NZ785186A - Methods of treatment for cholestatic and fibrotic diseases - Google Patents

Abstract

The present invention relates to the compound [2-[(5-nitro-1,3-thiazol-2- yl)carbamoyl]phenyl]ethanoate (Nitazoxanide) or 2-hydroxy-N-(5-nitro-2-thiazolyl)benzamide (Tizoxanide) for treating cholestatic and fibrotic diseases.

Description

S OF TREATMENT FOR TATIC AND FIBROTIC DISEASES TECHNICAL FIELD The present invention relates to the field of medicine, in particular to the treatment of cholestatic or fibrotic diseases.

BACKGROUND al and exaggerated deposition of extracellular matrix is the hallmark of all fibrotic diseases, ing liver, pulmonary, kidney or cardiac fibrosis. The spectrum of affected , the progressive nature of the fibrotic process, the large number of affected persons, and the absence of effective treatment pose an enormous challenge when treating fibrotic diseases.

In an attempt to propose new therapeutic gies for the treatment of fibrotic diseases, the inventors found that the compound 2-[(5-nitro-1,3-thiazol yl)carbamoyl]phenyl]ethanoate (Nitazoxanide or NTZ), a synthetic antiprotozoal agent, also shows potent antifibrotic properties. Moreover, the evaluation of NTZ in a liver injury model revealed its capacity to reduce circulating bile acid concentration, thus reflecting its potential to treat both cholestatic (such as PBC and PSC) and fibrotic diseases.

NTZ, first described in 1975 gnol and Cavier, 1975), was shown to be highly ive against anaerobic protozoa, ths, and a wide spectrum of es including both anaerobic and aerobic bacteria (Rossignol and Maisonneuve, 1984; Dubreuil, Houcke et al., 1996; Megraudd, Occhialini et al., 1998; Fox and Saravolatz, 2005; Pankuch and Appelbaum, 2006; Finegold, Molitoris et al., 2009). It was first studied in humans for the treatment of intestinal cestodes (Rossignol and neuve, 1984) and it is now licensed in the United States (Alinia®, Romark laboratories) for the treatment of diarrhea caused by the protozoan parasites Crystosporidium parvum and Giardia intestina/is. NTZ has also been widely commercialized in Latin America and in India where it is indicated for treating a broad spectrum of inal parasitic infections (Hemphill, Mueller et al., 2006). The proposed ism of action by which NTZ exerts its antiparasitic activity is through the inhibition of pyruvate:ferredoxin oxidoreductase (PFOR) enzyme-dependent electron transfer reactions that are essential for anaerobic metabolism (Hoffman, Sisson et al., 2007). NTZ also exhibits ty against Mycobacterium tuberculosis, which does not possess a homolog of PFOR, thus suggesting an alternative mechanism of action. Indeed, it was shown that NTZ can also act as an uncoupler disrupting membrane potential and intra-organism pH homeostasis (de Carvalho, Darby et al., 2011).

The pharmacological effects of NTZ are not restricted to its antiparasitic activities and in recent years, several studies revealed that NTZ can also confer antiviral activity (Di Santo and an, 2014; Rossignol, 2014). NTZ interferes with the viral replication by diverse ways ing a blockade in the tion of hemagglutinin (influenza) or VP7 irus) proteins, or the activation of the protein PKR involved in the innate immune response (for a review, see (Rossignol, . NTZ was also shown to have broad anticancer properties by interfering with crucial metabolic and prodeath signaling pathways (Di Santo and Ehrisman, 2014) In this invention, using a phenotypic screening assay to identify potential antifibrotic agents, it was discovered that NTZ or its active metabolite Tizoxanide (or TZ) interferes with the activation of hepatic stellate cells (HSC), which play a key role in the development of hepatic fibrosis. This effect was y unexpected in view of the properties previously reported for these molecules. Moreover, NTZ and T2 were shown to interfere with the tion of stimulated fibroblasts derived from other organs such as heart, lung and intestines. The antifibrotic properties of NTZ was further confirmed in a preclinical model of liver disease (CDAAc diet-induced NASH) by showing significant reduced levels of hepatic collagen and fibrosis. In addition to its antifibrotic activity, NTZ was also shown to reduce circulating bile acid concentration in a CCl4-induced liver injury model. NTZ and TZ thus appear as nds of st for the treatment of cholestatic diseases and diverse types of fibrotic diseases.

SUMMARY OF INVENTION The present invention relates to compound [2-[(5-nitro-1,3-thiazol bamoyl]phenyl]ethanoate (Nitazoxanide) or its active metabolites 2-hydroxy-N-(5-nitro- 2-thiazolyl)benzamide (Tizoxanide), or Tizoxanide glucuronide (TZG), or a pharmaceutically acceptable salt thereof, for use in a method for the treatment of a cholestatic or fibrotic disease.

In a ular embodiment, the ic disorder is selected in the group consisting of liver, gut, kidney, skin, epidermis, endodermis, muscle, tendon, cartilage, heart, pancreas, lung, uterus, nervous system, testis, penis, ovary, adrenal gland, artery, vein, colon, intestine (e.g. small intestine), biliary tract, soft tissue (e.g. tinum or eritoneum), bone marrow, joint, eye and stomach fibrosis. In a further particular embodiment, the fibrotic disorder is selected in the group ting of liver, kidney, skin, epidermis, endodermis, muscle, tendon, cartilage, heart, pancreas, lung, uterus, nervous system, testis, ovary, adrenal gland, artery, vein, colon, intestine (e.g. small intestine), biliary tract, soft tissue (e.g. mediastinum or retroperitoneum), bone marrow, joint and stomach fibrosis. In a further particular embodiment, the fibrotic disorder is selected in the group consisting of liver, gut, lung, heart, kidney, muscle, skin, soft tissue, bone marrow, intestinal, and joint is. In yet r embodiment the fibrotic disorder is selected in the group consisting of non-alcoholic steatohepatitis (NASH), pulmonary fibrosis, thic ary fibrosis, skin fibrosis, eye fibrosis (such as capsular fibrosis), endomyocardial fibrosis, mediastinal is, myelofibrosis, retroperitoneal fibrosis, progressive massive fibrosis (a complication of coal workers' pneumoconiosis), proliferative fibrosis, neoplastic fibrosis, lung fibrosis consecutive to chronic inflammatory ainNay disease (COPD, asthma, emphysema, smoker’s |ung,tubercu|osis), l or drug-induced liver fibrosis, liver cirrhosis, ion-induced liver fibrosis, radiation or chemotherapeutic-induced fibrosis, nephrogenic systemic fibrosis, Crohn's disease, ulcerative colitis, keloid, old myocardial infarction, scleroderma/systemic sclerosis, fibrosis, some forms of adhesive capsulitis, chronic fibrosing cholangiopathies such as Primary Sclerosing Cholangitis (PSC), Primary Biliary Cholangitis (PBC), biliary atresia, familial intrahepatic cholestasis type 3 (PFICB), peri-implantational fibrosis and asbestosis. ing to a ular embodiment of the invention, the cholestestatic disease is selected in the group consisting of primary biliary cholangitis (PBC), primary sclerosing cholangitis (PSC), lntrahepatic Cholestasis of Pregnancy, Progressive Familial lntrahepatic Cholestasis, Biliary atresia, Cholelithiasis, Infectious Cholangitis, Cholangitis associated with hans cell histiocytosis, Alagille me, Nonsyndromic ductal y, Drug-induced tasis, and Total parenteral nutrition-associated cholestasis. In a particular embodiment, the cholestatic disease is PBC.

According to another aspect, the ion relates to a pharmaceutical composition comprising a compound selected from NTZ or TZ(G), or a pharmaceutically acceptable salt of NTZ or TZ(G), for use in a method for treating a cholestatic or fibrotic disorder, wherein said compound(s) ) the only active ingredient(s) in the composition.

According to another aspect, the invention relates to the compound or the ceutical composition as defined above, for use in the treatment of a fibrotic disorder in combination with at least one eutically active agent with known antifibrotic activity selected from pirfenidone or receptor tyrosine kinase inhibitors (RTKls) such as Nintedanib, Sorafenib and other RTKls, or angiotensin II (AT1) receptor blockers, or CTGF inhibitor, or any antifibrotic compound susceptible to interfere with the TGFB- and BMP-activated pathways including tors of the latent TGFB x such as MMP2, MMP9, THBS1 or cell-surface integrins, TGFB receptors type | (TGFBRI) or type II (TGFBRII) and their ligands such as TGFB, Activin, inhibin, Nodal, anti-Miillerian hormone, GDFs or BMPs, auxiliary co-receptors (also known as type III receptors), or components of the SMAD-dependent canonical pathway including regulatory or inhibitory SMAD proteins, or members of the SMAD- independent or non-canonical pathways including various branches of MAPK signaling, TAK1, Rho-like GTPase signaling pathways, phosphatidylinositol-3 kinase/AKT pathways, TGFB-induced EMT process, or canonical and non-canonical og signaling pathways including Hh ligands or target genes, or any members of the WNT, or Notch pathways which are susceptible to nce TGFB signaling.

The invention r relates to the compound or pharmaceutical composition as defined above, for use in combination with at least one eutically active agent selected from JAK/STAT inhibitors, other anti-inflammatory agents and/or immunosuppressant agents.

According to a particular embodiment, the therapeutically active agent is selected from glucocorticoids, NSAIDS, cyclophosphamide, nitrosoureas, folic acid analogs, purine analogs, pyrimidine analogs, rexate, azathioprine, mercaptopurine, ciclosporin, in, tacrolimus, sirolimus, mycophenolic acid derivatives, fingolimod and other sphingosinephosphate receptor modulators, monoclonal and/or polyclonal antibodies against such s as lammatory cytokines and proinflammatory cytokine receptors, T-cell receptor, integrins.

The invention further relates to a pharmaceutical composition comprising - NTZ or a pharmaceutically acceptable salt of NTZ; and - TZ(G), or a ceutically acceptable salt of TZ(G).

The invention also relates to a kit-of-parts comprising: - NTZ or a pharmaceutically acceptable salt of NTZ; and - TZ(G) or a pharmaceutically able salt of TZ(G).

According to a particular embodiment, in each aspects and ments described herein, NTZ or T2, or a pharmaceutically acceptable salt of NTZ or T2 is used.

DESCRIPTION OF THE FIGURES AND TABLES Abbreviations used in the figuresI in the tablesI and in the text: a-SMA: alpha Smooth Muscle Actin BMP: Bone Morphogenetic Protein cDNA: Complementary Deoxyribonucleotide Acid COL1A1: Collagen, type 1, Alpha 1 CDAA: Choline-Deficient L-Amino efined diet CDAAc: Choline-Deficient L-Amino efined diet supplemented with cholesterol CHOL: cholesterol CSAA: Choline mented L-Amino Acid-defined diet CYPA: Cyclophilin A DDC: 3,5-diethoxycarbonyI-1,4-dihydrocollidine DMSO: Dimethyl sulfoxide ELISA: Enzyme-Linked lmmunosorbent Assay EMT: Epithelial-mesenchymal transition DTT: Dithiothreitol FBS: Fetal Bovine Serum FDA: Food and Drug Administration GDF: Growth Differentiation s Hh: Hedgehog hHSC: Human Hepatic te Cells HSC: Hepatic Stellate Cells IC5o: Half maximal Inhibitory Concentration lnMyoFib: Intestinal Myofibroblasts MMP2: Matrix Metallopeptidase 2 MMP9: Matrix Metallopeptidase 9 pl: microliter NHLF: Normal Human Lung Fibroblasts NTZ: Nitazoxanide PBC: Primary Biliary Cholangitis PBS: Phosphate Buffer Saline PSC : Primary Sclerosing Cholangitis qPCR: Quantitative Polymerase Chain Reaction pMol: picomoles thGF : recombinant human basic Fibroblast Growth Factor RNA: Ribonucleic Acid WO 78172 RT: Reverse Transcriptase SmBM: Smooth Muscle cell Basal Medium : Stellate Cell Growth Supplement STeCM: Stellate Cell Medium TBA: Total Bile Acids TGFB1: Tumor Growth Factor beta 1 TGFBRI: TGFb type I receptor TGFBRII: TGFb type II receptor THBS1: Thrombospondine 1 TMB: Tetramethylbenzidine TZ: Tizoxanide TZG: Tizoxanide glucuronide TZ(G): T2 or TZG Fi ure 1. Nitazoxanide and its metabolite Tizoxanide inhibit TGF 1-induced ex ression of d- SMA protein in human HSC Serum-deprived HSC were preincubated for 1 hour with NTZ (A) or T2 (B) before the activation with the profibrogenic cytokine TGFB1 l). After 48 hours of incubation, the expression of d-SMA was measured by ELISA. The obtained values were transformed into percentage inhibition over TGFB1 control. Data are presented as mean (triplicates) i standard ion (SD). Statistical analyses were performed by one-way ANOVA followed by Bonferroni post-hoc tests, using Sigma Plot 11.0 software. [*: p<0.05; **: p<0.01; ***: p<0.001 (comparison versus TGFB1 1ng/mL group)]. The curve fitting and the calculation of half maximal inhibitory concentration (leo) were performed with XLFit software 5.3.1.3.

Figure 2. Nitazoxanide and its metabolite nide reduce COL1A1 transcripts in TGFE1- induced human HSC Serum-deprived HSC were ubated for 1 hour with NTZ (A) or T2 (B) before the activation with TGFB1 (1ng/ml). After 24 hours of incubation, the expression of COL1A1 was measured by RT-qPCR. Expression values were transformed into fold induction over TGFB1 control. Data are presented as mean (triplicates) i standard deviation (SD). Statistical es were performed by one-way ANOVA followed by Bonferroni oc tests, using Sigma Plot 11.0 software. [*: p<0.05; **: p<0.01; ***: p<0.001 (comparison versus TGFB1 1ng/mL ].

Fi ure 3: NTZ A or T2 B inhibit TFG 1-induced ex ression of o-SMA rotein in rat HSCs.

NTZ (A) or T2 (B) were added to deprived rat HSC (rHSC) 1 hour before the activation with TGFB1 (3ng/ml). After 48 hours of incubation, the expression of d-SMA was measured by ELISA. The obtained values were transformed into tage inhibition over TGFB1 control. Data are presented as mean (triplicates) i standard ion (SD).

Statistical analyses were performed by one-way ANOVA followed by Bonferroni post-hoc tests, using Sigma Plot 11.0 software. [*: p<0.05; **: p<0.01; ***: p<0.001 (comparison versus TGFB1 3ng/mL group)].

Fi ure 4: NTZ A or T2 B t TFG 1-induced ex ression of o-SMA rotein in human lung fibroblasts.

NTZ (A) or T2 (B) was added to deprived lung lasts (NHLF) 1 hour before the activation with TGFB1 (1ng/ml). After 48 hours of incubation, the expression of d-SMA was measured by ELISA. The obtained values were transformed into percentage inhibition over TGFB1 control. Data are presented as mean (triplicates) i standard ion (SD).

Statistical analyses were performed by one-way ANOVA followed by Bonferroni post-hoc tests, using Sigma Plot 11.0 software. [*: p<0.05; **: p<0.01; ***: p<0.001 (comparison versus TGFB1 1ng/mL group)].

Fi ure 5: NTZ A or T2 B inhibit TFG 1-induced ex ression of o-SMA rotein in human cardiac fibroblasts.

NTZ (A) or T2 (B) were added to serum-deprived cardiac fibroblasts (NHCF) 1 hour before the activation with TGFB1 (3ng/ml). After 48 hours of incubation, the expression of o-SMA was measured by ELISA. The obtained values were transformed into percentage inhibition over TGFB1 l. Data are presented as mean (triplicates) i standard ion (SD).

Statistical analyses were performed by one-way ANOVA followed by Bonferroni oc tests, using Sigma Plot 11.0 re. [*: p<0.05; **: p<0.01; ***: p<0.001 (comparison versus TGFB1 3ng/mL group)].

Fi ure 6: NTZ A or T2 B inhibit TFG 1-induced ex ression of o-SMA rotein in human inal fibroblasts.

NTZ (A) or T2 (B) were added to serum-deprived intestinal fibroblasts (lnMyoFib) 1 hour before the activation with TGFB1 (3ng/ml). After 48 hours of incubation, the expression of or- SMA was measured by ELISA. The obtained values were transformed into percentage inhibition over TGFB1 control. Data are presented as mean (triplicates) i standard deviation (SD). Statistical analyses were performed by one-way ANOVA followed by Bonferroni post- hoc tests, using Sigma Plot 11.0 re. [*: p<0.05; **: p<0.01; ***: p<0.001 rison versus TGFB1 3ng/mL group)].

Fi ure 7: The chronic oral stration of Nitazoxanide 10m /k /da revents the CDAA- induced collagen storage in the liver of C57Bl/6J mice. 6 week-old C5YBL/6 mice were fed a control (CSAA) diet, CDAA + 1% CHOL (CDAAc) diet, or CDAAc diet supplemented with NTZ 10 mg/kg/day for 12 weeks. After the sacrifice, the hepatic collagen content was ined. Data are presented as mean i standard deviation (SD). Statistical analyses were performed by a student t-test using Sigma Plot 11.0 software.: CSAA vs CDAAc (#: p<0.05; ##: p<0.01; ##: p<0.001) and CDAAc vs NTZ 10 mg/kg/day (*: p<0.05; **: p<0.01; ***: p<0.001).

Fi ure 8: The chronic oral administration of Nitazoxanide 10m /k /da revents the CDAAc diet-induced fibrosis in the liver of C57Bl/6J mice. 6 week-old C5YBL/6 mice were fed a control (CSAA) diet, CDAAc diet, or CDAAc diet supplemented with NTZ 10 mg/kg/day for 12 weeks. After the sacrifice, the hepatic fibrosis area was determined.Data are presented as mean i standard deviation (SD). tical es were performed by a student t-test using Sigma Plot 11.0 software: CSAA vs CDAAc (#: p<0.05; ##: p<0.01; ##li: p<0.001) and CDAAc vs NTZ 10 mg/kg/day (*: p<0.05; **: p<0.01; ***: p<0.001).

Figure 9: The chronic oral administration of Nitazoxanide prevents CCI4-induced levels of circulating TBA tration. 250-275g rats were intraperitoneally ed with olive oil (ctrl group) or with CCI4 emulsified in olive oil (CCI4:olive oil 1:2 v/v, final CCI4 concentration : 2m|/kg) twice weekly for 3 weeks.

Concomitantly, the olive oil ed group was placed on control diet while the CCI4 ed groups were placed on control diet or diet supplemented with NTZ 10 mg/kg/day or 30 mg/kg/day. After the sacrifice, circulating TBA concentration was determined. Data are presented as mean i standard deviation (SD). Statistical analyses were performed by a student t-test. using Sigma Plot 11.0 software: Olive Oil vs CCI4 (#: p<0.05; ##: ; ##li: p<0.001) and CCI4 vs NTZ (*: p<0.05; **: p<0.01; ***: p<0.001).

DETAILED DESCRIPTION OF THE INVENTION In the experimental part of the present application, it is shown that nds [2-[(5- nitro-1,3-thiazolyl)carbamoyl]phenyl]ethanoate (Nitazoxanide) and 2-hydroxy-N-(5-nitro thiazolyl)benzamide (Tizoxanide) have ibrotic properties in several models of fibrosis.

Moreover, it is shown that NTZ, or its active lite TZ, have the capacity to prevent the nce of altered levels of circulating bile acids in a model of liver injury, g the y of NTZ and TZ to treat cholestatic diseases. Accordingly, the present invention relates to novel therapeutic uses of compound NTZ or of an active metabolite thereof such as T2 or In particular, the present ion relates to the compound NTZ or TZ(G), or a ceutically able salt of NTZ or TZ(G), for use in a method for the treatment of a cholestatic or fibrotic disorder. The invention relates also to a pharmaceutical composition comprising NTZ or TZ(G), or a pharmaceutically acceptable salt thereof, for use in a method for the treatment of a cholestatic or fibrotic disorder. rmore, the invention s to the use of NTZ or TZ(G), or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament useful for the treatment of a cholestatic or fibrotic disorder. The invention also relates to a pharmaceutical composition comprising NTZ or TZ(G), or a pharmaceutically acceptable salt thereof. The pharmaceutical composition according to the invention is useful for treating a cholestatic or fibrotic disorder.

Although the causative agents or initiating events of fibrotic disorders are quite diverse and their pathogenesis is variable, a common feature in ed tissues is the presence of large numbers of activated fibroblasts called myofibroblasts ((Rosenbloom, Mendoza et al., 2013)). Fibrotic stimulus such as TGFB] can induce differentiation of fibroblasts to myofibroblasts (Leask and Abraham, 2004; Leask, 2007). Myofibroblasts are metabolically and morphologically distinctive fibroblasts whose activation and proliferation play a key role in development of the fibrotic response. Furthermore, these myofibroblasts display unique biological functions including expression of proteins involved in extracellular matrix formation such as different forms of collagen, fibronectin and other ECM proteins. The induction of or- smooth muscle actin (q-SMA) expression is a recognized hallmark of quiescent fibroblast to activated myofibroblast differentiation and can be used as a physiological read-out to evaluate the potency of the drugs that interfere with the fibrotic process. Tumor Growth [3 factors, and especially the Tumor Growth Factor beta 1 ) are recognized physiological signals that induce the ypic transformation of fibroblasts into rotic roblasts that express high levels of q-SMA and high levels of extracellular matrix proteins, which are then secreted and form the fibrotic scar tissue.

Moreover, it is known that the proliferation and the activation of fibroblasts is responsible for the production of several connective tissue components (for example, collagens, elastin, glycans, and hyaluronan) that constitute the extracellular matrix (Kendall and Feghali-Bostwick, 2014).

Unexpectedly, NTZ but also its active metabolite TZ, reveal antifibrotic properties since these compounds dose-dependently reduced the level of a—SMA in TGFB-induced hepatic stellate cells and in primary lasts from other organs. Furthermore, treatment with NTZ or T2 also repressed collagen 1) expression in TGFB activated rat HSC, which confirms antifibrotic properties of both molecules. The antifibrotic activity of NTZ, or its metabolite T2 was also trated in vivo using a model of CDAAc-induced liver fibrosis, in which reduced hepatic collagen content and diminished fibrosis area were exemplified. er, in the CCl4-induced liver injury model, it was shown that NTZ, or its active metabolite TZ, could prevent the induction of circulating bile acid , which represent a marker of cholestatic diseases.

NTZ, T2 and TZG to be used according to the invention have the following Formula (I), (II) and (Ill) respectively: HN% | 0 S N02 (ll) HN | 0 S HOOC OH HO OH (m) NTZ and T2 were known for their rasitic and antiviral activities, but the prior art does not teach that NTZ, T2 and TZG have anticholestatic and anti-fibrotic effects.

The ors have demonstrated in a new and inventive way that these compounds have a therapeutic effect in the treatment of tasis or fibrosis.

Accordingly, the invention s to compound NTZ or TZ(G), or a pharmaceutically acceptable salt of NTZ or TZ(G), for use in a method for the ent of a cho|estatic or fibrotic disorder.

In a further aspect, the ion relates to NTZ or TZ(G), or a pharmaceutically acceptable salt of NTZ or TZ(G), for use in the inhibition of proliferation and/or activation of fibroblasts. As is known in the art, fibroblasts are sible for the production of collagen fibers or other tive tissue components of the ellular matrix.

According to the present invention, the terms "fibrosis", "fibrotic disease", "fibrotic disorder" and declinations thereof denote a pathological condition of excessive deposition of fibrous connective tissue in an organ or tissue. More specifically, fibrosis is a pathological process, which includes a persistent fibrotic scar formation and overproduction of extracellular matrix by the connective tissue, as a response to tissue damage.

Physiologically, the deposit of connective tissue can obliterate the architecture and function of the underlying organ or tissue.

According to the present invention, the fibrosis or fibrotic disorder may be associated with any organ or tissue fibrosis. Illustrative, miting examples of particular organ fibrosis include liver, gut, kidney, skin, epidermis, rmis, muscle, tendon, cartilage, heart, pancreas, lung, uterus, nervous system, testis, penis, ovary, adrenal gland, artery, vein, colon, intestine (e.g. small intestine), biliary tract, soft tissue (e.g. mediastinum or retroperitoneum), bone marrow, joint or stomach fibrosis., in ular liver, kidney, skin, epidermis, endodermis, muscle, tendon, cartilage, heart, pancreas, lung, uterus, nervous system, testis, ovary, adrenal gland, artery, vein, colon, intestine (e.g. small intestine), biliary tract, soft tissue (e.g. mediastinum or retroperitoneum), bone marrow, joint or stomach fibrosis.

According to the present invention, the terms "cholestasis" or "cholestatic disease",or "cholestatic disorder" and ations thereof denote a pathological condition defined by a decrease in bile flow due to ed ion by hepatocytes or to obstruction of bile flow through intra-or extrahepatic bile ducts. Therefore, the clinical definition of cholestasis is any condition in which substances normally excreted into bile are retained.

In a particular embodiment, the ic er is selected in the group consisting of a liver, gut, lung, heart, kidney, muscle, skin, soft tissue (e.g. mediastinum or retroperitoneum), bone marrow, intestinal, and joint (e.g. knee, shoulder or otherjoints) fibrosis.

In a preferred embodiment, the ic disorder is selected in the group consisting of liver, lung, skin, kidney and intestinal fibrosis.

In a more preferred embodiment of the present invention, treated fibrotic disorder is selected in the group ting of the following non exhaustive list of fibrotic disorders: non- alcoholic steatohepatitis (NASH), pulmonary fibrosis, idiopathic pulmonary is, skin fibrosis, eye is, endomyocardial fibrosis, mediastinal fibrosis, myelofibrosis, retroperitoneal fibrosis, progressive massive fibrosis (a complication of coal workers' pneumoconiosis), proliferative fibrosis, neoplastic fibrosis, lung is consecutive to chronic matory ainNay e (COPD, asthma, emphysema, smoker’s lung, tuberculosis), alcohol or drug-induced liver fibrosis, liver cirrhosis, infection-induced liver fibrosis, radiation or chemotherapeutic-induced fibrosis, nephrogenic systemic is, Crohn's disease, ulcerative colitis, keloi'd, old myocardial infarction, scleroderma/systemic sclerosis, arthrofibrosis, some forms of adhesive capsulitis, chronic fibrosing cholangiopathies such as y Sclerosing gitis (PSC) and Primary y Cholangitis (PBC), biliary atresia, al intrahepatic cholestasis type 3 (PFIC3), periimplantational fibrosis and asbestosis.

According to a ular embodiment of the invention, the cholestestatic disease is selected in the group consisting of primary y cholangitis (PBC), primary sclerosing cholangitis (PSC), lntrahepatic Cholestasis of Pregnancy, Progressive Familial lntrahepatic Cholestasis, Biliary atresia, Cholelithiasis, Infectious Cholangitis, Cholangitis associated with Langerhans cell histiocytosis, Alagille syndrome, Nonsyndromic ductal paucity, Drug-induced cholestasis, and Total parenteral nutrition-associated cholestasis. In a preferred embodiment, the cholestatic e is PBC or PSC, in particular PBC.

The term "treatment" or "treating" refers to the curative or preventive treatment of a cholestatic or fibrotic disorder in a subject in need thereof. The treatment involves the administration of the compound, in particular sed in a pharmaceutical composition, to a subject having a declared disorder, i.e. to a patient, to cure, delay, reverse, or slow down the progression of the disorder, improving thereby the condition of the subject. A treatment may also be administered to a subject that is healthy or at risk of ping a cholestatic or fibrotic disorder to prevent or delay the disorder.

Therefore, according to the invention, the treatment of a fibrotic disorder involves the administration of NTZ or TZ(G), or of a pharmaceutically acceptable salt thereof, or of a pharmaceutical composition containing the same, to a subject having a ed disorder to cure, delay, reverse or slow down the ssion of the disorder, thus improving the condition of the patient or to a healthy subject, in particular a subject who is at risk of ping a cholestatic or fibrotic disorder.

The subject to be treated is a mammal, ably a human. The subject to be treated ing to the invention can be selected on the basis of several ia associated with cholestatic or fibrotic es such as us drug treatments, associated pathologies, genotype, exposure to risk factors, viral infection, as well as on the basis of the detection of any nt biomarker that can be evaluated by means of imaging methods and immunological, biochemical, tic, chemical, or nucleic acid detection s.

Synthesis of NTZ or T2 can be for example carried out as described by Rossignol and Cavier, 1975, or by any other way of synthesis known by a person skilled in the art. TZG can be, for example, synthesized according to way of synthesis known in the art such as in Wadouachi 2011. S'agit—il de A Wadouachi, J Kovensky, Synthesis of Glycosides of onic, uronic and Mannuronic Acids: An Overview, Molecules, 2011, 16(5), 3933- 3968.

In a particular embodiment, the treatment of a cholestatic or fibrotic disorder may comprise the administration of a combination of both NTZ and TZ(G), or of a pharmaceutically acceptable salt of NTZ and TZ(G). According to a variant of this embodiment, both NTZ and TZ(G) are comprised together in a single composition.

In another variant of this embodiment, NTZ and TZ(G) are for simultaneous, tial or te administration in therapy, therefore being possibly included in different compositions. In case of sequential administration, NTZ may be administered prior to the administration of TZ(G), or TZ(G) may be administered prior to NTZ administration. As such, the invention also relates to a kit-of-parts comprising (i) NTZ or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising NTZ or a pharmaceutically acceptable salt thereof; and (ii) TZ(G) or a pharmaceutically acceptable salt f, or a pharmaceutical composition comprising TZ(G) or a pharmaceutically able salt thereof, for simultaneous, sequential or separate administration.

NTZ or TZ(G) can be formulated as pharmaceutically acceptable salts particularly acid or base salts compatible with pharmaceutical use. Salts of NTZ and TZ(G) include pharmaceutically acceptable acid addition salts, pharmaceutically acceptable base addition salts, pharmaceutically acceptable metal salts, ammonium and alkylated ammonium salts.

These salts can be obtained during the final purification step of the compound or by incorporating the salt into the previously purified compound.

In a another aspect, the present invention concerns a pharmaceutical composition comprising a compound selected from NTZ or TZ(G), or a pharmaceutically acceptable salt of NTZ or TZ(G), for use in a method of treatment of a cholestatic or fibrotic disease.

The pharmaceutical composition comprising NTZ or TZ(G), in particular for use in a method for the ent of a cholestatic or fibrotic disorder, can also se one or several pharmaceutically acceptable ents or vehicles (e.g. saline solutions, physiological solutions, isotonic solutions, etc., compatible with pharmaceutical usage and well-known by one of ordinary skill in the art).

These compositions can also further comprise one or l agents or vehicles chosen among dispersants, lisers, isers, preservatives, etc. Agents or vehicles useful for these formulations (liquid and/or injectable and/or solid) are particularly methylcellulose, hydroxymethylcellulose, carboxymethylcellulose, polysorbate 80, mannitol, gelatin, lactose, vegetable oils, acacia, liposomes, etc.

These compositions can be formulated in the form of injectable suspensions, syrups, gels, oils, ointments, pills, tablets, suppositories, powders, gel caps, es, aerosols, etc., eventually by means of galenic forms or s assuring a prolonged and/or slow release.

For this kind of formulations, agents such as cellulose, carbonates or starches can advantageously be used.

NTZ or TZ(G) may be administered by different routes and in different forms. For example, the nd(s) may be administered via a systemic way, per os, parenterally, by inhalation, by nasal spray, by nasal instillation, or by ion, such as for example intravenously, by intramuscular route, by subcutaneous route, by transdermal route, by topical route, by intra-arterial route, etc.

Of course, the route of administration will be adapted to the form of NTZ or TZ(G) according to ures well known by those skilled in the art.

In a particular ment, the nd is formulated as a tablet. In another particular embodiment, the compound is administered orally.

NTZ or TZ(G), or a pharmaceutically acceptable salt thereof, is administered in a therapeutically effective amount. Within the context of the invention, the term "effective amount" refers to an amount of the nd sufficient to produce the desired therapeutic effect.

The ncy and/or dose relative to the administration can be adapted by one of ordinary skill in the art, in function of the patient, the pathology, the form of stration, etc. lly, NTZ or TZ(G) can be administered for the treatment of a cholestatic or fibrotic disease at a dose comprised between 0.01 mg/day to 4000 , such as from 50 mg/day to 2000 mg/day, such as from 100 mg/day to 2000 mg/day; and particularly from 100 mg/day to 1000 mg/day. In a particular embodiment, the NTZ, TZ(G), or a pharmaceutically acceptable salt thereof, is administered at a dose of about 1000 mg/day (i.e at a dose of 900 to 1100 ), in particular at 1000 mg/day. In a particular embodiment, NTZ, TZ(G), or a pharmaceutically acceptable salt thereof, is stered orally at a dose of about 1000 mg/day, in particular at 1000 mg/day, in particular as a tablet. Administration can be performed daily or even several times per day, if necessary. In one embodiment, the compound is administered at least once a day, such as once a day, twice a day, or three times a day. In a particular embodiment, the compound is administered once or twice a day.

In particular, oral administration may be performed once a day, during a meal, for example during breakfast, lunch or dinner, by taking a tablet comprising the nd at a dose of about 1000 mg, in particular at a dose of 1000 mg. In another embodiment, a tablet is orally administered twice a day, such as by administering a first tablet comprising the compound at a dose of about 500 mg (i.e. at a dose of 450 to 550 mg), in ular at a dose of 500 mg, during one meal, and administering a second tablet comprising the nd at a dose of about 500 mg, in particular at a dose of 500 mg, during r meal the same day.

Suitably, the course of treatment with NTZ, TZ(G) or a pharmaceutically acceptable salt thereof is for at least 1 week, in particular for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or 24 weeks or more. In particular, the course of treatment with NTZ, TZ(G) or a pharmaceutically acceptable salt thereof is for at least 1 year, 2 years, 3 years, 4 years or at least 5 years.

In a particular embodiment, the invention relates to the treatment of a cholestatic or fibrotic disease, in ular liver fibrosis, more particularly liver fibrosis consecutive to NASH, in a patient in need thereof, comprising administering to said patient a therapeutically effective amount of NTZ or TZ(G) or of a pharmaceutically acceptable salt of NTZ or TZ(G), in particular administering NTZ at a dose of 1000 mg/day, in ular by administering a tablet containing 500 mg of NTZ twice a day, in particular during two different meals.

In a particular embodiment, the invention relates to the use of NTZ or TZ(G), or a pharmaceutically acceptable salt of NTZ or TZ(G) for the treatment of a cholestatic or fibrotic disease, in ation with at least one other therapeutically active agent with known antifibrotic activity. ing to a variant of this embodiment, NTZ or TZ(G) can be combined with any antifibrotic compound such as pirfenidone or receptor tyrosine kinase inhibitors (RTKls) such as anib, nib and other RTKls, or angiotensin II (AT1) receptor blockers, or CTGF inhibitor, or any antifibrotic compound susceptible to interfere with the TGFB- and BMP-activated pathways including tors of the latent TGFB complex such as MMP2, MMP9, THBS1 or cell-surface integrins, TGFB receptors type | (TGFBRI) or type II (TGFBRII) and their ligands such as TGFB, Activin, inhibin, Nodal, anti-MUllerian hormone, GDFs or BMPs, auxiliary co-receptors (also known as type III receptors), or components of the SMAD-dependent canonical pathway including regulatory or inhibitory SMAD proteins, or members of the SMAD-independent or non-canonical pathways including s branches of MAPK signaling, TAK1, Rho-like GTPase signaling pathways, phosphatidylinositol-3 kinase/AKT pathways, TGFB-induced EMT process, or canonical and non-canonical Hedgehog signaling pathways including Hh ligands or target genes, or any members of the WNT, or Notch pathways which are susceptible to influence TGFB signaling.

Thus, the invention also relates to a pharmaceutical composition comprising a compound selected from NTZ or TZ(G), or a pharmaceutically acceptable salt of NTZ or of TZ(G), in combination with at least one therapeutically active agent with known brotic activity selected from pirfenidone or or ne kinase inhibitors (RTKls) such as anib, sorafenib and other RTKls, or angiotensin II (AT1) receptor blockers, or CTGF inhibitor, or antifibrotic compound susceptible to interfere with the TGFB- and BMP-activated pathways including activators of the latent TGFB complex such as MMP2, MMP9, THBS1 or cell-surface integrins, TGFB receptors type | (TGFBRI) or type II (TGFBRII) and their ligands such as TGFB, Activin, inhibin, Nodal, anti-MUllerian hormone, GDFs or BMPs, auxiliary co- receptors (also known as type III receptors), or components of the ependent canonical pathway including regulatory or inhibitory SMAD ns, or members of the SMAD-independent or non-canonical pathways including various es of MAPK signaling, TAK1, Rho-like GTPase signaling pathways, phosphatidylinositol-3 kinase/AKT pathways, TGFB-induced EMT process, or canoninal and non-canonical Hedgehog signaling pathways ing Hh ligands or target genes , or any members of the WNT, or Notch pathways which are susceptible to influence TGFB signaling, for use in a method for treating a fibrotic disorder.

In another particular embodiment, other classes of molecules that could also be combined with NTZ or TZ(G) e JAK/STAT inhibitors, or other anti-inflammatory and/or immunosuppressant agents. A non tive list of these agents includes but is not limited to glucocorticoids, NSAIDS, cyclophosphamide, nitrosoureas, folic acid analogs, purine s, pyrimidine analogs, methotrexate, oprine, mercaptopurine, porin, myriocin, imus, sirolimus, mycophenolic acid derivatives, fingolimod and other sphingosinephosphate receptor modulators, monoclonal and/or polyclonal antibodies against such targets as proinflammatory cytokines and proinflammatory cytokine receptors, T-cell receptor, integrins. Other classes of molecules that could also be combined with NTZ or TZ(G) include molecules that could potentially enhance the exposure or the effect of NTZ or TZ(G).

In another particular embodiment, the invention relates to a combination of NTZ, TZ(G) or a pharmaceutically acceptable salt thereof with at least one other therapeutically active agent with known brotic activity, or with JAK/STAT tors, or other anti-inflammatory and/or immunosuppressant agents. The combination may be in the form of a single pharmaceutical composition comprising the different active ingredients, including NTZ, TZ(G), or a pharmaceutically acceptable salt thereof. In a variant, the combination is a kit of parts comprising NTZ, TZ(G), or a pharmaceutically acceptable salt thereof, and another active ingredient such as another anti-fibrotic agent, a JAK/STAT inhibitor, or r anti- inflammatory or immunosuppressant agent. Said kit of parts may be for simultaneous, te or sequential administration for the treatment of a cholestatic or ic disorder In another embodiment, compound NTZ or TZ(G), or a combination of NTZ and TZ(G), is administered as the sole active ingredient. Accordingly, the invention also relates to a pharmaceutical composition comprising a compound selected from NTZ or TZ(G), or a ceutically acceptable salt of NTZ or of TZ(G), or a mixture thereof, for use in a method for treating a cholestatic or fibrotic er, wherein said compound(s) is(are) the only active ingredient(s) in the composition In a further embodiment, the present invention provides methods of treating cholestatic or fibrotic diseases comprising the administration of NTZ or TZ(G), or a pharmaceutically acceptable salt of NTZ or TZ(G), in particular in the form of a ceutical composition containing NTZ or T2.

In r aspect, the invention relates to a kit-of-parts comprising: - xanide or a pharmaceutically acceptable salt of xanide; and - Tizoxanide or a pharmaceutically acceptable salt of Tizoxanide.

The compounds of the kit of parts of the invention are administered simultaneously, separately or sequentially for the treatment of a fibrotic disorder.

In another ment, the invention provides a method of treating a tactic and/or fibrotic diseases comprising administering twice daily to a patient in need thereof having a cholestatic or fibrotic disease (in particular to a NASH patient or to a patient having a liver fibrosis) a tablet containing 500 mg of NTZ, in ular during a meal (such as during breakfast, lunch or dinner).

The invention is further described with nce to the following, non-limiting, examples.

EXAMPLES Materials & Methods nds were dissolved in dimethyl sulfoxide (DMSO, Fluka cat# 41640). Nitazoxanide (INTERCHIM cat#RQ550U) and Tizoxanide (INTERCHIM cat#RP253) were obtained commercially. hHSC culture The human primary hepatic te cells (hHSC) (lnnoprot) were cultured in STeCM medium (ScienCell cat# 5301) that was supplemented with 2% fetal bovine serum (FBS, ScienCell cat# 0010), 1% penicillin/streptomycin (ScienCell cat# 0503) and stellate cell growth supplement (SteCGS; ScienCell cat# 5352). Cell culture flasks were coated with Poly-L Lysine (Sigma cat# P4707) for a better adherence.

Activation of hHSC with TGF-B1 The human y hepatic stellate cells (hHSC) (lnnoprot) were cultured under standard conditions, as described above. The cells were subsequently plated at a y of 7 x 104 cells/well into 24-well plates for gene expression studies, and at a density of 2 x 104cells/well into 96-well plates for the measure of o-SMA by ELISA. The next day, cell culture medium was removed, and cells were washed with PBS (lnvitrogen cat# 14190). hHSC were deprived for 24 hours in serum-free and -free medium. For the treatments with NTZ or TZ, the serum-deprived hHSC were preincubated for 1 hour with the compounds followed by the on of the profibrogenic stimuli TGFB1 (PeproTech cat# 100-21, 1ng/mL) in serum-free and -free medium for an additional 24 or 48 hour period (the timepoint is indicated in the figure legends). At the end of treatment, cells were washed with PBS (lnvitrogen, cat# 14190) before the addition of 50 ul of lysis buffer (CelLyticTM MT reagent; Sigma #03228). Plates were then incubated for 30 min on ice using a plate , before storage at —20°C. tion of rat HSC with TGFB1: The rat primary hepatic stellate cells (rHSC) (Innoprot) were cultured in STeCM medium (ScienCeII cat# 5301) that was supplemented with 2% fetal bovine serum (FBS, ScienCeII cat# 0010), 1% penicillin/streptomycin (ScienCeII cat# 0503) and stellate cell growth supplement (SteCGS; ScienCeII cat# 5352). For the activation experiments with TGFB1, the rHSC were plated at a density of 10x103 cells per well in 96-well plates. The next day, cell culture medium was removed, and cells were washed with PBS (Invitrogen cat# 14190). rHSC were deprived for 24 hours in serum—free and SteCGS—free medium. For the treatments with NTZ or TZ, the serum-deprived rHSC were preincubated for 1 hour with the compounds followed by addition of the profibrogenic i TGFB1 (PeproTech cat# 100-21, 3ng/mL) in serum—free and —free medium for an additional 48 hour . At the end of ent, cells were washed with PBS (Invitrogen, cat# 14190) before the addition of 50 pl of lysis buffer (CelLyticTM MT reagent; Sigma #C3228). Plates were then incubated for min on ice using a plate shaker, before storage at —20°C. tion of NHLF with TGFB1 The Normal Human Lung Fibroblasts (NHLF) (Lonza) were cultured in Fibroblast Basal Medium (FBM) (Lonza cat# 1) that was supplemented with FGM-2 SingIeQuotsTM Kit (Lonza cat# CC-3132). The complete medium contains 2% fetal bovine serum. For the activation experiments with TGFB1, the NHLF were plated at a density of 5x103 cells per well in 96-well plates. The next day, ulture medium was removed, and cells were washed with PBS (Invitrogen cat#14190). NHLF were deprived for 24 hours in serum—free, insulin- free and thGF-B—free medium. For the treatments with NTZ or TZ, the serum-deprived NHLF were preincubated for 1 hour with the compounds followed by addition of the profibrogenic stimuli TGFB1 (PeproTech cat#100-21, 1ng/mL) in free, insulin-free and thGF-B—free medium for an additional 48 hour period. At the end of treatment, cells were washed with PBS (Invitrogen, cat# 14190) before the addition of 50 ul of lysis buffer (CelLyticTM MT reagent; Sigma #03228). Plates were then incubated for 30 min on ice using a plate shaker, before storage at -20°C.

Activation of NHCF-V with TGFB1: The Normal Human Cardiac Fibroblasts (ventricle) (NHCF-V) (Lonza) were ed from normal adult heart tissue. Cells were cultured in Fibroblast Basal Medium (FBM) (Lonza cat# CC-3131) that was supplemented with FGMTM-3 KitTM kit (Lonza cat# CC-4525). The complete medium contains 10% fetal bovine serum. For the activation experiments with WO 78172 TGFB1, the NHCF-V were plated at a density of 6x103 cells per well in 96-well plates. The next day, cell-culture medium was removed, and cells were washed with PBS (Invitrogen cat#14190). NHCF were deprived for 24 hours in serum—free, insulin-free and thGF-B—free medium. For the treatments with NTZ or TZ, the serum-deprived NHCF were preincubated for 1 hour with the compounds followed by addition of the profibrogenic stimulus TGFB1 (PeproTech cat#100-21, ) in serum—free, insulin-free and —free medium for an additional 48 hour period. At the end of treatment, cells were washed with PBS (Invitrogen, cat# 14190) before the addition of 50 ul of lysis buffer (CelLyticTM MT reagent; Sigma ). Plates were then incubated for 30 min on ice using a plate shaker, before storage at —20°C.

Activation of lnMyoFib with TGFB1: The Human Intestinal Myofibroblasts (lnMyoFib) (Lonza) were cultured in Smooth Muscle Cell Basal Medium (SmBM-2TM) (Lonza cat# CC-3181) that was supplemented with SmGMTM-2 BulletKit TM (Lonza cat# 00-4149). The complete medium ns 5% fetal bovine serum. For the activation experiments with TGFB1, the inMyoFib were plated at a density of 10x103 cells per well in 96-well plates. The next day, cell-culture medium was removed, and cells were washed with PBS (Invitrogen cat#14190). lnMyoFib were deprived for 24 hours in serum—free, insulin-free and thGF-B—free medium. For the treatments with NTZ or TZ, the serum-deprived lnMyoFib were preincubated for 1 hour with the compounds followed by addition of the profibrogenic stimuli TGFB1 (PeproTech cat#100-21, 3ng/mL) in serum—free, insulin-free and thGF-B—free medium for an additional 48 hour period. At the end of treatment, cells were washed with PBS (Invitrogen, cat# 14190) before the addition of 50 ul of lysis buffer (CelLyticTM MT reagent; Sigma #03228). Plates were then incubated for 30 min on ice using a plate shaker, before e at —20"C. a-SMA ELISA The level of d-SMA was measured using a ch ELISA. Briefly, the wells of an ELISA plate were first coated with the e dy (mouse monoclonal anti-ACTA2, Abnova) at 4°C ght. After 3 washes in PBS + 0,2% Tween 20, a blocking solution consisting of PBS +0.2% BSA was added for one hour followed by another washing cycle. The cell Iysates were transferred into the wells for binding to the capture dy for a period of 2h at room temperature. After the washing procedure, the detection antibody (biotinylated mouse monoclonal anti-ACTA2, Abnova) was added for 2 hours at room temperature followed by 3 . For the detection, an HRP-conjugated Streptavidin (R&D Systems cat# DY998) was first applied for 30 min at room temperature. After washing, the HRP ate TMB (BD,#555214) was added and incubated for 7min at room temperature in the dark. Upon oxidation, TMB forms a water-soluble blue reaction product that becomes yellow with addition of sulfuric acid ion stop), enabling accurate measurement of the intensity at 450nm using a spectrophotometer. The developed color is directly proportional to the amount of q-SMA present in the lysate.

Gene sion Total RNA was isolated using Nucleospin® 96 RNA (Macherey Nagel) ing manufacturer’s instructions. Total RNA (500ng for in vitro samples) were e transcribed into cDNA using M-MLV RT (Moloney Murine Leukemia Virus Reverse Transcriptase) (lnvitrogen cat# 28025) in 1X RT buffer (lnvitrogen), 1mM DTT (lnvitrogen), 0.18mM dNTPs (Promega), 200ng pdN6 (Amersham) and 30U of RNase inhibitor ga).

Quantitative PCR was then carried out using the MyiQ Single-Color Real-Time PCR Detection System (Biorad). Briefly, the PCR reactions were performed in 96-WP format in 25 ul of total volume containing 1uL of reverse transcription reaction, 0.5uL of reverse and forward primers (10 pmol each), and 12,5 ul of 2X iQ SYBR Green Supermix (BioRad, 1725006CUST).The sequences of s are depicted in the table 1 Table 1: Human Primers Primer name Sequence (5’->3’) 3684 forward CATGCTCAACATCTCCCCCTTCTCC (SEQ ID NO:1) 36B4 reverse GGGAAGGTGTAATCCGTCTCCACAG (SEQ ID NO:2) COL1A1 forward AGGCGAACAAGGTGACAGAG (SEQ ID NO:3) COL1A1 reverse GCCAGGAGAACCAGCAGAG (SEQ ID NO:4) Expression levels were normalized using the expression of 3684 gene as a reference in human samples.

For each gene, the standard curves were drawn by selecting the best points (at least three points) in order to have PCR on efficiency close to 100% and a correlation coefficient close to 1. Expression levels were determined using the rd curve equation for both the housekeeping gene and the target gene g into account the specific PCR efficiency of each target gene).

Evaluation of NTZ in a chronic CDAAc diet—induced liver is model The antifibrotic effect of NTZ was assessed in a murine model of CDAAc diet-induced experimental liver fibrosis. 6 week-old CS7BL/6 mice were fed for 12 weeks a control (CSAA) diet, CDAAc diet, or CDAAc diet supplemented with NTZ 10 mg/kg/day for 12 weeks.

The body weight and the food intake were monitored twice per week. On the last day of treatment, mice were sacrificed after a 6h g period. The liver was rapidly d for biochemical and histological studies.

All animal procedures were performed according to standard protocols and in accordance with the standard recommendations for the proper care and use of laboratory animals.

Evaluation of NTZ in CCI4—induced liver damage model The antifibrotic effect of NTZ was assessed in a rat model of CCI4 induced liver .

OFA S;Dawley rats (initial body weight 250-275g) were randomized according to their body weight into 4 groups and treated for 3 weeks. The rats were intraperitoneally injected with olive oil (ctrl group) or with CCI4 fied in olive oil (CCI4:olive oil 1:2 v/v, final CCI4 concentration : 2mi/kg) twice weekly. Concomitantly, the olive oil injected group was placed on control diet while the CCI4 ed groups were placed on control diet or diet supplemented with NTZ. 2 regimen containing NTZ were prepared corresponding respectively to an exposure of 10, or 30, mg/kg/day. The last day of treatment, the rats were sacrificed after a 6h fasting . Blood samples were ted and the serum was isolated for biochemical analyses.

Evaluation of NTZ in the DDC model of tasis: CSYBL/6 mice will be fed for 8 weeks a 0,1% DDC-supplemented diet, or 0.1% DDC- supplemented diet containing NTZ 100 mg/kg/day, or a standard mouse diet (Ssniff). The last day of treatment, the mice will be sacrificed after a 6h fasting period. Blood samples will be taken for biochemical analyses and the liver will be rapidly excised for biochemical and histological studies.

Evaluation of NTZ in a chronic CCI4—induced liver fibrosis model 9 week-old CSYBL/6 mice will be placed on control diet or diet supplemented with NTZ for 6 weeks. 2 regimen ning NTZ will be prepared corresponding respectively to an exposure of NTZ 30, or 100 mg/kg/day. Concomitantly, and for the total duration of 6 weeks, the mice will be treated 3 times a week with CCI4 dissolved in olive oil or vehicle by oral gavage. The amount of CCI4 will be progressively increased from 0.875 ml/kg to kg.

The last day of treatment, the mice will be sacrificed after a 6h fasting period. Blood samples will collected for biochemical analyses of serum . The liver will be rapidly excised for biochemical, histological and expression studies.

Histology Tissue embedding and sectioning: The liver slices were first fixed for 12 hours in a solution of 4% formalin.. The, liver pieces were then washed 30 minutes in PBS, and dehydrated in ethanol solutions (successive baths at 70, 80, 95 and 100% ethanol). The liver pieces were incubated in three different baths of Xylene (Sigma-Aldrich cat# 534056), followed by two baths in liquid paraffin (56°C). Liver pieces were then put into racks that were gently filled with Histowax® to completely cover the tissue.

The paraffin blocks containing the tissue pieces were d from the racks and stored at room temperature. The liver blocks were cut into 3 pm slices. irius red staining Liver sections were deparaffinized, rehydrated and incubated for 15 minutes in a solution of Fast Green FCF 0.1% (Sigma-Aldrich, cat# F7258) before rinsing in a bath of 0.5% acetic acid (Panreac, cat# 131008.1611). The liver sections were rinsed in water and ted for minutes in a solution of 0.1% sirius red (Direct Red 80, Fluka cat# 43665) in saturated aqueous picric acid (Sigma-Aldrich cat# P6744). The liver sections were finally dehydrated, and mounted using the CV Mount medium (Leica, cat #14046430011). ogical examinations The identity of the liver en was blinded from the examiner. Virtual slides were generated using the Pannoramic 250 scanner from 3D Histech. Using Quant Center software (3D Histech, ing Pattern Quant and Histo Quant modules), collagen-stained areas were quantified. Briefly, Pattern Quant was used to detect relevant tissue structure and to measure the surface. Then, Histo Quant was used to detect the stained collagen content and for the measurement of total area and percentages, based on a color threshold method. The fibrosis area was expressed as the percentage of en surface over the whole tissue.

Measurement of hepatic collagen content The hepatic collagen content was determined using the appropriate Quickame kit (Total collagen assay, cat# QZB-totcol2). The assay is based on the detection of yproline, which is a non-proteinogenic amino acid mainly found in the triple helix of collagen. Thus, hydroxyproline in tissue hydrolysates can be used as a direct e of the amount of en present in the tissue (without discrimination between procollagen, mature collagen and collagen degradation products).

Complete hydrolysis of tissue samples in 6M HCI at 95°C is required before dosing the yproline. The assay results in the generation of a chromogen with a maximum absorbance at 570 nm. Results are expressed as mg of collagen/g of liver.

Evaluation of NTZ in the BDL model Surgical bile duct ligation will be performed on rats in order to induce an extrahepatic cholestasis and subsequently liver fibrosis. After a 2 week recovery period, s will be treated with NTZ at 30 or 100 mg/kg/day for one or two weeks. The last day of treatment, the mice will be sacrificed after a 6h fasting period. Blood samples will be ted for mical analyses of serum. The liver will be rapidly excised for biochemical, histological & expression studies.

Measurement of tic concentration of Total Bile Acids The tic concentration of Total Bile Acids (TBA) was determined using the appropriate Randox kit for the Daytona automated analyzer (Randox, cat#Bl 3863). In the presence of Thio-NAD, the enzyme 3-01 hydroxysteroid dehydrogenase (3-q HSD) converts bile acids to 3-keto steroids and Thio-NADH. The reaction is reversible and 3-0, HSD can convert 3- ketosteroids and Thio-NADFH-to bile acids and Thio- NAD. In the ce of excess NADH, the enzyme cycling occurs efficiently and the rate of formation of Thio-NADH is determined by measuring specific change of absorbance at 405nm. Results are expressed in umol/L.

Results and Conclusions: The abnormal persistence of differentiated myofibroblasts is a characteristic of many ic diseases. Following liver injury, quiescent HSC undergo a process of activation that is characterized by a differentiation into (d-SMA)—positive myofibroblasts. In an attempt to find new antifibrotic molecules, a library of FDA-approved drugs was phenotypically screened in a model of human HSC activated with the profibrogenic cytokine TGFB1. The levels of d-SMA, a hallmark of fibrotic lesions, were used to evaluate the potency of the drugs to interfere with the fibrotic process. The ing campaign led to the identification of xanide (NTZ), which dose-dependently d the level of d-SMA in TGFfi-induced HSCs. Overall, NTZ exhibited an IC50 comprised between 0.1 and 3uM (Fig. 1A). Since it is known that NTZ is rapidly hydrolyzed into an active metabolite tizoxanide (TZ) (Broekhuysen, Stockis et al., 2000), this metabolite was also evaluated for its antifibrotic activity in HSC. TZ showed a profile similar to the parent drug with an |C50 comprised between 0.1 and 3uM (Fig.1 B). Other markers of TGFB ation were reduced by both compounds including the extracellular matrix collagen 1A1 (COL1A1) (Fig.2).Toxicity assays confirmed that the reduced levels of or- SMA were not due to toxicity or sis of HSC (data not shown).

NTZ and T2 also reduced d-SMA levels in TGFfi-activated HSC derived from rat (Fig.3). In addition, the antifibrotic potential of NTZ and TZ was extended to fibroblasts derived from other tissues, including normal human lung fibroblasts (NHLF) (Fig.4), normal human cardiac fibroblasts (Fig.5) and human Intestinal myofibroblasts (lnMyoFib) (Fig.6). In all these models of fibrosis, NTZ and TZ showed significant antifibrotic effects at a concentration of 1uM.

In vivo efficacy of NTZ was assessed in a CDAA cholesterol diet-induced experimental liver fibrosis model. The chronic oral administration of xanide 10 mg/kg/day demonstrated antifibrotic properties reflected by significantly lower c en content (Fig 7) and reduced hepatic fibrosis area by histological examination (Fig 8).

In the in vivo model of nduced liver injury, NTZ prevented the pathological increase of circulating TBA concentration (fig 09), which is a marker associated with cholestasis (Chang 2013) In conclusion, the applicant has discovered unexpected antifibrotic and olestatic activities for the antiparasitic agent NTZ. These results demonstrate that NTZ and/or its active metabolite TZ can provide therapeutic benefits in cholestatic diseases and multiple types of fibrotic es.

REFERENCES Broekhuysen, J., A. Stockis, et al. (2000). "Nitazoxanide: pharmacokinetics and lism in man." Int J Clin Pharmacol Ther 38(8): 387-394. de Carvalho, L. P. S., C. M. Darby, et al. (2011). "Nitazoxanide disrupts membrane potential and intrabacterial pH homeostasis of Mycobacterium tuberculosis." ACS Med. Chem.

Lett. 2(Copyright (C) 2015 American Chemical Society (ACS). All Rights Reserved.): 849-854.

Di Santo, N. and J. Ehrisman (2014). "A functional perspective of nitazoxanide as a potential anticancer drug." Mutat. Res., Fundam. Mol. Mech. Mutagen. 768(Copyright (C) 2015 American Chemical Society (ACS). All Rights ed.): 16-21. il, L., l. , et al. (1996). "In vitro evaluation of activities of nitazoxanide and tizoxanide against anaerobes and aerobic organisms." Antimicrob. Agents Chemother. 40(Copyright (C) 2015 American al y (ACS). All Rights Reserved.): 2266-2270.

Finegold, S. M., D. Molitoris, et al. (2009). "Study of the in vitro ties of rifaximin and comparator agents against 536 anaerobic intestinal bacteria from the perspective of potential utility in pathology involving bowel flora." Antimicrob. Agents Chemother. 53(Copyright (C) 2015 American al Society (ACS). All Rights Reserved.): 281- Fox, L. M. and L. D. Saravolatz (2005). "Nitazoxanide: a new thiazolide antiparasitic agent." Clin. Infect. Dis. 40(Copyright (C) 2015 American Chemical Society (ACS). All Rights Reserved.): 1173-1180.

Hemphill, A., J. Mueller, et al. (2006). "Nitazoxanide, a broad-spectrum thiazolide anti- infective agent for the treatment of gastrointestinal infections.‘ Expert Opin.

Pharmacother. 7(Copyright (C) 2015 American Chemical Society (ACS). All Rights ed.): 4.

Hoffman, P. S., G. Sisson, et al. . "Antiparasitic drug nitazoxanide inhibits the pyruvate oxidoreductases of Helicobacter , selected anaerobic bacteria and parasites, and obacter jejuni." Antimicrob. Agents Chemother. 51(Copyright (C) 2015 American Chemical Society (ACS). All Rights Reserved.): 868-876.

Kendall, R. T. and C. A. Feghali-Bostwick (2014). "Fibroblasts in fibrosis: novel roles and mediators." Front col 5: 123.

Leask, A. (2007). "TGFbeta, cardiac fibroblasts, and the fibrotic response." Cardiovasc Res 74(2): 207-212.

Leask, A. and D. J. Abraham (2004). "TGF-beta signaling and the ic response." FASEB 4 18(7): 816-827.

Megraudd, F., A. Occhialini, et al. (1998). "Nitazoxanide, a potential drug for eradication of Helicobacter pylori with no cross-resistance to metronidazole." Antimicrob. Agents Chemother. 42(Copyright (C) 2015 American Chemical Society (ACS). All Rights Reserved.): 2836-2840.

Pankuch, G. A. and P. C. Appelbaum (2006). "Activities of nide and nitazoxanide compared to those of five other lides and three other agents t anaerobic species." Antimicrob. Agents Chemother. 50(Copyright (C) 2015 American Chemical Society (ACS). All Rights Reserved.): 1112-1117.

Rosenbloom, J., F. A. Mendoza, et al. (2013). "Strategies for anti-fibrotic therapies." Biochim Bioghys Acta 1832(7): 1088-1103.

Rossignol, J.-F. . "Nitazoxanide: A in-class broad-spectrum antiviral agent." Antiviral Res. 110(Copyright (C) 2015 American al Society (ACS). All Rights Reserved.): 94-103.

Rossignol, J. F. and R. Cavier (1975). 2-Benzamidonitrothiazoles, S.P.R.L. Phavic, Belg. . 11 pp.

Rossignol, J. F. and H. Maisonneuve (1984). "Nitazoxanide in the treatment of Taenia ta and Hymenolepis nana infections." Am J Trog Med Hyg 33(Copyright (C) 2015 US. National Library of Medicine.): 511-512.

Claims (11)

1. A compound ed in the group consisting of Nitazoxanide (NTZ), Tizoxanide (T2) and nide glucuronide (TZG), and a pharmaceutically acceptable salt of NTZ, T2 or TZG, for use in a method for the treatment of a cholestatic or fibrotic disorder.

2. The compound for use according to claim 1, which is selected in the group consisting of NTZ and T2, and a pharmaceutically acceptable salt of NTZ or T2. 10

3. The compound for use according to claim 1 or 2, comprised in a pharmaceutical composition.

4. The compound for use according to any one of claims 1 to 3, wherein the fibrotic disorder is selected in the group consisting of liver, gut, kidney, skin, epidermis, endodermis, muscle, 15 tendon, cartilage, heart, pancreas, lung, , nervous system, testis, penis, ovary, adrenal gland, artery, vein, colon, intestine (e.g. small intestine), biliary tract, soft tissue (e.g. mediastinum or retroperitoneum), bone marrow, joint, eye and stomach fibrosis.

5. The compound for use ing to any one of claims 1 to 4, wherein the ic disorder 20 is selected in the group ting of liver, gut, lung, heart, kidney, muscle, skin, soft tissue, bone marrow, intestinal, and joint is.

6. The compound for use according to any one of claims 1 to 5, wherein the fibrotic disorder is selected from the group consisting of non-alcoholic steatohepatitis (NASH), pulmonary 25 is, idiopathic pulmonary fibrosis, skin fibrosis, eye fibrosis, endomyocardial fibrosis, mediastinal fibrosis, myelofibrosis, retroperitoneal fibrosis, progressive massive fibrosis, proliferative fibrosis, neoplastic is, lung fibrosis consecutive to chronic matory ainNay disease (COPD, asthma, emphysema, smoker’s lung,tuberculosis), alcohol or drug- induced liver fibrosis, liver cirrhosis, infection-induced liver fibrosis, radiation or 30 chemotherapeutic-induced fibrosis, nephrogenic systemic fibrosis, Crohn's e, ulcerative colitis, keloid, old myocardial infarction, scleroderma/systemic sclerosis, arthrofibrosis, some forms of adhesive capsulitis, c ing cholangiopathies such as Primary Sclerosing Cholangitis (PSC), Primary Biliary gitis (PBC), biliary atresia, familial intrahepatic cholestasis type 3 (PFICB), peri-lmplantational fibrosis and asbestosis.

7. The compound for use according to any one of claims 1 to 3, wherein the cholestatic disorder is selected in the group consisting of primary biliary cho|angitis (PBC), primary sclerosing cho|angitis (PSC), |ntrahepatic Cholestasis of Pregnancy, Progressive Familial |ntrahepatic tasis, Biliary atresia, Cholelithiasis, Infectious gitis, Cholangitis associated with hans cell histiocytosis, Alagille syndrome, Nonsyndromic ductal paucity, nduced cholestasis, and Total parenteral nutrition-associated cholestasis.

8. The compound for use according to claim 7, n the cholestatic disorder is PEG. 10

9. The compound for use according to any one of claims 1 to 8, for use in combination with at least one therapeutically active agent with known antifibrotic activity selected from pirfenidone or receptor tyrosine kinase inhibitors (RTKls) such as Nintedanib, Sorafenib and other RTKls, or angiotensin II (AT1) receptor blockers, or CTGF inhibitor, or any antifibrotic compound susceptible to interfere with the TGFB- and BMP-activated pathways including 15 activators of the latent TGFB complex such as MMP2, MMP9, THBS1 or urface integrins, TGFB receptors type | (TGFBRI) or type II (TGFBRII) and their ligands such as TGFB, Activin, inhibin, Nodal, anti-Miillerian hormone, GDFs or BMPs, auxiliary co-receptors (also known as type III receptors), or ents of the SMAD-dependent cal pathway including regulatory or inhibitory SMAD proteins, or members of the SMAD- 20 independent or non-canonical pathways including various branches of MAPK signaling, TAK1, Rho-like GTPase signaling pathways, phosphatidylinositol-3 kinase/AKT pathways, TGFB-induced EMT process, or canonical and non-canonical Hedgehog signaling pathways including Hh s or target genes, or any members of the WNT, or Notch pathways which are susceptible to influence TGFB signaling.

10. The compound for use according to any one of claims 1 to 8, for use in combination with at least one therapeutically active agent selected from AT inhibitors, other anti- inflammatory and/or immunosuppressant . 30

11. The compound for use according to claim 10, where the eutically active agent is selected from glucocorticoids, NSAIDS, cyclophosphamide, nitrosoureas, folic acid analogs, purine analogs, pyrimidine s, methotrexate, oprine, mercaptopurine, ciclosporin, in, imus, sirolimus, mycophenolic acid derivatives, fingolimod and other sphingosinephosphate receptor modulators, monoclonal and/or polyclonal antibodies 35 against such targets as proinflammatory cytokines and proinflammatory cytokine receptors, T-cell receptor, integrins. FIGURE 1 A B NSTAZOXANJDE TIZOXANJDE E a-SMA i a-SMA 1 20 — 1 20 :2 :2 U- 1 00 - U- 1 00 0 0 in“ ': ill so — ': 80 *1“: g g 60 - “ mm: o o 66 40 7 u Q\°' : c at“ O O E 20 _ awn E mint :9 :9 .C ° ’ .C ° 5 5 _29 | \ \ _20 J9 -7 -5 J9 —7 —5 Ccmpound Lagiml nd LogiM}