NZ791679A - Methods for the detection of genomic copy changes in dna samples - Google Patents

Abstract

The present invention includes compositions and methods useful for the detection of a mutational change, SNP, translocation, inversion, deletion, change in copy number, or other genetic variation within a sample of cellular genomic DNA or cell-free DNA (cfDNA). In some embodiments, the compositions and methods of the present invention provide an extremely high level of resolution that is particularly useful in detecting copy number variations in a small fraction of the total cfDNA from a biological sample (e.g., blood). and methods of the present invention provide an extremely high level of resolution that is particularly useful in detecting copy number variations in a small fraction of the total cfDNA from a biological sample (e.g., blood).

Description

METHODS FOR THE DETECTION OF C COPY CHANGES IN DNA SAMPLES REFERENCE TO D APPLICATIONS This application is a divisional of New Zealand Patent Application No 750902 which claims ty to U.S. Provisional Patent Application No. 62/379,593, filed August 25, 2016, and U.S. Provisional Patent Application No. ,538, filed April 4, 2017, each of which are incorporated herein by reference in their entireties.

ENT REGARDING SEQUENCE LISTING The sequence listing associated with this application is provided in text format and is hereby incorporated by reference into the specification.

TECHNICAL FIELD The invention relates generally to compositions and methods for the quantitative genetic analysis of biological samples, e.g., direct tissue biopsies or peripheral blood. In particular, the present invention relates to methods for detection of target-specific copy number change, as well as genetic characterization and is, of biological samples.

BACKGROUND It is becoming increasing clear that most, if not all, of the most common human cancers are diseases of the human . It is thought that somatic mutations accumulate during an individual’s lifetime, some of which se the ility that the cell in which they are harbored can develop into a tumor. With just the wrong combination of accumulated mutational events, a precancerous growth loses constraints that keep uncontrolled proliferation in check and the resulting cell mass becomes a cancer. The constellations of mutations that are necessary and sufficient to cause cancer are often collectively referred to as “driver mutations.” One of the themes that have emerged from recent and intensive molecular analysis is that cancer, once thought of as a single, tissue-specific e, is in fact a group of related diseases, each with a unique molecular pathology. The human genome project laid the groundwork for genome-wide analysis of cancers.

Changes in gene copy number are a fundamental driver of biological diversity. In the context of evolution, duplication of genes and ence of function is a ecognized driver of species diversity. In the context of human disease, gene loss and gene amplification within somatic cells are hallmarks of diseased tissues such as cancer. Certain therapeutic agents act specifically on cells with these genomic gain and/or loss mutations, however, the identification of these copy number variations is difficult because often such mutations are only present within the DNA of diseased or cancerous cells and are not found in other cells of the body. While the diseased tissue or cells is the major source of the mutated DNA, acquiring DNA through a biopsy is invasive, risky and often not possible. The observation that dying tumor or cancer cells release small pieces of their DNA into the bloodstream, termed cell free DNA or circulating DNA has allowed for the development of genetic tests that can be performed with less invasive techniques, such as a blood sample. However, only small amounts of DNA can be obtained from isolating cell free DNA from a , and only a portion of the total DNA will carry the mutation associated with the disease. For e, in the context of cancer genomics, diagnostically icant tumor mutations are often only found at minor allele frequencies that are icantly less than 50%.

This is in contrast to conventional SNP genotyping where allele frequencies are generally ~100%, 50% or 0%.

Thus there is a need for genomic techniques capable of ing genetic copy number changes in specific target loci.

BRIEF SUMMARY ] In a first aspect, the invention s to a kit comprising a set of adaptors, wherein each adaptor of the set of adaptors comprises a sample tag region selected from a pool of unique sample tag regions, wherein the pool is selected from a plurality of pools, and wherein the selected pool is unique to a test sample; wherein the test sample comprises a plurality of DNA fragments. [0006b] In a second , the invention relates to a DNA y, wherein the DNA library comprises a ity of DNA library fragments, wherein each of the DNA library fragments comprises an adaptor module and a DNA fragment, wherein the adaptor module is a DNA polynucleotide comprising (i) an amplification region, (ii) a sample tag region, and (iii) an anchor ; wherein the amplification region comprises a polynucleotide sequence capable of serving as a primer recognition site for PCR amplification; wherein the sample tag region identifies the test sample; and wherein the anchor region comprises a polynucleotide sequence that is capable of ing to a DNA fragment. [0006c] In a third aspect, the invention s to a set of adaptors, wherein each adaptor of the set of adaptors comprises a sample tag region selected from a pool of unique sample tag s, wherein the pool is selected from a plurality of pools, and n the selected pool is unique to a test sample; wherein each adaptor in said set of adapters is a DNA polynucleotide that comprises: an amplification region, a sample tag region, and an anchor region; wherein the amplification region comprises a cleotide sequence capable of g as a primer recognition site for PCR ication; wherein the sample tag region identifies the test sample; and wherein the anchor region comprises a polynucleotide sequence that is capable of attaching to a DNA fragment.

Methods of detecting rare mutations in cfDNA have been previously described in International PCT Publication No. requisite sensitivity to detect the rarest copy number losses at very minor allele frequencies.

Provided herein are itions and methods for detection of target-specific copy number change that are applicable to several sample types, including direct tissue biopsies, peripheral blood, and in particular cfDNA, The compositions and methods bed herein are sensitive enough to detect changes in copy number that are present only a tiny fraction of the total DNA. 2a followed by page 3 The present invention includes, inter alia, compositions and methods that are useful for the ion of a mutational change, SNP, translocation, inversion, on, change in copy , or other genetic variation within a sample of cellular genomic DNA (e.g,, from a tissue biopsy sample) or chNA (6g, from a blood sample). In particular, the itions and methods of the present invention provide an extremely high level of resolution that is particularly useful in detecting copy number variations in a small fraction of the total chNA from a biological sample (6. g.

Particular embodiments are drawn to a method for performing a genetic analysis on a DNA target region from a test sample comprising: (a) generating a genomic DNA library comprising a plurality of DNA library fragments, wherein each of the DNA library fragments comprises a c DNA fragment from the test sample and an adaptor; (b) contacting the genomic DNA library with a plurality of e probes that specifically bind to a DNA target region, y forming complexes between the capture probes and DNA library nts comprising the DNA target region; and (c) performing a quantitative genetic analysis of the genomic DNA fragments comprising the DNA target region, wherein the adaptor is a DNA polynucleotide that comprises: an amplification , a sample tag region, and an anchor region; wherein the amplification region comprises a polynucleotide sequence capable of serving as a primer ition site for PCR amplification; n the sample tag comprises a polynucleotide sequence that encodes an identity of the unique library DNA fragment and encodes an identity of the test sample; wherein the anchor region comprises a polynucleotide sequence that s the identity of the test sample and wherein the anchor region is capable of attaching to the genomic DNA fragment, and wherein the genetic analysis is performed to detect a genetic change tive of a disease state.

In some embodiments, the genetic change indicative of a disease state is selected from a single nucleotide variant (SNV), an insertion less than 40 nucleotides in length, a deletion of a DNA region less than 40 nucleotides in length, and/or a change in copy number. In particular embodiments, the genetic change indicative of a disease state is a change in copy number. In some ments, the test sample is a tissue biopsy. In various embodiments, the tissue biopsy is taken from a tumor or a tissue suspected of being a tumor.

In certain embodiments, the genomic DNA is cell free DNA (chNA) or cellular DNA. In particular embodiments, the genomic DNA is chNA is isolated from the test sample; and wherein the test sample is a biological sample selected from the group consisting of: amniotic fluid, blood, plasma, serum, semen, lymphatic fluid, cerebral spinal fluid, ocular fluid, urine, saliva, stool, mucous, and sweat.

In certain ments, the genomic DNA fragments are obtained the steps comprising, (i) isolating cellular DNA from the test sample, and (ii) fragmenting the cellular DNA to obtain the genomic DNA fragments. In particular embodiments, step (ii) is performed by contacting the cellular DNA with at least one digestion enzyme. In some embodiments, step (ii) is performed by applying mechanical stress to the cellular DNA. In certain embodiments, the mechanical stress is applied by sonicating the cellular DNA.

In particular embodiments, the sample tag further comprises a unique molecule identifier (UMI) that facilitates the identification of the unique genomic DNA fragment.

In some embodiments, the amplification region is between 10 and 50 tides in length. In particular embodiments, the cation region is between 20 and nucleotides in length. In certain embodiments, the amplification region is 25 nucleotides in length.

In some embodiments, the sample tag is between 5 and 50 nucleotides in length. In particular embodiments, the sample tag is between 5 and 15 nucleotides in length. In certain embodiments, the sample tag is 8 nucleotides in length. In some embodiments, the UMI multiplier is adjacent to or contained within the sample tag .

In n embodiments, the UMI multiplier is between 1 and 5 nucleotides in length. In particular embodiments, the UMI multiplier is 3 nucleotides in length, and comprises one of 64 possible nucleotide sequences.

In some ments, the anchor region is between 1 and 50 nucleotides in length. In particular embodiments, the anchor region is between 5 and 25 nucleotides in length. In certain embodiments, the anchor region is 10 nucleotides in length.

Particular embodiments of the present invention are drawn to s where the step of (a) generating a genomic DNA library comprising a plurality of DNA library fragments, ses attaching the genomic DNA fragments to a plurality of adaptors.

In certain embodiments, the genomic DNA nts are end repaired prior to attaching the genomic DNA fragments with a plurality of adaptors. In particular embodiments, the amplification regions of each adaptor of the plurality of adaptors ses an identical nucleotide sequence.

In certain ments, the sample tag region of each adaptor of the plurality of adaptors comprise one of between 2 and 1,000 nucleotide sequences. In ular embodiments, the sample tag region of each adaptor of the plurality of adaptors comprise one of between 50 and 500 nucleotide sequences. In various embodiments, the sample tag region of each adaptor of the plurality of adaptors comprises one of between 100 and 400 nucleotide sequences. In some embodiments, the sample tag region of each adaptor of the plurality of adaptors comprises one of between 200 and 300 nucleotide sequences. In certain ments, the sample tag region of each adaptor of the plurality of rs is 8 nucleotides in length. In some embodiments, each sequence of the nucleotide sequences are discrete from any other ce of the 240 nucleotide sequences by Hamming distance of at least two.

In particular embodiments, each of the plurality of adaptors ses a UMI multiplier that is adjacent to or contained within the sample tag region. In some embodiments, each of the plurality of adaptors ses a UMI multiplier that is adjacent to the sample tag region. In n embodiments, the UMI multiplier of each adaptor of the plurality of adaptors is between 1 and 5 nucleotides in length. In some embodiments, the UMI multiplier of each adaptor of the plurality of adaptors is three nucleotides in length.

In particular embodiments, the anchor tag region of each r of the plurality of adaptors comprises one of four nucleotide sequences, and each sample region of a given sequence is paired to only one of the four anchor regions of a given sequence.

In some embodiments, the amplification regions of each adaptor of the plurality of adaptors comprises an identical nucleotide sequence; the sample tag region of each r of the plurality of adaptors is 8 nucleotides in length; the nucleotide sequence of each sample tag is te from any other nucleotide sequence of the sample tags of the plurality of adaptors by Hamming distance of at least two, each of the plurality of adaptors comprises a UMI multiplier that is adjacent to or contained within the sample tag region; the UMI multiplier of each adaptor of the ity of adaptors is three nucleotides in length; and the UMI multiplier of each of the possible nucleotide sequences is paired to each sample tag region of the plurality of adaptors, the anchor tag region of each adaptor of the plurality of adaptors comprises one of four nucleotide sequences; and each sample region of a given sequence is paired to only one of the four anchor regions of a given sequence.

Particular ments of the present invention are drawn to a method where the step of ing the genomic DNA fragments with a plurality of adaptors comprises: (i) attaching an oligonucleotide sing least a portion of an anchor region to each genomic DNA fragment, wherein the oligonucleotide comprising least a portion of an anchor region is a DNA duplex comprising a 5’ orylated ment strand duplexed with a partner strand, wherein the partner strand is d from attachment by al ation at its 3’ end, and wherein the attachment strand is attached to the genomic DNA fragment, (ii) contacting the genomic DNA fragments attached to the oligonucleotides sing at least a portion of the anchor region with DNA oligonucleotides encoding full length adaptor sequences for each adaptor nucleotide sequence of the plurality of adaptors, and (iii) contacting the genomic DNA fragments and the DNA oligonucleotides encoding the full length adaptor sequence with T4 polynucleotide kinase, Taq DNA ligase and full-length Bst polymerase under conditions suitable for DNA ligation, y attaching the plurality of adaptors to the genomic DNA fragments. In some embodiments, the genomic DNA fragments are chNA. In certain embodiments, the DNA target region is analyzed for a change in copy number.

In particular embodiments, step (c) ming a quantitative genetic is of the genomic DNA fragments comprising the DNA target region comprises purification of the complexes formed between the capture probes and DNA library fragments comprising the DNA target region. In certain embodiments, step (c) comprises purification of the complexes formed between the capture probes and DNA library fragments comprising the DNA target region, preforming primer extension and/or amplification of the DNA y fragments comprising the region of interest from the genomic DNA library. In some embodiments, step (0) comprises purification of the complexes formed n the capture probes and DNA library fragments comprising the DNA target region, preforming primer extension and amplification of the DNA library fragments comprising the region of interest from the genomic DNA y. In certain embodiments, step (c) comprises DNA sequencing of the DNA library fragments comprising the DNA target region to generate a plurality of sequencing reads.

In some ments, the present invention is drawn to a method wherein the genomic is comprises determining a change of copy number in a DNA region of interest, and wherein step (c), performing a quantitative genetic analysis of the genomic DNA fragments comprising the DNA target region, comprises determining a copy number of the region of interest present in the genomic DNA library derived from the test sample, and comparing it to a copy number of the region of interest present in the genomic DNA library derived from a nce , wherein the reference sample comprises a known copy number of the DNA target region.

In some embodiments, determining the copy number in the region of interest comprises DNA sequencing of the DNA library nts comprising the DNA target region to generate a plurality of sequencing reads, wherein each sequencing read comprises a unique molecular identification element (UMIE). In some embodiments, the UMIE comprises sequencing information from the adaptor and at least a portion of the genomic DNA sequence. In some embodiments, sequencing reads comprising cal UMIEs are identified as a unique genomic sequence (UGS).

In some embodiments, methods of ining the copy number further comprise determining a raw genomic depth (RGD) for each of the e probes contacted with the genomic DNA library. In some embodiments, ining the RGD comprises determining the e number of UGSs associated with each capture probe sequence within a group of sample replicates. In some ments, capture probes associated with a highly variable number of UGSs are identified as noisy probes and are removed from further calculations, In some embodiments, determining the RGD further comprises calculating an RGD for a sample, comprising calculating a numerical average of all RGDs for all capture probes in the sample. In some embodiments, the RGD values for noisy probes are not included in calculating an RGD for a sample.

In some embodiments, the RGDs for the capture probes are ized across all samples in an experimental group by converting the RGD for each capture probe into a probe—specific, normalized read count comprising (i) multiplying each capture probe RGD in a sample by a normalization constant, wherein the normalization constant comprises any real number, and (ii) dividing the product of (i) by the RGD calculated for the corresponding sample; or (iii) dividing the product of (i) by an average RGD calculated from a subset of probes. In some embodiments, the subset of probes is a set of control probes.

In some embodiments, the probe-specific, normalized read counts are converted in to a copy number value comprising (i) lying the probe-specific, normalized read counts of probes directed to autosomal and/or ed regions by 2 in samples derived from females; (ii) multiplying the probe—specific, normalized read counts of probes directed to Y-linked and/or X-linked regions by 1 in samples derived from males, (iii) averaging the products of (i) and/or (ii) across all samples in an experiment; and (iv) dividing the product of (i) and/or (ii) by the average of (iii). In some embodiments, the approximate copy number values for all probes that target a specific gene are averaged.

In some embodiments, the present invention is drawn to a method for highly sensitive detection of copy number gain and copy number loss comprising (i) determining an RGD for a e probe; (ii) normalizing the RGD for the capture probe across all samples in an experimental group by converting the RGD for the capture probe into a probe-specific, normalized read count; (iii) calculating an approximate copy number value for each probe-specific, normalized read count; and (iv) averaging the approximate copy number values for all probes that target a specific gene.

In some embodiments, the present invention is drawn to a method for measuring chromosome stability comprising (i) designing and validating a set of one or more chromosomal stability , wherein the chromosomal stability probes are uniformly distributed across human somes; (ii) performing ed sequencing on patient samples using the one or more chromosomal stability probes; (iii) determining an imate copy number value for each chromosomal probe; (iv) determining a genomic phenotype of a patient sample, wherein fluctuations in the copy number values for one or more chromosomal probes in the patient sample indicate genomic instability.

In some embodiments, the present invention is drawn to a method of treating a cancer in a subject in need thereof, wherein the subject has been identified as having a destabilized genome according to the method claim 62, n the method of treating the cancer comprises administering a pharmaceutically effective amount of a PARP inhibitor.

In some embodiments, the present invention is drawn to a method wherein the genomic analysis comprises determining a change of copy number in a DNA region of interest, and wherein step (c), ming a quantitative genetic analysis of the genomic DNA fragments comprising the DNA target , comprises ining a copy number of the region of interest present in the genomic DNA library derived from the test sample, and comparing it to a copy number of the region of interest present in the genomic DNA library derived from a reference sample, wherein the reference sample comprises a known copy number of the DNA target . In some embodiments, the region of interest is a gene or a portion of the gene. In particular embodiments, the gene is ated with a disease. In certain embodiments, the e is a cancer. In various embodiments, the gene is BRCA2, ATM, BRCAl, BRIPl, CHEK2, FANCA, HDAC2, and/or PALB2.

Particular embodiments are drawn to a genomic DNA library sing a plurality of DNA library fragments, wherein each of the DNA y fragments comprises an adaptor and a genomic DNA fragment; wherein the adaptor is a DNA polynucleotide that comprises: an cation region, a sample tag region, and an anchor region, wherein the amplification region ses a polynucleotide sequence capable of g as a primer recognition site for PCR amplification, wherein the sample tag comprises a polynucleotide ce that encodes an identity of the unique library DNA fragment and encodes an ty of the test sample, and wherein the anchor region comprises a polynucleotide sequence that encodes the identity of the test sample, and wherein the anchor region is capable of attaching to the genomic DNA fragment. In some embodiments, the sample tag further comprises a unique molecule identifier (UMI), wherein the UMI facilitates the identification of the unique genomic DNA fragment. In particular embodiments, the amplification region is between 10 and 50 nucleotides in length. In particular embodiments, the amplification region is 25 nucleotides in length. In particular embodiments, the sample tag is n 5 and 50 nucleotides in length. In certain embodiments, the sample tag is 8 nucleotides in length. In some embodiments, the UMI multiplier is adjacent to or contained within the sample tag region. In particular ments, the UMI multiplier is between I and tides in length. In n embodiments, the anchor region is between 1 and 50 nucleotides in length. In some embodiments, the anchor region is 10 tides in length. In particular embodiments, the amplification regions of each adaptor of the plurality of adaptors comprises an identical nucleotide sequence. In some embodiments, each nucleotide sequence of the sample tags are discrete from any other sequence of the nucleotide sequences of the sample by g distance of at least two. In certain embodiments, each of the plurality of adaptors comprises a UMI multiplier that is adjacent to or contained within the sample tag region. In particular embodiments, each of the plurality of adaptors comprises a UMI multiplier that is nt to the sample tag region. In some embodiments, the anchor tag region of each adaptor of the plurality of rs comprises one of four nucleotide sequences, and wherein each sample region of a given sequence is paired to only one of the four anchor regions of a given sequence. In some embodiments, the genomic DNA nt is chNA.

In certain embodiments, the amplification regions of each adaptor of the plurality of rs comprises an identical nucleotide sequence; the sample tag region of each adaptor of the plurality of adaptors is 8 nucleotides in length, the sample tag region of each r of the plurality of rs comprises a nucleotide sequence that is te from any other nucleotide sequence of the sample tags of the plurality of adaptors by Hamming distance of at least two, the each of the plurality of adaptors comprises a UMI multiplier that is adjacent to or contained within the sample tag region, the UMI multiplier of each adaptor of the plurality of adaptors is three nucleotides in length, and the UMI multiplier of each of the possible nucleotide sequences is paired to each of the sample tag regions of the plurality of adaptors, the anchor tag region of each adaptor of the plurality of adaptors comprises one of four nucleotide sequences, and each sample region of a given sequence is paired to only one of the four anchor regions of a given sequence. In some embodiments, the genomic DNA nt is chNA.

Certain embodiments are drawn to a plurality of genomic DNA libraries, comprising more than one genomic library described herein. In some embodiments, the nucleic acid sequences of the sample tag regions of a c DNA library belonging to the plurality of genomic DNA libraries are different from the nucleic acid sequences of the sample tag regions of other genomic DNA libraries belonging to the ity of genomic DNA libraries. In ular ments, the nucleic acid ces of the amplification regions of a genomic DNA y belonging to the ity of genomic DNA ies are identical to the nucleic acid sequences of the amplification regions of other genomic DNA libraries belonging to the plurality of genomic DNA libraries.

Certain embodiments are drawn to a method for genetic analysis of a DNA target region of cell free DNA (chNA) comprising: (a) generating a DNA library as described herein, (b) contacting the chNA y with a plurality of capture probes that specifically bind to a DNA target region, thereby forming complexes between the capture probes and DNA library fragments sing the DNA target region; and (c) performing a quantitative genetic is of the chNA fragments comprising the DNA target region, thereby performing genetic analysis of the DNA target region.

Certain embodiments are directed to a method of predicting, diagnosing, or ring a genetic disease in a subject comprising: (a) obtaining a test sample from the subject, (b) isolating genomic DNA from the test sample, (c) generating a DNA library comprising a plurality of DNA library fragments, wherein each of the DNA library nts comprises a genomic DNA fragment from the test sample and an adaptor, (d) contacting the chNA library with a plurality of capture probes that specifically bind to a DNA target region, thereby forming complexes between the capture probes and DNA library fragments comprising the DNA target region; and (e) performing a quantitative genetic analysis of one or more target genetic loci associated with the genetic disease in the chNA clone library, n the fication or detection of one or more genetic lesions in the one or more target genetic loci is prognostic for, stic of, or rs the progression of the genetic disease. In particular embodiments, the tative genetic is comprises DNA sequencing to generate a plurality of sequencing reads.

Particular embodiments are drawn to a set of adaptors that encode an identify of a unique genomic DNA fragment and an ty of a test sample, for use in generating a genomic DNA library, wherein each adaptor in said set of adapters is a DNA polynucleotide that comprises: an amplification region, a sample tag region, and an anchor region, n the amplification region comprises a polynucleotide sequence capable of serving as a primer recognition site for PCR cation, n the sample tag comprises a polynucleotide sequence that encodes the identity of the unique library DNA fragment and encodes the identity of the test sample; and n the anchor region comprises a polynucleotide sequence that encodes the identity of the test , and wherein the anchor region is capable of attaching to the genomic DNA fragment. In some embodiments, the sample tag further comprises a unique molecule identifier (UMI), wherein the UMI facilitates the identification of the unique c DNA fragment. In various embodiments, the amplification region is between 10 and 50 nucleotides in length. In certain embodiments, the amplification region is 25 nucleotides in length. In particular embodiments, the sample tag is between 5 and 50 nucleotides in length. In some embodiments, the sample tag is 8 nucleotides in . In particular embodiments, the UMI multiplier is adjacent to or contained within the sample tag region. In some embodiments, the UMI multiplier is n 1 and 5 nucleotides in length. In particular embodiments, the anchor region is between 1 and 50 nucleotides in length. In some embodiments, the anchor region is 10 nucleotides in length.

In certain embodiments, the amplification regions of each adaptor of the plurality of adaptors comprises an identical nucleotide sequence.

In some embodiments, each nucleotide sequence of the sample tags is discrete from any other nucleotide sequence of the sample tags of the set of rs by Hamming ce of at least two. In various embodiments, each of the plurality of adaptors comprises a UMI multiplier that is adjacent to or contained within the sample tag region. In particular embodiments, each of the plurality of adaptors comprises a UMI multiplier that is adjacent to the sample tag region.

In some embodiments, the anchor tag region of each adaptor of the plurality of adaptors comprises one of four nucleotide sequences, and wherein each sample region of a given sequence is paired to only one of the four anchor regions of a given sequence. The set of adaptors claim 75, wherein the amplification regions of each adaptor of the plurality of adaptors comprises an identical nucleotide sequence; wherein the sample tag region of each adaptor is 8 tides in length, wherein each tide sequence of the sample tags is discrete from any other nucleotide sequence of the sample tags of the set of adaptors by Hamming ce of at least two, wherein each of the plurality of adaptors comprises a UMI lier that is nt to or contained within the sample tag region, wherein the UMI multiplier of each adaptor of the plurality of adaptors is three nucleotides in length, wherein the UMI multiplier comprises one of 64 possible nucleotide sequences, and wherein the UMI multiplier of each of the 64 possible nucleotide sequences is paired to each of the sample tag region of the plurality of adaptors, wherein the anchor tag region of each adaptor of the plurality of adaptors comprises one of four nucleotide sequences, and wherein each sample region of a given sequence is paired to only one of the four anchor regions of a given sequence.

BRIEF PTION OF THE SEVERAL VIEWS OF THE DRAWINGS shows the framework of the copy number loss (CNL) assay.

Each gene (rows) exhibits a characteristic unique read value that is represented here by a shade. Each sample (columns) is interrogated across the same panel of genes. shows a diagram illustrating the drivers of the CNL assay signal.

FIG, 3 shows a m illustrating steps of an illustrative CNL assay performed on cell free DNA (chNA). — 4B shows diagrams of an illustrative first generation r ( and 4B) and an adaptor of the present invention (FIGs. 4C-4E). shows the first generation adaptor . shows that in the first generation adaptors, there were a collection of 249 possible sequence tags, each 5 nucleotides (nt) in length that attached to a single anchor sequence. shows a diagram of a second generation adaptor. shows an illustrative set of adaptors that are d to a single sample that consists of four sets of 8mer tag sequences with each set having 60 members, Each set of 60 tags is specific to one of four anchor sequences. shows an illustrative DNA sequence of a 47 nt adaptor. — shows a m illustrating that ng the position of the UMI multiplier within the sample tag can increase the number of unique sample tags. and B shows a diagram illustrating the process of constructing c libraries for a CNL assay. shows the step where the 10 nt anchor ce is attached to the 3’ ends of genomic fragments. shows the step where the full length genomic adaptors are annealed to the initial anchor sequence. shows DNA inputs into CNL libraries. Agarose gel images are shown with the sizes of markers (bp) indicated at left. — shows conventional box-and-whiskers plots of measured gene copies across eight samples as determined by CNL analysis. — shows Logio P-value plots that quantify significant deviation-from—normal in CNL measurements for fragmented genomic samples. The SNP percentages at the top show the minor allele frequencies of rare, heterozygous SNPs that are present in the AATM and ABRCA2 samples.

A — B shows Logio P—value plots that quantify significant deviation-from—normal in CNL measurements for chNA samples spiked with fragmented genomic DNA. The SNP percentages at the top show the minor allele frequencies of rare, heterozygous SNPs that are t in the AATM and ABRCA2 samples.

A — 11D illustrate the targeted hybrid capture rm. A shows conversion of chNA to a genomic library by the addition of adaptor sequences that provide sal, single-primer PCR amplification sequences, sample multiplexing tags, and unique molecular identifiers to every genomic clone. B shows denatured amplified c hybridized with target specific capture probes and primer extension. C shows a schematic of asymmetric paired-end cing. D shows mapping statistics for 377,711,020 Illumina NextSeq reads from a typical targeted capture sequence run. 98.5% of reads map to their intended targets. ing de—duplication, 20.40% of reads (77,053,048) are d from unique genomic clones.

A — H shows sequences of adaptor oligonucleotides from Pools 1 — 3.

A — H shows sequences of adaptor oligonucleotides from Pools 4 — 6.

A — 1 shows sequences of adaptor ucleotides from Pools 7 — 9.

A — H shows sequences of adaptor oligonucleotides from Pools 10 — 12.

A — H shows sequences of adaptor oligonucleotides from Pools l3 — 15.

A — H shows sequences of adaptor oligonucleotides from Pools l6 — 18.

A — H shows sequences of adaptor oligonucleotides from Pools l9 — 21.

A — H shows sequences of adaptor oligonucleotides from Pools 22 — 24.

A — H shows sequences of adaptor oligonucleotides from Pools 25 — 27.

A — H shows sequences of r oligonucleotides from Pools 28 — 30.

A — H shows sequences of adaptor oligonucleotides from Pools 31 — 32.

A — 23C shows targeted sequencing of the TP53 gene. A illustrates BedFile y of capture probes. B illustrates coverage depth at each base on on a scale of 0 to 8000 unique reads. C illustrates a UCSC gene model display of known TP53 splice variants. The r rectangular regions represent the amino acid coding s for the TP53-encoded protein.

A — 24C illustrate raw and normalized unique read density for a single probe, TP53r10_1, across 16 samples. A illustrates the number of raw unique reads capture by probe TP53r10_1 for 16 ndent sample after removal of redundant reads by “de—duplication.” B shows global average of unique reads across 2596 capture probes for all 16 samples. C shows normalized unique read depth across 16 samples (Calculated as: [sample n unique reads from probe TP53r10_1 X constant + global average unique reads/probe from sample n]). shows general consistency of the normalized unique read counts for all 16 samples within any given TP53 probe despite significant average depth variation between probes. The normalized unique read counts for all 16 samples are shown as “pillars” of tightly spaced bar graphs; the results for all 45 probes that target TP53 are shown.

Two probes that exhibit “noisy” counting behavior are highlighted with . Counts from such probes often appear as outliers in subsequent copy number analysis. rates sample-to-sample consistency of normalized probe- by-probe unique read counts across a broad panel of 2596 probes. The scatter plots from three representative samples are shown. Each dot represents a ent probe. The x-axis is the normalized average unique read depth per probe across 16 s. The y-axis is the ized unique read depth per probe for three different individual samples. The consistent probe-by-probe unique read counts support quantitative analysis of chromosomal copy variation.

A — 27C illustrate copy number analysis of chNA from a healthy female and male donor and from an advanced stage prostate cancer patient. A shows analysis of a chNA from a healthy female donor. The x-axis is a series of control probes that target regions from all 22 autosomal chromosomes, a series of probes that target the X-linked AR gene, and a series of probes that target the coding regions of the TP53 gene.

The Y-axis shows the calculated ploidy for each probe. This approximation is calculated for each probe by normalizing the observed unique read counts to a series of control samples whose ploidy is known ([unique read count for Y of sample _Z] x 2 + [average unique read count for Y for multiple control samples]). B illustrates that the X-linked AR gene exhibits a haploid copy number in healthy males. C illustrates copy number analysis of chNA from an advanced prostate cancer patient and shows ce of very significant oidy across the control probes, amplification of the AR gene, and loss of the TP53 gene. shows whole genome aneuploidy analysis of a te patient chNA library relative to a control sample. The imate ploidy for each of 239 control probes is shown sorted by chromosome. Patient chromosome 2 probes show consistent copy loss and the majority of chromosome 5 probes show copy gain. Significant deviation of approximate ploidy are seen for many, but not all, of the t control probes. shows analytical validation of copy number loss detection.

Genomic DNA from immortalized line NA02718 (monoallelic AATM) and from NA09596 (monoallelic ) were spiked into the “gold standard” c DNA from NA1287 8 at 16%, ing in the equivalent of an 8% biallelic deletion minor allele frequency.

Following targeted sequencing and CNV analysis, the probe-by-probe es were averaged for the two target genes. Two unperturbed control genes, BRIPl and HDAC2, are shown for comparison.

DETAILED DESCRIPTION A. OVERVIEW The present invention includes, inter alia, compositions and methods that are useful for the detection of a mutational change, SNP, translocation, inversion, deletion, change in copy number or other genetic variation within a sample of cellular genomic DNA (e.g. from a tissue biopsy sample) or chNA (e.g. from a blood ), The compositions and methods of the current invention are particularly useful in detecting incredibly hard to detect copy number variations in chNA from a biological sample (6. g. blood) with ite resolution. In particular, some embodiments of the present invention are drawn to a method for the detecting copy number of a DNA target region from a test sample by generating a genomic DNA y made up of genomic DNA fragments attached to an adaptor, capturing DNA target regions with a plurality of capture probes, isolating the DNA library fragments comprising the DNA target region, and performing a quantitative genetic analysis of the DNA target region to thereby determining the copy number of the DNA target . The adaptors described herein allow for the identification of the individual DNA fragment that is being sequenced, as well as the identity of the sample or source of the genomic DNA.

The present invention contemplates, in part, compositions and methods for ion of target-specific copy number changes that are able to several sample types, including but not limited to direct tissue biopsies and peripheral blood. In the context of cancer genomics, and in particular cell free DNA (chNA) assays for the analysis of solid tumors, the amount of tumor DNA is often a very small fraction of the overall DNA. Further, copy number loss is ult to detect in genomic DNA assays, and in particular, genomic DNA assays where copy number change may only be present in a n of the total genomic DNA from a sample, e.g., chNA . For example, most of the cell-free DNA extracted from a cancer patient will be derived from normal sources and have a diploid copy number (except for X-linked genes in male subjects). In a cancer patient, the fraction of DNA derived from tumors often has a low minor allele frequency, such as for example, a patient in which 2% of the circulating DNA extracted from plasma is derived from the tumor. The loss of one copy of a tumor suppressor gene (for example, BRCAI in breast cancer) means that the minor allele ncy for the absence of able genomic fragments is 1%. In this io, a copy number loss assay engineered must be able to discriminate between 100 copies (normal) and 99 copies (heterozygous gene loss). Thus, particular embodiments contemplate that the methods and compositions of the present invention allow for the detection of copy number change with sufficient tion to detect changes in copy number at minor allele frequencies even in the context of cfl)NA.

To e this level of discrimination, the present invention provides novel sample r designs The rs of the present invention are designed to include features that are critical for successful copy number loss assay mance including (i) even performance across adaptors; (ii) a high number of unique molecule identifiers (UMIs); (iii) high efficiency attachment; and (iv) accommodation of sample multiplexing. For example, the adaptors of the present invention provide the following: Even performance across adaptors: Bioinformatics analysis often looks at intra—sample probe performance and inter-sample probe performance. Thus, it is contemplated that any performance fluctuation between adaptor pools across samples will negatively impact the y to detect the subtle variations ed by CNL analysis. In the present invention, this evenness of performance is achieved by having multiple anchor tags that are all represented in each sample tag pool, with the fixed sample tag s (which serve to identify both the sample and the genomic fragments) being randomly selected for each pool, and a UMI multiplier that increases the unique sample tag sequences for identifying the genomic fragments.

High number of Unique Molecule Identifiers 1UMIs]: While adaptors must be functionally equivalent from a molecular biology perspective, they must possess a very large number of unique sequence tags (2 10,000) that t the identification of unique genomic fragments. In this context, by “augment,” it is meant that each genomic clone fragment has a particular pair of ntation sites corresponding to the position in the genomic sequence where the double-strand DNA was cleaved. This cleavage site is used to differentiate unique genomic clones since each clone is likely to possess a different ge site. However, in libraries that possess thousands of independent clones, uniquely derived nts will often possess the exact same cleavage sites. Genomic clones (i.e. fragments) sharing the same cleavage site can be classified as either unique or as redundant with respect to other clone sequences derived from the same sample. By attaching adaptors that introduce a high diversity of sequence tags, different genomic clones sharing the same cleavage site are more likely to be identified as unique. In this system, the UMI is created by a combination of the sample tag region with the UMI multiplier. The combination of the UMI and the cleavage site create a unique molecular identifier t , which facilitates the classification of sequence reads as ant reads or unique reads. Particular embodiments contemplate that the UMI multiplier could comprise longer or shorter sequences to increase or lower the overall UMI xity.

High efficiency attachment: Adaptors must attach to genomic fragments with high efficiency. In most oncology applications, the quantities of ble cellular DNA or chNA are limited and therefore conversion of these genomic fragments to genomic library clones must be highly efficient. In order to achieve this, in some aspects of the present invention, the adaptor systems described herein convert about 25% to about 50% or greater of the genomic input fragments are converted into genomic library .

Accommodation of sample multiplexing: In general, there must be pools of different sets of adaptors where each unique adaptor of the set is ed to a different sample. At the same time, each member of the set of adaptors must s essentially identical behavior (from a sequence counting perspective) to all other members in a set. In order to achieve this, in some embodiments, the sample tag regions have a Hamming distance of 2 between any other possible sample tag combinations reducing the chance for a read to be spuriously ed to the wrong sample. In some embodiments, each set of adaptors is split into pools that are paired with specific anchor s, allowing for further reduction in the possibility of an error in sample de-multiplexing. For example, in an 8mer tag with Hamming distance of 2, the total number of possible sequences is .

In a particular embodiment, pre-specified pools of adaptor oligonucleotides are ed. Such pre-specified pools are used to represent a single sample.

That is, each r sequence in each pool of X adapter oligonucleotides (16,384 in the example given above) is distinct from each adapter sequence in every other pool used to identify other samples. One of skill in the art will recognize the number of ct pre- specified pools that are possible for the adapter oligonucleotides will depend on the length of the sample tag and/or the UMI multiplier.

Thus, in certain embodiments the adaptors comprise a sequence, i.e., the sample tag and adjacent and/or encompassed UMI lier that represents or identifies both the sample and uniquely identifies the genetic fragment. This is in stark contrast to the current systems that are used in the art that use a randomly generated tag to identify the sequence and a separate barcode or sequencer indexing to allow for multiplexing.

An illustrative embodiment for detecting -specific copy number changes within DNA obtained from a sample is shown in While generates a DNA library from chNA, this illustrative procedure could be used with DNA from other s, e.g, fragmented cellular DNA. As shown in chNA is collected (top panel).

Next, a genomic library is generated from chNA by ating genomic library rs (gray circles) of the present invention to the genomic DNA. Genomic DNA fragments are ed with capture probes (black circles) that recognize the genomic region of interested.

The c DNA of st is ced, and data analysis is performed for copy loss analysis and/or characterization of the genomic DNA of interest.

The practice of particular embodiments of the invention will employ, unless indicated specifically to the contrary, conventional methods of chemistry, biochemistry, organic chemistry, molecular biology, microbiology, recombinant DNA techniques, genetics, immunology, and cell biology that are within the skill of the art, many of which are described below for the purpose of illustration. Such techniques are explained fully in the ture. See, e.g., Sambrook, et al., Molecular Cloning: A Laboratory Manual (3rd Edition, 2001); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989), Maniatis et al., Molecular Cloning: A Laboratory Manual (1982); Ausubel et al., Current Protocols in Molecular Biology (John Wiley and Sons, updated July 2008), Short ols in Molecular Biology: A Compendium of Methods fiom Current Protocols in Molecular Biology, Greene Pub. Associates and Interscience, Glover, DNA Cloning: A Practical Approach, vol. I & II (IRL Press, Oxford, 1985); Anand, Techniques for the Analysis of Complex s, (Academic Press, New York, 1992); Transcription and Translation (B. Hames & S. Higgins, Eds, 1984), Perbal, A Practical Guide to Molecular Cloning (1984), and Harlow and Lane, Antibodies, (Cold Spring Harbor tory Press, Cold Spring Harbor, NY, 1998).

B. DEFINITIONS Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or g of the present invention, preferred embodiments of compositions, methods and materials are described herein. For the purposes of the present invention, the following terms are defined below.

The articles “a ” “an, ” and “the” are used herein to refer to one or to more than one (Le. to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

The use of the alternative (eg, “or”) should be understood to mean either one, both, or any combination f of the atives.

The term “and/or” should be understood to mean either one, or both of the alternatives.

As used herein, the term “about” or “approximately” refers to a quantity, level, value, number, ncy, percentage, dimension, size, amount, weight or length that varies by as much as 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length. In one embodiment, the term ” or “approximately” refers a range of ty, level, value, number, frequency, percentage, dimension, size, amount, weight or length 15%, 10%, 9%, + 8%, + 7%, 6%, 5%, 4%, i 3%, :: 2%, or i 1% about a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length.

Throughout this specification, unless the context requires otherwise, the words “comprise”, “comprises,” and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. In particular embodiments, the terms de,” “has, 7: ains,” and “comprise” are used synonymously.

By “consisting of” is meant ing, and limited to, whatever s the phrase “consisting of.” Thus, the phrase “consisting of” indicates that the listed elements are required or mandatory, and that no other elements may be present.

By sting essentially of” is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed ts. Thus, the phrase “consisting essentially of” indicates that the listed elements are required or ory, but that no other elements are optional and may or may not be present depending upon whether or not they affect the activity or action of the listed elements. nce throughout this specification to “one ment,” “an embodiment,77 cc 7) cc 7) cc a particular embodiment, a related embodiment, a certain embodiment,” “an additional ment,” or “a further embodiment” or combinations thereof means that a particular feature, structure or characteristic described in tion with the ment is included in at least one embodiment of the present invention. Thus, the appearances of the foregoing phrases in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular es, structures, or characteristics may be ed in any suitable manner in one or more embodiments.

As used herein, the term “isolated” means material that is substantially or essentially free from components that normally accompany it in its native state. In particular embodiments, the term “obtained” or “derived” is used synonymously with isolated.

As used herein, the term “DNA” refers to deoxyribonucleic acid. In various embodiments, the term DNA refers to genomic DNA, recombinant DNA, synthetic DNA, or cDNA. In one embodiment, DNA refers to genomic DNA or cDNA. In particular embodiments, the DNA comprises a “target region.” DNA libraries contemplated herein include c DNA libraries and cDNA libraries constructed from RNA, e.g., an RNA expression library. In various ments, the DNA libraries comprise one or more additional DNA ces and/or tags.

The terms t genetic locus” and “DNA target region” are used interchangeably herein and refer to a region of interest within a DNA sequence. In various embodiments, targeted genetic analyses are performed on the target genetic locus. In particular embodiments, the DNA target region is a region of a gene that is associated with a particular genetic state, genetic condition, genetic diseases, fetal testing; genetic mosaicism, paternity testing; predicting response to drug treatment; sing or monitoring a medical condition; microbiome profiling, pathogen screening; or organ transplant monitoring. In further embodiments, the DNA target region is a DNA sequence that is associated with a particular human chromosome, such as a particular autosomal or ed chromosome, or region thereof (6. g. , a unique chromosome region).

As used herein, the terms “circulating DNA,” “circulating cell-free DNA,” and “cell-free DNA” are often used interchangeably and refer to DNA that is extracellular DNA, DNA that has been extruded from cells, or DNA that has been released from necrotic or apoptotic cells. This term is often used in contrast to “cellular genomic DNA” or “cellular DNA,” which are used interchangeably herein and refer to genomic DNA that is contained within the cell (ie. the nuclease) and is only accessible to molecular biological techniques such as those described herein, by lysing or otherwise disrupting the integrity of the cell, A “subject,” “individual,” or “patient” as used herein, includes any animal that exhibits a symptom of a ion that can be ed or identified with compositions contemplated herein. Suitable subjects include laboratory animals (such as mouse, rat, , or guinea pig), farm animals (such as horses, cows, sheep, pigs), and domestic animals or pets (such as a cat or dog). In particular embodiments, the subject is a mammal. In certain embodiments, the subject is a non-human primate and, in preferred embodiments, the subject is a human.

As used herein, the term “paired” when used with respect to two different polynucleotide sequences or s of DNA comprising different polynucleotide sequences, means that the two different polynucleotide sequences or s of DNA comprising different polynucleotide sequences are present on the same polynucleotide. For example, if a particular sample tag region of DNA is said to be paired to particular amplification region of DNA, it is meant that the sample tag region and the amplification tag are present on the same DNA cleotide molecule.

C. S OF COPY NUMBER IS In various embodiments, a method for copy number analysis of a DNA target region DNA is provided. In n embodiments, copy number analysis is performed by generating a genomic DNA library of DNA library fragments that each contain genomic DNA fragment and an adaptor, isolating the DNA library fragments containing the DNA target regions, and performing a quantitative genetic analysis of the DNA target region. By “quantitative genetic analysis” it is meant an analysis med by any molecular biological technique that is able to fy s in a DNA (e.g., a gene, genetic locus, target region of st, etc.) including but not limited to DNA mutations, SNPs, translocations, deletions, and copy number variations (CNVs). In certain embodiments, the quantitative genetic analysis is med by sequencing, for example, next generation sequencing.

Next-generation DNA cing (NGS) is ideally suited for two diagnostic applications. The first is the determination of DNA sequence on a vast scale. In the present context, this capability enables the search for rare, actionable variants that guide effective treatment decisions. The second is counting gene copy number. The output of millions of independent sequences can enable precise measurement of gene copy number on a genome-wide scale. The emergence of non-invasive prenatal testing for fetal trisomy from maternal blood samples is a ent to this capability. RNAseq, that is, the technology of gene expression profiling using NGS is another example, albeit the input is RNA (cDNA) rather than genomic DNA. Comparisons of t capture methods are described Samorodnitsky et a]. J Mol Diagn. 2015 Jan;17(1):64-75.

The present invention extends NGS counting capability into the realm of ed hybrid capture methods. The s described here are ive for the detection of copy number variation at least in part because they possess the following four qualities: (a) The present methods differentiate between unigue clones and redundant mNGS sequencing of amplified genomic DNA library fragments results in a plurality of dual NGS reads, each comprising adaptor-encoded sequence information linked to a specific human genomic sequence. These elements define the identity of every clone.

Because captured genomic regions are amplified by PCR, it is not uncommon for the same clone to be encountered several times in a subsequent NGS analysis. Groups of reads that are derived from a single cloning and capture process are termed “redundant ” Two or more redundant reads are identified as redundant reads based on the sequencing ation provided by the unique molecular identification elements (UMIE). The UMIE refers to the combination of the sequence information from the adaptor tags and the start of the genomic DNA sequence. Two or more reads comprising identical UMIEs are fied as redundant reads. Redundant reads are grouped together and a single, entative consensus sequence is assembled from families of redundant reads. This consensus sequence is ated as a “unique 77 rea or a e genomic ce” (UGS). Each unique read represents a separate clone from the original DNA specimen. The process of identifying and grouping redundant clone families and of generating a single unique read entative of this family is defined as “deduplication.” The adaptors used to create genomic libraries possess a very deep repertoire of unique sample tag information (15,360 codes per adaptor). When applied in conjunction with the exact mapping nates of each captured genomic clone (which can span >100 different positions relative to a capture probe), each unique clone that is ted in a genomic library and subsequently retrieved by a target-specific capture probe has an extremely high likelihood of being entiable from all other unique clones that encompass the same capture nment. The ability to differentiate between unique clones and redundant clones is central to the methods described herein. (b) The adaptors used to create c libraries permit sample multiplexing without creating adaptor-to—adaptor variabili‘py in copy number counts. A central foundation of copy number determination is the simultaneous analysis of a set of samples that have all been processed within a single sequencing run. This allows positive and negative controls to be included along with al samples. A major issue with previous adaptor design ions induced subtle shifts in gene copy counts among identical control samples, in effect setting a -to-noise uncertainty threshold that was too high to be clinically useful in blood-based, solid tumor genotyping assays. The present invention overcomes this issue and substantially lowers the signal—to-noise threshold such that single copy gene loss is detectable at S 2% minor allele frequency. This improved signal recognition s the s of the present invention to have significant clinical y in circulating tumor DNA assays. (c) The proprietafl targeted hybrid capture method used herein must produce h'ghly m “on-target” read coverage across all targets. Methods that rely on counting of unique genomic fragments to estimate copy number, such as the ones described herein, must achieve near-saturation in terms of encountering all possible unique nts. Near- saturation is only achieved by oversampling, that is to say, gathering more sequencing reads than the number of unique reads that will ultimately be encountered. To be practical, scalable, and economical, the unique reads in a targeted hybrid capture y must exhibit sufficient uniformity such that < 10-fold oversampling of on-target reads, and preferably < 4-fold oversampling of on-target reads will capture > 90% of unique on-target reads at all target loci. (d) The targeted hybrid capture method {See US. Patent Publication No. 2014- 02747312 must have high on-target capture rates. To be practical, scalable and economical, in other words to be a distinguishing feature of the present disclosure relative to other art in the field, the method must achieve >90%, preferably >95% on-target reads. With on-target mapping rates exceeding 95%, the requirement for 4 to 10-fold oversampling of on-target reads and the requirement for overall oversampling are one in the same.

In some embodiments, the number of copies of the DNA target region t in the sample is determined by the quantitative genetic analysis. In some embodiments, the copy number of the DNA target region is determined by comparing the amount of copies of DNA target regions present in the sample and comparing it to amounts of DNA target regions present in one or more samples with known copy number.

Particular embodiments contemplate that the compositions and s described herein are particularly useful for ing changes in copy number in a sample of genomic DNA, where only a portion of the total genomic DNA in the sample has a change in copy number. For example, a significant tumor mutation may be t in a sample, e.g. a sample of cell free DNA, that is present in a minor allele ncy that is significantly less than 50% ( e.g., in the range of 0.1% to >20%), in contrast to conventional SNP genotyping where allele frequencies are generally ~100%, 50% or 0%. One of skill of the art will recognize that the compositions and methods of the current invention are also useful in detecting other types of mutation including single nucleotide variants (SNVs), short (e.g., less than 40 base pairs (bp)) ions, and deletions (indels), and genomic rearrangements including oncogenic gene fusions.

In n ments, the compositions and/or methods of the present invention described herein are useful for, capable of, suited for, and/or able to detect, identify, observe, and/or reveal a change in copy number of one or more DNA target regions present in less than about 20%, less than about 19%, less than about 18%, less than about 17%, less than about 16%, less than about 15%, less than about 14%, less than about 13%, less than about 12%, less than about 11%, less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, less than about 1%, less than about 0.5%, less than about 0.2%, or less than about 0.1% of the total genomic DNA from the sample. In some embodiments, the methods of the t invention are useful for, capable of, suited for, and/or able to detect, identify, observe, and/or reveal a change in copy number of one or more DNA target regions present in between about 0.01% to about 100%, about 0.01% to about 50%, and or about 0.1% to about 20% of the total genomic DNA from the sample.

Particular ments are represented by the conceptual framework that is illustrated in In each gene is represented by a row and each patient sample is represented as a column. Within any given genomic DNA sample, the number of fragments counted for each individual gene will have some variability, and that for any given DNA region of interest, 6. g. a gene, perturbations in copy number are ed as significant fragment count deviations relative to the normalized counts to the DNA target region in other samples. Such an assay requires the gene-by-gene fragment ng profile within a sample to be reproducible, and also requires the sample-by-sample counting profiles to be highly comparable. Both assay requirements demand excellent signal-to-noise counting discrimination.

Some embodiments contemplate that the assay elements that contribute to increasing the signal to noise ratio are the genomic input, the number of probes, and the sequencing depth, as rated in In particular embodiments, a method for c analysis of chNA comprises: ting and amplifying a chNA library, determining the number of genome equivalents in the chNA library, and performing a quantitative genetic analysis of one or more genomic target loci.

Particular embodiments contemplate that the any of the methods and compositions described herein are effective for use to efficiently analyze, detect, diagnose, and/or monitor genetic states, genetic conditions, genetic diseases, c mosaicism, fetal diagnostics, paternity testing, iome profiling, pathogen screening, and organ transplant monitoring using genomic DNA, e.g., ar or chNA, Where all or Where only a portion of the total genomic DNA in the sample has a feature of st, 6. g. a genetic lesion, mutation, single nucleotide variant (SNV). In some embodiments, a feature of interest is a genetic feature associated with a disease or condition. For example, a icant tumor on may be present in a sample, 6. g. a sample of chNA, that is present in a minor allele frequency that is significantly less than 50% (e. g. in the range of 0.1% to >20%), in contrast to conventional SNP genotyping Where allele frequencies are generally ~100%, 50% or 0%.

In certain ments, the compositions and/or methods of the present invention described herein are useful for, capable of, suited for, and/or able to detect, identify, e, and/or reveal a genetic lesion of one or more DNA target regions present in less than about 20%, less than about 19%, less than about 18%, less than about 17%, less than about 16%, less than about 15%, less than about 14%, less than about 13%, less than about 12%, less than about 11%, less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, less than about 1%, less than about 0.5%, less than about 0.2%, or less than about 0.1% of the total genomic DNA from the sample. In some embodiments, the methods of the present invention are useful for, capable of, suited for, and/or able to detect, identify, e, and/or reveal a genetic lesion of one or more DNA target regions present in between about 0.01% to about 100%, about 0.01% to about 50%, and or about 0.1% to about % of the total genomic DNA from the sample. 1. GENERATINGADNA LIBRARY In ular embodiments, methods of genetic analysis contemplated herein comprise ting a DNA library comprising treating chNA or fragmented cellular genomic DNA with one or more end-repair enzymes to generate paired DNA and attaching one or more adaptors to each end of the end-repaired DNA to generate the DNA library. Genomic DNA In particular embodiments, the methods and compositions contemplated herein are designed to efficiently analyze, detect, se, and/or monitor change in copy number using genomic DNA as an analyte. In certain embodiments, copy number analysis is med by generating a genomic DNA library from c DNA obtained from a test sample, e.g., a biological sample such as a tissue biopsy. In certain embodiments, the genomic DNA is ating or cell free DNA. In some embodiments, the c DNA is cellular genomic DNA.

In certain embodiments, genomic DNA is obtained from a tissue sample or biopsy taken from a tissue, including but not limited to, bone marrow, esophagus, stomach, duodenum, rectum, colon, ileum, pancreases, lung, liver, prostate, brain, nerves, eal tissue, renal tissue, endometrial tissue, cervical tissue, , lymph node, muscle, and skin. In certain embodiments, the tissue sample is a biopsy of a tumor or a suspected tumor. In particular embodiments, the tumor is cancerous or suspected of being cancerous. In particular embodiments, the tissue sample comprises cancer cells or cells suspected of being cancerous.

Methods for purifying genomic DNA from cells or from a biologic tissue comprised of cells are well known in the art, and the skilled artisan will recognize l procedures or commercial kits depending on the tissue and the ions in which the tissue is obtained. Some embodiments contemplate that purifying cellular DNA from a tissue will require cell disruption or cell lysis to expose the cellular DNA within, for example by chemical and al methods such as blending, grinding or sonicating the tissue sample; removing membrane lipids by adding a ent or surfactants which also serves in cell lysis, optionally removing proteins, for example by adding a protease; removing RNA, for example by adding an RNase; and DNA purification, for example from detergents, proteins, salts and ts used during cell lysis step. DNA purification may be performed by precipitation, for example with ethanol or isopropanol; by phenol—chloroform tion.

In ular embodiments, cellular DNA obtained from tissues and/or cells are fragmented prior to and or during obtaining, generating, making, forming, and/or producing a genomic DNA library as described herein. One of skill in the art will understand that there are several suitable techniques for DNA fragmentation, and is able to recognize and identify suitable ques for fragmenting ar DNA for the purposes of ting a genomic DNA library for DNA sequencing, including but not limited to next-generation sequencing. Certain ments contemplate that cellular DNA can be fragmented into fragments of appropriate and/or sufficient length for generating a library by methods including but not lirrrited to physical fragmentation, enzymatic fragmentation, and chemical shearing.

Physical fragmentation can include, but is not limited to, acoustic shearing, sonication, and hydrodynamic shear. In some embodiments, cellular DNA is fragmented by physical fragmentation. In particular embodiments, cellular DNA is fragmented by acoustic shearing or sonication. Particular embodiments contemplate that acoustic shearing and sonication are common physical methods used to shear cellular DNA.

The Covaris® ment (Woburn, MA) is an acoustic device for breaking DNA into 100- Skb bp. Covaris also manufactures tubes (gTubes) which will process samples in the 6-20 kb for air libraries. The Bioruptor® (Denville, NJ) is a sonication device utilized for ng chromatin, DNA and disrupting tissues. Small volumes of DNA can be sheared to lSO-lkb in length. Hydroshear from Digilab (Marlborough, MA) utilizes hydrodynamic forces to shear DNA. Nebulizers (Life Tech, Grand , NY) can also be used to atomize liquid using compressed air, shearing DNA into 100-3kb fragments in seconds. Nebulization is low cost, but the process can cause a loss of about 30% of the cellular DNA from the original sample. In certain embodiments, ar DNA is nted by sonication.

Enzymatic fragmentation can include, but is not d to, treatment with a restriction endonuclease, e. g. DNase I, or treatment with a nonspecific nuclease. In some embodiments, ar DNA is fragmented by tic fragmentation. In particular embodiments, the cellular DNA is fragmented by treatment with a restriction endonuclease.

In some embodiments, the ar DNA is fragmented by treatment with a nonspecific nuclease. In certain embodiments, the cellular DNA is fragmented by ent with a transposase. Certain embodiments contemplate that tic methods to shear cellular DNA into small pieces include DNAse I, a combination of maltose binding protein (MBP)- T7 Endo I and a non-specific nuclease Vibrio vulnificus (an) New England Biolabs’s (Ipswich, MA) Fragmentase and Nextera tagmentation technology (Illumina, San Diego, CA). The ation of non-specific se and T7 Endo synergistically work to produce non-specific nicks and counter nicks, generating fragments that disassociate 8 nucleotides or less from the nick site. Tagmentation uses a transposase to simultaneously fragment and insert adapters onto double stranded DNA.

Chemical fragmentation can include treatment with heat and divalent metal cation. In some embodiments, genomic DNA is fragmented by chemical fragmentation.

Particular embodiments contemplate that chemical shear is more commonly used for the breakup of long RNA fragments as opposed to c DNA. Chemical ntation is typically performed h the heat digestion of DNA with a divalent metal cation (magnesium or zinc). The length of DNA fragments can be adjusted by increasing or decreasing the time of incubation.

In particular embodiments, the methods and compositions contemplated herein are designed to efficiently analyze, detect, se, and/or monitor change in copy number using cell-free DNA (chNA) as an analyte. The size distribution of chNA ranges from about 150 bp to about 180 bp fragments. Fragmentation of chNA may be the result of endonucleolytic and/or exonucleolytic ty and presents a formidable nge to the accurate, reliable, and robust analysis of chNA. Another challenge for analyzing chNA is its short half-life in the blood stream, on the order of about 15 minutes.

Without wishing to be bound to any particular theory, the present invention contemplates, in part, that analysis of chNA is like a d biopsy” and is a real-time snapshot of current biological processes.

Moreover, because chNA is not found within cells and may be obtained from a number of suitable sources including, but not limited to, biological fluids and stool samples, it is not subject to the existing tions that plague next generation sequencing analysis, such as direct access to the tissues being analyzed.

Illustrative examples of biological fluids that are suitable sources from which to isolate chNA in ular embodiments include, but are not limited to amniotic fluid, blood, plasma, serum, semen, tic fluid, cerebral spinal fluid, ocular fluid, urine, saliva, mucous, and sweat. In particular embodiments, the biological fluid is blood or blood plasma.

In certain embodiments, commercially available kits and other methods known to the skilled artisan can used to isolate chNA directly from the biological fluids of a subject or from a usly obtained and optionally stabilized ical sample, e.g., by freezing and/or on of enzyme chelating agents including, but not limited to EDTA, EGTA, or other chelating agents specific for divalent cations. (a) Generating End-Repaired chNA In particular embodiments, generating a genomic DNA library comprises the end-repair of isolated chNA or fragmented cellular DNA. The fragmented chNA or cellular DNA is processed by pair enzymes to generate end-repaired chNA with blunt ends, rhangs, or 3’-overhangs. In some embodiments, the end-repair enzymes can yield for example. In some embodiments, the end-repaired chNA or cellular DNA contains blunt ends. In some embodiments, the end-repaired cellular DNA or chNA is processed to contain blunt ends. In some embodiments, the blunt ends of the paired chNA or cellular DNA are further modified to contain a single base pair overhang. In some embodiments, end-repaired chNA or cellular DNA containing blunt ends can be further processed to n adenine (A)/thymine (T) overhang. In some embodiments, paired chNA or cellular DNA containing blunt ends can be further processed to contain adenine (A)/thymine (T) ng as the single base pair overhang. In some embodiments, the end- repaired chNA or cellular DNA has non-templated 3’ overhangs. In some embodiments, the end—repaired chNA or cellular DNA is processed to contain 3’ overhangs. In some embodiments, the end-repaired cflDNA or ar DNA is processed with terminal transferase (TdT) to contain 3’ overhangs. In some embodiments, a G—tail can be added by TdT. In some ments, the end-repaired chNA or cellular DNA is sed to contain overhang ends using partial digestion with any known restriction enzymes (e.g., with the enzyme Sau3A, and the like. (b) Attaching Adaptor Molecules to paired chNA In particular embodiments, generating a chNA y comprises attaching one or more adaptors to each end of the end-repaired chNA. The present invention contemplates, in part, an adaptor module designed to accommodate large numbers of genome equivalents in cfl)NA libraries. Adaptor modules are red to measure the number of genome equivalents t in chNA libraries, and, by extension, the sensitivity of sequencing assays used to fy sequence mutations.

As used herein, the terms “adaptor” and “adaptor module” are used for interchangeably, and refer to a polynucleotide comprising that comprises at least three elements: an amplification region, a sample tag , and an anchor region. In particular embodiments, the r comprises an amplification region, a sample tag region, and an anchor region. In some embodiments, the adaptor also comprises a unique molecule identifier (UMI). In particular embodiments, the adaptor comprises one or amplification regions, one or more sample tag regions, one or more UMIs, and/or one or more anchor regions. In some embodiments, the r comprises, in order from 5’ to 3’, an amplification region, a sample tag region, a UMI, and an anchor . In particular ments, the adaptor comprises, in order from 5’ to 3’, an amplification region, a sample tag region, a UMI, and an anchor region. In certain embodiments, the UMI is contained within the sample tag region, and the adaptor comprises, in order from 5’ to 3’, an amplification region, an ated sample tag/UMI region, and an anchor region.

As used herein, the term “amplification region” refers to an element of the r molecule that ses a polynucleotide sequence capable of serving as a primer recognition site for PCR amplification. In particular embodiments, an adaptor comprises an amplification region that comprises one or more primer recognition sequences for single- primer amplification of a genomic DNA library. In some embodiments, the amplification region comprises one, two, three, four, five, six, seven, eight, nine, ten, or more primer recognition sequences for single-primer amplification of a genomic DNA library.

In some embodiments, the cation region is about is between 5 and 50 nucleotides, between 10 and 45 nucleotides, between 15 and 40 nucleotides, or between 20 and 30 nucleotides in length. In some embodiments, the amplification region is tides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, about 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 tides, 38 tides, 39 nucleotides, or 40 nucleotides or more. In particular embodiments, the amplification region is nucleotides in length.

As used herein, the term “sample tag” or sample tag region” are used interchangeably and refer to an element of the adaptor that comprises a polynucleotide sequence that uniquely identifies the particular DNA fragment as well as the sample from which it was d.

In certain embodiments, the sample tag region is about is between 3 and 50 nucleotides, between 3 and 25 nucleotides, or between 5 and 15 nucleotides in length.

In some embodiments, the sample tag region is 3 nucleotides, 4 tides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 tides, 9 nucleotides, 10 nucleotides, about 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, or 20 nucleotides or more in .

In certain embodiments, the adaptor comprises a UMI multiplier, wherein the UMI multiplier is at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 tides in length.

In certain embodiments, each nucleotide on of the UMI multiplier can comprise any of adenine, guanine, cytosine, or thymine. Thus, in some embodiments, a UMI multiplier comprising 11 number of nucleotides can comprise any of n4 possible tide sequences. In some embodiments, the UMI multiplier is one nucleotide in length and comprises one of four possible sequences. In some embodiments, the UMI multiplier is two nucleotides in length and comprises one of sixteen possible sequences. In some embodiments, the UMI multiplier is three nucleotides in length and comprises one of 64 possible sequences. In some embodiments, the UMI multiplier is four nucleotides in length and comprises one of 256 le sequences. In some embodiments, the UMI multiplier is five nucleotides in length and comprises one of 1,024 possible sequences. In some embodiments, the UMI multiplier is six nucleotides in length and comprises one of 4,096 possible ces. In some embodiments, the UMI multiplier is seven nucleotides in length and comprises one of 16,384 possible sequences. In some ments, the UMI multiplier is eight nucleotides in length and comprises one of 65,5336 possible ces. In some embodiments, the UMI multiplier is nine nucleotides in length and comprises one of 262,144 possible sequences. In some embodiments, the UMI multiplier is ten or more nucleotides in length and comprises one of 1,048,576 or more possible sequences.

In particular embodiments, the r comprises a UMI multiplier, wherein the UMI lier is adjacent to or contained within the sample tag region (). Illustrative examples of UMI multipliers adjacent or contained within the sample tag are shown in . In , an 8-mer sample tag region is shown with an adjacent UMI multiplier (top and bottom rows) or a UMI multiplier incorporated within the sample tag (middle 7 rows). In some embodiments, that adaptor ses a sample tag that is eight tides in length and a UMI multiplier that is three nucleotides in length and comprises one of 64 possible sequences, and wherein the UMI multiplier is adjacent to or contained within the sample tag region. In some embodiments, identical processes attach full length adaptor to the other end of the genomic fragments.

In particular embodiments, an adaptor module comprises one or more anchor sequences. As used herein, an “anchor region” and “anchor sequence” are used interchangeably and refer to a nucleotide ce that hybridizes to a partner oligonucleotide. In some embodiments, the anchor region comprises the following three properties: (1) each anchor sequence is part of a family of two or more anchor sequences that collectively represent each of the four possible DNA bases at each site within extension; this feature, ed base representation, is useful to calibrate proper base calling in sequencing reads in particular embodiments, (2) each anchor sequence is composed of only two of four possible bases, and these are specifically chosen to be either and equal number of A + C or an equal number of G + T, an anchor sequence formed from only two bases reduces the possibility that the anchor sequence will participate in secondary ure formation that would preclude proper adaptor function; and (3) because each anchor sequence is composed of equal numbers of A + C or G + T, each anchor ce shares roughly the same melting temperature and duplex stability as every other anchor sequence in a set of four.

In some embodiments, the anchor sequences is n 1 and 50 tides in length. In some embodiments, the anchor sequences is between 4 and 40 nucleotides in length. In certain embodiments, the anchor region is between 5 and 25 nucleotides in length. In particular embodiments, the anchor region is at least 4 nucleotides, at least six tides, at least 8 nucleotides, at least 10 nucleotides, at least 12 nucleotides, at least 14 tides, or at least 16 nucleotides in length. In particular embodiments, the anchor region is 10 tides in length.

In particular embodiments, an attachment step comprises attaching/ligating an adaptor module to the end-repaired chNA or cellular DNA to generate a “tagged” genomic DNA library. In some embodiments, a single adaptor module is ed. In some embodiments, two, three, four or five r modules are employed. In some embodiments, an adaptor module of identical sequence is attached to each end of the fragmented end-repaired DNA.

In some embodiments, a plurality of adaptor species is attached to an paired cellular or cell free genomic DNA fragments. Each of the plurality of adaptors may comprise one or more amplification regions for the amplification of the chNA or cellular DNA library, one or more sample tag regions for the identification of the chNA or ar genomic DNA fragment and identification of the individual sample; and one or more sequences for DNA sequencing.

In some embodiments, a plurality of adaptor species is attached to an end—repaired cellular or cell free genomic DNA fragments of a , and the plurality of adaptors all comprise amplification regions of an identical nucleotide sequence.

In certain embodiments, the genomic DNA from a sample is attached with a plurality of adaptors that se sample tag sequences that all are different from other sequences of sample tag regions in adaptors that are attached to genomic DNA fragments from other samples.

In particular embodiments, a plurality of adaptor species is attached to an end-repaired cellular or cell free genomic DNA fragments from a sample, and the plurality of adaptors all comprise one or more sample tag s comprising one of between 2 and ,000 tide sequences, one of between 5 and 5,000 nucleotide ces, one of between 25 and 1,000 nucleotide sequences, one of between 50 and 500 nucleotide sequencesone of between 100 and 400 nucleotide sequences, or one of between 200 and 300 nucleotide sequences. In some embodiments, the sample tag region of each adaptor is 8 tides in length, and each sample tag region of the plurality of adaptors comprises one of 240 nucleotide sequences.

In certain embodiments, a plurality of r species is attached to an end-repaired cellular or cell free genomic DNA fragments from a sample, and the sample tag regions of the ity of adaptors comprises nucleotide sequences that are different from each other by a Hamming distance of l, 2, 3, 4 or greater than 4. In ular ments, the Hamming distance is 2.

In particular embodiments, the sample tag s of the plurality of adaptors that are attached to genomic DNA fragments of a sample are 8 nucleotides in length, and comprise one of 240 nucleotide sequences that are different from each other by a Hamming distance of 2.

In certain embodiments, the sample tag region serves to identify dual c DNA fragments and to identify the individual sample, i.e., the genomic library source. For example, when the sample tags of a plurality of adaptors ed to a sample have one of 240 possible sequences, each sample is identified as having one of 240 possible tags, and each sample receives a set of 240 tags that are discrete from any other sample by Hamming distance of two (meaning two base changes are ed to change one tag into another). These same tags are used to enumerate clone diversity and thus they also serve as sequence tags, i.e., to identify genomic DNA nts. To further augment the diversity of possible sequence tags, UMI multipliers may be added. For e, a UMI multiplier can be added to the adaptor region comprising 3 nucleotides consisting of the 64 possible combinations of 3 bases. In addition, the plurality of adaptors can comprise more than one anchor sequence. For example, a plurality of adaptors may contain 4 different anchor sequences are used simultaneously. These anchor sequences may also be used during sample de-multiplexing to lower errors. shows an illustrative comparison between a first generation adaptor ( and 4B) and an adaptor of the present invention ( — ). and show an example of first generation adaptor that is 40 nt in length and consisted of a discrete PCR amplification sequence, ce tag, and sample tag. Here, the sample is identified by a fixed sequence (sequence tag) that is present on all adaptors that are used to generate a DNA y from the sample. Individual genomic fragments are identified by a separate and distinct sequences (sequence tag). — show an illustrative e of an adaptor from the present invention. The illustrative adaptor shown is 47 nucleotides in length, and the sequence tag is combined with the sample tag. There is an additional 3 nt sequence, the UMI lier, ting of the 64 possible combinations of 3 bases. The 10 nt anchor sequence is one of four different distinct sequences.

Thus, in the illustrative example (See — ), a set of adaptors that are used in tion with a single sample comprise 240 sample tag sequences that can be split into four sets of sample tag sequences with each set comprising 60 tags (one for each nucleotide, A, C, T and G). Thus, each set of 60 tags is specific to one of four anchor sequences. In total, a pool of 240 possible sample tag configurations are possible per sample.

Specifically, in this scenario, the 240 sample tag sequences are divided into four sets of 60 sequences, with each set directed to a specific anchor region. Therefore, the sample ID involves not only the sequence information from the eight nucleotide sample tag, but also the associated anchor sequence information. In addition, the position of sequences within the read is fixed, and ore the sample tags and anchor sequences must have a fixed position within a sequencing read in order to pass inclusion filters for downstream consideration.

Further, the inclusion of the UMI multiplier increases the sequence tag diversity from 240 to 240 x 64 = 15,360 possible sequence tags. ] ment of one or more adaptors contemplated herein may be carried out by s known to those of ordinary skill in the art. In particular embodiments, one or more adaptors contemplated herein are attached to end-repaired chNA that comprises blunt ends. In certain embodiments, one or more adaptors contemplated herein are attached to end—repaired chNA that comprises complementary ends appropriate for the attachment method employed. In n embodiments, one or more adaptors contemplated herein are attached to end-repaired chNA that ses a 3’ ng.

In some embodiments, attaching the c DNA fragments to a plurality of adaptors includes the steps of attaching the end repaired chNA or cellular DNA fragments to an oligonucleotide containing at least a portion of an anchor region. In some embodiments, the oligonucleotide contains the whole anchor region. In particular embodiments, the oligonucleotide is a DNA duplex comprising a 5’ phosphorylated attachment strand duplexed with a partner strand, wherein the r strand is blocked from attachment by chemical ation at its 3’ end, and wherein the attachment strand is attached to the genomic DNA fragment. In certain embodiments, the DNA fragments attached with at least a n of the anchor region are then annealed with DNA oligonucleotides encoding the full length adaptor sequences. In particular embodiments, one or more polynucleotide kinases, one or more DNA ligases, and/or one or more DNA polymerases are added to the genomic DNA fragments and the DNA oligonucleotides encoding the full length adaptor sequence. In some embodiments, the polynucleotide kinase is T4 polynucleotide kinase. In some embodiments, the DNA ligase is Taq DNA ligase. In certain embodiments, the DNA polymerase is Taq polymerase. In particular embodiments, the DNA rase is full length Bst polymerase. shows an illustrative method for attaching a plurality of adaptors to the 3’ end of repaired DNA fragments. In the first step, the anchor sequence is ed to the 3’ ends of c nts In this step, the anchor portion is a DNA duplex in which the ten nucleotide 5’ orylated “attachment strand” is ed with an eight nucleotide “partner strand” that is blocked from attachment by chemical modification at its 3’ end. The anchor duplex is blunt-ended on the phosphorylated/blocked end and can therefore attach to blunt-ended genomic fragments. In the next step, pools of oligonucleotides encoding the full adaptor sequences are annealed to the initial anchor sequence. The ed action of T4 polynucleotide kinase, Taq DNA ligase, and ength Bst polymerase attach this oligonucleotide Via ligation as illustrated for the top strand and extend the initial anchor sequence by DNA rization on the bottom strand to complete the full- length adaptor sequence. Identical processes may be used to attach full length adaptors to the ’ end of the genomic fragments. 2. DNA LIBRARY AMPLIFICATION In particular embodiments, methods of genetic analysis contemplated herein comprise amplification of a genomic DNA library, 6. g. a cellular DNA library or a chNA library, to generate a DNA clone library or a library of DNA clones, e.g., a chNA clone y or a library of chNA clones, or a cellular DNA clone library or a library of cellular DNA clones. Each molecule of the DNA library ses an adaptor attached to each end of an end-repaired DNA fragments, and each adaptor comprises one or more cation regions. In some embodiments, different adaptors are attached to different ends of the end-repaired chNA. In particular embodiments, ent adaptors are attached to ent ends of the end-repaired cellular DNA.

In some embodiments, the same adaptor is attached to both ends of the DNA fragment. Attachment of the same adaptor to both ends of end-repaired DNA allows for PCR amplification with a single primer sequence. In particular embodiments, a portion of the adaptor attached-chNA library will be amplified using standard PCR techniques with a single primer sequence driving amplification. In one embodiment, the single primer sequence is about 25 nucleotides, optionally with a projected Tm of 2 55° C under standard ionic strength conditions.

In particular embodiments, picograms of the l genomic DNA library, 6. g. a ar DNA library or chNA library, are amplified into micrograms of DNA , implying a 10,000-fold amplification. The amount of amplified product can be measured using methods known in the art, e.g., quantification on a Qubit 2.0 or Nanodrop instrument. 3. DETERMINING THE NUMBER OF GEN0ME EQUIVALENTS In various embodiments, a method for genetic analysis of genomic DNA comprises determining the number of genome equivalents in the DNA clone library. As used herein, the term “genome equivalent” refers to the number of genome copies in each library. An important challenge met by the compositions and methods contemplated herein is achieving sufficient assay ivity to detect and analysis rare genetic mutations or differences in genetic sequence. To ine assay sensitivity value on a sample-by-sample basis, the numbers of different and distinct sequences that are present in each sample are measured by measuring the number of genome equivalents that are present in a sequencing library. To establish sensitivity, the number of genome equivalents must be measured for each sample library.

The number of genome equivalents can be determined by qPCR assay or by using ormatics-based counting after sequencing is performed. In the process flow of clinical samples, qPCR measurement of genome equivalents is used as a QC step for DNA libraries, e.g., chNA libraries or genomic DNA libraries. It establishes an expectation for assay sensitivity prior to sequence analysis and allows a sample to be excluded from analysis if its corresponding DNA clone library lacks the required depth of genome equivalents.

Ultimately, the bioinformatics-based counting of genome equivalents is also used to identify the genome equivalents — and hence the assay ivity and false negative estimates — for each given DNA clone library.

The empirical qPCR assay and statistical counting assays should be well correlated. In cases where cing fails to reveal the ce depth in a DNA clone library, reprocessing of the DNA clone library and/or onal sequencing may be required.

In one embodiment, the genome equivalents in a cellular DNA or chNA clone library are determined using a quantitative PCR (qPCR) assay. In a particular embodiment, a standard library of known tration is used to construct a standard curve and the ements from the qPCR assay are fit to the resulting standard curve and a value for genome equivalents is derived from the fit. The present inventors have discovered that a qPCR “repeat-based” assay comprising one primer that cally hybridizes to a common sequence in the genome, e.g., a repeat sequence, and r primer that binds to the primer g site in the adaptor, measured an 8-fold increase in genome equivalents compared to methods using just the adaptor specific primer (present on both ends of the chNA clone).

The number of genome equivalents measured by the repeat-based assays es a more consistent library-to-library performance and a better alignment between qPCR estimates of genome equivalents and bioinformatically counted tag equivalents in sequencing runs.

Illustrative examples of repeats suitable for use in the -based genome equivalent assays contemplated herein e, but not limited to: short interspersed nuclear elements (SINEs), e.g., Alu repeats, long interspersed nuclear elements (LINES), e.g., LINEl, LINE2, LINE3, microsatellite repeat elements, e.g., short tandem s (STRs), simple sequence repeats (S SRs), and mammalian-wide interspersed repeats (MIRs).

In one embodiment, the repeat is an Alu repeat. 4. QUANTITATIVE C ANALYSIS In various embodiments, a method for genetic analysis of genomic DNA, e.g., genomic cellular or chNA, comprises quantitative genetic analysis of one or more target c loci of the DNA library clones. Quantitative genetic analysis comprises one or more of, or all of, the following steps: capturing DNA clones comprising a target genetic locus; amplification of the captured targeted genetic locus; sequencing of the amplified captured targeted genetic locus; and bioinforrnatic analysis of the ing sequence reads. As used herein, the terms “DNA library clone” refer to a DNA y fragment wherein the combination of the adaptor and the genomic DNA fragment result in a unique DNA sequence (e.g., a DNA sequence that can be distinguished from that of another DNA library clone). (a) Capture of Target c Locus The present invention contemplates, in part, a capture probe module designed to retain the efficiency and reliability of larger probes but that minimizes uninformative sequence tion in a genomic DNA library that comprises smaller DNA fragments, e.g., a chNA clone library. A “capture probe” or “capture probe module” as used herein, are used interchangeably and refer to a polynucleotide that comprises a capture probe sequence and a tail sequence. In particular embodiments, the e probe module sequence or a portion thereof serves as a primer binding site for one or more sequencing primers.

In particular ments, a capture probe module comprises a capture probe. As used herein a “capture probe” refers to a region capable of hybridizing to a specific DNA target region. In some embodiments, the capture probes are used with genomic DNA y constructed from ar DNA. In ular ments, the capture probes are used with genomic DNA library constructed from chNA. Because the e size of chNA is about 150 to about 170 bp and is highly fragmented, certain embodiments are directed itions and methods contemplated herein comprise the use of high y and relatively short capture probes to interrogate DNA target regions of interest. In some embodiments, the capture probes are capable of hybridizing to DNA target regions that are distributed across all chromosomal segments at a uniform density. A set of such capture probes is referred to herein as “chromosomal stability probes.” Chromosomal ity probes are used to interrogate copy number variations on a genome-wide scale in order to provide a genome-wise measurement of chromosomal copy number (eg, chromosomal ).

One particular concern with using high density capture probes is that generally capture probes are designed using specific “sequence rules.” For example, regions of redundant ce or that exhibit extreme base composition biases are generally excluded in designing capture probes. However, the present inventors have discovered that the lack of flexibility in capture probe design rules does not substantially impact probe performance. In st, capture probes chosen strictly by positional constraint provided on-target sequence information; exhibit very little off-target and unmappable read capture; and yield uniform, useful, on-target reads with only few exceptions. Moreover, the high redundancy at close probe spacing more than compensates for occasional poor-performing capture probes.

In particular embodiments, a target region is targeted by a plurality of capture probes, wherein any two or more capture probes are designed to bind to the target region within 10 nucleotides of each other, within 15 nucleotides of each other, within 20 nucleotides of each other, within 25 tides of each other, within 30 nucleotides of each other, within 35 nucleotides of each other, within 40 nucleotides of each other, within 45 nucleotides of each other, or within 50 nucleotides or more of each other, as well as all intervening nucleotide lengths.

In one ment, the capture probe is about 25 nucleotides, about 26 nucleotides, about 27 tides, about 28 nucleotides, about 29 nucleotides, about 30 nucleotides, about 31 nucleotides, about 32 nucleotides, about 33 nucleotides, about 34 nucleotides, about 35 nucleotides, about 36 nucleotides, about 37 nucleotides, about 38 nucleotides, about 39 tides, about 40 nucleotides, about 41 nucleotides, about 42 tides, about 43 nucleotides, about 44 nucleotides, or about 45 nucleotides.

In one embodiment, the capture probe is about 100 nucleotides, about 200 nucleotides, about 300 nucleotides, about 400 nucleotides, or about 100 nucleotides. In another embodiment, the capture probe is from about 100 nucleotides to about 500 nucleotides, about 200 nucleotides to about 500 nucleotides, about 300 nucleotides to about 500 tides, or about 400 nucleotides to about 500 nucleotides, or any intervening range thereof.

In a particular embodiment, the e probe is 60 nucleotides. In another embodiment, the capture probe is substantially smaller than 60 nucleotides but hybridizes ably, as well as, or better than a 60 nucleotide capture probe targeting the same DNA target region. In a certain embodiment, the e probe is 40 nucleotides.

In certain embodiments, a capture probe module comprises a tail sequence. As used herein, the term “tail sequence” refers to a polynucleotide at the 5’ end of the capture probe module, which in particular embodiments can serve as a primer binding site. In particular embodiments, a sequencing primer binds to the primer binding site in the tail region.

In particular embodiments, the tail sequence is about 5 to about 100 nucleotides, about 10 to about 100 nucleotides, about 5 to about 75 nucleotides, about 5 to about 50 nucleotides, about 5 to about 25 nucleotides, or about 5 to about 20 nucleotides. In certain embodiments, the third region is from about 10 to about 50 nucleotides, about 15 to about 40 nucleotides, about 20 to about 30 nucleotides or about 20 nucleotides, or any intervening number of nucleotides.

In particular ments, the tail sequence is about 30 nucleotides, about 31 nucleotides, about 32 tides, about 33 nucleotides, about 34 nucleotides, about nucleotides, about 36 nucleotides, about 37 nucleotides, about 38 tides, about 39 nucleotides, or about 40 nucleotides.

In various embodiments, the capture probe module comprises a c member of a binding pair to enable isolation and/or purification of one or more captured fragments of a tagged and or amplified c DNA library (e.g., a cellular or chNA library) that hybridizes to the e probe. In particular embodiments, the capture probe module is conjugate to biotin or r suitable , e.g., dinitrophenol, digoxigenin.

In various embodiments, the e probe module is hybridized to a tagged and optionally amplified DNA y to form a complex. In some embodiments, the multifunctional capture probe module substantially hybridizes to a specific genomic target region in the DNA library.

Hybridization or hybridizing conditions can include any reaction conditions where two nucleotide sequences form a stable complex; for example, the tagged DNA library and capture probe module forming a stable tagged DNA library —capture probe module complex. Such reaction conditions are well known in the art and those of skill in the art will appreciated that such conditions can be modified as appropriate, e.g., decreased annealing temperatures with shorter length e probes, and within the scope of the present invention. Substantial hybridization can occur when the second region of the capture probe complex exhibits 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92% 91%, 90%, 89%, 88%, 85%, 80%, 75%, or 70% sequence identity, gy or complementarity to a region of the tagged DNA y.

In particular embodiments, the capture probe is about 40 nucleotides and has an l annealing temperature of about 44° C to about 470 C.

In certain embodiments, the methods contemplated herein comprise isolating a tagged chNA library—capture probe module complex. In particular embodiments, methods for isolating DNA complexes are well known to those skilled in the art and any methods deemed appropriate by one of skill in the art can be employed with the methods of the present invention (Ausubel et al, Current Protocols in Molecular Biology, 2007-2012). In particular embodiments, the complexes are ed using biotin—streptavidin isolation techniques.

In particular embodiments, removal of the single stranded 3’—ends from the isolated tagged DNA library fragments-capture probe module complex is contemplated.

In certain ments, the methods comprise 3’—5' exonuclease enzymatic processing of the isolated tagged DNA library-multifunctional capture probe module complex to remove the single stranded 3’ ends.

In certain other embodiments, the methods comprise performing 5'-3’ DNA polymerase extension of unctional capture probe utilizing the isolated tagged DNA library fragments as template.

In certain other embodiments, the methods comprise creating a hybrid capture probe-isolated tagged DNA target molecule, e.g., a tagged chNA target molecule or a tagged cellular DNA target molecule, through the concerted action of a 5’ FLAP endonuclease, DNA polymerization and nick closure by a DNA ligase.

A variety of enzymes can be employed for the 3'-5' exonuclease enzymatic processing of the isolated tagged DNA library-multifunctional capture probe module x. Illustrative examples of suitable enzymes, which exhibit 3’-5’ exonuclease enzymatic activity, that can be employed in ular ments include, but are not limited to: T4 or Exonucleases I, 111, V (See also, Shevelev IV, Hubscher U., Nat Rev Mol Cell Biol. 3(5):364—76 (2002)). In particular embodiments, the enzyme comprising 3'-5’ exonuclease activity is T4 polymerase. In particular embodiments, an enzyme which exhibits 3’-5’ exonuclease enzymatic activity and is capable of primer template extension can be employed, including for example T4 or Exonucleases I, III, V. Id.

In some embodiments, the methods contemplated herein comprise performing sequencing and/or PCR on the 3'-5' exonuclease enzymatically processed x discussed supra and elsewhere herein. In ular ments, a tail portion of a capture probe molecule is copied in order to generate a hybrid nucleic acid molecule. In one embodiment, the hybrid nucleic acid molecule generated comprises the target region capable of hybridizing to the e probe module and the ment of the capture probe module tail sequence.

] In a particular embodiment, genetic analysis comprises a) hybridizing one or more capture probe modules to one or more target genetic loci in a plurality of genomic DNA library clones to form one or more capture probe module—DNA library clone complexes; b) isolating the one or more capture probe -DNA y clone complexes from a), c) enzymatically processing the one or more isolated capture probe module-DNA library clone complexes from step b); d) performing PCR on the tically processed x from c) wherein the tail portion of the capture probe molecule is copied in order to generate amplified hybrid nucleic acid molecules, n the ed hybrid nucleic acid molecules comprise a target sequence in the target genomic locus e of hybridizing to the capture probe and the ment of the capture probe module tail sequence; and e) ming quantitative genetic analysis on the amplified hybrid nucleic acid molecules from In a particular embodiment, s for determining copy number of a specific target genetic locus are contemplated comprising: a) hybridizing one or more capture probe modules to one or more target genetic loci in a plurality of DNA library clones to form one or more e probe module-DNA library clone complexes; b) isolating the one or more capture probe module-DNA library clone complexes from a); c) enzymatically processing the one or more isolated capture probe -DNA library clone complexes from step b); d) performing PCR on the enzymatically processed complex from c) wherein the tail n of the capture probe molecule is copied in order to generate amplified hybrid nucleic acid molecules, wherein the amplified hybrid nucleic acid molecules comprise a target sequence in the target genetic locus capable of hybridizing to the capture probe and the complement of the capture probe module tail sequence; e) performing PCR amplification of the amplified hybrid nucleic acid molecules in d); and f) quantitating the PCR reaction in e), wherein the quantitation allows for a determination of copy number of the specific target region.

In one ment, the enzymatic processing of step c) comprises performing 3'-5' lease enzymatic processing on the one or more e probe module-DNA library clone complexes from b) using an enzyme with 3'-5' exonuclease activity to remove the single stranded 3’ ends; creating one or more hybrid capture probe -cfl)NA library clone molecules through the concerted action of a 5’ FLAP clease, DNA rization and nick closure by a DNA ligase; or performing 5’-3' DNA polymerase extension of the capture probe using the isolated DNA clone in the complex as a template.

In one embodiment, the enzymatic processing of step 0) comprises performing 5’-3' DNA polymerase extension of the capture probe using the isolated DNA clone in the complex as a template.

In particular embodiments, PCR can be performed using any standard PCR reaction conditions well known to those of skill in the art. In certain embodiments, the PCR on in e) employs two PCR primers. In one embodiment, the PCR reaction in e) employs a first PCR primer that hybridizes to a repeat within the target genetic locus. In a particular embodiment, the PCR reaction in e) s a second PCR primer that hybridizes to the hybrid nucleic acid molecules at the target genetic locus/tail junction. In certain embodiments, the PCR reaction in e) employs a first PCR primer that hybridizes to the target genetic locus and a second PCR primer hybridizes to the amplified hybrid nucleic acid molecules at the target c locus/tail junction. In particular embodiments, the second primer hybridizes to the target genetic locus/tail junction such that at least one or more nucleotides of the primer hybridize to the target genetic locus and at least one or more nucleotides of the primer hybridize to the tail sequence.

In certain ments, the amplified hybrid nucleic acid molecules obtained from step e) are sequenced and the sequences aligned horizontally, i.€., aligned to one r but not d to a reference sequence. In particular embodiments, steps a) through e) are ed one or more times with one or more capture probe modules. The capture probe s can be the same or different and designed to target either chNA strand of a target genetic locus. In some embodiments, when the capture probes are different, they ize at overlapping or adjacent target sequences within a target genetic locus in the tagged chNA clone library. In one embodiment, a high density capture probe gy is used wherein a plurality of capture probes hybridize to a target genetic locus, and wherein each of the plurality of capture probes izes to the target genetic locus within about 5, , 15, 20, 25, 30, 35, 40, 45, 50, 100, 200 bp or more of any other capture probe that hybridizes to the target genetic locus in a tagged DNA clone library, ing all intervening distances.

In some embodiments, the method can be performed using two capture probe modules per target c locus, wherein one hybridizes to the “Watson” strand (noncoding or template strand) upstream of the target region and one izes to the “Crick” strand (coding or non-template strand) downstream of the target region.

In particular embodiments, the methods contemplated herein can further be performed multiple times with any number of capture probe s, for example 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more capture probe modules per target genetic locus any number of which hybridize to the Watson or Crick strand in any combination. In some embodiments, the sequences obtained can be aligned to one another in order to identify any of a number of differences.

In certain embodiments, a plurality of target genetic loci are interrogated, e.g., 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 10000, 50000, 100000, 500000 or more in a single reaction, using one or more capture probe modules. (b) Sequencing In particular embodiments, the quantitative genetic analysis comprises cing a plurality of hybrid nucleic acid molecules, as discussed elsewhere herein, supra, to generate sufficient sequencing depths to obtain a plurality of unique sequencing reads. The terms “unique reads” or “unique genomic sequences” (UGS) are used hangeably herein and are identified by grouping individual redundant reads er into a y.” Redundant reads are ce reads that share an identical UMIE (e.g, share the same read code and the same DNA sequence start position within genomic sequence) and are derived from a single attachment event and are therefore amplification-derived “siblings” of one another. A single consensus representative of a family of redundant reads is carried forward as a unique read or UGS. Each unique read or UGS is considered a unique attachment event.

The sum of unique reads corresponding to a particular capture probe is referred to as the “raw genomic dept ” (RGD) for that particular capture probe Each capture probe yields a set of unique reads that are ationally distilled from total reads by grouping into families. The unique reads for a given sample (e.g., raw genomic depth for a sample) are then computed as the average of all the unique reads observed on a probe-by-probe basis. Unique reads are important because each unique read must be d from a unique genomic DNA clone.

Each unique read represents the input and analysis of a haploid equivalent of genomic DNA.

The sum of unique reads is the sum of haploid genomes analyzed. The number of genomes analyzed, in turn, defines the sensitivity of the cing assay. By way of a non-limiting example, if the average unique read count is 100 genome equivalents, then that particular assay has a sensitivity of being able to detect one mutant read in 100, or 1%. Any observation less than this is not defensible.

Cases where there is an obvious copy number change (6.3, instances of noisy probes) are excluded from the data set used to compute the sample average. Herein, a “noisy probe” refers to a probe that captures a highly variable number of unique reads among a large set identical s (e.g., a highly variable number of unique reads among 12 — 16 sample replicates). In some embodiments, the number of unique reads associated with a noisy probe is sed ed to the average number of unique reads for the sample by 50% or more. In some embodiments, the number of unique reads ated with a noisy probe is decreased compared to the e number of unique reads for the sample by 50% or more. In some ments, about 2% to about 4% of probes used in a particular analysis are identified as noisy probes and are ed from calculations to determine the average number of unique reads for a given sample.

In some embodiments, sequencing reads are identified as either “on- target reads” or “off-target reads.” On-target reads possess a genomic DNA sequence that maps within the vicinity of a capture probe used to create the genomic library. In some embodiments, where each genomic sequence is physically linked to a specific capture probe and where the sequence of the genomic segment and capture probe are both determined as a unified piece of information, an on-target read is defined as any genomic sequence whose starting coordinate maps within 400 bp, and more generally within 200 bp of the 3’ end of the corresponding capture probe. rget reads are defined as having genomic sequence that aligns to the reference genome at a location 2 500 base pairs (and more often mapping to entirely different chromosomes) relative to the capture probe.

] In particular ments, the quantitative genetic analysis comprises lex sequencing of hybrid nucleic acid molecules derived from a plurality of samples.

In various embodiments, the quantitative genetic analysis comprises obtaining one or more or a plurality of tagged DNA library clones, each clone comprising a first DNA sequence and a second DNA sequence, wherein the first DNA sequence comprises a sequence in a targeted genetic locus and the second DNA sequence comprises a capture probe sequence; performing a paired end sequencing reaction on the one or more clones and obtaining one or more cing reads or performing a sequencing reaction on the one or more clones in which a single long sequencing read of greater than about 100, 200, 300, 400, 500 or more nucleotides is obtained, wherein the read is ent to identify both the first DNA sequence and the second DNA sequence; and ordering or clustering the sequencing reads of the one or more clones according to the probe sequences of the sequencing reads. (0) Bioinformatics is In various embodiments, the quantitative c analysis further comprises bioinformatic analysis of the sequencing reads. Bioinformatic analysis excludes any purely mental analysis performed in the absence of a composition or method for sequencing. In certain ments, bioinformatics analysis includes, but is not limited to: sequence alignments; genome equivalents analysis; single nucleotide variant (SNV) analysis; gene copy number variation (CNV) analysis; measurement of chromosomal copy ; and detection of genetic lesions. In particular embodiments; ormatics analysis is useful to quantify the number of genome lents ed in the chNA clone library; to detect the genetic state of a target genetic locus; to detect genetic lesions in a target genetic locus; and to e copy number fluctuations within a target c locus.

Sequence alignments may be performed between the sequence reads and one or more human reference DNA sequences. In particular embodiments; sequencing alignments can be used to detect genetic lesions in a target genetic locus ing; but not limited to detection of a nucleotide transition or transversion; a nucleotide insertion or deletion; a genomic rearrangement; a change in copy number; or a gene . Detection of genetic lesions that are causal or prognostic indicators may be useful in the diagnosis; prognosis; treatment; and/or monitoring of a particular genetic condition or disease.

Also contemplated herein; are methods for sequence alignment analysis that can be performed without the need for alignment to a reference sequence; ed to herein as horizontal sequence is. Such analysis can be performed on any sequences generated by the methods contemplated herein or any other methods. In particular ments; the sequence analysis comprises performing sequence alignments on the reads obtained by the methods contemplated herein.

In one embodiment; the genome equivalents in a chNA clone library are determined using bioinformatics-based counting after sequencing is performed. Each sequencing read is associated with a particular capture probe; and the collection of reads assigned to each capture probe is parsed into groups. Within a group; sets of individual reads share the same read code and the same DNA sequence start position within genomic ce. These individual reads are grouped into a “family” and a single consensus representative of this family is carried d as a “unique read.” All of the individual reads that constituted a family are derived from a single ment event and thus; they are amplification—derived ngs” of one another. Each unique read is considered a unique attachment event and the sum of unique reads is considered equivalent to the number of genome equivalents analyzed.

As the number of unique clones approaches the total number of le sequence combinations, probability dictates that the same code and start site combinations will be created by independent events and that these independent events will be inappropriately grouped within single es. The net result will be an underestimate of genome equivalents analyzed, and rare mutant reads may be discarded as sequencing errors because they overlap with wild-type reads bearing the same identifiers.

In particular embodiments, to provide an accurate analysis for chNA clone libraries, the number of genome equivalents ed is about 1/10, about 1/ 12, about 1/ 14, about 1/ 16, about 1/ 18, about 1/20, about 1/25 or less the number of possible unique clones. It should be understood that the procedure outlined above is merely illustrative and not limiting.

In some embodiments, the number of genome equivalents to be analyzed may need to be increased. To expand the depth of genome lents, at least two ons are contemplated. The first solution is to use more than one adaptor set per sample.

By combining adaptors, it is possible to multiplicatively expand the total number of possible clones and therefore, expand the table limits of genomic input. The second solution is to expand the read code by 1, 2, 3, 4, or 5, or more bases. The number of possible read codes that differ by at least 2 bases from every other read code scales as 40“) where n is the number of bases within a read code. Thus, in a non-limiting example, if a read code is 5 nucleotides and 45'” = 256, therefore, the inclusion of additional bases expands the available repertoire by a factor of four for each additional base.

In one embodiment, quantitative genetic analysis comprises bioinformatic analysis of cing reads to fy rare single nucleotide variants (SNV).

Next-generation cing has an inherent error rate of roughly 0.02- 0.02%, meaning that anywhere from 1/200 to 1/500 base calls are incorrect. To detect variants and other mutations that occur at frequencies lower than this, for example at frequencies of 1 per 1000 sequences, it is necessary to invoke molecular annotation gies. By way of a non-limiting example, analysis of 5000 unique molecules using targeted sequence capture technology would generate — at sufficient cing depths of >50,000 reads — a collection of 5000 unique reads, with each unique read belonging to a “family” of reads that all possess the same read code. A SNV that occurs within a family is a candidate for being a rare variant. When this same variant is observed in more than one family, it becomes a very strong candidate for being a rare variant that exists within the starting sample. In contrast, ts that occur sporadically within families are likely to be sequencing errors and variants that occur within one and only one family are either rare or the result of a base alteration that occurred ex vivo (e.g., oxidation of a DNA base or PCR— uced errors).

In one ment, the methods of detecting SNVs comprise introducing 10-fold more genomic input (genomes or genome equivalents) as the desired target ivity of the assay. In one non-limiting example, if the desired sensitivity is 2% (2 in 100), then the experimental target is an input of 2000 genomes.

In particular embodiments, bioinforrnatics analysis of sequencing data is used to detect or identify SNV associated with a genetic state, ion or disease, genetic mosaicism, fetal testing, paternity testing, predicting response to drug treatment, diagnosing or monitoring a medical condition, microbiome profiling, pathogen screening, and monitoring organ transplants.

In various embodiments, a method for copy number determination analysis is provided comprising obtaining one or more or a plurality of clones, each clone comprising a first DNA sequence and a second DNA sequence, wherein the first DNA sequence comprises a sequence in a targeted genetic locus and the second DNA sequence comprises a capture probe sequence. In related embodiments, a paired end sequencing reaction on the one or more clones is med and one or more sequencing reads are obtained. In another ment, a sequencing reaction on the one or more clones is performed in which a single long sequencing read of greater than about 100 tides is obtained, wherein the read is sufficient to identify both the first DNA sequence and the second DNA ce. The sequencing reads of the one or more clones can be ordered or clustered according to the probe sequence of the sequencing reads.

Copy number analyses include, but are not limited to, analyses that examine the number of copies of a particular gene or mutation that occurs in a given genomic DNA sample and can further e quantitative determination of the number of copies of a given gene or sequence differences in a given sample. In particular embodiments, copy number analysis is used to detect or identify gene amplification associated with genetic states, ions, or diseases, fetal testing, genetic mosaicism, paternity testing, predicting response to drug treatment, diagnosing or monitoring a medical ion, microbiome profiling, pathogen screening, and ring organ transplants.

In some embodiments, copy number analysis is used to measure chromosomal instability. In such embodiments, sets of capture probes that comprise somal stability probes are used to determine copy number ions at a uniform density across all sets of chromosomes. Copy number analyses are performed for each chromosomal stability probe and the chromosomal stability probes are then ordered according to their chromosomal target. This allows for visualization of copy number losses or gains across the genome and can serve as a measure of chromosomal ity.

In particular embodiments, bioinformatics analysis of sequencing data is used to detect or identify one or more sequences or genetic s in a target locus including, but not limited to detection of a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a change in copy number, or a gene fusion.

Detection of genetic s that are causal or prognostic indicators may be useful in the diagnosis, prognosis, ent, and/or monitoring of a particular genetic condition or disease. In one embodiment, genetic lesions are associated with genetic , conditions, or diseases, fetal testing, genetic mosaicism, paternity testing, predicting response to drug treatment, diagnosing or monitoring a medical condition, microbiome profiling, pathogen screening, and monitoring organ transplants.

D. CLINICAL APPLICATIONS OF TATIVE CNL ASSAYS ] In various embodiments, the present invention contemplates a method of detecting, identifying, predicting, diagnosing, or monitoring a ion or disease in a subject by detecting a mutational change, SNP, translocation, inversion, deletion, change in copy number or other genetic variation in a region of interest.

E. CLINICAL APPLICATIONS OF QUANTITATIVE GENETIC ANALYSIS In various embodiments, the present invention contemplates a method of detecting, identifying, predicting, sing, or monitoring a condition or disease in a subject.

In particular embodiments, a method of detecting, identifying, predicting, diagnosing, or monitoring a c state, condition or disease in a subject comprises performing a tative genetic analysis of one or more target genetic loci in a DNA clone library to detect or identify a change in the sequence at the one or more target genetic loci. In some embodiments, the change is a change in copy number.

In one embodiment, a method of detecting, identifying, predicting, diagnosing, or monitoring a genetic state, condition or disease comprises ing or obtaining cellular DNA or chNA from a biological sample of a t; treating the cellular DNA or chNA with one or more end-repair enzymes to generate end-repaired DNA, attaching one or more adaptors to each end of the end-repaired DNA to generate a genomic DNA library, amplifying the DNA library to generate a DNA clone library, determining the number of genome equivalents in the DNA clone library, and performing a quantitative genetic analysis of one or more target genetic loci in a DNA clone library to detect or identify a change in the sequence, eg, an SNP, a ocation, an inversion, a deletion, or a change in copy number at of the one or more target genetic loci.

In particular embodiments, a method of detecting, identifying, predicting, sing, or monitoring a genetic state, or genetic condition or disease selected from the group consisting of: genetic diseases, genetic mosaicism, fetal testing; paternity testing, paternity testing, predicting response to drug treatment; diagnosing or monitoring a medical condition; iome profiling; pathogen screening, and organ transplant monitoring comprising isolating or obtaining genomic DNA from a biological sample of a subject, treating the DNA with one or more end-repair s to generate paired DNA, attaching one or more adaptors to each end of the end—repaired DNA to te a genomic DNA library, amplifying the genomic DNA library to generate a DNA clone library, determining the number of genome lents in the DNA clone library, and performing a quantitative genetic analysis of one or more target genetic loci in a DNA clone library to detect or identify a nucleotide tion or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a change in copy number, or a gene fusion in the sequence at the one or more target genetic loci.

Illustrative examples of genetic diseases that can be detected, identified, ted, diagnosed, or monitored with the compositions and methods contemplated herein include, but are not limited to cancer, Alzheimer’s disease (APOEI), Charcot-Marie-Tooth disease, Leber tary optic neuropathy (LHON), an syndrome (UBE3A, ubiquitin-protein ligase E3A), Prader-Willi syndrome (region in chromosome 15), B—Thalassaemia (HBB, B—Globin), Gaucher disease (type 1) (GBA, Glucocerebrosidase), Cystic fibrosis (CFTR Epithelial chloride channel), Sickle cell disease (HBB, B-Globin), Tay—Sachs e (HEXA, Hexosaminidase A), Phenylketonuria (PAH, alanine hydrolyase), Familial holesterolaemia (LDLR, Low density lipoprotein receptor), Adult polycystic kidney disease (PKDl, Polycystin), gton disease (HDD, Huntingtin), Neuroflbromatosis type I (NFl, NFl tumour suppressor gene), Myotonic dystrophy (DM, Myotonin), us sclerosis (TSCl, Tuberin), Achondroplasia (FGFR3, Fibroblast growth factor receptor), Fragile X syndrome (FMRl, RNA-binding protein), ne muscular dystrophy (DMD, Dystrophin), Haemophilia A (F8C, Blood ation factor VIII), Lesch—Nyhan syndrome (HPRTl, Hypoxanthine guanine ribosyltransferase l), and Adrenoleukodystrophy (ABCDl).

Illustrative examples of cancers that can be detected, identified, predicted, diagnosed, or monitored with the compositions and methods contemplated herein include, but are not limited to: B cell cancer, e.g., multiple myeloma, melanomas, breast cancer, lung cancer (such as non-small cell lung carcinoma or NSCLC), bronchus cancer, colorectal cancer, te cancer, pancreatic , stomach cancer, ovarian cancer, y bladder cancer, brain or central nervous system , peripheral nervous system , esophageal , cervical cancer, uterine or trial cancer, cancer of the oral cavity or pharynx, liver cancer, kidney , testicular cancer, biliary tract cancer, small bowel or appendix cancer, salivary gland cancer, thyroid gland cancer, adrenal gland cancer, osteosarcoma, chondrosarcoma, cancer of hematological tissues, adenocarcinomas, inflammatory myof1broblastic tumors, gastrointestinal stromal tumor (GIST), colon cancer, multiple myeloma (MM), myelodysplastic syndrome (MDS), myeloproliferative er (MPD), acute lymphocytic leukemia (ALL), acute myelocytic ia (AML), chronic myelocytic leukemia (CML), chronic lymphocytic leukemia (CLL), polycythemia Vera, Hodgkin lymphoma, non-Hodgkin lymphoma (NHL), soft-tissue sarcoma, f1brosarcoma, myxosarcoma, rcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, s tumor, leiomyosarcoma, rhabdomyosarcoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, ary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, ioblastoma, acoustic neuroma, oligodendroglioma, meningioma, neuroblastoma, retinoblastoma, follicular lymphoma, diffuse large B-cell lymphoma, mantle cell lymphoma, hepatocellular carcinoma, thyroid cancer, gastric cancer, head and neck cancer, small cell cancers, essential thrombocythemia, agnogenic d metaplasia, hypereosinophilic me, systemic mastocytosis, familiar hypereosinophilia, c eosinophilic leukemia, neuroendocrine cancers, carcinoid tumors, and the like.

In one ment, the genetic lesion is a lesion annotated in the Cosmic database (the lesions and sequence data are available online and can be downloaded from the Cancer Gene Census section of the Cosmic website) or a lesion annotated in the Cancer Genome Atlas (the lesions and sequence data are available online and can be downloaded from The Cancer Genome Atlas website).

Illustrative examples of genes that harbor one or more genetic lesions associated with cancer that can be detected, identified, predicted, diagnosed, or monitored with the compositions and methods contemplated herein include, but are not d to ABCBl, ABCC2, ABCC4, ABCG2, ABLl, ABL2, AKT1, AKT2, AKT3, ALDH4A1, ALK, APC, AR, ARAF, ARFRPl, ARIDlA, ATM, ATR, AURKA, AURKB, BCL2, BCL2A1, BCL2Ll, BCL2L2, BCL6, BRAF, BRCAl, BRCAZ, Clorfl44, CARDll, CBL, CCNDl, CCND2, CCND3, CCNEl, CDHl, CDH2, CDH20, CDH5, CDK4, CDK6, CDK8, CDKNZA, CDKNZB, CDKNZC, CEBPA, CHEKl, CHEKZ, CRKL, CRLFZ, CTNNBl, , CYP2C19, CYP2C8, CYP2D6, CYP3A4, CYP3A5, DNMT3A, DOTlL, DPYD, EGFR, EPHA3, EPHAS, EPHA6, EPHA7, EPHBl, EPHB4, EPHB6, EPHXl, ERBB2, ERBB3, ERBB4, ERCC2, ERG, ESRl, ESR2,ETV1, ETV4, ETVS, ETV6, EWSRi, EZH2, FANCA, FBXW7, , FGFRl, FGFR2, FGFR3, FGFR4, FLTl, FLT3, FLT4, FOXP4, GATAl, GNAll, GNAQ, GNAS, GPR124, GSTPl, GUCY1A2, HOXA3, HRAS, A1, IDHl, IDH2, IGFlR, IGF2R, IKBKE, IKZFl, INHBA, 1Rs2, ITPA, JAKl, JAK2, JAK3, JUN, KDR, KIT, KRAS, LRPlB, LRP2, LTK, MANlBl, MAP2K1, MAP2K2, , MCLl, MDM2, MDM4, MEN], MET, MITF, MLHl, MLL, MPL, MREllA, MSH2, MSH6, MTHFR, MTOR, MUTYH, MYC, MYCLl, MYCN,NF1, NF2, NKX2-1, NOTC PDGFRA, PDGFRB, PIK3CA, PIK3R1, PKHDl, PLCGl, PRKDC, PTCHi, PTEN, PTPN11, PTPRD, RAFl, RARA, RBI, RET, RICTOR, RPTOR, RUNXl, SLC19A1, SLC22A2, SLCOlB3, SMAD2, SMAD3, SMAD4, SMARCA4, SMARCBl, SMO, SOD2, SOXlO, SOX2, SRC, STKl 1, l, TBX22, TETZ, TGFBRZ, TMPRSSZ, TNFRSF14, TOPl, TP53, TPMT, TSCl, TSC2, TYMS, UGTlAl, UMPS, USP9X, VHL, and WTl.

In particular embodiments, the genetic lesion comprises a nucleotide transition or transversion, a nucleotide insertion or deletion, a c rearrangement, a change in copy number, or a gene fusion.

In one embodiment, the genetic lesion is a gene fusion that fuses the 3' coding region of the ALK gene to another gene.

In one embodiment, the genetic lesion is a gene fusion that fuses the 3' coding region of the ALK gene to the EML4 gene.

Illustrative es of conditions suitable for fetal testing that can be detected, identified, predicted, diagnosed, or monitored with the compositions and methods contemplated herein include but are not limited to: Down Syndrome (Trisomy 21), s Syndrome (Trisomy 18), Patau Syndrome (Trisomy 13), Klinefelter's me (XXY), Triple X syndrome, XYY syndrome, Trisomy 8, y 16, Turner Syndrome (X0), Robertsonian translocation, DiGeorge Syndrome and irschhorn Syndrome. rative examples of alleles suitable for paternity testing that can be detected, identified, predicted, diagnosed, or monitored with the compositions and methods contemplated herein include but are not limited to 16 or more of: D20S1082, D6S474, D12ATA63, D22S1045, D10S1248, D1Sl677, 63, D4S2364, D9S1122, D2Sl776, D10S1425, 3, Dsszsoo, D1S1627, D3S4529, D28441, D17S974, D6S1017, D482408, D9S2157, Amelogenin, D17Sl301, D1GATA113, D18S853, D20S482, and D14S1434. rative examples of genes suitable for predicting the response to drug treatment that can be detected, identified, predicted, diagnosed, or monitored with the compositions and methods plated herein include, but are not limited to, one or more of the following genes: ABCBl (ATP-binding cassette, sub-family B (MDR/TAP), member 1), ACE (angiotensin I converting ), ADHIA (alcohol dehydrogenase 1A (class 1), alpha polypeptide), ADHlB (alcohol dehydrogenase IB (class 1), beta polypeptide), ADHlC (alcohol dehydrogenase 1C (class I), gamma polypeptide), ADRBl (adrenergic, beta—l-, receptor), ADRB2 (adrenergic, beta-2—, receptor, surface), AHR (aryl hydrocarbon receptor), I (aldehyde dehydrogenase 1 , member A1), ALOX5 (arachidonate 5- lipoxygenase), BRCAl (breast cancer 1, early onset), COMT (catechol-O—methyltransferase), CYP2A6 (cytochrome P450, family 2, subfamily A, polypeptide 6), CYP2B6 (cytochrome P450, family 2, subfamily B, polypeptide 6), CYP2C9 hrome P450, family 2, subfamily C, ptide 9), CYP2C19 (cytochrome P450, family 2, subfamily C, polypeptide 19), CYP2D6 (cytochrome P450, family 2, subfamily D, polypeptide 6), CYP2J2 (cytochrome P450, family 2, subfamily J, polypeptide 2), CYP3A4 (cytochrome P450, family 3, subfamily A, polypeptide 4), CYP3A5 (cytochrome P450, family 3, subfamily A, polypeptide 5), DPYD (dihydropyrimidine dehydrogenase), DRD2 (dopamine receptor D2), F5 (coagulation factor V), GSTPl (glutathione S-transferase pi), HMGCR (3-hydroxy methylglutaryl-Coenzyme A reductase), KCNH2 (potassium voltage-gated channel, subfamily H (eag—related), member 2), KCNJ11 sium inwardly-rectifying channel, subfamily J, member 11), MTHFR (5,10-methylenetetrahydrofolate reductase (NADPH)), NQOl (NAD(P)H dehydrogenase, quinone 1), P2RY1 ergic receptor P2Y, G—protein coupled, l), P2RY12 (purinergic receptor P2Y, G—protein d, 12), PTGIS (prostaglandin I2 (prostacyclin) synthase), SCN5A m channel, voltage-gated, type V, alpha (long QT syndrome 3)), SLC19A1 (solute carrier family 19 e transporter), member 1), SLCOlBl (solute carrier organic anion transporter family, member 1B1), SULTIAI (sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1), TPMT (thiopurine S-methyltransferase), TYMS (thymidylate synthetase), UGT1A1 (UDP onosyltransferase 1 family, polypeptide A1), VDR in D (1,25- dihydroxyvitamin D3) receptor), VKORCl (vitamin K epoxide reductase complex, subunit 1).

Illustrative es of medical conditions that can be detected, identified, predicted, diagnosed, or monitored with the compositions and methods plated herein include, but are not limited to: stroke, transient ischemic , traumatic brain injury, heart disease, heart attack, angina, atherosclerosis, and high blood pressure. rative examples of pathogens that can be screened for with the compositions and methods contemplated herein include, but are not limited to: bacteria fungi, and s.

] Illustrative examples of bacterial species that can be screened for with the compositions and methods contemplated herein include, but are not limited to: a Mycobacterium spp., a Pneumococcus spp., an Escherichia spp., a Campylobacter spp., a Corynebacterium spp., a Clostridium spp., a Streptococcus spp., a Staphylococcus spp., a Pseudomonas spp., a Shigella spp., a Treponema spp., or a Salmonella spp.

Illustrative examples of fungal species that can be screened for with the compositions and methods plated herein include, but are not d to: an illis spp., a Blastomyces spp., a Candida spp., a Coccicioides spp., a Cryptococcus spp., dermatophytes, a Tinea spp., a Trichophyton spp., a Microsporum spp., a Fusarium spp., a Histoplasma spp,, a mycotina spp., a Pneumocystis spp., a Sporothrix spp., an Exserophilum spp., or a Cladosporium spp.

Illustrative examples of viruses that can be screened for with the compositions and methods contemplated herein include, but are not d to: za A such as HlNl, HlN2, H3N2 and H5Nl (bird flu), Influenza B, Influenza C virus, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Hepatitis D virus, Hepatitis E virus, Rotavirus, any virus of the Norwalk virus group, enteric adenoviruses, parvovirus, Dengue fever virus, Monkey pox, Mononegavirales, Lyssavirus such as rabies virus, Lagos bat virus, Mokola virus, age virus, European bat virus 1 & 2 and Australian bat virus, Ephemerovirus, Vesiculovirus, Vesicular Stomatitis Virus (VSV), Herpesviruses such as Herpes simplex virus types 1 and 2, varicella zoster, galovirus, Epstein-Bar virus (EBV), human herpesviruses (HHV), human herpesvirus type 6 and 8, Moloney murine leukemia virus (M- MuLV), Moloney murine sarcoma virus (MoMSV), Harvey murine a virus (HaMuSV), murine mammary tumor virus ), gibbon ape ia virus (GaLV), feline leukemia virus (FLV), spumavirus, Friend murine leukemia virus, Murine Stem Cell Virus (MSCV) and Rous Sarcoma Virus (RSV), HIV (human immunodeficiency virus, including HIV type 1, and HIV type 2), visna-maedi virus (VMV) virus, the caprine arthritisencephalitis virus (CAEV), equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), bovine immune deficiency virus (BIV), and simian immunodeficiency virus (SIV), papilloma virus, murine gammaherpesvirus, Arenaviruses such as Argentine hemorrhagic fever virus, Bolivian hemorrhagic fever virus, associated hemorrhagic fever virus, Venezuelan hemorrhagic fever virus, Lassa fever virus, Machupo virus, Lymphocytic choriomeningitis virus (LCMV), Bunyaviridiae such as Crimean-Congo hagic fever virus, Hantavirus, hemorrhagic fever with renal syndrome causing virus, Rift Valley fever virus, Filoviridae (filovirus) including Ebola hemorrhagic fever and Marburg hemorrhagic fever, Flaviviridae including Kaysanur Forest e virus, Omsk hemorrhagic fever virus, Tick—bome encephalitis causing virus and Paramyxoviridae such as Hendra virus and Nipah virus, variola major and variola minor (smallpox), alphaviruses such as Venezuelan equine encephalitis virus, eastern equine encephalitis virus, western equine encephalitis virus, SARS-associated coronavirus (SARS-CoV), West Nile virus, and any encephaliltis causing virus.

] Illustrative examples of genes suitable for ring an organ transplant in a transplant ent that can be detected, identified, predicted, diagnosed, or monitored with the compositions and methods contemplated herein include, but are not limited to, one or more of the following genes: HLA-A, HLA-B, HLA—C, HLA—DR, HLA- DP, and HLA-DQ.

In particular embodiments, a bioinformatic analysis is used to quantify the number of genome equivalents analyzed in the chNA clone library, detect genetic variants in atarget c locus, detect mutations within a target c locus, detect genetic fusions within a target genetic locus; or measure copy number tions within a target genetic locus.

F. CONIPANION DIAGNOSTICS In various embodiments, a ion diagnostic for a genetic disease is provided, comprising: ing or obtaining genomic DNA from a biological sample of a subject, treating the DNA with one or more pair s to generate end-repaired DNA; attaching one or more adaptors to each end of the end-repaired DNA to generate a DNA library, amplifying the DNA library to generate a DNA clone library, determining the number of genome lents in the DNA clone library; and ming a quantitative genetic analysis of one or more biomarkers associated with the genetic disease in the DNA clone library, wherein detection of, or failure to detect, at least one of the one or more biomarkers indicates whether the subject should be treated for the genetic disease. In some embodiments, the DNA is chNA. In particular embodiments, the DNA is cellular DNA.

As used herein, the term “companion diagnostic” refers to a diagnostic test that is linked to a particular anti-cancer therapy. In a particular embodiment, the diagnostic methods comprise detection of genetic lesion in a biomarker associated with in a biological sample, thereby allowing for prompt identification of patients should or should not be treated with the anti-cancer therapy.

Anti-cancer y includes, but is not limited to surgery, radiation, chemotherapeutics, anti-cancer drugs, and immunomodulators.

Illustrative examples of anti-cancer drugs e, but are not limited to: alkylating agents such as thiotepa and cyclophosphamide (CYTOXANTM), alkyl sulfonates such as an, improsulfan and piposulfan, aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, lenephosphoramide, triethylenethiophosphaoramide and trimethylolomelamine resume; nitrogen mustards such as chlorambucil, chlomaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, ine, ranimustine; antibiotics such as aclacinomysins, actinomycin, authramycin, ine, bleomycins, cactinomycin, calicheamicin, carabicin, carminomycin, ophilin, chromomycins, dactinomycin, daunorubicin, bicin, 6-diazooxo-L-norleucine, doxorubicin and its pegylated ations, epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimeX, zinostatin, zorubicin; anti—metabolites such as methotrexate and 5-fluorouracil (5- FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as bine, azacitidine, 6—azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine, 5-FU; androgens such as erone, dromostanolone propionate, epitiostanol, ostane, testolactone; anti—adrenals such as lutethirnide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; ine; bucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; etoglucid; gallium e; hydroxyurea; lentinan; lonidamine; mitoguazone; mitoxantrone; mopidamol; nitracrine; pentostatin; phenamet; pirarubicin; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK®; razoxane; sizofiran; spirogermanium; onic acid; triaziquone; 2, 2,2”- trichlorotriethylamine; urethan; Vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside (“Ara-C”); cyclophosphamide; thiotepa; taxoids, e.g., paclitaxel (TAXOL®, Bristol-Myers Squibb Oncology, Princeton, NJ.) and doxetaxel (TAXOTERE®., Rhne—Poulenc Rorer, Antony, France); chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; stine; um; etoposide (VP-l6); ifosfamide; mitomycin C; mitoxantrone; Vincristine; vinorelbine; navelbine; novantrone; teniposide; terin; xeloda; ibandronate; CPT-ll; topoisomerase inhibitor RFS 2000; difluoromethylomithine (DMFO); retinoic acid tives such as TargretinTM (bexarotene), PanretinTM (alitretinoin); ONTAKTM (denileukin diftitox) ; esperamicins; capecitabine, and ceutically able salts, acids or derivatives of any of the above. Also included in this definition are anti-hormonal agents that act to regulate or inhibit hormone action on cancers such as anti- estrogens including for example tamoxifen, raloxifene, aromatase inhibiting 4(5)—imidazoles, 4-hydroxytamoxifen, trioxifene, ene, LY117018, onapristone, and toremifene (Fareston); and anti-androgens such as de, nilutamide, bicalutamide, leuprolide, and goserelin; and pharmaceutically acceptable salts, acids or tives of any of the above.

Illustrative examples of immunomodulators include, but are not limited to: cyclosporine, tacrolimus, tresperimus, olimus, sirolimus, mus, laflunimus, imod and imiquimod, as well as analogs, derivatives, salts, ions and complexes f.

In some embodiments, an anti-cancer drug may include a poly-ADP ribose polymerase (PARP) inhibitor. Illustrative examples of PARP inhibitors include, but are not limited to, olaparib (AZD-2281), rucaparib (AG014699 or PF-01367338, niraparib (MK-4827), talazoparib (BMN-673) rib 88), CEP 9722, E7016, BGB-290, 3- aminobenzamide.

All publications, patent applications, and issued patents cited in this specification are herein incorporated by reference as if each individual publication, patent application, or issued patent were specifically and individually indicated to be incorporated by nce. In particular, the entire contents of International PCT Publication No. WO 2016/028316 are specifically incorporated by reference.

Although the foregoing invention has been described in some detail by way of ration and example for purposes of clarity of understanding, it will be readily apparent to one of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims. The following examples are provided by way of illustration only and not by way of limitation. Those of skill in the art will y recognize a variety of noncritical parameters that could be changed or ed to yield essentially similar results.

EXAMPLES Example 1: Copy Number Analysis of Samples Containing Blends Of Fragmented c DNA Meticulous blends of fragmented genomic DNA were generated that contained DNA derived from AATM or ABRCAZ immortalized human samples spiked into a fragmented wild-type human gDNA sample. The advantage of this sample type is that the composition can be carefully controlled and sample availability is essentially unlimited.

Wild-type, human female genomic DNA was purified from whole blood s donated by a healthy volunteer. Genomic DNA isolated from an immortalized cell harboring a heterozygous deletion covering the entire ATM gene (NA095 96, AATM) and a te sample bearing a heterozygous deletion of BRCA2 18, ABRCAZ) were ed from the Coriell repository. Importantly, these samples appeared to have an otherwise normal ploidy across the remainder of the genomes. The AATM sample was d from a male donor and was therefore also hemizygous in copy number for the X- linked AR gene. Cell free DNA (chNA) was ed from healthy donor plasma samples of female or male origin. For library construction, genomic DNA was sonicated on a g of 200 bp with a Covaris instrument, then further size selected using a “two-sided” DNA bead purification. Library input DNA samples are shown in Appropriate combinations of fragmented and chNA samples were blended to defined percentages, end-repaired, and converted to genomic libraries.

Approximately 500 ng of each y was combined in sets of eight samples and hybridized to the copy number loss (CNL) prostate probe pool that ned 2304 DNA probes.

Following sample processing, each set of eight samples was sequenced on an Illumina NextSeq NGS instrument to a depth of ~480 million pass-filter reads, this corresponds to 60 million reads/sample. Roughly 95% of reads possessed legitimate sample ID tags and aligned to the human reference genome and of these, ~98% mapped to the intended target loci. The overall sequencing depth, measured as the number of reads per input genome per probe (calculated as on-target reads (60 million) divided by average genome depth (2500) and divided by probe count (2400)) was approximately 10 reads per genome per probe. A graphic entation of the copy number loss analysis is shown in Copy number perturbations are highlighted by . (Sample 1, 5% male DNA into female DNA, sample 2, 5% AATM DNA (male) into female DNA; sample 3, 5% ABRCAZ DNA (female) into female DNA; sample 4, pure female DNA).

The CNL caller identifies redundant reads and condenses these into a single sus reads that are then quantified at each probe location. This information was further sed into gene-by-gene copy number averages. Finally, a statistical significance was ed to deviations detected in each CNL measurement; this is shown graphically as the logioP-value of statistical significance. ] shows box-and—whisker plots of copy number determinations for the AR () and ATM () genes in fragmented and d c libraries. Because the AATM sample is male, the AR gene (X-linked, hemizygous) and the ATM gene both exhibited CNL or. As anticipated, the magnitude of measured copy variation was modest. The statistical analysis shown in FIG 9B demonstrates that the observed copy fluctuation was statistically significant. Moreover, very little significant fluctuation was observed in the remaining genes that were predicted to exhibit uniform copy characteristics. These values correlated well with frequencies predicted for the various genomic blends. shows that statistically significant copy fluctuation was also readily observed in samples that were primarily chNA with minor spike-ins of either chNA from the opposite sex or minor additions of fragmented gDNA. These values correlated well with frequencies predicted for the various genomic blends. The results seen with both fragmented gDNA and with cfl)NA were comparable, thereby demonstrating the integrity of the assay and suggesting that the ity will translate to al samples.

These data demonstrate the ability of the assay system to detect subtle changes in gene copy number down to minor allele frequencies of 2%. While the focus of demonstrated examples presented is on copy number loss, the technology is equally well suited to the detection of copy number gains, including increases in gene copy that occur through chromosomal arm duplications and focal amplifications. This assay further retains the ability to detect other types of genomic variants, including SNVs, indels and gene fusions osomal rearrangements). Importantly, these data demonstrate that the method can be applied to genomic DNA derived from plasma, but also to genomic DNA derived from other s such as tissue and other bodily sources.

Example 2: Copy number analysis of chNA from healthy donors and a cancer patient The following e illustrate the manner in which the molecular features added during genomic library construction and post-hybridization processing are used to generate copy number is. DNA was extracted from the plasma of sixteen healthy donors and one castration-resistant prostate cancer patient using the Qiagen Circulating Nucleic Acids tion kit (Qiagen, Hilden, Germany). The yield of double— strand DNA was quantified using a Qubit fluorometer (Thermo Fisher, Waltham, MA) and the corresponding hsDNA quantitation kit. Size analysis was performed using gel electrophoresis on 2% agarose gels with PCR markers as size standards (New England Biolabs, Ipswich, MA). Approximately 40 — 100 ng of chNA, depending on the yield of chNA from the sample, was used for library construction.

The basic features of library construction are illustrated in A — 11C. The chNA was first dephosphorylated and then repaired to blunt ends in a two-step process. Short, 10 nt anchor sequences consisting of a phosphorylated ligation strand and an inert partner strand were then d to the chNA. The eight oligonucleotides used to create the set of four anchor sequences are shown in Table l.

T—g—g—able1: Liation anchor oli onucleotides on strand oligo_16-4 /5Phos/ACC TGA TGC A** A, C, G, or T)-Q] denotes a modified base in which the hydroxyl group resides on the 2’ position of the ribose ring ** /5Phos/ s the chemical addition of a 5’ phosphate group to the 5’ base position ] The adaptor structures were completed by the addition of full-length adaptor sequences that annealed to the anchor sequence. Thirty-two sets of adaptor sequences, each composed of 240 members, are shown in — . These adaptors were attached to the chNA and extended h the concerted actions of cleotide kinase, DNA polymerase and DNA ligase to generate genomic ies. As a pre—sequencing quality control step, the resulting genomic libraries were quantified by qPCR for depth of coverage. The genomic libraries were then ed and hybridized to probe sets targeting specific genes (B). ing hybridization, primer ion of the probe was used to copy the captured genomic sequences and the information encoded in the attached adaptor (FIG. llC). An example of post sequencing analysis using standard next—generation analysis software is shown in FIG. MD. This analysis was performed on a sequencing run that contained 32 samples (28 cancer patient samples and 4 wild-type controls) and it displays the overall distribution of sequencing reads.

A central e of the targeted hybrid capture platform described herein is that it provides multiple types of genomic ation. One essential function of capture probes is to e mutation detection across target regions at a high depth of coverage. This function is governed by the sequence context, density, and placement of the capture probes and is illustrated in with the TP53 gene (TP53 probe sequences are shown in Table 2 below). Of equal significance, the targeted hybrid capture platform assay generated a readout of equal depth of coverage in regions where no significant mutations were ed. These data are al to physicians and patients as they add tical significance in cases where no deleterious mutations were detected.

Table 2: TP53 Probes TPS379 GCAGAGACCTGTGGGAAGCGAAAATTCCATGGGACTGACT 7697 TPS371 l GCAGGGGGATACGGCCAGGCATTGAAGTCTCATGGAAGCC 7699 CCATCGCTATCTGAGCAGCGCTCATGGTGGGGGCAGCGCC GCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGA TP53723 CATGGCGCGGACGCGGGTGCCGGGCGGGGGTGTGGAATCA 771 1 GAGGGCCACTGACAACCACCCTTAACCCCTCCTCCCAGAG 7713 TP53737 TCTCCCAGGACAGGCACAAACACGCACCTCAAAGCTGTTC 7725 TP53744 CCTGGAGTGAGCCCTGCTCCCCCCTGGCTCCTTCCCAGCC 7732 TP53745 TCCGAGAGCTGAATGAGGCCTTGGAACTCAAGGATGCCCA 7733 The linkage of the capture probe with captured genomic sequence (C) also facilitated ement of genomic depth at each probe location. The number of unique reads associated with every capture probe used in the experiment was measured (). The data shown in was derived from a sequencing run in which 16 healthy donor chNA samples were analyzed. The depth of unique reads encountered in each sample at one probe location in the TP53 gene were calculated (Raw unique read counts shown in A). Each sample comprised a unique library depth, as reflected in the broad sample-to-sample distribution of unique reads. The global average of unique read depth across all 2596 capture probes in the experiment was also calculated (B).

Significantly, normalization of the ed read depth at the single probe site yed in C by the global unique read depth measured for all probes revealed a uniform density of normalized unique reads. These data indicate that the capture performance of a particular probe chosen for analysis was uniform from sample-to-sample and proportional to the genomic depth of each individual library.

This same normalization function was applied to the 45 TP53-specific probes shown in (normalization data shown in ). Whereas shows the aggregate contribution of all probes to the sequencing depth of TP53 coding regions, shows the normalized depth ved by each individual probe. The ized depth retrieved by each individual probe was generally consistent from sample-to-sample for any given probe but somewhat variable when one probe was compared to another. Several factors governed the differences in the post—normalization capture depths observed between probes, the most significant being the ent of probes relative to one another and the ity of probes to c repeat regions. Not all probes exhibited uniform capture behavior; two probes whose capture mance were not consistent are ghted by arrows in .

However, these data te that such probes are rare and easily identified. As such, and they can be ed from downstream copy number analysis.

The uniform capture performance exhibited by the 45 TP53 ing probes in is a general feature of the targeted hybrid capture platform described . In , the average capture depth for each probe in a panel of 25 96 capture probes was calculated for all 16 normal chNA libraries that were profiled in this experiment. The average was then compared individually with three entative samples using scatter plot analysis. Each dot represents a ent probe and its position on the graph is a ison of the average on the x-axis and the individual sample on the y-axis. The tight diagonal distribution of the majority of probes reflected the highly-correlated unique read capture performance of most probes (R2 correlation Z 0.95 for all three graphs). Importantly, the consistency of probe—by-probe sequencing depth supports the use of the targeted hybrid capture platform in copy number measurement.

With respect to copy number, the most straightforward treatment of probe data is to further normalize the adjusted genomic depth values that occur in autosomal chromosomes to a diploid-averaged value of “”2 The same is true for probe values that occur in females for X-linked loci. For X-linked and Y-linked regions in normal males, averaged copy values are appropriately set to “1” This numerical transformation was applied to a set of chromosomal control probes (239 probes that target select loci on all 22 autosomal chromosomes, Table 3), a set of 199 probes that target the X-linked AR gene, and the 45 TP53-specif1c probes considered in detail above (A and 27B). Each dot represents the value for an individual probe. With the exception of infrequent “noisy” probes, the vast majority of individual probe counts in regions anticipated to be diploid possessed values that were imately ‘2’ Probes for the AR gene in a healthy male fluctuated with an average value close to the anticipated “.”1 Table 3: Chromosomal l Probes Chrili9 GTGAGCCTTCTCTCACCATTCTGTCCAAAATAGCAGCCCT 7742 CCCAGCGCCCGTGGCTTTGGCTCCTCAGTCCCATTTAAAT TATACCACCAAGTCTACCTACTGCCTGCACATGCTATGGC Chr7279 GGTCAATCCGGCACTACTGGTTGTCCAAAGGGAGGTTACT 7754 Chr7271 l GTGTCTCCTGGAGGTGCATGGGTGGTTTTGAACTTCATTG 7756 GTCCCTGGGACCATCTGTGCATTGTTCTTGTAACTGGAAA GACCGAATGGCGAACGCAGTGAATAGATCAGGAGGGAAAA ChI7371 GAAGGAATGGAGTGGAACAGATAGGGGTGAGGGAATAACG 7764 ChI_3_3 ATCCAGGCTTCATGTTCAAATGCAATGGCCCTTGCCCCAT 7766 Chri4i3 CATGAGTCCTTCTATGACTCCCTCTCAGACATGCAGGAAG 7778 Chr7579 GTCGGTCAGAAGGAACACCTGAGAAACCGCTTTA 7792 GGAGACAACTTAGGAGGTTATCTAGACCATTCCCGCCTTC GTGTTTCCTCCCAGCATGCACTTTGTGGCTGCCTTTCTTT Chr75714 TGGCTTGTGTAGCGTGTTTCATTTTGGAACCTTGGAGCCG 7797 Chr75716 GTTTCAGATCTTGCAATGGGAGGGATCGACTCGGCCCTTT 7799 Chri6il GAGTTTTTCTTTCAGGTAGTCTGAGATGGCCCGCACCAAG 7802 3 GGCAGATTCGATGGGACTTTAGACACTTGCTTTGCTCCCT 7804 Chri7i4 CCATGACTTATGTGCAGCTTGCGCATCCAGGGGTAGATCT 7816 Chr7876 TGGCTTTGGCGCTTTAAGGCCAGACACGGCATTAAAAAGC 7830 CCATGGTTCTGTGAGACTGGTAGAAAGCACAGACCCCTTA AATGTGCTTATCACTCGTGATGGGGTCCTGAAGCTGGCAG Chri972 AGGGTCTCATTTTAAGACAGCTTGATTTGAGGGTGAGGGG 783 5 Chri9i4 GTCTAAGGGCATCTTACCTCCAAGAACTGCTTGAGGCGTA 7837 ChI7977 AGTGTCGGAAGAAACCTACCTGCGTTTCTTAGAA 7840 ChI_9_9 TATATCTCACGTGACCGAGGATGGGTCGTGGGCATTCACA 7842 Chril 174 AAGGTATAGAGCTGGGCGGCTTTCCTCGTTATAGGTGGAG 7854 ChI71277 ACATTATATCCGGTCCAGGAATATCTGGCTCAGGCTGGGT 7868 AAAAGAAATGCGATCAGCGCAACCCATCCGGTGTGGCGCT GGCAGTGGTACCATGACATACTTAGCAGAGATGGACTACA Chr71371 ATTTCCCATGCGAGAGGTAGCTTGCCCAGGCTGTTGGATA 7873 Chr71373 TCACGGGAGCTTCCTTCACTGAGTTCTGCGAATCTGAAGC 7875 Chr71376 GTTCACTCGTCGGTTTTTCACCAACCACAGACTAGCCTCA 7878 _8 TCTCAGTGAACAGAGGGCTCACTGAGAGGACTTTGAATAC 7880 Chr71574 TTCAATCAGGTACTCCGAGTTCCCTTGGAGGCCAAAAGGA 7892 ChI71676 CTGGCATTGGTGAGTAATAGGAGCCAGACGGGTCTGTGTT 7906 GTGCTACCCTCCTCCCTTCAGGTTATGTGGTCCAGGCTTT TAAGTGGAACAACATTCCCTTCATTATAGCCCTTCGTGGG Chr71671 1 GCAACGTCAACAACTACTACGTGCACAAGCGCCTCTACTG 791 1 Chr71772 GTGGTCACCATCTCTTCAAACCATTTGGACTGGGCCTGGT 7913 ChI71775 GTTGTCATTGGGGCTATAGACATAAGCACCTTCCGGAATC 7916 Chr_17_7 GTCAGACCCTGTCCTCGTCTCCTTTACCTTGTCTCGATTT 7918 Chr71878 CTATGAGCATACTGGGGAGGGAAACCTCTAAGCGGAACTT 7930 ChI71971 1 CCTCTTAGTCCTGGGCCATACCTTAGCCTTGTGC 7944 TCTAGATGGAAGCTGTATCCAAGGATGCTCCGGAATGTTG ATCTTCTCTGCCTGCCGCACTAGCTTCTTGGTGACTTCTC Chr72075 ATCGAGTTGTCGAGCCCCATGATTCGACACCAAGATCCCA 7949 Chr72077 GTGCACTGTCAGATCTTGGAAACGGCCAAAGGATTTTTCC 795 1 Chr720710 CTCCTCCAGGAGCTGGCAGCATCAAGACCCCACTTCGCTT 7954 Chr_21_2 AAGTCTGACAGCATCTGCTTGAACTGAGGCACAGTGATGG 7956 AGACCCAGCCTACCTGCATGATCTCTTGTACAGCTTTGCA TCATGGAACATGGGCCTTGCAAAGGGGTCAAGATCACAAC Chr72275 CATTCCCCATTCTGCAGGATCCGTTCCCCTGGCA 7968 CAGAAGGATACTAGAATGGAATGTCCTGCGTGACGAAAGC CATCTGATTCTCCTATGGCTGCTAGGCTCCAGGA Significantly, when the same analysis was applied to chNA collected from the blood plasma fraction of a castration-resistant prostate cancer patient using healthy samples as normalization controls, three ent features emerged (C). First, all of the control probes exhibited noisy counting behavior. Second, the counts across all AR probes were significantly elevated from a normal value of “l” to an ed value of approximately “”5 Amplification of the AR gene is consistently observed in advanced prostate cancer ts. Third, the TP53 probe counts, while more tightly clustered, possessed an average value far closer to “1” than the expected value of “2’ This likely reflected inactivation of one or both alleles of TP53 by copy number loss in the fraction of circulating DNA derived from tumor tissue.

These data indicated that the methods of the present invention comprise three important karyotyping aspects. Namely, the methods bed herein detect generalized chromosomal aneuploidy, copy increases of specific, ed genes, and copy losses in the same specific, targeted genes. These result further indicate that the methods and platforms described herein can guide the use of precision ies, as all three of these genomic abnormalities occur frequently in .

Generalized chromosomal aneuploidy for castration-resistant te cancer patient samples (blue dots) relative to a healthy control (brown dots) was measured (). In this analysis, the approximate ploidy for all 239 control probes used in the experiment were d ing to their chromosomal targets. For some chromosomes (e.g., chromosome 1 and chromosome 22) a similar ploidy value of “2” was observed between t and control samples. In other cases, deviation between the two samples was observed. The degree of information regarding overall genomic ploidy provided by these experiments was constrained by the number and density of control probes used. However, these data indicate that a denser probe panel covering all chromosomal segments at uniform density can be used — in conjunction with the additional unique features of the t invention. Such analyses will provide a higher tion, genome-wide measurement of chromosomal copy number, These data further ght the capabilities of the present invention as a guide for precision therapy. For example, tumors that possess genomic deficiencies in homologous recombination repair often exhibit highly destabilized chromosomal es, and patients with such tumors are good candidates for inhibitors of the PARP enzyme complex (See Popova et at, Genome Biol. 0(11):R128). Unlike most sequencing assays that seek to genotype a tumor, the assays described herein use sequencing to detect destabilized chromosomal ploidy as a tumor phenotype, even if the causal mutations driving this ype remain hidden from targeted analysis.

The ability to detect gene loss in DNA shed from solid tumors is especially significant. Mutation and deletion of tumor suppressor genes is a frequent event in cancer genomes, moreover, individuals with germline loss of tumor suppressor genes are uniquely vulnerable to developing cancer later in life. The diagnostic value of a liquid biopsy copy number loss (CNL) assay is directly proportional to its sensitivity. To ine the lower limit of detection for the invention described here, the immortalized lines described in Example 1 were systematically diluted into the “genome-in—a—bottle” reference cell line, NA12878. One line had a single copy deletion (monoallelic loss) of ATM, the other a single copy deletion of BRCA2. The experiment included four control samples of pure NA12878 and eight spike-in samples containing 16% of each lelic deletion line (). For reporting purposes, this corresponds to an 8% minor allele frequency of biallelic loss. ed values for all probes targeting specific genes and two additional, undeleted control genes are shown in . Copy loss of ATM and BRCA2 was confined to spike-in s only. Additional computational treatment of the data revealed confident copy loss calling of biallelic deletions down to 2% minor allele ncies. This sensitivity indicated that the present invention required no specialized considerations in order to routinely include copy loss calls in standard blood-based genotyping assays.

These data demonstrate the use of probe-specific genomic capture data for the analysis of copy number, including both copy number gain and copy number loss of target genomic loci. Additionally, the invention described herein has been shown to possess the sensitive ability to detect single nucleotide variants, insertions and deletions ranging from single nucleotides to many thousands of base pairs, and gene fusions resulting from chromosomal rearrangement by aberrant mutational processes (See PCT Publication No. WO 2016/028316, and US. Patent Publication No. 2014-0274731). All of these mutational processes can contribute to the ormation of normal tissue to stic cancers, and as precision ies continue to emerge, accurate diagnosis of these ed genomic signatures will become an increasingly indispensable feature of precision medicine.

Claims (21)

1. A kit comprising a set of adaptors, wherein each adaptor of the set of rs comprises a sample tag region selected from a pool of unique sample tag regions, wherein the pool is selected from a plurality of pools, and wherein the selected pool is unique to a test sample; wherein the test sample comprises a plurality of DNA fragments.

2. The kit of claim 1, wherein each adaptor of the set of adaptors is a DNA polynucleotide that comprises (i) an amplification region, (ii) a sample tag ; and (iii) an anchor region.

3. The kit of claim 2, wherein the amplification region comprises a polynucleotide sequence e of serving as a primer recognition site for PCR amplification.

4. The kit of claim 2 or claim 3, wherein the amplification region is about 10 to about 50 nucleotides in length, about 20 to about 30 nucleotides in length or n the amplification region is about 25 nucleotides in length.

5. The kit of any one of claims 2-4, wherein the sample tag region identifies the test sample.

6. The kit of any one of claims 2-5, wherein the sample tag region identifies a DNA fragment attached thereto.

7. The kit of any one of claims 2-6, wherein the sample tag region is about 5 to about 50 nucleotides in length, about 5 to about 15 nucleotides in length or wherein the sample tag region is about 8 nucleotides in length.

8. The kit of any one of claims 2-7, wherein the amplification region of each adaptor of the set of adaptors is identical to the amplification region of every other adaptor of the set of adaptors.

9. The kit of any one of claims 2-8, wherein the anchor region comprises a polynucleotide sequence that is capable of attaching to a DNA nt.

10. The kit of any one of claims 2-9, wherein the anchor region is about 1 to about 50 nucleotides in length, about 5 to about 25 nucleotides in length or wherein the anchor region is about 10 nucleotides in length.

11. The kit of any one of any one of claims 1-10, wherein each adaptor of the set of adaptors is ured to attach to a DNA nt of the plurality of DNA fragments to generate a DNA library comprising at least two unique sample tag regions, wherein each of the DNA library fragments comprises a DNA nt attached to an adaptor.

12. The kit of any one of claims 1-11, wherein the test sample is a tissue biopsy, optionally wherein the tissue biopsy is taken from a tumor or a tissue suspected of being a tumor.

13. The kit of any one of claims 1-12, wherein the DNA fragments are cell-free DNA (cfDNA) or cellular DNA, optionally wherein the cfDNA is isolated from the test sample; and wherein the test sample is a biological sample selected from the group consisting of: amniotic fluid, blood, plasma, serum, semen, lymphatic fluid, cerebral spinal fluid, ocular fluid, urine, saliva, stool, mucous, and sweat.

14. The kit of any one of claims 2-10, wherein each adaptor of the set of adaptors further comprises a unique molecule identifier multiplier (UMI multiplier) that is adjacent to or contained within the sample tag region, optionally wherein the UMI multiplier is about 1 to about 5 nucleotides in length or wherein the UMI multiplier is about 3 nucleotides in length.

15. The kit of claim 14, wherein the UMI multiplier increases the number of unique sequences for identifying the plurality of DNA fragments.

16. The kit of any one of claims 1-15, wherein each sample tag region of the pool of sample tag regions comprises one of 2 to 1,000 unique nucleotide sequences, one of 50 to 500 unique nucleotide sequences, one of 100 to 400 unique nucleotide ces, one of 200 to 300 unique nucleotide ces, or wherein each sample tag region of the pool of sample tag regions comprises one of 240 unique nucleotide sequences.

17. The kit of claim 16, n each ce of the unique tide sequences is discrete from any other sequence by a Hamming distance of at least two.

18. The kit of any one of claims 1-17, r comprising one or more capture probe modules.

19. The kit of claim 18, wherein each capture probe module comprises a tail sequence and a e probe sequence e of hybridizing to a target sequence in the test sample.

20. A DNA library, wherein the DNA library comprises a plurality of DNA library fragments, wherein each of the DNA library fragments ses an r module and a DNA fragment, n the adaptor module is a DNA polynucleotide comprising (i) an ication region, (ii) a sample tag region, and (iii) an anchor region; wherein the amplification region comprises a polynucleotide sequence capable of serving as a primer recognition site for PCR ication; wherein the sample tag region identifies the test sample; and wherein the anchor region comprises a polynucleotide sequence that is capable of attaching to a DNA fragment.

21. A set of adaptors, wherein each adaptor of the set of rs comprises a sample tag region selected from a pool of unique sample tag regions, wherein the pool is selected from a plurality of pools, and wherein the selected pool is unique to a test sample; wherein each adaptor in said set of adapters is a DNA polynucleotide that comprises: an ication region, a sample tag , and an anchor region; wherein the amplification region comprises a polynucleotide sequence capable of serving as a primer recognition site for PCR amplification; wherein the sample tag region identifies the test sample; and wherein the anchor region comprises a polynucleotide sequence that is capable of attaching to a DNA fragment.