting ligand, including any ligand described herein or known in the art. In preferred embodiments, the ing ligand is a carbohydrate moiety, e.g., a GalNAC3 ligand, or any other ligand that directs the RNAi agent to a site of interest, e.g., the liver of a subject.

The term "inhibiting," as used herein, is used interchangeably with "reducing," "silencing," "downregulating" and other similar terms, and includes any level of inhibition.

The phrase "inhibiting expression of a Serpinal" is intended to refer to inhibition of expression of any Serpinal gene (such as, e.g., a mouse al gene, a rat Serpinal gene, a monkey Serpinal gene, or a human Serpinal gene) as well as variants or mutants of a Serpinal gene. Thus, the al gene may be a wild—type Serpinal gene, a mutant Serpinal gene, or a transgenic Serpinal gene in the context of a cally manipulated cell, group of cells, or organism.

"Inhibiting expression of a Serpinal gene" includes any level of inhibition of a Serpinal gene, e.g., at least partial suppression of the expression of a Serpinal gene. The expression of the Serpinal gene may be assessed based on the level, or the change in the level, of any variable ated with Serpinal gene expression, e.g., Serpinal mRNA level, Serpinal protein level, or lipid levels. This level may be assessed in an individual cell or in a group of cells, including, for e, a sample derived from a subject.

Inhibition may be assessed by a decrease in an absolute or relative level of one or more variables that are associated with Serpinal expression compared with a control level.

The control level may be any type of l level that is utilized in the art, e.g., a se baseline level, or a level determined from a r subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).

In some embodiments of the methods of the invention, expression of a Serpinal gene is ted by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%. at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

Inhibition of the expression of a Serpinal gene may be manifested by a reduction of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a al gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an RNAi agent of the invention, or by administering an RNAi agent of the invention to a subject in which the cells are or were t) such that the expression of a Serpinal gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s)). In preferred embodiments, the tion is assessed by expressing the level of mRNA in treated cells as a percentage of the level of mRNA in control cells, using the following formula: (mRNA in control cells) — (mRNA in d cells) —. 10070 (mRNA in control cells) atively, inhibition of the expression of a Serpinal gene may be assessed in terms of a reduction of a ter that is functionally linked to Serpinal gene expression, e.g., Serpinal protein expression, such as ALT, alkaline phosphatase, bilirubin, prothrombin and albumin. Serpinal gene silencing may be determined in any cell expressing Serpinal, either constitutively or by genomic engineering, and by any assay known in the art. The liver is the major site of Serpinal expression. Other significant sites of expression e the lung and intestines.

Inhibition of the expression of a al protein may be manifested by a reduction in the level of the al protein that is sed by a cell or group of cells (e.g., the level of protein expressed in a sample derived from a subject). As explained above for the assessment of mRNA suppression, the ton of protein expression levels in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells.

A control cell or group of cells that may be used to assess the inhibition of the expression of a Serpinal gene includes a cell or group of cells that has not yet been ted with an RNAi agent of the invention. For example, the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an RNAi agent.

The level of Serpinal mRNA that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of expression of Serpinal in a sample is determined by detecting a transcribed cleotide, or portion thereof, e.g., mRNA of the Serpinal gene. RNA may be extracted from cells using RNA tion techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy RNA preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run—on assays, RT—PCR, RNase protection assays (Melton er al., Nuc. Acids Res. 12:7035), Northern blotting, in situ hybridization, and microarray analysis.

In one embodiment, the level of expression of Serpinal is determined using a nucleic acid probe. The term "probe", as used herein, refers to any molecule that is capable of selectively binding to a specific Serpinal. Probes can be synthesized by one of skill in the art, or derived from appropriate biological ations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, rn or rn analyses, polymerase chain reaction (PCR) analyses and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can ize to Serpinal mRNA.

In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an Affymetrix gene chip array. A d artisan can readily adapt known mRNA detection methods for use in determining the level of Serpinal mRNA.

An alternative method for determining the level of expression of Serpinal in a sample involves the process of nucleic acid amplification and/or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT—PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Pat. No. 4,683,202), ligase chain on (Barany (1991) Proc.

Natl. Acad. Sci. USA 88:189—193), self sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874—1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173—1177), Q—Beta Replicase (Lizardi et al. (1988) Bio/Technology 6:1197), rolling circle replication (Lizardi et al., U.S. Pat. No. 033) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of c acid molecules if such les are present in very low numbers. In ular aspects of the ion, the level of expression of Serpinal is determined by quantitative fluorogenic RT—PCR (i.e., the TaqManTM System).

The expression levels of Serpinal mRNA may be monitored using a membrane blot (such as used in hybridization analysis such as Northern, Southern, dot, and the like), or microwells, sample tubes, gels, beads or fibers (or any solid support comprising bound nucleic acids). See U.S. Pat. Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195 and 934, which are incorporated herein by nce. The determination of Serpinal expression level may also comprise using nucleic acid probes in on.

In preferred embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) assays or real time PCR . The use of these methods is described and exemplified in the es presented herein.

The level of Serpinal n expression may be determined using any method known in the art for the measurement of protein levels. Such s include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, ﬂuid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, ﬂow cytometry, diffusion (single or double), immunoelectrophoresis, Western blotting, mmunoassay (RIA), enzyme—linked immunosorbent assays (ELISAs), immunoﬂuorescent assays, ochemiluminescence assays, and the like.

The term "sample" as used herein refers to a collection of similar ﬂuids, cells, or tissues isolated from a subject, as well as ﬂuids, cells, or tissues present Within a subject.

Examples of biological ﬂuids include blood, serum and serosal ﬂuids, plasma, lymph, urine, cerebrospinal ﬂuid, saliva, ocular ﬂuids, and the like. Tissue samples may include samples from tissues, organs or localized regions. For example, samples may be derived from ular organs, parts of organs, or ﬂuids or cells Within those organs. In certain embodiments, samples may be derived from the liver (6.g. , Whole liver or certain segments of liver or n types of cells in the liver, such as, e.g., cytes). In preferred embodiments, a "sample derived from a subject" refers to blood or plasma drawn from the subject. In further embodiments, a e derived from a t" refers to liver tissue derived from the subject.

In some ments of the methods of the invention, the RNAi agent is administered to a subject such that the RNAi agent is delivered to a specific site Within the subject. The inhibition of expression of Serpinal may be assessed using ements of the level or change in the level of Serpinal mRNA or Serpinal protein in a sample derived from ﬂuid or tissue from the specific site Within the subject. In preferred embodiments, the site is the liver. The site may also be a subsection or subgroup of cells from any one of the aforementioned sites. The site may also include cells that express a particular type of receptor.

VII. Methods for Treating 0r Preventing a Serpinal Associated Disease The present invention also provides methods for treating or preventing diseases and conditions that can be modulated by down regulating Serpinal gene expression. For example, the compositions described herein can be used to treat Serpinal associated diseases, such as liver diseases, e.g., chronic liver disease, liver inﬂammation, cirrhosis, liver fibrosis, and/or cellular carcinoma, and other pathological conditions that may be ated with these disorders, such as lung inﬂammation, emphysema, and COPD.

The present invention also es methods for inhibiting the pment of hepatocellular carcinoma in a subject, e.g., a subject having a Serpinal deficiency variant.

The s include administering a therapeutically effective amount of a composition of the invention to the subject, thereby inhibiting the development of hepatocellular carcinoma in the subject.

Methods and uses of the compositions of the invention for reducing the accumulation of misfolded Serpinal in the liver of a subject, e.g., a subject having a Serpinal ency variant, are also provided by the present invention. The methods include adminsitering a eutically effective amount of a composition of the ion to the t, thereby reducing the accumulation of misfolded Serpinal in the liver of the subject.

As used herein, a "subject" es a human or man animal, ably a vertebrate, and more preferably a mammal. A t may include a transgenic organism.

Most ably, the subject is a human, such as a human ing from or predisposed to developing a Serpinal—associated disease. In one embodiment, the subject suffering or predisposed to developing a Serpinal—associated disease has one or more Serpinal deficient alleles, e.g., a PIZ, PIS, or PIM(Malton) allele.

In further embodiments of the invention, an iRNA agent of the invention is administered in combination with an onal therapeutic agent. The iRNA agent and an additional therapeutic agent can be administered in combination in the same composition, e.g., parenterally, or the additional eutic agent can be administered as part of a separate composition or by another method described herein. es of additional therapeutic agents suitable for use in the methods of the ion include those agents known to treat liver disorders, such as liver cirhosis. For example, an iRNA agent ed in the invention can be administered with, e.g., ursodeoxycholic acid (UDCA), immunosuppressive agents, methotrexate, osteroids, cyclosporine, colchicine, antipruritic treatments, such as antihistamines, cholestyramine, colestipol, rifampin, dronabinol (Marinol), and plasmaphesesis, prophylactic antibiotics, ultraviolet light, zinc supplements, and hepatitis A, inﬂuenza and pneumococci vaccination.

In some embodiments of the methods of the invention, Serpinal expression is decreased for an extended duration, e.g., at least one week, two weeks, three weeks, or four weeks or longer. For example, in certain instances, expression of the Serpinal gene is suppressed by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or 55% by administration of an iRNA agent described herein. In some embodiments, the Serpinal gene is suppressed by at least about 60%, 70%, or 80% by administration of the iRNA agent.

In some embodiments, the Serpinal gene is suppressed by at least about 85%, 90%, or 95% by administration of the iRNA agent.

The iRNA agents of the invention may be administered to a t using any mode of administration known in the art, including, but not limited to subcutaneous, intravenous, intramuscular, intraocular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, cerebrospinal, and any combinations thereof. In preferred embodiments, the iRNA agents are administered subcutaneously.

In some embodiments, the administration is via a depot injection. A depot ion may e the iRNA agents in a consistent way over a prolonged time period. Thus, a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of Serpinal, or a eutic or prophylactic effect. A depot injection may also provide more consistent serum concentrations. Depot injections may include subcutaneous injections or intramuscular ions. In preferred embodiments, the depot ion is a subcutaneous injection.

In some embodiments, the administration is via a pump. The pump may be an external pump or a ally implanted pump. In n embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. An infusion pump may be used for intravenous, subcutaneous, arterial, or epidural infusions. In preferred ments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implanted pump that delivers the RNAi agent to the liver.

Other modes of administration include epidural, intracerebral, intracerebroventricular, nasal administration, intraarterial, intracardiac, sseous infusion, intrathecal, and intravitreal, and pulmonary. The mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated. The route and site of administration may be chosen to enhance targeting.

The methods of the ion include administering an iRNA agent at a dose sufficient to suppress/decrease levels of Serpinal mRNA for at least 5, more preferably 7, 10, 14, 21, 25 , 30 or 40 days; and optionally, administering a second single dose of the iRNA agent, wherein the second single dose is administered at least 5, more preferably 7, 10, 14, 21, 25, 30 or 40 days after the first single dose is administered, thereby ting the expression of the Serpinal gene in a subject.

In one embodiment, doses of an iRNA agent of the invention are administered not more than once every four weeks, not more than once every three weeks, not more than once every two weeks, or not more than once every week. In another embodiment, the strations can be maintained for one, two, three, or six months, or one year or longer.

In general, the iRNA agent does not activate the immune system, e.g., it does not increase cytokine levels, such as TNF—alpha or IFN—alpha levels. For example, when measured by an assay, such as an in vitro PBMC assay, such as described herein, the increase in levels of TNF—alpha or IFN—alpha, is less than 30%, 20%, or 10% of control cells treated with a control iRNA agent, such as an iRNA agent that does not target Serpinal.

For example, a subject can be administered a therapeutic amount of an iRNA agent, such as 0.5 mg/kg, 10 mg/kg, 15 mg/kg, 2.0 mg/kg, or 2.5 mg/kg dsRNA. The iRNA agent can be administered by intravenous infusion over a period of time, such as over a 5 minute, , 15 minute, 20 , or 25 minute period. The administration is ed, for example, on a regular basis, such as biweekly (Le. two weeks) for one month, two , every months, three months, four months or longer.

After an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after administration biweekly for three months, stration can be repeated once per month, for six months or a year or longer. Administration of the iRNA agent can reduce Serpinal levels, e.g., in a cell, tissue, blood, urine, organ (e.g., the liver), or other compartment of the patient by at least 10%, at least 15%, at least 20%, at least %, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80 % or at least 90% or more.

Before administration of a full dose of the iRNA agent, patients can be administered a r dose, and monitored for adverse effects, such as an allergic reaction, or for elevated lipid levels or blood pressure. In another example, the patient can be monitored for unwanted immunostimulatory effects, such as increased cytokine (e.g., TNF—alpha or INF—alpha) levels.

An exemplary smaller dose is one that results in an incidence of infusion reaction of less than or equal to 5%.

Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, m severity, reduction in pain, quality of life, dose of a tion required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. For example, efficacy of treatment of liver is or amelioration of liver fibrosis can be assessed, for example by periodic monitoring of liver fibrosis s: a—2—macroglobulin(a—MA), transferrin, apolipoproteinAl, hyaluronic acid (HA), n, N—terminal procollagen III(PIIINP), 7S collagen IV (7S—IV), total bilirubin, indirect bilirubin, alanine aminotransferase (ALT), aspartate aminotransferase(AST), AST/ ALT, g—glutamyl transpeptidase(GGT), alkaline phosphatase(ALP), albumin, albumin/globulin, blood urea nitrogen(BUN), creatinine(Cr), triglyceride, cholersterol, high density lipoprotein and low density lipoprotein and liver puncture biopsy. Liver fibrosis markers can be measured and/or liver puncture biopsy can be performed before treatment (initial readings) and subsequently (later readings) during the treatment n.

Comparisons of the later gs with the l gs provide a physician an tion of whether the treatment is effective. It is well within the y of one skilled in the art to monitor cy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. In tion with the administration of an iRNA agent targeting Serpinal or pharmaceutical composition thereof, "effective against" a Serpinal associate disease, such as a liver disease, e.g., a hepatic fibrosis condition, indicates that administration of an iRNA agent of the invention in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as an improvement of symptoms, a cure, a reduction in disease load, reduction in tumor mass or cell numbers, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating liver es.

In the s of the invention, an iRNA agent as described herein can be used to treat individuals having the signs, symptoms and/or markers of, or being diagnosed with, or being a risk of having an Serpinal associate disease, such as a liver disease, e.g., liver inﬂammation, cirrhosis, liver fibrosis, and/or hepatoceullar carcinoma. One of skill in the art can easily monitor the signs, symptoms, and/or makers of such disorders in subjects receiving ent with an iRNA agent as described herein and assay for a reduction in these signs, symptoms and/or makers of at least 10% and preferably to a clinical level representing a low risk of liver disease.

A treatment or preventive effect is evident when there is a statistically significant improvement in one or more parameters of disease status, or by a failure to worsen or to develop symptoms where they would otherwise be anticipated. As an example, a favorable change of at least 10% in a measurable parameter of disease (such as a liver on described supra), and preferably at least 20%, 30%, 40%, 50% or more can be indicative of effective treatment. cy for a given iRNA agent of the invention or ation of that iRNA agent can also be judged using an experimental animal model for the given disease as known in the art.

When using an mental animal model, cy of treatment is ced when a statistically significant ion in a marker or symptom is observed.

A treatment or preventive effect is also evident when one or more symtoms are reduced or alleveiated. For example, a treatment or preventive is effective when one or more of weakness, fatigue, weight loss, nausea, ng, nal swelling, extremity ng, excessive itching, and jaundice of the eyes and/or skin is d or alleviated.

For n indications, the efficacy can be ed by an increase in serum levels of Serpinal protein. As an example, an increase of serum levels of properly folded Serpinal of at least 10%, at least 20%, at least 50%, at least 100%, at least 200% more can be indicative of effective treatment.

Alternatively, the efficacy can be measured by a reduction in the severity of disease as determined by one skilled in the art of diagnosis based on a clinically accepted disease severity grading scale, as but one example the Child—Pugh score (sometimes the Child— Turcotte—Pugh score). In this example, prognosis of chronic liver e, mainly cirrhosis, is measured by an aggregate score of five clinical measures, billirubin, serum albumin, INR, ascites, and hepatic encephalopathy. Each marker is assigned a value from l—3, and the total value is used to provide a score categorized as A (5—6 points), B (7—9 points), or C (10—l5 points), which can be correlated with one and two year survival rates. Methods for determination and analysis of Child—Pugh scores are well known in the art (Farnsworth et al, Am J y 2004 188:580—583; Child and Turcotte. Surgery and portal hypertension. In: The liver and portal hypertension. Edited by CG Child. Philadelphia: Saunders 1964:50— 64; Pugh et al, Br J Surg 1973;60:648—52). cy can be measured in this example by the movement of a patient from e.g., a "B" to an "A." Any positive change resulting in e.g., lessening of severity of disease measured using the appropriate scale, ents adequate treatment using an iRNA or iRNA formulation as described herein.

In one embodiment, the RNAi agent is administered at a dose of between about 0.25 mg/kg to about 50 mg/kg, e.g., n about 0.25 mg/kg to about 0.5 mg/kg, between about 0.25 mg/kg to about 1 mg/kg, between about 0.25 mg/kg to about 5 mg/kg, between about 0.25 mg/kg to about 10 mg/kg, between about 1 mg/kg to about 10 mg/kg, between about 5 mg/kg to about 15 mg/kg, between about 10 mg/kg to about 20 mg/kg, between about 15 mg/kg to about 25 mg/kg, between about 20 mg/kg to about 30 mg/kg, between about 25 mg/kg to about 35 mg/kg, or between about 40 mg/kg to about 50 mg/kg.

The dose of an RNAi agent that is administered to a subject may be tailored to balance the risks and benefits of a particular dose, for example, to achieve a desired level of al gene suppression (as ed, e.g., based on Serpinal mRNA suppression, Serpinal protein expression) or a desired therapeutic or prophylactic effect, while at the same time avoiding undesirable side effects.

In some embodiments, the RNAi agent is stered in two or more doses. If desired to facilitate repeated or frequent infusions, implantation of a delivery device, 6. g. a pump, ermanent stent (e.g., intravenous, intraperitoneal, intracistemal or intracapsular), or reservoir may be advisable. In some ments, the number or amount of uent doses is dependent on the achievement of a desired effect, e.g., the suppression of a Serpinal gene, or the achievement of a therapeutic or prophylactic effect, e.g., reducing reducing a symptom of a liver disease. In some embodiments, the RNAi agent is administered according to a schedule. For example, the RNAi agent may be administered once per week, twice per week, three times per week, four times per week, or five times per week. In some embodiments, the schedule es regularly spaced administrations, e.g., hourly, every four hours, every six hours, every eight hours, every twelve hours, daily, every 2 days, every 3 days, every 4 days, every 5 days, weekly, biweekly, or monthly. In other embodiments, the schedule involves closely spaced administrations followed by a longer period of time during which the agent is not administered. In some embodiments, the RNAi agent is administered in a dosing regimen that includes a "loading phase" of closely spaced administrations that may be followed by a "maintenance phase", in which the RNAi agent is stred at longer spaced intervals.

Any of these les may optionally be repeated for one or more iterations. The number of ions may depend on the achievement of a desired effect, e.g., the ssion of a Serpinal gene, and/or the achievement of a therapeutic or prophylactic effect, e.g., reducing a symptom of a Serpinal associated disease, e.g., a liver disease.

In another aspect, the invention features, a method of cting an end user, e.g., a caregiver or a subject, on how to administer an iRNA agent bed herein. The method includes, optionally, providing the end user with one or more doses of the iRNA agent, and instructing the end user to administer the iRNA agent on a regimen described herein, y instructing the end user. c predisposition plays a role in the development of target gene associated diseases, e.g., liver e. Therefore, a patient in need of a siRNA can be identified by taking a family history, or, for example, screening for one or more genetic markers or variants. Accordingly, in one aspect, the invention provides a method of treating a patient by selecting a patient on the basis that the patient has one or more of a Serpinal deficiency or a al deficiency gene t, e.g., a PIZ, PIS, or PIM(Malton) allele. The method includes administering to the patient an iRNA agent in a therapeutically effective amount.

A healthcare provider, such as a doctor, nurse, or family member, can take a family history before prescribing or administering an iRNA agent of the invention. In on, a test may be performed to determine a geneotype or phenotype. For example, a DNA test may be performed on a sample from the patient, e.g., a blood sample, to identify the al genotype and/or phenotype before a Serpinal dsRNA is administered to the patient.

VIII. Kits The present invention also provides kits for using any of the iRNA agents and/or performing any of the methods of the invention. Such kits include one or more RNAi agent(s) and instructions for use, e.g., instructions for inhibiting expression of a Serpinal in a cell by contacting the cell with the RNAi agent(s) in an amount ive to inhibit expression of the Serpinal. The kits may optionally further comprise means for contacting the cell with the RNAi agent (e.g., an injection device), or means for measuring the inhibition of Serpinal (e.g., means for measuring the inhibition of Serpinal mRNA). Such means for measuring the inhibition of al may comprise a means for obtaining a sample from a subject, such as, e.g., a plasma sample. The kits of the invention may optionally further comprise means for administering the RNAi agent(s) to a subject or means for determining the eutically effective or prophylactically effective amount.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although s and materials similar or equivalent to those described herein can be used in the practice or testing of the iRNAs and methods featured in the invention, suitable s and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their ty. In case of conﬂict, the present specification, including definitions, will control. In addition, the als, methods, and examples are illustrative only and not intended to be limiting.

EXAMPLES Example 1. Mitigation of off-target effects and in vivo toxicity RNA interference or "RNAi" is a term initially coined by Fire and kers to describe the observation that double stranded RNAi (dsRNA) can block gene sion (Fire et al. (1998) Nature 391, 806—81 1; Elbashir et al. (2001) Genes Dev. 15, 188—200). Short dsRNA directs gene—specific, post—transcriptional silencing in many organisms, including vertebrates, and has provided a new tool for studying gene function. RNAi is mediated by RNA—induced silencing complex (RISC), a sequence—specific, multi—component nuclease that destroys messenger RNAs homologous to the ing trigger. RISC is known to contain short RNAs (approximately 22 nucleotides) derived from the double ed RNA trigger, but the protein components of this activity remained unknown.

One of the rget s of siRNA is the miRNA—like effect — the argonaute protein, the core effector in RNA interference, treats siRNA, which is artificially introduced in order to induce RNA interference, as a miRNA (microRNA). (Lam et al. (2015) Molecular Therapy Nucleic Acids (2015) 4, e252). The miRNA recognizes a target gene y h base—pairing between the seed region (positions 2—7 from the 5’ end) and the target mRNA for gene suppression. The off—targets caused by siRNAs originate from base— complemtarity of the seed regions of the RISC—loaded antisense strand of siRNA with one or more mRNA. The miRNA—like off—target effects in siRNAs have been ed in several s, and affect expression of multitude of genes depending on ces of the seed regions and are serious enough to cause up to 30% of the positive hits in siRNA based phenotype screening. Additionally, in the case of miRNAs, they are also reported to silence target genes through compensatory gs within their 3’ end regions (3’—compensatory pairing) when the interactions between seed region and targets become weak, implicating that the miRNA—like off—target effects are likely to be mediated by such mechanism.

As described below, it has been discovered that dsRNA agents where the antisense strand comprises at least one thermally destabilizing modification of the duplex within the seed region (i.e., at position 2—9 of the 5’—end of the antisense strand, counting from the 5'— end) and/or the dsRNA agent has a melting temperature in the range of from about 40°C to about 80°C can be more effective in mediating RNA interference than a parent dsRNA agent lacking the destabilizing modification. Such agents are advantageous for inhibition of target gene expression, while having reduced off—target gene silencing effects, as well as RNAi compositions suitable for eutic use.

Materials and Methods The ing materials and methods were used in the es. siRNA design Lead development candidate dsRNA agents targeting serine peptidase inhibitor, clade A, member 1 (Serpinal) (AAT) were selected for evaluation in the experiments described herein. dsRNA agents targeting Serpinal having the modified tide ce of the parent lead pment candidate and having an antisense strand comprising at least one thermally destabilizing modification of the duplex within the seed region (i.e., at position 2—9 of the 5’—end of the antisense strand, counting from the 5'—end) and/or having a melting temperature in the range of from about 40°C to about 80°C were designed, synthesized and evaluated as described below.

Specifically, as described in U.S. Provisional Application No. 61/826,125, filed on May 22, 2013, U.S. ional Application No. 61/898,695, filed on November 1, 2013; U.S. Provisional Application No. 61/979,727, filed on April 15, 2014; U.S. Provisional Application No. ,028, filed on May 6, 2014; U.S. Patent Application No. 14/284,745, now issued as U.S. Patent No. 9,574,192, issued on February 21, 2017; U.S. Patent Application No. ,820, filed on January 6, 2017; and International Patent Application No. , filed on May 22, 2014, AD-61444 was identified and shown to effectively and durably inhibit AAT in vitro and in vivo. The unmodified sense strand nucleotide sequence of AD—61444 is 5’ — CUUCUUAAUGAUUGAACAAAA — 3’ (SEQ ID NO: 417) and the unmodified nucleotide sequence of AD—61444 is 5’ — UUUUGUUCAAUCAUUAAGAAGAC — 3’ (SEQ ID NO: 419). The modified sense strand nucleotide sequence of AD—61444 is 5’ — csusucuuaaquAfuugaacaaaaL96 — 3’ (SEQ ID NO: 418) and the modified antisense strand nucleotide sequence of AD—61444 is 5’ — ngfquaAfucanuAfaGfaAfgsasc — 3’ (SEQ ID NO: 420).

Table B: Table 1: Abbreviations of nucleotide monomers used in nucleic acid sequence representation.

It will be understood that these monomers, when present in an oligonucleotide, are mutually linked b 5—3'— nhos nhodiester bonds.

Abbreviation Nucleotide(s) _Adenosine—3’—hoshate uoroadenosine—3’ — nhos nhate 2’ —fluoroadenosine—3 ’ — nhos nhorothioate Abbreviation Nucleotide(s) C c tidine—3’— nhos nhate Cf roc tidine—3’— nhos nhate Cfs 2’—ﬂuoroc —3’— nhos nhorothioate Cs cytidine—3 ’ —phosphorothioate G guanosine—3’—phosphate Gf 2’ —fluoroguanosine—3 ’ —phosphate Gfs 2’ —fluoroguanosine—3 ’ —phosphorothioate Gs guanosine—3 ’ —phosphorothioate T 5 ’ —methyluridine—3 ’ —phosphate Tf 2’—ﬂuoro—5—meth luridine—3’— nhos nhate Tfs 2’ —ﬂuoro—5—rneth luridine—3 ’ — nhos nhorothioate Ts 5—meth luridine—3’— nhos nhorothioate U Uridine—3 ’ — nhos nhate Uf 2’ uridine—3 ’ — nhos nhate Ufs rouridine —3’— nhos nhorothioate Us uridine —3’—phosphorothioate N any nucleotide (G, A, C, T or U) a 2'—O—methyladenosine—3 ’ —phosphate as 2'—O—methyladenosine—3’— phosphorothioate c 2'—O—methylcytidine—3 ’ —phosphate cs 2'—O—rnethylcytidine—3’— orothioate ; 2'—O—meth l uanosine—3’—hos hate 2'—O—meth luanosine—3’— hos ioate t 2’—O—meth l—S—meth luridine—3’— nhos nhate ts 2’—O—meth l—S—meth luridine—3’—nhnoshorothioate u 2'—O—meth luridine—3’— nhos nhate us 2'—O—meth luridine—3’— nhos nhorothioate s orothioate linkage L96 N—[tris(GalNAc—alkyl)—amidodecanoyl)]—4—hydroxyprolinol Hyp—(GalNAc—alkyl)3 L44 inverted abasic DNA (2—hydroXymethyl—tetrahydrofurane—5— phosphate) (Agn) Adenosine—glycol nucleic acid (GNA) (Egg) Cytidine—glycol nucleic acid (GNA) (ng) Guanosine—glycol nucleic acid (GNA) T_n Th midine—1 col nucleic acid (GNA) S—Isomer Abbreviation tide(s) P Phos hate VP Vin l—hos hate Aam 2\—O—(N—meth lacetamide)adenosine—3\— nhos nhate Aams 2\—O—(N—methylacetamide)adenosine—3Xphosphorothioate (Tam) N—methylacetamide)thymidine—3\—phosphate (Tams) 2\—O—(N—methylacetamide)thymidine—3Xphosphorothioate dA xyadenosine—3\—phosphate dAs 2\—deoxyadenosine—3\—phosphorothioate dC 2\—deoxycytidine—3\—phosphate dCs 2\—deox c tidine—3\—--hoshorothioate dG 2\—deox _--uanosine—3\—hoshate dGs 2\—deox osine—3\—hoshorothioate dT 2\—deox th midine—3\—hos hate de 2\—deox th midine—3\—--hoshorothioate dU 2\—deox uridine dUs 2\—deoxyuridine—3\—phosphorothioate Synthesis and Purification All oligonucleotides were prepared on a MerMade 192 synthesizer on a 1 umole scale using universal or custom supports. All phosphoramidites were used at a concentration 100 mM in 100% Acetonitrile or 9:1 AcetonitrilezDMF with a standard protocol for oethyl phosphoramidites, except that the coupling time was extended to 400 seconds. Oxidation of the newly formed linkages was ed using a solution of 50 mM 12 in 9:1 AcetonitrilezWater to create phosphate linkages and 100 mM DDTT in 9:1 PyridinezAcetonitrile to create phosphorothioate linkages. After the trityl—off synthesis, s were incubated with 150 uL of 40% aqueous Methylamine for 45 minutes and the solution drained Via vacuum into a 96—well plate. After repeating the incubation and draining with a fresh portion of aqueous Methylamine, the plate ning crude ucleotide solution was sealed and shaken at room ature for an additional 60 minutes to completely remove all protecting groups. of the crude oligonucleotides was accomplished Via the addition of 1.2 mL of 9:1 AcetonitrilezEtOH to each well followed by incubation at — °C overnight. The plate was then centrifuged at 3000 RPM for 45 minutes, the supernatant removed from each well, and the pellets resuspended in 950 uL of 20 mM aqueous NaOAc. Each crude solution was finally desalted over a GE Hi—Trap Desalting Column (Sephadex G25 Superfine) using water to elute the final oligonucleotide products.

All identities and purities were confirmed using ESI—MS and IEX HPLC, respectively.

Temperature-dependent UV SQectroscogy The melting studies were performed at a duplex concentration of 1 uM (consisting of the modified antisense strand paired with the complementary unmodified RNA sense strand) in 0.33x PBS (3.3 mM Na/K ate buffer, pH 7.4, with 46 mM NaCl and 0.9 mM KCl) in 1 cm path length quartz cells on a Beckman DU800 spectrophotometer ed with a thermoprogrammer. Each cuvette contained 200 uL of sample solution covered by 125 uL of light mineral oil. Melting curves were monitored at 260 nm with a heating rate of 1 °C/min from 15—90 0C. Melting temperatures (Tm) were calculated from the first tives of the smoothed heating curves and the reported values are the result of at least two independent measurements.

In vitro r assays COS—7 cells were cultured at 37°C, 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS). Cells were co—transfected in 96— well plates (15,000 cells / well) with 10 ng luciferase reporter d and 50 fM to 50 nM siRNA in 10—fold ons using 2 ug/mL ctamine 2000 (Thermo Fisher Scientific) according to manufacturer’s instructions. Cells were harvested at 48 h after transfection for the dual luciferase assay (Promega) according to cturer’s instructions. The on—target reporter plasmid contained a single perfectly—complementary site to the antisense strand in the 3’ untranslated (3’ UTR) of Renilla luciferase. The off—target reporter plasmid contained four tandem omplementary sites separated by 21 —28 tides in the 3’ UTR of Renilla luciferase. Both plasmids co—expressed Fireﬂy rase as a transfection control.

Gene expression analysis Cryopreserved rat and human hepatocytes clamation) were cultured at 37°C, % CO2 in InVitroGRO CP Medium with Torpedo Antibiotic Mix. Cells were transfected in l plates (20,000 cells / well) with 10 nM siRNA using 2 ug/mL Lipofectamine RNAiMAX (Thermo Fisher Scientific) according to manufacturer’s instructions. Cells were harvested at 24 h after transfection for RNA extraction with the miRNeasy Kit (Qiagen) according to manufacturer’s instructions. cDNA libraries were prepared using the TruSeq Stranded Total RNA Library Prep Kit (Illumina) and sequenced on NextSeq 500 (Illumina).

In vivo mouse and rat studies All studies were conducted using protocols consistent with local, state and federal regulations as applicable and approved by the Institutional Animal Care and Use Committees s) at Alnylam Pharmaceuticals.

In mouse pharmacodynamic studies, female C57BL/6 mice (Charles River Laboratories) were administered a single dose of a vehicle control (0.9% sodium chloride, saline) or 0.5 or 1 mg/kg siRNA subcutaneously in the upper back. On Day 8, livers were collected, rinsed in cold saline, immediately snap frozen in liquid nitrogen, and stored at —80C for mRNA and siRNA analysis.

In rat toxicity studies, male Sprague Dawley rats (Charles River Laboratories) were administered three repeat weekly doses (qw x 3) of a vehicle control (0.9% sodium chloride, saline) or 30 mg/kg siRNA subcutaneously in the upper back. On Day 16, serum was collected for clinical pathology evaluation, and livers were collected for histopathology evaluation and for mRNA and siRNA analysis. mRNA and siRNA guantitation RNA was extracted with the miRNeasy Kit (Qiagen) according to manufacturer’s instructions, converted to cDNA with the High—Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) according to manufacturer’s instructions, and mRNA levels were ed by quantitative polymerase chain reaction (qPCR) using pecific Taqman probes (Thermo Fisher Scientific) on Roche Light Cycler 480 11 using ycler 480 Probes Master (Roche).

To quantitate exposure to siRNAs, cell s were resuspended in phosphate—buffer saline (PBS) containing 0.25% Triton X—100, heated at 95°C for 10 min, centrifuged at 14,000 rpm at 4°C for 10 min, and e transcription was performed on the supematants using TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. qPCR was performed on Roche Light Cycler 480 11 using LightCycler 480 Probes Master (Roche) according to the cturer’s instructions.

Results 1. In vitro studies Results of in vitro reporter assay are summarized in Table 1. As the data in Table 1 show, ic nucleic acid (GNA) modification at position 7 of the antisense strand preserves the on—target activity while mitigating the off—target activity in vitro.

Table 1: In vitro reporter assays data for GNA cation at position 7 of anti-sense strands On-target ICso rget ICso (11M) (11M) 0.013 (S)-GNA at AS os. 7 0.013 rase reporter plasmids were co—transfected with siRNAs into COS—7 cells and the luciferase assay was performed at 48 h. 2. Gene expression analysis Results of in vitro gene expression analysis are summarized in Table 2. As seen from Table 2, GNA modification at position 7 of the antisense strand ted off—target activity in vitro.

Table 2. Gene expression analysis Number of gulated genes Number of upregulated genes (p (p< ) —015)0.< I"(S)-GNAatAS pos. 7 Human hepatocytes (AAT) were transfected with siRNAs and RNA llectedat 24 h for RNA sequencing. 3. In vivo mouse studies Results of in vivo studies are summarized in Table 3. As seen, GNA modification at position 7 of the antisense strand preserves potency in viva (Table 3).

Table 3: Mouse pharmacodynamics data (S)-GNA at AS pos. 7 Mice were administered a single dose of siRNAs targeting AAT at 1 mg/kg and liver mRNA own was assessed at Day 8.

Example 2. In Vivo and in Vitro Analysis of dsRNA Agents Targeting Serpinal To further evaluate the in viva effect of incorporating a GNA nucleotide in AD—6l444, AD—6l444 was further modified with a GNA nucleotide at antisense on 6 994) or 7 (AD—75995) (Figure 1A) and mice transgenic for human AAT were subcutaneously stered a singlel mg/kg dose of the agent. Prior to dosing, and at the timepoints indicated in Figure 1B, serum was obtained for quantification of circulating AAT. AAT protein levels were determined by sandwich ELISA, and the data was normalized to the baseline value of AAT protein levels.

As depicted in Figure 1B, incorporation of a GNA nucleotide at either position 6 or 7 of the antisense strand of AD—6l444 resulted in a loss of activity as compared to the parent molecule.

Accordingly, the total numer of 2’—ﬂuoro modified nucleotides in AD—6l444 was reduced resulting in AD—77407, and a GNA nucleotide was incorporated at antisense postion 7 of AD—77407 resulting in AD—77412 (Figure 1C). Mice transgenic for human AAT were subcutaneously administered a single 1 mg/kg dose of the agent. Prior to dosing, and at the timepoints indicated in Figure 1D, serum was obtained for quantification of circulating AAT.

AAT protein levels were determined by ch ELISA, and the data was ized to the baseline value of AAT protein levels.

Figure 1D demonstrates that reducing the 2’ﬂouro content of AD—6l444 (i. 6., AD— 77407) resulted in a marked improvement in activity in the mice. Moreover, incorporation of a GNA nucleotide in this context (AD—77412) ed in a net improvement relative to the parent le, AD—6l444.

To determine the effect of reducing the 2’—ﬂuoro content of AD—6l444 and incorporation of a GNA tide at position 7 of the antisense strand on off—target effects, Hep3b cells were transfected with 10 nM of AD—6l444 or AD—77412 using ctamine RNAiMax. After 16 hours, cells were lysed and prepared for transcriptional profiling. As depicted in Figures 2A and 2B, the resulting data was graphed showing transcripts whose expression was statistically significantly different relative to mock treated cells as black circles and transcripts whose expression was not statistically significantly different relative to mock treated cells as gray circles. The AAT transcript is ted and highlighted with a circle.

The data depicted inFigures 2A and 2B trate that treatment of cells with AD— 61444 resulted in downregulation of fifty—two transcripts, including AAT. By comparison, the GNA—containing duplex, AD—77412, resulted in the gulated transcripts of only three transcripts, including AAT. Thus, incorporation of a GNA nucleotide substantially d the number of ed off—targets downregulated by 44 in vitro.

The effect of AD—77412 was also ted in non—human primates. Cynomolgus monkeys were subcutaeoulsy administered a single 0.3 mg/kg, 1.0 mg/kg, 3 mg/kg, or 10 mg/kg dose of either AD—6l444 or AD—77412. Prior to dosing, and at the timepoints indicated in Figures 3A—3D, serum was obtained for quantification of circulating AAT. AAT protein levels were determined by sandwich ELISA, and the data was normalized to the baseline value of AAT protein levels.

As depicted in Figures 3A—3D, all doses of 44 and AD—77412 effectively silenced AAT expression with similar maximum lavels of ing.

In summary, these assays demonstrate that incorporation of a GNA nucleotide into the antisense seed region of the parent molecule, AD—6l444, does not result in loss of activity as compared to the parent molecule and significantly reduces off—target effects.

We

Claims

claim:

1. A double stranded RNA (dsRNA) agent that inhibits expression of a serine peptidase inhibitor, clade A, member 1 (Serpinal) gene, comprising a sense strand and an antisense strand forming a double ed region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide ce of SEQ ID NO: 1, and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 15, 10 wherein said antisense strand ses at least one thermally destabilizing modification of the double stranded region within the first 9 nucleotide positions of the 5' region or a precursor thereof, wherein said sense strand comprises an ASGPR ligand, and wherein each of the sense strand and the antisense strand are independently 14 to 40 15 nucleotides in length.

2. A double ed RNA (dsRNA) agent that inhibits expression of a serine peptidase inhibitor, clade A, member 1 (Serpinal) gene, comprising a sense strand and an antisense strand forming a double stranded , said antisense strand comprising a region 20 of mentarity to an mRNA encoding Serpinal, wherein the region of complementarity comprises at least 15 contiguous tides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 15 wherein said antisense strand comprises at least one thermally destabilizing modification within the first 9 nucleotide positions of the 5' region or a precursor thereof, 25 wherein said sense strand comprises an ASGPR ligand, wherein each of the sense strand and the antisense strand are independently 14 to 40 nucleotides in length.

3. The dsRNA agent according to claim 1 or 2, wherein the dsRNA agent 30 comprises at least four nucleotides comprising a 2’—ﬂuoro modification.

4. The dsRNA agent ing to claim 1 or 2, haVing the following characteristics: a) the thermally destabilizing modification is located in position 4—8 of the 5' region of the 35 antisense strand; b) each of the sense and antisense strands independently comprise at least two nucleotides comprising a 2’—ﬂuoro modification; and c) an ASGPR ligand ed to either end of the sense strand.

5. The dsRNA agent according to claim 1 or 2, n the antisense strand has at least two of the following characteristics: a) the thermally destabilizing modification is located in position 4 to 8 of the antisense strand; b) at least two tides comprise a 2’—ﬂuoro modification; c) a phosphorothioate internucleotide linkage between nucleotide positions 1 and 2 (counting from the 5’ end); d) a length of 18 to 35 nucleotides. 10

6. The dsRNA agent according to claim 1 or 2, wherein the sense strand has at least one of the following teristics: a) the ASGPR ligand attached to either end of the sense ; b) at least two nucleotides comprise a 2’—ﬂuoro modification; c) the double stranded region spans at least 19 tide positions and wherein the thermally 15 destabilizing modification is d within said double stranded region.

7. The dsRNA agent according to claim 1 or 2, n the thermally destabilizing modification is selected from the group consisting of Sic/NEE:O B £\O/\’; Sic/NJ 0:9 . 9 . 0:: B £0 19’ {5‘5\O/>’g /O * 0?; and 7 W4” 0:: 20 wherein B is nucleobase.

8. The dsRNA agent according to l or 2, wherein the destabilizing modification is located in position 7 of the antisense strand. 25

9. The dsRNA agent acccording to claim 1 or 2, wherein the ASGPR ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

10. The dsRNA agent of claim 9, wherein the ASGPR ligand is: o o o HO&&0 o ACHN WYHN/\/\N H 5

11. The double stranded RNAi agent of claim 10, wherein the RNAi agent is ated to the ligand as shown in the following schematic o=I‘T—xe OH HogAzow/rnvno f wherein X is O or S. 10

12. A double stranded RNA molecule that inhibits expression of a serine peptidase inhibitor, clade A, member 1 (Serpinal) target gene sequence, comprising a sense strand and an antisense strand, wherein the sense strand comprises at least 15 uous nucleotides ing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 1, and the antisense 15 strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO: 15, wherein the nse strand comprises at least one thermally destabilizing modification within the first 9 nucleotide positions of the 5' region, wherein each of the sense strand and the antisense strand are independently 14 to 40 20 nucleotides in length, and n the dsRNA has a melting temperature of from about 40°C to about 80°C.

13. A double stranded RNA molecule that inhibits expression of a serine ase inhibitor, clade A, member 1 (Serpinal) target gene sequence, comprising a sense strand and an nse strand, said antisense strand comprising a region of complementarity to an mRNA encoding Serpinal, wherein the region of complementarity comprises at least 15 contiguous nucleotides ing by no more than 3 nucleotides from the nucleotide sequence of SEQ ID NO:15, n the antisense strand comprises at least one thermally destabilizing modification within the first 9 nucleotide positions of the 5' region, wherein each of the sense strand and the antisense strand are independently 14 to 40 10 nucleotides in length, and wherein the dsRNA has a g temperature of from about 40°C to about 80°C.

14. The dsRNA agent of claim 12 or 13, wherein the dsRNA has a melting temperature of from about 55°C to about 67°C.

15. The dsRNA agent of claim 14, wherein the dsRNA has a melting temperature of from about 60°C to about 67°C.

16. The dsRNA agent of any one of claims 12—14, further comprising an ASGPR 20 ligand.

17. The dsRNA agent of claim 16, n the ASGPR ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker. 25

18. The dsRNA agent of claim 17, wherein the ASGPR ligand is:

19. The double stranded RNAi agent of claim 18, wherein the RNAi agent is conjugated to the ligand as shown in the following schematic HoﬁzoO r ACHN \/\/\lo],HN’V‘N H wherein X is O or S.

20. The dsRNA of any one of claims 1—19, wherein the dsRNA further has at least one of the ing characteristics: (i) the antisense strand comprises 2, 3, 4, 5 or 6 nucleotides comprising a 2’—ﬂuoro modifications; 10 (ii) the nse strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand is conjugated with a ligand; (iv) the sense strand ses 2, 3, 4 or 5 nucleotides comprising a 2’—ﬂuoro modification; (V) the sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (Vi) the dsRNA ses at least four nucleotides sing a 2’—ﬂuoro modification; 15 (Vii) the dsRNA comprises a double stranded region region of 12—40 nucleotide pairs in length; and (Viii) a blunt end at 5’end of the antisense strand.

21. The dsRNA agent of any one of claims 1—4 or 7—20, wherein each strand has 20 15—30 nucleotides.

22. The ddRNA agent of any one of claims 1—4 or 7—20, wherein each strand has 19—30 nucleotides. 25

23. The dsRNA agent of any one of claims 1—20, wherein the sense strand has 21 nucleotides, and the antisense strand has 23 nucleotides.

24. The dsRNA agent of claim 2, wherein the antisense strand comprises a region of complementarity comprising at least 15 contiguous nucleotides differing by no more than 30 3 nucleotides from nucleotides 1440—1480 of SEQ ID NO:1.

25. The dsRNA agent of claim 2, wherein the region of complemntarity ses at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence 5’ — UUUUGUUCAAUCAUUAAGAAGAC — 3’ (SEQ ID NO: 419).

26. The dsRNA agent of claim 1 or 2, wherein the sense strand comprises the nucleotide ce 5’ — CUUCUUAAUGAUUGAACAAAA — 3’ (SEQ ID NO: 417) and the antisense strand comprises the nucleotide ce 5’ — UUUUGUUCAAUCAUUAAGAAGAC — 3’ (SEQ ID NO: 419).

27. The dsRNA agent of claim 1 or 2, wherein the sense strand comprises the nucleotide ce 5’ — uuAfanGfAfuugaacaaaa — 3’ (SEQ ID NO: 33) and the antisense strand comprises the nucleotide sequence 5’ — usUfsuugu(Tgn)caaucanuAfagaagsasc — 3’ (SEQ ID NO: 34) , 15 wherein a, g, c, and u are 2'—O—methyl (2'—OMe) A, G, C, and U, respectively; Af, Gf, Cf and Uf are 2'—ﬂuoro A, G, C and U, respectively; s is a phosphorothioate linkage; and (Tgn) is a thymidine—glycol nucleic acid (GNA) S—Isomer.

28. A double stranded RNA (dsRNA) molecule that inhibits expression of a serine 20 peptidase tor, clade A, member 1 (Serpinal) gene, comprising a sense strand and an antisense strand forming a double stranded region, wherein the sense strand ses the nucleotide sequence 5’ — csusucuuAfanGfAfuugaacaaaaL96 — 3’ (SEQ ID NO: 35) and the antisense strand comprises the nucleotide sequence 5’ — usUfsuugu(Tgn)caaucanuAfagaagsasc — 3’ (SEQ ID NO: 34), 25 wherein a, g, c, and u are 2'—O—methyl (2'—OMe) A, G, C, and U, respectively; Af, Gf, Cf and Uf are 2'—ﬂuoro A, G, C and U, respectively; s is a phosphorothioate linkage; (Tgn) is a thymidine—glycol nucleic acid (GNA) S—Isomer; and L96 is N—[tris(GalNAc—alkyl)— amidodecanoyl)]—4—hydroxyprolinol. 30

29. A vector containing the dsRNA agent of any one of claims 1—28.

30. A cell containing the dsRNA agent of any one of claims 1—28.

31. A pharmaceutical composition comprising the dsRNA agent of any one of 35 claims 1—28.

32. The pharmaceutical composition of claim 31, n RNAi agent is administered in an unbuffered solution.

33. The ceutical ition of claim 32, wherein said unbuffered solution is saline or water.

34. The pharmaceutical composition of claim 3 1, wherein said siRNA is administered with a buffer solution.

35. The pharmaceutical composition of claim 34, wherein said buffer solution comprises acetate, e, prolamine, carbonate, or ate or any combination thereof.

36. The ceutical composition of claim 34, wherein said buffer solution is phosphate buffered saline (PBS).

37. A method of inhibiting Serpinal expression in a cell, the method comprising 15 contacting the cell with the dsRNA agent of any one of claims l—28, the vector of claim 29, or the pharmaceutical composition of any one of claims 3 l—36, thereby inhibiting expression of the Serpinal gene in the cell.

38. The method of claim 37, wherein said cell is within a subject.

39. The method of claim 38, wherein the subject is a human.

40. The method of any one of claims 37—39, wherein the Serpinal expression is inhibited by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, 25 about 90%, about 95%, about 98%, or about 100%.

41. A method of treating a subject having a Serpinal associated disease, comprising administering to the subject a therapeutically effective amount of the dsRNA agent of any one of claims l—28, the vector of claim 29, or the pharmaceutical composition 30 of any one of claims 3 l—36, thereby treating said subject.

42. The method of claim 41, wherein the subject is a human.

43. The method of claim 41, wherein the al associated disease is a liver 35 disorder.

44. The method of claim 43, wherein the liver er is selected from the group consisting of chronic liver disease, liver inﬂammation, cirrhosis, liver fibrosis, and/or hepatocellular carcinoma.

45. The method of claim 41, wherein the double stranded RNAi agent is administered at a dose of about 0.01 mg/kg to about 10 mg/kg or about 0.5 mg/kg to about 50 mg/kg.

46. The method of claim 45, n the double stranded RNAi agent is 10 administered at a dose of about 10 mg/kg to about 30 mg/kg.

47. The method of claim 41, wherein the double stranded RNAi agent is stered subcutaneously. 15

48. The method of claim 41, wherein the double stranded RNAi agent is administered intravenously.

49. The method of claim 41, wherein said RNAi agent is administered in two or more doses.

50. A method of inhibiting development of hepatocellular oma in a subject having a Serpinal deficiency t, comprising administering to the subject a therapeutically effective amount of the dsRNA agent of any one of claims 1—28, the vector of claim 29, or the pharmaceutical composition of any one of claims 3 1—36, thereby inhibiting 25 development of hepatocellular carcinoma in the subject.

51. 5 l. The method of claim 50, wherein the subject is a primate or rodent.

52. The method of claim 50, wherein the subject is a human.

53. The method of claim 50, wherein the double ed RNAi agent is administered at a dose of about 0.01 mg/kg to about 10 mg/kg or about 0.5 mg/kg to about 50 mg/kg. 35

54. The method of claim 53, wherein the double stranded RNAi agent is administered at a dose of about 10 mg/kg to about 30 mg/kg.

55. The method of claim 50, wherein said RNAi agent is administered in two or more doses.

56. The method of claim 50, wherein the double ed RNAi agent is 5 administered subcutaneously.

57. The method of claim 50, wherein the double stranded RNAi agent is administered intravenously. 10

58. A method of reducing the accumulation of misfolded Serpinal in the liver of a subject having a Serpinal deficiency variant, comprising administering to the subject a therapeutically effective amount of the dsRNA agent of any one of claims 1—28, the vector of claim 29, or the ceutical composition of any one of claims 31—36, y reducing the accumulation of misfolded Serpinal in the liver of the subject.

59. The method of claim 58, wherein the subject is a primate or rodent.

60. The method of claim 58, wherein the subject is a human. 20

61. The method of claim 58, wherein the double ed RNAi agent is administered at a dose of about 0.01 mg/kg to about 10 mg/kg or about 0.5 mg/kg to about 50 mg/kg.

62. The method of claim 61, n the double stranded RNAi agent is 25 administered at a dose of about 10 mg/kg to about 30 mg/kg.

63. The method of claim 58, wherein said RNAi agent is administered in two or more doses. 30

64. The method of claim 58, wherein the double stranded RNAi agent is administered subcutaneously.

65. The method of claim 58, wherein the double stranded RNAi agent is administered intravenously. 33m . 1 33w MT. W Fax(3., XE? mmom§®q 0:{ $ng ﬁﬁwmﬁ ﬁx é; é; 1w; 3? 1? ﬁg Ngumcu , m” 3 m; mmﬁﬁ aw DH gwmuv‘q $3 .07. Sammy“ “a?“ am .07. 3&5 mxmwmm $33 a“ m.« .3‘ mm‘ m3 3‘ .w mm use it m a»my w A» 31., a.W w:mm WmMy f: w8Pm{a a1* m m.w {mW $2892 wuzowtzz . sz wuzomtzz gggﬁmmm $5303. 8:622 8:522 EEUOE ‘w_>_-o-.~ ”TN m._>_-O..N gum UH . \\\