NZ765534B2 - P38 kinase inhibitors reduce dux4 and downstream gene expression for the treatment of fshd - Google Patents

P38 kinase inhibitors reduce dux4 and downstream gene expression for the treatment of fshd Download PDF

Info

Publication number
NZ765534B2
NZ765534B2 NZ765534A NZ76553418A NZ765534B2 NZ 765534 B2 NZ765534 B2 NZ 765534B2 NZ 765534 A NZ765534 A NZ 765534A NZ 76553418 A NZ76553418 A NZ 76553418A NZ 765534 B2 NZ765534 B2 NZ 765534B2
Authority
NZ
New Zealand
Prior art keywords
alkyl
amino
substituted
group
substituents
Prior art date
Application number
NZ765534A
Other versions
NZ765534A (en
Inventor
Angela Marie Cacace
Aaron Nakwon Chang
Alan Scott Robertson
Soto Luis Gustavo Alejandro Rojas
Lucienne V Ronco
Ning Shen
Lorin A Thompson Iii
Owen Brendan Wallace
Original Assignee
Fulcrum Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fulcrum Therapeutics Inc filed Critical Fulcrum Therapeutics Inc
Priority claimed from NZ762856A external-priority patent/NZ762856A/en
Publication of NZ765534A publication Critical patent/NZ765534A/en
Publication of NZ765534B2 publication Critical patent/NZ765534B2/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/415—1,2-Diazoles
    • A61K31/416—1,2-Diazoles condensed with carbocyclic ring systems, e.g. indazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/437—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4418—Non condensed pyridines; Hydrogenated derivatives thereof having a carbocyclic group directly attached to the heterocyclic ring, e.g. cyproheptadine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/4439—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/496—Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/53—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with three nitrogens as the only ring hetero atoms, e.g. chlorazanil, melamine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5375—1,4-Oxazines, e.g. morpholine
    • A61K31/5377—1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4707—Muscular dystrophy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/11—Protein-serine/threonine kinases (2.7.11)
    • C12Y207/11024—Mitogen-activated protein kinase (2.7.11.24), i.e. MAPK or MAPK2 or c-Jun N-terminal kinase
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/10—Screening for compounds of potential therapeutic value involving cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5061—Muscle cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids

Abstract

The disclosure relates to methods and compositions including p38 kinase inhibitors and agents that regulate expression of DUX4 and downstream genes including but not restricted to ZSCAN4, LEUTX, PRAMEF2, TRIM43, MBD3L2, KHDC1L, RFPL2, CCNA1, SLC34A2, TPRX1, PRAMEF20, TRIM49, PRAMEF4, PRAME6, PRAMEF15, or ZNF280A. Methods useful for treating a disease associated with abnormal DUX4 and downstream gene expression (e.g., Fascioscapulohumeral muscular dystrophy) are disclosed. 15, or ZNF280A. Methods useful for treating a disease associated with abnormal DUX4 and downstream gene expression (e.g., Fascioscapulohumeral muscular dystrophy) are disclosed.

Description

WO 71147 P38 KH‘IASE H‘IHIBITORS REDUCE DUX4 AND DOWNSTREAM GENE EXPRESSION FOR THE TREATMENT OF FSHD RELATED APPLICATIONS This application claims priority to US. Provisional Application No. 62/568,673, filed on October 5, 2017; US. Provisional Application No. 62/568,754, filed on October 5, 2017; US.
Provisional Application No. 62/682,563, filed on June 8, 2018; and US. Provisional Application No. ,565, filed on June 8, 2018; all of which are incorporated by reference herein in their entireties.
H‘ICORPORATION OF SEQUENCE LISTE‘IG The contents of the text file named “FULC-02602WO_SeqList,” which was created on October 5, 2018, and is 3 KB in size, are hereby incorporated by nce in their entirety.
FIELD OF THE H‘IVENTION The present invention relates to methods of inhibiting p38 kinase for reduction of DUX4 expression levels and/or downstream gene and protein expression and the treatment of diseases associated with DUX4.
BACKGROUND OF THE H‘IVENTION The muscular dystrophies (MD) are a group of more than 30 different c diseases terized by progressive ss and degeneration of the skeletal muscles that control movement. Some forms ofMD occur in infancy or childhood, while others may not appear until middle age or older. The various MD diseases differ in terms of the bution and extent of muscle weakness (some forms of MD also affect cardiac muscle), age of onset, rate of ssion, and n of inheritance.
Facioscapulohumeral muscular dystrophy (FSHD) is the third most common form of muscular dystrophy and affects approximately 1 in 15,000 people worldwide. FSHD is caused by genetic mutations resulting in the epigenetic derepression of the DUX4 gene, which makes this WO 71147 disease unique among muscular dystrophies. FSHD’s primary stations are weakness and wasting of muscles of the face, shoulder girdle, upper arms, and trunk, and s lower extremities in more severe cases.
Genetic mutations associated with FSHD lead to a partial decompaction of the D424 chromatin structure and a resulting failure to repress DUX4, a transcription factor d by the D424 unit, in skeletal muscle. FSHDl, representing about 95% of FSHD cases reported, is associated with deletions of macrosatellite D4Z4 repeats in the subtelomeric region of some 4q35, leaving 1—10 D4Z4 repeats wed in Tawil et. al., 2014). FSHDZ is caused by mutations in Structural nance of Chromosomes Flexible Hinge Domain Containing 1 gene (SMCHDI) on chromosome 18 (reviewed in van der Maarel et. al., 2007).
Both FSHDl and FSHDZ mutations lead to loss of sion at the 4q35 D4Z4 repeat array, allowing aberrant ription in muscle of a full-length form of Double homeoboX 4, DUX4, mRNA (DUX4—fl), which encodes the double homeoboX 4 (DUX4) transcription factor (Tawil et. al., 2014). DUX4—fl RNA isoforms found associated with FSHD vary only in the 3’ untranslated region and have no identified functional distinction.
There is currently no approved treatment that can halt or reverse the effects of FSHD, although nonsteroidal anti-inflammatory drug are often prescribed to improve comfort and mobility. Clearly, therefore, there is a need in the art for new methods for reducing the eXpression levels of DUX4, e.g., DUX4—fl mRNA and/or DUX4 protein, e.g., to treat FSHD and other diseases. The present invention meets this need.
SUMMARY OF THE H‘IVENTION In one aspect, a method for treating a disorder responsive to p38 kinase inhibition is provided. The method includes administering to a t in need thereof, an effective amount of a p38 kinase inhibitor of Formula V’: F (V’), or a isomer thereof, an isotopically-enriched compound f, a prodrug f, a solvate thereof, or a pharmaceutically acceptable salt thereof. The method includes the treatment of ers associated with DUX4 gene expression, wherein the inhibition of p38 kinase with a p38 kinase inhibitor may reduce DUX4 eXpression levels and/or the eXpression of one or more downstream genes in cells of the subject.
In another aspect, a method for treating capulohumeral muscular phy (FSHD) is provided. The method includes administering to a t in need thereof, an effective amount of a p38 kinase inhibitor of Formula V’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one aspect, a method for treating a disorder responsive to p38 kinase inhibition is provided. The method includes administering to a subject in need thereof, an effective amount of a p38 kinase inhibitor selected from one or more of the following Formulae I’-XX[X’: o N / N (1’), H2” 0 F F (11’), OH F F O N \ \ o N \ \ )L / JL / N N N o F N N N O F H | H I (III’a), HO (III’b), o N/ A I N/><H 0 (W), F (V’), WO 71147 F (VI’), 5 ‘ (W), o NH 7; D O N/—/ 8 V/NH o N/ / (4) kN N / 0 (VIII'), _\— (IX'), O F \\ N \\( S I ”0 (XIV’), F (XV’), ( N/ \ 1N9 N/ N \ N j OH F (XVI’), F (XVH’), 0 OH KOH ’), G (XlX’), NH2 (XXV), H C02H 0 O /\/©/ F 09 CI 0 (XXH’), CI (XXHI’), N’0 Cl | / N H F i » (XX[V’), N (XXV’), (XXVIII’), and F (XX[X’), or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof. The method includes the treatment of disorders associated with DUX4 gene eXpression, wherein the inhibition of p38 kinase with a p38 kinase inhibitor may reduce DUX4 eXpression levels and/or the eXpression of one or more ream genes in cells of the subject.
In r aspect, a method for treating facioscapulohumeral muscular dystrophy (FSHD) is ed. The method includes administering to a t in need thereof, an effective amount of a p38 kinase inhibitor selected from one or more of Formulae I’-XX[X’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically able salt thereof.
In one aspect, a method for treating a disorder responsive to p38 kinase inhibition is provided. The method includes stering to a subject in need f, an effective amount of a p38 kinase inhibitor selected from one or more of Formulae I-X[II (of Genuses I-X[II described herein), or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof. The method includes the treatment of disorders associated with DUX4 gene expression, wherein the inhibition of p38 kinase with a p38 kinase inhibitor may reduce DUX4 eXpression levels and/or the eXpression of one or more downstream genes in cells of the subject.
In another aspect, a method for ng capulohumeral muscular dystrophy (FSHD) is provided. The method includes administering to a t in need thereof, an effective amount of a p38 kinase inhibitor selected from one or more of ae I-XlII (of Genuses I-XIII described herein), or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug f, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one aspect, a method for treating a disorder responsive to p38 kinase inhibition is provided. The method includes administering to a subject in need thereof, an effective amount of a p38 kinase inhibitor, or a stereoisomer thereof, an ically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt f. The method includes the treatment of disorders associated with DUX4 gene sion, wherein the inhibition of p38 kinase with a p38 kinase inhibitor may reduce DUX4 sion levels and/or the eXpression of one or more downstream genes in cells of the subject.
In several embodiments, a method for treating facioscapulohumeral muscular dystrophy (FSHD) is provided. The method includes administering to a subject in need thereof, an ive amount of a p38 kinase inhibitor described herein, or a stereoisomer thereof, an isotopically-enriched compound f, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
BRIEF DESCRIPTION OF THE DRAWE‘IGS FIGS. 1A and 1B show expression of DUX4 protein and RNA in FSHD myotubes. includes micrographs of FSHD myotubes stained using an antibody that binds DUX4 protein and/or DAPI (to detect nuclei). Mature FSHD myotubes showed actin striations in culture (not shown) and expressed DUX4 protein in discrete sets of nuclei contained within a differentiated myotube (). is a graph showing relative expression of DUX4 mRNA in FSHD myotubes and myotubes from an isogenic wild type hy) control. is a graph showing mRNA expression of the indicated DUX4 regulated genes in wild type myotubes treated with DMSO, or FSHD myotubes treated with FTX-2 or DMSO.
For each indicated gene, the bars from left to right correlate to wild type myotubes treated with DMSO, FSHD myotubes treated with DMSO, and FSHD es treated with FTX-2 (DUX4- targeted ASO).
FIGS. 3A- 3C show reduction ofMBD3L2 mRNA in FSHD myotubes treated with DUX4-targeted ASOs. MBD3L2 was normalized to POLRZA mRNA as measured by qPCR. is a graph g grouped plate quality control data comparing MBD3L2 sion in FSHD myotubes treated with DMSO control or 1 uM DUX4-targeted ASOs, and healthy normal ic wild-type myotubes (WT). is a graph showing dose-dependent reduction of MBD3L2 mRNA expression in FSHD myotubes treated with different dilutions of the DUX4- targeted ASO (FTX-2). shows plate-based assay statistics comparing MBD3L2 signal in FSHD myotubes treated with DMSO to DUX4-targeted ASOs or wild type myotubes treated with DMSO.
FIGS. 4A-4D are graphs g expression levels ofMBD3L2 mRNA and MY0G mRNA in FSHD es treated with the indicated p3 Soc/B inhibitors relative to treatment with DMSO control. The p3 8(1/B inhibitors included SB 239063 (), VX-702 (), Pamapimod (), and TAK-715 (). The structures of the inhibitors are also provided.
FIGS. 5A and 5B show data from FSHD myotubes treated with Pamapimod. is a graph showing that ependent reduction in DUX4-fl mRNA (filled circles) and MBD3L2 mRNA (open circles). shows micrographs of FSHD es treated with either DMSO or Pamapimod.
FIGS. 6A-6C are graphs showing mRNA levels ofWK]4 () and MBD3L2 ( and ) in FSHD myotubes treated with siRNAs targeting p3 8a MAPKM (siMAPKl4 85 and siMAPKl4 86, and ) or treated with p3 8a kinase (MAPKl4 and DUX4 pLAM) Cas9/ngNA RNPs (), as compared to non-targeting control (NT CTRL). In , for each treatment, the results shown left to right correspond to MBD3L2 andMY0G, respectively. is a graph g sion levels of DUX4 protein, MBD3L2 mRNA, and p-HSP27 protein in FSHD myotubes following treatment with increasing dosages of FTX-1821 (structure shown), as a percentage of DMSO l treatment levels. Bars represent standard deviation.
FIGS. 8A and 8B show the effect of FTX-1821 on myotube formation. provides representative images of morphology of immortalized FSHD myotubes ed after treatment with vehicle (DMSO) or the ted concentrations of FTX-1 821 and staining with antibodies against MHC and DAPI (nuclear stain). is a graph showing quantification of nuclei in myotubes, as defined by MHC staining, after treatment with FTX-1821 at concentrations tested. Bars represent standard deviation of three replicates.
FIGS. 9A and 9B show the results of apoptosis assays in FSHD es in vitro. provides micrographs of FSHD myotubes stained for active caspase-3 (as a marker of apoptosis) or DAPI. Apoptosis was ed in a sporadic manner in a subset of myotubes in culture as shown by white circles in the left panel and in the magnified region to the right. is a graph showing quantification of active caspase-3 signal in FSHD myotubes treated with the indicated concentrations of FTX 1821.
FIGS. 10A and 10B illustrate the identification of genes gulated in FSHD myotubes by 21. A is a heatmap, which rates differentially expressed genes fied by RNA-seq profiling. Three replicates for each ion were analyzed by RNA-seq and genes were clustered by the direction and intensity of change as indicated. The color bar indicates the normalized s observed, e.g., genes that were downregulated by FTX-1821 are enriched in samples treated with only DMSO. Down-regulated genes are listed in A.
B is a graph showing the normalized expression level reads of the DUX4 target genes that were downregulated upon treatment with FTX-1821 in wild type cells treated with vehicle control DMSO, FSHD cells treated with DMSO, or FSHD cells treated with FTX-1821. is a graph showing mRNA expression levels by qRT-PCR of the DUX4 target gene, MBD3L2 lized to POLRZA), in myotubes derived from four distinct FSHD patient myoblast lines, FTCE-016, -O20, -197, -196 and two wild type (WT) control lines, following the indicated treatment with DMSO vehicle control, FTX-1821 or FTX-83 9.
FIGS. 12A and 12B provide information on various p38 kinase inhibitors. A is a table of data summarizing pharmacology for the indicated p3 80L and B inhibitors, including ICso for reducing MBD3L2 expression in FSHD cells. Comparable MBD3L2 ICso values are shown, indicating inhibition of DUX4 downstream gene expression in FSHD myotubes across a broad structural panel of p3 80L and B inhibitors reported to have r enzyme potencies. These data indicate that p38 tion result in DUX4 target gene, MBD3L2, reduction ICso values in the range of ~6-68 nM. B provides the compound structures of the p38 kinase inhibitors listed in A. is a table of various cell lines utilized in “clinical trial in a dish,” which shows diversity of genotypes, and includes both y and immortalized lines, as well as FSHDl and FSHD2 patient lines.
FIGS. 14A and 14B are graphs showing MBD3L2 mRNA expression normalized to POLR2A (by qRT-PCR) (A) and apoptosis as ed by cleaved caspase-3 (B) determined in nine FSHDl and three FSHD2 patient es (listed in Table 2, B ns only 2 FSHD2 cell lines) following treatment with FTX-1821, FTX-839, or DMSO vehicle control. . is a graph showing the time course of plasma exposure, trapezius muscle exposure and p38 target engagement (Phosphorylated - p3 80L : Total p3 80L Ratio) in the rat following oral administration of 0.3 mg/kg FTX-1821. . is a graph showing MBD3L2 mRNA leves in A4 and C6 xenografted TA muscles. . is a graph showing or/total MC2 ratio in mouse trapezius muscles ing treatment with vehicle control or p38 kinase tor, FTX-2865. . is a graph showing MBD3L2 mRNA levels in C6 xenografted TA muscles following treatment with vehicle control or p38 inhibitor, FTX-2865.
DETAILED DESCRIPTION OF THE H‘IVENTION The present invention is based, in part, on the discovery that inhibition of p38 kinase, e.g., p3 8-oc, results in reduced expression of DUX4 and downstream genes regulated by DUX4. ingly, the invention includes methods and compositions related to using an inhibitor of p3 8, e.g., p3 8-oc, (alone or in combination with another agent) to reduce the expression and/or activity levels of DUX4 and/or any of its downstream target genes, e.g., in the treatment or prevention of diseases associated with aberrant DUX4 expression, such as FSHD, a type of ar dystrophy.
The muscular dystrophies are a diverse group of c diseases that cause progressive weakness of the body's muscles. Some types of muscular dystrophy will present symptoms in early childhood, while other types will appear in adulthood. Different muscle groups also may be affected depending on the type of muscular dystrophy. See, e.g., Isin Dalkilic and Louis M Kunkel. Nearly 30 genes are known to give rise to various forms of ar phy, which differ in age of onset, ty, and muscle groups affected. The number of genes identified increases each year, adding to our understanding as well as revealing the overall complexity of the pathogenesis of these diseases.
For example, two common muscular dystrophies — Duchenne Muscular Dystrophy (DMD) and Facioscapulohumeral dystrophy (FSHD) — are considered to be unique diseases with some shared teristics. Similarities n DMD and FSHD include that both are genetic diseases and ms include muscle loss with muscle weakness leading to disability (therefore both DMD and FSHD are grouped in the large ry of muscular dystrophies, which means muscle degeneration). However, DMD and FSHD have very different etiology and disease diagnosis (dystrophin loss in DMD vs expression of DUX4-myotoxin in FSHD). For example, in DMD, mutations in the DMD gene (>2000 known) result in dysfunctional or missing dystrophin. In FSHD, the disease is due to overexpression of the DUX4 gene in muscle tissue; it is not due to point mutations in the gene (DUX4 protein is sed when the number ofD424 repeats in the DUX4 gene is between 1 and 8, or when repression is lost at the D424 by mutations in other silencing machinery). Other differences include that only skeletal muscle is involved in FSHD, whereas both skeletal and cardiac muscle are affected in DMD; the diaphragm is involved in DMD but not FSHD; lly there is childhood onset in DMD but adult/adolescent onset in FSHD; and onset with ambulatory involvement in DMD but onset with face and proximal arm/shoulders in FSHD. Another important distinction is that there is response to ds in DMD but not in FSHD. In addition, the approved treatment for DMD (Exondys-51 in the US, Ataluren in the EU) will not have any effect in FSHD. y, only males are affected in DMD while there is equal involvement of both sexes in FSHD.
FSHD also has an unusual pathology, and it is unique among ar dystrophies in that its development requires both genetic and epigenetic conditions. The genetic condition is the presence of a complete DUX4 gene. The DUX4 gene is a retrogene ly expressed in germ line and early embryonic cells, but it is repressed by D4Z4 repeat-induced silencing in adult tissues (Ehrlich and Lacey, 2012). Each D4Z4 t contains a promoter and the DUX4 ORF, but lacks a polyadenylation signal (PAS), resulting in rapid DUX4 mRNA degradation. In contrast, transcripts initiated in the distal D4Z4 unit on a 4qA permissive allele extend outside of the repeat array and reach a PAS in the flanking pLAM sequence (reviewed in Tawil et al., 2014, Himeda et al., 2015). The resulting poly-A tail stabilizes the DUX4 mRNAs and allows for their translation into a protein that is not normally expressed in healthy muscle and is toxic to skeletal muscle function. Two ers, DUX4 ic enhancer 1 (DME1) and DME2, which activate DUX4-fl expression in skeletal myocytes, have been described to regulate DUX4-fl expression in FSHD (Himeda et al., 2014).
FSHDl, FSHD2 and stages in early development as well as germline formation stages appear to confer a transcriptionally permissive conformation to D4Z4 chromatin. This is evidenced by changes in histone modification, partial but le hypomethylation ofD4Z4 in FSHDl, and more extensive hypomethylation in FSHD2 (Himeda et al., 2015). However, D4Z4 hypomethylation does not suffice for the disease, since there is an absence of muscular dystrophy symptoms in patients with ICF (immunodeficiency, meric region instability and facial anomalies), a rare, ted DNA hypomethylation-associated disease in which D4Z4 is strongly hypomethylated (OMIM Entry - # ).
DUX4 is a homeobox transcription factor n, and expression of DUX4 in muscle induces a transcriptional program g to expression of downstream genes and protein products that are not normally expressed in skeletal muscle. For example, DUX4 expression results in the induction of l germline genes in FSHD skeletal muscles and in transfected cells (Yao et al, 2014, Ehrlich and Lacey, 2012). Many of these novel transcripts are expressed in FSHD muscle cells but not in control muscle cells (Yao et al., 2014, Homma et al., 2015, Shadle et al.; 2017; Bosnakovski et al.; 2014). Since some of the downstream target genes of DUX4 encode transcription factors, DUX4 pathological activation leads to a large gene expression deregulation cascade in muscle, which causes the e (Yao et al.; 2014; Homma et al.; 2015; Shadle et al.; 2017; Bosnakovski et al.; 2014). nous (in the FSHD myofiber) and forced DUX4 eXpression in muscle cells is toXic; leads to apoptosis and oXidative ; and eres with myogenesis and sarcomere function (Rickard et al.; 2015; Homma et al.; 2015; Bosnokovski et al.; 2014; Tawil et al.; 2014; Himeda et al.; 2015). al heterogeneity in both disease progression and age of onset can be accounted for; in part; by etic instability leading to progressive changes in DUX4 transcription. The role ofDNA hypomethylation and permissive DUX4 transcription is exemplified by the high clinical severity ed in patients who inherited combined FSHDl and 2 defects (reviewed in Tawil et al.; 2014; van der Maarel et al.; 2007). Clinical heterogeneity is also eXplained by differences in the severity ofD4Z4 repeat shortening; with more severe phenotype and r age at onset in patients with shorter repeats (1-3) ed to patients with less severely contracted repeats (4-7).
DUX4 is now recognized as the cause of the pathology of FSHD; since activation of its target genes is the main molecular signature in FSHD muscle (Reviewed in Tawil et al.; 2014; Himeda et al.; 2015). Maj or downstream target genes are members of highly homologous gene families that are clustered spatially on chromosomes; including PRAMEF (preferentially eXpressed in melanoma); TRIM (tripartite motif-containing); 1\/fl3DL (methyl-CpG binding protein-like); ZSCAN (zinc finger and SCAN domain containing) and RFPL (ret-finger protein- like) es (Geng et al.; 2012; Yao et al.; 2014; Shadle et al.; 2017; Ehrlich and Lacey; 2012; Tawil et al.; 2014; van der Maarel et al.; 2007). Discrimination between FSHD and control skeletal muscle can be made using ZSCAN4; LEUTX; PRAMEF2; ; 1\/fl3D3L2; KHDCIL; RFPL2; CCNAl, SLC34A2, TPRX1,PRAMEF20; TRIM49, PRAMEF4; PRAME6; PRAMEF15; A etc. (described in but not limited to Yao et al.; 2014; Shadle et al.; 2017; Ehrlich and Lacey; 2012).
Annotated chemical probes were screened to identify disease-modifying small molecule drug targets that reduce DUX4 eXpression in FSHD myotubes. These screens identified multiple al scaffolds that inhibit p38 mitogen-activated protein kinase alpha (MAPK14 or p3 8-oc). As described in the accompanying Examples; it has been shown that knockdown of the 2018/054642 MAPK14 gene using small interfering RNA (siRNA) technology or CRISPR—mediated genome editing with ic guide RNA’s ) that selectively target the alpha m of p38 kinase also reduces DUX4 and DUX4-related downstream gene expression in FSHD myotubes.
It was also found that selective p3 Set and B kinase inhibitors ically reduced DUX4 and its downstream genes in FSHD es, y impacting the core pathophysiology of the FSHD disease process (data exemplified herein). The same experiments revealed that p3 Set and B kinase inhibitors do not impact myogenin or the expression of other myogenic factors, nor do they impact proliferation of myoblasts or differentiation of myoblasts exhibited by myogenic fusion in FSHD myotubes. These p38 kinase inhibitor small molecules reduce the expression of DUX4 and related downstream genes, thereby impacting pathophysiology of the FSHD disease process, including reducing apoptotic cell death. p3 ated DUX4 reduction would be expected to impact ream inflammatory, fatty infiltration and fibrotic processes in FSHD.
Members of the p38 MAPK family, composed of (X, B, y and 8, isoforms are encoded by separate genes that play a critical role in cellular responses needed for adaptation to stress and survival (reviewed in Whitmarsh 2010, Martin et al., 2014, Krementsov et al., 2013). In many inflammatory diseases, including cardiovascular and other chronic diseases, these same p38 MAPK stress-induced signals can trigger maladaptive responses that aggravate, rather than alleviate, the disease (reviewed in Whitmarsh 2010; Martin et al., 2014). Indeed, in al muscle, a variety of cellular stresses including chronic exercise, insulin exposure and altered endocrine states, myoblast differentiation into myocytes, ve oxygen species, as well as apoptosis, have all been shown to induce the p38 kinase pathway (Keren, et.al., 2006, Zarubin et al., 2006). In fact, the p38 kinase pathway can be activated by a number of external stimuli, including pro-inflammatory cytokines and cellular stress, leading to activation of the ecificity MAPK s MKK3 and MKK6. tion of MKK3 and MKK6, which in turn phosphorylate p38 in its activation loop, trigger ream phosphorylation events. These include phosphorylation of HSP27,MAPKAPK2 (MK2) and a variety of transcription factors culminating in transcriptional changes in the nucleus. A modest number of p3 8-regulated transcripts and a large number of downstream effectors of p38 kinase have been identified (described in Cuenda et al., 2007 and Kyriakis et.al., 2001, Viemann et al. 2004).
Several compounds from different chemical scaffolds that inhibit the p3 80L MAPK signaling y have entered clinical trials in diverse (non-neuromuscular) indications, including rheumatoid arthritis, chronic obstructive pulmonary e, pain, cardiovascular es, and cancer. Inhibition of p3 80L and B in clinical trials has proven to be safe but not efficacious in any of these indications. In vitro and in vivo pharmacology suggest that p3 80L target engagement in these clinical studies was robust, as demonstrated by measuring reduction in phosphorylation of HSP27 (an indirect target) and pMK2 (a direct target). p3 80L MAPK is known to play critical roles in skeletal muscle biology, specifically in abrogating proliferating myoblasts to differentiation and subsequently fusion to form multi- nucleated myotubes. Treatment of muscular dystrophy patients that are constitutively undergoing processes of degeneration and regeneration with p3 80L inhibitors would not be obvious. te knockout (KO) of p3 80L is embryonically lethal. Embryonic rescue allows for survival of pups to a few days postnatal and isolation of satellite cells to study Myogenic precursors g p3 80L.
Myoblasts tely lacking p3 80L express significantly less critical differentiation genes and show severe deficits in . Histology of P2 pups show significantly increased cycling satellite cells and a left-shifted fiber distribution. (Perdiguero et. al, 2007). Importantly, KO of p3 80L in mature muscle (cre driven by Myll promoter) shows no deficiencies in early time points, but mice deficient in p3 80L at 6 months of age show significantly r regeneration and type I fibers, as well as a smaller fiber distribution ed to controls (Wissing et. al, 2014). These data suggest that inhibition of p3 80L would trigger skeletal muscle regeneration in es deficient in regeneration in addition to FSHD by a mechanism independent of regulation of DUX4 expression.
In skeletal muscle, p38 has been shown to regulate gene expression during esis. p3 87 has been shown to be required for myogenesis using both specific gene knock out and conditional knock out ches (Cuenda et.al., 2007; Kerin et.al., 2006; Aouadi et.al., 2006). In the adult, selective inhibitors of p3 80L and B avoid p3 8y-related impact to myogenesis.
The present disclosure finds that p38 is activated during myogenesis, and that inhibition of p3 80L and B by molecules exemplified herein, including FTX-83 9, FTX-l 821, etc., profoundly reduces DUX4 expression and its downstream gene m in FSHD myotubes (data exemplified ). Without wishing to be bound by theory, p3 80L s to directly regulate DUX4 expression by impacting the activity of critical myogenic ers required for pathologic DUX4 expression at the level of the mutated D4Z4 locus with shorter repeats ) or SMCHDl mutations (FSHD2) or when repression is lost by other mechanisms in the muscle of FSHD patients. This is a differentiated mechanism from the previous clinical studies, which targeted functions of p38 in the asm and failed to show cy in numerous diseases, including rheumatoid arthritis, pain, depression, chronic obstructive pulmonary disease, and cardiovascular disease. tors of p38 have never been explored clinically for FSHD.
Definitions As used in this specification and the appended claims, the singular forms “a,” “an” and “the” include plural references unless the content clearly es ise.
As used in this ication, the term “and/or” is used in this disclosure to either “and” or “or” unless indicated otherwise.
Throughout this ication, unless the context requires otherwise, the word ise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the ion of any other t or integer or group of elements or integers.
As used in this application, the terms “about” and “approximately” are used as equivalents. Any numerals used in this application with or without about/approximately are meant to cover any normal ations appreciated by one of ordinary skill in the relevant art.
In certain embodiments, the term “approximately” or “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, %, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
“Administration” refers herein to introducing an agent or composition into a subject or contacting an agent or composition with a cell and/or tissue.
“Treating” or “treatment” of a disease includes: (1) preventing the disease, i.e., causing the clinical symptoms of the disease not to develop in a mammal that may be exposed to or predisposed to the disease but does not yet experience or display symptoms of the disease; (2) inhibiting the disease, i.e., arresting or reducing the development of the disease or its clinical symptoms; or (3) relieving the disease, i.e., causing regression of the disease or its al symptoms.
“A eutically effective amount” means the amount of a compound that, when administered to a mammal for treating a disease, is sufficient to effect such treatment for the disease. The “therapeutically effective amount” will vary depending on the compound, the disease and its severity and the age, weight, etc., of the mammal to be treated.
Certain compounds of the present invention may exist in stereoisomeric forms (e. g. they may contain one or more asymmetric carbon atoms or may exhibit cis-trans isomerism).
Some compounds may include more than one asymmetric carbon atoms. oisomer” refers to a compound that differ in orientation (R/S) about one or more asymmetric carbon atom(s), or differs in orientation (cis:trans) about a double bond. The term stereoisomer may also encompass atropisomers, which arise from hindered rotation about a single bond, e. g., in compounds having a tuted biphenyl moiety. An iomer” is a compound that is a mirror image of r compound, i.e., all asymmetric carbon atoms of an omer exist in opposite orientation (R/S) with respect to the other compound. A “diastereomer” is a compound that is not a mirror image of another compound, but includes one or more asymmetric carbon atoms existing in opposite orientation (R/S) with respect to the other compound. The embodiments of the present invention may include mixtures of stereoisomers, or may include a single stereoisomer. Single enantiomers or diastereomers may be prepared beginning with chiral reagents or by stereoselective or stereospecific synthetic techniques. Alternatively, the single enantiomers or diastereomers may be isolated from es by rd chiral chromatographic or crystallization techniques.
“Isotopically-enriched” refers to a compound wherein one or more atoms is enriched with an e beyond its natural abundance. For example, the natural nce of deuterium is 0.015%. One of ordinary skill in the art recognizes that in all chemical compounds with a H atom, the H atom ly represents a mixture ofH and D, with about 0.015% being D. An isoptically-enriched compound may have one or more specific al sites wherein the H/D ratio is greater than 0.015%. An isotopically-enriched compound may be refered to as isotopically-labeled.
“Solvate” refers to an aggregate of a compound with one or more solvent molecules - a complex of variable iometry formed by a solute and the solvent. Such solvents for the purpose of the invention may not ere with the biological activity of the solute. Examples of suitable solvents include water, methanol, ethanol and acetic acid. ably the solvent used is a pharmaceutically acceptable solvent. Examples of suitable pharmaceutically acceptable solvents include water, ethanol and acetic acid. All such solvates are included within the scope of the present invention. For example, the solvent in any solvate described herein may include water.
“Prodrug” refers to a compound that may be converted under physiological conditions or by solvolysis to the specified compound or to a pharmaceutically able salt of such compound. aceutically acceptable salt” is a salt that retains the biological effectiveness of the free acids and bases of the ied compound and that is not biologically or otherwise undesirable. A compound of the invention may possess a sufficiently acidic, a sufficiently basic, or both functional groups, and accordingly react with any of a number of inorganic or organic bases, and inorganic and organic acids, to form a pharmaceutically able sale. Examples of pharmaceutically acceptable salts include those salts prepared by reaction of the compounds of the present invention with a mineral or organic acid or an nic base. For example, salts of the present invention include, but are not limited to: sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, phosphates, drogenphosphates, dihydrogenphosphates, metaphosphates, pyrophosphates, chlorides, bromides, iodides, acetates, propionates, decanoates, ates, acrylates, formates, iso-butyrates, caproates, heptanoates, propiolates, oxalates, malonates, succinates, suberates, tes, fumarates, maleates, butyn-l,4-dioates, hexyne-l,6-dioates, benzoates, benzoates, methylbenzoates, dinitro-menzoates, hydroxybenzoates, methoxybenzoates, ates, sulfonates, xylenesulfonates, pheylacetates, phenylpropionates, phenylbutyrates, es, lactates, y-hydroxybutyrates, glycollates, tartrates, esulfonates, propanesulfonates, alene-l-sulfonates, naphthalenesulfonates, and mandelates. For example, salts of the present invention include, but are not limited to: Acetate, Benzenesulfonate, Benzoate, Bicarbonate, Bisulfate, Bitartrate, Borate, Bromide, Calcium Edetate, ate, Carbonate, Chloride, Clavulanate, Citrate, Dihydrochloride, Edetate, Edisylate, Estolate, Esylate, Fumarate, Gluceptate, Gluconate, Glutamate, Glycollylarsanilate, Hexylresorcinate, amine, Hydrobromide, Hydrochloride, Hydroxynaphthoate, Iodide, Isethionate, Lactate, ionate, Laurate, Malate, Maleate, Mandelate, Mesylate, Methylbromide, Methylnitrate, Methylsulfate, Monopotassium Maleate, Mucate, Napsylate, Nitrate, N—methylglucamine, Oxalate, te (Embonate), Palmitate, Pantothenate, Phosphate/diphosphate, Polygalacturonate, Potassium, Salicylate, Sodium, Stearate, Subacetate, ate, Tannate, Tartrate, Teoclate, Tosylate, iodide, hylammonium and Valerate. For example, salts of the t invention e, but are not limited to: hydrochloric, sulfuric, phosphoric, diphosphoric, hydrobromic, and nitric or salts of organic acids such as formic, citric, malic, maleic, fumaric, tartaric, succinic, acetic, lactic, esulfonic, enesulfonic, 2-hydroxyethylsulfonic, salicylic and stearic. Similarly, pharmaceutically acceptable cations include, but are not limited to sodium, potassium, calcium, aluminum, lithium and ammonium. For example, salts of the present invention include, but are not limited to: alkali metal salts: sodium salt, potassium salt and the like; alkaline earth metal salt: calcium salt, magnesium salt, barium salt, and the like; aluminum salt and the like. As a suitable example of a salt with an organic base, for example, there are salts with trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N,N’-dibenzylethylenediamine and the like. As a suitable example of a salt with an nic acid, for example, there are salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid and the like. As a suitable example of a salt with an organic acid, for example, there are salts with formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, ic acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid and the like. As a suitable example of a salt with a basic amino acid, for example, there are salts with alginine, lysine, ornithine and the like. As a suitable example of a salt with an acidic amino acid, for example, there are salts with ic acid, glutamic acid and the like.
Methods of Use In several embodiments, a method for treating a disorder responsive to p38 kinase inhibition is provided. The method may include administering to a t in need thereof, an effective amount of a p38 kinase inhibitor selected from one or more of the following Formulae I’-XX[X’: 2018/054642 o N / N (Ir)7 H2N O F F (Hr)7 OH F F O N \ \ o N \ \ )L / JL / N N N o F N N N o F H | H I (III’a), HO (III’b), o N/ A | N/><H 0 (W), F (V’), H | \>—NH2 \N/ N / o N N 0 \ I NE) CI F N\ (VI’), 5 (VII’), \ N' o>\_NH P O NH Q YCfH NH o QN O V N/ k\N’N / 0 (VIII’), _\_ (IX’), WO 71147 CI CI 0 N’ O F \ \ N \\( NVN‘N/ 8 \NJ/ F (XlI’), | (XlII’), HO (XIV’), (XV’), N/ (KC \ N é OH F (XVI’), F (XVH’), Cl ), N (XXV’), / | O o \ N II )b \ \ V \ O P H NH2 F (XXVI’), (XXVII’), (XXVIII’), and F (XXlX’), or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a e f, or a pharmaceutically acceptable salt thereof. The method includes the treatment of disorders associated with DUX4 gene expression, wherein the inhibition of p38 kinase with a p38 kinase inhibitor may reduce DUX4 eXpression levels and/or the eXpression of one or more downstream genes in cells of the subject.
In some embodiments, the p38 kinase inhibitor is a compound selected from Formulae I’-XX[X’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In some embodiments, the p38 kinase inhibitor is selected from Formulae I’, II’, III’a, III’b, and IV’-X[V’, or a isomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In some embodiments, the p38 kinase tor is selected from Formulae I’, 11’, IV’- VIII’, and X’-X[II’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a ceutically acceptable salt thereof.
In one embodiment, the p38 kinase tor is a compound of a I’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a g thereof, a solvate thereof, or a ceutically acceptable salt thereof.
WO 71147 In one embodiment, the p38 kinase inhibitor is a nd of Formula II’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor is a compound of Formula IIIa’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a ceutically acceptable salt thereof.
In one ment, the p38 kinase inhibitor is a nd of Formula IIIb’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor is a nd of Formula IV’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase tor is a compound of Formula V’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase tor is a compound of Formula VI’, or a isomer f, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically able salt thereof.
In one embodiment, the p38 kinase inhibitor is a nd of Formula VII’, or a stereoisomer thereof, an isotopically-enriched nd thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor is a compound of Formula VIII’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor is a compound of Formula IX’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a e thereof, or a ceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor is a compound of Formula X’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a ceutically acceptable salt thereof. 2018/054642 In one ment, the p38 kinase inhibitor is a compound of Formula XI’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug f, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one ment, the p38 kinase inhibitor is a compound of Formula XlI’, or a stereoisomer f, an ically-enriched compound f, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor is a compound of Formula XIII’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor is a compound of Formula X[V’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one ment, the p38 kinase inhibitor is a compound of Formula XV’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase tor is a compound of Formula XVI’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor is a compound of Formula XVII’, or a stereoisomer thereof, an isotopically-enriched nd thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor is a compound of Formula XVIII’, or a stereoisomer thereof, an isotopically-enriched compound f, a g thereof, a solvate thereof, or a pharmaceutically acceptable salt f.
In one embodiment, the p38 kinase inhibitor is a compound of Formula X[X’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug f, a solvate f, or a ceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor is a compound of Formula XX’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor is a compound of Formula XXI’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a ceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor is a compound of Formula XXII’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically able salt thereof.
In one ment, the p38 kinase inhibitor is a compound of Formula XXIII’, or a stereoisomer thereof, an isotopically-enriched nd thereof, a g thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase tor is a compound of Formula XXIV’, or a isomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor is a compound of Formula XXV’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor is a compound of Formula XXVI’, or a stereoisomer thereof, an ically-enriched nd f, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor is a compound of Formula , or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase tor is a compound of Formula XXVIII’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase tor is a compound of Formula XXIX’, or a stereoisomer f, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In many embodiments, the cells are muscle cells. In some embodiments, the cells are terminally-differentiated muscle cells.
In some embodiments, the cells include one or more mutations in a Structural Maintenance Of Chromosomes Flexible Hinge Domain Containing l (SMCHDl) gene. In some embodiments, the cells may include at least one non-deleted 4qA allele.
In many embodiments, the cells may include an increased expression level of a DUX4 polypeptide, or a polypeptide encoded by one or more downstream target genes, as ed to the expression level of a DUX4 polypeptide, or a polypeptide encoded by one or more downstream target genes in a control cell.
In many embodiments, the DUX4 is a DUX4 full length fl).
In some embodiments, the cells may be associated with FSHD.
In some embodiments, the disorder is associated with DUX4 gene expression.
In some embodiments, the disorder is associated with DUX4 gene expression and the DUX4 gene expression may result from the subject haVing less than 10 D4Z4 repeats in the subtelomeric region of chromosome 4q35. In some embodiments, the cells may e a deletion of one or more macrosatellite D4Z4 repeats in the subtelomeric region of some 4q35. In other embodiments, the cells may e less than 7 macrosatellite D4Z4 repeats in the subtelomeric region of chromosome 4q35.
] In some embodiments, the cells may include a ulated D4Z4 array at chromosome 4q35 prior to administration of the p38 kinase inhibitor. In one ment, the cells may include a dysregulated D4Z4 array including fewer than 11 repeat units. In some embodiments, the dysregulated D4Z4 array may include fewer than 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 repeat units.
In some embodiments, the cells are muscle cells and the cells may include a dysregulated D4Z4 array at chromosome 4q35 prior to administration of the p38 kinase inhibitor.
In one embodiment, the muscles cells may include a dysregulated D4Z4 array including fewer than 11 repeat units. In some embodiments, the dysregulated D4Z4 array may include fewer than 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 repeat units.
In some embodiments, the disorder is FSHD. FSHD may include one or more of FSHDl and FSHDZ. In one embodiment, the disorder is FSHDl. In another embodiment, the disorder is FSHDZ. In one embodiment, the disorder is FSHDl and FSHDZ.
In one embodiment, the er is ICF (immunodeficiency, centromeric region ility and facial anomalies).
In one embodiment, the er is amyotrophic lateral sclerosis (ALS).
] In one embodiment, the disorder is inclusion body myopathy (IBM).
] In one embodiment, the disorder is . The cancer may be selected from Ewing’s sarcoma, soft tissue sarcoma, rhabdomyosarcoma, and adult and pediatric B-cell acute lymphoblastic ia.
In some embodiments, the disorder may be selected from one or more of: FSHDl, FSHDZ, ICF, ALS, IBM, Ewing’s sarcoma, soft tissue sarcoma, myosarcoma, and adult and pediatric B-cell acute lymphoblastic leukemia.
In one embodiment, the subject is identified as having FSHD based upon the presence of a transcriptionally active DUX4. In another embodiment, the subject is fied as having FSHD based upon the presence of one or more downstream genes ZSCAN4, LEUTX, PRAMEFZ, TRIM43, 3L2, KHDClL, RFPLZ, CCNAI, 2, TPRXl, PRAMEFZO, TRIM49, PRAMEF4, PRAME6, lS, and ZNF280A in muscle. In another embodiment, the subject is identified as having FSHD based upon the presence of increased expression levels of one or more downstream genes ZSCAN4, LEUTX, PRAMEFZ, TRIM43, l\/fl3D3L2,KHDC1L,RFPL2, CCNAI, SLC34A2, TPRX1,PRAMEF20, TRIM49, PRAMEF4, PRAME6, PRAMEFl 5, and ZNF280A relative to a healthy control. In another embodiment, the subject is identified as having FSHD based upon the presence of a transcriptionally active DUX4 and the presence of downstream genes , LEUTX, Z, TRIM43, lVfl3D3L2, KHDClL, RFPLZ, CCNAI, SLC34A2, TPRX1,PRAMEF20, TRIM49, PRAMEF4, PRAME6, PRAlVlEFl 5, or ZNF280A.
In another embodiment, the method may include measuring the expression level of one or more of: DUX4, ZSCAN4, LEUTX, EFZ, TRIM43, lVfl3D3L2, KHDClL, RFPLZ, CCNAI, SLC34A2, TPRXl, ZO, TRIM49,PRA1VIEF4,PRA1VIE6,PRA1VIEF15, and ZNF280A in the subject prior to the administration of the p38 kinase inhibitor. The method may r include determining that the subject is in need of treatment if the expression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAIVIEFZ, TRIM43, lVfl3D3L2, KHDClL, RFPLZ, CCNAI, SLC34A2, TPRXl, PRAMEFZO, TRIM49,PRA1VIEF4,PRA1VIE6,PRA1VIEF15, and ZNF280A is/are elevated relative to a healthy control.
In another embodiment, the method may include measuring the expression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAMEFZ, TRIM43, lVfl3D3L2, KHDClL, RFPLZ, CCNAI, SLC34A2, TPRXl, PRAMEFZO, TRIM49,PRA1VIEF4,PRA1VIE6,PRA1VIEF15, and ZNF280A in the cells of the t before and after the stration of the p38 kinase inhibitor. The method may include comparing the expression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAIVIEFZ, , lVfl3D3L2, KHDClL, RFPLZ, CCNAl, SLC34A2, TPRXl, PRAIVIEFZO, TRIM49, PRAIVIEF4, PRAlVlE6, PRAIVIEFlS, and ZNF280A in the subject before and after the stration of the p38 kinase inhibitor. The method may include determining the effectiveness of treatment by the comparing of the eXpression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAMEFZ, , ivn3D3L2, KHDClL, RFPL2, CCNAl, SLC34A2, TPRXl, PRAIVIEFZO, TRIM49, PRAIVIEF4, PRAlVlE6, EFlS, and ZNF280A before and after the administration of the p38 kinase inhibitor, wherein a decrease in the eXpression level(s) is indicative of effective treatment.
In some embodiments, the p38 kinase inhibitor reduces one or more downstream genes selected from ZSCAN4, LEUTX, PRAMEFZ, TRIM43, lVfl3D3L2, KHDClL, RFPL2, CCNAI, SLC34A2, TPRXl, PRAMEFZO, TRIM49,PRA1VIEF4,PRA1VIE6,PRA1VIEF15, and ZNF280A.
] In one embodiment, the p38 kinase inhibitor reduces lVfl3D3L2.
In one embodiment, the p38 kinase inhibitor reduces ZSCAN4.
In one embodiment, the p38 kinase inhibitor s LEUTX.
In one embodiment, the p38 kinase inhibitor reduces PRAMEFZ.
In one embodiment, the p38 kinase inhibitor reduces TRIM43.
In one ment, the p38 kinase inhibitor reduces KHDClL.
In one ment, a transcriptional modulator of DUX4 and downstream genes ZSCAN4, LEUTX, EFZ, TRIM43, lVfl3D3L2, KHDClL, RFPLZ, CCNAl, SLC34A2, TPRXl, PRAIVIEFZO, TRIM49, PRAIVIEF4, E6, PRAIVIEFlS, and ZNF280A are inhibited by p38 kinase.
In some embodiments, the administering may be combined with clinical management involving physical therapy, aerobic exercise, respiratory function therapy, orthopedic interventions.
In some embodiments, the administering includes administering of the p38 kinase inhibitor with another pharmaceutical agent.
In some embodiments, the administering includes administering of the p38 kinase inhibitor with another pharmaceutical agent for the treatment of FSHD.
] In some embodiments, the administering causes a decrease in muscle ration.
In some embodiments, the administering causes a reduction in apoptosis of muscle cells in the subject. In one embodiment, the muscles cells are terminally differentiated.
In several embodiments, a method for treating facioscapulohumeral muscular dystrophy (FSHD) is provided. The method may include stering to a subject in need thereof, an effective amount of a p38 kinase inhibitor ed from one or more of ae I’- XXIX’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In some embodiments, the p38 kinase inhibitor is selected from Formulae I’-XX[X’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a g thereof, a solvate thereof, or a pharmaceutically acceptable salt f.
In some embodiments, the p38 kinase inhibitor is selected from Formulae I’, II’, III’a, III’b, and IV’-X[V’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a ceutically acceptable salt thereof.
In some embodiments, the p38 kinase inhibitor is selected from Formulae I’, 11’, IV’- VIII’, and X’-X[II’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of Formula I’, or a stereoisomer thereof, an isotopically-enriched nd thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
] In one embodiment, the p38 kinase tor may e a compound of Formula II’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt f.
In one embodiment, the p38 kinase inhibitor may include a compound of Formula IIIa’, or a isomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a e thereof, or a pharmaceutically able salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of Formula IIIb’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of Formula IV’, or a stereoisomer thereof, an isotopically-enriched compound f, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of Formula V’, or a stereoisomer thereof, an isotopically-enriched nd thereof, a prodrug thereof, a e thereof, or a pharmaceutically acceptable salt thereof.
] In one embodiment, the p38 kinase inhibitor may e a compound of a VI’, or a stereoisomer thereof, an isotopically-enriched compound f, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one ment, the p38 kinase inhibitor may include a compound of Formula VII’, or a stereoisomer thereof, an ically-enriched compound f, a prodrug f, a solvate thereof, or a pharmaceutically acceptable salt thereof.
] In one embodiment, the p38 kinase inhibitor may e a compound of Formula VIII’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of a IX’, or a stereoisomer thereof, an ically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of a X’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of Formula XI’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of Formula XlI’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of Formula XIII’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a g thereof, a solvate thereof, or a pharmaceutically acceptable salt f.
In one embodiment, the p38 kinase inhibitor may include a nd of Formula X[V’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug f, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of Formula XV’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug f, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of Formula XVI’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of Formula XVII’, or a stereoisomer thereof, an ically-enriched nd thereof, a prodrug thereof, a e thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor may e a compound of Formula XVIII’, or a stereoisomer thereof, an isotopically-enriched nd thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one ment, the p38 kinase inhibitor may include a compound of a X[X’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of Formula XX’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a ceutically acceptable salt thereof.
In one ment, the p38 kinase inhibitor may include a compound of Formula XXI’, or a stereoisomer thereof, an ically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor may include a nd of Formula XXII’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug f, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of Formula XXIII’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically able salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of Formula XXIV’, or a stereoisomer f, an isotopically-enriched compound f, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor may e a compound of Formula XXV’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically able salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of Formula XXVI’, or a isomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of Formula , or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically able salt thereof.
In one embodiment, the p38 kinase inhibitor may include a compound of Formula XXVIII’, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
] In one embodiment, the p38 kinase inhibitor may include a compound of Formula XXIX’, or a stereoisomer f, an isotopically-enriched nd thereof, a g thereof, a solvate f, or a pharmaceutically acceptable salt thereof.
In some embodiments, the disorder is FSHD. FSHD may include one or more of FSHDl and FSHDZ. In one embodiment, the disorder is FSHDl. In another embodiment, the disorder is FSHD2. In one embodiment, the disorder is FSHDl and FSHDZ.
In several embodiments, a method for treating a disorder sive to p38 kinase inhibition is provided. The method may include administering to a subject in need thereof, an effective amount of a p38 kinase inhibitor of Formula V’: 40 N’I EX F (V’), or a stereoisomer f, an isotopically-enriched compound thereof, a g thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof. The method includes the treatment of disorders associated with DUX4 gene expression, wherein the inhibition of p38 kinase with a p38 kinase tor may reduce DUX4 eXpression levels and/or the eXpression of one or more downstream genes in cells of the subject.
In many embodiments, the cells are muscle cells. In some embodiments, the cells are terminally-differentiated muscle cells.
In some embodiments, the cells include one or more ons in a Structural Maintenance Of Chromosomes Flexible Hinge Domain Containing l (SMCHDl) gene. In some embodiments, the cells may include at least one non-deleted 4qA allele.
In many embodiments, the cells may e an increased eXpression level of a DUX4 ptide, or a polypeptide encoded by one or more downstream target genes, as compared to the eXpression level of a DUX4 polypeptide, or a polypeptide d by one or more downstream target genes in a control cell.
In many embodiments, the DUX4 is a DUX4 full length (DUX4-fl).
In some embodiments, the cells may be associated with FSHD.
In some embodiments, the disorder is associated with DUX4 gene eXpression.
In some embodiments, the disorder is associated with DUX4 gene eXpression and the DUX4 gene eXpression may result from the t having less than 10 D4Z4 repeats in the subtelomeric region of chromosome 4q35. In some embodiments, the cells may include a deletion of one or more macrosatellite D4Z4 repeats in the subtelomeric region of chromosome 4q35. In other embodiments, the cells may include less than 7 macrosatellite D4Z4 repeats in the omeric region of chromosome 4q35.
In some embodiments, the cells may include a dysregulated D4Z4 array at chromosome 4q35 prior to stration of the p38 kinase inhibitor. In one embodiment, the cells may include a dysregulated D4Z4 array including fewer than 11 repeat units. In some ments, the dysregulated D4Z4 array may include fewer than ll, 10, 9, 8, 7, 6, 5, 4, 3, or 2 repeat units.
In some embodiments, the cells are muscle cells and the cells may include a dysregulated D4Z4 array at chromosome 4q35 prior to administration of the p38 kinase inhibitor.
In one embodiment, the muscles cells may include a dysregulated D4Z4 array including fewer than 11 repeat units. In some embodiments, the dysregulated D4Z4 array may include fewer than ll, 10, 9, 8, 7, 6, 5, 4, 3, or 2 repeat units.
In some embodiments, the er is FSHD. FSHD may include one or more of FSHDl and FSHDZ. In one embodiment, the disorder is FSHDl. In another embodiment, the disorder is FSHDZ. In one embodiment, the disorder is FSHDl and FSHDZ.
] In one embodiment, the disorder is ICF.
] In one ment, the disorder is ALS.
In one embodiment, the disorder is IBM.
] In one embodiment, the disorder is cancer. The cancer may be selected from Ewing’s sarcoma, soft tissue sarcoma, rhabdomyosarcoma, and adult and pediatric B-cell acute blastic leukemia.
In some embodiments, the disorder may be selected from one or more of: FSHDl, FSHDZ, ICF, ALS, IBM, Ewing’s sarcoma, soft tissue sarcoma, rhabdomyosarcoma, and adult and pediatric B-cell acute lymphoblastic leukemia.
In one embodiment, the subject is identified as having FSHD based upon the presence of a riptionally active DUX4. In another embodiment, the subject is identified as having FSHD based upon the presence of one or more downstream genes ZSCAN4, LEUTX, PRAMEFZ, TRIM43, ivn3D3L2, KHDCIL, RFPLZ, CCNAl, SLC34A2, TPRXl, PRAMEFZO, TRIM49, PRAMEF4, PRAME6, PRAMEFlS, and ZNF28OA in muscle. In another embodiment, the subject is identified as having FSHD based upon the presence of increased eXpression levels of one or more downstream genes ZSCAN4, LEUTX, PRAMEFZ, TRIM43, 3L2,KHDC1L,RFPL2, CCNAI, 2, TPRX1,PRAMEF20, TRIM49, PRAMEF4, PRAME6, PRAMEFl 5, and ZNF28OA relative to a healthy l. In another embodiment, the subject is fied as having FSHD based upon the presence of a transcriptionally active DUX4 and the presence of one or more downstream genes ZSCAN4, LEUTX, PRAMEFZ, TRIM43, WO 71147 l\/fl3D3L2,KHDC1L,RFPL2, CCNAI, SLC34A2, TPRX1,PRAMEF20, TRIM49, PRAMEF4, PRAlVlE6, PRAlVlEFl 5, and ZNF280A.
In another embodiment, the method may e measuring the expression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAIVIEFZ, TRIM43, lVfl3D3L2, , RFPLZ, CCNAI, SLC34A2, TPRXl, PRAMEFZO, TRIM49,PRA1VIEF4,PRA1VIE6,PRA1VIEF15, and ZNF280A in the subject prior to the administration of the p38 kinase inhibitor. The method may further include determining that the subject is in need of treatment if the expression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAIVIEFZ, TRIM43, lVfl3D3L2, KHDClL, RFPLZ, CCNAI, 2, TPRXl, PRAMEFZO, TRIM49,PRA1VIEF4,PRA1VIE6,PRA1VIEF15, and ZNF280A is/are elevated relative to a healthy control.
In r embodiment, the method may include measuring the expression level of one or more of: DUX4, ZSCAN4, LEUTX, EFZ, TRIM43, lVfl3D3L2, KHDClL, RFPLZ, CCNAI, SLC34A2, TPRXl, PRAMEFZO, TRIM49,PRA1VIEF4,PRA1VIE6,PRA1VIEF15, and ZNF280A in the cells of the subject before and after the administration of the p38 kinase inhibitor. The method may include comparing the expression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAIVIEFZ, TRIM43, lVfl3D3L2, KHDClL, RFPLZ, CCNAl, SLC34A2, TPRXl, PRAIVIEFZO, TRIM49, PRAIVIEF4, PRAlVlE6, PRAIVIEFlS, and ZNF280A in the subject before and after the stration of the p38 kinase inhibitor. The method may include determining the effectiveness of treatment by the comparing of the expression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAMEFZ, TRIM43, l\/fl3D3L2, , RFPLZ, CCNAI, SLC34A2, TPRXl, PRAMEFZO, TRIM49,PRA1VIEF4,PRA1VIE6,PRA1VIEF15, and A before and after the administration of the p38 kinase inhibitor, wherein a decrease in the expression level(s) is indicative of effective treatment.
In some embodiments, the p38 kinase inhibitor reduces one or more downstream genes selected from ZSCAN4, LEUTX, PRAMEFZ, TRIM43, lVfl3D3L2, KHDClL, RFPLZ, CCNAI, SLC34A2, TPRXl, ZO, TRIM49,PRA1VIEF4,PRA1VIE6,PRA1VIEF15, and ZNF280A.
In one embodiment, the p38 kinase inhibitor reduces MBD3L2.
In one embodiment, the p38 kinase inhibitor reduces ZSCAN4.
In one embodiment, the p38 kinase inhibitor reduces LEUTX.
In one embodiment, the p38 kinase inhibitor s PRAMEFZ.
WO 71147 In one embodiment, the p38 kinase inhibitor reduces TRIM43.
In one embodiment, the p38 kinase inhibitor reduces KHDClL.
In one embodiment, a transcriptional modulator of DUX4 and downstream genes , LEUTX, PRAIVIEFZ, TRIM43, lVfl3D3L2, KHDClL, RFPLZ, CCNAl, SLC34A2, TPRXl, PRAIVIEFZO, TRIM49, EF4, PRAlVlE6, PRAlVlEFlS, and ZNF280A are inhibited by p38 kinase.
In some embodiments, the administering may be combined with clinical management involving physical therapy, aerobic exercise, respiratory function therapy, orthopedic interventions.
In some embodiments, the stering includes administering of the p38 kinase tor with r pharmaceutical agent.
] In some embodiments, the administering includes administering of the p38 kinase inhibitor with another pharmaceutical agent for the treatment of FSHD.
In some ments, the administering causes a decrease in muscle degeneration.
In some embodiments, the administering causes a reduction in apoptosis of muscle cells in the subject. In one embodiment, the muscles cells are terminally differentiated.
In several embodiments, a method for treating facioscapulohumeral muscular dystrophy (FSHD) is provided. The method may include stering to a subject in need f, an effective amount of a p38 kinase inhibitor of Formula V’: 40 N/I fix F (V’), or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In some embodiments, the disorder is FSHD. FSHD may include one or more of FSHDl and FSHDZ. In one embodiment, the disorder is FSHDl. In another embodiment, the disorder is FSHDZ. In one embodiment, the disorder is FSHDl and FSHDZ.
In several ments, a method for treating a disorder responsive to p38 kinase inhibition is provided. The method may include administering to a subject in need thereof, an effective amount of a p38 kinase inhibitor selected from one or more of Formulae I-XlII (of Genuses I-XIII described below), or a isomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt f. The method includes the treatment of disorders associated with DUX4 gene expression, wherein the inhibition of p38 kinase with a p38 kinase inhibitor may reduce DUX4 expression levels and/or the expression of one or more downstream genes in cells of the subject.
In many embodiments, the cells are muscle cells. In some embodiments, the cells are terminally-differentiated muscle cells.
In some embodiments, the cells e one or more mutations in a Structural Maintenance Of Chromosomes Flexible Hinge Domain Containing l (SMCHDl) gene. In some embodiments, the cells may include at least one non-deleted 4qA allele.
In many embodiments, the cells may include an increased expression level of a DUX4 polypeptide, or a polypeptide encoded by one or more downstream target genes, as compared to the expression level of a DUX4 polypeptide, or a polypeptide encoded by one or more downstream target genes in a l cell.
In many embodiments, the DUX4 is a DUX4 full length (DUX4-fl).
In some ments, the cells may be associated with FSHD.
In some embodiments, the disorder is associated with DUX4 gene sion.
In some embodiments, the disorder is associated with DUX4 gene expression and the DUX4 gene expression may result from the subject having less than 10 D4Z4 repeats in the subtelomeric region of chromosome 4q35. In some embodiments, the cells may include a deletion of one or more macrosatellite D4Z4 repeats in the subtelomeric region of chromosome 4q35. In other ments, the cells may e less than 7 macrosatellite D4Z4 repeats in the subtelomeric region of chromosome 4q35.
In some embodiments, the cells may e a dysregulated D4Z4 array at chromosome 4q35 prior to administration of the p38 kinase inhibitor. In one embodiment, the cells may include a ulated D4Z4 array including fewer than 11 repeat units. In some embodiments, the dysregulated D4Z4 array may include fewer than ll, 10, 9, 8, 7, 6, 5, 4, 3, or 2 repeat units.
In some embodiments, the cells are muscle cells and the cells may include a dysregulated D4Z4 array at chromosome 4q35 prior to administration of the p38 kinase inhibitor.
In one ment, the muscles cells may include a dysregulated D4Z4 array including fewer than 11 repeat units. In some embodiments, the dysregulated D4Z4 array may include fewer than ll, 10, 9, 8, 7, 6, 5, 4, 3, or 2 repeat units.
In some embodiments, the disorder is FSHD. FSHD may include one or more of FSHDl and FSHDZ. In one embodiment, the disorder is FSHDl. In another embodiment, the disorder is FSHD2. In one embodiment, the disorder is FSHDl and FSHDZ.
In one embodiment, the disorder is ICF.
] In one embodiment, the er is ALS.
In one embodiment, the disorder is IBM.
In one embodiment, the er is cancer. The cancer may be selected from Ewing’s sarcoma, soft tissue sarcoma, myosarcoma, and adult and pediatric B-cell acute lymphoblastic leukemia.
In some embodiments, the disorder may be ed from one or more of: FSHDl, FSHDZ, ICF, ALS, IBM, Ewing’s sarcoma, soft tissue sarcoma, rhabdomyosarcoma, and adult and pediatric B-cell acute lymphoblastic leukemia.
] In one embodiment, the t is identified as having FSHD based upon the presence of a transcriptionally active DUX4. In another embodiment, the subject is identified as having FSHD based upon the presence of one or more downstream genes ZSCAN4, LEUTX, Z, TRIM43, l\/fl3D3L2, KHDCIL, RFPL2, CCNAl, SLC34A2, TPRXl, PRAMEFZO, TRIM49, PRAMEF4, PRAME6, PRAMEFlS, and A in muscle. In another embodiment, the subject is identified as having FSHD based upon the presence of increased sion levels of one or more downstream genes ZSCAN4, LEUTX, PRAMEFZ, TRIM43, l\/fl3D3L2,KHDC1L,RFPL2, CCNAI, SLC34A2, TPRX1,PRAMEF20, TRIM49, PRAMEF4, PRAME6, PRAMEFl 5, and ZNF28OA ve to a healthy control. In another embodiment, the subject is identified as having FSHD based upon the presence of a transcriptionally active DUX4 and the presence of one or more downstream genes ZSCAN4, LEUTX, PRAMEFZ, TRIM43, 2018/054642 l\/fl3D3L2,KHDC1L,RFPL2, CCNAI, 2, TPRX1,PRAMEF20, TRIM49, PRAMEF4, PRAlVlE6, PRAlVlEFl 5, and ZNF280A.
In another embodiment, the method may include measuring the expression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAIVIEFZ, TRIM43, L2, , RFPL2, CCNAI, SLC34A2, TPRXl, PRAMEFZO, TRIM49,PRA1VIEF4,PRA1VIE6,PRA1VIEF15, and ZNF280A in the subject prior to the administration of the p38 kinase inhibitor. The method may further include determining that the subject is in need of treatment if the expression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAIVIEFZ, , L2, KHDClL, RFPL2, CCNAI, 2, TPRXl, PRAMEFZO, TRIM49,PRA1VIEF4,PRA1VIE6,PRA1VIEF15, and ZNF280A is/are ed relative to a healthy control.
In another ment, the method may e measuring the expression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAIVIEFZ, TRIM43, lVfl3D3L2, KHDClL, RFPL2, CCNAI, SLC34A2, TPRXl, PRAMEFZO, TRIM49,PRA1VIEF4,PRA1VIE6,PRA1VIEF15, and ZNF280A in the cells of the subject before and after the administration of the p38 kinase inhibitor. The method may include ing the expression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAIVIEFZ, TRIM43, lVfl3D3L2, KHDClL, RFPL2, CCNAl, SLC34A2, TPRXl, PRAIVIEFZO, TRIM49, PRAIVIEF4, PRAlVlE6, PRAIVIEFlS, and ZNF280A in the subject before and after the administration of the p38 kinase inhibitor. The method may include determining the effectiveness of treatment by the comparing of the expression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAMEFZ, TRIM43, l\/fl3D3L2, KHDClL, RFPL2, CCNAI, SLC34A2, TPRXl, PRAMEFZO, TRIM49,PRA1VIEF4,PRA1VIE6,PRA1VIEF15, and ZNF280A before and after the administration of the p38 kinase inhibitor, wherein a decrease in the sion level(s) is indicative of effective treatment.
In some embodiments, the p38 kinase inhibitor reduces one or more downstream genes selected from ZSCAN4, LEUTX, PRAMEFZ, , lVfl3D3L2, KHDClL, RFPL2, CCNAI, SLC34A2, TPRXl, PRAMEFZO, TRIM49,PRA1VIEF4,PRA1VIE6,PRA1VIEF15, and ZNF280A.
In one embodiment, the p38 kinase inhibitor reduces MBD3L2.
In one embodiment, the p38 kinase inhibitor reduces ZSCAN4.
In one embodiment, the p38 kinase inhibitor reduces LEUTX.
In one ment, the p38 kinase inhibitor reduces PRAMEFZ.
In one embodiment, the p38 kinase inhibitor reduces TRIM43.
In one embodiment, the p38 kinase inhibitor reduces KHDClL.
In one embodiment, a transcriptional modulator of DUX4 and ream genes ZSCAN4, LEUTX, PRAIVIEFZ, TRIM43, lVfl3D3L2, KHDClL, RFPLZ, CCNAl, SLC34A2, TPRXl, PRAIVIEFZO, TRIM49, PRAlVlEF4, E6, PRAlVlEFlS, and ZNF280A are inhibited by p38 kinase.
In some embodiments, the administering may be combined with al management involving physical therapy, aerobic exercise, respiratory function y, edic interventions.
In some embodiments, the administering includes administering of the p38 kinase inhibitor with another pharmaceutical agent.
In some embodiments, the administering includes stering of the p38 kinase inhibitor with another pharmaceutical agent for the treatment of FSHD.
In some embodiments, the stering causes a decrease in muscle ration.
] In some embodiments, the administering causes a reduction in apoptosis of muscle cells in the subject. In one embodiment, the muscles cells are terminally differentiated.
In several embodiments, a method for ng facioscapulohumeral muscular dystrophy (FSHD) is provided. The method may e administering to a subject in need thereof, an effective amount of a p38 kinase inhibitor selected from one or more of Formulae I- XIII (of Genuses I-XIII described below), or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically able salt thereof.
In some embodiments, the p38 kinase inhibitor is selected from one or more of Genuses I-XIII characterized by Formulae I-X[II. Each chemical identifier, e.g., R1, R2, X, Z, and the like, is unique to the Genus under which it is described. Likewise, each definition of any such chemical identifiers or al nomenclature terms, e.g., aryl, heteroaryl, alkynyl, and the like, are unique to the Genus under which it is described. If any such al nomenclature term is not specifically defined for a particular Genus, the term shall be construed to involve the definition understood by a person of ordinary skill in the art.
] In one embodiment, the p38 kinase inhibitor is selected from Genus I, II, III, IV, V, VI, VII, VIII, IX, X, X[, XII, and XIII, or any combination thereof. For example, the p38 kinase inhibitor may be selected from Genus I, II and III. For example, the p38 kinase inhibitor may be selected from Genus III and V.
] In one embodiment, the p38 kinase inhibitor is selected from Genus I.
In one embodiment, the p38 kinase inhibitor is selected from Genus II.
In one embodiment, the p38 kinase tor is selected from Genus III.
In one embodiment, the p38 kinase inhibitor is ed from Genus IV.
In one ment, the p38 kinase inhibitor is selected from Genus V.
In one embodiment, the p38 kinase inhibitor is selected from Genus VI.
In one embodiment, the p38 kinase inhibitor is selected from Genus VII.
In one embodiment, the p38 kinase tor is ed from Genus VIII.
In one embodiment, the p38 kinase inhibitor is selected from Genus IX.
In one embodiment, the p38 kinase tor is selected from Genus X.
In one embodiment, the p38 kinase inhibitor is selected from Genus XI.
In one embodiment, the p38 kinase inhibitor is selected from Genus XII.
In one embodiment, the p38 kinase inhibitor is selected from Genus XIII.
In one embodiment, the p38 kinase inhibitor is selected from Genus I, II, III, V, VI, VII, VIII, X, X[, X11, and XIII.
Genus I Description Compounds of Genus I can be prepared according to the disclosure of US 7,276,527, which is herein incorporated herein by reference in its entirety.
Genus I is characterized by optionally N—oxidized compounds of Formula (I): RZ—Z— \ WW or stereoisomers thereof, isotopically-enriched compounds f, prodrugs thereof, solvates thereof, and pharmaceutically acceptable salts thereof; WO 71147 wherein: R1 is ed from: (i) hydrogen, (ii) a group selected from C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3.6cycloalkyl, C644 aryl, and C746 aralkyl group, wherein the C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-6cycloalkyl, C644 aryl, or C746 aralkyl is optionally substituted with one or more substituents selected from a Substituent Group A, (iii) —(C=O)—R5, —(C=O)—OR5, —(C=O)—NR5R6, —(C=S)—NHR5, or —SOz—R7, wherein: R5 en, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-6 cycloalkyl, C644 aryl, or C746 aralkyl, wherein the C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3.6 cycloalkyl, C644 aryl, or C746 l is optionally substituted with one or more substituents selected from the tuent Group A, R6 is hydrogen or C1-6 alkyl, R7 is C1-6 alkyl, C2.6alkenyl, C2-6 alkynyl, C3-6 cycloalkyl, a C644 aryl, or C746 aralkyl, wherein the C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3.6 cycloalkyl, C644 aryl, or C746 aralkyl is optionally substituted with one or more substituents selected from the Substituent Group A, or (iV) an amino group optionally substituted with substituents selected from: (a) C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3.6 cycloalkyl, C644 aryl, or C746 aralkyl, wherein the C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3.6 cycloalkyl, C644 aryl, and a C746 aralkyl is optionally substituted with one or more substituents selected from the Substituent Group A, (b) —(C=O)—R5, —(C=O)—OR5, —(C=O)—NR5R6, —(C=S)—NHR5, or —s02—R7, and (c) C1.6 alkylidene optionally substituted with one or more substituents selected from the Substituent Group A R2 is a C644 monocyclic or fused polycyclic aryl optionally substituted with one or more substituents selected from the Substituent Group A; R3 is hydrogen or C644 aryl, n the C644 aryl is optionally substituted with one more substituents selected from the Substituent Group A; X is —S—, S(O)—, or ; Y is a bond, —O—,—S—, S(O)—, S(O)2—, or NR4, wherein R4 is: (a) hydrogen, (b) C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3.6 cycloalkyl, C644 aryl, or C746 aralkyl, wherein the C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3.6 cycloalkyl, C644 aryl, and C7— 16 aralkyl is optionally substituted with one or more substituents ed from the tuent Group A, or (c) —(C=O)—R5, —(C=O)—OR5, —(C=O)—NR5R6, —NHR5, or 7; Z is a bond, C145 alkylene, C246 alkenylene, or C246 lene, wherein the C145 alkylene, C246 alkenylene, or C246 alkynylene is optionally substituted with one or more substituents selected from the Substituent Group A; and a tuent of the Substituent Group A is selected from: oxo, halogen, C1-3 alkylenedioxy, nitro, cyano, optionally halogenated C16 alkyl, optionally halogenated C2.6 alkenyl, carboxy C2.6 alkenyl, optionally halogenated C2-6 alkynyl, ally halogenated C3-6 cycloalkyl, C6- 14 aryl, optionally halogenated Cl-S alkoxy, C1-6 alkoxy-carbonyl-C1—6 alkoxy, hydroxy, C6- 14 aryloxy, C746 aralkyloxy, to, optionally halogenated C1.6 alkylthio, C644 arylthio, C7— 16aralkylthio, amino, mono-C16 mino, mono-C644 arylamino, di-C1.6alkylamino, di-C6— 14 arylamino, formyl, carboxy, C1.6 alkyl-carbonyl, C3-6cycloalkyl-carbonyl, C1-6 alkoxy- carbonyl, C644 aryl-carbonyl, C746 aralkyl-carbonyl, C644 aryloxy-carbonyl, C746 aralkyloxycarbonyl , carbamoyl, thiocarbamoyl, mono-C16 alkyl-carbamoyl, di-C1-6 alkyl-carbamoyl, C6- 14aryl-carbamoyl, C1.6 ulfonyl, C644 arylsulfonyl, C1-6 alkylsulfinyl, C644arylsulfinyl, formylamino, C1.6 alkyl-carbonylamino, C644 aryl-carbonylamino, C1-6 alkoxy- carbonylamino, C1.6 alkylsulfonylamino, C644 arylsulfonylamino, C1.6 alkyl-carbonyloxy, C6- 14 aryl-carbonyloxy, C1-6 -carbonyloxy, mono-C16 alkyl-carbamoyloxy, di-C1—6 alkyl- carbamoyloxy, C644 arbamoyloxy, sulfo, oyl, sulfinamoyl and sulfenamoyl.
In some embodiments, the p3 8 kinase inhibitor from Genus I is selected from the following: ] (F) N— [ 5- zoylaminopyridyl)(3 , 5-dimethylphenyl)- l ,3 -thiazol yl]acetamide; (2-benzylaminopyridyl)(3 , 5-dimethylphenyl)- l ,3 -thiazolyl]acetamide; \I-[4-[4-(4-methoxyphenyl)methyl-l ,3-thiazolyl]pyridyl]benzamide, \I-[4-[2-(4-fluorophenyl)(3-methylphenyl)- l ,3 -thiazolyl] pyridyl]phenylacetamide; \I-[4-[2-ethyl(3 -methylphenyl)- l ,3-thiazolyl]pyridyl]phenylacetamide; \I-[4-[4-(3 -methylphenyl)propyl- l ,3-thiazolyl]pyridyl]phenylacetamide; \I-[4-[2-butyl(3-methylphenyl)- l ,3 -thiazolyl]pyridyl]phenylacetamide; \I-[4- [4-(3-methylphenyl)(4-methylthiophenyl)-l ,3-thiazolyl] pyridyl]phenylacetamide; N—[4-[2-ethyl(3 -methylphenyl)- l ,3-thiazolyl]pyridyl]benzamide, N—[4-[2-ethyl(3 -methylphenyl)-l ,3-thiazolyl]pyridyl] phenylpropionamide; N—[4-[2-ethy1—4-(3 -methy1pheny1)-1,3-thiazoly1]pyridy1](4- methoxypheny1)propionamide; N—[4-[2-ethy1—4-(3 -methy1pheny1)-1,3-thiazoly1]pyridy1]pheny1butyramide; N—[4-[4-(3 -methy1pheny1)propyl-1,3-thiazoly1]pyridy1]benzamide; 4-(3 -methy1pheny1)propy1—1,3-thiazoly1]pyridy1] phenylpropionamide; N—[4-[2-buty1—4-(3-methy1pheny1)-1,3 -thiazoly1]pyridy1]benzamide; N—[4-[2-buty1—4-(3-methy1pheny1)-1,3 -thiazoly1]pyridy1] phenylpropionamide; N—[4-[2-(4-fluoropheny1)(3-methy1pheny1)-1,3 oly1]pyridy1]benzamide; N—[4-[2-(4-fluoropheny1)(3-methy1pheny1)-1,3 -thiazoly1]pyridy1]-3 - phenylpropionamide; ] N—[4-[4-(3-methy1pheny1)(4-methylthiopheny1)-1 ,3-thiazoly1] pyridy1]benzamide; N—[4-[4-(3-methy1pheny1)(4-methy1thiopheny1)-1,3-thiazoly1]pyridy1]-3 - phenylpropionamide; N—benzyl-N—[4-[2-ethy1(3-methy1phenyl)-1,3-thiazoly1]pyridy1]amine; ] N—[4-[2-ethy1—4-(3 -methy1pheny1)-1,3-thiazoly1]pyridy1]-N—(2- phenylethy1)amine; N—[4-[2-ethy1—4-(3 -methy1pheny1)-1,3-thiazoly1]pyridy1]-N—(3- phenylpropyl)amine; N—benzyl-N—[4- [4-(3 1phenyl)propy1-1,3 -thiazoly1]pyridy1]amine; ] N—[4-(4-(3 -methy1pheny1)propy1-1,3 -thiazoly1]pyridy1]-N—(2- phenylethy1)amine; N—[4-[4-(3 -methy1pheny1)propy1-1 ,3-thiazoly1]pyridy1]-N—(3 - phenylpropyl)amine; N—benzyl-N—[4-[2-buty1—4-(3-methy1pheny1)-1,3-thiazoly1]pyridy1]amine; N—(4-[2-buty1—4-(3-methy1pheny1)-1,3 -thiazoly1]pyridy1]-N—(2- phenylethy1)amine; N—[4-[2-buty1—4-(3-methy1pheny1)-1,3 -thiazoly1]pyridy1]-N—(3 - phenylpropyl)amine; N—benzyl-N—[4-[4-(3-methy1pheny1)(4-methy1thiophenyl)-1,3-thiazoly1] pyridy1]amine; N—[4-[4-(3-methy1pheny1)(4-methylthiopheny1)-1,3-thiazoly1]pyridy1]-N—(2- phenylethy1)amine N—[4-[4-(3-methy1pheny1)(4-methylthiopheny1)-1,3-thiazoly1]pyridy1]-N—(3- phenylpropyl)amine; N—[4- [4-(3 -methy1pheny1)(4-methylsulfony1phenyl)-1,3 -thiazoly1] pyridy1]benzamide N—[4- [4-(3 -methy1pheny1)(4-methylsulfony1phenyl)-1,3 -thiazoly1] pyridy1]phenylacetamide N—[4- [4-(3 1pheny1)(4-methylsulfony1phenyl)-1,3 oly1] pyridy1]-3 - phenylpropionamide N—benzyl-N—[4- [4-(3-methy1pheny1)(4-methylsulfony1phenyl)- 1 ,3-thiazoly1] pyridy1]amine; ] N—[4- [4-(3 -methy1pheny1)(4-methylsulfony1phenyl)-1,3 -thiazoly1] pyridy1]- N—(3 -pheny1propyl)amine; ] N—[4- [4-(3 -methy1pheny1)(4-methylsulfony1phenyl)-1,3 -thiazoly1] pyridy1]- N—(2-phenylethyl)amine; ] N—(4-fluorobenzy1)-N—[4- [4-(3 -methy1pheny1)(4-methylsu1fonylphenyl)-1,3- thiazol-S-yl]pyridy1]amine; (E) [4-(3 , 5-dimethylpheny1)(2-pheny1methyloxypyridy1)-1,3 -thiazol y1]amine; N—[4-[2-benzoylamino(4-methoxyphenyl)-1,3 -thiazoly1]pyridy1]benzamide; N—[4-(4-methoxyphenyl)[2-[(3 -pyridy1carbonylamino)]pyridy1]-1,3 -thiazol y1]nicotinamide; ] -[-4[2-amino(4-methoxyphenyl)-1,3-thiazoly1]pyridy1]benzamide; -[-4 [2-amino(3,5-dimethy1phenyl)-1,3-thiazoly1]pyridy1]benzamide; -[-4 [2-amino(3,5-dimethy1pheny1)-1,3-thiazoly1]pyridy1]benzylamine; -[-4 [2-amino(3,5-dimethy1phenyl)-1,3-thiazoly1]pyridy1]benzamide; hydrochloride; N—[4-[2-amino(3,5-dimethylphenyl)-l,3-thiazolyl]pyridyl]benzylamine dihydrochloride; and N—(4-(2-ethyl(3-methylphenyl)-l,3-thiazolyl]pyridyl]benzamide (“TAK- 715”), Formula (I’).
In one embodiment, the p38 kinase inhibitor is N—(4-(2-ethyl(3-methylphenyl)-l,3- thiazolyl]pyridyl]benzamide (“TAK-715”), Formula (I’).
Genus I Definitions In the aforementioned Formula, R1 represents a hydrogen atom, a hydrocarbon group optionally having substituents, a heterocyclic group optionally haVing substituents, an amino group optionally haVing substituents or acyl group.
As “acyl group” represented by R1, for example, there are an acyl group ented by the Formula: —(C=O)—R5, —(C=O)—OR5, —(C=O)—NR5R6, —(C=S)—NHR5 or — SOz—R7 (wherein R5 represents a en atom, a hydrocarbon group optionally having substituents or a heterocyclic group optionally haVing substituents, R6 represents a hydrogen atom or a C1.6alkyl, R7 represents a hydrocarbon group optionally haVing substituents or a cyclic group optionally having substituents) and the like.
In the entioned a, as “hydrocarbon group” of “hydrocarbon group optionally haVing substituents”, for example, there are an acyclic or cyclic hydrocarbon group (for example, alkyl, l, alkynyl, lkyl, aryl, aralkyl and the like) and the like. Among them, acyclic or cyclic hydrocarbon groups having carbon number of l to 16 are able.
As “alkyl”, for example, C1-6 alkyl (for example, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert—butyl, pentyl, hexyl and the like) is preferable and, in particular, C1-3 alkyl (for example, methyl, ethyl, propyl and isopropyl) and the like are preferable.
As “alkenyl”, for example, C2-6 alkenyl (for e, Vinyl, allyl, isopropenyl, l- butenyl, 2-butenyl, 3-butenyl, 2-methylpropenyl, l-methylpropenyl, 2-methyl-l-propenyl and the like) and the like are preferable.
As yl”, for example, C2-6 alkynyl (for example, ethynyl, propargyl, l-butynyl, nyl, 3-butynyl, 1-hexynyl and the like) and the like are preferable. 2018/054642 As “cycloalkyl”, for example, C3.6 cycloalkyl (for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and the like) and the like are preferable.
As “aryl”, for example, C644 aryl (for e, phenyl, l-naphthyl, 2-naphthyl, 2- biphenylyl, 3-biphenylyl, 4-biphenylyl, ryl and the like) and the like are preferable.
As “aralkyl”, for example, C746 aralkyl (for example, benzyl, phenethyl, diphenylmethyl, l-naphthylmethyl, 2-naphthylmethyl, 2,2-diphenylethyl, 3-phenylpropyl, 4- phenylbutyl, 5-phenylpentyl and the like) and the like are preferable.
As “substituents” of “hydrocarbon group ally having substituents” represented by R5, for example, there are oxo, halogen atom (for example, fluorine, chlorine, bromine, iodine and the like), C1.3 alkylenedioxy (for example, methylenedioxy, ethylenedioxy and the like), nitro, cyano, optionally halogenated C1-6 alkyl, optionally halogenated C2-6 alkenyl, carboxy C2— 6 l (for example, 2-carboxyethenyl, 2-carboxymethylethenyl and the like), optionally nated C2.6 alkynyl, optionally halogenated C3.6 cycloalkyl, C644 aryl (for example, phenyl, l-naphthyl, 2-naphthyl, enylyl, 3-biphenylyl, 4-biphenylyl, 2-anthryl and the like), optionally halogenated Cl-S alkoxy, C1.6 alkoxy-carbonyl-C1.6 alkoxy (for example, ethoxycarbonylmethyloxy and the like), hydroxy, C644 aryloxy (for example, phenyloxy, 1- yloxy, 2-naphthyloxy and the like), C746aralkyloxy (for example, benzyloxy, phenethyloxy and the like), mercapto, optionally halogenated C1-6 alkylthio, C644 arylthio (for example, phenylthio, l-naphthylthio, thylthio and the like), C746 aralkylthio (for example, benzylthio, phenethylthio and the like), amino, mono-C1.6alkylamino (for e, methylamino, mino and the like), mono-C644 arylamino (for example, phenylamino, l- naphthylamino, 2-naphthylamino and the like), di-C1.6 alkylamino (for example, dimethylamino, diethylamino, ethylmethylamino and the like), di-C644arylamino (for example, ylamino and the like), formyl, carboxy, C1.6alkyl-carbonyl (for example, acetyl, propionyl and the like), C3.6 cycloalkyl-carbonyl (for e, cyclopropylcarbonyl, cyclopentylcarbonyl, cyclohexylcarbonyl and the like), C1.6 alkoxy-carbonyl (for example, methoxycarbonyl, carbonyl, propoxycarbonyl, tert-butoxycarbonyl and the like), C644 aryl-carbonyl (for example, benzoyl, 1-naphthoyl, thoyl and the like), C746 aralkyl-carbonyl (for example, phenylacetyl, 3-phenylpropionyl and the like), C644 aryloxy-carbonyl (for example, ycarbonyl and the like), C746 aralkyloxy-carbonyl (for example, benzyloxycarbonyl, phenethyloxycarbonyl and the like), 5 or 6 membered heterocyclic carbonyl (for example, nicotinoyl, isonicotinoyl, thenoyl, furoyl, morpholinocarbonyl, thiomorpholinocarbonyl, piperazin-l-ylcarbonyl, idin-l-ylcarbonyl and the like), carbamoyl, thiocarbamoyl, mono- C1.6alkyl-carbamoyl (for example, carbamoyl, arbamoyl and the like), di-C1—6 alkyl- carbamoyl (for example, dimethylcarbamoyl, diethylcarbamoyl, ethylcarbamoyl and the like), C644 aryl-carbamoyl (for e, phenylcarbamoyl, l-naphthylcarbamoyl, 2- naphthylcarbamoyl and the like), 5 or 6 membered heterocyclic carbamoyl (for example, 2- lcarbamoyl, 3-pyridylcarbamoyl, 4-pyridylcarbamoyl, 2-thienylcarbamoyl, 3- thienylcarbamoyl and the like), C1.6 alkylsulfonyl (for example, methylsulfonyl, ethylsulfonyl and the like), C644 arylsulfonyl (for example, phenylsulfonyl, l-naphthylsulfonyl, 2- naphthylsolfonyl and the like), C1.6 alkylsulfinyl (for example, methylsulfinyl, ethylsulfinyl and the like), C644 arylsulfinyl (for example, phenylsulfinyl, l-naphthylsulfinyl, 2-naphthylsulfinyl and the like), formylamino, C1-6 alkyl-carbonylamino (for example, acetylamino and the like), C644 aryl-carbonylamino (for example, benzoylamino, oylamino and the like), C1— 6 -carbonylamino (for example, methoxycarbonylamino, ethoxycarbonylamino, propoxycarbonylamino, butoxycarbonylamino and the like), C1.6alkylsulfonylamino (for example, methylsulfonylamino, ethylsulfonylamino and the like), C644 arylsulfonylamino (for example, phenylsulfonylamino, 2-naphthylsulfonylamino, l-naphthylsulfonylamino and the like), C1-6 alkyl-carbonyloxy (for example, acetoxy, propionyloxy and the like), C644 aryl- carbonyloxy (for example, benzoyloxy, naphthylcarbonyloxy and the like), C1.6 alkoxycarbonyloxy (for example, methoxycarbonyloxy, ethoxycarbonyloxy, ycarbonyloxy, butoxycarbonyloxy and the like), 1.6 alkyl-carbamoyloxy (for example, methylcarbamoyloxy, ethylcarbamoyloxy and the like), di-C1-6 alkyl-carbamoyloxy (for example, dimethylcarbamoyloxy, lcarbamoyloxy and the like), C644 aryl-carbamoyloxy (for example, phenylcarbamoyloxy, naphthylcarbamoyloxy and the like), nicotinoyloxy, 5 to 7 membered saturated cyclic amino ally having substituents, 5 to 10 membered aromatic heterocyclic group (for example, 2-thienyl, 3-thienyl, 2-pyridyl, dyl, 4-pyridyl, 2-quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 8-quinolyl, l-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5- nolyl, l-indolyl, 2-indolyl, 3-indolyl, 2-benzothiazolyl, 2-benzo [b]thienyl, 3- benzo[b]thienyl, 2-benzo[b]furanyl, 3-benzo[b]furanyl and the like), sulfo, sulfamoyl, sulfinamoyl, sulfenamoyl and the like.
The “hydrocarbon group” may have 1 to 5, preferably 1 to 3 aforementioned substituents at a substitutable position and, when the number of substituents is 2 or more, respective substituents may be the same or different.
As aforementioned “optionally nated C1-6 alkyl”, for example, there are C1— 6alkyl (for example, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl and the like) and the like optionally having 1 to 5, preferably 1 to 3 halogen atoms (for example, fluorine, chlorine, bromine, iodine and the like). Examples thereof are methyl, chloromethyl, difluoromethyl, trichloromethyl, trifluoromethyl, ethyl, 2-bromoethyl, 2,2,2- trifluoroethyl, pentafluoroethyl, propyl, 3,3,3-trifluoropropyl, isopropyl, butyl, 4,4,4- trifluorobutyl, yl, sec-butyl, tert—butyl, pentyl, tyl, tyl, 5,5,5-trifluoropentyl, hexyl, 6,6,6-trifluorohexyl and the like.
As the aforementioned nally halogenated C2-6 alkenyl”, for example, there are C2-6 alkenyl (for example, Vinyl, propenyl, isopropenyl, 2-buten-l-yl, 4-penten-l-yl, 5-hexen-l- yl) and the like optionally having 1 to 5, preferably 1 to 3 n atoms (for example, fluorine, chlorine, bromine, iodine and the like).
As the aforementioned “optionally halogenated C2-6 alkynyl”, there are kynyl (for example, 2-butyn-l-yl, 4-pentyn-l-yl, 5-hexyn-l-yl and the like) and the like optionally having 1 to 5, preferably 1 to 3 halogen atoms (for example, ne, ne, bromine, iodine and the like).
As the aforementioned “optionally halogenated C3-6 cycloalkyl”, for example, there are C3-6 cycloalkyl (for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and the like) and the like optionally having 1 to 5, preferably 1 to 3 halogen atoms (for example, fluorine, chlorine, bromine, iodine and the like). Examples thereof are cyclopropyl, utyl, cyclopentyl, cyclohexyl, 4,4-dichlorocyclohexyl, 2,2,3,3-tetrafluorocyclopentyl, 4- chlorocyclohexyl and the like.
] As the entioned “optionally halogenated C1-s alkoxyl”, for example, there are C1.s alkoxy (for example, methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, pentyloxy, hexyloxy and the like) and the like ally having 1 to 5, preferably 1 to 3 halogen atoms (for example, fluorine, ne, bromine, iodine and the like). Examples thereof are methoxy, difluoromethoxy, trifluoromethoxy, ethoxy, 2,2,2-trifluoroethoxy, propoxy, isopropoxy, butoxy, 4,4,4-trifluorobutoxy, isobutoxy, sec-butoxy, pentyloxy, hexyloxy and the like.
As the aforementioned “optionally halogenated Cl-6 alkylthio”, for example, there are Cl-6 alkylthio (for example, methylthio, ethylthio, thio, isopropylthio, butylthio, sec- hio, tert—butylthio and the like) and the like optionally having 1 to 5, preferably 1 to 3 n atoms (for example, fluorine, chlorine, bromine, iodine and the like). Examples thereof are methylthio, difluoromethylthio, trifluoromethylthio, ethylthio, propylthio, isopropylthio, butylthio, 4,4,4-trifluorobutylthio, pentylthio, hexylthio and the like.
] As “5 to 7 membered ted cyclic amino” of the aforementioned “5 to 7 membered saturated cyclic amino optionally haVing substituents”, there are 5 to 7 membered saturated cyclic amino optionally containing 1 to 4 heteroatoms of one or two kinds selected from a en atom, a sulfur atom and an oxygen atom in addition to one en atom and carbon atoms and examples thereof are pyrolidin-l-yl, piperidino, piperazin-l-yl, morpholino, thiomorpholino, hexahydroazepin- l -yl and the like.
] As “substituents” of the “5 to 7 membered saturated cyclic amino optionally haVing substituents”, for example, there are l to 3 C1-6 alkyl (for example, methyl, ethyl, propyl, isopropyl, butyl, yl, sec-butyl, tert—butyl, pentyl, hexyl and the like), C6-14aryl (for example, , l-naphthyl, 2-naphthyl, 2-biphenylyl, 3-biphenylyl, 4-biphenylyl, 2-anthryl and the like), Cl-6 carbonyl (for example, acetyl, propionyl and the like), 5 to 10 membered ic heterocyclic group (for example, nyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2- quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 8-quinolyl, l-isoquinolyl, 3-isoquinolyl, 4- isoquinolyl, 5-isoquinolyl, l-indolyl, 2-indolyl, 3-indolyl, 2-benzothiazolyl, 2-benzo[b]thienyl, 3-benzo[b]thienyl, 2-benzo[b]furanyl, 3-benzo[b]furanyl and the like), oxo and the like.
As “heterocyclic group” of “heterocyclic group optionally haVing substituents” represented by R5, for example, there is a monovalent group obtained by remoVing one arbitrary hydrogen atom from a 5 to 14 membered (monocyclic, bicyclic or tricyclic) heterocycle containing 1 to 4 heteroatoms of one or two kinds selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to carbon atoms, preferably (i) a 5 to 14 membered (preferably 5 to 10 membered, particularly preferably 5 to 6 ed) aromatic heterocycle, (ii) a 5 to 10 membered (preferably 5 to 6 membered) non-aromatic heterocycle or (iii) a 7 to 10 membered bridged heterocycle.
As the aforementioned “5 to 14 membered (preferably 5 to 10 membered) aromatic heterocycle”, there are an aromatic heterocycle such as thiophene, benzo[b]thiophene, benzo[b]furan, benzimidazole, benzoxazole, benzothiazole, benzisothiazole, naphtho[2,3- b]thiophene, furan, pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indole, isoindole, lH-indazole, purine, 4H-quinolizine, isoquinoline, quinoline, phthalazine, yridine, quinoxaline, quinazoline, cinnoline, ole, B-carboline, phenanthridine, acridine, phenazine, thiazole, azole, phenothiazine, isoxazole, furazan, phenoxazine and the like, and a ring formed by fusing these rings (preferably monocyclic) with l or a plurality (preferably 1 to 2) of aromatic rings (for example, benzene ring and the like).
As the aforementioned “5 to 10 membered non-aromatic heterocycle”, for example, there are pyrrolidine, imidazoline, pyrazolidine, line, piperidine, piperazine, morpholine, thiomorpholine, dioxazole, oxadiazoline, azoline, triazoline, azole, dithiazole and the like.
As the aforementioned “7 to 10 membered bridged heterocycle”, for example, there are quinuclidine, 7-azabicyclo[2.2. l]heptane and the like.
The “heterocyclic group” is preferably a 5 to 14 membered (preferably 5 to 10 membered) (monocyclic or ic) heterocyclic group containing preferably 1 to 4 heteroatoms of one or two kinds selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to carbon atoms. More particularly, examples thereof are an ic heterocyclic group such as 2-thienyl, nyl, 2-furyl, 3-furyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-quinolyl, 3-quinolyl, 4- quinolyl, 5-quinolyl, 8-quinolyl, l-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, pyrazinyl, 2-pyrimidinyl, 4-pyrimidinyl, 3-pyrrolyl, 2-imidazolyl, dazinyl, 3-isothiazolyl, 3-isoxazolyl, l-indolyl, 2-indolyl, 3-indolyl, 2-benzothiazolyl, 2-benzo[b]thienyl, 3- benzo[b]thienyl, 2-benzo[b]furanyl, 3-benzo[b]furanyl and the like, and a non-aromatic heterocyclic group such as l-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, 2-imidazolinyl, 4- imidazolinyl, 2-pyrazolidinyl, 3-pyrazolidinyl, zolidinyl, piperidino, 2-piperidyl, 3- piperidyl, 4-piperidyl, l-piperazinyl, 2-piperazinyl, lino, thiomorpholino and the like.
Among them, for example, a 5 or 6 ed heterocyclic group containing 1 to 3 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to carbon atoms is r preferable. More particularly, examples thereof are 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-furyl, 3-furyl, nyl, 2-pyrimidinyl, 3-pyrrolyl, 3- zinyl, hiazolyl, 3-isoxazolyl, l-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, 2- imidazolinyl, 4-imidazolinyl, zolidinyl, 3-pyrazolidinyl, 4-pyrazolidinyl, piperidino, 2- piperidyl, 3-piperidyl, 4-piperidyl, l-piperazinyl, 2-piperazinyl, morpholino, thiomorpholino and the like.
As “substituents” of “heterocyclic group optionally having tuents”, for example, there are the same “substituents” as substituents of “hydrocarbon group optionally having substituents” represented by R5.
The “heterocyclic group” may have 1 to 5, ably 1 to 3 aforementioned substituents at a substitutable on and, when the number of substituents is 2 or more, respective substituents may be the same or different.
As “Ci—6 alkyl” represented by R6, for example, there are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, utyl, pentyl, hexyl and the like.
As “hydrocarbon group optionally having substituents” and “heterocyclic group optionally having substituents” represented by R7, for example, there are the aforementioned “hydrocarbon group optionally having substituents” and “heterocyclic group optionally having substituents” represented by R5, respectively.
As “hydrocarbon group optionally having substituents” and ocyclic group optionally having substituents” represented by R1, for example, there are the aforementioned “hydrocarbon group optionally having substituents” and “heterocyclic group optionally having tuents” represented by R5, respectively.
] As “amino group optionally having substituents” represented by R1, for example, there are (1) an amino group optionally having 1 or 2 substituents and (2) a cyclic amino group optionally having substituents and the like.
As “substituents” of “amino group optionally having 1 or 2 substituents” of the aforementioned (l), for example, there are a hydrocarbon group optionally having substituents, a heterocyclic group optionally having substituents, an acyl group, an alkylidene group optionally having tuents and the like. As these “hydrocarbon group optionally having substituents” and “heterocyclic group optionally having substituents”, there are the same “hydrocarbon group optionally having substituents” and “heterocyclic group optionally having substituents” as those ented by R5 described above, respectively. As the “acyl group”, there is the same “acyl group” as that by represented by R1 as described above.
As “alkylidene group” of “alkylidene group ally having substituents”, for example, there are a C1-6 alkylidene group (for example, idene, ethylidene, idene and the like) and the like. As “substituents” of “alkylidene group optionally having substituents”, there are l to 5, preferably 1 to 3 same substituents as “substituents” of “hydrocarbon group optionally having substituents” represented by R5.
When the number of the aforementioned “substituents” of “amino group optionally having 1 or 2 substituents” is 2, tive substituents may be the same or different.
] As “cyclic amino group” of “cyclic amino group optionally having substituents” of the aforementioned (2), there are a 5 to 7 membered non-aromatic cyclic amino group optionally containing 1 to 4 heteroatoms of one or two kinds selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to one nitrogen atom and carbon atoms. More particularly, examples thereof are idin-l -yl, piperidino, zin-l-yl, morpholino, thiomorpholino, hexahydroazepin- l -yl, imidazolidin- l -yl, 2,3-dihydro-lH-imidazol-l -yl, tetrahydro- 1 (2H)- pyrimidinyl, 3,6-dihydro-l(2H)-pyrimidinyl, hydro-l(2H)-pyrimidinyl and the like. As “substituents” of “cyclic amino optionally having substituents”, there are l to 3 same ones as “substituents” of “5 to 7 membered saturated cyclic amino group” which were described in detail as “substituents” of “hydrocarbon group optionally having substituents” represented by R5.
Examples of the 5 to 7 membered non-aromatic cyclic amino group having 1 oxo, there are 2-oxoimidazolidin-l-yl, 2-oxo-2,3-dihydro- lH-imidazol-l -yl, 2-oxotetrahydro-l (2H)- pyrimidinyl, 2-oxo-3,6-dihydro- l (2H)-pyrimidinyl, 2-oxo-3,4-dihydro- l (2H)-pyrimidinyl, 2- oxopyrrolidin-l-yl, 2-oxopiperidino, 2-oxopiperazin-l-yl, 3-oxopiperazin-l-yl, 2-oxo- 2,3,4,5,6,7-hexahydroazepin- l -yl and the like.
As R1, an amino group optionally having substituents, an aryl group optionally having substituents and an alkyl group ally having substituents and the like are preferable.
As further preferable example of the “amino group optionally having tuents” is an amino group optionally having 1 or 2 acyl represented by the Formula: —(C=O)—R5, — (C=O)—OR5, —NR5R6, —NHR5 or —SOz—R7 [wherein respective symbols represent the same meanings as described above]. Particularly preferable example is an amino group optionally having 1 or 2 acyl represented by the Formula: —C(C=O)—R5 or —(C=O)— NRSR6 in respective symbols represent the same meanings as described above].
] As the “aryl group optionally having substituents”, for e, there is preferably a C644 aryl group (preferably a phenyl group and the like) optionally having 1 to 5 substituents selected from C1-6 alkylthio, C644arylthio, C1-6 alkylsulfinyl, C644 arylsulfinyl, C1-6 alkylsulfonyl, C644arylsulfonyl and carboxy.
As the “alkyl group optionally haVing substituents”, for example, a kyl group (for example, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl and the like) optionally substituted with l to 3 substituents selected from halogen atom, C1.6 alkoxy, hydroxy, carboxy and C16 alkoxy-carbonyl and the like are preferable, and ularly C1—3alkyl group such as methyl, ethyl and the like is preferable.
Among them, as R1, (i) C16 alkyl group (for example, C1-4 alkyl group such as , ethyl, propyl, butyl), (ii) a C644 aryl group (for example, a phenyl group) ally substituted with substituents selected from C1-6 alkylthio (for example, methylthio), C1.6 alkylsulfonyl (for example, methylsulfonyl) and halogen atom (for example, chlorine atom, fluorine atom) or (iii) an amino group optionally having 1 or 2 acyl represented by the Formula: —(C=O)—R5’ (wherein R5’ ents {circle around (1)} a C16 alkyl group (for example, C1—3 alkyl group such as methyl), {circle around (2)} a C644aryl group (for example, a phenyl group) or {circle around (3)} a 5 to 14 membered heterocyclic group containing 1 to 4 atoms of one or two kinds selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to carbon atoms (for example, a 5 to 6 membered heterocyclic group containing 1 to 2 heteroatoms selected from a en atom, a sulfur atom and an oxygen atom in addition to carbon atoms such as pyridyl group) are preferable. As R5’ and R5”, a phenyl group or a pyridyl group is suitable.
In the aforementioned Formula, R2 represents an aromatic group optionally haVing substituents.
] As “aromatic group” of “aromatic group optionally haVing substituents” represented by R2, for example, there are an ic hydrocarbon group, an aromatic heterocyclic group and the like.
As the “aromatic hydrocarbon , examples thereof include a C644monocyclic or fused polycyclic (bicyclic or tricyclic) aromatic hydrocarbon group, etc. As examples, there are a C644 aryl group and the like such as phenyl, 1-naphthyl, 2-naphthyl, 2-biphenylyl, 3-biphenylyl, 4-biphenylyl, 2-anthryl and the like and, further preferably, a C640 aryl group and the like (for example, phenyl, l-naphthyl, 2-naphthyl and the like, preferably phenyl and the like).
As the “aromatic heterocyclic group”, there is a monoValent group obtained by removing one arbitrary hydrogen atom from 5 to 14 membered (preferably 5 to 10 membered) aromatic heterocycle containing 1 to 4 heteroatoms of one or two kinds selected from nitrogen atom, sulfur atom and oxygen atom in addition to carbon atoms.
As the aforementioned “5 to 14 membered (preferably 5 to 10 membered) aromatic heterocycle”, for example, there are an aromatic heterocycle such as thiophene, benzo[b]thiophene, benzo[b]furan, idazole, benzoxazole, benzothiazole, othiazole, naphtho[2,3-b]thiophene, furan, pyrrole, ole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indole, isoindole, lH-indazole, purine, 4H-quinolizine, isoquinoline, quinoline, phthalazine, yridine, quinoxaline, quinazoline, cinnoline, carbazole, oline, thridine, acridine, phenazine, thiazole, azole, phenothiazine, isoxazole, furazan, phenoxazine and the like, and a ring formed by fusing these rings (preferably monocycle) with l or a plurality of (preferably 1 or 2) aromatic rings (for example, benzene ring and the like).
As the “aromatic heterocyclic group”, there are preferably a 5 to 14 membered (preferably 5 to 10 membered)(monocyclic or bicyclic) ic heterocyclic group containing preferably 1 to 4 heteroatoms of one or two kinds selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to carbon atoms and the like and, more particularly, there are an aromatic heterocyclic group such as 2-thienyl, 3-thienyl, l, 3-furyl, 2-pyridyl, 3-pyridyl, 4- pyridyl, 2-quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 8-quinolyl, l-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, pyrazinyl, 2-pyrimidinyl, 4-pyrimidinyl, 3-pyrrolyl, 2-imidazolyl, dazinyl, 3-isothiazolyl, 3-isoxazolyl, l-indolyl, 2-indolyl, 3-indolyl, 2-benzothiazolyl, 2- benzo[b]thienyl, o[b]thienyl, o[b]furanyl, o[b]furanyl and the like.
As “substituents” of “aromatic group optionally haVing substituents”, there are l to 5, preferably 1 to 3 same substituents as “substituents” of “hydrocarbon group optionally haVing substituents” represented by R5. When the number of substituents is 2 or more, respective substituents may be the same or different.
As R2, (1) a C6-14 aryl group optionally haVing substituents and (2) a 5 to 14 membered aromatic heterocyclic group containing 1 to 4 heteroatoms of one or two kinds ed from a nitrogen atom, a sulfur atom and an oxygen atom in addition to carbon atoms are able and, among them, (1) a C6-14 aryl group (for example, phenyl group, naphthyl group) optionally substituted with halogen atom (for example, chlorine atom, fluorine atom) or C1- 6 alkoxy (for example, methoxy), (2) a 5 to 14 membered aromatic heterocyclic group containing 1 to 4 heteroatoms of one or two kinds selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to carbon atoms (for example, a 5 to 6 membered aromatic heterocyclic group containing 1 to 2 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to carbon atoms such as l group, thienyl group) and the like are preferable and, in ular, a phenyl group, a pyridyl group and the like are le.
In the aforementioned a, R3 represents a hydrogen atom, a pyridyl group optionally haVing substituents or an aromatic arbon group optionally haVing substituents.
As “substituents” of “pyridyl group optionally haVing substituents” represented by R3, there are the same substituents as “substituents” of “hydrocarbon group ally haVing substituents” represented by R5.
The “pyridyl group” may, for example, have 1 to 5, preferably 1 to 3 aforementioned substituents at substitutable positions and, when the number of substituents is 2 or more, respective substituents may be the same or different. In addition, an intracyclic en atom may be N—oxidized.
As “aromatic hydrocarbon group” of tic hydrocarbon group optionally haVing substituents” represented by R3, there is the same aromatic hydrocarbon group as “aromatic hydrocarbon group” of “aromatic hydrocarbon group optionally haVing substituents” represented by R2 and, preferably, there are a C644 aryl group and the like such as phenyl, l-naphthyl, 2- naphthyl, 2-biphenylyl, 3-biphenylyl, 4-biphenylyl, 2-anthryl and the like and, further preferably, a C640 aryl group and the like (for example, phenyl, l-naphthyl, 2-naphthyl and the like, preferably phenyl and the like) and the like. As ituents” of “aromatic hydrocarbon group optionally haVing substituents” represented by R3, there are the same substituents as substituents of “aromatic group optionally haVing substituents” ented by R2.
As R3, a C644 aryl group optionally haVing substituents is preferable and, among them, a C644 aryl group optionally substituted with l or 2 C16 alkyl (for example, methyl, ethyl and the like) or C1.6 alkoxy (for example, methoxy, ethoxy and the like) is preferable and, in particular, a phenyl group optionally substituted with l or 2 C16 alkyl or C1-6 alkoxy (for example, 3-methoxyphenyl, 2-methylphenyl, 2,4-dimethylphenyl and the like) is suitable.
In the entioned Formula, X represents an oxygen atom or an optionally oxidized sulfur atom.
W0 2019/071147 As “optionally oxidized sulfur atom” represented by X, there are S, SO and S02.
As X, there is preferably an optionally oxidized sulfur atom. Further preferably, it is ] In the aforementioned Formula, Y represents a bond, an oxygen atom, an optionally oxidized sulfur atom or the Formula NR4 in R4 ents a hydrogen atom, a hydrocarbon group optionally haVing tuents or an acyl group).
As “optionally oxidized sulfur atom” represented by Y, there are S, SO and S02.
As “hydrocarbon group optionally haVing substituents” represented by R4, for example, there is the same group as “hydrocarbon group optionally haVing substituents” represented by R5. Among them, a C1-6 alkyl group such as methyl, ethyl and the like and, in particular, a C16 alkyl group such as methyl and the like is preferable.
As “acyl group” represented by R4, there is the same group as “acyl group” represented by R1.
As Y, an oxygen atom, an optionally oxidized sulfur atom, a group represented by the Formula NR4 (wherein R4 represents the same meaning as that described above) and the like are preferable and, among them, an oxygen atom, an optionally oxidized sulfur atom, a group ented by the Formula NR4’ (R4’ represents a hydrogen group or a C1-6 alkyl group) and the like are preferable and, r, an oxygen atom, S, S02, NH, N(CH3) and the like are preferable and, in particular, 0 or NH is suitable.
] In the aforementioned Formula, Z represents a bond or a divalent acyclic hydrocarbon group optionally haVing substituents.
As “divalent acyclic hydrocarbon group” of ent acyclic hydrocarbon group optionally haVing substituents”, for example, there are a C1-15alkylene group (for example, methylene, ethylene, propylene, butylene, pentamethylene, hexamethylene, ethylene, octamethylene and the like, preferably a C1-6 alkylene group and the like), a C2-16 alkenylene group (for example, Vinylene, propylene, l-butenylene, 2-butenylene, l-pentenylene, 2- pentenylene, 3-pentenylene and the like), a C2-16 alkynylene group ylene, propynylene, lbutynylene , nylene, l-pentynylene, 2-pentynylene, 3-pentynylene and the like) and the like, preferably, a C1-15alkylene group, particularly preferably, a C1-6 alkylene group and the like.
As “substituents” of “divalent c hydrocarbon group optionally haVing substituents” WO 71147 ented by Z, for example, there are the same tuents as “substituents” of carbon group optionally having substituents” represented by R5.
As Z, a lower alkylene group optionally having C1-3 alkyl (for example, methyl), oxo and the like (for example, a C1-6 alkylene group such as methylene, ethylene, propylene and the like, in particular, a CH alkylene group) is able and, among them, a C1-6 alkylene group ally having oxo (for example, a CH alkylene group such as methylene, ethylene, propylene, in particular, methylene) is suitable.
More particularly, as Z, CH2 , (CH2)2 , (CH2)3—, —CO—, —CH2CO—, —(CH2)2CO—, —CH(CH3)— and the like are used and, in particular, —CH2—, —CO— and the like are suitable.
A nitrogen atom in Formula (I) may be N—oxidized. For example, a nitrogen atom which is a constituent atom of 4-pyridyl group as a substituent at 5-position of a ring represented by the Formula: n a symbol in the Formula represents the same meaning as that described above, may be N—oxidized. As Formula (I), for example, a compound represented by the Formula: ( )H\N0 / X R2 Y I We R3 N wherein n represents 0 or 1, and other s represents the same meanings as those described above, or salts thereof are preferable.
As Formula (1), compounds shown by the following (A) to (F) are preferably used.
(A) Formula (I) wherein R1 is an amino group optionally having substituents, R2 is a C6-14 aryl group optionally having substituents, R3 is a C6-14 aryl group optionally having substituents, X is a sulfur atom, Y is an oxygen atom or a group ented by the Formula NR4 (wherein R4represents the same meaning as that described above) or (and) Z is a lower alkylene group optionally having substituents.
] (B) Formula (I) wherein R1 is (i) a C16 alkyl group (for example, a C1—4alkyl group such as methyl, ethyl, propyl, butyl and the like), ] (ii) a C644 aryl group (for example, a phenyl group) optionally tuted with substituents selected from C1-6 alkylthio (for example, methylthio), C1.6 alkylsulfonyl (for example, methylsulfonyl) and halogen atom (for example, chlorine atom, fluorine atom), or (iii) an amino group optionally having 1 or 2 acyl represented by the Formula: — (C=O)—R5’ [wherein R5’ represents {circle around (1)} a C1.6alkyl group (for example, C1— 3 alkyl group such as methyl and the like), {circle around (2)} a C644 aryl group (for example, a phenyl group) or {circle around (3)} a 5 to 14 ed heterocyclic group containing 1 to 4 heteroatoms of one or two kinds selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to carbon atoms (for e, a 5 to 6 membered heterocyclic group containing 1 to 2 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to carbon atoms such as a pyridyl group); R2 is a C644 aryl group (for example, a phenyl group, a naphthyl group) optionally tuents with halogen atom (for example, chlorine atom, ne atom) or C1.6 alkoxy (for e, y), or a 5 to 14 membered aromatic heterocyclic group containing 1 to 4 heteroatoms of one or two kinds ed from a nitrogen atom, a sulfur atom and an oxygen atom in addition to carbon atoms (for example, a 5 to 6 membered aromatic heterocyclic group containing 1 to 2 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to carbon atoms such as a pyridyl group, a thienyl group and the like), R3 is a C644 aryl group (particularly, a phenyl group) optionally substituted with l or 2 C16 alkyl (for example, methyl) or C1.6 alkoxy (for example, methoxy), X is a sulfur atom; Y is an oxygen atom, an optionally oxidized sulfur atom or a group represented by the Formula NR4’ (R4’ is a hydrogen atom or a C16 alkyl group) (in particular, an oxygen atom, S, 802, NH, N(CH3) and the like); Z is a C16 alkylene group (in particular, a C14 alkylene group) optionally haVing oxo or C16 alkyl (for example, C1-3 alkyl such as methyl) or a bond.
(C) Formula (I) wherein R1 is an amino group optionally having 1 or 2 acyl represented by the Formula —(C=O)—R5” (wherein R5” represents {circle around (1)} a C6- 14 aryl group (for e, phenyl group) or {circle around (2)} a 5 to 14 membered heterocyclic group containing 1 to 4 heteroatoms of one or two kinds ed from a nitrogen atom, a sulfur atom and an oxygen atom in addition to carbon atoms (for example, a 5 to 6 membered heterocyclic group containing 1 to 2 heteroatoms ed from a nitrogen atom, a sulfur atom and an oxygen atom in on to carbon atoms such as a pyridyl group); R2 is a C6-14 aryl group (for example, a phenyl group) or a 5 to 14 membered aromatic heterocyclic group containing 1 to 4 heteroatoms of one or two kinds selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to carbon atoms (for example, a 5 to 6 membered aromatic heterocyclic group containing 1 to 2 heteroatoms selected from a en atom, a sulfur atom and an oxygen atom in addition to carbon atoms such as a pyridyl ; R3 is a C6-14 aryl group (in particular, a phenyl group) optionally substituted with l or 2 Cl-6 alkyl (for example, methyl) or Cl-6 alkoxy (for example, methoxy); X is a sulfur atom; ] Y is 0, NH or s; Z is a bond or a Cl-6 alkylene group (in particular, a Cl-3 alkylene group optionally haVing oxo, such as methylene, ethylene and the like) optionally haVing oxo.
Genus 11 Description Compounds of Genus II can be prepared according to the disclosure of US 7,115,746, which is herein incorporated herein by reference in its entirety.
] Genus II is characterized by compounds of Formula (II): Ar1—T_Ar2 Y (H), or stereoisomers thereof, isotopically-enriched compounds thereof, prodrugs thereof, solvates thereof, and pharmaceutically acceptable salts thereof; wherein: Ar1 and Ar2 are each independently aryl or heteroaryl optionally fused to a saturated or unsaturated 5—8 membered ring having 0—4 heteroatoms; ed that Ar1 or Ar2 is aryl; wherein the aryl or heteroaryl is optionally tuted with one or more substituents independently selected from halo; C1—C6 aliphatic optionally substituted with —N(R’)2, —OR’, —C02R’, —C(O)N(R’)2, —OC(O)N(R’)2, —NR’C02R’, —NR’C(O)R’, R’)2, —N=CH—N(R’)2; or —OPO3H2; C1—C6 alkoxy optionally substituted with —N(R’)2, —OR’; —C02R’, —C(O)N(R’)2, N(R’)2, —NR’C02R’, —NR’C(O)R’, —SOzN(R’)2, —N=CH—N(R’)2; or —OPO3H2; —Ar3; —CF3; —OCF3; —OR’; —SR’; —SOzN(R’)2; —OSOzR’; —SCF3; —N02; —CN; —N(R’)2; ; —C02N(R’)2; —C(O)N(R’)2; —NR’C(O)R’; — R’; —NR’C(O)C(O)R’; —NR’SOzR’; —OC(O)R’; —NR’C(O)R2; —NR’C02R2; — ’R’C(O)C(O)R2; —NR’C(O)N(R’)2; N(R’)2; —NR’SOzR2; —NR’R2; —N(R2)2, —OC(O)R2; —OPO3H2; and —N=CH—N(R’)2; R’ is selected from hydrogen; C1—C6 aliphatic; or a 5—6 membered carbocyclic or heterocyclic ring system ally substituted with l to 3 substituents independently selected from halo; C1—C6 alkoxy; cyano; nitro; amino; hydroxy; and C1—c 6 aliphatic; R2 is a C1—C6 aliphatic optionally substituted with —N(R’)2, —OR’; —C02R’; (R’)2 or — SOzN(R’)2; or a carbocyclic or cyclic ring system optionally substituted with —N(R’)2, — OR’, —C02R’, —C(O)N(R’)2 or —SOzN(R’)2; Ar3 is an aryl or heteroaryl ring system optionally fused to a saturated or unsaturated 5—8 membered ring having 0—4 heteroatoms; wherein Ar3 is optionally substituted at one or more ring atoms with one or more substituents independently selected from halo; C1—C6 aliphatic optionally substituted with —N(R’)2, —OR’, —C02R’, —C(O)N(R’)2, —OC(O)N(R’)2, —NR’C02R’, —NR’C(O)R’, —SOzN(R’)2; —N=C—N(R’)2; or —OP03H2; C1—C6 alkoxy optionally substituted with —N(R’)2, —OR’, —C02R’, —C(O)N(R’)2, —OC(O)N(R’)2, R’)2, —NR’C02R; —NR’C(O)R’, —N=C—N(R’)2; or —OP03H2; —CF3; —OCF3; —OR’; —SR’; —SOzN(R’)2; —OSOzR’; —SCF3; —N02; —CN; —N(R’)2; ; —C02N(R’)2; —C(O)N(R’)2; —NR’C(O)R’; —NR’C02R’; —NR’C(O)C(O)R’; —NR’SOzR’; —OC(O)R’; —NR’C(O)R2; 2018/054642 — ’R’COzRZ; —NR’C(O)C(O)R2; O)N(R’)2; —OC(O)N(R’)2; —NR’S02R2; — ’R’Rz; —N(R2)2; —OC(O)R2; —OPO3H2; and —N=C—N(R’)2; and Y is —C(O)—NH2.
In one embodiment, the p38 kinase inhibitor is 2-(2,4-difluorophenyl)(l-(2,6- difluorophenyl)ureido)nicotinamide (“VX-702”), Formula II’.
Genus II Definitions As used herein, the following tions shall apply unless otherwise indicated. The phrase “optionally substituted” is used interchangeably with the phrase “substituted or unsubstituted.” Also, combinations of substituents are permissible only if such combinations result in chemically stable compounds. In addition, unless otherwise indicated, functional group radicals are independently selected.
The term “aliphatic” as used herein means ht-chain or branched C1— C12hydrocarbon chain that is completely saturated or that contains one or more units of ration. The term “aliphatic” also includes a monocyclic C3—Cshydrocarbon or bicyclic C8— C12 hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic (said cyclic hydrocarbon chains are also referred to herein as “carbocycle” or “cycloalkyl”), that has a single point of attachment to the rest of the molecule wherein any individual ring in said bicyclic ring system has 3—7 members. For example, suitable aliphatic groups include, but are not limited to, linear or branched alkyl, alkenyl, alkynyl groups and hybrids thereof such as alkyl)alkyl, (cycloalkenyl)alkyl) or (cycloalkyl)alkenyl.
The terms “alkyl”, “alkoxy”, “hydroxyalkyl”, yalkyl”, and “alkoxycarbonyl”, used alone or as part of a larger moiety includes both straight and branched chains containing one to twelve carbon atoms. The terms “alkenyl” and “alkynyl” used alone or as part of a larger moiety shall include both ht and branched chains containing two to twelve carbon atoms, n an l comprises at least one double bond and an alkynyl comprises at least one triple bond.
The term “chemically stable” or “chemically feasible and stable”, as used herein, refers to a compound structure that renders the compound iently stable to allow manufacture and stration to a mammal by methods known in the art. Typically, such compounds are stable at temperature of 40° C. or less, in the absence of moisture or other chemically reactive conditions, for at least a week.
The term “haloalkyl”, “haloalkenyl”, and lkoxy”, means alkyl, alkenyl, or alkoxy, as the case may be, substituted with one or more halogen atoms. The term “halogen” means F, Cl, Br, or I.
] The term “heteroatom” means N, O, or S and shall include any oxidized form of nitrogen and sulfur, and the quaternized form of any basic nitrogen.
The term “amine” or “amino” used alone or as part of a larger moiety, refers to a trivalent nitrogen, which may be primary or which may be substituted with 1—2 aliphatic groups.
The term “aryl” used alone or as part of a larger moiety as in “aralkyl”, “aralkoxy”, or “aryloxyalkyl”, refers to monocyclic, bicyclic, and tricyclic carbocyclic ring systems having a total of five to fourteen members, where at least one ring in the system is aromatic and wherein each ring in the system contains 3 to 8 ring members. The term “aryl” may be used interchangeably with the term “aryl ring”.
The term ocycle”, “heterocyclyl”, or “heterocyclic” as used herein means non- aromatic, monocyclic, bicyclic, or tricyclic ring systems having five to fourteen ring members in which one or more of the ring members is a heteroatom, wherein each ring in the system contains 3 to 7 ring s.
One having ordinary skill in the art will recognize that the maXimum number of heteroatoms in a stable, chemically feasible heterocyclic or heteroaromatic ring is determined by the size of the ring, degree of unsaturation, and valence of the heteroatoms. In general, a heterocyclic or heteroaromatic ring may have one to four heteroatoms so long as the cyclic or heteroaromatic ring is chemically feasible and stable.
The term “heteroaryl”, used alone or as part of a larger moiety as in “heteroaralkyl” or “heteroarylalkoxy”, refers to clic, bicyclic and tricyclic ring systems having a total of five to fourteen ring members, and wherein at least one ring in the system is aromatic, at least one ring in the system contains one or more atoms, and each ring in the system contains 3 to 7 ring members. The term “heteroaryl” may be used interchangeably with the term “heteroaryl ring” or the term “heteroaromatic”.
An aryl ding l, xy, aryloxyalkyl and the like) or heteroaryl (including heteroarylalkyl and arylalkoxy and the like) group may contain one or more substituents. le substituents on the unsaturated carbon atom of an aryl, heteroaryl, aralkyl, or aralkyl group are ed from halogen; haloalky, —CF3, —R4, —OR4, —SR4, 1,2- methylenedioxy; l,2-ethylenedioxy; protected OH (such as y); phenyl (Ph); Ph substituted with R4; —OPh; —OPh substituted with R4; —CH2Ph; —CH2Ph substituted with R4; — CH2CH2(Ph), —CH2CH2(Ph) substituted with R4, —N02; CN; N(R’)2; —NR4C(O)R4, — NR4C(O)N(R4)2; —NR4C02R4; —NR4NRC(O)R4; —NR4C(O)N(R4)2; —NR4NR4C(O)R4; — NR4NR4C(O)N(R4)2; —NR4NR4C02R4; —C(O)C(O)R4—C(O)CH2C(O)R’; —C02R’, — C(O)R’; —C(O)N(R’)2; —OC(O)N(R4)2; —S02R’; —S02N(R’)2; —S(O)R4; —NR4S02N(R’)2; —NR4S02R4; —C(=S)N(R’)2; —C(=NH)—N(R’)2; —(CH2)yNHC(O)R4; —(CH2)yR4; — (CH2)yI\HC(O)N}IR4; yNHC(O)OR4; —(CH2)yNHS(O)R4; —(CH2)yNHS02R4; or — (CH2)yl\HC(O)CH(V—R4)R4; wherein each R4 is independently ed from hydrogen, optionally tuted C1-6 tic, an unsubstituted 5—6 membered heteroaryl or heterocyclic ring, phenyl (Ph), —O—Ph, —CH2 (Ph), wherein y is 0—6, and V is a linker group. When R4 is C1-6 aliphatic, it may be substituted with one or more substituents selected from —NH2, — NH(C1-4 aliphatic), —N(C1.4 aliphatic)2, —S(O) (Cl-4 aliphatic), —S02(C1-4 aliphatic), halogen, —(C1-4 aliphatic), —OH, —O—(C1-4 aliphatic), —N02, —CN, —C02H, —C02(C1.4 aliphatic), lo C1.4 aliphatic), or -halo(C1-4 aliphatic); n each C1.4 aliphatic is unsubstituted.
] The term “linker group” or “linker” means an organic moiety that connects two parts of a compound. Linkers are comprised of O S NR* , , , —, —C(O), or an alkylidene chain. The alkylidene chain is a saturated or unsaturated, straight or branched, C1- 6 carbon chain which is optionally substituted, and wherein up to two non-adjacent saturated carbons of the chain are optionally replaced by —C(O)—, —C(O)C(O)—, —C(O)NR*—, — C(O)NR*NR*—, NR*NR*—, —NR*C(O) S SO S02 NR* , , , , , SOzNR*—, or —NR*SOz—; wherein R* is selected from hydogen or aliphatic. Optional substituents on the alkylidene chain are as described below for an aliphatic group.
An aliphatic group or a non-aromatic heterocyclic ring may contain one or more substituents. Suitable substituents on the saturated carbon of an aliphatic group or of a non- aromatic heterocyclic ring are selected from those listed above for the unsaturated carbon of an aryl or heteroaryl group and the following: :0, =S, =NNHR5, =NN(R5)2, =NR5, —OR5, =NNHC(O)R5, =NNHC02R5, =NNHS02R5, or =NR5, where each R5 is ndently selected from hydrogen or a ally tuted C1-6 aliphatic. When R5 is C1-6 aliphatic, it may be substituted with one or more substituents selected from —NH2, .4 aliphatic), —N(C1— 4 aliphatic)2, halogen, —OH, —O—(C1.4 aliphatic), N02, CN, COzH, C02(C1— 4 aliphatic), —O-(halo C1.4 aliphatic), or (halo C1-4 aliphatic); n each C1.4 aliphatic is unsubstituted.
Substituents on the nitrogen of a non-aromatic heterocyclic ring are selected from — R6, —N(R6)2, —C(O)R6, —C02R6, —C(O)C(O)R6, H2C(O)R6, —SOzR6, — SOzN(R6)2, —C(=S)N(R’)2, —C(=NH)—N(R’)2, or —NRSOzR; wherein each R6 is ndently selected from hydrogen, an optionally substituted C1-6 aliphatic, optionally substituted phenyl (Ph), optionally substituted —O—Ph, ally substituted —CH2 (Ph), or an unsubstituted 5—6 membered heteroaryl or heterocyclic ring. When R6 is a C1-6 aliphatic group or a phenyl ring, it may be substituted with one or more substituents selected from —NH2, — 4aliphatic), —N(C1.4 tic)2, halogen, —(C1-4 aliphatic), —OH, —O—(C1-4 aliphatic), —N02, —CN, —C02H, —C02(C1-4 aliphatic), —O-halo(C1.4 aliphatic), or (halo C1-4aliphatic); wherein each C1.4 tic is unsubstituted.
Genus 111 Description Compounds of Genus 111 can be prepared according to the disclosure of US 6,696,566, which is herein incorporated herein by reference in its entirety.
Genus III is characterized by compounds of Formula 111: N\\XAr1_1 R3 (111), or stereoisomers thereof, isotopically-enriched compounds thereof, prodrugs thereof, solvates thereof, and pharmaceutically acceptable salts f; wherein: R1 is hydrogen, alkyl, haloalkyl, aryl, aralkyl, heteroaryl, heteroaralkyl, cycloalkyl, lkylalkyl, heteroalkylsubstituted cycloalkyl, heterosubstituted cycloalkyl, heteroalkyl, cyanoalkyl, heterocyclyl, heterocyclylalkyl, Rlz—SOz-heterocycloamino, —Y1—C(O)—Y2— R11, (heterocyclyl)(cycloalky1)a1ky1, or (heterocyclyl)(heteroary1)a1ky1; wherein: R12 is haloalkyl, aryl, aryalkyl, heteroaryl or heteroaralkyl, Y1 and Y2 are each ndently absent or an alkylene group, and R11 is hydrogen, alkyl, haloalkyl, hydroxy, alkoxy, amino, monoalkylamino or dialkylamino, W is NR2; X1 is O, NR4, S, or CR5R6, or C=O, wherein: R4 is hydrogen or alkyl, and R5 and R6 are each independently en or alkyl; X2 is O or NR7, wherein R7 is hydrogen or alkyl; Ar1 is aryl or heteroaryl; R2 is hydrogen alkyl, acyl, alkoxycarbonyl, aryloxycarbonyl, heteroalkylcarbonyl, heteroalkyloxycarbonyl or —R21—R22, wherein: R21 is alkylene or —, and R22 is alkyl or alkoxy; R3 is hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, haloalkyl, heteroalkyl, cyanoalkyl, alkylene—C(O) —R31, amino, monoalkylamino, dialkylamino, or NR32—Y3— R3 3 wherein: R31 is hydrogen, alkyl, hydroxy, alkoxy, amino, monoalkylamino or dialkylamino, and Y3 is —C(O), —C(O)O—, —C(O)N(R34)—, —S(O)2—, or —S(O)2N(R35)—, wherein: R34 is hydrogen or alkyl, and R33 is hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, heteroalkyl or optionally substituted phenyl) or acyl.
In some ments, the p38 kinase inhibitor from Genus III is selected from the following: 2-amino(2-fluorophenoxy)methyl-pyrido[2,3-d]pyrimidin-7(8H)-one; 6-(phenoxy)methyl(tetrahydro-2H-pyranylamino)pyrido[2,3-d]pyrimidin- one; 6-(3-fluorophenoxy)methyl(tetrahydro-2H-pyranylamino)pyrido[2,3- midin-7(8H)-one ] 6-(2,4-difluorophenoxy)methy1(tetrahydro-2H-pyranylamino)pyrido[2,3- d]pyrimidin-7(8H)-one; luorobenzyl)methyl(tetrahydro-2H-pyranylamino)pyrido[2,3- d]pyrimidin-7(8H)-one; 6-[(4-fluorophenyl)thiol-][(4-hydroxycyclohexyl)amino]methylpyrido[2,3- d]pyrimidin-7(8H)-one; 6-(4-fluorophenoxy)[(4-hydroxycyclohexyl)amino]methylpyrido[2,3- d]pyrimidin-7(8H)-one; 6-(2-fluorobenzyl)[(4-hydroxycyclohexyl)amino]methylpyrido[2,3- d]pyrimidin-7(8H)-one; ] uorophenoxy)[(4-methoxycyclohexy1) amino]methy1pyrido[2;3- d]pyrimidin-7(8H)-one; 6-(2-fluorophenoxy)methy1 { [1 -(methyl sulfony1)piperidin y1]amino} [2;3-d]pyrimidin-7(8H)-one; 6-(2-fluorophenoxy)(4-fluoropheny1) {[1 -(methylsulfony1)piperidin y1]amino} pyrido[2;3-d]pyrimidin-7(8H)-one; 8-cyclopropy1(2-fluorophenoxy){[1-(methylsu1fony1)piperidin y1]amino} pyrido[2;3-d]pyrimidin-7(8H)-one; [0041 1] 6-(2-chlorophenoxy)methy1 {[1-(methylsulfony1)piperidin y1]amino} pyrido[2;3-d]pyrimidin-7(8H)-one; 6-(4-chlorophenoxy)methy1 {[1-(methylsulfony1)piperidin y1]amino} pyrido[2;3-d]pyrimidin-7(8H)-one; 2-(cyclopropy1amino)(2-fluorophenoxy)methy1pyrido[2;3-d]pyrimidin-7(8H)- one; lopenty1amino)(4-fluorophenoxy)methy1pyrido[2;3-d]pyrimidin-7(8H)- one; 2-(cyclopenty1amino)(3-fluorophenoxy)methy1pyrido[2,3-d]pyrimidin-7(8H)- one; 2-(buty1amino)(2-fluorophenoxy)methy1pyrido[2;3-d]pyrimidin-7(8H)-one; 6-(2-fluorophenoxy)[(2-hydroxyethy1) amino]-8methy1pyrido[2;3-d]pyrimidin- 7(8H)-one; 6-(2-fluorophenoxy)(isobuty1amino)methy1pyrido[2;3-d]pyrimidin-7(8H)-one‘u 6-(2-fluorophenoxy){[(1S)(hydroxy methy1)methy1propy1]amino} methylpyrido[2;3-d]pyrimidin-7(8H)-one; 2-[(2;3 -dihydroxypropy1)amino](2-fluorophenoxy)methy1pyrido[2,3 - d]pyrimidin-7(8H)-one; 6-(2-fluorophenoxy)methy1[(2-piperidiny1ethy1)amino]pyrido[2,3 - d]pyrimidin-7(8H)-one; ] 2-[(cyclohexylmethy1)amino](2-fluorophenoxy)methy1pyrido[2;3-d]pyrimidin- 7(8H)-one; 2-[(cyclopropylmethyl)amino](2-fluoro phenoxy)methylpyrido[2,3- d]pyrimidin-7(8H)-one; uorophenoxy) [(2-methoxyethy1)amino] methy1pyrido[2,3-d]pyrimidin- 7(8H)-one; 2- {[3-(dimethy1amino)propy1]amino} (2-fluorophenoxy)methylpyrido[2,3- midin-7(8H1)-one; 6-(2-fluorophenoxy)methy1 {[3-(2-oxopyrrolidin y1)propy1]amino}pyrido[2,3-d]pyrimidin-7(8H)-one; N—(2- {[6-(2-fluorophenoxy)methy1—7-oxo-7, 8-dihydropyrido[2,3-d]pyrimidin y1]amino}ethy1)acetamide; 6-(2-fluorophenoxy)methy1—2-[(2-pyridinylethy1)amino]pyrido[2,3 - d]pyrimidin-7(8H)-one; ethyl N-[6-(2-fluorophenoxy)methy10X0-7,8-dihydropyrido[2,3-d]pyrimidin y1]-B-alaninate; 6-(2-fluorophenoxy) [(3-methoxypropy1)amino]methy1pyrido[2,3-d]pyrimidin- 7(8H)-one; 6-(4-chlorophenoxy) {[(1 ydroxy- 1 ,2-dimethylpropy1]amino} methylpyrido[2,3-d]pyrimidin-7(8H)-one; 6-(2,4-difluorophenoxy) { [(1 S)hydroxy- 1 ,2-dimethylpropy1]amino} - 8- methylpyrido[2,3 imidin-7(8H)-one; ] 6-(2-fluorobenzy1) { [(1 S)hydroxy-1 ,2-dimethy1propy1]amino} methylpyrido[2,3-d]pyrimidin-7(8TH-one; 6-(2-fluorophenoxy)methy1[(1-0Xidotetrahydro-2H-thiopyran y1)amino]pyrido[2,3-d]pyrimidin-7(8H)-one; 2-[(1,1-dioxidotetrahydro-2H-thiopyrany1)amino](2-fluorophenoxy) methylpyrido[2,3 -d]pyrimidin-7(8H)-one; 6-(2,4-difluorophenoxy)methy1—2-[(1-0Xido tetrahydro-2H-thiopyran y1)amino]pyrido[2,3-d]pyrimidin-7(8H)-one; ] 2-[(1,1-dioxidotetrahydro-2H-thiopyrany1)amino](2,4-difluorophenoxy) methylpyrido[2,3-d]pyrimidin-7(8H)-one; 6-(2,6-difluorophenoxy) {[1 -(hydroxy methy1)buty1]amino} methy1pyrido [2,3 - d]pyrimidin-7(8H)-one; ] 6-(2,6-difluorophenoxy)[(2-hydroxy-1,1-dimethylethyl)amino] methylpyrido[2,3-d]pyrimidin-7(8H)-one; 6-(2-fluorophenoxy) { [1 oxymethyl) cyclopenty1]amino}- 8- methylpyrido[2,3-d]pyrimidin-7(8H)-one; 6-(2-fluorophenoxy) {[1 -(hydroxymethy1)-3 -(methylthio)propy1]amino} - 8- methylpyrido[2,3-d]pyrimidin-7(8H)-one; ] 2-(benzylamino)(4-fluorophenoxy)methy1pyrido[2,3 -d]pyrimidin-7(8H)-one; 2-(benzylamino)(4-fluorobenzyl)methy1pyrido[2,3 -d]pyrimidin-7(8H)-one; 6-(2-fluorophenoxy)methy1[(1-pheny1 propy1)amino]pyrido[2,3-d]pyrimidin- 7(8H)-one; 6-(2-fluorophenoxy)methy1[(pyridinylmethyDamino]pyrido[2,3- d]pyrimidin-7(8H)-one; 6-(2-fluorophenoxy) [(3-furylmethy1) amino]methylpyrido[2,3-d]pyrimidin- 7(8H)-one; 8-methy1phenoxy[(2-phenylethy1) amino]pyrido[2,3-d]pyrimidin-7(8H)-one; 6-(2-chlorophenoxy)methy1[(2-pheny1 ethyl)amino]pyrido[2,3-d]pyrimidin- one; Ethyl 4- {[6-(2,4-difluorophenoxy)methy1oxo-7,8-dihydropyrido[2,3- d]pyrimidiny1]amino } piperidinecarboxy1ate; 8-methy1—2- {[3 -(4-methy1piperaziny1)propy1]amino} phenoxypyrido [2,3 - d]pyrimidin-7(8H)-one; 6-(2-chlorophenoxy)methy1 {[3 -(4-methy1piperazin y1)propy1]amino}pyrido[2,3-d]pyrimidin-7(8H)-one; ino(4-fluorobenzy1)methy1pyrido[2,3-d]pyrimidin-7(8H)-one; 6-(4-fluorophenoxy)[(4-fluoropheny1) methy1pyrido[2,3-d]pyrimidin- one; 6-(2,6-dichlorophenoxy)[(4-fluoropheny1) amino]methy1pyrido[2,3- d]pyrimidin-7(8H)-one; 6-(4-fluorobenzy1)[(4-fluoropheny1)amino]methy1pyrido[2,3 -d]pyrimidin- 7(8H)-one; 2- { [4-(2-hydroxyethyl)pheny1]amino} methy1—6-phenoxypyrido[2,3-d]pyrimidin- 7(8H)-one; hlorophenoxy)( (diethylamino) ethoxy]pheny1} amino) methylpyrido[2,3-d]pyrimidin-7(8H)-one; 2-( {4-[2-(diethylamino)ethoxy]phenyl}amino)(4-fluorophenoxy) methylpylido[2,3 -d]pyrimidin-7(8H)-one; 6-(2-fluorophenoxy)[(3 xypyridin-Z-y1)amino] methy1pyrido[2,3- midin-7(8H)-one; 6-(2-fluorophenoxy)methy1—2-[(5-methy1pyridinyl)amino]pyrido[2,3- d]pyrimidin-7(8H)-one; 2-(benzylthio)(4-fluorophenoxy)pyrido[2,3-d]pyrimidinamine; -difluorophenoxy)(benzylthio)pyrido[2,3 -d]pyrimidin-7(8H)-one; 1-tert—Buty1-3 - [6-(2,4-difluoro-phenoxy)(tetrahydro-pyranylamino)- pyrido[2,3 -d]pyrimidiny1] -urea; N—[6-(2,4-Difluoro-phenoxy)(tetrahydro-pyranylamino)-pyrido[2,3 - d]pyrimidiny1] -methanesulfonamide; 6-(2,4-difluorophenoxy){[(1 S)fluoro-1,2-dimethylpropy1]amino} methylpyrido[2,3 -d]pyrimidin-7(8H)-one; 6-(2,4-Difluoro-phenoxy) { [(1 S)hydroxy- 1 ,2-dimethylpropy1]amino} - 8- isopropylpyrido[2,3-d]pyrimidin-7(8H)-one; 6-(2,4-difluorophenoxy)methy1(tetrahydro-ZH-pyranylamino)pyrido[2,3 - d]pyridin-7(8H)-one; 8-Amino(2,4-difluoro-phenoxy)(tetrahydro-pyranylamino)-8H-pyrido[2,3- d]pyrimidinone; 6-(2,4-Difluoro-phenoxy)isopropylamino-Z-(tetrahydro-pyranylamino)-8H- pyrido[2,3 imidinone; 6-(2,4-Difluoro-phenoxy)[N—methyl-(N—3 -methy1-buty1)-amino](tetrahydropyranylamino )-8H-pyrido[2,3-d]pyrimidinone; 6-(2,4-Difluoro-phenoxy)N,N-dimethylamino-Z-(tetrahydro-pyranylamino)- 8H-pyrido[2,3-d]pyrimidinone; 6-(2,4-Difluoro-phenylamino)(2-hydroxy-1,1 -dimethy1-ethy1amino)methy1- 8H-pyrido[2,3-d]pyrimidinone: 6-[(2,4-Difluoro-pheny1)-methy1-amino] methy1(tetrahydro-pyranylamino)- 8H-pyrido[2,3-d]pyrimidinone; 6-(2,4-Difluorophenoxy)ethyl(tetrahydro-2H-pyrany1amino)pyrido[2,3- d]pyrimidin-7(8H)-one; 6-(2,4-difluorophenoxy)ethy1(3 xy-tetrahydro-pyran ylamino)pyrido[2,3-d]pyrimidin-7(8H)-one; 6-(2,4-Difluoro-phenoxy)(3-hydroxy-1,3-dimethy1-buty1amino)methy1-8H- [2,3 -d]pyrimidinone; 6-(2,4-Difluoro-phenoxy)(3 -hydroxy-1(S),3 hy1-butylamino)methy1-8H- pyrido[2,3 -d]pyrimidinone; 6-(2,4-Difluoro-phenoxy)(3 -hydroxy-1(R), 3-dimethy1-butylamino)methy1-8H- pyrido[2,3 -d]pyrimidinone; 6-(2,4-difluorophenoxy)methy1—2-(3-hydroxy-tetrahydro-pyran ylamino)pyrido[2,3-d]pyrimidin-7(8H)-one; 6-(2-fluorophenoxy)[(5-hydroxypyrazolyl)amino]methylpyrido[2,3- d]pyrimidin-7(8H)-one; uorophenoxy) [(pyridin-Z-yl-methy1)amino]methy1pyrido[2,3- d]pyrimidin-7(8H)-one; ] 2- {[(1,5-Dimethy1-1H-pyrazoly1)methy1]amino} (2-fluorophenoxy) methylpyrido[2,3 -d]pyrimidin-7(8H)-one; 2- {[(1,3 -Dimethy1-1H-pyrazoly1)methy1]amino}(2-fluorophenoxy methylpyrido[2,3 -d]pyrimidin-7(8H)-one; 6-(2-fluorophenoxy) { [(3-methy1-isoxazoly1)methy1]amino} methylpyrido[2,3 imidin-7(8H)-one; 2- {[1-(Hydroxymethy1)cyclohexyl]amino} (2-methy1benzy1)methylpyrido[2,3 - d]pyrimidin-7(8H)-one; 2- {[1-(Hydroxymethyl)cyclopentyl]amino} (2-methylbenzyl)methylpyrido [2,3 - d]pyrimidin-7(8H)-one; 6-Benzyl {[1 oxymethyl)cyclopentyl]amino} methylpyrido[2,3- d]pyrimidin-7(8H)-one; N-[6-(2,4-Difluoro-phenoxy)methyloxo-4a,7,8,8a-tetrahydropyrido [2,3d]pyrimidiny]-N-(tetrahydro-pyranyl)-acetamide; ethyl 4- {[6-(2-fluorophenoxy)methyloxo-7,8-dihydropyrido[2,3-d]pyrimidin- 2-yl]amino}piperidine—1-carboxylate; ] 6-(2-fluorophenoxy)methyl{[(1-benzylsulfonyl)piperidiny yl]amino}pyrido[2,3-d]pyrimidin-7(8H)-one; 6-(2-methylfluorophenoxy)methyl {[(1-benzylsulfonyl)piperidiny yl]amino}pyrido[2,3-d]pyrimidin-7(8H)-one; 6-(2,4-difluorophenoxy)methyl(Nl lsulfonyl)-l ,3-diaminopentane) pyrido[2,3-d]pyrimdin-7(8H)-one; 6-(2,4-difluorophenoxy)methy1((tetrahydro-2H-pyranyl)amino)pyrido[2,3- d]pyrimidin-7(8H)-one (“R1487”), Formula III’a; and ] 6-(2,4-difluorophenoxy)((1,5-dihydroxypentanyl)amino)methylpyrido[2,3- d]pyrimidin-7(8H)-one (“Pamapimod”), Formula III’b.
In one embodiment, the p38 kinase inhibitor is 6-(2,4-difluorophenoxy)methyl ((tetrahydro-2H-pyranyl)amino)pyrido[2,3-d]pyrimidin-7(8H)-one (“R1487”), Formula III’a.
In one embodiment, the p38 kinase inhibitor is 6-(2,4-difluorophenoxy)((1,5- dihydroxypentanyl)amino)methylpyrido[2,3-d]pyrimidin-7(8H)-one (“Pamapimod”), Formula III’b.
Genus III Definitions: “Acyl” means a radical —C(O)R, where R is en, alkyl, cycloalkyl, cycloalkylalkyl, phenyl or phenylalkyl n alkyl, cycloalkyl, cycloalkylalkyl, and phenylalkyl are as defined herein. Representative examples include, but are not d to formyl, acetyl, cylcohexylcarbonyl, cyclohexylmethylcarbonyl, benzoyl, benzylcarbonyl, and the like.
“Acylamino” means a radical —NR’C(O)R, where R’ is hydrogen or alkyl, and R is hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, phenyl or phenylalkyl wherein alkyl, cycloalkyl, cycloalkylalkyl, and phenylalkyl are as defined herein. Representative es include, but are not limited to formylamino, acetylamino, cylcohexylcarbonylamino, cyclohexylmethylcarbonylamino, benzoylamino, benzylcarbonylamino, and the like.
“Alkoxy” means a radical —OR where R is an alkyl as defined herein e. g., methoxy, ethoxy, propoxy, butoxy and the like.
“Alkyl” means a linear saturated monovalent hydrocarbon radical of one to siX carbon atoms or a branched saturated lent hydrocarbon radical of three to siX carbon atoms, e.g., methyl, ethyl, propyl, 2-propyl, n-butyl, iso-butyl, tert-butyl, pentyl, and the like.
“Alkylene” means a linear saturated divalent hydrocarbon l of one to siX carbon atoms or a branched saturated nt arbon radical of three to siX carbon atoms, e. g., methylene, ethylene, 2,2-dimethylethylene, propylene, 2-methylpropylene, butylene, ene, and the like. thio” means a radical —SR where R is an alkyl as defined above e. g., methylthio, ethylthio, propylthio, butylthio, and the like.
“Aryl” means a lent monocyclic or bicyclic aromatic hydrocarbon radical which is optionally substituted independently with one or more substituents, preferably one, two or three, substituents preferably selected from the group consisting of alkyl, hydroxy, alkoxy, haloalkyl, haloalkoxy, Y—C(O)—R (where Y is absent or an ne group and R is hydrogen, alkyl, haloalkyl, haloalkoxy, hydroxy, alkoxy, amino, monoalkylamino or dialkylamino), heteroalkyl, heteroalkyloxy, heteroalkylamino, halo, nitro, cyano, amino, monoalkylamino, dialkylamino, alkylsulfonylamino, heteroalkylsulfonylamino, sulfonamido, methylenedioxy, ethylenedioxy, heterocyclyl or heterocyclylalkyl. More specifically the term aryl includes, but is not limited to, phenyl, chlorophenyl, methoxyphenyl, 2-fluorophenyl, 2,4-difluorophenyl, l- yl, 2-naphthyl, and the tives thereof.
“Aryloxy” means a l —OR where R is an aryl as defined herein e. g. phenoxy.
“Aryloxycarbonyl” means a radical R—C(=O)— where R is aryloxy, e. g. phenoxycarbonyl.
“Cycloalkyl” refers to a saturated monovalent cyclic hydrocarbon l of three to seven ring carbons e. g., cyclopropyl, cyclobutyl, cyclohexyl, 4-methyl-cyclohexyl, and the like. 2018/054642 “Cycloalkylalkyl” means a radical —R5‘Rb where Ral is an alkylene group and Rb is cycloalkyl group as defined herein, e.g., cyclohexylmethyl, and the like.
“Substituted cycloalkyl” means a cycloalkyl radical as defined herein with one, two or three (preferably one) ring hydrogen atoms independently ed by cyano or —Y—C(O)R (where Y is absent or an ne group and R is hydrogen, alkyl, haloalkyl, hydroxy, alkoxy, amino, monoalkylamino, dialkylamino, or optionally tuted phenyl).
“Dialkylamino” means a radical —NRR’ where R and R’ independently ent an alkyl, hydroxyalkyl, cycloalkyl, or cycloalkylalkyl group as defined herein. Representative examples include, but are not limited to dimethylamino, methylethylamino, di(l- methylethyl)amino, (methyl)(hydroxymethyl)amino, (cyclohexyl)(methyl)amino, hexyl)(ethyl)amino, (cyclohexyl)(propyl)amino, (cyclohexylmethyl)(methyl)amino, (cyclohexylmethyl)(ethyl)amino, and the like.
“Halo” means fluoro, chloro, bromo, or iodo, preferably fluoro and chloro.
“Haloalkyl” means alkyl substituted with one or more same or different halo atoms, e.g., —CH2Cl, —CF3, 3, —CH2CCl3, and the like.
“Heteroalkyl” means an alkyl radical as d herein wherein one, two or three hydrogen atoms have been replaced with a substituent independently selected from the group consisting of —ORa, —N(O)anRC (where n is O or 1 if Rb and RC are both independently alkyl, cycloalkyl or cycloalkylalkyl, and 0 if not) and —S(O)an(where n is an integer from O to 2), with the understanding that the point of attachment of the heteroalkyl radical is through a carbon atom, wherein Ral is hydrogen, acyl, alkoxycarbonyl, alkyl, lkyl, or cycloalkylalkyl, Rb and RC are independently of each other hydrogen, acyl, alkoxycarbonyl, alkyl, cycloalkyl, cycloalkylalkyl, alkylsulfonyl, aminosulfonyl, mono- or di-alkylaminosulfonyl, aminoalkyl, mono- or di-alkylaminoalkyl, hydroxyalkyl, alkoxyalkyl, hydroxyalkylsulfonyl or alkoxyalkylsulfonyl, and when n is O, R“1 is hydrogen, alkyl, cycloalkyl, cycloalkylalkyl or optionally substituted phenyl, and when n is l or 2, Rdis alkyl, cycloalkyl, cycloalkylalkyl, ally substituted phenyl, amino, acylamino, monoalkylamino, or dialkylamino.
Representative examples include, but are not limited to, 2-hydroxyethyl, 3-hydroxypropyl, 2- hydroxy-l-hydroxymethylethyl, 2,3-dihydroxypropyl, oxymethylethyl, 3-hydroxybutyl, 2,3-dihydroxybutyl, 2-hydroxy-l-methylpropyl, 2-aminoethyl, 3-aminopropyl, 2- methylsulfonylethyl, aminosulfonylmethyl, ulfonylethyl, aminosulfonylpropyl, methylaminosulfonylmethyl, methylaminosulfonylethyl, methylaminosulfonylpropyl, and the like.
“Heteroalkylcarbonyl” means the group Ra—C(=O)—, where Ra is a heteroalkyl group. Representative examples include acetyloxymethylcarbonyl, aminomethylcarbonyl, 4- acetyloxy-2,2-dimethyl-butanoyl, 2-aminomethyl-pentanoyl, and the like.
] “Heteroalkyloxy” means the group RaO—, where Ra is a alkyl group.
Representative examples include (Me—C(=O)—O—CH2—O—, and the like “Heteroalkyloxycarbonyl” means the group Ra—C(=O), where Ra is a heteroalkyloxy group. Representative examples include l-acetyloxy-methoxycarbonyl (Me—C(=O)—O— CH2—O—C(=O)—) and the like “Heteroaryl” means a monovalent monocyclic or bicyclic radical of 5 to 12 ring atoms having at least one aromatic ring containing one, two, or three ring heteroatoms selected from N, O, or S, the remaining ring atoms being C, with the understanding that the attachment point of the heteroaryl radical will be on an aromatic ring. The aryl ring is optionally substituted independently with one or more substituents, preferably one or two substituents, selected from alkyl, haloalkyl, heteroalkyl, hydroxy, alkoxy, halo, nitro or cyano. More specifically the term heteroaryl includes, but is not limited to, l, furanyl, thienyl, thiazolyl, azolyl, triazolyl, imidazolyl, isoxazolyl, pyrrolyl, pyrazolyl, pyrimidinyl, benzofuranyl, tetrahydrobenzofuranyl, zofuranyl, benzothiazolyl, benzoisothiazolyl, benzotriazolyl, indolyl, isoindolyl, benzoxazolyl, quinolyl, tetrahydroquinolinyl, isoquinolyl, benzimidazolyl, oxazolyl or benzothienyl, imidazo[l,2-a]-pyridinyl, imidazo[2,l-b]thiazolyl, and the derivatives thereof.
“Heteroaralkyl” means a radical —R5‘Rb where Ral is an alkylene group and Rb is a heteroaryl group as defined herein, e.g., nylmethyl, imidazolylethyl, nylethyl, 3- (benzofuranyl)propyl, and the like.
“Heteroalkylsubstituted cycloalkyl” means a cycloalkyl radical as defined herein wherein one, two or three hydrogen atoms in the cycloalkyl radical have been ed with a heteroalkyl group with the understanding that the heteroalkyl radical is attached to the lkyl radical via a -carbon bond. entative examples include, but are not limited to, l- hydroxymethylcyclopentyl, 2-hydroxymethylcyclohexyl, and the like. osubstituted cycloalkyl” means a cycloalkyl radical as defined herein n one, two or three en atoms in the cycloalkyl radical have been replaced with a substituent independently ed from the group consisting of hydroxy, alkoxy, amino, acylamino, monoalkylamino, dialkylamino, oxo (C=O), imino, hydroXimino (=NOH), NR’SOzR‘l1 (where R’ is hydrogen or alkyl and R“1 is alkyl, cycloalkyl, hydroxyalkyl, amino, monoalkylamino or dialkylamino), —X—Y—C(O)R (where X is O or NR’, Y is alkylene or absent, R is hydrogen, alkyl, haloalkyl, alkoxy, amino, monoalkylamino, dialkylamino, or optionally substituted phenyl, and R’ is H or alkyl), or —S(O)nR (where n is an integer from O to 2) such that when n is O, R is hydrogen, alkyl, cycloalkyl, cycloalkylalkyl optionally substituted phenyl or thienyl, and when n is 1 or 2, R is alkyl, cycloalkyl, lkylalkyl, optionally substituted phenyl, thienyl, amino, acylamino, monoalkylamino or dialkylamino. Representative es include, but are not limited to, 2-, 3-, or 4-hydroxycyclohexyl, 2-, 3-, or 4-aminocyclohexyl, 2-, 3-, or 4- methanesulfonamido-cyclohexyl, and the like, ably 4-hydroxycyclohexyl, 2- aminocyclohexyl or 4-methanesulfonamido-cyclohexyl.
“Heterosubstituted cycloalkyl-alkyl” means a l RaRb— where Ral is a heterosubstituted cycloalkyl radical and Rb is an alkylene radical.
“Heterocycloamino” means a saturated monoValent cyclic group of 4 to 8 ring atoms, wherein one ring atom is N and the remaining ring atoms are C. Representative es include piperidine and pyrrolidine.
“Heterocyclyl” means a saturated or unsaturated non-aromatic cyclic radical of 3 to 8 ring atoms in which one or two ring atoms are heteroatoms selected from N, O, or S(O)n (where n is an integer from O to 2), the ing ring atoms being C, where one or two C atoms may ally be replaced by a carbonyl group. The heterocyclyl ring may be optionally substituted independently with one, two, or three substituents selected from alkyl, haloalkyl, heteroalkyl, halo, nitro, cyano, cyanoalkyl, hydroxy, alkoxy, amino, monoalkylamino, dialkylamino, aralkyl, —(X)n—C(O)R (where X is O or NR’, 11 is O or 1, R is hydrogen, alkyl, haloalkyl, hydroxy (when n is 0), alkoxy, amino, monoalkylamino, dialkylamino, or optionally substituted phenyl, and R’ is H or alkyl), -alkylene-C(O)Ral (where Ral is alkyl, OR or NR’R” and R is hydrogen, alkyl or kyl, and R’ and R” are independently en or alkyl), or —S(O)nR (where n is an integer from O to 2) such that when n is O, R is hydrogen, alkyl, cycloalkyl, or cycloalkylalkyl, and when n is l or 2, R is alkyl, cycloalkyl, cycloalkylalkyl, amino, acylamino, monoalkylamino, WO 71147 dialkylamino or heteroalkyl. More specifically the term heterocyclyl includes, but is not limited to, tetrahydropyranyl, dino, ylpiperidinyl, piperazino, N—methylpyrrolidinyl, 3-pyrrolidino, morpholino, thiomorpholino, thiomorpholino-l-oxide, thiomorpholino-l,l- dioxide, 4-(1,l-dioxo-tetrahydro-2H-thiopyranyl), pyrrolinyl, imidazolinyl, N—methanesulfonyl- piperidinyl, and the derivatives thereof.
“Heterocyclylalkyl” means a radical —R5‘Rb where Ral is an alkylene group and Rb is a heterocyclyl group as defined above, e.g., tetrahydropyranylmethyl, 2- or 3-piperidinylmethyl, 3-(4-methyl-piperazin-l-yl)propyl and the like.
“(Heterocyclyl)(cycloalkyl)alkyl” means an alkyl l wherein two hydrogen atoms have been replaced with a heterocyclyl group and a cycloalkyl group.
] “(Heterocyclyl)(heteroaryl)alkyl” means an alkyl radical wherein two hydrogen atoms have been replaced with a heterocycyl group and a heteroaryl group. “Heterocyclyl spiro cycloalkyl” means a spiro radical consisting of a cycloalkyl ring and a heterocyclic ring with each ring having 5 to 8 ring atoms and the two rings having only one carbon atom in common, with the understanding that the point of attachment of the heterocyclyl spiro cycloalkyl radical is via the cycloalkyl ring. The spiro radical is formed when two hydrogen atoms from the same carbon atom of the cycloalkyl radical are replaced with a heterocyclyl group as defined herein, and may be optionally substituted with alkyl, hydroxy, hydroxyalkyl, or oxo. es include, but are not limited to, for example, l,4-dioxaspiro[4.5]decanyl, 1,3-diazaspiro[4.5]decanyl, 2,4-dione- l ,3-diaza-spiro[4. 5]decanyl, l,5-dioxa-spiro[5 . canyl, (3-hydroxymethyl- 3-methyl)-l,5-dioxa-spiro[5.5]undecanyl, and the like.
] “Hydroxyalkyl” means an alkyl radical as defined herein, substituted with one or more, preferably one, two or three hydroxy groups, provided that the same carbon atom does not carry more than one hydroxy group. Representative examples include, but are not limited to, hydroxymethyl, 2-hydroxyethyl, 2-hydroxypropyl, 3-hydroxypropyl, l-(hydroxymethyl) methylpropyl, 2-hydroxybutyl, 3-hydroxybutyl, 4-hydroxybutyl, 2,3-dihydroxypropyl, 2- hydroxy-l-hydroxymethylethyl, 2,3-dihydroxybutyl, 3,4-dihydroxybutyl and 2-(hydroxymethyl)- 3-hydroxypropyl, preferably 2-hydroxyethyl, 2,3-dihydroxypropyl and l-(hydroxymethyl) hydroxyethyl. Accordingly, as used herein, the term “hydroxyalkyl” is used to define a subset of heteroalkyl groups.
“Monoalkylamino” means a l —NHR where R an alkyl, hydroxyalkyl, cycloalkyl, or cycloalkylalkyl group as defined above, e.g., methylamino, (1-methylethyl)amino, hydroxymethylamino, exylamino, cyclohexylmethylamino, cyclohexylethylamino, and the like.
“Optionally substituted phenyl” means a phenyl ring which is optionally substituted independently with one or more substituents, preferably one or two substituents selected from the group consisting of alkyl, hydroxy, alkoxy, haloalkyl, haloalkoxy, heteroalkyl, halo, nitro, cyano, amino, enedioxy, ethylenedioxy, and acyl.
Genus IV Description: Compounds of Genus IV can be prepared according to the disclosure of US 2009/0042856, which is herein orated herein by reference in its ty.
Genus IV is characterized by compounds of Formula IV: (1V), or stereoisomers thereof, isotopically-enriched compounds thereof, prodrugs thereof, solvates thereof, and pharmaceutically acceptable salts thereof; wherein: R1 is selected from the group consisting of en, substituted or unsubstituted lower alkyl and tuted or unsubstituted aryl; R2 is selected from the group consisting of substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl; 2018/054642 R3 is lower alkyl, p is O, l or 2, '—" is a single or double bond; and R6 and R7 are taken together to form a group of the Formula: Kw")? R12 n 13 14 wherein: R8 is hydrogen, and X is oxygen or N—R9, in which R9 is hydrogen, substituted or unsubstituted lower alkanoyl or substituted or unsubstituted lower alkyl, or R8 and R9 may be taken together to form a bond; and m and n are each independently O, 1 or 2, R10 and R12 are each independently selected from the group consisting of hydrogen, halogen, hydroxy, formyl, cyano, substituted or unsubstituted lower alkyl, tuted or unsubstituted amino, tuted or unsubstituted lower alkoxy, saturated cyclic amino, substituted or unsubstituted carbamoyl, carboxy, substituted or unsubstituted lower alkoxycarbonyl, and substituted or unsubstituted acyloxy, or R9 and R10 may be taken together to form lower alkylene or a bond; and R11, R13 and R14 are each independently selected from the group ting of en, halogen, substituted or unsubstituted lower alkyl, carboxy, and substituted or unsubstituted lower alkoxycarbonyl, or R10 and R11 or R12 and R13 are taken together to form oxo, hydroxyimino, tuted or unsubstituted lower alkylene in which one or more carbon(s) may be replaced by hetero atom(s), or substituted or unsubstituted lower alkylidene, or R11 and R12 or R13 and R14 may be taken together to form a bond; and ed that when n=1 and R10, R“, R”, R13 and R14 are simultaneously hydrogen, then R9 is substituted or unsubstituted lower alkyl or substituted or unsubstituted lower alkanoyl.
In one ment, the p3 8 kinase inhibitor from Genus IV is selected from the following: 6-{2-(2,4-Difluorophenyl)[(dimethylamino)methyl]-4,5,6,7- tetrahydropyrazolo[l ,5-a]pyrimidinyl} (2-methylphenyl)-3(2H)-pyridazinone; 6- 4-Difluorophenyl)[(dimethylamino)methyl]pyrazolo[ l - , 5-a]pyrimidin-3 yl} (2-methylphenyl)-3 (2H)-pyridazinone; 6-[1 -Ethyl(4-fluorophenyl)-2,3 -dihydro- l H-imidazo[l ,2-b]pyrazolyl](2- methylphenyl)-3 (2H)-pyridazinone; 6-[2-(4-Fluorophenyl)-6,6-bis(hydroxymethyl)-4,5,6,7-tetrahydropyrazolo[l,5- a]pyrimidinyl] (2-methylphenyl)pyridazin-3 ne; 6-[2-(2,4-Difluorophenyl)(hydroxymethyl)-4,5,6,7-tetrahydropyrazolo[l,5- a]pyrimidinyl)(2-methylphenyl)pyridazin-3 (2H)-one; 6- {2-(4-Fluorophenyl) [(4-methylpiperazin-l -yl)methyl]-4, 5,6,7- ydropyrazolo[5-a]pyrimidinyl} (2-methylphenyl)pyridazin-3 (2H)-one ochloride; 6-{2-(2,4-difluorophenyl)[(dimethylamino)methyl]-4,5,6,7- tetrahydropyrazolo[l ,5-a]pyrimidin-3 -yl} (2-methylphenyl)-4,5-dihydropyridazin-3(2H)-one; N-cyclopropyl(4-fluorophenyl)-3 - [ l thylphenyl)oxo- l , 6- dihydropyridazin-3 -yl] -4, 5,6,7-tetrahydropyrazolo[l , 5-a]pyrimidinecarboxamide; 6-[6,6-Difluoro(4-fluorophenyl)-4,5,6,7-tetrahydropyrazolo[l,5-a]pyrimidinyl]- 2-(2-methylphenyl)pyridazin-3(2H)-one; 6-{6-[(tert—Butylamino)methyl](2,4-difluorophenyl)-4,5,6,7- tetrahydropyrazolo[l ,5-a]pyrimidinyl} (2-methylphenyl)pyridazin-3(2H)-one; ] 6-[1-Acety1—2’-(4-fluorophenyl)-4’,5 ’-dihydrospiro[piperidine-4,6’-pyrazolo[1 ,5- a]pyrimidin]-3 ’-y1](2-methy1pheny1)pyridazin-3(2H)-one; 6-[(5 S)(4-F1uoropheny1)(hydroxymethy1)-4,5,6,7-tetrahydropyrazolo[1,5- a]pyrimidinyl] (2-methy1pheny1)pyridazin-3 (2H)-one; 6-[(5 S)(4-F1uoropheny1)(hydroxymethy1)-4,5,6,7-tetrahydropyrazolo[1,5- a]pyrimidiny1](2-methy1pheny1)pyridazin-3(2H)-one; Ethyl 3 -(4-fluorophenyl)[1-(2-methy1pheny1)oxo-1,6-dihydropyridazin-3 -y1] -3 - oxopropanoate; 6-(5-Isopropy1—2-pheny1-4,5,6,7-tetrahydropyrazolo[1,5-a]pyrazinyl)(2- methylpheny1)pyridazin-3(2H)-one; 6-[2-(4-Fluorophenyl)(hydroxymethyl)-4,5,6,7-tetrahydropyrazolo[1,5- a]pyrimidinyl] (2-methylphenyl)-3(2H)-pyridazinone; 6-[2-(4-F1uorophenyl)hydroxy-4,5,6,7-tetrahydropyrazolo[1,5-a]pyrimidinyl] (2-methylpheny1)-3(2H)-pyridazinone; 6-[2-(2,4-Difluoropheny1)(hydroxymethy1)-4,5,6,7-tetrahydropyrazolo[1,5- a]pyrimidiny1](2-methy1pheny1)pyridazin-3(2H)-one; 6-[2’-(4-F1uoropheny1)-2,3,4’,5,5’,6-hexahydrospiro[pyran-4,6’-pyrazolo[1,5- a]pyrimidin] -3 ’-y1] (2-methy1pheny1)pyridazin-3 (2H)-one; 6-[2’-(4-Fluoropheny1)-4’,5 ’-dihydrospiro[ 1 ,3-dioxolane-2,6’-pyrazolo[1,5- a]pyrimidin]-3 ’-y1](2-methy1pheny1)pyridazin-3(2H)-one; ] 6-[(6R)(4-Fluoropheny1)hydroxy-4,5,6,7-tetrahydropyrazolo[1,5-a]pyrimidin yl](2-methy1pheny1)pyridazin-3(2H)-one; 6-[(5S)(4-fluoropheny1)(hydroxymethy1)-4,5,6,7-tetrahydropyrazolo[1,5- midiny1)(2-methy1pheny1)pyridazin-3(2H)-one; 6-[(5S)(4-fluoropheny1)(hydroxymethy1)-4,5,6,7-tetrahydropyrazolo[1,5- a] pyrimidin-3 -(2-methy1pheny1)pyridazin-3 (2H)-one; 6-[2-(4-F1uorophenyl)-6,6-dimethy1—4,5,6,7-teterahydropyrazolo[1 ,5-a]pyrimidin yl](2-methy1pheny1)pyridazin-3(2H)-one; (+)[2-(4-Fluoropheny1)(hydroxymethyl)-4,5,6,7-tetrahydropyrazolo[1,5- a] pyrimidin-3 -y1](2-methy1pheny1)pyridazin-3 (2H)-one; (—) [2-(4-Fluoropheny1)(hydroxymethy1)-4, 5 etrahydropyrazolo[1, 5 - a]pyrimidinyl] (2-methy1pheny1)pyridazin-3 (2H)-one; (+){2-(4-Fluoropheny1)[(dimethylamino)methy1]-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (—){2-(4-Fluoropheny1)[(dimethylamino)methy1]-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (+) {2-(3 -Methylphenyl)[(dimethylamino)methyl]-4, 5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (—)(2-(3-Methylpheny1)[(dimethylamino)methyl)-4,5,6,7- tetrahydropyrazolo[1 , 5-a]pyrimidin-3 -y1)(2-methylpheny1)pyridazin-3(2H)-one; (+){2-(2-Chlorofluorophenyl)[(dimethylamino)methyl]-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (—){2-(2-Chlorofluorophenyl)[(dimethylamino)methyl]-4,5,6,7- ydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (+){2,5-Difluorophenyl)[(dimethylamino)methy1]-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (2-(2,5-Difluoropheny1)[(dimethylamino)methy1]-4,5,6,7- tetrahydropyrazolo[1 , 5-a]pyrimidin-3 -y1)(2-methylpheny1)pyridazin-3(2H)-one; (+){2-(2,4-Difluoropheny1)[(diethylamino)methyl]-4,5,6,7- tetrahydropyrazolo[1 , 5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; {2-(2,4-Difluoropheny1)[(diethylamino)methyl]-4,5,6,7- tetrahydropyrazolo[1 , 5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (+) {2-(4-Fluoropheny1)[(diethylamino)methy1] -4,5,6,7-tetrahydropyrazolo[ 1 ,5- a]pyrimidin-3 -y1} (2-methy1pheny1)pyridazin-3 (2H)-one; (—) Fluoropheny1)[(diethylamino)methy1] -4,5,6,7-tetrahydropyrazolo[ 1 ,5- a]pyrimidin-3 -y1} (2-methy1pheny1)pyridazin-3 (2H)-one; (+) {2-(3 -Methylphenyl)[(dimethylamino)methyl]-4, 5,6,7- tetrahydropyrazolo[1 , 5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (—) {2-(3 1phenyl)[(diethylamino)methy1]-4,5,6,7-tetrahydropyrazolo[1 ,5- a]pyrimidin-3 -y1} (2-methy1pheny1)pyridazin-3 (2H)-one; (+){2-(2-Chlorofluorophenyl)[(diethylamino)methy1]-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (—){2-(2-Chlorofluorophenyl)[(diethylamino)methy1]-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (+){2,5-Difluorophenyl)[(diethylamino)methy1)-4,5,6,7-tetrahydropyrazolo[1,5- midin-3 -y1} (2-methy1pheny1)pyridazin-3 (2H)-one; (—) {2-(2, 5-Difluoropheny1)[(diethylamino)methy1]-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (+)(2-(2,4-Difluorophenyl)(hydroxymethyl)-4, 5 ,6,7-tetrahydropyrazolo[1, 5- a]pyrimidinyl] (2-methy1pheny1)pyridazin-3 (2H)-one; (—)[2-(2,4-Difluoropheny1)(hydroxymethy1)-4,5,6,7-tetrahydropyrazolo[1,5- a]pyrimidinyl] methy1pheny1)pyridazin-3 (2H)-one; (+)[2-(3-Methy1phenyl)(hydroxymethyl)-4,5,6,7-tetrahydropyrazolo[1,5- midinyl] (2-methy1pheny1)pyridazin-3 (2H)-one; (—)[2-(3-Methy1phenyl)(hydroxymethyl)-4,5,6,7-tetrahydropyrazolo[1,5- a]pyrimidinyl] (2-methy1pheny1)pyridazin-3 (2H)-one; (+) [2-(2, 5 -Difluoropheny1)(hydroxymethy1)-4, 5 ,6,7-tetrahydropyrazolo[1, 5- a]pyrimidinyl] (2-methy1pheny1)pyridazin-3 (2H)-one; (—)[2-(2,5-Difluoropheny1)(hydroxymethy1)-4,5,6,7-tetrahydropyrazolol[1,5- a]pyrimidinyl] (2-methy1pheny1)pyridazin-3 (2H)-one; (+)[2-(2-Chlorofluorophenyl)(hydroxymethyl)-4,5,6,7- tetrahydropyrazolo[1 , 5-a]pyrimidin-3 -y1] (2-methylpheny1)pyridazin-3 (2H)-one; (—)[2-(2-Chlorofluorophenyl)(hydroxymethyl)-4,5,6,7- tetrahydropyrazolo[1 , 5-a]pyrimidin-3 -y1] (2-methylpheny1)pyridazin-3 (2H)-one; (+) {2-(4-Fluoropheny1) ylamino)methy1] -4,5,6,7-tetrahydropyrazolo[ 1 ,5- a]pyrimidin-3 -y1} (2-methy1pheny1)pyridazin-3 (2H)-one; (—) Fluoropheny1) [(methylamino)methy1] ,7-tetrahydropyrazolo[ 1 ,5- midin-3 -y1} (2-methy1pheny1)pyridazin-3 (2H)-one; (+){2-(2,4-Difluoropheny1)[(methylamino)methyl]-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; 2018/054642 {2-(2,4-Difluoropheny1)[(methylamino)methyl]-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (+) {2-(2,5-Difluoropheny1) [(methylamino)methy1]-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (—) {2-(2,5-Difluoropheny1) [(methylamino)methy1]-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (+) {2-(3 -Methylphenyl)[(methylamino)methy1]-4,5,6,7-tetrahydropyrazolo[1 ,5- a]pyrimidin-3 -y1} (2-methy1pheny1)pyridazin-3 (2H)-one; (—) {2-(3-Methy1pheny1)[(methylamino)methy1)-4, 5,6,7-tetrahydropyrazolo[1,5- a]pyrimidin-3 -y1} (2-methy1pheny1)pyridazin-3 (2H)-one; (+){2-(2-Chlorofluoropheny1)[(methylamino)methy1]-4,5,6,7- ydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (—){2-(2-Chlorofluoropheny1)[(methylamino)methy1]-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (+){6-[(tert—Butylamino)methyl](4-fluorophenyl)-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (—){6-[(tert—Butylamino)methyl](4-fluorophenyl)-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (+){6-[(tert—Butylamino)methy1](2,4-difluorophenyl)-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; {6-[(tert—Butylamino)methy1](2,4-difluorophenyl)-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (+){6-[(tert—Butylamino)methy1](2,5-difluorophenyl)-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (—)(6-[(tert-Butylamino)methy1](2,5-difluoropheny1)-4,5,6,7- ydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (+){6-[(tert—Butylamino)methy1](3-methy1phenyl)-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (—) {6-[(tert—Butylamino)methy1](3-methy1phenyl)-4,5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (+){2-(4-Fluorophenyl)[(4-methylpiperaziny1)methy1]-4, 5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (—){2-(4-Fluorophenyl)[(4-methylpiperaziny1)methy1]-4, 5,6,7- tetrahydropyrazolofl,5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (+) {2-(2,4-Difluoropheny1)[(4-methy1piperaziny1)methy1]-4, 5,6,7- tetrahydropyrazolo[1, 5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (—) {2-(2,4-Difluoropheny1)[(4-methy1piperaziny1)methy1]-4, 5,6,7- tetrahydropyrazolo[1, 5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (+) {2-(2,5-Difluoropheny1)[(4-methy1piperaziny1)methy1]-4, 5,6,7- tetrahydropyrazolo[1, 5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (—) {2-(2,5-Difluoropheny1)[(4-methy1piperaziny1)methy1]-4, 5,6,7- tetrahydropyrazolo[1, 5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (+) {2-(3 1pheny1)[(4-methy1piperaziny1)methy1]-4,5,6,7- tetrahydropyrazolo[1, 5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (—) {2-(3 -Methy1pheny1)[(4-methy1piperaziny1)methy1]-4,5,6,7- tetrahydropyrazolo[1, 5-a]pyrimidiny1}(2-methy1pheny1)pyridazin-3(2H)-one; (+)(4-F1uoropheny1)[1-(2-methy1pheny1)oxo-1,6-dihydropyridazin-3 -y1] - 4, 5, trahydropyrazolo[1, 5-a]pyrimidinecarbonitrile; [0061 1] (—)(4-Fluoropheny1)[1-(2-methy1pheny1)oxo-1,6-dihydropyridazin-3 -y1] - 4, 5, trahydropyrazolo[1, 5-a]pyrimidinecarbonitrile; ] (+)(2,4-Difluoropheny1)-3 -[1-(2-methy1pheny1)oxo-1,6-dihydropyridazin-3 -y1] - 4, 5, 6,7-tetrahydropyrazolo[1, 5-a]pyrimidinecarbonitrile; (—)(2,4-Difluoropheny1)-3 -[1-(2-methy1pheny1)oxo-1,6-dihydropyridazin-3 -y1] - 4, 5, 6,7-tetrahydropyrazolo[1, 5-a]pyrimidinecarbonitrile; ] (+)(2, 5-Difluoropheny1)-3 -[1-(2-methy1pheny1)oxo-1,6-dihydropyridazin-3 -y1]- 7-tetrahydropyrazolo[1,5-a]pyrimidinecarbonitrile (—)(2,5-Difluoropheny1)[1 -(2- methylpheny1)oxo-1,6-dihydropyridaziny1]-4,5,6,7-tetrahydropyrazolo[1,5-a]pyrimidine carbonitrile; (+)(3-Methy1pheny1)[1-(2-methylpheny1)oxo-1,6-dihydropyridazin-3 -y1] - 4, 5, 6,7-tetrahydropyrazolo[1, 5-a]pyrimidinecarbonitrile; (—)(3 -Methylphenyl)[ l -(2-methylphenyl)oxo- l ,6-dihydropyridazin-3 -yl] - 4, 5, 6,7-tetrahydropyrazolo [ l , 5-a]pyrimidinecarbonitrile; and ] (R)(2-(4-fluorophenyl)(hydroxymethyl)-4,5,6,7-tetrahydropyrazolo[l,5- a]pyrimidinyl)(o-tolyl)pyridazin-3(2H)-one (“ASl940477”), Formula IV’.
In one embodiment, the p38 kinase inhibitor is (R)(2-(4-fluorophenyl) (hydroxymethyl)-4, 5,6,7-tetrahydropyrazolo[ l , 5-a]pyrimidin-3 -yl)(o-tolyl)pyridazin-3 (2H)- one 40477”), Formula IV’.
Genus IVDefinitions Hereinafter the symbols of the Formula (IV) are explained in detail. Throughout the specification and claims, the term “lower” is intended to mean 1 to 6 carbon atom(s) unless otherwise indicated.
(Definition of R1) In the a (I), R1 is selected from the group consisting of hydrogen, tuted or unsubstituted lower alkyl and tuted or unsubstituted aryl.
Examples of the “lower alkyl” of the “substituted or unsubstituted lower alkyl” for R1 may include straight or branched (Ci—6)alkyl such as methyl, ethyl, , isopropyl, butyl, isobutyl, tert-butyl, pentyl, hexyl, etc., in which the preferred one may be alkyl, and more preferable one may be , ethyl, , isopropyl, isobutyl, etc.
Examples of the substituents for the “substituted lower alkyl” for R1 may include hydroxy, hydroxy(C5.s)cycloalkyl, (Cs—s)cycloalkyl, nitro, nitro (Cs—s)cycloalkyl, amido, amido(C5-s)cycloalkyl, sulfonamido, sulfonamido(C5-s)cycloalkyl, ureido, ureido (C5— s)cycloalkyl etc. The number of the substituent may be one; two or more. Where the number of the substituent is two or more, the substituents may be the same or different.
Examples of the “aryl” of the “substituted or unsubstituted aryl” for R1 may include (Cs—14)aryl such as , naphthyl, indenyl, anthryl, etc., in which the red one may be (Cs—io)aryl, and the more preferred one may be phenyl, etc.
Examples of the substituents for the “substituted aryl” for R1 may include lower alkyl [e.g., (Ci—4)alkyl (e.g., methyl, ethyl, propyl, butyl, etc.), etc.], (lower)alkylaminosulfonyl [e.g., (Ci—4)alkylaminosulfonyl (e.g., methylaminosulfonyl, ethylaminosulfonyl, aminosulfonyl, tert—butylaminosulfonyl, etc.), etc.], aryloxy (e.g., (Cs—14)aryloxy, etc.), halo(lower)alkyl (e.g., chloromethyl, dichloromethyl, fluoromethyl, difluoromethyl, oromethyl, pentachloroethyl, etc.), hydroxy(lower)alkyl (e.g., hydroxy(C1—4)alkyl, etc.), lower alkanoyl (e.g., (Ci—4)alkyl- carbonyl, etc.), halogen (e.g., fluoro, chloro, bromo, iodo, etc.), lower alkoxy (e.g., (Ci—4)alkoxy, etc.), carboxy, lower alkoxycarbamoyl, carbamoyl, lower alkylcarbamoyl, etc. The number of the substituent may be one or two or more. Where the number of the substituent is two or more, the substituents may be the same or different.
Suitable examples of R1 may include hydrogen, methylphenyl, (tert- butylamino)sulfonylphenyl, ethylphenyl, methoxyphenyl, aminosulfonylphenyl, etc.
(Definition of R2) In the a (I), R2 is selected from the group consisting of substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl.
Examples of the “aryl” of the “substituted or unsubstituted aryl” for R2 may include aryl r to those exemplified for R1 above, in which the preferred one may be (Cs—io)aryl, and the more preferred one may be phenyl, etc.
Examples of the substituents for the ituted aryl” for R2 may include n (e.g., fluoro, chloro, bromo, iodo, etc.), lower alkyl [e.g., alkyl (e.g., methyl, ethyl, propyl, butyl, etc.), etc.], lower alkoxy [e.g., (Ci—4)alkoxy (e.g., methoxy, , propoxy, butoxy, etc.), etc.], halo(lower)alkyl (e.g., chloromethyl, dichloromethyl, fluoromethyl, difluoromethyl, trifluoromethyl, pentachloroethyl, etc.), hydroxy(lower)alkyl, etc. The number of the substituent may be one, two or more. Where the number of the substituent is two or more, the substituents may be the same or different.
Examples of the “heteroaryl” of the “substituted or unsubstituted heteroaryl” for R2 may include, 5 to l4-membered heteroaryl, such as furyl, pyrrolyl, thienyl, oxazolyl, etc., in which the preferred one may be 5 or 6-membered heteroaryl, and more preferred one may be thienyl, etc.
Examples of the substituents for the “substituted heteroaryl” for R2 may e substituents r to the substituents exemplified above for the “substituted aryl” for R2. The number of the substituent may be one or two or more. Where the number of the substituent is two or more, the tuents may be the same or different.
] Suitable examples of R2 may include phenyl, fluorophenyl, difluorophenyl, chlorofluorophenyl, methylphenyl, dimethylphenyl, methoxyphenyl, methyl(fluoro)phenyl, etc.
(Definition of R3) In the a (I), R3 is lower alkyl.
Examples of the “lower alkyl” for R3 may include lower alkyl similar to those exemplified for R1 above, in which the preferred one may be (Ci—4)alkyl.
Suitable examples of R3 may include methyl, ethyl, etc.
(Definition of p) In the Formula (I), p is O, l or 2.
Suitable example of p is 0. itions of R4 and R5) In the Formula (I), R4 and R5 are each hydrogen or taken er to form a bond.
(Definitions of R6 and R7) In the Formula (I), R6 and R7 are taken together to form a group of the Formula: x m R12 n (Definition of R8) R8 is hydrogen. 2018/054642 (Definition of X) X is oxygen or N—R9, in which R9 is en, substituted or unsubstituted lower alkanoyl, or substituted or unsubstituted lower alkyl.
Examples of the “lower alkyl” of the “substituted or unsubstituted lower alkyl” for R9 may include lower alkyl similar to those exemplified for Rlabove.
Examples of the substituents for the ituted lower alkyl for R9 may include those exemplified as the substituents for the “substituted lower alkyl” for R18 and R19 mentioned below, in which the preferred are carboxy, hydroxy, (Cr—6)alkoxycarbonyl, morpholino, morpholinocarbonyl or (Ci—6)alkylsulfonyloxy.
Examples of the “lower alkanoyl” of the “substituted or unsubstituted lower alkanoyl” for R9 may include (C2.7)alkanoyl [e. g, (Cr—6)alkyl-carbonyl (e. g. acetyl, ethylcarbonyl, propylcarbonyl, butylcarbonyl, pentylcarbonyl, hexylcarbonyl, etc), etc].
Examples of the substituents for the “substituted lower yl” for R9may include those exemplified as the substituents for the “substituted lower alkyl” for R18 and R19 mentioned below.
Preferred examples of R9 may include hydrogen; (Cr—6)alkyl optionally substituted by carboxy, hydroxy, (Cr—6)alkoxycarbonyl, morpholino, linocarbonyl or (C1. 6)alkylsulfonyloxy, (C2-7)alkanoyl, etc.
] Alternatively, R6 and R9 may be taken together to form a bond.
(Definitions of m and 11) m and n are each 0, l or 2.
(Definitions of R10 and R”) In the a (IV), R10 is selected from the group consisting of en, halogen, hydroxy, formyl, cyano, substituted or unsubstituted lower alkyl, tuted or unsubstituted amino, substituted or unsubstituted lower alkoxy, saturated cyclic amino, substituted or unsubstituted carbamoyl, carboxy and substituted or unsubstituted lower alkoxycarbony.
Specifically, R10 is hydrogen or substituted or unsubstituted lower alkyl.
Examples of the “lower alkyl” for the “substituted or unsubstituted lower alkyl” for R10 may include lower alkyl similar to those ified for Rlabove, in which the red one may be (Ci—6)alkyl and more preferred one may be methyl, ethyl, isopropyl, etc.
Examples of the substituents for the “substituted lower alkyl” for R10 may include: (1) hydroxy, (2) arylalkoxy [e.g., (Cs—14)aryl(C1-6)alkoxy such as benzyloxy, phenethyloxy, etc]; (3) di(C6—14)aryl(C1-6)alkylsilyloxy (e.g., methyldiphenylsilyloxy, tert- butyldiphenylsilyloxy, etc.), etc.
Preferred examples of R10 may e hydrogen, (Ci—6)alkyl optionally substituted by (Cs—14)aryl(C1.6)alkoxy, di(C6—14)aryl(C1-6)alkylsilyloxy or hydroxy, etc.
Examples of the “substituted or unsubstituted ) (4 substituted or unsubstituted lower alkoxy”, “saturated cyclic amino”, “substituted or unsubstituted carbamoyl” and “lower alkoxycarbonyl” for R10 may be similar to the “substituted or unsubstituted amino”, “substituted or tituted lower ”, “saturated cyclic amino”, “substituted or unsubstituted carbamoyl” and “lower alkoxycarbonyl” exemplified above as the substituents for the “substituted lower alkyl” for R12 ned below.
Alternatively, R9 and R10 may be taken together to form lower alkylene (e.g., (C2. 6)alkylene such as ethylene, ene, butylene, pentylene, hexylene, etc.), in which preferred may be propylene, etc.
R11 is selected from the group consisting of hydrogen, halogen, substituted or tituted lower alkyl, carboxy and substituted or unsubstituted lower alkoxycarbonyl.
] Examples of the “halogen” for R11 may include , fluoro, bromo, iodo, etc.
Examples of the “lower alkyl” for the “substituted or unsubstituted lower alkyl” for R11 may include lower alkyl similar to those exemplified for Rlabove, and examples of the “lower alkoxycarbonyl” for the “substituted or unsubstituted lower alkoxycarbonyl” for R11 may include those exemplified above as the substituent (8) for the “substituted lower alkyl” for Rlzmentioned below. Examples of the substituents for “substituted lower alkyl” and “substituted lower alkoxycarbonyl” for R11 may include those exemplified as the substituents for the “substituted lower alkyl” for R1.
Specifically, R11 is hydrogen, or lower alkyl.
Examples of the lower alkyl for R11 may e lower alkyl r to those exemplified for R1 above, in which the preferred may be (Ci—4)alkyl and more preferred may be methyl, ethyl, isopropyl, etc.
Alternatively, R10 and R11 may be taken together to form (1) substituted or unsubstituted lower alkylene [e.g., alkylene (e.g., ethylene, propylene, butylene, pentylene, ne, etc., in which the preferred one may be ethylene, ene, butylene, etc.)]; (2) substituted or unsubstituted lower alkylidene [e.g., (Ci—6)alkylidene such as methylidene, ethylidene, propylidene, butylidene, pentylidene, hexylene, etc., in which the preferred one may be methylidene, ethylidene, propanylidene, etc]; (3) oxo, or (4) hydroxyimino, etc.
As used herein, the term “lower alkylene” in the phrase “substituted lower alkylene” formed by R10 and R11 may also include alkylene group as defined above in which one or more carbon atom(s) is (are) replaced by one or more heteroatom(s) selected from a nitrogen atom, an oxygen atom and a sulfur atom, and examples of such lower alkylene formed by R10 and R11 may include following groups such as, but not limited to, —(CH2)2—O—(CH2)2—, —(CH2)2—N— (CH2)2—, etc.
Examples of the substituents for the above-mentioned “substituted lower alkylene” formed together by R10 and R11 may include: (1) koxycarbonyl [e.g., (Cs—14)aryl(C1.6)alkoxycarbonyl such as benzyloxycarbonyl, phenetyloxycarbonyl, etc. ]; (2) acyl [e.g., alkanoyl such as formyl, acetyl, propionyl, butyryl, etc., (Cs—14)acyl such as benzoyl, etc.], etc.
] Preferred examples of the “substituted or unsubstituted lower ne” formed by R10 and R11 may include (C2-6)alkylene in which one or more carbon atom(s) may be replaced with heteroatom(s) selected from an oxygen atom and a nitrogen atom, which is optionally substituted by (C6—14)aryl(C1.6)alkoxycarbonyl or (Ci—7)alkanoyl.
] Alternatively, R9 and R10 may be taken er to form lower alkylene or a bond.
Examples of the “lower alkylene” formed by R9 and R11 may include (C2—6)alkylene, in which preferred are propylene, etc.
(Definitions of R12, R13 and R“) In the above-mentioned Formula (I), R12 is selected from the group ting of en, halogen, hydroxy, formyl, cyano, substituted or unsubstituted lower alkyl, substituted or unsubstituted amino, substituted or unsubstituted lower alkoxy, saturated cyclic amino, tuted or unsubstituted carbamoyl, carboxy and tuted or unsubstituted lower alkoxycarbonyl, substituted or unsubstituted acyloxy.
Examples of the en” for R12 may include chloro, fluoro, bromo, iodo, etc., in which the preferred one may be , etc.
Examples of the “lower alkyl” of the “substituted or unsubstituted lower alkyl” for R12 may include lower alkyl similar to those exemplified above for R1, in which the preferred one may be (Ci—4)alkyl and more preferred one may be methyl, ethyl, isopropyl, etc.
Examples of the substituents for the “substituted lower alkyl” for R12 may include: (1) hydroxy, hydroxyimino or tri(lower)alkylsilyloxy, (2) halogen (e.g., chloro, fluoro, bromo, iodo, etc.); (3) substituted or unsubstituted amino [e.g., amino, mono- or di-(substituted or unsubstituted lower alkyl)amino (e.g., mono-(C1.6)alkylamino in which said (Ci—6)alkyl may be substituted by (Cs—14)aryl, (C3.s)cycloalkylcarbonyl or hydroxy (e.g., methylamino, ethylamino, amino, isopropylamino, butylamino, tert-butylamino, neopentylamino, hydroxymethylamino, hydroxyethylamino, cyclopropanecarbonylamino, etc.), -4)alkylamino in which one or both of said (C1— 4)alkyl may be substituted by (Cs—14)aryl (e.g., dimethylamino, diethylamino, ethylmethylamino, etc.), 2-hydroxyethylamino, 2-methoxyethylamino, 2- hylamino)ethylamino, 2-hydroxy-l,l-dimethylethylamino, 2-hydroxy-l- (hydroxymethyl)ethylamino, (2-hydroxyethyl)methylamino, (2- WO 71147 methoxyethyl)methylamino, benzylmethylamino, tert-butylbenzylamino, dibenzylamino etc.), mono-(C2.7) alkanoylamino (e.g., acetylamino, ethylcarbonylamino, propylcarbonylamino, pylcarbonylamino, butylcarbonylamino, pentylcarbonylamino, hexylcarbonylamino, etc.), (Cs—s)cycloalkylamino (e.g., cyclopropylamino, cyclobutylamino, cyclopentylamino, cyclohexylamino, etc.), etc]; (4) substituted or unsubstituted lower alkoxy (e.g., (Ci—6)alkoxy (e.g., methoxy, ethoxy, propoxy, isopropoxy, butoxy, neopentyloxy, etc.), (Cs—14)aryl(C1—6)alkoxy (e.g., benzyloxy, etc.), 2-hydroxyethyloxy, 2-hydroxy-l,l-dimethylethyloxy, 2- methoxyethyloxy, 2-(dimethylamino)ethyloxy, etc.); (5) saturated cyclic amino [e.g., 4-, 5- or 6-membered saturated cyclic amino which may further have heteroatom(s) selected from a nitrogen atom, an oxygen atom and a sulfur atom and/or oxo besides the amino nitrogen and may have tuent(s), such as azetidinyl (e.g., 3-hydroxy-l-azetidinyl, 3-amino-l-azetidinyl, 3-methylamino-l- azetidinyl, etc.), pyrrolidinyl (e.g., l-pyrrolidinyl, oxy-l-pyrrolidinyl, 3-amino-l- pyrrolidinyl, ylamino-l-pyrrolidinyl, etc.), morpholinyl (e.g., morpholino, etc.), 4- (lower)alkyl-l-piperazinyl (e.g., 4-methyl-l-piperazinyl, 4-isopropyl-l-piperazinyl, etc.), 4-(mono- or di-(lower)alkylamino)-l-piperidinyl (e.g., 4-(dimethylamino)-l-piperidinyl, etc.), oxopyrrolidinyl (e.g., 2-oxo-l-pyrrolidinyl, etc.), etc]; (6) substituted or unsubstituted carbamoyl [e.g., carbamoyl, (lower)alkylcarbamoyl (e.g., (Ci—4)alkylcarbamoyl such as methylcarbamoyl, ethylcarbamoyl, propylcarbamoyl, isopropylcarbamoyl, butylcarbamoyl, etc.), (C3-s)cycloalkylcarbamoyl (e.g., cyclopropylcarbamoyl, etc.), etc]; (7) carboxy; (8) lower alkoxycarbonyl [e.g., (Ci—6)alkoxycarbonyl (e.g., methoxycarbonyl, ethoxycarbonyl, oxycarbonyl, tert-butoxycarbonyl, pentyloxycarbamoyl, hexyloxycarbamoyl, etc. ), etc. ]; (9) lower alkylureido [e.g., (Ci—6)alkylureido (e.g., ureido, ethylureido, etc.)] (10) lower y [e.g., (Ci—7)alkanoyloxy (e.g., formyloxy, acetyloxy, arbonyloxy, propylcarbonyloxy, butylcarbonyloxy, pentylcarbonyloxy, hexylcarbonyloxy, etc.], etc.
The number of the substituent may be one, two or more. Where the number of the substituent is two or more, the tuents may be the same or different.
Examples of the “substituted or unsubstituted amino”, “saturated cyclic amino”, “substituted or unsubstituted lower alkoxy”, “substituted or unsubstituted carbamoyl” and “lower carbonyl” for R12 may be similar to the “substituted or unsubstituted amino”, “saturated cyclic amino”, “substituted or unsubstituted lower alkoxy”, “substituted or unsubstituted carbamoyl” and “substituted or unsubstituted lower alkoxycarbonyl” exemplified above as the substituents of the “substituted lower alkyl” for R”. es of the “acyloxy” for the “substituted or unsubstituted acyloxy” for R12 may include lower acyloxy r to those exemplified above as the substituent (10) for the “substituted lower alkyl” for R12 mentioned above.
] Examples of the substituents for the “substituted acyloxy” for R12 may be similar to those exemplified as the substituents for the “substituted lower alkyl” for R”.
] Preferable examples for R12 may include hydrogen; halogen; hydroxy, carboxy; formyl, cyano, hydroxycyano; (Ci—6)alkyl ally tuted by hydroxy, hydroxyimino, halogen, (Ci-6)alkoxy, (Ci—7)alkanoyloxy, amino, mono- or .6)alkylamino (in which one or both of said (Ci—6)alkyl is (are) optionally tuted by y, (Ci—6)alkoxy, (Cs—14)aryl or (C3— 6)cycloalkyl-carbonyl), (Ci—6)alkylureido, morpholino, (Ci—7)alkanoyloxy, or 4- to ered cyclic amino optionally substituted by hydroxy, (Ci—6)alkyl or 6)alkylamino, mono- or di- (C1-7)alkylamino, 4- to 6-membered cyclic amino; (Ci—6)alkoxy optionally substituted by (C6- 14)aryl; carbamoyl optionally substituted by (Cs—6)cycloalkyl or hydroxy(C1—6)alkyl, (C1— 6)alkoxycarbonyl, (Ci—6)alkoxycarbonyloxy, etc.
Among the above-mentioned substituents, suitable examples of R12 may include hydrogen, fluoro, hydroxy, formyl, cyano, methyl, aminomethyl, tert-butylaminomethyl, dimethylaminomethyl, diethylaminomethyl, dibenzylaminomethyl, benzylmethylaminomethyl, benzyl(tert-buthyl)aminomethyl, methoxycarbonylmethyl, 3-hydroxyazetinylmethyl, 4- methylpiperazinylmethyl, pyrrolidinylmethyl, hydroxymethyl, hydroxyethylaminomethyl, methoxyethylaminomethyl, iodomethyl, methylaminomethyl, morpholinomethyl, (2- hydroxyethyl)methylaminomethyl, acetyloxymethyl, 4-(dimethylamino)-l-piperidinylmethyl, ethoxycarbonylmethyl, cyclopropylcarbamoylmethyl, ethylureidomethyl, yiminomethyl, dimethylamino, isopropylamino, 3-hydroxy-l-azetidinyl, piperidino, lino, benzyloxy, tyloxy, carboxy, methoxycarbonyl, ethoxycarbonyl, tert-butoxycarbonyl, carbamoyl, cyclopropylcarbamoyl, etc.
R13 is selected from the group consisting of hydrogen, halogen, substituted or unsubstituted lower alkyl, carboxy and substituted or unsubstituted lower alkoxycarbonyl.
Examples of the “halogen” and “substituted or unsubstituted lower alkoxycarbonyl” for R13 may be similar to those exemplified for R“.
Examples of the “lower alkyl” of the “substituted or unsubstituted lower alkyl” for R13 may include lower alkyl similar to those exemplified above for R1, in which the preferred one may be (Ci—4)alkyl, and more preferred one may be methyl, ethyl, isopropyl, etc.
Examples of the substituents for the “substituted lower alkyl” for R13 may include (1) hydroxy; (2) halogen (e.g., chloro, fluoro, bromo, iodo, etc.); (3) substituted or unsubstituted amino [e.g., amino, mono- or bstituted or unsubstituted lower alkyl)amino (e.g., mono-(C1.6)alkylamino (e.g., amino, ethylamino, propylamino, isopropylamino, mino, tert-butylamino, neopentylamino, etc.), di-(C1-4)alkylamino (e.g., dimethylamino, diethylamino, ethylmethylamino, etc.), 2- hydroxyethylamino, 2-methoxyethylamino, 2-(dimethylamino)ethylamino, 2-hydroxy- l, l -dimethylethylamino, 2-hydroxy- l -(hydroxymethyl)ethylamino, (2- hydroxyethyl)methylamino, (2-methoxyethyl)methylamino, etc.), mono-(C2- 7)alkanoylamino (e.g., acetylamino, ethylcarbonylamino, propylcarbonylamino, isopropylcarbonylamino, butylcarbonylamino, pentylcarbonylamino, hexylcarbonylamino, etc.), (C3.s)cycloalkylamino (e.g., cyclopropylamino, cyclobutylamino, cyclopentylamino, cyclohexylamino, etc.), etc]; (4) substituted or tituted lower alkoxy [e.g., alkoxy (e.g., methoxy, ethoxy, propoxy, poxy, , etc.), 2-hydroxyethyloxy, 2-hydroxy-l,l-dimethylethyloxy, 2-methoxyethyloxy, ethylamino)ethyloxy, etc]; (5) lower alkanoyloxy [e.g., (Ci—7)alkanoyloxy [e.g., formyloxy, acetyloxy, ethylcarbonyloxy, propylcarbonyloxy, butylcarbonyloxy, carbonyloxy, hexylcarbonyloxy, etc]; etc.
The number of the substituent may be one, two or more. Where the number of the substituent is two or more, the substituents may be the same or different.
Suitable examples of R13 may include hydrogen, halogen (e.g., fluoro, etc.), (C1. 6)alkyl optionally substituted by hydroxy, fluoro, halogen, (Ci—6)alkoxy or (Ci—7)alkanoyl (e.g., methyl, hydroxymethyl, fluoromethyl, methoxymethyl, acetyloxymethyl, etc.), in which preferred are hydrogen, halogen or (Ci—6)alkyl optionally tuted by hydroxy or (C1— 7)alkanoyloxy (e.g., hydroxymethyl, acetyloxymethyl, etc.), etc.
R14 is selected from the group consisting of hydrogen, halogen, substituted or unsubstituted lower alkyl, carboxy and substituted or unsubstituted lower alkoxycarbonyl.
The “halogen”, “substituted or unsubstituted lower alkyl” and “substituted or tituted lower alkoxycarbonyl” for R14 may be similar to those exemplified for R“.
Preferably, R14 is hydrogen.
Alternatively, R12 and R13 may be taken together to form (1) substituted or unsubstituted lower alkylene [e.g., (C2.6)alkylene (e.g., ethylene, propylene, butylene, ene, hexylene, etc., in which the preferred one may be ethylene, propylene, butylene, etc.)]; (2) substituted or unsubstituted lower alkylidene (e.g., (Ci—6)alkylidene such as methylidene, ethylidene, propylidene, butylidene, idene, hexylidene, etc., in which the preferred one may be idene, ethylidene, ylidene, etc]; (3) oxo, or (4) hydroxyimino.
The term “lower alkylene” in the phrase ituted or unsubstituted lower ne” for R12 and R13 refers to alkylene group as defined above in which one or more carbon atom(s) is (are) replaced by one or more heteroatom(s) selected from a nitrogen atom, an oxygen atom and a sulfur atom es of the substituents for the above-mentioned ituted lower alkylene” formed by R12 and R13 may include (1) substituents for “substituted or unsubstituted lower alkyl” for R”; and (2) substituted or unsubstituted lower alkyl [e. g., substituted or unsubstituted (Ci—6)alkyl (e.g., methyl, ethyl, propyl, isopropyl, n-butyl, tert-butyl, pentyl, hexyl, etc.), examples of the substituent may include the tuents for the “substituted or unsubstituted lower alkyl” for R12] Suitable examples of the “substituted or unsubstituted lower alkylene” formed by R12 and R13 may include following groups such as, but not limited to: Examples of the substituents for the mentioned “substituted lower alkylidene” formed by R12 and R13 may be similar to those exemplified for the “substituted or unsubstituted alkylene” formed by R12 and R13.
Suitable es of the “substituted or unsubstituted lower alkylidene” formed by R12 and R13 may e (Ci—6)alkylidene optionally substituted by hydroxy, such as the following groups, but not limited to, —CH2=CH—CH3=CH—CH2—OH, etc.
Alternatively, R11 and R12 or R13 and R14 may be taken together to form a bond.
In an embodiment of the present invention, R6 and R7 are taken together to form the following structure (A), (B1) or (B2).
(B1) (132) (Definition of R15) In the above-mentioned Formula (A), R15 is selected from the group consisting of hydroxy, tuted or unsubstituted lower alkyl, tuted or unsubstituted amino, substituted or unsubstituted lower alkoxy, saturated cyclic amino, lower substituted or unsubstituted carbamoyl, carboxy and substituted or unsubstituted lower alkoxycarbonyl.
Examples of the “lower alkyl” of the “substituted or unsubstituted lower alkyl” for R15 may include lower alkyl similar to those ified for Rlaboye, in which the preferred one may be (Ci—4)alkyl and more preferred one may be methyl, ethyl, isopropyl, etc.
Examples of the substituents for the “substituted lower alkyl” for R15 may include: (1) hydroxy; (2) substituted or unsubstituted amino [e.g., amino, mono or di-(substituted or unsubstituted lower alkyl)amino (e.g., mono-(C1—6)alkylamino such as methylamino, ethylamino, propylamino, isopropylamino, butylamino, utylamino, neopentylamino, etc; di-(C1-4)alkylamino such as ylamino, diethylamino, ethylamino, etc; 2-hydroxyethylamino, 2-methoxyethylamino, 2-(dimethylamino)ethylamino, 2-hydroxy- l, l -dimethylethylamino, 2-hydroxy- l -(hydroxymethyl)ethylamino, (2- hydroxyethyl)methylamino, (2-methoxyethyl)methylamino, etc), mono-(C2- )alkanoylamino (e.g., acetylamino, arbonylamino, propylcarbonylamino, isopropylcarbonylamino, butylcarbonylamino, etc.), (Cs—6)cycloalkylamino (e.g., cyclopropylamino, cyclobutylamino, cyclopentylamino, cyclohexylamino, etc.), etc.); (3) substituted or unsubstituted lower alkoxy [e.g., alkoxy (e.g., methoxy, ethoxy, propoxy, isopropoxy, butoxy, etc.), 2-hydroxyethyloxy, 2-hydroxy-l,l-dimethylethyloxy, 2-methoxyethyloxy, ethylamino)ethyloxy, etc]; (4) saturated cyclic amino [e.g., 4-, 5- or 6-membered saturated cyclic amino which may further have heteroatom(s) selected from a nitrogen atom, an oxygen atom and a sulfur atom and/or oxo besides the amino nitrogen and may have substituent(s), such as inyl (e.g., 3-hydroxy-l-azetidinyl, 3-amino-l-azetidinyl), pyrrolidinyl (e.g., lidinyl , etc.), morpholinyl (e.g., morpholino, etc.), 4-(lower)alkyl-l-piperazinyl (e.g., 4-methyl-l-piperazinyl, 4-isopropyl-l-piperazinyl, etc.), oxopyrrolidinyl (e.g., 2- oxo-l-pyrrolidinyl, etc.), etc]; (S) substituted or unsubstituted carbamoyl [e.g., carbamoyl, (lower)alkylcarbamoyl (e.g., (Ci—4)alkylcarbamoyl such as methylcarbamoyl, ethylcarbamoyl, propylcarbamoyl, isopropylcarbamoyl, butylcarbamoyl, etc.), etc.], (6) carboxy; (7) lower alkoxycarbonyl [e.g., (Ci—6)alkoxycarbonyl (e.g., methoxycarbonyl, ethoxycarbonyl, utoxycarbonyl, pentyloxycarbonyl, hexyloxycarbonyl), etc.], etc.
The number of the tuent may be one, two or more. Where the number of the substituent is two or more, the substituents may be the same or different.
Examples of the ituted or unsubstituted amino3) (4 substituted or unsubstituted lower alkoxy”, “saturated cyclic amino”, ituted or unsubstituted carbamoyl” and “lower alkoxycarbonyl” for R15 may be similar to the “substituted or tituted amino”, “substituted or unsubstituted lower alkoxy”, “saturated cyclic amino”, “substituted or tituted carbamoyl” and “lower alkoxycarbonyl” exemplified above as the substituents for the “substituted lower alkyl” for R15.
Suitable examples of R15 may include dimethylaminomethyl, methylaminomethyl, hydroxymethyl, morpholino, 3-hydroxyl-azetidinyl, etc.
(Definitions of R16 and R17) In the above-mentioned Formula (Bl), R16 is ed from the group consisting of hydrogen, halogen, hydroxy, tuted or unsubstituted lower alkyl, tuted or tituted amino, saturated cyclic amino, substituted or unsubstituted lower alkoxy, substituted or unsubstituted carbamoyl, carboxy and lower carbonyl.
] Examples of the “halogen” for R16 may include chloro, fluoro, bromo, iodo, etc., in which the preferred one may be fluoro, etc. es of the “lower alkyl” of the “substituted or unsubstituted lower alkyl” for R16 may include lower alkyl similar to those exemplified for RlaboVe, in which the preferred one may be (Ci—4)alkyl and more preferred one may be methyl, ethyl, isopropyl, etc.
Examples of the substituents for the “substituted lower alkyl” for R16 may include: (1) hydroxy or tri(lower)alkylsilyloxy, (2) halogen (e.g., chloro, fluoro, bromo, iodo, etc); (3) substituted or unsubstituted amino [e.g., amino, mono- or di-(substituted or unsubstituted lower alkyl)amino (e.g., mono-(C1.6)alkylamino (e.g., methylamino, ethylamino, propylamino, isopropylamino, butylamino, tert-butylamino, tylamino, etc.), di-(C1-4)alkylamino (e.g., dimethylamino, diethylamino, ethylmethylamino, etc.), 2- hydroxyethylamino, 2-methoxyethylamino, 2-(dimethylamino)ethylamino, 2-hydroxy- l, l -dimethylethylamino, 2-hydroxy- l -(hydroxymethyl)ethylamino, (2- hydroxyethyl)methylamino, (2-methoxyethyl)methylamino, etc.), mono-(C2- )alkanoylamino (e.g., acetylamino, ethylcarbonylamino, propylcarbonylamino, pylcarbonylamino, butylcarbonylamino, etc.), (C3.s) cycloalkylamino (e.g., cyclopropylamino, cyclobutylamino, cyclopentylamino, cyclohexylamino, etc.), etc]; (4) tuted or unsubstituted lower alkoxy (e.g., (Ci—4)alkoxy (e.g., methoxy, ethoxy, propoxy, isopropoxy, butoxy, etc.), 2-hydroxyethyloxy, oxy-l,l-dimethylethyloxy, 2-methoxyethyloxy, 2-(dimethylamino)ethyloxy, etc); (5) saturated cyclic amino [e.g., 4-, 5- or 6-membered saturated cyclic amino which may further have heteroatom(s) selected from a nitrogen atom, an oxygen atom and a sulfur atom and/or oxo besides the amino nitrogen and may have substituent(s), such as azetidinyl (e.g., 3-hydroxy-l-azetidinyl, 3-amino-l-azetidinyl, 3-methylamino-lazetidinyl , etc.), idinyl (e.g., l-pyrrolidinyl, 3-hydroxy-l-pyrrolidinyl, 3-amino-l- pyrrolidinyl, 3-methylamino-l-pyrrolidinyl, etc.), morpholinyl (e.g., morpholino, etc.), 4- (lower)alkyl-l-piperazinyl (e.g., 4-methyl-l-piperazinyl, 4-isopropyl-l-piperazinyl, etc.), o- or di-(lower)alkylamino)-l-piperidinyl (e.g., 4-(dimethylamino)-l-piperidinyl, etc.), oxopyrrolidinyl (e.g., 2-oxo-l-pyrrolidinyl, etc.), etc]; (6) substituted or unsubstituted carbamoyl [e.g., carbamoyl, (lower)alkylcarbamoyl (e.g., (Ci—4)alkylcarbamoyl such as methylcarbamoyl, ethylcarbamoyl, propylcarbamoyl, isopropylcarbamoyl, butylcarbamoyl, etc.), etc]; (7) carboxy; (8) lower alkoxycarbonyl [e.g., (Ci—4)alkoxycarbonyl (e.g., methoxycarbonyl, ethoxycarbonyl, tert-butoxycarbonyl, etc.), etc.], etc. The number of the substituent may be one or two or more. Where the number of the substituent is two or more, the substituents may be the same or ent. es of the “substituted or unsubstituted amino”, “saturated cyclic amino”, “substituted or unsubstituted lower alkoxy”, “substituted or unsubstituted carbamoyl” and “lower alkoxycarbonyl” for R16 may be similar to the “substituted or unsubstituted amino”, “saturated cyclic amino”, “substituted or unsubstituted lower alkoxy”, “substituted or unsubstituted carbamoyl” and “lower alkoxycarbonyl” exemplified as the substituents of the “substituted or tituted lower alkyl” for R7.
Suitable examples of R16 may e hydrogen, fluoro, hydroxy, dimethylaminomethyl, hydroxymethyl, iodomethyl, 4-(dimethylamino)-l-piperidinylmethyl, dimethylamino, dino, pylamino, methylaminomethyl, morpholinomethyl, (2- hydroxyethyl)methylaminomethyl, morpholino, y, methoxycarbonyl, tert-butoxycarbonyl, oxy-l -azetidinyl, etc.
In the above-mentioned Formula (Bl), R17 is selected from the group consisting of hydrogen, halogen, substituted or unsubstituted lower alkyl, carboxy and lower alkoxycarbonyl.
Examples of the “halogen” for R17 may e chloro, fluoro, bromo, iodo, etc., in which the preferred one may be fluoro, etc.
Examples of the “lower alkyl” of the “substituted or unsubstituted lower alkyl” for R17 may include lower alkyl similar to those exemplified for e, in which the red one may be (Ci—4)alkyl, and more preferred one may be methyl, ethyl, isopropyl, etc. es of the substituents for the “lower alkyl” for R17 may include (1) hydroxy; (2) halogen (e.g., chloro, fluoro, bromo, iodo, etc); (3) tuted or unsubstituted amino [e.g., amino, mono- or di-(substituted or unsubstituted lower alkyl)amino (e.g., mono-(C1.6)alkylamino (e.g., methylamino, ethylamino, propylamino, isopropylamino, butylamino, t-butylamino, neopentylamino, etc.), di-(C1-4)alkylamino (e.g., dimethylamino, diethylamino, ethylmethylamino, etc.), 2- hydroxyethylamino, 2-methoxyethylamino, 2-(dimethylamino)ethylamino, 2-hydroxy- l, l -dimethylethylamino, 2-hydroxy- l -(hydroxymethyl)ethylamino, (2- hydroxyethyl)methylamino, (2-methoxyethyl)methylamino, etc.), mono-(C2- )alkanoylamino (e.g., acetylamino, ethylcarbonylamino, propylcarbonylamino, isopropylcarbonylamino, butylcarbonylamino, etc.), (C3.s) cycloalkylamino (e.g., cyclopropylamino, cyclobutylamino, cyclopentylamino, cyclohexylamino, etc.), etc]; (4) substituted or unsubstituted lower alkoxy [e.g., (Ci—4)alkoxy (e.g., y, ethoxy, propoxy, isopropoxy, butoxy, etc.), oxyethyloxy, 2-hydroxy-l,l-dimethylethyloxy, 2-methoxyethyloxy, 2-(dimethylamino)ethyloxy, etc.], etc. The number of the substituent may be one or two or more. Where the number of the substituent is two or more, the substituents may be the same or different.
Suitable examples of R17 may include hydrogen, , ymethyl, fluoro, fluoromethyl, methoxymethyl, etc.
Alternatively, R16 and R17 are taken together to form lower alkylene or lower alkylidene.
Examples of the “lower alkylene” for R16 and R17 may include (C2-6)alkylene such as ethylene, propylene, butylene, ene, ne, etc., in which the red one may be ethylene, propylene, butylene, etc.
Examples of the “lower alkylidene” for R16 and R17 may include (Ci—6)alkylidene such as methylidene, ethylidene, propylidene, butylidene, pentylidene, hexylene, etc., in which the preferred one may be methylidene, dene, propanylidene, etc.
(Definition of R18) In the above-mentioned Formula (Bl); R18 is hydrogen or substituted or tituted lower alkyl; provided that when both R16 and R17 are simultaneously en, R1 is substituted or unsubstituted lower alkyl.
Examples of the “lower alkyl” of the “substituted or unsubstituted lower alkyl” for R18 may include lower alkyl similar to those exemplified for RlaboVe; in which the preferred one may be (Ci—4)alkyl and more preferred one may be ethyl, propyl; etc.
] Examples of the substituents for the “substituted lower alkyl” for R18 may e (1) hydroxy; (2) carboxy; (3) halogen (chloro; fluoro; bromo; iodo); (4) (lower)alkoxycarbonyl [e.g.; (Ci—6)alkoxycarbonyl (e.g.; methoxycarbonyl; ethoxycarbonyl; propoxycarbonyl; butoxycarbonyl; t-butoxycarbonyl; pentyloxycarbonyl; hexyloxycarbonyl; etc.); etc]; (S) substituted or unsubstituted amino (e.g.; amino; mono- or di-(substituted or unsubstituted lower amino (e.g.; mono-(C1.6)alkylamino (e.g.; methylamino; ethylamino; amino; isopropylamino; butylamino; tert-butylamino; neopentylamino; etc.); di-(C1-4)alkylamino (e.g.; dimethylamino; diethylamino; ethylamino; etc.); 2- hydroxyethylamino; 2-methoxyethylamino; 2-(dimethylamino)ethylamino; 2-hydroxy- l; l -dimethylethylamino; 2-hydroxy- l -(hydroxymethyl)ethylamino; (2- hydroxyethyl)methylamino; (2-methoxyethyl)methylamino; etc.); mono-(C2- )alkanoylamino (e.g.; acetylamino; ethylcarbonylamino; propylcarbonylamino; isopropylcarbonylamino; butylcarbonylamino; etc.); (C3-9)cycloalkylamino (e.g.; cyclopropylamino; utylamino; cyclopentylamino; cyclohexylamino; etc.); etc]; (6) substituted or unsubstituted lower alkoxy [e.g.; (Ci—4)alkoxy (e.g.; y; ethoxy; propoxy; isopropoxy; butoxy; etc.); 2-hydroxyethyloxy; 2-hydroxy-l,l-dimethylethyloxy; 2-methoxyethyloxy; 2-(dimethylamino)ethyloxy; etc]; (7) saturated cyclic amino [e.g.; 4; 5- or 6-membered saturated cyclic amino which may further have heteroatom(s) selected from a nitrogen atom; an oxygen atom and a sulfur atom and/or oxo besides the amino nitrogen and may have substituent(s); such as inyl (e.g., 3-hydroxy-l-azetidinyl, 3-amino-l-azetidinyl, 3-methylamino-l- azetidinyl, etc.), pyrrolidinyl (e.g., l-pyrrolidinyl, 3-hydroxy-l-pyrrolidinyl, 3-amino-lpyrrolidinyl , ylamino-l-pyrrolidinyl, etc.), morpholinyl (e.g., morpholino, etc.), 4- (lower)alkyl-l-piperazinyl (e.g., 4-methyl-l-piperazinyl, 4-isopropyl-l-piperazinyl, etc.), 4-(mono- or di-(lower)alkylamino)-l-piperidinyl (e.g., 4-(dimethylamino)-l-piperidinyl, etc.), oxopyrrolidinyl (e.g., 2-oxo-l-pyrrolidinyl, etc.), etc]; (8) lower alkylsulfonyloxy [e.g., (Ci—6)alkylsulfonyloxy (e.g., sulfonyloxy, ethylsulfonyloxy, propylsulfonyloxy, butylsulfonyloxy, pentylsulfonyloxy, hexylsulfonyloxy, etc.), etc]; (9) tuted or unsubstituted arylsulfonyloxy (e.g., p-toluenesulfonyloxy, benzenesulfonyloxy, mesitylenesulfonyloxy, etc.), etc. The number of the substituent may be one or two or more. Where the number of the substituent is two or more, the substituents may be the same or different.
Suitable examples of R18 may include hydrogen, methyl, ethyl, tert- butoxycarbonylethyl, carboxyethyl, hydroxypropyl, methoxyethyl, hydroxyethyl, dimethylaminopropyl, etc.
(Definition of R”) In the above-mentioned Formula (B2), R19 is hydrogen or substituted or unsubstituted lower alkyl.
Examples of the “lower alkyl” of the “substituted or unsubstituted lower alkyl” for R19 may include lower alkyl similar to those exemplified for Rlaboye, in which the preferred one may be (Ci—14)alkyl and more preferred one may be ethyl, propyl, etc.
Examples of the substituents for the ituted lower alkyl” for R19 may e (1) hydroxy; (2) carboxy; (3) )alkoxycarbonyl [e.g., (Ci—6)alkoxycarbonyl (e.g., methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, butoxycarbonyl, oxycarbonyl, hexyloxycarbonyl, etc.), etc]; (4) saturated cyclic amino [e.g., 4-, 5- or 6-membered saturated cyclic amino which may further have atom(s) selected from a nitrogen atom, an oxygen atom and a sulfur atom and/or oxo besides the amino nitrogen and may have tuent(s), such as azetidinyl (e.g., 3-hydroxy-l-azetidinyl, 3-amino-l-azetidinyl, etc.), morpholinyl (e.g., morpholino, etc.), etc]; (5) (saturated cyclic carbonyl [e.g., a group in which the saturated cyclic amino as exemplified in (4) above is attached to a carbonyl group (e.g., morpholinocarbonyl, etc.), etc]; (6) (lower)alkylsulfonyloxy [e.g., (Ci—6)alkylsulfonyloxy (e.g., methylsulfonyloxy, ethylsulfonyloxy, propylsulfonyloxy, butylsulfonyloxy, pentylcarbonyloxy, hexylcarbonyloxy, etc.), etc]; (7) substituted or unsubstituted amino [e.g., amino, mono- or di-(substituted or tituted lower alkyl)amino (e.g., mono-(C1.6)alkylamino (e.g., methylamino, ethylamino, propylamino, isopropylamino, butylamino, tert-butylamino, neopentylamino, etc.), di-(C1-4)alkylamino (e.g., dimethylamino, diethylamino, ethylmethylamino, etc.), 2- hydroxyethylamino, 2-methoxyethylamino, 2-(dimethylamino)ethylamino, 2-hydroxy- l, l -dimethylethylamino, oxy- l oxymethyl)ethylamino, (2- hydroxyethyl)methylamino, (2-methoxyethyl)methylamino, etc.), C2— )alkanoylamino (e.g., amino, ethylcarbonylamino, propylcarbonylamino, isopropylcarbonylamino, butylcarbonylamino, etc.), (C3.s) cycloalkylamino (e.g., cyclopropylamino, cyclobutylamino, cyclopentylamino, cyclohexylamino, etc.), etc.), (8) substituted or unsubstituted arylsulfonyloxy (e.g., p-toluenesulfonyloxy, benzenesulfonyloxy, mesitylenesulfonyloxy, etc.); (9) halogen (e.g., chloro, fluoro, bromo, iodo, etc.), etc. The number of the tuent may be one or two or more. Where the number of the substituent is two or more, the substituents may be the same or different.
Suitable examples of R19 may include methyl, ethyl, propyl, methoxyethyl, methoxypropyl, hydroxyethyl, ethoxycarbonylethyl, carboxyethyl, hydroxypropyl, morpholinocarbonylethyl, methylsulfonyloxypropyl, morpholinopropyl, methylaminopropyl, dimethylaminopropyl, etc.
Genus V Description Compounds of Genus V can be prepared according to the disclosure of US 7,125,898, which is herein incorporated herein by reference in its entirety.
Genus V is characterized by compounds of Formula V: o N—(CH2)m—R1 | ()nz x R4 Y (V), or stereoisomers thereof, isotopically-enriched compounds thereof, prodrugs thereof, solvates thereof, and pharmaceutically acceptable salts thereof; wherein: R1 is selected from hydrogen, C1.6alkyl optionally substituted by up to three groups selected from koxy, halogen and hydroxy, C2-6alkenyl, C3.7cycloalkyl ally substituted by one or more C1—6alkyl groups, phenyl optionally substituted by up to three groups selected from R5 and R6, and heteroaryl optionally substituted by up to three groups selected from R5 and R2 is selected from en, C1.6alkyl and — —C3.7cycloalkyl optionally substituted by one or more kyl groups, or —(CH2)mR1 and R2 taken er with the nitrogen atom to which they are bound, form a 4membered heterocyclic ring optionally substituted by up to three C1-6alkyl groups; R3 is chloro or methyl, R4 is —NH—CO—R7 or —CO—NH—(CH2)q—R8; R5 is selected from C1—6alkyl, C1-6alkoxy, —(CH2)q—C3-7cycloalkyl optionally substituted by one or more C1-6alkyl groups, —CONR9R10, 10, —SOzNHR9, (CH2)sNHSOzR10, halogen, —CN, —OH, —(CH2)sNR11R12, and trifluoromethyl, R6 is ed from C1—6alkyl, C1-6alkoxy, halogen, oromethyl, and —(CH2)sNR1 1R12, R7 is selected from hydrogen, C1.6alkyl, —(CH2)q—C3-7cycloalkyl optionally substituted by one or more C1-6alkyl groups, oromethyl, —(CH2)r—heteroaryl optionally substituted by R13 and/or R14, and —(CH2)r—phenyl optionally substituted by R13 and/or R14; R8 is selected from hydrogen, C1—6alkyl, C3.7cycloalkyl optionally substituted by one or more C1-6alkyl groups, —CONHR9, phenyl optionally substituted by R13 and/or R14, and heteroaryl optionally substituted by R13 and/or R14; R9 and R10 are each independently selected from hydrogen and kyl, or R9 and R10 taken together with the nitrogen atom to which they are bound, form a 5- or 6- membered heterocyclic ring optionally containing one additional atom selected from oxygen, sulfur and N—Rls, wherein the ring may be substituted by up to two C1- 6alkyl groups; R11 is selected from hydrogen, C1-6alkyl and q—C3-7cycloalkyl optionally substituted by one or more C1—6alkyl groups, R12 is selected from en and C1—6alkyl, or R11 and R12 taken together with the nitrogen atom to which they are bound, form a 5- or 6-membered heterocyclic ring ally containing one additional heteroatom selected from oxygen, sulfur and N—Rls, R13 is selected from C1—6alkyl, C1.6alkoxy, —(CH2)q—C3-7cycloalkyl optionally substituted by one or more C1.6alkyl groups, R10, —NHCOR10, halogen, —CN, —(CH2)sNR11R12, trifluoromethyl; phenyl optionally substituted by one or more R14 groups and heteroaryl optionally substituted by one or more R14 groups; R14 is ed from C1—6alkyl; C1.6alkoxy; halogen, trifluoromethyl and —NR“R12; R15 is selected from hydrogen and methyl; X and Y are each independently selected from hydrogen, methyl and n; Z is halogen; m is selected from O; l; 2; 3 and 4; wherein each carbon atom of the ing carbon chain may be optionally substituted with up to two groups ed independently from C1-6alkyl and halogen; n is selected from O; l and 2; q is selected from O; l and 2; r is selected from O and l; and s is selected from O; 1; 2 and 3.
In one embodiment; the p38 kinase inhibitor from Genus V is selected from the following: 6-(5-cyclopropylcarbamoylfluoromethyl-phenyl)-N-cyclopropylmethyl- nicotinamide; 6-(5-cyclopropylcarbamoylfluoromethyl-phenyl)-N-(lcyclopropylethyl )nicotinamide; 6-(5-cyclopropylcarbamoylfluoromethyl-phenyl)-N-(2,2- dimethylpropyl)nicotinamide; 6-(5-cyclopropylcarbamoylfluoromethyl-phenyl)-N-(2- methylpropyl)nicotinamide; and ] 6-(5-cyclopropylcarbamoylfluoromethyl-phenyl)-N-(lmethylpropyl )nicotinamide. yclopropy1carbamoyl-3 -fluoromethyl-phenyl)-N-cyclobuty1methyl- nicotinamide; 6-(5-cyclopropy1carbamoyl-3 -fluoromethy1—pheny1)-N-cyclobutyl-nicotinamide, 6- {5-[(cyclopropylamino)carbonyl]-3 -fluoromethylpheny1} -N—(2,4, 5- trifluorobenzy1)nicotinamide; 6- yclopropylamino)carbonyl]-3 -fluoromethylpheny1}-N—(2,5- obenzyl)nicotinamide; 6- {5-[(cyclopropylamino)carbonyl]-3 -fluoromethylpheny1}-N—(3,4- difluorobenzyl)nicotinamide; ] N—(3-chlorobenzyl) {5-[(cyclopropylamino)carbonyl]fluoro methylphenyl } nicotinamide; N—(4-chlorobenzyl) {5-[(cyclopropylamino)carbonyl]fluoro methylphenyl } nicotinamide; N—(3-ch1orofluorobenzyl) {5- [(cyclopropylamino)carbonyl]-3 -fluoro methylphenyl } nicotinamide; N—(2-chloro-3,6-difluorobenzyl) {5-[(cyclopropylamino)carbonyl]fluoro methylphenyl } nicotinamide; 6- yclopropylamino)carbonyl]-3 -fluoromethy1pheny1}-N—(2,3-difluoro methylbenzyl)nicotinamide; 6- {5-[(cyclopropylamino)carbonyl]-3 -fluoromethy1pheny1} -N—(2,3, 5- trifluorobenzy1)nicotinamide; 6- {5-[(cyclopropylamino)carbonyl]-3 -fluoromethy1pheny1} -N—(3-fluoro methylbenzyl)nicotinamide; N—(5-ch1orofluorobenzyl) {5- [(cyclopropylamino)carbonyl]-3 -fluoro methylphenyl } nicotinamide; hlorobenzyl) {5-[(cyclopropylamino)carbonyl]fluoro methylphenyl } nicotinamide; 6- {5-[(cyclopropylamino)carbonyl]-3 -fluoromethy1pheny1} -N—(4- fluorobenzyl)nicotinamide; 6- yclopropylamino)carbonyl]-3 -fluoromethy1pheny1}-N—(2,3,4- trifluorobenzy1)nicotinamide; N—benzy1{5-[(cyclopropylamino)carbonyl]fluoro methylphenyl } nicotinamide; 6-{5-[(cyclopropylamino)carbonyl]fluoromethy1pheny1}-N-[3 - (trifluoromethyl)benzyl]nicotinamide; 6- {5-[(cyclopropylamino)carbonyl]-3 -fluoromethylpheny1}-N—(1,1- dimethylbutyl)nicotinamide; N—(4-ch10rofluorobenzy1){5-[(cyclopropylamino)carbonyl]-3 -fluoro methylphenyl } nicotinamide; 6-{5-[(cyclopropylamino)carbony1]fluoromethy1pheny1}-N-[4- (trifluoromethyl)benzyl]nicotinamide; 6-{5-[(cyclopropylamino)carbony1]fluoromethy1phenyl}-N-[(5-methy1—2- fury1)methy1] nicotinamide; 6- {5-[(cyclopropylamino)carbonyl]-3 -fluoromethy1pheny1}-N—(2,3- obenzyl)nicotinamide; N—(3-ch1orofluorobenzyl) {5- [(cyclopropylamino)carbonyl]-3 -fluoro methylphenyl } nicotinamide; 6- yclopropylamino)carbonyl]-3 -fluoromethy1pheny1} -N—(4- methylbenzyl)nicotinamide; 6-{5-[(cyclopropylamino)carbony1]fluoromethy1phenyl}-N-[(3-methy1thien y1)methy1]nicotinamide; N—(3-chloro-2,6-difluorobenzyl) {5-[(cyclopropylamino)carbonyl]fluoro phenyl } nicotinamide; 6- {5 - [(cyclopropylamino)carbonyl] -3 -fluoromethy1pheny1} -N—(1 methylpropy1)nicotinamide; 6- {5-[(cyclopropylamino)carbonyl]-3 -fluoromethy1pheny1} -N—(2- fluorobenzyl)nicotinamide; ] 6- {5-[(cyclopropylamino)carbonyl]-3 -fluoromethy1pheny1} -N—(tert— )nicotinamide; 6- {5-[(cyclopropylamino)carbonyl]-3 -fluoromethy1pheny1} -N—(3- methylbenzyl)nicotinamide; and 6-(5-(cyclopropylcarbamoyl)fluoromethylphenyl)-N-neopentylnicotinamide (“Losmapimod”), a V’.
In one embodiment, the p38 kinase inhibitor is 6-(5-(cyclopropylcarbamoyl) fluoromethylphenyl)-N-neopentylnicotinamide (“Losmapimod”), Formula V’.
Genus VDefinitions ] As used herein, the term “alkyl” refers to straight or branched hydrocarbon chains ning the specified number of carbon atoms. For example, Cl-6alkyl means a straight or branched alkyl containing at least 1, and at most 6, carbon atoms. Examples of “alkyl” as used herein include, but are not d to, methyl, ethyl, n-propyl, n-butyl, n-pentyl, yl, isopropyl and t-butyl. A Cl -4alkyl group is preferred, for example methyl, ethyl, isopropyl or t- butyl. The said alkyl groups may be optionally substituted with one or more fluorine atoms for example, trifluoromethyl.
As used , the term “alkenyl” refers to straight or branched hydrocarbon chains containing the specified number of carbon atoms and containing at least one double bond. For example, C2-6alkenyl means a straight or branched alkenyl containing at least 2, and at most 6, carbon atoms and containing at least one double bond. Examples of “alkenyl” as used herein include, but are not limited to ethenyl, propenyl, 3-methylbutenyl and l,l-dimethylbutenyl.
As used herein, the term “alkoxy” refers to a straight or ed chain alkoxy group, for example, methoxy, ethoxy, propoxy, propoxy, butoxy, butoxy, 2-methylprop-l-oxy, 2- methylpropoxy, pentoxy, or hexyloxy. A Cl-4alkoxy group is preferred, for example y or ethoxy.
As used , the term “cycloalkyl” refers to a non-aromatic hydrocarbon ring containing the specified number of carbon atoms which may optionally contain up to one double bond. For example, C3-7cycloalkyl means a non-aromatic ring containing at least three, and at most seven, ring carbon atoms. Examples of “cycloalkyl” as used herein include, but are not d to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and cycloheptyl. A cloalkyl group is preferred, for example, cyclopropyl, cyclopentyl or cyclohexyl. The said cycloalkyl groups may be optionally substituted with one or more Cl-6alkyl , for example one or two methyl groups. In one embodiment, the cycloalkyl groups may be optionally substituted by up to four C1-6alkyl groups, for example one or two Cl-6alkyl groups, in particular one or two Cl- 4alkyl groups such as methyl or ethyl.
As used herein, the terms “heteroaryl ring” and “heteroaryl” refer to a monocyclic five- to seven-membered unsaturated hydrocarbon ring containing at least one heteroatom independently selected from , nitrogen and . Preferably, the heteroaryl ring has five or six ring atoms. Examples of heteroaryl rings include, but are not limited to, furyl, l, pyrrolyl, oxazolyl, thiazolyl, isoxazolyl, isothiazolyl, imidazolyl, pyrazolyl, oxadiazolyl, triazolyl, tetrazolyl, thiadiazolyl, l, pyridazinyl, pyrimidinyl, pyrazinyl and triazinyl. The said ring may be optionally substituted by one or more substituents ndently selected from C1-6alkyl and oxy.
As used herein, the terms “heterocyclic ring” or “heterocyclyl” refer to a monocyclic three- to seven-membered saturated hydrocarbon ring containing at least one heteroatom independently selected from oxygen, nitrogen and sulfur. Preferably, the heterocyclyl ring has five or six ring atoms. Examples of cyclyl groups include, but are not limited to, pyrrolidinyl, imidazolidinyl, pyrazolidinyl, piperidyl, zinyl, morpholino, tetrahydropyranyl, tetrahydrofuranyl, and thiomorpholino. The said ring may be optionally tuted by one or more substituents independently selected from Cl-6alkyl and oxy.
As used herein, the terms “halogen” or “halo” refer to the elements fluorine, chlorine, bromine and iodine. Preferred ns are fluorine, chlorine and bromine. A particularly preferred n is fluorine or chlorine.
As used herein, the term “optionally” means that the subsequently described s) may or may not occur, and includes both event(s) which occur and events that do not occur.
As used , the term “substituted” refers to substitution with the named substituent or substituents, multiple degrees of substitution being allowed unless otherwise stated.
Genus VI Description Compounds of Genus VI can be prepared according to the disclosure of US 7,582,652, which is herein incorporated herein by reference in its entirety.
Genus VI is characterized by nds of Formula VI: \ N\\ | ,X w N N R (VI), or stereoisomers thereof, isotopically-enriched compounds thereof, prodrugs thereof, solvates thereof, and pharmaceutically acceptable salts thereof; wherein: W is ed from: X is N, or C—Rl; R is C1-C7 alkyl, C3-C7 cycloalkyl, (Ci-C7 alkylene)-(C3-C7 cycloalkyl), —SOz— (Ci-C7 alkyl), or — SOz—NR5R6; R1 is hydrogen, amino, methyl, or NMe)2; R2 is phenyl ally substituted with one or two substituents independently selected from halo; R3 is hydrogen, C1-C7 alkyl, C3-C7 cycloalkyl, or phenyl optionally substituted with one or two substituents independently selected from halo and trifluoromethyl; R4 is hydrogen or C1-C7 alkyl, and R5 and R6 are independently selected from the group consisting of C1-C7 alkyl.
In one embodiment, the p38 kinase inhibitor from Genus VI is selected from the following: ] 5-(2-tert-Butylphenyl-3H-imidazolyl)(2,2-dimethylpropyl)-3H-imidazo[4,5- b]pyridinylamine methanesulfonate; 5-[2-(2,6-Difluorophenyl)phenyl-3H-imidazolyl](2,2-dimethylpropyl)-3H- imidazo[4,5-b]pyridinylamine methanesulfonate; 5-(2-tert-Butylphenyl-3H-imidazolyl)cyclopropylmethyl-3H-imidazo[4,5- b]pyridinylamine methanesulfonate; yclopropylphenyl-3H-imidazolyl)(2,2-dimethylpropyl)-3H- o[4,5-b]pyridinylamine methanesulfonate; 3 -(2,2-Dimethylpropyl) [ 5-(4-fluorophenyl)(2-fluorotrifluoromethylphenyl)- 3H-imidazolyl]-3H-imidazo[4,5-b]pyridinylamine methanesulfonate; 3-(2,2-Dimethylpropyl)[2-(2-fluorotrifluoromethylphenyl)phenyl-3H- imidazolyl]-3H-imidazo[4,5-b]pyridinylamine esulfonate; 5-[2-Cyclopropyl(4-fluorophenyl)-3H-imidazolyl](2,2-dimethylpropyl)-3H- imidazo[4,5-b]pyridinylamine methanesulfonate; 5-[2-(2,6-Difluorophenyl)(4-fluorophenyl)-3H-imidazolyl](2,2- dimethylpropyl)-3H-imidazo[4,5-b]pyridinylamine methanesulfonate; 5-[2-tert-Butyl(4-fluorophenyl)-3H-imidazolyl](2,2-dimethylpropyl)-3H- imidazo[4,5-b]pyridinylamine methanesulfonate; ert-Butyl(4-fluorophenyl)-3H-imidazolyl]cyclopropylmethyl-3H- imidazo[4,5-b]pyridinylamine methanesulfonate; 5-[2-tert-Butyl(2,4-difluorophenyl)-3H-imidazolyl](2,2-dimethylpropyl)-3H- o[4,5-b]pyridinylamine methanesulfonate; R-S-[2-tert—Butyl(4-fluorophenyl)-3H-imidazolyl](l,2,2-trimethylpropyl)- 3H-imidazo[4, 5-b]pyridinylamine methanesulfonate; R—S-[2-(2,6-Difluorophenyl)(4-fluorophenyl)-3H-imidazolyl](l,2,2- trimethylpropyl)-3H-imidazo[4, 5-b]pyridinylamine methanesulfonate; R-S-[5-(4-Fluorophenyl)(2-fluorotrifluoromethyl-phenyl)-3H-imidazolyl] (1,2,2-trimethylpropyl)-3H-imidazo[4,5-b]pyridinylamine methanesulfonate; 2018/054642 3 -Cyclopropylmethy1 6-dichloropheny1)(4-fluoropheny1)-3H-imidazol yl]-3H-imidazo[4,5-b]pyridinylamine esulfonate; 3 -Cyclopropylmethy1 [2-(2,6-difluorophenyl)(4-fluorophenyl)-3H-imidazol yl]-3H-imidazo[4,5-b]pyridinylamine methanesulfonate; 5-[2-(2,6-Dichlorophenyl)(4-fluorophenyl)-3H—imidazoly1](2,2- dimethylpropyl)-3H-imidazo[4,5-b]pyridinylamine esulfonate; 5-[2-(2-Chlorofluorophenyl)pheny1-3H-imidazolyl]-3 dimethy1propyl)- 3H-imidazo[4, 5-b]pyridinylamine methanesulfonate; 3 -Cyclopropylmethy1[2-(2,6-difluorophenyl)pheny1-3H-imidazolyl]-3H- imidazo[4,5-b]pyridinylamine methanesulfonate; 3 -Cyclopropylmethy1 [2-(2,6-dichloropheny1) pheny1-3H-imidazoly1]- 3H-imidazo[4, 5-b]pyridinylamine methanesulfonate; 5-[5-(2,4-Difluorophenyl)(2,6-difluorophenyl)-3H-imidazoly1](2,2- dimethylpropyl)-3H-imidazo[4,5-b]pyridinylamine methanesulfonate; 5-[3-(4-F1uorophenyl)methy1pyrazoly1]-3H-3 -isobuty1-imidazo[4,5-b]pyridin ylamine methanesulfonate; 5-[5-(4-F1uorophenyl)methy1pyrazoly1]-3H-3 -isobuty1-imidazo[4,5-b]pyridin e methanesulfonate; 5-[3-(4-Fluorophenyl)morpholinoethylpyrazoly1]-3Hisobuty1-imidazo[4,5- b]pyridin-Z-ylamine-methanesulfonate; 5-[3-(4-F1uorophenyl)-pyrazoly1]-3H-3 -isobuty1—imidazo[4,5-b]pyridinylamine di-methanesulfonate; 3Hisobutyl(3 1—1-isopropylpyrazoly1)-imidazo[4,5-b]pyridinylamine di-methanesulfonate; 3Hisobutyl(3 -pheny1—1-methy1pyrazoly1)-imidazo[4,5-b]pyridinylamine di-methanesulfonate; 3Hisobutyl(3 -pheny1—pyrazolyl)-imidazo[4,5-b]pyridinylamine di- methanesulfonate 5-[3-(2,4-Difluorophenyl)pyrazoly1]-3Hisobuty1-imidazo[4, 5-b]pyridin ylamine di-methanesulfonate; 5-[2-(2,6-Difluoropheny1)pheny1-3H-imidazoly1]isobuty1-3H-imidazo[4,5- b]pyridinylamine methanesulfonate; 5-[2-(2,6-Dichloropheny1)pheny1-3H-imidazoly1](2,2-dimethylpropy1)-3H- o[4,5-b]pyridinylamine methanesulfonate; 5-[2-(2,6-Dichlorophenyl)pheny1-1H-imidazolyl]isobuty1-3H-imidazo[4,5- b]pyridinylamine methanesulfonate; ] 5-[2-(2,6-Dichlorophenyl)(4-fluoropheny1)-1H—imidazolyl]isobuty1-3H- imidazo[4,5-b]pyridinylamine methanesulfonate; 2,6-Dichloropheny1)(2,4-difluorophenyl)-1H-imidazoly1]isobuty1-3H- imidazo[4,5-b]pyridinylamine methanesulfonate; R-S-[2-(2-Chlorofluoropheny1)(4-fluoropheny1)-3H-imidazoly1](1,2,2- trimethylpropyl)-3H-imidazo[4, ridinylamine methanesulfonate; 5-[2-tert-Buty1(4-fluorophenyl)-3H-imidazoly1](2,2-dimethylpropy1) methyl-3H-imidazo[4,5-b]pyridine esulfonate; 5-(2-tert-Buty1pheny1-3H-imidazoly1)(2,2-dimethy1-propy1)methy1-3H- o[4,5-b]pyridine methanesulfonate; 5-[2-(2-Chlorofluoropheny1)pheny1-3H-imidazoly1](2,2-dimethy1- propy1)methy1-3H-imidazo[4, 5-b]pyridine methanesulfonate; 5-[2-(2,6-Difluoropheny1)pheny1-3H-imidazoly1](2,2-dimethylpropyl) methyl-3H-imidazo[4,5-b]pyridine methanesulfonate; 5-[2-(2,6-Difluoropheny1)(4-fluorophenyl)-3H-imidazoly1](2,2- dimethylpropyl)methy1-3H-imidazo[4,5-b]pyridine methanesulfonate; 5-[2-(2,6-Dichloropheny1)(4-fluoropheny1)-3H—imidazoly1](2,2- dimethylpropyl)methy1-3H-imidazo[4,5-b]pyridine methanesulfonate; 3-Cyclopropylmethy1[2-(2,6-difluoropheny1)pheny1-3H-imidazoly1] methyl-3H-imidazo[4,5-b]pyridine methanesulfonate; 3-Cyclopropylmethy1[2-(2,6-dichloropheny1) pheny1-3H-imidazoly1] methyl-3H-imidazo[4,5-b]pyridine methanesulfonate; 5-(2-Cyclopropy1pheny1-3H-imidazoly1)(2,2-dimethylpropy1)methy1-3H- imidazo[4,5-b]pyridine methanesulfonate; WO 71147 5-[2-(2,6-Dichlorophenyl)pheny1-3H-imidazoly1](2,2-dimethylpropy1) methyl-3H-imidazo[4,5-b]pyridine methanesulfonate; 5-[2-(2-Chlorofluoropheny1)pheny1-3H-imidazoly1](2,2-dimethy1propy1)- dazo[4, ridine methanesulfonate; 5-(2-Cyclopropy1pheny1-3H-imidazolyl)(2,2-dimethylpropy1)-3H-imidazo [4,5-b]pyridine methanesulfonate; 5-[2-(2,6-Difluoropheny1)pheny1-3H-imidazoly1]isobuty1-3H-imidazo[4,5- b]pyridine methanesulfonate; 5-[3 -(4-Fluoropheny1)isopropylpyrazoly1]-3H-3 -isobutylimidazo[4, 5-b]pyridin 2-ylamine hanesulfonate; 5-[2-tert-Buty1phenyl-1H-imidazolyl]isobuty1-3H-imidazo[4,5-b]pyridin ylamine di-methanesulfonate; 5-[2-(2-Fluorochloropheny1)pheny1-1H-imidazolyl]isobuty1-3H- o[4,5-b]pyridinylamine methanesulfonate; 5-[2-Cyclopropy1pheny1-1H-imidazoly1]isobuty1-3H-imidazo[4,5-b]pyridin- 2-ylamine methanesulfonate; 2-F1uorotrifluoromethylpheny1)pheny1-1H-imidazoly1]isobuty1-3H- imidazo[4,5-b]pyridinylamine methanesulfonate; 5-[2-(2-F1uorochloropheny1)(4-fluorophenyl-1H-imidazoly1]isobuty1-3H- imidazo[4,5-b]pyridinylamine methanesulfonate; 5-[2-isopropy1pheny1-1H-imidazoly1]isobuty1-3H-imidazo[4,5-b]pyridin ylamine di-methanesulfonate; 5-[2-(2-F1uorotrifluoromethylphenyl)(2,4-difluorophenyl-1H-imidazoly1] isobuty1-3H-imidazo[4,5-b]pyridinylamine methanesulfonate; 5-[2-tert—Buty1)(2,4-difluoropheny1-1H-imidazoly1]isobuty1-3H-imidazo[4,5- b]pyridinylamine methanesulfonate; 5-[2-Isopropyl)(2,4-difluoropheny1-1H-imidazoly1]isobuty1-3H-imidazo[4,5- b]pyridinylamine methanesulfonate; 5-[2-(2-Fluorochlorophenyl)(2,4-difluoropheny1-1H-imidazoly1]isobuty1- 3H-imidazo[4, 5-b]pyridinylamine methanesulfonate; 5-[2-Cyclopropy1(2,4-difluoropheny1)-1H-imidazoly1]isobuty1-3H- imidazo[4,5-b]pyridinylamine methanesulfonate; 5-[2-Cyclopropy1(4-fluorophenyl)-1H-imidazolyl]isobuty1-3H-imidazo[4,5- dinylamine di-methanesulfonate; ert-Buty1(4-fluoropheny1)-1H-imidazoly1]isobuty1-3H-imidazo[4,5- b]pyridinylamine di-methanesulfonate; N’-{5-[2-(2,6-Difluoropheny1)pheny1—3H-i;midazoly1]isobuty1—3H- imidazo[4, ridiny1} -N,N—dimethylformamidine; 5-[2-(2,6-Difluorophenyl)methy1pheny1-3H—imidazoly1]isobuty1—3H- imidazo[4,5-b]pyridinylamine; 5-[2-(2,6-Dichlorophenyl)methy1pheny1—3H-imidazolyl]isobuty1-3H- imidazo[4,5-b]pyridinylamine; 3-(2,2-Dimethylpropyl)(5-pheny1—3H-[1,2,3]triazoly1)-3H-imidazo[4,5- b]pyridinylamine methanesulfonate; 3-(2,2-Dimethylpropyl)[5-(4-fluoro-phenyl)-3H-[1,2,3]triazoly1]-3H- o[4,5-b]pyridinylamine methanesulfonate; 3-Cyclopropylmethyl[5-(4-fluoro-phenyl)-3H-[1,2,3]triazoly1]-3H-imidazo[4,5- b]pyridinylamine methanesulfonate; 3-Cyclopropylmethyl(5-pheny1-3H—[1,2,3]triazolyl)-3H-imidazo[4,5-b]pyridin- 2-ylamine methanesulfonate; 5-[2-(2-Chlorofluoropheny1)pheny1-1H-imidazoly1]isobuty1—3H- [1,2,3]triazolo[4,5-b]pyridine methanesulfonate; 5-[2-(2,6-Dichlorophenyl)pheny1-1H-imidazoly1]isobuty1—3H- ]triazolo[4,5-b]pyridine methanesulfonate; 5-[2-(2,6-Dichlorophenyl)(2,4-difluoro-pheny1)-1H-imidazoly1]isobutyl-3H- [1,2,3]triazolo[4,5-b]pyridine methanesulfonate 5-[2-tert-Buty1(4-fluoropheny1)-1H-imidazoly1]isobuty1—3H- [1,2,3]triazolo[4,5-b]pyridine methanesulfonate; 2-Amino(2-tert—butylpheny1-3H-imidazoly1)imidazo[4,5-b]pyridine ic acid dimethylamide methanesulfonate; 2-Amino[(2-fluorochloropheny1)pheny1-3H-imidazolyl)]imidazo[4,5- b]pyridinesulfonic acid dimethyl-amide methanesulfonate; ] 2-Amino[(2,6-dichlorophenyl)pheny1-3H-imidazoly1)]imidazo[4,5- b]pyridinesulfonic acid dimethyl-amide esulfonate; 2-Amino(2-tert-butyl(2,4-difluoro-phenyl)-3H-imidazolyl)imidazo[4,5- b]pyridinesulfonic acid dimethyl-amide methanesulfonate; 5-[2-(2,6-Difluoropheny1)pheny1-3H-imidazoly1](propanesulfony1)-3H- imidazo[4,5-b]pyridinylamine methanesulfonate; 3-Buty1[2-(2,6-difluoropheny1)pheny1-3H-imidazoly1]-3H-imidazo[4,5- b]pyridinylamine methanesulfonate; 3-Buty1—5-[2-(2-fluorophenyl)pheny1-3H-imidazoly1]-3H-imidazo[4,5- b]pyridinylamine, di-methanesulfonate; 3-Buty1—5-[2-(2-chlorofluorophenyl)pheny1-3H-imidazoly1]-3H-imidazo[4,5- b]pyridinylamine methanesulfonate; 3-Buty1(2-tert-buty1pheny1-3H-imidazolyl)-3H-imidazo[4,5-b]pyridin ylamine methanesulfonate; 3-Buty1—5-[2-(2-fluorotrifluoromethy1phenyl)pheny1-3H-imidazoly1]-3H- imidazo[4,5-b]pyridinylamine methanesulfonate; 2-Amino(5-(pheny1-2H-[1,2,3]triazolyl)imidazo[4,5-b]pyridinesu1fonic acid dimethylamide; 5-[2-(2-Fluorotrifluoromethylpheny1)pheny1-3H-imidazoly1](propane yl)-3H-imidazo[4,5-b]pyridinylamine methanesulfonate; 5-(2-tert—Buty1pheny1-3H-imidazoly1)(propanesulfony1)-3H-imidazo[4,5- b]pyridinylamine methanesulfonate; 5-[2-(2,6-Dichlorophenyl)pheny1—3H-imidazoly1](propanesulfonyl)-3H- imidazo[4,5-b]pyridinylamine esulfonate; 5-[2-(2-Chlorofluorophenyl)pheny1-3H-imidazoly1](propanesulfonyl)- 3H-imidazo[4, 5-b]pyridiny1amine methanesulfonate; 3-Buty1—5-[2-tert—buty1(2,4-difluoropheny1)-3H-imidazoly1]-3H-imidazo[4,5- dinylamine methanesulfonate; 5-[2-tert—Buty1(4-fluorophenyl)oxazoly1]isobuty1-3H-imidazo[4,5-b]pyridin- 2-ylamine; WO 71147 5-[2-tert—Buty1(2,4-difluorophenyl)oxazoly1]isobuty1-3H-imidazo[4,5- b]pyridinylamine esulfonate; 5-[4-(4-F1uorophenyl)isopropyloxazoly1]isobuty1-3H-imidazo[4,5-b]pyridin- 2-ylamine methanesulfonate; 3-Isobuty1(2-methy1phenylthiazoly1)-3H-imidazo[4,5-b]pyridinylamine methanesulfonate; 5-[4-(4-Fluorophenyl)methylthiazoly1]isobuty1-3H-imidazo[4,5-b]pyridin ylamine methanesulfonate; 2-Amino(2-tert-buty1(4-fluorophenyl)oxazoly1)imidazo[4,5-b]pyridine sulfonic acid ylamide; 2-Amino(2-ispropyl(4-fluoropheny1) oxazol-S-yl)imidazo[4,5-b]pyridine- 3-su1fonic acid dimethylamide methane-sulfonate; ] 5-[2-(2,6-Dichloro-phenyl)(4-fluoro-phenyl)-1H-imidazolyl](2,2-dimethy1— propyl)-3H-imidazo[4,5-b]pyridinylamine methanesulfonate; 3-(2,2-Dimethy1—propy1)[5-(4-fluoro-phenyl)(2-fluorotrifluoromethy1— pheny1)-1H-imidazoly1]-3H-imidazo[4,5-b]pyridin—2-ylamine methanesulfonate; 5-[2-tert-Buty1(2,4-difluoro-pheny1)-1H-imidazoly1](2,2-dimethy1-propyl)- 3H-imidazo[4, 5-b]pyridinylamine methanesulfonate; 5-[2-tert—Buty1(4-fluoro-phenyl)-1H-imidazoly1](2,2-dimethyl-propy1)-3H- imidazo[4,5-b]pyridinylamine esulfonate; 5-[2-tert—Buty1(4-fluoro-phenyl)-1H-imidazoly1](2,2-dimethyl-propy1)-3H- imidazo[4,5-b]pyridinylamine fumarate; 5-[2-tert—Buty1(4-fluoro-phenyl)-1H-imidazoly1](2,2-dimethyl-propy1)-3H- imidazo[4,5-b]pyridinylamine dimethanesulfonate; 5-[2-tert—Buty1(4-fluoro-phenyl)-1H-imidazoly1](2,2-dimethyl-propy1)-3H- imidazo[4,5-b]pyridinylamine succinate; 5-[2-tert—Buty1(4-fluoro-phenyl)-1H-imidazoly1](2,2-dimethyl-propy1)-3H- imidazo[4,5-b]pyridinylamine dimaleate; ] 5-[2-tert—Buty1(4-fluoro-phenyl)-1H-imidazoly1](2,2-dimethyl-propy1)-3H- imidazo[4,5-b]pyridinylamine dihydrochloride; 5-[2-(2-Chlorofluoro-phenyl)phenyl-3H-imidazolyl](2,2-dimethylpropyl)- 3H-imidazo[4,5-b]pyridinylamine methanesulfonate; ] 5-[2-tert-Butyl(4-fluoro-phenyl)-3H-imidazolyl](l(R),2,2-trimethyl-propyl)- 3H-imidazo[4, 5-b]pyridinylamine methanesulfonate; 5-[2-(2,6-Difluoro-phenyl)(4-fluoro-phenyl)-3H-imidazolyl](l(R), 2,2- trimethyl-propyl)-3H-imidazo[4,5-b]pyridinylamine esulfonate; 5-[2-tert—butyl(4-fluoro-phenyl)-lH-imidazolyl](2,2-dimethyl-propyl)-3H- imidazo[4,5-b]pyridinylamine dimethanesulfonate 5-Bromo(2,2-dimethyl-propyl)-3H- imidazo[4,5-b]pyridin-2—yl-ammonium bromide; 5-[2-tert—butyl(4-fluoro-phenyl)-lH-imidazolyl](2,2-dimethyl-propyl)-3H- imidazo[4,5-b]pyridinylamine dimethanesulfonate 2-Amino(2,2-dimethyl-propyl)[2-(4- fluorophenyl)oxo-acetyl]-3H-imidazo[4,5-b]pyridinium methanesulfonate; 5-(2-(tert-butyl)(4-fluorophenyl)-lH-imidazol-S-yl)neopentyl-3H-imidazo[4,5- b]pyridinamine methansulfonate (“LY2228820 salt”); and 5-(2-(tert-butyl)(4-fluorophenyl)-lH-imidazol-S-yl)neopentyl-3H-imidazo[4,5- b]pyridinamine (“LY2228820”), a VI’.
In one ment, the p38 kinase inhibitor is 5-(2-(tert-butyl)(4-fluorophenyl)- lH-imidazol-S-yl)neopentyl-3H-imidazo[4,5-b]pyridinamine (“LY2228820”), a VI’.
In one embodiment, the p38 kinase inhibitor is 5-(2-(tert-butyl)(4-fluorophenyl)- lH-imidazol-S-yl)neopentyl-3H-imidazo[4,5-b]pyridinamine methansulfonate (“LY2228820 salt”).
In one embodiment, the p38 kinase inhibitor is a dimesylate salt (“[CH3S(O)2OH]2”) of LY2228820.
Genus VI Definitions The general chemical terms used in the Formulae above have their usual meanings.
For example, the term “C1-C7 alkyl” includes methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert—butyl, pentyl, hexyl and heptyl moieties. The term “Cl-C7 alkylene” includes ene, ethylene, propylene, isopropylene, butylene, isobutylene, sec-butylene, tert-butylene, pentylene, hexylene and heptylene es. The term “C3-C7 cycloalkyl” includes cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and cycloheptyl moieties. The term “(C1-C7 alkylene)-(C3- C7 cycloalkyl)” is taken to mean a C3-C7 cycloalkyl attached through a C1-C7alkylene linker.
The term “halo” includes fluoro, chloro, bromo, and iodo.
The skilled artisan will also appreciate that when variable “W” is ole (i), and R4 is en, the ole ring exists in the following two tautomeric forms: lH-Imidazole Tautomer I 3H-Imidazole Tautomer II Although Tautomers I and II are structurally ct, the skilled artisan will appreciate that they eXist in equilibrium and are easily and rapidly interconvertible under ry conditions. (See: March, Advanced Organic Chemistry, Third Edition, Wiley cience, New York, NY. (1985), pages 66-70; and Allinger, Organic Chemistry, Second Edition, Worth Publishers, New York, NY, (1976), page 173) As such, the representation of a compound of Formula I, where variable W” is imidazole (i) and R4 is hydrogen, in one tautomeric form contemplates both tautomeric forms of the imidazole ring. Likewise, the naming of a compound of Formula I where “W” is imidazole (i) and R4 is hydrogen as either a 1H- imidazole or a 3H-imidazole contemplates both tautomeric forms of the imidazole ring.
Specifically, the name 5-[2-tert-butyl(4-fluoro-phenyl)-1H-imidazolyl](2,2-dimethyl- )-3H-imidazo[4,5-b]pyridinylamine plates the molecule in either the 1H- imidazolyl or 3H-imidazolyl form. Similarly, when variable “W” is triazole (iv), the le moiety eXists in three tautomeric forms, and the representation or naming of one tautomeric form contemplates all three tautomeric forms of the triazole ring.
Especially preferred are di-methanesulfonic acid salts of the compounds of Formula Genus VII Description nds of Genus VII can be prepared according to the disclosure of US 6,867,209, which is herein incorporated herein by reference in its entirety.
Genus VII is characterized by compounds of a VII: (R3)n (R4)m Ar-LQ—M—Ll \‘z \_/ M (VII), or stereoisomers thereof, ically-enriched compounds thereof, prodrugs thereof, solvates thereof, and pharmaceutically acceptable salts thereof; wherein: = ents a single or double bond; one of Y and Z is CA or CRSA and the other is CR1, CR12, NR6 or N; wherein: each R1 is independently hydrogen or is alkyl, alkenyl, alkynyl, aryl, arylalkyl, acyl, aroyl, aryl, —NH-aroyl, halo, —OR, —NR2, —SR, —S(O)R, —S(O)2R, —OC(O)R, —NRC(O)R, —NRC(O)NR2, —NRC(O)OR, —OC(O)NR2, —C(O)R, —C(O)OR, alkyl-OC(O)R, —SO3R, — C(O)NR2, —S(O)2NR2, —NRS(O)2NR2, —CN, —CF3, —SiR3, and —N02, wherein: each R is independently —H, alkyl, alkenyl or aryl, R6 is H, alkyl, alkenyl, l, aryl, arylalkyl, acyl, aroyl, or heteroaryl, or is —S(O)R, —S(O)2R, —C(O)R, —C(O)OR, —alkyl-C(O)R, —S(O)2OR, —C(O)NR2, —S(O)2NR2, —CN, —CF3, or —SiR3, wherein: each R is independently —H, alkyl, alkenyl or aryl, R8 is H, halo, alkyl or alkenyl; A is —Wi—C(O)XjY, wherein: Y is C(O)R2, and wherein: R2 is hydrogen or is straight or branched chain alkyl, alkenyl, alkynyl, aryl, arylalkyl, heteroaryl, or heteroarylalkyl, each optionally substituted with halo, alkyl, —SR, — OR, —NR2, —OC(O)R, —NRC(O)R, —NRC(O)NR2, —NRS(O)2R, —NRS(O)2NR2, — OC(O)NR2, —CN, R, —C(O)NR2, , or —SiR3, n each R is independently —H, alkyl, alkenyl or aryl, or R2 is —OR, —NR2, —NRCONR2, NR2, —NRS(O)2NR2, heteroarylalkyl, — C(O)OR, —NRNR2, heteroaryl, heteroaryloxy, heteroaryl-NR, or —NROR, wherein: each R is independently —H, alkyl, alkenyl or aryl, or two R ed to the same N atom may form a 3-8 member ring selected from the group consisting of a piperazine ring, a morpholine ring, a thiazolidine ring, an oxazolidine ring, a pyrrolidine ring, a piperidine ring, an azacyclopropane ring, an azacyclobutane ring and an azacyclooctane ring; and wherein said ring is optionally substituted with alkyl, alkenyl, alkynyl, aryl, arylalkyl, heteroaryl, heteroarylalkyl, each optionally substituted with halo, —SR, —OR, —NR2, —OC(O)R, —NRC(O)R, —NRC(O)NR2, — 2R, —NRS(O)2NR2, —OC(O)NR2, or —SiR3, wherein: each R is independently —H, alkyl, l, or aryl, or two R attached to the same N atom may form a 3-8 member ring, optionally substituted as above defined, and each ofW and X is substituted or unsubstituted alkylene, alkenylene or alkynylene, each of 2-6 A or Y is tetrazole, 1,2,3-triazole, 1,2,4-triazole, or imidazole, and each of i and j is ndently O or 1; R7 is —H or is alkyl, alkenyl, alkynyl, aryl, kyl, acyl, aroyl, heteroaryl, —S(O)R, —S(O)2R, — C(O)R, —C(O)OR, —alkyl-COR, —S(O)2OR, —C(O)NR2, —S(O)2NR2, —CN, —CF3, —NR2, —OR, —alkyl-SR, —alkyl-S(O)R, —alkyl-S(O)2R, —alkyl-OC(O)R, —alkyl-C(O)OR, alkyl-CN, —alkyl- C(O)NR2, or —SiR3, wherein each R is independently —H, alkyl, alkenyl or aryl or R7 is methoxymethyl, methoxyethyl, ethoxymethyl, benzyloxymethyl, or oxyethyloxy methyl; each R3 is independently halo, alkyl, —OC(O)R, —OR, —NRC(O)R, —SR, or —NR2, wherein R is H, alkyl or aryl; n is 0-3, L1 is —C(O)—, —S(O)2—, or alkylene (l-4C); L2 is alkylene (l-4C) or alkenylene (2-4C) optionally tuted with one or two es selected from the group ting of alkyl, alkenyl, alkynyl, aryl, arylalkyl, acyl, aroyl, heteroaryl, —NH-aroyl, halo, —OR, —NR2, —SR, —S(O)R, —S(O)2R, —OC(O)R, —NRC(O)R, — NRC(O)NR2, —NRC(O)OR, —OC(O)NR2, —C(O)R, —C(O)OR, —alkyl-OC(O)R, —S(O)2OR, — C(O)NR2, —S(O)2NR2, —NRS(O)2NR2CN, —CF3, and —SiR3, wherein each R is independently H, alkyl, l or aryl, and wherein two tuents on L2 can be joined to form a non-aromatic ted or unsaturated ring that includes 0-3 heteroatoms which are 0, S and/or N and which contains 3 to 8 members or said two substituents can be joined to form a carbonyl moiety or an oXime, oximeether, oXimeester or ketal of said carbonyl moiety; each R4 is ndently selected from the group consisting of alkyl, alkenyl, alkynyl, aryl kyl, acyl, aroyl, heteroaryl, —NH-aroyl, halo, OR, NR2, SR, SOR, SOzR, OCOR, —NRCOR, —NRCONR2, —NRCOOR, —OCONR2, —RCO, —COOR, —alkyl-OOCR, —SO3R, — CONR2, —S02NR2, —NRS02NR2, —CN, —CF3, —SiR3, and —N02, or two R4 on adjacent positions can be joined to form a fused, optionally substituted aromatic or nonaromatic, saturated or unsaturated ring which contains 3-8 members, or R4 is =0 or an oXime, oXimeether, oXimeester or ketal thereof wherein each R is independently H, alkyl, alkenyl or aryl,; m is 0-4, Ar is an aryl group substituted with 0-5 substituents selected from the group consisting of alkyl, alkenyl, alkynyl, aryl, kyl, acyl, aroyl, heteroaryl, —NH-aroyl, halo, —OR, —NR2, —SR, — S(O)R, —S(O)2R, —OC(O)R, —NRC(O)R, —NRC(O)NR2, —NRC(O)OR, —OC(O)NR2, — C(O)R, —C(O)OR, —alkyl-OC(O)R, —S(O)2OR, —C(O)NR2, —S(O)2NR2, —NRS(O)2NR2, —CN, —CF3, —SiR3, and —N02, wherein each R is independently —H, alkyl, alkenyl or aryl, and wherein two of said optional substituents on nt positions can be joined to form a fused, optionally substituted ic or nonaromatic, saturated or rated ring which contains 3-8 members.
In one embodiment, the p38 kinase inhibitor from Genus VII is selected from the following: l-methylmethoxy-[4’-fluoro-(4-benzyl-2,5-dimethyl piperazinyl)]-indole carboxamideN,N—dimethyl glyoxalicamide, l-methylchloro-[4’-fluoro-(4-benzyl-2,5-dimethyl piperazinyl)]-indole carboxamideN,N—dimethyl glyoxalicamide, l-methylchloro-[4’-fluoro-(4-benzyl-2R,5S-dimethyl piperazinyl)]-indole—5- carboxamideN,N-dimethyl glyoxalicamide; l-methylchloro-[4’-fluoro-(4-benzyl-2R,5S-dimethyl piperazinyl)]-indole—5- carboxamideglyoxalicamide; ylchloro-[4’-fluoro-(4-benzyl-2R,5S-dimethyl piperazinyl)]-indole—5- carboxamideN—methyl-glyoxalicamide; l-methylmethoxy-[4’-fluoro-(4-benzyl-2R,5S-dimethyl piperazinyl)]-indole carboxamideN,N-dimethyl glyoxalicamide; l-methylchloro-[4’-fluoro-(4-benzyl-2R,5S-dimethyl piperazinyl)]-indole—5- carboxamideglyoxalic orpholinamide; and l-methylmethoxy-[4’-fluoro-(4-benzyl-2R,5S-dimethyl zinyl)]-indole carboxamideglyoxalic acid-morpholinamide.
In one embodiment, the p38 kinase inhibitor is selected from the following Compounds 1-182: Cmmfl.# URE o—CH3 131 131 Compd. # URE m; C”; > 0 \—C113 132 132 Compd. it URE 9 cu; 0 N4) N \ (113 0 12 0 \—(‘113 0 NJ N \ CH3 ‘ 133 133 Compd. # URE o NJ CH3 ; \—Clh 14 CH] fN\ N CH; 16 "3C 0 N—C‘Hx “ \ 17 [13C o N—CH, Cllg o N \ 0 ‘ E‘H (I‘H > 0 I 1 \—CI13 134 134 Compd. # CIURE 18 CH3 O N) CH3 >—o 0 \—CH3 19 H3C O N—CH; V \ :c (OQ o \ v \ c1 N\ 21 o 0 /—CH_~. cu3 >—0 135 135 Compd. # IURE 23 (70 0 NJ ~ \ 0 \ 24 o \—CH3 /—CH3 ”3C 136 136 Compd. # IL‘RE H3C 0 O N ‘ \ 27 H3C 137 137 Compd. # URE 138 138 Compd. # URE C113 0 CH3 CH3 CH3 /A\ 37 0 139 139 Compd. it URE 39 113C 40 le o N-—Gh " \ G N\ 139A 139A Compd- # cVIURE 0 N—CUJ AV (‘l Cl 13 44 HJC 0 N_—CH3 (=‘H3 CH3 139B 1398 Compd. It CIURE 48 [13C 49 [he CH3 )7 /N\ o N—Cm ‘1 ”3c o N—(‘lh CH3 \ 0 N—(‘lh 139C 139C Compd. It URE 54 ”K- o N—CH; N \ ”(+013 [13C 50 [13C C113 139D 139D Compd. # URE 57 H3C‘\ o N—CH3 CH3 0 N \ N\/l \' O ‘ s \ a | m‘ CH3 CH3 ‘ O N”; [mI \ (.l ‘ ()1 up O N—(‘H3 139E 139E Compd. # J'RF. 63 HJC 66 up O N—CH3 h \ k \ 139F 139F Compd. # URE 67 [13C o—Cn, 71 C”; o \J c1 N\ 139G 139G Compd. # URE 75 [13C 0 N—-Gh 139H 139H Compd. # URE 77 [[3C 79 H,(‘ CH3 \ _< o N C] A 80 113C cu; o \v 139I 139| . # S'l‘RlIC'l‘URl-I so CH3 0 N—O 139J 139J Compd- # URE 87 ”3C (\luluuF 139K 139K Compd. # URE 92 HJC 93 [13C 0 N—CH; 94 ”3C 9: WC 139L 139L Compd. # URE 9s u,c 99 [13C 139M 139M Compd. it URE ] [13C <N—\cu; 102 [13C\ /Cu, CH3 0 : CH} CH; 5n; 103 CH; < —/—m; o N N \ (‘H3 104 <\S 0 NJ I:0/0 (“H3 105 cm3 0 N (TH; 139N 139N Compd. # URE 0 1\ 0 \ 110 CH‘ (“H3 (.‘1 139O 1390 Compd. # URE 1 1 1 CH3 112 "3C CH3 113 II;(‘. —_L\ \ _/_ 0 N Cl - ”4 O 115 H‘C 139P 139P Compd. # UCTURE 117 CH3 o—CH3 N \o 119 OH 120 CH3 N \ 139Q 139Q Compd. # UCI'IIRE 123 0 1\H3 ‘ \ 1% 0 on 139R 139R Compd. # MOISTRIIC'I‘URF. 126 cu; I:\Q/O n7 on ::::l\\//J:::::T F\\[::::L\\//[::::I 139 0 0—(‘H3 c1 I3 139S 1395 Compd. # UCTL'RE 134 cu3 0 ()H 135 O ()H 136 [[30 o 137 0—013 139T 139T Compd. # L'C'I‘L'RE 139 CH3 @0 s 140 HO OH o O"\ N \ 139U 139U Compd. # UCTURE 143 O 145 0 NH; 146 ”3C 139V 139V . # MOLS'I‘RUCI'URI'I 148 CH; 150 "3C C113 151 CH; 0 N) ?. H3(‘ O N—Cllg CH; 0 \j L\ 139W 139W . # MOI ,S'l‘RUCl'lIRli 154 [13c 157 CH; O h ‘ \ 139X 139X Compd. # M01 URE cu3 Uh 19 <r__N 160 “3C 0 N—CH; C113 0 ‘ \ 161 {—0 cu3 mg 139Y 139Y Compd. # RUCTURF. 163 c1 13 166 CH} 0 NJ 168 HJC 139Z 1392 Compd. # UCI‘URF. 170 CH; 171 113C 17: ch 139Za 1392a Compd. # ‘RUCTURE n7 th () N"CH3 CH} 0 N \ Nd hv z T Eu; an 139Zb 1392b In one embodiment, 2-(6-chloro((2R,5S)(4-fluorobenzyl)-2,5- ylpiperazinecarbonyl)methyl-1H-indolyl)-N,N-dimethyloxoacetamide (“SCIO-469”), Formula VI′. 139Zc 2018/054642 Genus VII Definitions ] As used herein, the term “alkyl,” “alkenyl” and “alkynyl” include straight— and branched-chain and cyclic monoyalent substituents. Examples include methyl, ethyl, isobutyl, cyclohexyl, cyclopentylethyl, 2-propenyl, 3-butynyl, and the like. Typically, the alkyl, alkenyl and alkynyl substituents contain l-lOC (alkyl) or 2-10C yl or alkynyl). Preferably they contain l-6C (alkyl) or 2-6C (alkenyl or l). alkyl, heteroalkenyl and heteroalkynyl are similarly defined but may contain 1-2 0, S or N heteroatoms or combinations thereof within the backbone residue.
As used herein, “acyl” encompasses the definitions of alkyl, alkenyl, alkynyl and the related hetero-forms which are coupled to an additional residue through a carbonyl group.
“Aromatic” moiety refers to a monocyclic or fused ic moiety such as phenyl or naphthyl; “heteroaromatic” also refers to monocyclic or fused bicyclic ring systems containing one or more heteroatoms selected from O, S and N. The inclusion of a atom permits inclusion of 5-membered rings as well as ered rings. Thus, typical ic systems include pyridyl, pyrimidyl, indolyl, benzimidazolyl, benzotriazolyl, isoquinolyl, quinolyl, benzothiazolyl, benzofuranyl, l, furyl, pyrrolyl, thiazolyl, oxazolyl, imidazolyl and the like.
Any monocyclic or fused ring bicyclic system which has the characteristics of aromaticity in terms of electron distribution throughout the ring system is included in this definition. Typically, the ring systems contain 5-12 ring member atoms.
Similarly, “arylalkyl” and “heteroalkyl” refer to ic and heteroaromatic systems which are coupled to r residue through a carbon chain, including substituted or unsubstituted, saturated or unsaturated, carbon chains, typically of l-6C. These carbon chains may also include a carbonyl group, thus making them able to provide substituents as an acyl moiety.
Genus VIII Description Compounds of Genus VIII can be prepared according to the disclosure of US 6,319,921, which is herein incorporated herein by reference in its entirety.
Genus VIII is characterized by compounds of Formula VIII: Ar —1 H H—Ar -L-Q2 (VIII), or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate f, or a pharmaceutically acceptable salt thereof, wherein AI'l is pyrazole optionally substituted by one or more R1, R2 or R3; Ar2 is phenyl, naphthyl quinoline, isoquinoline, tetahydronaphthyl, droquinoline, tetrahydroisoquinoline, benzimidazole, benzofuran, indanyl, indenyl or indole each being optionally substituted with one to three R2 groups; L is a C1-10 saturated or unsaturated branched or unbranched carbon chain; wherein one or more methylene groups are optionally independently replaced by O, N or S; wherein said linking group is optionally substituted with 0-2 oxo groups and one or more C1- 4 branched or unbranched alkyl which may be tuted by one or more halogen atoms; Q is ed from the group consisting of: a) pyridine, pyrimidine, ine, imidazole, benzimidazole, oxazo[4,5-b]pyridine and imidazo[4,5-b]pyridine, which are ally tuted with one to three groups selected from the group consisting of halogen, C1-6 alkyl, C1-6 alkoxy, hydroxy, mono- or di-(C1-3 alkyl)amino, C1-6 alkyl-S(O)m and phenylamino wherein the phenyl ring is optionally substituted with one to two groups ed from the group consisting of halogen, C1-6 alkyl and C1-6 alkoxy; b) morpholine, thiomophorline, thiomorpholine sulfoXide, thiomorpholine sulfone, piperidine, piperidinone and tetrahydropyrrimidone which are optionally substituted with one to three groups selected from the group consisting of kyl, C1-6 alkoxy, hydroxy, mono- or di-(C1-3 alkyl)amino-C1.3 alkyl, phenylamino-C1.3 alkyl and C1— 3 alkoxy-Ci—s alkyl, R1 is selected from the group consisting of: a) C3-1o branched or unbranched alkyl, which may optionally be lly or fully halogenated, and optionally tuted with one to three , naphthyl or heterocyclic groups selected from the group ting of pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, pyrrolyl, imidazolyl, pyrazolyl, thienyl, furyl, isoxazolyl and azolyl, each such phenyl, yl or heterocycle selected from the group hereinabove described, being substituted with O to 5 groups selected from the group consisting of halogen, C1-6 branched or unbranched alkyl which is optionally partially or fully halogenated, C3.s cycloalkyl, C5.s cycloalkenyl, hydroxy, cyano, C1—3 alkyloxy which is ally partially or fully halogenated, NH2C(O) and di(C1— 3)alkylaminocarbonyl; b) C3.7 cycloalkyl selected from the group consisting of cyclopropyl, cyclobutyl, cyclopentanyl, cyclohexanyl, cycloheptanyl, bicyclopentanyl, ohexanyl and bicycloheptanyl, which may optionally be partially or fully halogenated and which may optionally be substituted with one to three 06 alkyl groups, or an analog of such cycloalkyl group wherein one to the ring methylene groups are replaced by groups ndently ed from O, S, CHOH, >C=O, >C=S and NH; c) C3-1o branched alkenyl which may optionally be partially or fully halogenated, and which is optionally substituted with one to three C1-5 branched or unbranched alkyl, , naphthyl or heterocyclic groups, with each such heterocyclic group being independently selected from the group consisting of pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, pyrrolyl, imidazolyl, lyl, thienyl, furyl, isoxazolyl and isothiazolyl, and each such phenyl naphthyl or heterocyclic group being substituted with O to 5 groups selected from halogen, C1-6branched or unbranched alkyl which is optionally partially or fully halogenated, cyclopropyl, cyclobutyl, cyclopentanyl, cyclohexanyl, cycloheptanyl, bicyclopentanyl, bicyclohexanyl and bicycloheptanyl, hydroxy, cyano, C1.3alkyloxy which is optionally partially or fully halogenated, NH2C(O), mono- or di(C1-3)alkylaminocarbonyl; d) C5.7 cycloalkenyl selected from the group consisting of cyclopentenyl, cyclohexenyl, cyclohexadienyl, cycloheptenyl, eptadienyl, bicyclohexenyl and bicycloheptenyl, wherein such cycloalkenyl group may optionally be substituted with one to three 06 alkyl ; e) cyano, and, f) methoxycarbonyl, ethoxycarbonyl and propoxycarbonyl; R2 is selected from the group consisting of: a) C1-6 branched or unbrenched akyl which may optionally be partially or fully halogenated, acetyl, aroyl, C1.4 branched or ched alkoxy, which may optionally be partially or fully halogenated, halogen, methoxycarbonyl and phenylsulfonyl, R3 is ed from the group ting of: a) a phenyl, naphthyl or heterocyclic group selected from the group ting of pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, pyrrolyl, imidazolyl, pyrazolyl, thienyl, furyl, tetrahydrofuryl, isoxazolyl, isothiazolyl, quinolinyl, isoquinolinyl, indolyl, idazolyl, benzofuranyl, benzoxazolyl, benzisoxazolyl, benzpyrazolyl, benzothiofuranyl, cinnolinyl, pterindinyl, phthalazinyl, naphthypyridinyl, quinoxalinyl, quinazolinyl, purinyl and indazolyl, wherein such , naphthyl or heterocyclic group is optionally substituted with one to five groups ed from the group consisting of a C1-6 branched or unbranched alkyl, phenyl naphthyl, heterocycle selected from the group above described, C1-6 branched or unbranched alkyl which is optionally partially or fully halogenated, cyclopropyl, cyclobutyl, cyclopentanyl, cyclohexanyl, cycloheptanyl, bicyclopentanyl, bicyclohexanyl, bicycloheptanyl, phenyl C1-5alkyl, naphthyl C15 alkyl, halo, hydroxy, cyano, C1— 3 alkyloxy which may optionally be partially or fully halogenated, phenyloxy, naphthyloxy, aryl wherein the heterocyclic moiety is selected from the group aboVe described, nitro, amino, mono- or di-(C1.3)alkylamino, phenylamino, naphthylamino, heterocyclylamino, wherein the cyclyl moiety is selected from the group hereinaboVe described, NH2C(O), a mono- or di-(C1-3)alkyl aminocarbonyl, C1—5 C(O)—C1—4 alkyl, amino-C1.5 alkyl, mono- or di-(C1.3)alkylamino-C1-5 alkyl, amino-S(O)2, di-(Ci— 3)alkylamino-S(O)2, R4—C1—5 alkyl, k—Cis alkoxy, R6—C(O)—C1-5 alkyl and R7— 05 alkyl(Rs)N; b) a fused aryl selected from the group consisting of benzocyclobutanyl, indanyl, l, onaphthyl, tetahydronaphthyl, benzocycloheptanyl and benzocycloheptenyl, or a fused heterocyclyl selected from the group consisting of cyclopentenopyridine, exanopyridine, cyclopentanopyrimidine, cyclohexanopyrimidine, cyclopentanopyrazine, cyclohexanopyrazine, cyclopentanopyridazine, cyclohexanopyridazine, cyclopentanoquinoline, cyclohexanoquinoline, cyclopentanoisoquinoline, cyclohexanoisoquinoline, entanoindole, cyclohexanoindole, cyclopentanobenzimidazole, cyclohexanobenzimidazole, cyclopentanobenzoxazole, cyclohexanobenzoxazole, cyclopentanoimidazole, cyclohexanoimidazole, cyclopentanothiophene and cyclohexanothiophene, wherein the fused aryl or fused heterocyclyl ring is substituted with O to 3 groups independently selected from phenyl naphthyl and heterocyclyl selected from the group consisting of pyridinyl, dinyl, pyrazinyl, pyridazinyl, pyrrolyl, imidazolyl, pyrazolyl, thienyl, furyl, isoxazolyl, and isothiazolyl, C1-6 branched or ched alkyl which is optionally partially or fully halogenated, halo, cyano, C1- 3 alkyloxy which is optionally lly or fully halogenated, phenyloxy, naphthyloxy, heterocyclyloxy wherein the heterocyclyl moiety is selected from the group hereinaboVe described, nitro, amino, mono- or di-(C1.3)alkylamino, phenylamino, naphthylamino, heterocyclylamino, wherein the heterocyclyl moiety is selected from the group hereinabove described, NH2C(O), a mono- or di-(C1-3)alkyl aminocarbonyl, C1—4 alkyl-OC(O), C1—5 alkl- C(O)—C1-4 ed or unbranched alkyl, an amino-C1-5 alkyl, mono- or or di-(Ci— lamino-C1—5 alkyl; 5alkyl; R1o—C1.5 alkoxy; R11—C(O)—C1.5 alkyl and R12—C1—5 alkyl(R13)N; c) cycloalkyl selected from the group ting of cyclopentanyl; cyclohexanyl; cycloheptanyl; bicyclopentanyl; bicyclohexanyl and bicycloheptanyl; wherein the cycloalkyl is optionally partially or fully halogenated and which may optionally be substituted with one to three C1—3 alkyl groups; d) C5.7 cycloalkenyl; selected from the group consisting of cyclopentenyl; cyclohexenyl; cyclohexadienyl; cycloheptenyl; eptadienyl; bicyclohexenyl and bicycloheptenyl; wherein such cycloalkenyl group is ally substituted with 1-3 C1.3 alkyl groups; e) ; aroyl; alkoxycarbonylalkyl or phenylsulfonyl; and f) C1-6 branched or unbranched alkyl is optionally be partially or fully halogenated; orR1 and R2 are taken together to form a fused phenyl or pyridinyl ring; each of R3 and R13 are independently selected from the group consisting of hydrogen and C1— 4 branch or unbranched alkyl which may optionally be partially or fully halogenated; each R4; &, R6, R7; R9; R10, R11 and R12 is independently selected from the group consisting of morpholine; piperidine; piperazine; imidazole and ole; m=0; 1 or2; and X = O or S.
In one embodiment; the p38 kinase inhibitor from Genus VIII is selected from the following: l-[5-tert-Butylp-tolyl-2H-pyrazolyl][4-(2-morpholinyl- ethoxy)naphthalen— 1 -yl] -urea; l-[5-tert-Butylp-tolyl-2H-pyrazolyl][4-(2-(cis-2;6-dimethylmorpholin yl)ethoxy)naphthalenyl] -urea; 1--[-tertButy1-p--toly12H-pyrazol-3 -]-3y1 2-(trans—d1methy1morph011n y1)ethoxy)naphthalen-1 -y1]-urea; 1--[-tert-Buty12---p--toly12H-pyrazoly1]-3 -[-4[-(2-(2-(methoxymethylemorpholin- y1)ethoxy)naphthalen-1 rea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y1]-3 -[-4[-(2-(morpholiny1)- oxoethoxy)naphthaleny1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[-(2-(morpholiny1)- methylethoxy)naphthalen-1 -y1] -urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[-(2-(morpholiny1)- 1- methylethoxy)naphthalen-1 -y1] -urea; 1--[5---tert-Buty12--p---toly12H-pyrazoly1]-3 -[-4[-(2-t—hiomorpholiny1- ethoxy)naphthalen-1 -y1] -urea; 1--[5---tert-Buty12--p---toly12H-pyrazol-3 -y]-31 -[-4[-(-2(1--oxoth10morph011n oxy)naphthaleny1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[(2--morpholiny1-ethoxy)- methylnaphthalen-l -y1] -urea; 1--[5---tertButy1-p---toly12H-pyrazoly1]-3 -[-4[-(2--p1perid1ny1-ethoxy)naphthalen- 1-y1]-urea; --tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[(2-(1--acety1p1perid1n y1)ethoxy)naphthaleny1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[(2-t—hiazolidin-3 -y1- )naphthalen-1 -y1] -urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[-(2-(morpholin-y1- carbonyl0X0)ethoxy)naphthaleny1]-urea; 1--[5---tert-Buty12--p---toly12H-pyrazol-3 -y]-31 -[4-[(2-(tetrahydropyran- y1)ethoxy)naphthaleny1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[(2-(N—methy1 methoxyethylamino)ethoxy)naphthalen-1 -y1] -urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 2-(1-0X0--tetrahydroth10phen y1)ethoxy)naphthaleny1]-urea; 1--[-tertButy1-p--toly12H-pyrazol-3 -]-3y1 -[-4[(3-morphol1ny1-propy1)naphthalen- 1-y1]-urea; 1--[-tertButy1-p--toly12H-pyrazol-3 -]-3y1 -[-4[(morpholin-4—--y1-methy1)naphthalen- urea; 1--[5---tertButy1p--toly12H-pyrazol-3 -y]-31 -[-4[(3-t—hiaz011d1n-3 -y1- propy1)naphthalen-1 -y1] -urea; 1--[5---tert-Buty12--p---toly12H-pyrazol-3 -y]-31 -[4-(-[3(tetrahydopyran-y1- oxy)propy1)naphthalen-1 -y1] -urea; 1--[5---tertButy1p--toly12H-pyrazol-3 -y]-31 -[-4[(2--pyrid1ny1—ethy1)naphthalen y1]-urea; 1--[5---tertButy1p--toly12H-pyrazol-3 -y]-31 2-pyrid1ny1-etheny1)naphthalen y1]-urea; 1--[5---tertButy1p--toly12H-pyrazol-3 -y]-31 (3-(morpholiny1)propyn y1)naphthaleny1]-urea; ] 1--[5---tert-Buty12--p---toly12H-pyrazol-3 -y]-31 -[4-[(3-(tetrahydropyran---2yl--oxy)propyn- 1-y1)naphthaleny1]-urea; 1--[5---tertButy1p--toly12H-pyrazoly1]-3 -[-4[-(-3(methoxymethyloxy)propyn y1)naphthaleny1]-urea; 1--[5---tertButy1p--toly12H-pyrazol-3 -y]-31 -[-4[-(3-(morpholiny1)-methylpropyn- 1-y1)naphthaleny1]-urea; 1--[5---tertButy1p--toly12H-pyrazol-3 -y]-31 -[-4[-(3-(morpholiny1)- dimethylpropyn- 1 phthalen-1 -y1] -urea; 1--[5---tert-Buty12--p---toly12H-pyrazol-3 -y]-31 -[-4[(3-(tetrahydropyran---2yl--oxy)butyn- 1-y1)naphthaleny1]-urea; 1--[5---tert-Buty12--p---toly12H-pyrazol-3 -y]-31 -[-4[-(-3(furan--ylcarbonyloxy)propyn y1)naphthaleny1]-urea; 1--[5---tert-Buty12--p---toly12H-pyrazol-3 -y]-31 -[-4[-(-3(p1perd1ny1)propyn y1)naphthaleny1]-urea; 1--[5---tert-Buty12--p---toly12H-pyrazoly1]-3 -[-4[-(3-(2-methoxymethy1morphol1n y1)propyny1)naphthaleny1]-urea; ] 1--[-tertButy1-p--toly12H-pyrazol-3 -]-3y1 -[-4[-(pyrid1n--y1--methoxy)naphthalen 1- y1]-urea; ] 1--[-tertButy1-p--toly12H-pyrazol-3 -]-3y1 -[-4[(2--pyrid1ny1—ethoxy)naphthalen- 1- y1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[(3--pyrid1ny1—-propoxy)naphthalen- 1-y1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[-(2-1m1dazoly1-ethoxy)naphthalen- 1-y1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[-(2--benz1m1dazol- 1-y1- ethoxy)naphthalen—1-y1]-urea; ] 1--[5---tert-Buty12--p---toly12H-pyrazol-3 -y]-314(2(34— dimethoxyphenyl)ethoxy)naphthalen-1 -y1] -urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[(pyridin-y1- methylamino)naphthaleny1]-urea; ] 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[(pyridin-y1- carbonylamino)naphthaleny1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[(morpholin-y1- acetamido)naphthaleny1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[(pyridin-3 -y1- amino)naphthaleny1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[(pyridin-3 -y1- carbonylamino)naphthaleny1]-urea; 1-[5-1so--Propy12-phenyl-2H-pyrazoly1]-3 -[-4[-(morph011ny1— ethoxy)naphthalen—1-y1]-urea; 1- [-5[-(Tetrahydropyran--y-1)pheny1-2H-pyrazoly1]-3 -[-4[-(2--morpholiny1— ethoxy)naphthalen—1-y1]-urea; 1--[5-c—y-clohexyl2-pheny1-2H-pyrazol-3 -y]-31 -[-4[-(2--morpholiny1— ethoxy)naphthalen—1-y1]-urea; 1- 222--trifluoroethyl)-pheny1-2H-pyrazol-3 -y][-4[-(morph011ny1— ethoxy)naphtha1eny1]-urea; 1- 5[-[-(-methylcycloprop 1-y1)---2pheny1-2H-pyrazol-3 -]-3y1-[4-[-(morph011n ethoxy)naphthalen—1-y1]-urea; 1-[-ethoxycarbony12-pheny1—2H-pyrazol-3 -]-3y1 (morph011ny1- ethoxy)naphthalen—1-y1]-urea; 1- [-5[-(1--methylcycloheX-1 -y1)-pheny1-2H-pyrazol-3 -y]-31 -[4-[-(morph011n ethoxy)naphthalen—1-y1]-urea; 1--[5---tertbuty1methyl-2H-pyrazoly1]-3 -[4-[-(morph011ny1- ethoxy)naphthalen—1-y1]-urea; ] --tert—buty12-benzy1-2H-pyrazol-3 -y]-31 -[4-[(2--morpholiny1--ethoxy)naphtalen- 1-y1]-urea; 1--[5---tert—buty12--(-4chloropheny1)-Hpyrazoly1]-3 -[4-[-(2--morpholiny1- ethoxy)naphthaleny1) -urea; 1--[5---tert—buty12-buty1-2H-pyrazol-3 -y]-31 -[4-[(2--morpholiny1--ethoxy)naphthalen- 1-y1]-urea; ] 1--[5---tert—buty12-{-ethoxycarbonylmethyl)Hpyrazol-3 -y]-31 -[4-[(2--morph011ny1- ethoxy)naphthalen—1-y1]-urea; --tertbuty1-(-methy13--carbamy1phenyl)Hpyrazoly1]-3 -[4-[-(morph011n- 4-y1-ethoxy)naphtha1eny1]-urea; 1-[5-tert-buty1(4-methy1(2-ethoxycarbonylviny1)pheny1)-2H-pyrazoly1][4- (2-morpholiny1—ethoxy)naphthaleny1]-urea; 1-[5-tert-buty1(4-methy1(morpho11ny1)methy1pheny1)-2H-pyrazoly1][4- (2-morpholiny1—ethoxy)naphthaleny1]-urea; 1-[5-tert-buty1(4-methy1—3-dimethylaminomethylpheny1)-2H-pyrazoly1]4-(2- morpholiny1-ethoxy)naphthaleny1]-urea; 1--[5---tertbuty1-(-3(2--morpholiny1---ethy1)pheny1)Hpyrazol-3 -y]-31 -[4-[-(2- morpholiny1-ethoxy)naphthaleny1]-urea; 1--[5---tert—buty12--(-3(tetrahydropyrany1am1no)pheny1)-Hpyrazoly1]-3 -[4-[-(2- morpholiny1-ethoxy)naphthaleny1]-urea; ] 1--[5---tertbuty1-(-3dimethylaminomethylpheny1)-Hpyrazol-3 -y]-31 -[4-[-(2- morpholiny1-ethoxy)naphthaleny1]-urea; 1--[-tert—buty12--(-4(tetrahydropyrany1am1no)pheny1)---2Hpyrazoly1]-3 -[4-[-(2- morpholiny1-ethoxy)naphthaleny1]-urea; 1--[-tertbuty1-(-4(3-benzy1ureido)pheny1)-Hpyrazol-3 -y1]-3 -[4-[(morph011n y1—ethoxy)naphthalen-1 -y1]-urea; --tert—buty12--(-2c—hloropyridin- 5---y1)Hpyrazol-3 -y]-31 -[4-[(2--morph011ny1- ethoxy)naphtha1eny1]-urea; 1--[5---tertbuty1(2--methy1pyrid1n-y-1)Hpyrazol-3 -y]-31 -[4-[-(morph011ny1- )naphtlaleny1]-urea; 1--[5---tert—buty12--(methoxypyrid1n-y-1)Hpyrazol-3 -y]-31 -[4-[(2--morpholiny1- ethoxy)naphthalen—1-y1]-urea; 1--[5---tert—buty12--(pyrid1n--y-1)Hpyrazol-3 -y]-31 -[4-[-(morph011ny1- ethoxy)naphthalen—1-y1]-urea; 1--[5---tertbuty1(2--methy1pyrid1n-y-1)Hpyrazol-3 -y]-31 -[4-[-(-2p-yridin ethoxy)naphthalen—1-y1]-urea; 1--[5---tertbuty1(2--methy1pyrid1n-y-1)Hpyrazol-3 -y]-31 -[4-[-(-2(trans— d1methy1morpholinyl)ethoxy)naphthaleny1]-urea; 1--[5---tertbuty1(2--methy1pyrid1n-y-1)Hpyrazol-3 -y]-31 -[4-[-(morph011ny1- propyny1)naphthalen-1 -y1] -urea; --tertButy1-p--toly12H-pyrazol-3 -y]-31 -[4-[(2-(2- dimethylaminomethylmorpholiny1)ethoxy)naphthaleny1]-urea; 1--[5---tertbuty1iso--p-ropy12H-pyrazol-3 -y]-31 (morph011ny1- ethoxy)naphthalen—1-y1]-urea; 1--[5---tert—buty12-cyclopropy1-2H-pyrazoly1]-3 -[4-[-(morph011ny1- ethoxy)naphthalen—1-y1]-urea; --tert—buty12--(th10phen-y-1)Hpyrazol-3 -y]-31 -[4-[-(2--morpholiny1- ethoxy)naphthalen—1-y1]-urea; ] 1--[5---tertbuty1cyclopentyl-2H-pyrazol-3 -y]-31 -[4-[-(morph011ny1- ethoxy)naphthalen—1-y1]-urea; 1--[5---tertbuty1150-p-ropy12H-pyrazol-3 -y]-31 -[4-[(tetrahyropyran-y1- ethoxy)naphthalen—1-y1]-urea; 1--[-tert—buty12-cyclopropy1-2H-pyrazol-3 -y]-31 -[4-[-(-10X0--tetrahydrothiophen-3 -yl- ethoxy)naphthalen—1-y1]-urea; ] 1--[-tert—buty12--(th10phen--y-1)Hpyrazoly1]-3 -[4-[-(2--pyrid1ny1y1- ethoxy)naphthalen—1-y1]-urea; --tert—buty12-cyclopenty1-2H-pyrazol-3 -y]-31 -[4-[(pyrid1n-y1- methoxy)naphthalen-1 -y1] -urea; 1--[5---tert-Buty12---p--toly12H-pyrazol-3 -y1-3 -[4-[-(-3(pyridiny1)propyn y1)naphthaleny1]-urea; 1--[5---tertButy1-p--toly12H-pyrazol-3 -y1-3 -[4-[(3-(2-methy1am1nopyrid1n y1)propyny1)naphthaleny1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 3-(1-0X0--tetrahydroth10phen y1)propyny1)naphthaleny1]-urea; --tertButy1-p---toly12H-pyrazol-3 -y]-31 -[4-[-(3-(th1azolid1n-y-1)propyn 1- y1)naphthaleny1]-urea; 1--[5---tert-Buty12--p---toly12H-pyrazol-3 -y]-31 -[4-[(-3(tetrahydropyrany1)propyn hthaleny1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[4-[-(methy1am1nopyr1m1d1ny1- methoxy)naphthaleny1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[4-[(2-(2--methy1am1nopyrim1d1n y1)ethoxy)naphthalen-1 -y1]-urea; 1--[5---tert-Buty12--p---toly12H-pyrazoly1]-3 -[4-[-(2-(4-methoxybenz1m1dazol y1)ethoxy)naphthalen-1 -y1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[4-[(2-(4--methy1am1nobenz1m1dazol- 1- y1)ethoxy)naphthaleny1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[4-[-(2-(2--1m1dazo[4 5-b]pyridin- 1- y1)ethoxy)naphthaleny1]-urea; 1--[5---tert-Buty12--p---toly12H-pyrazol-3 -y]-31 -[4--(-[2[1 thyrid1n y1)ethoxy)naphthaleny1]-urea; 1--[5---tert-Buty12--p---toly12H-pyrazol-3 -y]-31 -[4-[-(2-(34-d1hydro-2H--pyrano[23- b]pyr1d1ny1)ethoxy)naphthaleny1]-urea; 2018/054642 1--[-tert-Buty12-pyrid1ny1-2H-pyrazol-3 -]-3y1 -[4-[-(methy1am1nopyrim1d1n y)naphthalen-1 -y1] -urea; 1--[-tertButy1(methy1pyrid1n-y1)Hpyrazoly1]-3—[—4[(2(2— methylam1nopyr1m1d1ny1)ethoxy)naphthalen-1 -y1] -urea; 1--[5---tertButy1-(methy1pyrid1n-y-1)Hpyrazoly1]-3—[—4[(2(4— methoxybenz1m1dazol-1 -y1)ethoxy)naphthaleny1]-urea; 1--[5---tertButy1-(methy1pyrid1n-y-1)Hpyrazoly1]-3—[—4([2(4— methylaminobenzimidazoly1)ethoxy)naphthalen-1 -y1] -urea; 6] --tertButy1-(methy1pyrid1n-y-1)Hpyrazoly1]-3—[—4[(2(2— 1m1dazo[4, 5b]pyrid1ny1)ethoxy)naphthaleny1]-urea; 1--[5---tertButy1-(methy1pyrid1n-y-1)Hpyrazoly1]-3 -[4-[(-[2[1 ,8]naphthyrid1n- 4-y1)ethoxy)naphthaleny1]-urea; 1--[5---tertButy1-(methy1pyrid1n-y-1)Hpyrazoly1]-3 -[4-[(2-(34-d1hydro-2H- pyrano[2,3-b]pyrid1ny1)ethoxy)naphthalen-1 -y1]-urea; 1--[5---tertButy1cyclopropy1-2H-pyrazol-3 -y]-31 -[4-[-(methy1am1nopyrim1d1ny1- methoxy)naphthaleny1]-urea; 1--[5---tert-Buty12-cyclopropy1-2H-pyrazol-3 -y]-31 -[4-[-(-2(2--methy1am1nopyrim1d1n y1)ethoxy)naphthalen-1 -y1]-urea; 1--[5---tert-Buty12-cyclopropy1-2H-pyrazol-3 -y]-31 -[4-[-(-2(4-methoxybenz1m1dazol y1)ethoxy)naphthalen-1 -y1]-urea; 1--[5---tert-Buty12-cyclopropy1-2H-pyrazol-3 -y]-31 -[4-[-(-2(4- methylaminobenzimidazoly1)ethoxy)naphthalen-1 -y1] -urea; 1--[5---tertButy1methyl-2H-pyrazol-3 -y]-31 (-2(2--1m1dazo[4, 5-b]pyrid1n y1)ethoxy)naphthalen-1 -y1]-urea; 1--[5---tert-Buty12-methyl-2H-pyrazoly1]-3 -[4-[-(-[2[1,8]naphthyrid1n y1)ethoxy)naphthalen-1 -y1]-urea; 1--[5---tert-Buty12-methyl-2H-pyrazoly1]-3 -[4-[-(2-(3,4-d1hydro-2H-p-y,rano[23- b]pyridiny1)ethoxy)naphthalen-1 -y1]-urea 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[4-[(2--morpholiny1- ethoxy)naphthalen—1-y1]-urea; 1--[-tert-Buty12---p--toly12H-pyrazol-3 -y31- -[-4[-(2-(cis—d1methy1morpholin y1)ethoxy)naphthalen-1 -y1]-urea; 1--[-tertButy1-p--toly12H-pyrazol-3 -]-3y1 -[-4[(2-(trans—d1methy1morph011n y1)ethoxy)naphthalen-1 -y1]-urea; 1--[5---tert-Buty12--p---toly12H-pyrazolyl]-3 -[-4[-(2-(2-(methoxymethy1)morpholin- y1)ethoxy)naphthalen-1 -y1]-urea; --tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[-(2-(morpholiny1)- oxoethoxy)naphthaleny1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[-(2-(morpholiny1)- ethoxy)naphthalen-1 -y1] -urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[-4[-(2-(morpholiny1)- 1- methylethoxy)naphthalen-1 -y1] -urea; 1--[5---tert-Buty12--p---toly12H-pyrazolyl]-3 -[-4[-(2-t—hiomorpholiny1- ethoxy)naphthalen—1-y1]-urea; 1--[5---tert-Buty12--p---toly12H-pyrazol-3 -y]-31 -[4-[-(-2(1--oxoth10morpholin y1)ethoxy)naphthalen-1 -y1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[4-[(2--morpholiny1-ethoxy)- methylnaphthalen-l -y1] -urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[4-[-(2-(morpholin-y1- carbonyl0X0)ethoxy)naphthaleny1]-urea; 1--[5---tert-Buty12--p---toly12H-pyrazol-3 -y]-31 -[4-[(2-(tetrahydropyran- y1)ethoxy)naphthalen-1 -y1]-urea; 8] 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[4-[(2-(1-0X0--tetrahydroth10phen y1)ethoxy)naphthalen-1 -y1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[4-[(3-morphol1ny1-propy1)naphthalen- 1-y1]-urea; 0] 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-31 -[4-[(morpholin-y1--methy1)naphthalen- 1-y1]-urea; --tertButy1-p---toly12H-pyrazol-3 -y]-31 -[4-[(2--pyrid1ny1-ethy1)naphthalen yl] -urea; 1--[-tertButy1-p--toly12H-pyrazoly1- -[-4[-(3-(morpholiny1)propyn y1)naphthaleny1]-urea; --tert-Buty12---p--toly12H-pyrazol-3 -]-3y1 -[4-[(3-(tetrahydropyran-yl--oxy)propyn- 11-y1)naphthalen- -y1]-urea; 1--[5---tert-Buty12--p---toly12H-pyrazol-3 -y]-13 -[-4[(3-(tetrahydropyran-yl--oxy)butyn- 11-y1)naphthalen- -y1]-urea; 1--[5---tert-Buty12--p---toly12H-pyrazol-3 -y]-13 -[-4[-(-3(p1perd1ny1)propyn y1)naphthaleny1]-urea; 1--[5---tert-Buty12--p---toly12H-pyrazol-3 -y]-13 -[-4[-(3-(2-methoxymethy1morphol1n pyny1)naphthaleny1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-13 -[-4[-(pyrid1n--y1--methoxy)naphthalen 1- y1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-13 -[-4[(2--pyrid1ny1-ethoxy)naphthalen y1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-13 -[-4[(3--pyrid1ny1--propoxy)naphthalen- 1-y1]-urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-13 -[-4[-(2-1m1dazoly1-ethoxy)naphthalen- 1-y1]-urea; 1--[5---tert-Buty12--p---toly12H-pyrazol-3 -y]-134(2(34— dimethoxyphenyl)ethoxy)naphthalen-1 -y1] -urea; 1--[5---tertButy1-p---toly12H-pyrazol-3 -y]-13 -[-4[(pyridin-y1- methylamino)naphthaleny1]-urea; 1-[5-1so--Propy12-pheny1-2H-pyrazoly1]-3 -[-4[-(morph011n-4y1- ethoxy)naphthalen—1-y1]-urea; 4] 1--[5-c—y-clohexyl2-pheny1-2H-pyrazol-3 -y]-13 -[-4[-(2--morph011ny1- ethoxy)naphthalen—1-y1]-urea; 1- 222--trifluoroethyl)-pheny1-2H-pyrazol-3 -y]-13 -[-4[-(morph011ny1- ethoxy)naphtha1eny1]-urea; 1- 1-“methylcycloprop 1-y1)-pheny1-2H-pyrazol-3 -y]-13 -[-4[-(morph011ny1- ethoxy)naphthalen—1-y1]-urea; 1-5[-[-(methylcycloheXy1)--2pheny1-2H-pyrazol-3 -]-3y1 -[4-[-(morph011ny1- ethoxy)naphthalen—1-y1]-urea; 1--[-tertbuty1methy1-2H-pyrazoly1]-3 -[4-[-(morph011ny1- ethoxy)naphthalen—1-y1]-urea; 1--[5---tert—buty12--(-4chloropheny1)-Hpyrazoly1]-3 -[-4[-(2--morpholiny1- ethoxy)naphthalen—1-y1]-urea; 1--[5---tert—buty12-buty1-2H-pyrazol-3 -y1]-3 -[-4[(2--morpholiny1--ethoxy)naphthalen- -1yl]-urea; 1--[5---tertbuty1-(-methy13--carbamy1phenyl)Hpyrazoly1]-3 -[-4[-(morph011n- 4-y1-ethoxy)naphtha1eny1]-urea; 1-[5-tert-buty1(4-methy1(morpho11ny1)methy1pheny1)-2H-pyrazoly1][4- (2-morpholiny1-ethoxy)naphthaleny1]-urea; 1-[5-tert-buty1(4-methy1dimethylaminomethylpheny1)-2H-pyrazoly1][4- (2-morpholiny1-ethoxy)naphthaleny1]-urea; 4] 1--[5---tertbuty1-(-3dimethylaminomethylpheny1)-Hpyrazol-3 -y][-4[-(2- morpholiny1-ethoxy)naphthaleny1]-urea; 1--[5---tert—buty12--(-2c—hloropyridin- 5--y-1)Hpyrazol-3 -y][-4[(2--morph011ny1- ethoxy)naphtha1eny1]-urea; 1--[5---tertbuty1(2--methy1pyrid1n-y-1)Hpyrazol-3 -[-4[-(morph011ny1- ethoxy)naphtha1eny1]-urea; 1--[5---tert—buty12--(methoxypyrid1n-y-1)Hpyrazol-3 -y][-4[(2--morpholiny1- ethoxy)naphthalen—1-y1]-urea; 1--[5---tert—buty12--(pyrid1n--y-1)Hpyrazol-3 -y][-4[-(morph011ny1- )naphthalen—1-y1]-urea; 1--[5---tertbuty1(2--methy1pyrid1n-y-1)Hpyrazol-3 -y][-4[-(-2p—yridiny1- )naphthalen—1-y1]-urea; 1--[5---tertbuty1(2--methy1pyrid1n-y-1)Hpyrazol-3 -y][-4[-(-2(trans— y1morpholiny1)ethoxy)naphthalen-1 -y1]-urea; 1--[5---tertbuty1(2--methy1pyrid1n-y-1)Hpyrazol-3 -y][-4[-(morph011ny1- - 1-y1)naphthalen-1 -y1]-urea. 1--[-tertButyl--p--tolyl2H-pyrazol-3 -]-3yl -[4-[(morpholinyl- ethoxy)naphthalen— 1 -yl] -urea; 1--[-tert-Butyl2---p--tolyl2H-pyrazol-3 -]-3yl -[4-[-(-2(l--oxothiomorpholin yl)ethoxy)naphthalen- l -yl] -urea; 1--[5---tertbutyl(2--methylpyridin-y-l)Hpyrazol-3 -y]-31 (pyridinyl- ethoxy)naphthalen—1-yl]-urea; 1--[5---tert-butyl2--(methoxypyridin-y-l)Hpyrazol-3 -y]-31 -[4-[(2--morpholinyl- ethoxy)naphthalen-1 -yl] -urea; 1--[5---tertbutylmethyl-2H-pyrazolyl]-3 (morpholinyl- ethoxy)naphthalen-1 -yl] -urea; and 7] l-(3-(tert-butyl)- l lyl)-lH-pyrazol-S-yl)-3 -(4-(2-morpholinoethoxy)naphthalen- l-yl)urea (“Doramapimod”), Formula VIH’.
In one embodiment, the p38 kinase inhibitor is l-(3-(tert-butyl)-l-(p-tolyl)-lH- pyrazolyl)(4-(2-morpholinoethoxy)naphthalen-l-yl)urea (“Doramapimod”), Formula VIII’.
Genus VIII Definitions The term “aroyl” as used in the present specification shall be understood to mean yl” or “naphthoyl”.
Genus IX Description Compounds of Genus IX can be prepared according to the disclosures of US 7,160,883, US 7,462,616, and US 7,759,343 whichare herein incorporated herein by reference in their entireties.
Genus IX is characterized by compounds of Formula IX: or stereoisomers thereof, isotopically-enriched compounds thereof, prodrugs thereof, solvates thereof, and pharmaceutically acceptable salts thereof; wherein: X is selected from –O–; –OC(═O)–, –S–, –S(═O)–, –SO2–, –C(═O)–, –CO2–, –NR8–, – NR8C(═O)–, –NR8C(═O)NR9–, –NR8CO2–, –NR8SO2–, –NR8SO2NR9–, –SO2NR8–, – C(═O)NR8–, n, nitro, and cyano, or X is absent; Y is –C(═O)NH–, –NR10aCO—Ba, —NR10CO2—Baa, O2 or —SO2NR10; Ba and Baa are each independently selected from the group consisting of a C3-7 cycloalkyl, a 5-membered heteroaryl, and a 5-6 membered heterocyclo, wherein the C3-7 cycloalkyl, 5-membered aryl, or 5-6 membered heterocyclo is optionally substituted with 1-2 R7; wherein: (a) R7 is attached to any available carbon or en atom of Ba or Baawhen Ba or Baa is a substituted cycloalkyl, a substituted heterocyclo or a substituted aryl, and (b) at each occurrence R7 is independently selected from the group consisting of keto (═O), alkyl, substituted alkyl, halogen, koxy, ureido, cyano, —SR20, —OR20, —NR20R21, —NR20SO2R21, —SO2R19, —SO2NR20R21, —CO2R20, —C(═O)R20, —C(═O)NR20R21, —OC(═O)R20, — OC(═O)NR20R21, —NR20C(═O)R21, —NR20CO2R21, aryl, cycloalkyl, heterocycle, and heteroaryl; and/or (c) when Ba or Baa is lkyl, two R7 groups may join to form an optionallysubstituted -carbon bridge of three to four carbon atoms, or two R7 groups may join to form a fused carbocyclic, heterocyclic or heteroaryl ring, said fused ring being in turn optionally substituted with one to three of R22; B is optionally—substituted cycloalkyl, optionally—substituted heterocyclo, or optionally— substituted heteroaryl, or aryl substituted with one R11 and 0-2 R12, or B is selected from —C(=O)R13, —C02R13, and —C(=O)NR13R13a; R1 and k are independently selected from hydrogen, alkyl, substituted alkyl, —OR14, —SR14, — OC(=O)R14, —C02R14, —C(=O)NR14R14a, l4a, —S(=O)R14, —SOzR14, —SOzNR14R14a, — zNR14aR14b, —NRl4aSO2Rl4, —NR14C(=O)R14a, —NR14C02R14a, — NR14C(=O)NR14aR14b, halogen, nitro, and cyano, R2 is en or C1—4alkyl; R3 is hydrogen, , perfluoromethyl, methoxy, halogen, cyano, —NH2, or —NH(CH3); R4 is selected from: a) hydrogen, provided that R4 is not hydrogen if X is —S(=O)—, —SOz—, 2—, or — NR3802—; b) alkyl, alkenyl, and alkynyl, any of which may be ally substituted with keto and/or one to four R17; c) aryl and heteroaryl, either of which may be optionally substituted with one to three R16; d) heterocyclo and cycloalkyl, either of which may be optionally substituted with keto and/or one to three R16; or R4 is absent if X is halogen, nitro, or cyano, R6 is attached to any ble carbon atom of phenyl ring and at each occurrence is independently selected from alkyl, halogen, OCF3, CF3, OH, ORe, C(=O)Re, — OC(=O)Re, —SH, —SRe, —NHC(=O)NH2, —N02, —CN, —C02H, —RfC02H, —C(=O)NH2, — C(=O)ORe, —S(=O)Re, —S(=O)(aryl), —NHSOz(aryl), —NHSO3(aryl), —NHSOzRe, —SO3H, — SOz(Re), —SO3(Re), —SOzNH2, phenyl, benzyl, —O(aryl), and —O(benzyl), wherein: Re is alkyl, and Rf is alkylene, and each alkyl, alkylene, aryl or benzyl group of R6 in turn may be further substituted by one to two R18; R8 and R9 are independently selected from en, alkyl, substituted alkyl, aryl, lkyl, heterocyclo, and heteroaryl; Rm and R103 are each independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkoxy, and aryl; R11 is selected from optionally—substituted cycloalkyl, optionally—substituted heterocyclo, and ally—substituted heteroaryl; R12 is selected from alkyl, R17, and C1_4alkyl substituted with keto (=0) and/or one to three R17; R13 and R13a are independently selected from hydrogen, alkyl, and substituted alkyl, R14, R14a and R14b are independently selected from hydrogen, alkyl, substituted alkyl, aryl, cycloalkyl, heterocyclo, and heteroaryl, except when R14 is joined to a nyl group as in —S(=O)R14, —SOzR14, and —NR14aSOzR14, then R14 is not hydrogen, R16 is ed from alkyl, R17, and kyl substituted with keto (=0) and/or one to three R17; R17 is selected from (a) halogen, haloalkyl, haloalkoxy, nitro, cyano, —SR23, —OR23, —NR23R24, — NR23802R25, —SOzR25, —SOzNR23R24, 3, —C(=O)R23, —C(=O)NR23R24, —OC(=O)R23, —OC(=O)NR23R24, —NR23C(=O)R24, —NR23C02R24; (b) aryl or heteroaryl either of which may be optionally substituted with one to three R26; or (c) cycloalkyl or heterocyclo, either of which may be optionally substituted with one or more of keto(=O) and 1-3 R26; R18 and R26 are independently selected from C1—6alkyl, C2_6alkenyl, halogen, haloalkyl, koxy, cyano, nitro, amino, C1_4alkylamino, aminoC1_4alkyl, hydroxy, hydroxyC1— 4alkyl, alkoxy, kylthio, phenyl, benzyl, phenyloxy, and benzyloxy, R19 is Camila/L phenyl, Cmcycioalkyl, or 5~6 membered heterocyclo or heteroary}, Rm and Rm are each independently selected from the group consisting of hydrogen, alkyl, allaenyl, substituted alkyl, substituted alkenyl, phenyi, my}, Cmcycioalkyl, and five~tonsit< meml’sered heterocycio and heteroaryi; R2; is ed from the group ting of CI-fifilkffl, kenyl, halogen lialoalkyl, haloallwxy, cyano, nitro, amino, {:l—4Eillify’lall’iii'ii‘), aminoCmallqy'i, hydroxy, hydroxij.4aii<yl, alkoxy, aikylthio, r5henyl, benzyi, phenyloxy, and henzyloxy; R23 and R24 are each independently selected from hydrogen, alkyl, l, substituted alkyl, substituted alkenyl, aryl, cycloalkyl, heteroaryl, and heterocyclo; R25 is selected from alkyl, substituted alkyl, aryl, heteroaryl, cyclo alkyl and cyclo; and mis0,1,20r3.
In one embodiment, the p38 kinase inhibitor from Genus IX is selected from compounds 1-131 of US 7,160,883.
In one embodiment, the p38 kinase inhibitor from Genus IX is ed from the following: HSC ch 161 161 0 0 \ \N 113% M \ J ch—/—N N\\I/ HzC \<] 0 0 \ \N \ N 2 ch \N \ I\ 113C \ / 113C H;(" \< -, N\<~ \ / H3C \< H3( 0 0 \ \N N \ N /J V \; 0 162 162 0 o \ \N \ N g HjcfN \N ch d 0 0 \ \N N \N H3C Q 0 0 we \ \N \ \ \N N \N \ N g o HgN \N N K]9 H3O 0 o \ \N \/\N \ N\N) 163 163 In one embodiment, the p38 inhbitior is 4-((5-(cyclopropylcarbamoyl) methylphenyl)amino)methyl-N-propylpyrrolo[2,1-f][1,2,4]triazinecarboxamide (“MBS- 582949”), Formula IX′.
Genus IX Definitions The term “alkyl” refers to straight or branched chain unsubstituted hydrocarbon groups of 1 to 20 carbon atoms, ably 1 to 7 carbon atoms. The expression “lower alkyl” refers to unsubstituted alkyl groups of 1 to 4 carbon atoms. When a subscript is used with 163A nce to an alkyl or other group, the subscript refers to the number of carbon atoms that the group may contain. For e, the term “Co—4alkyl” includes a bond and alkyl groups of 1 to 4 carbon atoms. 6] The term “substituted alkyl” refers to an alkyl group substituted by one to four substituents selected from halogen, hydroxy, alkoxy, keto (=0), alkanoyl, aryloxy, alkanoyloxy, NRaRb, alkanoylamino, aroylamino, aralkanoylamino, substituted alkanoylamino, substituted arylamino, substituted aralkanoylamino, thiol, alkylthio, arylthio, aralkylthio, hiono, arylthiono, aralkylthiono, alkylsulfonyl, arylsulfonyl, aralkylsulfonyl, —SO2NRaRb, nitro, cyano, —C02H, —CONRaRb, alkoxycarbonyl, aryl, guanidino and heteroaryls or heterocyclos (such as indolyl, imidazolyl, furyl, l, lyl, pyrrolidyl, pyridyl, pyrimidyl and the like), wherein Raand Rb are selected from hydrogen, alkyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, aryl, heteroarylalkyl, heterocycle, and heterocyclealkyl. The substituent on the alkyl optionally in turn may be further substituted, in which case it will be with substituted one or more of C1-4alkyl, C2— 4alkenyl, halogen, haloalkyl, haloalkoxy, cyano, nitro, amino, C1.4alkylamino, aminoC1-4alkyl, hydroxy, hydroxyC1.4alkyl, alkoxy, hio, phenyl, benzyl, phenyloxy, and/or benzyloxy.
The term “alkenyl” refers to straight or branched chain hydrocarbon groups of 2 to 20 carbon atoms, preferably 2 to 15 carbon atoms, and most preferably 2 to 8 carbon atoms, haVing at least one double bond, and depending on the number of carbon atoms, up to four double bonds.
The term “substituted alkenyl” refers to an alkenyl group substituted by one to two substituents selected from those d above for substituted alkyl groups.
The term “alkynyl” refers to straight or branched chain hydrocarbon groups of 2 to 20 carbon atoms, preferably 2 to 15 carbon atoms, and most preferably 2 to 8 carbon atoms, haVing at least one triple bond, and depending on the number of carbon atoms, up to four triple bonds.
The term ituted l” refers to an alkynyl group substituted by one to two substituents selected from those recited above for alkyl groups.
When the term alkyl is used in connection with another group, as in heterocycloalkyl or cycloalkylalkyl, this means the identified (first named) group is bonded directly through an alkyl group which may be ed or straight chain (e.g., cycloproplel-4alkyl means a cyclopropyl group bonded through a straight or branched chain alkyl group haVing one to four carbon atoms.). In the case of substituents, as in “substituted cycloalkylalkyl,” the alkyl portion of the group, besides being branched or straight chain, may be substituted as recited above for substituted alkyl groups and/or the first named group (e.g., cycloalkyl) may be substituted as d herein for that group. 2] The term “halogen” or “halo” refers to fluorine, chlorine, bromine and iodine.
The term “aryl” refers to monocyclic or bicyclic aromatic substituted or unsubstituted hydrocarbon groups haVing 6 to 12 carbon atoms in the ring portion, such as phenyl, naphthyl, and biphenyl groups.) Aryl groups may ally include one to three additional rings (either cycloalkyl, heterocyclo or heteroaryl) fused thereto. Examples include: and the like. Each ring of the aryl may be optionally substituted with one to three chroups, wherein Rc at each occurrence is selected from alkyl, substituted alkyl, n, trifluoromethoxy, trifluoromethyl, —SR, —OR, —NRR’, —NRSOZR’, —SOZR, R’, —C02R’, —C(=O)R’, —C(=O)NRR’, —OC(=O)R’, —OC(=O)NRR’, —NRC(=O)R’, — NRCOZR’, phenyl, C3-7 cycloalkyl, and five-to-siX membered heterocyclo or heteroaryl, wherein each R and R’ is selected from hydrogen, alkyl, substituted alkyl, alkenyl, tuted alkenyl, phenyl, C3-7cycloalkyl, and five-to-siX membered cyclo or heteroaryl, except in the case of a yl group, then R is not going to be hydrogen. Each substituent Rc optionally in turn may be further substituted by one or more (preferably 0 to 2) Rd groups, wherein Rd is selected from Cl-6alkyl, C2-6alkenyl, halogen, haloalkyl, haloalkoxy, cyano, nitro, amino, Cl- 4alkylamino, aminoCl-4alkyl, hydroxy, hydroxyCl-4alkyl, alkoxy, alkylthio, phenyl, benzyl, phenylethyl, phenyloxy, and benzyloxy.
The term “aralkyl” refers to an aryl group bonded ly through an alkyl group, such as benzyl, wherein the alkyl group may be branched or straight chain. In the case of a “substituted aralkyl,” the alkyl portion of the group besides being branched or straight chain, may be substituted as recited above for substituted alkyl groups and/or the aryl portion may be substituted as recited herein for aryl. Thus, the term nally substituted benzyl” refers to the group: wherein each R group may be hydrogen or may also be selected from Rc as defined above, in turn optionally substituted with one or more Rd. At least two of these “R” groups should be hydrogen and preferably at least five of the “R” groups is hydrogen. A preferred benzyl group involves the alkyl-portion being ed to define: HTI:© The term “heteroaryl” refers to a substituted or unsubstituted aromatic group for example, which is a 4 to 7 membered monocyclic, 7 to 11 ed bicyclic, or 10 to 15 membered tricyclic ring system, which has at least one heteroatom and at least one carbon atom- containing ring. Each ring of the heteroaryl group ning a heteroatom can contain one or two oxygen or sulfur atoms and/or from one to four nitrogen atoms, provided that the total number of atoms in each ring is four or less and each ring has at least one carbon atom.
The fused rings ting the bicyclic and tricyclic groups may n only carbon atoms and may be saturated, lly saturated, or unsaturated. The nitrogen and sulfur atoms may optionally be oxidized and the nitrogen atoms may optionally be quaternized. Heteroaryl groups which are bicyclic or tricyclic must include at least one fully aromatic ring but the other fused ring or rings may be aromatic or non-aromatic. The heteroaryl group may be attached at any available nitrogen or carbon atom of any ring. It may optionally be substituted with one to three rably 0 to 2) Rc , as defined above for aryl, which in turn may be substituted with one or more rably 0 to 2) Rd groups, also as recited above. ary monocyclic heteroaryl groups include pyrrolyl, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, lyl (i.e., (\ l N ), thiadiazolyl, isothiazolyl, furanyl, thienyl, oxadiazolyl, pyridyl, pyrazinyl, dinyl, pyridazinyl, nyl and the like.
Exemplary bicyclic heteroaryl groups include indolyl, benzothiazolyl, benzodioxolyl, benzoxaxolyl, benzothienyl, inyl, tetrahydroisoquinolinyl, isoquinolinyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuranyl, chromonyl, coumarinyl, benzopyranyl, cinnolinyl, quinoxalinyl, indazolyl, pyrrolopyridyl, furopyridinyl, dihydroisoindolyl, tetrahydroquinolinyl and the like.
Exemplary tricyclic heteroaryl groups include carbazolyl, benzidolyl, phenanthrollinyl, acridinyl, phenanthridinyl, xanthenyl and the like.
The term “cycloalkyl” refers to a saturated or partially unsaturated non-aromatic cyclic hydrocarbon ring system, preferably containing 1 to 3 rings and 3 to 7 carbon atoms per ring, which may be substituted or unsubstituted and/or which may be fused with a C3— C7 carbocylic ring, a heterocyclic ring, or which may have a bridge of 3 to 4 carbon atoms. The lkyl groups including any available carbon or en atoms on any fused or bridged rings optionally may have 0 to 3 (preferably 0—2) substituents selected from Rc groups, as recited above, and/or from keto (where riate) which in turn may be substituted with one to three Rd groups, also as recited above. Thus, when it is stated that a carbon-carbon bridge may be optionally substituted, it is meant that the carbon atoms in the bridged ring ally may be substituted with an Rc group, which preferably is seleted from Cl-4alkyl, C2-4alkenyl, halogen, haloalkyl, haloalkoxy, cyano, amino, Cl-4alkylamino, aminoCl-4alkyl, hydroxy, hydroxyCl- 4alkyl, and C1-4alkoxy. Exemplary cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, bicycloheptane, cycloctyl, cyclodecyl, odecyl, and adamantyl.
The terms “heterocycle”, “heterocyclic” and “heterocyclo” each refer to a fully ted or partially rated nonaromatic cyclic group, which may be substituted or unsubstituted, for example, which is a 4 to 7 membered monocyclic, 7 to 11 ed bicyclic, or 10 to 15 membered tricyclic ring system, which has at least one heteroatom in at least one carbon atom-containing ring. Each ring of the heterocyclic group containing a heteroatom may have 1, 2 or 3 heteroatoms ed from nitrogen, oxygen, and sulfur atoms, where the nitrogen and sulfur heteroatoms also optionally may be ed and the nitrogen heteroatoms also optionally may be quaternized. Preferably two adjacent heteroatoms are not simultaneously selected from oxygen and nitrogen. The heterocyclic group may be attached at any nitrogen or carbon atom. The heterocyclo groups optionally may have 0 to 3 (preferably 0—2) substituents selected from keto (=0), and/or one or more Rc groups, as recited above, which in turn may be substituted with one to three Rd groups, also as recited above.
Exemplary monocyclic heterocyclic groups include pyrrolidinyl, pyrrolyl, indolyl, pyrazolyl, oxetanyl, pyrazolinyl, imidazolyl, olinyl, imidazolidinyl, oxazolyl, oxazolidinyl, olinyl, olyl, thiazolyl, azolyl, thiazolidinyl, isothiazolyl, isothiazolidinyl, furyl, ydrofuryl, thienyl, zolyl, piperidinyl, piperazinyl, 2- oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, 2-oxazepinyl, azepinyl, ridonyl, pyridyl, N—oxo-pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, tetrahydropyranyl, morpholinyl, thiamorpholinyl, thiamorpholinyl sulfoxide, rpholinyl sulfone, l,3-dioxolane and tetrahydro-l, l-dioxothienyl, dioxanyl, isothiazolidinyl, thietanyl, thiiranyl, triazinyl, and triazolyl, and the like.
Exemplary bicyclic hetrocyclic groups include 2,3-dihydrooxo-lH-indolyl, benzothiazolyl, benzoxazolyl, benzothienyl, quinuclidinyl, quinolinyl, quinolinyl-N-oxide, tetrahydroisoquinolinyl, isoquinolinyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuryl, chromonyl, coumarinyl, cinnolinyl, quinoxalinyl, indazolyl, pyrrolopyridyl, furopyridinyl (such as furo[2,3-c]pyridinyl, furo[3,l-b]pyridinyl] or ,3-b]pyridinyl), dihydroisoindolyl, dihydroquinazolinyl (such as 3,4-dihydrooxo-quinazolinyl), benzisothiazolyl, benzisoxazolyl, iazinyl, benzofurazanyl, benzothiopyranyl, benzotriazolyl, benzpyrazolyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, dihydrobenzopyranyl, indolinyl, isochromanyl, isoindolinyl, naphthyridinyl, phthalazinyl, piperonyl, l, pyridopyridyl, quinazolinyl, tetrahydroquinolinyl, thienofuryl, thienopyridyl, thienyl, and the like.
Also included are smaller heterocyclos, such as epoxides and aziridines.
Unless otherwise indicated, when reference is made to a specifically-named aryl (e.g., ), lkyl (e.g., cyclohexyl), heterocyclo (e.g., pyrrolidinyl) or heteroaryl (e.g., indolyl), the reference is intended to include rings having 0 to 3, ably 0—2, substituents selected from those recited above for the the aryl, cycloalkyl, heterocyclo and/or heteroaryl groups, as appropriate. Additionally, when reference is made to a specific heteroaryl or heterocyclo group, the nce is intended to include those systems having the m number of non-cumulative double bonds or less than the maximum number of double bonds.
Thus, for e, the term “isoquinoline” refers to isoquinoline and tetrahydroisoquinoline.
Additionally, it should be understood that one skilled in the field may make appropriate selections for the substituents for the aryl, cycloalkyl, heterocyclo, and heteroaryl groups to provide stable compounds and compounds useful as pharmaceutically-acceptable nds and/or intermediate compounds useful in making pharmaceutically-acceptable compounds. Thus, for example, in compounds of Formula (IX), when B is a cyclopropyl ring, preferably the ring has no more than two substituents, and preferably said substituents do not comprise nitro (N02), more than one cyano group, or three halogen groups. Similarly, when m is 3, preferably R6, the tuents on the phenyl ring A, are not all nitro, and so forth.
The term “heteroatoms” shall include oxygen, sulfur and nitrogen.
The term “haloalkyl” means an alkyl having one or more halo substituents.
The term “perfluoromethyl” means a methyl group substituted by one, two, or three fluoro atoms, i.e., CH2F, CHF2 and CF3. The term “perfluoroalkyl” means an alkyl group having from one to five fluoro atoms, such as uoroethyl.
The term “haloalkoxy” means an alkoxy group having one or more halo substituents.
For example, “haloalkoxy” includes —OCF3.
The term “carbocyclic” means a saturated or unsaturated monocyclic or bicyclic ring in which all atoms of all rings are carbon. Thus, the term includes cycloalkyl and aryl rings. The carbocyclic ring may be substituted in which case the substituents are ed from those recited above for cycloalkyl and aryl groups.
When the term “unsaturated” is used herein to refer to a ring or group, the ring or group may be fully unsaturated or partially unsaturated.
Definitions for the various other groups that are recited above in connection with substituted alkyl, substituted alkenyl, aryl, cycloalkyl, and so forth, are as follows: alkoxy is — ORe, alkanoyl is —C(=O)Re, aryloxy is —OAr, alkanoyloxy is —OC(=O)Re, amino is —I\H2, alkylamino is —NHRe or 2, arylamino is —NHAr or —NReAr, lamino is —I\H— Rr—Ar, ylamino is —NH—C(=O)Re, aroylamino is =O)Ar, aralkanoylamino is —NH—C(=O)Rr—Ar, thiol is —SH, alkylthio is —SRe, arylthio is —SAr, aralkylthio is — S—Rf—Ar, alkylthiono is Re, arylthiono is —S(=O)Ar, aralkylthiono is —S(=O)Rr— Ar, alkylsulfonyl is —SO(C])Re, arylsulfonyl is —SO(q)Ar, arylsulfonylamine is —NHSO(q)Ar, alkylsulfonylamine is —NHSOzRe, aralkylsulfonyl is RrAr, sulfonamido is —SOzNH2, substituted sulfonamide is —SOzNHRe or —SOzN(Re)2, nitro is —N02, carboxy is —C02H, carbamyl is —CONH2, substituted carbamyl is NHRg or —C(=O)NR,th, alkoxycarbonyl is —C(=O)0Re, carboxyalkyl is —Rf—C02H, ic acid is SO3H, guanidino is —N—C—NH2, and ureido is —N—C—NH2, wherein Re is alkyl or substituted alkyl as defined above, Rf is alkylene or substituted alkylene as defined above, Rg and Rh are selected from alkyl, substituted alkyl, aryl, aralkyl, cycloalkyl, heterocyclo, and heteraryl; Ar is an aryl as defined above, and q is 2 or 3.
Genus X Description Compounds of Genus X can be prepared according to the sure of US 2005- 0176775, which is herein incorporated herein by reference in its entirety.
Genus X is characterized by compounds of Formula X: R5 (X), or stereoisomers thereof, isotopically-enriched compounds thereof, prodrugs thereof, solvates thereof, and pharmaceutically acceptable salts thereof; wherein: R1 is halogen substituted with l, 2, 3, 4, or 5 groups that are independently halogen, —(C1-C6)alkyl-N(R)—C02R30, haloalkyl, heteroaryl, heteroarylalkyl, —NR6R7, R6R7N—(C1-C6 alkyl)—, —C(O)NR6R7, —(C1-C4)alkyl-C(O)NR6R7, 4 alkyl)-NRC(O)NR16R17, haloalkoxy, alkyl, —CN, hydroxyalkyl, dihydroxyalkyl, alkoxy, alkoxycarbonyl, phenyl, —SOz-phenyl wherein the phenyl and —SOz-phenyl groups are optionally substituted with l, 2, or 3 groups that are independently halogen or —N02, or —OC(O)NR6R7, wherein: R16 and R17 are independently —H or C1-C6 alkyl, or R16, R17 and the nitrogen to which they are attached form a linyl ring, R6 and R7 are independently at each ence —H, alkyl, hydroxyalkyl, dihydroxyalkyl, alkoxy, alkanoyl, arylalkyl, arylalkoxy, carbonyl, —SOz- alkyl, —OH, alkoxy, alkoxyalkyl, arylalkoxycarbonyl, —(C1-C4)alkyl-C02-alkyl, heteroarylalkyl, or arylalkanoyl, n each is unsubstituted or substituted with l, 2, or 3 groups that are ndently, halogen, —OH, —SH, heterocycloalkyl, cycloalkylalkyl, C3-C7 cycloalkyl, alkoxy, —NH2, —NH(alkyl), —N(alkyl)(alkyl), —O-alkanoyl, alkyl, haloalkyl, aldehyde, or haloalkoxy, or R6, R7, and the nitrogen to which they are attached form a morpholinyl, pyrrolidinyl, thiomorpholinyl, thiomorpholinyl-S-oXide, thiomorpholinyl S,S-dioxide, piperidinyl, pyrrolidinyl, or zinyl ring which is optionally substituted with 1 or 2 groups that are independently C1-C4 alkyl, alkoxycarbonyl, C1-C4 alkoxy, hydroxyl, hydroxyalkyl, dihydroxyalkyl, or halogen; R30 is C1-C6 alkyl optionally substituted with 1 or 2 groups that are independently —OH, —SH, halogen, amino, monoalkylamino, dialkylamino or C3-C6 cycloalkyl, R3 is —H, halogen, alkoxycarbonyl, koxycarbonyl, aryloxycarbonyl, arylalkyl, —OC(O)NH(CH2)naryl, arylalkoxy, —OC(O)N(alkyl)(CH2)naryl, aryloxy, arylthio, thioalkoxy, arylthioalkoxy, alkenyl, —NR6R7, NR6R7—(C1-C6)alkyl, or alkyl, wherein: the aryl portion of arylalkoxycarbonyl, aryloxycarbonyl, kyl, —OC(O)NH(CH2)naryl, arylalkoxy, —OC(O)N(alkyl)(CH2)naryl, and arylthioalkoxy, is unsubstituted or substituted with 1, 2, 3, 4, or 5 groups that are independently, halogen, alkoxy, alkyl, haloalkyl, or haloalkoxy, wherein: n is 0,1, 2, 3, 4, 5, or 6; R4 is alkyl tituted or substituted with one or two groups that are independently —C02R, —C02—(C1-C6)alkyl, —C(O)NR6R7, —C(O)R6, —N(R30)C(O)NR16R17, )C(O)—(C1-C6)alkoxy, or —NR6R7, arylalkoxy, arylalkyl, heteroaryl, heteroarylalkyl, hydroxyalkyl, dihydroxyalkyl, kyl, R6R7N—(C1-C6 alkyl)-, —NR6R7, alkoxy, carboxaldehyde, —C(O)NR6R7, C02R, alkoxyalkyl, or alkoxyalkoxy, wherein the heteroaryl or aryl portions of is the above are unsubstituted or substituted with 1, 2, 3, 4, or 5 groups that are independently halogen, hydroxy, alkoxy, alkyl, —C02—(C1-C6)alky1, R7, — NR6R7, R6R7N—(C1-C6)alkyl-, nitro, haloalkyl, or haloalkoxy; and k is H, aryl, arylalkyl, arylthioalkyl, alkyl optionally substituted with 1, 2, or 3 groups that are ndently arylalkoxycarbonyl, —NRsR9, halogen, R3R9, alkoxycarbonyl, C3- C7 cycloalkyl, or alkanoyl, , alkoxyalkyl optionally substituted with one trimethylsilyl group, amino, carbonyl, hydroxyalkyl, dihydroxyalkyl, alkynyl, —SOz-a1ky1, alkoxy optionally substituted with one trimethylsilyl group, heterocycloalkylalkyl, cycloalkyl, cycloalkylalkyl, -S-aryl, -alkyl-SOz-aryl, heteroarylalkyl, heterocycloalkyl, heteroaryl, or alkenyl ally substituted with alkoxycarbonyl, each of the above is unsubstituted or substituted with 1, 2, 3, 4, or 5 groups that are independently alkyl, halogen, alkoxy, hydroxyalkyl, dihydroxyalkyl, arylalkoxy, thioalkoxy, alkoxycarbonyl, koxycarbonyl, COzR, CN, OH, hydroxyalkyl, dihydroxyalkyl, amidinooXime, —NR6R7, —NR8R9, R6R7N—(C1-C6 alkyl)—, carboxaldehyde, SOz alkyl, —SOzH, —SO2NR6R7, yl wherein the alkyl portion is optionally substituted with OH, halogen or alkoxy, —C(O)NR6R7, —(C1-C4 alkyl)- C(O)NR6R7, amidino, haloalkyl, 4 alkyl)-NR15C(O)NR16R17, —(C1-C4 alkyl)- NR15C(O)R18, —O—CH2—O, —O—CH2CH2—O—, or haloalkoxy, wherein: R15 is H or C1-C6 alkyl, and R18 is C1-C6 alkyl optionally substituted with —O—(C2-C6 alkanoyl, C1- C6hydroxyalkyl, C1-C6 dihydroxyalkyl, C1-C6 alkoxy, C1-C6 alkoxy C1- C6 alkyl; amino C1-C6 alkyl, mono or lamino C1-C6 alkyl. [001 105] In one embodiment, the p3 8 kinase inhibitor from Genus X is selected from the following: [001 106] 3 -Chloro(2,4-difluorobenzyloxy)methyl(lH-pyrazolylmethyl- lH-pyridin- 2-one; [001 107] 2- {[3-bromo[(2,4-difluorobenzyl)oxy] methyloxopyridin-l (2H)-yl] - methyl} benzonitrile, [001 108] 3 - {[3-bromo[(2,4-difluorobenzyl)oxy] methyloxopyridin-l (2H)-yl] - methyl} benzonitrile, [001 109] 4- {[3-bromo[(2,4-difluorobenzyl)oxy] methyloxopyridin-l (2H)-yl] - methyl} itrile, [001 1 10] 4- {[3-bromo[(2,4-difluorobenzyl)oxy] methyloxopyridin-l (2H)-yl] - methyl}benzamide; [001 1 1 1] Methyl 4- {[3 -bromo[(2,4-difluorobenzyl)oxy] methyloxopyridin-l (2H)-yl] - } benzate; [001 1 12] Methyl 3 - {[3 -bromo[(2,4-difluorobenzyl)oxy] methyloxopyridin-l (2H)-yl] - } benzate; [001 1 13] 3 - omo[(2,4-difluorobenzyl)oxy] methyloxopyridin-l (2H)-yl] - methyl}benzamide; [001 1 14] 2- {[3-bromo[(2,4-difluorobenzyl)oxy] methyloxopyridin-l (2H)-yl] - methyl}benzamide; [001 1 15] l-[2-(aminomethyl)benzyl]bromo[(2,4-difluorobenzyl)oxy]methylpyridin- 1(2H)-yl-one; [001 1 16] 3 -bromo- l -[3-(bromomethyl)benzyl]-4[(2,4-difluorobenzyl)oxy]methylpyridin- 2(1H)-one; [001 1 17] 3 -bromo- l romomethyl)benzyl] [(2,4-difluorobenzyl)oxy]methylpyridin- 2(1H)-one; [001 1 18] l-[4-(aminomethyl)benzyl]bromo[(2,4-difluorobenzyl)oxy]methylpyridin- 2(1H)-one; [001 1 19] l-[3-(aminomethyl)benzyl]bromo[(2,4-difluorobenzyl)oxy]methylpyridin- 2(1H)-one; [001 120] l-[3 -((morpholinyl)methyl)benzyl] bromo[(2,4-difluorobenzyl)oxy] pyridin-2(1H)-one; [001 121] l-[3 -((dimethylamino)methyl)benzyl]bromo[(2,4-difluorobenzyl)oxy] methylpyridin-2(1H)-one; [001 122] l-[3 -((isopropylamino)methyl)benzyl]bromo [(2,4-difluorobenzyl)oxy] methylpyridin-2(1H)-one; [001 123] l-[3 -((piperidin- l -yl)methyl)benzyl]-3 -bromo[(2,4-difluorobenzyl)oxy] methylpyridin-2(1H)-one; [001 124] l-[3 -((2-hydroxyethyl)amino)methyl)benzyl] bromo[(2,4-difluorobenzyl)oxy]- 6-methylpyridin-2(lH)-one; [001 125] l-[3 -((bis(2-hydroxyethyl)amino)methyl)benzyl]bromo[(2,4- difluorobenzyl)oxy]methylpyridin-2(lH)-one; [001 126] 1-[3 -((piperaziny1)methy1)benzy1]bromo[(2,4-difluorobenzy1)oxy] pyridin-2(1H)-one; [001 127] 3 - {[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1 (2H)- hy1}benzoic acid; [001 128] 1-[3 -((1 -oxoethy1)aminomethy1)benzy1]bromo[(2,4-difluorobenzy1)oxy] methylpyridin-2(1H)-one; [001 129] 1-[3-(carbomethoxyaminomethyl)benzyl]bromo[(2,4-difluorobenzyl)oxy] methylpyridin-2(1H)-one; [001 130] 1-[3 -(methylsulfonylaminomethy1)benzyl]-3 -bromo[(2,4-difluorobenzyl)oxy] methylpyridin-2(1H)-one; [001 131] 1-[3 -(g1ycolylaminomethyl)benzy1]bromo difluorobenzyl)oxy] methylpyridin-2(1H)-one; [001 132] 1-[3-(aminocarbonylaminomethy1)benzy1]bromo[(2,4-difluorobenzy1)oxy] methylpyridin-2(1H)-one; [001 133] isopropylaminomethy1)benzy1]bromo[(2,4-difluorobenzy1)oxy] methylpyridin-2(1H)-one; [001 134] 1-[4-(morpholiny1methy1)benzy1]bromo[(2,4-difluorobenzy1)oxy] methylpyridin-2(1H)-one; [001 135] 1-[4-(dimethylaminomethy1)benzyl]-3 -bromo[(2,4-difluorobenzyl)oxy] methylpyridin-2(1H)-one; [00 1 136] 1-[4-(piperidiny1methy1)benzyl]bromo [(2,4-difluorobenzyl)oxy] methylpyridin-2(1H)-one; [001 137] 1-[4([bis(2-hydroxyethyl)amino]methy1)benzy1] bromo[(2,4- difluorobenzyl)oxy]methy1pyridin-2(1H)-one; [001 138] 1-[4-((2-etholy1)aminomethy1)benzyl]bromo [(2,4-difluorobenzyl)oxy] methylpyridin-2(1H)-one; [001 139] 1 -[4-piperazin-1 -y1methy1)benzy1]bromo[(2,4-difluorobenzy1)oxy] methylpyridin-2(1H)-one; [001 140] 1-[4-(methoxycarbonylaminomethy1)benzyl] bromo[(2,4-difluorobenzyl)oxy] methylpyridin-2(1H)-one; [001 141] acety1aminomethylbenzy1]-3 -bromo[(2,4-difluorobenzy1)oxy] methylpyridin-2(1H)-one; [00 1 142] 1- [4-(methylsulfonylaminomethy1)benzyl] -3 -bromo [(2,4-difluorobenzyl)oxy] methylpyridin-2(1H)-one; [001 143] 1-[4-(carbamylaminomethy1)benzy1]bromo[(2,4-diflorobenzyl)oxy] methylpyridin-2(1H)-one; [00 1 144] 4-(4- {[3 -bromo[(2,4-difluorobenzy1)oxy] methy1oxopyridin- 1 (2H)- y1]methy1}benzoy1)piperazinecarboxamide; [001 145] N—(4-{[3-bromo[(2,4-difluorobenzy1)oxy]methy10X0pyridin-1(2H)- y1]methy1}benzyl)methoxyacetamide; [001 146] methyl (4-(2,4-difluorobenzyloxy)bromomethy1oxopyridin-1(2H)- y1)methy1)benzylcarbamoyl)acetate; [00 1 147] (4-(2,4-difluorobenzyloxy)bromomethyloxopyridin-1(2H)- y1)methy1)benzy1)hydroxymethylpropanamide; [00 1 148] N—(4-((4-(2,4-difluorobenzyloxy)bromomethyloxopyridin-1(2H)- y1)methy1)benzy1)-1 -hydroxycyclopropanecarboxamide; [00 1 149] N—(4-((4-(2,4-difluorobenzyloxy)bromomethyloxopyridin-1(2H)- hy1)benzy1)aminoacetamide; [00 1 150] N—(4-((4-(2,4-difluorobenzyloxy)bromomethyloxopyridin-1(2H)- y1)methy1)benzy1)hydroxyacetamide; [00 1 151] N—(4-((4-(2,4-difluorobenzyloxy)bromomethyloxopyridin-1(2H)- y1)methy1)benzy1)(1-oxoethylamino)acetamide; [001 152] 1-{4-[(4-acety1piperaziny1)carbony1]benzy1}bromo[(2,4- difluorobenzyl)oxy]methy1pyridin-2(1H)-one; [00 1 153] 3 -bromo[(2,4-difluorobenzy1)oxy]methy1(4- {[4-(methylsulfony1)piperazin yl] carbonyl}benzyl)pyridin-2(1H)-one; [00 1 154] 3 -Bromo[(2,4-diflurorbenzy1)oxy][3 -(hydroxymethyl)phenyl] methylpyridin- 2(1H)-one; [001 155] Methyl[3-bromo[(difluorobenzy1)oxy]methy1oxopyridin(2H)- y1]benzoate; [001 156] 4-[3-bromo[(difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]benzoic acid; [001 157] 4-(Benzyloxy)(3-fluorobenzy1)(trifluoromethy1)pyridin-2(1H)-one; [001 158] 4-{[3-bromo[(2,4-difluorobenzyloxy]methy1oxopyridin-1(2H)- y1]methy1}benzoic acid; [001 159] 3 -Bromo[(2,4-diflurobenzy1)oxy][4-(hydroxymethy1)benzy1]methy1pyridin- 2(1H)-one; [001 160] 3 -Bromo[(2,4-diflurobenzy1)oxy][4-(1-hydroxymethylethy1)benzy1] methylpyridin-2(1H)-one; [001 161] 3 -bromo[(2,4-diflurobenzy1)oxy]methy1 {4- [(methylamino)methy1]benzyl}pyridin-2(1H)-one; [001 162] 4-[(2,4-diflurobenzy1)oxy](4-methoxybenzyl)methy1pyridin-2(1H)-one; [001 163] 3 -bromo[(2,4-diflurobenzy1)oxy](4-methoxybenzy1)methy1pyridin-2(1H)- one; [001 164] 3 -bromo[(2,4-diflurobenzy1)oxy](4-hydroxybenzyl)methy1pyridin-2(1H)- one; [001 165] 3 -bromo[(2,4-difluorobenzyl)oxy]-1 {4-[(4-hydroxymethy1piperidin y1)carbony1]benzyl} methy1pyridin-2(1H)-one; [001 166] 4-{[3-bromo[(2,4-difluorobenzyloxy]methy1oxypyridin-1(2H)-y1]methy1}- N-(2-hydroxymethylpropy1)benzamide; [00 1 167] 3 [(2,4-difluorobenzyl)oxy] -1 {4-[(4-hydroxypiperidin y1)carbony1]benzyl} methy1pyridin-2(1H)-one; [001 168] 4-{[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]methy1}- N—(2-hydroxyethy1)benzamide; [001 169] 3 -bromo(2;4-difluorophenoxy)methy1[4- ((aminoethyl)aminocarbonyl)benzy1]pyridin-2(1H)-one; [001 170] 3 -bromo(2;4-difluorophenoxy)methy1[4- ((aminopropyl)aminocarbony1)benzy1]pyridin-2(1H)-one; [001 171] 3 -bromo(2;4-difluorophenoxy)methy1[4- (hydroxyaminocarbonyl)benzy1]pyridin-2( 1 ; [001 172] 3 (2;4-difluorophenoxy)methy1[4- ((aminomethy1)aminocarbony1)benzyl]pyridin-2(1H)-one; [00 1 173] 3 (2,4-difluorophenoxy)methy1[4- (dimethylaminocarbonyl)benzy1]pyridin-2(1H)-one; [001 174] 3 -bromo(2,4-difluorophenoxy)methyl[4-(diethanol ylaminocarbonyl)benzyl]pyridin-2(1H)-one; [00 1 175] 3 (2,4-difluorophenoxy)methy1[4- (isoyropylaminocarbonyl)benzy1]pyridin-2(1H)-one; [00 1 176] 3 -bromo(2,4-difluorophenoxy)methy1[4- ((dimethylaminoethyl)aminocarbony1)benzy1]pyridin-2(1H)-one; [00 1 177] 3 -bromo(2,4-difluorophenoxy)methy1[4- ((methoxyethy1)aminocarbony1)benzyl]pyridin-2(1H)-one; [001 178] 3 -bromo(2,4-difluorophenoxy)methy1[4-((ethanol y1)methylaminocarbony1)benzy1]pyridin-2(1H)-one; [00 1 179] 3 -bromo(2,4-difluorophenoxy)methy1[4- ((methoxyethy1)methylaminocarbony1)benzyl]pyridin-2(1H)-one; [001 180] 4-{[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]-N—(2- hydroxyethy1)benzamide; [00 1 181] 4-(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin- 1 (2H)-y1)-N-(2- aminoethyl)benzamide; [00 1 182] 4-(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N—(3 - aminopropy1)benzamide; [00 1 183] 4-(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N— hydroxybenzamide; [00 1 184] 4-(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N— methylbenzamide; [00 1 185] 4-(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N,N— ylbenzamide; [00 1 186] 2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N,N—bis(2- hydroxyethy1)benzamide; [00 1 187] 4-(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N— isopropylbenzamide; [001 188] 4-[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]benzamide; [001 189] Methyl{[3-chloro[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)- y1]methy1}benzoate; [001 190] 3 -{[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]methy1}- N—methylbenzamide; [001 191] 3 -((4-(2,4-difluorobenzyloxy)bromomethy1oxopyridin-1(2H)-y1)methy1)-N— (2-aminoethy1)benzamide; [001 192] 3 2,4-difluorobenzyloxy)bromomethy1oxopyridin-1(2H)-y1)methy1)-N— (3 -aminopropy1)benzamide; [001 193] 3 -((4-(2,4-difluorobenzyloxy)bromomethy1oxopyridin-1(2H)-y1)methy1)-N— hydroxybenzamide; [001 194] 3 -((4-(2,4-difluorobenzyloxy)bromomethy1oxopyridin-1(2H)-y1)methy1)- N,N—dimethylbenzamide; [001 195] 3 -((4-(2,4-difluorobenzyloxy)bromomethy1oxopyridin-1(2H)-y1)methy1)-N— (2-hydroxyethy1)benzamide; [001 196] 3 -((4-(2,4-difluorobenzyloxy)bromomethy1oxopyridin-1(2H)-y1)methy1)- N,N—bis(2-hydroxyethyl)benzamide; [001 197] 3 -((4-(2,4-difluorobenzyloxy)bromomethy1oxopyridin-1(2H)-y1)methy1)-N— isopropylbenzamide; [001 198] N—(3-{[3-bromo[(2,4-difluorobenzy1)oxy]methy10X0pyridin-1(2H)- y1)methy1}benzyl]methoxyacetamide; [001 199] N—(3-((4-(2,4-difluorobenzyloxy)bromomethyloxopyridin-1(2H)- y1)methy1)benzy1)aminoacetamide; N—(3-((4-(2,4-difluorobenzyloxy)bromomethyloxopyridin-1(2H)- hy1)benzy1)(1-oxoethylamino)acetamide; N—(3-((4-(2,4-difluorobenzyloxy)bromomethyloxopyridin-1(2H)- y1)methy1)benzy1)0X0butanamide; N—(3-{[3-bromo[(2,4-difluorobenzy1)oxy]methy10X0pyridin-1(2H)- y1]methy1}benzyl)hydroxy-Z-methylpropanamide; 3] N—(3-{[3-bromo[(2,4-difluorobenzy1)oxy]methy10X0pyridin-1(2H)- y1]methy1}benzy1)hydroxycyclopropanecarboxamide; N’-(3- {[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)- y1]methy1} benzy1)-N,N-dimethylurea; [00 1205] 1-(3 -((4-(2,4-difluorobenzyloxy)bromomethy1oxopyridin-1(2H)- y1)methy1)benzy1)-3 -methy1urea; 3 -[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]benzoic acid; 7] Ethyl 3-[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)- y1]benzoate; 3 -[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1 (2H)-y1]-N— methylbenzamide; [00 1209] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin- 1 1)-N-(2- aminoethyl)benzamide; [00 1210] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N—(3 - ropy1)benzamide; [00121 1] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N— ybenzamide; [00 1212] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N,N— dimethylbenzamide; [00 1213] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N—(2- hydroxyethy1)benzamide; [00 1214] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N— isopropylbenzamide; [00 1215] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N—(2- (dimethylamino)ethy1)-benzamide; [00 1216] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N—(2- methoxyethyl)benzamide; [00 1217] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N—(2- (dimethylamino)ethy1)-N—methy1benzamide; [00 1218] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N—(2- hydroxyethyl)-N-methy1benzamide; [00 1219] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin- 1 (2H)-y1)-N-(2- methoxyethyl)-N-methy1benzamide; 3-[3-bromo [(2,4-difluorobenzy1)oxy]methy1 idin-l (2H)-y1]benzamide; 3 -[3-chloro[(2,4-difluorobenzy)oxy]methy1oxopyridin-1(2H)-y1]benzoic acid; 3 -chloro[(2,4-difluorobenzy1)oxy][3-(hydroxymethy1)pheny1]methy1pyridin- 2(1H)-one; 1-[3-(aminomethyl)phenyl]bromo[(2,4-difluorobenzy1)oxy]methy1pyridin- 2(1H)-one; N— {3- [3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin- 1 (2H)- y1]benzy1} methanesulfonamide; 4] N—(3-(4-(2,4-difluorobenzyloxy)bromomethy1oxopyridin-1(2H)- y1)benzyl)acetamide; methyl 3 -(4-(2,4-difluorobenzyloxy)bromomethy1oxopyridin-1 (2H)- y1)benzylcarbamate; N— {3- [3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin- 1 (2H)- y1]benzy1} methoxyacetamide; N—(3-(4-(2,4-difluorobenzyloxy)bromomethy1oxopyridin- 1 (2H)-y1)benzy1)- 2-aminoacetamide; N—(3-(4-(2,4-difluorobenzyloxy)bromomethy1oxopyridin- 1 (2H)-y1)benzy1)- 2-hydroxyacetamide; [00 1229] N’- {3 - [3 [(2,4-difluorobenzy1)oxy] methy1oxopyridin- 1 (2H)- y1]benzy1} imethylurea; 1-(3-(4-(2,4-difluorobenzyloxy)bromomethy1oxopyridin-1(2H)-y1)benzy1) methylurea; N— {3- [3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin- 1 (2H)- y1]benzy1} urea; 3 -bromo[(2,4-difluorobenzy1)oxy] {3-[(dimethylamino)methyl]phenyl} methylpyridin-2(1H)-one; [00 1233] 3 -bromo[(2,4-difluorobenzyloxy] methy1-1 -(2-morpholiny1ethy1)pyridin- 2(1H)-one; 3 -bromo-1 omo-2,6-difluoropheny1)[(2,4-difluorobenzy1)oxy] methylpyridin-2(1H)-one; [00 1235] 3 -bromo[(2,4-difluorobenzy1)oxy] methy1(2,4,6-trifluoropheny1)pyridin- 2(1H)-one; [00 1236] 3 -chloro[(2,4-difluorobenzyl)oxy]methy1(2,4,6-trifluoropheny1)pyridin- 2(1H)-one; 3 -bromo[(2,4-difluorobenzy1)oxy](hydroxymethy1)(2,4,6- trifluoropheny1)pyridin-2(1H)-one; 8] 3 o[(2,4-difluorobenzyl)oxy](hydroxymethy1)(2,4,6- trifluoropheny1)pyridin-2(1H)-one; 3 -bromo[(2,4-difluorobenzy1)oxy](2,6-difluoromorpholinylpheny1) methylpyridin-2(1H)-one; 3 -bromo[(2,4-difluorobenzy1)oxy][2,6-difluoro(4-methy1piperazin y1)pheny1]methy1pyridin-2(1H)-one; 3 -chloro[(2,4-difluorobenzy1)oxy] [2,6-difluoro(4-methy1piperazin y1)pheny1]methy1pyridin-2(1H)-one; [00 1242] 3 -bromo[(2,4-difluorobenzyl)oxy][4-(dimethylamino)-2,6-difluoropheny1] methylpyridin-2(1H)-one; [00 1243] 3 -bromo[(2,4-difluorobenzy1)oxy] {2,6-difluoro [(2- hydroxyethy1)(methyl)amino]phenyl} methy1pyridin-2(1H)-one; 3 -bromo(3 ,5-dibromo-2,6-difluorohydroxyobeny1)[(2,4-difluorobenzy1)oxy]- 6-methy1pyridin-2(1H)-one; 2- {4-[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]-3,5- difluorophenoxyl} acetamide; [00 1246] 3 -bromo[(2,4-difluorobenzy1)oxy][2,6-difluor0(2-hydroxyethoxy)pheny1] methypyridin-2(1H)-one; [00 1247] 3 -bromo(2,6-difluoropheny1){[4-fluoro(hydroxymethy1)benzyl]oxy} methylpyridin-2(1H)-one; 3 o(2,6-difluoropheny1){[4-fluoro(hydroxymethyl)benzy1]oxy} methylpyridin-2(1H)-one; 3 -[3-bromo[(2,4-difluorobenzyl)oxy]methy1oxopyridin-1(2H)-y1]methy1)- N-(2-morpholinylethy1)benzamide; [00 1250] 3 -(4-(2,4-difluorobenzyloxy)-3 methy1oxopyridin- 1 (2H)-y1)-N-(2- methoxyethyl)methy1benzamide; 1] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N,N,2- trimethylbenzamide; [00 1252] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N—(2- hydroxyethyl)methy1benzamide; [00 1253] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N,2- dimethylbenzamide; [00 1254] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N—(2- hydroxyethy1)-N,2-dimethylbenzamide; [00 1255] 4-(2,4-difluorobenzyloxy)(3 -(4-methy1piperaziny1)carbony1methy1phenyl)-3 - bromomethylpyridin-2(1H)-one; 4-(2,4-difluorobenzyloxy)(3 -(morpholiny1)carbony1methy1pheny1)bromo- 6-methy1pyridin-2(1H)-one; [00 1257] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N—(2- methoxyethy1)-N,2-dimethy1benzamide; 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1) benzamide; 3 -bromo[(2,4-difluorobenzyl)oxy]-1 ydroxymethy1)methy1pheny1] methylpyridin-2(1H)-one; 0] 3 -[3-chloro[(2,4-difluorobenzyhoxy]methy1oxopyridin-1(2H)-y1]-N—(2- methoxyethyl)methy1benzamide; 3 -[3-chloro[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]-N,2- dimethylbenzamide; 3 -[3-chloro[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]-N—(2- hydroxyethyl)methy1benzamide; 3 -[3-chloro[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1] methylbenzamide; [00 1264] 3 -Bromo[(2,4-difluorobenzy1)oxy] (2;6-dimethy1pheny1)methy1pyridin- 2(1H)-one; 3 -Bromo(2;6-dimethylpheny1)[(4-fluorobenzy1)oxy]methy1pyridin-2(1H)- one; [00 1266] 3 -Bromo(2;6-dimethy1pheny1)methy1 [(2;4;6-trifluorobenzy1)oxy]pyridin- 2(1H)-one; [00 1267] 3 -Bromo[(2,6-difluorobenzy1)oxy] (2;6-dimethy1pheny1)methy1pyridin- 2(1H)-one; 3 -Bromo(2;6-dichloropheny1)[(4-fluorobenzy1)oxy]methy1pyridin-2(1H)- one; 3 (2;6-dichlorophenyl)[(2,4-difluorobenzy1)oxy]methy1pyridin-2(1H)- one; 3 -Bromo(2;6-dichloroyhenyl)[(2,6-difluorobenzy1)oxy]methy1pyridin-2(1H)- one; 3 -Bromo[(2,4-difluorobenzy1)oxy](2-methoxymethy1pheny1) pyridin-2(1H)-one; 4-[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1 (2H)-y1] -3;5- dichlorobenzenesulfonamide; 3 -Bromo[(2,4-difluorobenzy1)oxy](2;6-difluorophenyl)methy1pyridin-2(1H)- one; 3 [(2,4-difluorobenzy1)oxy](2;6-difluorophenyl)iodo methylpyridin-2(1H)-one; ] 3 -Bromo[(2,4-difluorobenzy1)oxy][2-(dimethylamino)-4;6-difluoropheny1] methylpyridin-2(1H)-one; 3 -Bromo[(2,4-difluorobenzy1)oxy] {2;4-difluoro [(2- hydroxyethy1)(methyl)amino]phenyl} methy1pyridin-2(1H)-one; 2-( {[3 -Bromo(2; 6-difluoropheny1)methy1oxo- 1 ,2-dihydropyridin y1]oxy}methy1)fluorobenzonitrile; 4-{[2-(Aminomethy1)fluorobenzy1]oxy}bromo- 1 difluoropheny1) methylpyridin-2(1H)-one trifluoroacetate; [00 1279] N—[2-( {[3 -bromo- l -(2,6-difluorophenyl)methyloxo- l ,2-dihydropyridin yl]oxy}methyl)fluorobenzyl]urea; Methyl 2-( { [3-bromo-l difluorophenyl)methyloxo- l ,2-dihydropyridin yl] oxy } methyl)-5 -fluorobenzylcarbamate; [00 1281] N—[2-( {[3 - l -(2,6-difluorophenyl)methyloxo- l ,2-dihydropyridin yl]oxy}methyl)fluorobenzyl]hydroxyacetamide; Ethyl 2-( {[3-chloro- l -(2,6-difluorophenyl)methyloxo- l ydropyridin yl] oxy } methyl)-5 -fluorobenzylcarbamate; Isobutyl 2-( {[3 -chloro- l -(2,6-difluorophenyl)methyloxo-l ,2-dihydropyridin yl] oxy } )-5 -fluorobenzylcarbamate; [00 1284] Cycloyronylmethyl 2-( {[3 -chloro- l -(2,6-difluorophenyl)methyloxo- l ,2- dihydropyridinyl]oxy} methyl)fluorobenzylcarbamate; l-[(4-aminomethylpyrimidinyl)methyl]bromo [(2,4-difluorobenzyl)oxy]- 6-methylpyridin-2(1H)-one trifluoroacetate; l-[(4-aminomethylpyrimidinyl)methyl]bromo [(2,4-difluorobenzyl)oxy]- 6-methylpyridin-2(lH)-one hydrochloride; l-[(4-aminomethylpyrimidinyl)methyl] chloro [(2,4-difluorobenzyl)oxy] methylpyridin-2(1H)-one trifluoroacetate; aminomethylpyrimidinyl)methyl] chloro [(2,4-difluorobenzyl)oxy] methylpyridin-2(1H)-one hydrochloride; 3 -Bromo [(2,4-difluorobenzyl)oxy]- l -(lH-indazolylmethyl)methylpyridin- one trifluoroacetate; [00 1290] 3 -bromo[(2,4-difluorobenzyl)oxy] methyl- l - { [2-(methylthio)pyrimidin yl]methyl} n-2(lH)-one; [00 1291] 3 [(2,4-difluorobenzyl)oxy] methyl- l - {[2-(methylsulfonyl)pyrimidin yl]methyl} pyridin-2(lH)-one; [00 1292] 4- {[3 -Bromo [(2,4-difluorobenzyl)oxy] methyloxopyridin-l (2H)- yl]methyl}pyrimidine-Z-carbonitrile trifluoroacetate; 4- {[2-(Aminomethyl)fluorobenzyl]oxy} bromo- l -(2,6-difluorophenyl) methylpyridin-2(1H)-one trifluoroacetate; 2018/054642 [00 1294] 3 -Bromo [(2,4-difluorobenzyl)oxy] -l - [(2-methoxypyrimidinyl)methyl] methylpyridin-2(1H)-one trifluoroacetate; [00 1295] Methyl 4- { [3 -bromo [(2,4-difluorobenzyl)oxy] methyloxopyridin-l (2H)- yl]methyl}pyrimidine-Z-carboxylate trifluoroacetate; [00 1296] 3 -Bromo[(2,4-difluorobenzyl)oxy] - l -[(2-hydroxypyrimidinyl)methyl] methylpyridin-2(1H)-one oroacetate; [00 1297] 4- { [3 -bromo[(2,4-difluorobenzyl)oxy] hyloxopyridin-l (2H)- yl]methyl}pyrimidine-Z-carboxamide trifluoroacetate; Methyl (4- {[3-bromo[(2,4-difluorobenzyl)oxy]methyloxopyridin-l (2H)- yl]methyl } pyrimidinyl)methylcarbamate; 3 -Bromo [(2,4-difluorobenzyl)oxy]methyl- l -[(5-methylpyrazin yl)methyl]pyridin-2(1H)-one; 0] 3 -bromo[(2,4-difluorobenzyl)oxy] methyl-l -(pyrazin-Z-ylmethyl)pyridin-2(1H)- one; [00 1301] 3 -Bromo[(2,4-difluorobenzyl)oxy] - l - {[5 -(hydroxymethyl)pyrazinyl]methyl} methylpyridin-2(1H)-one; [00 1302] 3 -Bromo[(2,4-difluorobenzyl)oxy] - l - {5- [(dimethylamino)methyl]pyrazin-Z- yl}methyl)methylpyridin-2(1H)-one trifluoroacetate; 3] 3 [(2,4-difluorobenzyl)oxy]- l -[(5- {[(2-hydroxyethyl)- (methyl)amino]methyl} pyrazin-Z-yl)methyl]methylpyridin-2( 1 H)-one trifluoroacetate; [00 1304] 3 -Bromo [(2,4-difluorobenzyl)oxy] methyl- l -( { 5- [(4-methylpiperazin- l - yl)carbonyl]pyrazinyl} methyl)pyridin-2(1H)-one trifluoroacetate; [00 1305] 3 -Bromo [(2,4-difluorobenzyl)oxy] methyl- l -( { 5- [(4-methylpiperazin- l - yl)carbonyl]pyrazin-Z-yl} methyl)pyridin-2(lH)-one; [00 1306] 5 - { [3 [(2,4-difluorobenzyl)oxy] methyloxopyridin-l (2H)-yl]methyl} - N—(2-hydroxyethyl)-N-methylpyrazine—2-carboxamide; [00 1307] 5 - { [3 -Bromo [(2,4-difluorobenzyl)oxy] methyloxopyridin-l (2H)-yl]methyl} - N—(2, 3 -dihydroxypropyl)pyrazinecarboxamide; [00 1308] 5 - { [3 -Bromo [(2,4-difluorobenzyl)oxy] methyloxopyridin-l (2H)-yl]methyl} - N-(2-hydroxyethyl)pyrazinecarboxamide; [00 1309] 3 -Bromo[(2,4-difluorobenzy1)oxy]-1 - {[5-(methoxymethy1)pyraziny1]methyl} - 6-methy1pyridin-2(1H)-one; 3 -Bromo[(2,4-difluorobenzyl)oxy]({5-[(2-methoxyethoxy)methy1]pyrazin-Z- yl}methyl)methy1pyridin-2(1H)-one; [00131 1] (5- {[3 -Bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)- y1]methy1}pyrazin-Z-y1)methy1 carbamate; y1bromo[(2,4-difluorobenzyl)oxy]methylpyridin-2(1H)-one; 3] 3 -chloro[(2,4-difluorobenzy1)oxy] (2;6-difluorophenyl)methy1pyridin-2(1H)- one; 3 -bromo(4-fluorobenzy1)[(4-fluorobenzy1)amino]methy1pyridin-2(1H)-one; 3 -bromo-1 -(cyclpyropylmethy1)[(2,4-difluorobenzy1)oxy]methy1pyridin-2(1H)- one; 3 -bromo[(2,4-difluorobenzy1)oxy] methy1-1 -(pyridinylmethy1)pyridin-2(1H)- one; 4-(4-fluorobenzyloxy)-3 -bromomethy1((pyridiny1)methy1)pyridin-2(1H)-one; 8] 4-(2;4,6-trifluorobenzyloxy)bromomethy1((pyridiny1)methy1)pyridin- 2(1H)-one; 4-(2;6-difluorobenzyloxy)-3 -bromomethy1((pyridiny1)methy1)pyridin-2(1H)- one; 3 -bromo[(2,4-difluorobenzy1)oxy] methy1-1 diny1methy1)pyridin-2(1H)- one; 4-(4-fluorobenzyloxy)-3 -bromomethy1((pyridin-3 -y1)methy1)pyridin-2(1H)-one; 4-(2;4,6-trifluorobenzyloxy)bromomethy1(pyridiny1)methy1)pyridin- 2(1H)-one; 4-(2-fluorobenzyloxy)-3 -bromomethy1((pyridin-3 -y1)methy1)pyridin-2(1H)-one; 4-(2;4;5-trifluorobenzyloxy)bromomethy1((pyridin-3 -y1methy1)pyridin- 2(1H)-one; 4-(4-chlorofluorobenzyloxy)bromomethy1((pyridiny1)methy1)pyridin- 2(1H)-one; 4-(2-chlorofluorobenzyloxy)bromomethy1((pyridiny1)methy1)pyridin- 2(1H)-one; 3 -bromo[(2,4-difluorobenzy1)oxy] methy1-1 -(pyridin-Z-ylmethy1)pyridin-2(1H)- one; 4-(2;6-difluorobenzyloxy)bromomethy1((pyridin-3 -y1)methy1)pyridin-2(1H)- one; 9] 4-(4-fluorobenzyloxy)-3 -bromomethy1((pyridiny1)methy1)pyridin-2(1H)-one; 4-(2;4,6-trifluorobenzyloxy)bromomethy1((pyridiny1)methy1)pyridin- 2(1H)-one; 4-(2;4;5-trifluorobenzyloxy)bromomethy1((pyridiny1)methy1)pyridin- 2(1H)-one; 3 -bromo[2-(4-fluorophenyl)ethy1]methy1(pyridin-3 -y1methy1)pyridin-2(1H)- one; 3 -bromo[2-(4-fluorophenyl)ethy1]methy1(pyridiny1methy1)pyridin-2(1H)- one; 3 -chloro[(2,4-difluorobenzy1)oxy]methy1(pyridiny1methy1)pyridin-2(1H)- one; ] 1-[(4-aminomethy1pyrimidiny1methy1] bromomethy1[(2;4;6- robenzy1)oxy]pyridin-2(1H)-one trifluoroacetate; [00 1336] 3 -bromo[(2,4-difluorobenzy1)oxy]methy1 { [2-methy1 (methylamino)pyrimidiny1]methyl} pyridin-2( 1 H)-one trifluoroacetate; ethyl N—(5- {[3 -bromo[(2,4-difluorobenzyl)oxy]methy1oxopyridin-1(2H)- y1]methy1}methy1pyrimidiny1)glycinate trifluoroacetate; N—(5-{[3-chloro[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)- hy1} methy1pyrimidiny1)hydroxyacetamide trifluoroacetate; 3 o[(2,4-difluorobenzy1)oxy]( {5-[(4-hydroxypiperidin-1 - y1)carbony1]pyrazin-Z-yl} methy1)methy1pyridin-2(1H)-one; 5- {[3-chloro[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]methy1}- N—(3 -hydroxy-2;2-dimethylpropyl)pyrazine—2-carboxamide; 5- {[3-chloro[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]methy1}- N-(2;2;2-trifluoroethyl-pyrazine-Z-carboxamide; 1-a11y1bromo[(2,4-difluorobenzy1)oxy]methy1pyridin-2(1H)-one; 1-a11y1chloro[(2,4-difluorobenzyl)oxy]methy1pyridin-2(1H)-one; [00 1344] Methyl (2E) [3 -bromo[(2,4-difluorobenzy1)oxy] methy1oxopyridin-1 (2H)- y1]butenoate; 3 -bromo[(2,4-difluorobenzyl)oxy]methy1prop—2-yny1pyridin-2(1H)-one; 3 -Bromo[(2,4-difluorobenzyl)oxy](hydroxymethy1)(pyridin-3 - ylmethy1)pyridin-2(1H)-one; 3 -bromo[(2,4-difluorobenzyl)oxy][(dimethylamino)methy1(pyridin ylmethy1)pyridin-2(1H)-one; [00 1348] 3 -bromo [(2,4-difluorobenzy1)oxy] (2,6-difluoropheny1) xymethyl)pyridin-2(1H)-one; 3 -chloro[(2,4-difluorobenzy1)oxy](2,6-difluoropheny1) (hydroxymethyl)pyridin-2(1H)-one; 5-bromo[(2,4-difluorobenzyl)oxy](2,6-difluorophenyl)oxo-1,6- dihydropyridine-Z-carbaldehyde; [00 1351] 3 -bromo difluorobenzy1)oxy] (2,6-difluoropheny1) [(dimethylamino)methy1]pyridin-2(1H)-one; 3 -bromo[(2,4-difluorobenzy1)oxy] (2,6-difluoropheny1)(morpholin ylmethy1)pyridin-2(1H)-one; 3 -bromo[(2,4-difluorobenzy1)oxy] (2,6-difluoropheny1) {[(2- methoxyethy1)amino]methyl } pyridin-2( 1H)-one; 5-bromo[(2,4-difluorobenzyl)oxy](2,6-difluorophenyl)oxo-1,6- dihydropyridine-Z-carboxylic acid; ] Methyl 4-[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1] methylbenzoate; 6] 2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1) methylbenzoic acid; 4-(2,4-difluorobenzyloxy)bromo- 1 ydroxymethy1)methy1phenyl) methylpyridin-2(1H)-one; [00 1358] 4-(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin- 1 (2H)-y1)-N-(2- methoxyethyl)methy1benzamide; 4-(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N,3- dimethylbenzamide; [00 1360] 3 -bromo[(2,4-difluorobenzyl)oxy] methyl- l -(2-methylVinylphenyl)pyridin- 2(1H)-one; 3 -bromo[(2,4-difluorobenzyl)oxy]- l -[4-(l ;2-dihydroxyethyl)methylphenyl] methylpyridin-2( l H)-one; methyl 3 -[3-bromo[(2,4-difluorobenzyl)oxy]methyloxopyridin- l l] chlorobenzoate; 3 -[3-bromo[(2,4-difluorobenzyl)oxy]methyloxopyridin-l (2H)-yl] benzoic acid; 3 -bromo[(2,4-difluorobenzyl)oxy]- l - [5-(hydroxymethyl)methylphenyl] methylpyridin-2( l H)-one; 3 -chloro[(2,4-difluorobenzyl)oxy]- l - [5-(hydroxymethyl)methylphenyl] yridin-2(lH)-one; 3 -bromo[(2,4-difluorobenzyl)oxy] - l - {5-[(dimethylamino)methyl] methylphenyl} methylpyridin-2( lH)-one hydrochloride; 3 -bromo[(2,4-difluorobenzyl)oxy]- l - {5-[(ispropylamino)methyl] methylphenyl} methylpyridin-2( lH)-one hydrochloride; 3 -[3-bromo[(2,4-difluorobenzyl)oxy]methyloxopyridin-l (2H)-yl] -N-(2- hydroxyethyl)methylbenzamide; [00 1369] 3 -(4-(2,4-difluorobenzyloxy)-3 methyloxopyridin- 1 (2H)-yl)-N-(2- yethyl)methylbenzamide; [00 1370] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethyloxopyridin- 1 (2H)-yl)-N;4- dimethylbenzamide; 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethyloxopyridin- l (2H)-yl)-N;N;4- trimethylbenzamide; 3 -bromo[(2,4-difluorobenzyl)oxy] - l -[5-(l -hydroxy-l -methylethyl) methylphenyl]methylpyridin-2( lH)-one; methyl 3 -[3-chloro [(2,4-difluorobenzyl)oxy]methyloxopyridin- l (2H)-yl] benzoate; methyl 4-[3-bromo[(2,4-difluorobenzyl)oxy]methyloxopyridin- l (2H)-yl] chlorobenzoate; [00 1375] 3 -bromo[(2,4-difluorobenzy1)amino]methy1(pyridiny1methy1)pyridin- 2(1H)-one; 6] 3 -bromo[(2,4-difluorobenzy1)amino]methy1(pyridiny1methy1)pyridin- 2(1H)-one; [00 1377] 3 -bromo[(2,4-difluorobenzy1)amino](2,6-difluoropheny1)methy1pyridin- 2(1H)-one; 3 -chloro[(2,4-difluorobenzy1)amino](2,6-difluoropheny1)methy1pyridin- 2(1H)-one; 3 - {[3 -chloro[(2,4-difluorobenzy1)amino]methy1oxopyridin-1(2H)- yl]methy1}benzonitrile; [00 1380] 4- {[3 -chloro[(2,4-difluorobenzy1)amino]methy1oxopyridin-1(2H)- yl]methy1}benzonitrile; 1] 3 -bromo[(2,4-difluorobenzyl)oxy]-1 -[2-fluoro(hydroxymethy1)pheny1] methylpyridin-2(1H)-one; 3 -[3-chloro[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1] fluorobenzoic acid; 3 loro[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]fluoro- N—methylbenzamide; 3 -(4-(2,4-difluorobenzyloxy)chloromethy1oxopyridin-1(2H)-y1)fluoro- N,N—dimethylbenzamide; 3 -(4-(2,4-difluorobenzyloxy)chloromethy1oxopyridin-1(2H)-y1)fluoro-N— (2-hydroxyethy1)benzamide; 3 -(4-(2,4-difluorobenzyloxy)chloromethy1oxopyridin-1(2H)-y1)fluoro-N— (2-methoxyethy1)benzamide; 3 -(4-(2,4-difluorobenzyloxy)chloromethy1oxopyridin-1(2H)-y1)fluoro-N— roxyethyl)-N-methy1benzamide; 3 -(4-(2,4-difluorobenzyloxy)chloromethy1oxopyridin-1(2H)-y1)fluoro-N— (3 -hydroxyoropy1)benzamide; 3 -(4-(2,4-difluorobenzyloxy)chloromethy1oxopyridin-1(2H)-y1)fluoro-N— (2,3 -dihydroxypropy1)benzamide; 3 omo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1 (2H)-y1] fluorobenzoic acid; 3 -[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1 (2H)-y1] methoxybenzoic acid; 3 omo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1 (2H)-y1] methoxy-N—methylbenzamide; 3 -[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1 (2H)-y1] methoxy-N,N—dimethylbenzamide; 1-[(5-aminomethy1)fluorophenyl]-3 -chloro[(2,4-difluorobenzyl)oxy] methylpyridin-2(1H)-one hydrochloride; 3 -[3-chloro[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]fluoro- N—[2-hydroxy(hydroxymethy1)ethy1]benzamide; N—(3-(4-(2,4-difluorobenzyloxy)chloromethy1oxopyridin-1(2H)-y1) fluorobenzyl)acetamide; N—(3-(4-(2,4-difluorobenzyloxy)chloromethy1oxopyridin-1(2H)-y1) enzyl)methoxyacetamide; N—(3-(4-(2,4-difluorobenzyloxy)chloromethy1oxopyridin-1(2H)-y1) fluorobenzyl)-methylsulfonamine; [00 1399] 1-(3 -(4-(2;4-difluorobenzyloxy)-3 -chloromethy1oxopyridin-1(2H)-y1) fluorobenzy1)urea; [00 1400] 2-( {[3 -chloro(2;6-difluoropheny1)methy1oxo-1,2-dihydropyridin y1]oxy}methy1)fluorobenzonitrile; 4- {[2-(aminomethy1)fluorobenzy1]oxy} -3 -chloro(2;6-difluoropheny1) methylpyridin-2(1H)-one trifluoroacetate; [00 1402] methyl 2-((3 o(2;6-difluoropheny1)-1;2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzy1carbamate; N—(2-((3-chloro(2;6-difluoropheny1)-1;2-dihydromethy1oxopyridin methy1)fluorobenzyl)-2;2,2-trifluoroacetamide; isopropyl 2-((3-chloro(2;6-difluoropheny1)-1,2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzy1carbamate; 1-(2-((3-chloro(2,6-difluoropheny1)-1,2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzyl)-3 urea; tetrahydrofuranyl 2-((3 -chloro(2,6-difluorophenyl)-1,2-dihydromethy1 oxopyridinyloxy)methy1)fluorobenzy1carbamate; 7] propyl 2-((3 -chloro(2,6-difluoropheny1)-1,2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzy1carbamate; allyl 2-((3-chloro(2,6-difluoropheny1)-1,2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzy1carbamate; -ynyl 2-((3-chloro(2,6-difluorophenyl)-1,2-dihydromethy1oxopyridin- 4-yloxy)methy1)fluorobenzy1carbamate; or pharmaceutically able salts thereof. [00141 1] 40. A compound of claim 1 which is t-butyl 2-((3-chloro(2,6-difluoropheny1)-1,2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzy1carbamate; 1-(2-((3-chloro(2,6-difluoropheny1)-1,2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzy1)-3 -tert—buty1urea; N—(2-((3-chloro(2,6-difluoroyheny1)-1,2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzy1)(propy1sulfony1)acetamide; N—(2-((3-chloro(2,6-difluoropheny1)-1,2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzy1)(ethylsulfony1)acetamide; 1-(2-((3-chloro(2,6-difluoropheny1)-1,2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzy1)isopropy1urea 1-(2-((3-chloro(2,6-difluoropheny1)-1,2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzy1)-3 1urea; 3 -(2-((3-chloro(2,6-difluoropheny1)-1,2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzy1)tert—buty1methy1urea; 1-(2-((3-chloro(2,6-difluoropheny1)-1,2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzy1)-3 -cyc1pyropy1urea; 1-(2-((3-chloro(2,6-difluoropheny1)-1,2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzy1)-3 -(2,2,2-trifluoroethy1)urea; 1-(2-((3-chloro(2,6-difluoropheny1)-1,2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzy1)(cyc1opropylmethy1)urea; (3-chloro(2,6-difluoropheny1)-1,2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzy1)-3 -neopenty1urea; 3 -(2-((3-chloro(2,6-difluoropheny1)-1,2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzyl)-1 , 1 -dimethy1urea; [00 1424] 3 -bromo[(2,4-difluorobenzy1)oxy]{[5-(1-hydroxymethylethy1)pyridin y1]methy1} methy1pyridin-2(1H)-one; [00 1425] 3 -bromo[(2,4-difluorobenzy1)oxy]{[5-(hydroxymethy1)pyridiny1]methyl} methylpyridin-2(1H)-one; [00 1426] 6- {[3 -bromo[(2,4-difluorobenzy1)oxy] methy1oxopyridin-1 (2H)-y1]methy1} - N-(2-hydroxyethy1)-N—methy1nicotinamide; [00 1427] 6- {[3 -bromo[(2,4-difluorobenzy1)oxy] methy1oxopyridin-1 (2H)-y1]methy1} - N-(2-hydroxyethy1)nicotinamide; [00 1428] 6- {[3 [(2,4-difluorobenzy1)oxy] methy1oxopyridin-1 (2H)-y1]methy1} - N,N—dimethylnicotinamide; [00 1429] 3 [(2,4-difluorobenzy1)oxy] methy1[2-(trifluoromethy1)pheny1]pyridin- 2(1H)-one; 3 -bromo[(2,4-difluorobenzy1)oxy] (2,6-difluorophenyl)methy1 Vinylpyridin-2(1H)-one; 3 -bromo[(2,4-difluorobenzy1)oxy](2,6-difluoropheny1)(1,2-dihydroxyethy1)- 6-methy1pyridin-2(1H)-one; 3 [(2,4-difluorobenzy1)oxy] - 1 difluoropheny1)(hydroxymethy1) methylpyridin-2(1H)-one; 4-(benzyloxy)bromo(2,6-difluorophenyl)methy1pyridin-2(1H)-one; 5-bromo[(2,4-difluorobenzy1)oxy](2,6-difluorophenyl)methy1oxo-1,6- dihydropyridiny1]methy1 carbamate; 5-bromo[(2,4-difluorobenzy1)oxy](2,6-difluorophenyl)methy1oxo-1,6- dihydropyridinecarba1dehyde; 5-bromo[(2,4-difluorobenzy1)oxy](2,6-difluoropbenyl)methy1oxo-1,6- dihydropyridinecarba1dehyde oxime; 2018/054642 o[(2,4-difluorobenzy1)oxy](2,6-difluorophenyl)methy1oxo-1,6- dihydropyridine-3 -carbonitri1e; 4-(benzyloxy)bromo(2,6-difluoropheny1)iodomethy1pyridin-2(1H)-one; 3 -bromo[(2,4-difluorobenzyloxy](2,6-difluoropheny1)methy10Xiran ylpyridin-2(1H)-one; 4-(benzylamino)bromo(2,6-difluoropheny1)iodomethylpyridin-2(1H)-one; 3 -bromo[(2,4-difluorobenzy1)oxy] (2,6-difluoropheny1)methy1[(E) phenyletheny1]pyridin-2(1H)-one; ethyl 3-bromo[(2,4-difluorobenzy1)oxy]methy10X0-2H-1,2’-bipyridine—5’- carboxylate; 3 -bromo[(2,4-difluorobenzyl)oxy]-5’-(1-hydroxymethy1ethy1)methy1-2H-1 ,2- bipyridin-Z-one; 3 -bromo[(2,4-difluorobenzy1)oxy](2-fury1methyl)methy1pyridin-2(1H)-one; 3 [(2,4-difluorobenzyl)oxy]methy1(thien-Z-y1methy)pyridin-2(1H)- one; 3 -bromo-1 -(2,6-difluoropheny1)(2-fury1methoxy)methy1pyridin-2(1H)-one; 3 -bromo[2-fluoro(3-fury1methoxy)pheny1](3-fury1methoxy) methylpyridin-2(1H)-one; 3 -bromo[2-fluoro(thieny1methoxy)pheny1]methy1(thien ylmethoxy)pyridin-2(1H)-one; methyl 2-[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1] ylamino)carbony1]benzoate; 3 -[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1 (2H)-y1] (1 - hydroxy-l -methy1ethyl)-N-methy1benzamide; 4-[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1] chlorobenzamide; 3 loro[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1] methylbenzamide; 3 -[3-chloro[(2,4-difluorobenzyloxy]methy1oxopyridin-1(2H)-y1]-N,4- dimethylbenzamide; 2018/054642 N-{3-[3-chloro[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1] fluorobenzy1}propanamide; N-{3-[3-chloro[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1] fluorobenzyl} dimethylurea; N-{3-[3-chloro[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1] fluorobenzyl} hydroxyacetamide; N-{3-[3-chloro[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1] fluorobenzyl} hydroxy-Z-methylpropanamide; [00 1458] N— {3 - [3 -chloro [(2,4-difluorobenzy)oxy] methy1oxopyridin- 1 (2H)-y1] fluorobenzy1}glycinamide hydrochloride; 9] 3 -[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1 (2H)-y1] fluorobenzamide; 3 -[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]fluoro- N—methylbenzamide; 3 -[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]fluoro- N,N—dimethy1benzamide; [00 1462] 3 -bromo[(2,4-difluorobenzy1)oxy] {2-fluoro-5 -[(4-methy1piperazin y1)carbony1]pheny1}methy1pyridin-2(1H)-one; [00 1463] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)fluoro-N— (2-hydroxyethyl)-N-methy1benzamide; [00 1464] 3 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)fluoro-N— (2-hydroxymethy1propy1)benzamide; methyl romo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1] fluorobenzoate; [00 1466] 4- {[3 -chloro[(2,4-difluorobenzy1)oxy]methy10X0pyridin-1(2H)- y1]methy1}benzoic acid; [00 1467] 4- {[3 -chloro[(2,4-difluorobenzy1)oxy]methy10X0pyridin-1(2H)- hy1}benzamide; [00 1468] 4- {[3 -chloro[(2,4-difluorobenzy1)oxy]methy10X0pyridin- 1 (2H)-y1]methy1} - N,N—dimethy1benzamide; [00 1469] 4- {[3 o[(2,4-difluorobenzy1)oxy]methy10X0pyridin- 1 (2H)-y1]methy1} - N—(2-hydroxymethylpropy1)benzamide; N— {4- [3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin- 1 (2H)- y1]benzy1} hydroxyacetamide; 3 -[3-chloro[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]benzamide; 1-(4-aminobenzy1)bromo[(2,4-difluorobenzy1)oxy]methylpyridin-2(1H)-one; 1-(3-aminobenzy1)bromo[(2,4-difluorobenzy1)oxy]methylpyridin-2(1H)-one; N—(4-{[3-bromo[(2,4-difluorobenzy1)oxy]methy10X0pyridin-1(2H)- y1]methy1} pheny1)acetamide; ] N—(4-((4-(2,4-difluorobenzyloxy)bromomethyloxopyridin-1(2H)- y1)methy1)pheny1)hydroxyacetamide; N—(4-((4-(2,4-difluorobenzyloxy)bromomethyloxopyridin-1(2H)- y1)methy1)phenyl)-(dimethylaminosulfonylcarbony1)amine; N—(3-{[3-bromo[(2,4-difluorobenzy1)oxy]methy10X0pyridin-1(2H)- y1]methy1} pheny1)acetamide; N—(3-((4-(2,4-difluorobenzyloxy)bromomethyloxopyridin-1(2H)- hy1)phenyl)-(dimethylaminosulfonylcarbony1)amine; N—(3-((4-(2,4-difluorobenzyloxy)bromomethyloxopyridin-1(2H)- y1)methy1)pheny1)hydroxyacetamide; N—(4-{[3-bromo[(2,4-difluorobenzy1)oxy]methy10X0pyridin-1(2H)- y1]methy1}benzy1)-N’-methylurea; N—(4-{[3-bromo[(2,4-difluorobenzy1)oxy]methy10X0pyridin-1(2H)- y1]methy1}benzy1)-N’-(2-hydroxy-Z-methy1propy1)urea; N—(4-{[3-bromo[(2,4-difluorobenzy1)oxy]methy10X0pyridin-1(2H)- y1]methy1}benzy1)piperidinecarboxamide; N—(4-{[3-bromo[(2,4-difluorobenzy1)oxy]methy10X0pyridin-1(2H)- y1]methy1}benzy1)morpholinecarboxamide; N—(4-{[3-bromo[(2,4-difluorobenzy1)oxy]methy10X0pyridin-1(2H)- hy1}benzy1)piperazine-1 -carboxamide hydrochloride; N—(4-{[3-bromo[(2,4-difluorobenzy1)oxy]methy10X0pyridin-1(2H)- y1]methy1}benzy1)-N’-(2-hydroxyethy1)urea; N’-(4- {[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)- y1]methy1} benzy1)-N,N-dimethylurea; N—(4-{[3-bromo[(2,4-difluorobenzy1)oxy]methy10X0pyridin-1(2H)- y1]methy1}benzy1)hydroxypiperidinecarboxamide; [00 1488] 4- { [3 [(2,4-difluorobenzy1)oxy] methy1oxopyridin-1 (2H)-y1]methy1} - N,N—dimethylbenzenesulfonamide; [00 1489] 4- { [3 -bromo[(2,4-difluorobenzy1)oxy] methy1oxopyridin-1 (2H)-y1]methy1} - N-(2-hydroxyethy1)benzenesulfonamide; [00 1490] 4- { [3 -bromo[(2,4-difluorobenzy1)oxy] methy1oxopyridin-1 (2H)-y1]methy1} - N-(2-hydroxymethyloropy1)benzenesulfonamide; 3 -Chloro(2,4-difluorobenzyloxy)methy1(1H-pyrazol-3 -y1methy1)-1H- pyridin-Z-one; 3 -Chloro(2,4-difluorobenzyloxy)methy1(2,3-dihydro-1H-indoly1methy1)- lH-pyridin-Z-one; 5-[3-Chloro(2,4-difluorobenzyloxy)methy1oxo-2H-pyridiny1methy1]-1,3- dihydro-indol-Z-one; N—[(5- {[3 -Bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)- y1]methy1} pyrazin-Z-y1)methy1]-N-methylmethanesulfonamide; Methyl (5-{[3-Bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)- hy1} pyrazin-Z-y1)methy1(methy1)carbamate; N—[(5- {[3 -Bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)- y1]methy1}pyrazin-Z-yl)methy1] roxy-N,2-dimethylpropanamide; 5-{[3-Bromo[(2,4-difluorobenzyhoxy]methy1oxopyridin-1(2H)-y1]methy1}- ydroxymethylpropy1)pyrazinecarboxamide; 1-[(5-Aminopyraziny1)methy1]bromo[(2,4-difluorobenzy1)oxy] methylpyridin-2(1H)-one trifluoroacetate; 3 -Bromo[(2,4-difluorobenzy1)oxy]methy1[(3-methy1-1,2,4-triazin hy1]pyridin-2(1H)-one trifluoroacetate; 3 -Bromo[(2,4-difluorobenzy1)oxy](1H-indazol-S-y1)methylpyridin-2(1H)- one; 1] 3 -bromo[(2,4-difluorobenzyl)oxy]- l -(lH-indazolyl)methylpyridin-2(1H)- one; [00 1502] methyl 2- {[(3 -bromomethyl- l - {2-methyl-5 - [(methylamino)carbonyl] phenyl} 0X0- 1 ydropyridinyl)oxy]methyl} fluorobenzylcarbamate; 3] methyl 2-( { [3-bromo- l -(5- { [(2-hydroxyethyl)amino]carbonyl} methylphenyl) methyloxo-1,2-dihydropyridinyl]oxy}methyl)fluorobenzylcarbamate; [00 1504] methyl 2-( { [3 -bromo- l -(5- { [(2-hydroxymethylpropyl)amino] carbonyl} methylphenyl)methyloxo-1 ydropyridinyl]oxy } methyl)fluorobenzylcarbamate; methyl 2-( { [3-bromo- l -(5- { [(2-methoxyethyl)amino]carbonyl} methylphenyl) methyloxo-1,2-dihydropyridinyl]oxy}methyl)fluorobenzylcarbamate; [00 1506] methyl 2- [( { l - [ 5-(aminocarbonyl)methylphenyl] -3 -bromomethyloxo- l ,2- dihydropyridinyl} oxy)methyl] fluorobenzylcarbamate; N—[2-( {[3-chloro- l -(2;6-difluorophenyl)methyloxo-l ,2-dihydropyridin yl]oxy}methyl)fluorobenzyl]-N’-phenylurea; [00 1508] thien-3 -ylmethyl 2-( {[3 -chloro-l -(2; 6-difluorophenyl)methyl0X0-1,2- dihydropyridinyl]oxy} methyl)fluorobenzylcarbamate; ethyl 2- { [(3-bromomethyl- l - {2-methyl[(methylamino)carbonyl]phenyl} 0X0- 1,2-dihydropyridinyl)oxy]methyl} fluorobenzylcarbamate; 3 -[3-bromo { [2-( { [(cyclopropylamino)carbonyl]amino} methyl) fluorobenzyl]oxy} hyloxopyridin- l (2H)-yl]-N;4-dimethylbenzamide; [00151 1] 3 -[3-bromo { [2-( { [(cyclopropylamino)carbonyl]amino} methyl) fluorobenzyl]oxy} methyloxopyridin- l (2H)-yl]methylbenzoic acid; methyl 3 -[6-[(acetyloxy)methyl]bromo[(2,4-difluorobenzyl)oxy]oxopyridin- 1(2H)-yl] methylbenzoate; 3 -[3-bromo[(2,4-difluorobenzyl)oxy](hydroxymethyl)0X0pyridin-l (2H)-yl]- 4-methylbenzoic acid; 3 -[3-bromo[(2,4-difluorobenzyl)oxy](hydroxymethyl)0X0pyridin-l (2H)-yl]- 4-methylbenzoic acid; ] 3 -[3-bromo[(2,4-difluorobenzyl)oxy](hydroxymethyl)0X0pyridin-l l]- N-(2-hydroxyethyl)methylbenzamide; 3 omo[(2,4-difluorobenzyl)oxy](hydroxymethy1)oxopyridin-1(2H)-y1]- N,4-dimethy1benzamide; 3 -[3-bromo[(2,4-difluorobenzyl)oxy](hydroxymethy1)oxopyridin-1(2H)-y1]- 4-methy1benzamide; (5-bromo[(2,4-difluorobenzy1)oxy]{2-methy1 [(methylamino)carbony1]phenyl} 0X0-1 ,6-dihydropyridin-Z-y1)methy1 acetate; -[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]-N— methylbutenamide; methyl 5- {[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)- y1]methy1} furoate; 3 -[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1 1] (hydroxymethy1)-N—methy1benzamide; 2-[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1 (2H)-y1]-N,N’- dimethylterephthalamide; 2-[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1]-N—(4- methylterephthalamide; methyl 4-(aminocarbonyl)[3-bromo[(2,4-difluorobenzyl)oxy]methy1 oxopyridin- 1 (2H)-y1]benzoate; 2-[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1 (2H)-y1]- N1 ,N1 ,N4-trimethylterephthalamide; romo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1(2H)-y1] [(methylamino)carbony1]benzyl carbamate; [00 1527] 3 -bromo [(2,4-difluorobenzy1)oxy] (2,6-difluoroViny1pheny1) methylpyridin-2(1H)-one; 3 -bromo[(2,4-difluorobenzy1)oxy][4-(1,2-dihydroxyethy1)-2,6-difluoropheny1]- 6-methy1pyridin-2(1H)-one; 9] 4-[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1 (2H)-y1] -3,5- difluorobenzaldehyde; 4-[3-bromo[(2,4-difluorobenzy1)oxy]methy1oxopyridin-1 (2H)-y1] -3,5- difluorobenzyl carbamate; 4-(2,4-difluorobenzyloxy)chloromethy1((5-methylpyrazin y1)methyl)pyridin-2(1H)-one; [00 1532] 4-(2,4-difluorobenzyloxy)-3 -chloro-1 -((5-(hydroxymethy1)pyraziny1)methy1) methylpyridin-2(1H)-one; 4-(2,4-difluorobenzyloxy)bromo((1-(2-hydroxyacetyl)indoliny1)methy1) methylpyridin-2(1H)-one; 1-((1H-pyrazoly1)methyl)(2,4-difluorobenzyloxy)bromomethylpyridin- 2(1H)-one; 3 -(4-(2,4-difluorobenzyloxy)chloromethy1oxopyridin-1(2H)-y1]-N,4- dimethylbenzamide; 6] 3 -(4-(2,4-difluorobenzyloxy)chloromethy10X0pyridin-1(2H)-y1) methylbenzamide; 3 -(4-(2,4-difluorobenzyloxy)chloromethy1oxopyridin-1(2H)-y1)fluoro-N— methylbenzamide; 3 -(4-(2,4-difluorobenzyloxy)chloromethy1oxopyridin-1(2H)-y1)chloro-N- methylbenzamide; 3 -(4-(2,4-difluorobenzyloxy)chloromethy10X0pyridin-1(2H)-y1) fluorobenzamide; 0] 4-(4-(2,4-difluorobenzyloxy)chloromethy1oxopyridin-1(2H)-y1)-N,3 - dimethylbenzamide; 4-(2,4-difluorobenzyloxy)chloro(4-(1,2-dihydroxyethyl)methy1phenyl) methylpyridin-2(1H)-one; [00 1542] N—(4-((4-(2,4-difluorobenzyloxy)chloromethy1oxopyridin-1(2H)- hy1)pheny1)hydroxyacetamide; [00 1543] (4-(2,4-difluorobenzyloxy)chloromethy1oxopyridin-1(2H)- y1)methy1)benzy1)-1 -hydroxycyclopropanecarboxamide; [00 1544] N—(4-((4-(2,4-difluorobenzyloxy)chloromethy1oxopyridin-1(2H)- y1)methy1)benzy1)hydroxyacetamide; [00 1545] N—(4-((4-(2,4-difluorobenzyloxy)chloromethy1oxopyridin- 1 (2H))- ylmethyl)pheny1)acetamide; [00 1546] ethyl 2-((3 -bromo(2,6-difluoropheny1-1,2-dihydromethy1oxopyridin yloxy)methy1)fluorobenzy1carbamate; [00 1547] 3 -(4-(2,4-difluorobenzyloxy)bromo(2-hydroxyethy1)0Xopyridin-1(2H)-y1)- N,4-dimethy1benzamide; -difluorobenzyloxy)bromo-1 -(5-(2-hydroxyethy1)methy1pheny1) methylpyridin-2(1H)-one; [00 1549] 5 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin- 1 (2H)-y1)(2- hydroxyethy1)-N,4-dimethylbenzamide; 4-(2,4-difluorobenzyloxy)bromomethy1(4-methy1 (methylsulfonyl)pyrimidiny1)-pyridin-2(1H)-one; [00 1551] 5 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1) methylpyrimidine-Z-carbonitrile; 4-(2,4-difluorobenzyloxy)(2-(aminomethyl)methy1pyrimidiny1)bromo methylpyridin-2(1H)-one; [00 1553] 4-(2,4-difluorobenzyloxy)bromo(2-((dimethylamino)methy1) methylpyrimidin-S-y1)methy1pyridin-2(1H)-one; N—((5-(4-(2,4-difluorobenzyloxy)bromomethy1oxopyridin-1(2H)-y1) pyrimidiny1)methy1)hydroxyacetamide; [00 1555] 5 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1) methylpyrimidine-Z-carboxylic acid; [00 1556] 5 ,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1) pyrimidine-Z-carboxamide; [00 1557] 5 -(4-(2,4-difluorobenzyloxy)-3 -bromomethy1oxopyridin-1(2H)-y1)-N,4- dimethylpyrimidine-Z-carboxamide; [00 1558] N—(4- {[3 -chloro[(2,4-difluorobenzy1)oxy] methy1oxopyridin-1 (2H)- y1]methy1} benzy1)hydroxyacetamide; [00 1559] N—(4- {[3 -chloro[(2,4-difluorobenzy1)oxy] methy1oxopyridin-1 (2H)- y1]methy1}benzy1)hydroxycyclopropanecarboxamide; [00 1560] 4- {[3 -bromo[(2,4-difluorobenzy1)oxy] methy1oxopyridin-1 (2H)- y1]methy1}benzy1 carbamate; [00 1561] 2- [4- {[3 -bromo[(2,4-difluorobenzyl)oxy] hyloxopyridin- 1 (2H)- yl]methyl } phenyl)amino] -l -methyloxoethyl acetate; [00 1562] 2- [4- {[3 -bromo[(2,4-difluorobenzyl)oxy] methyloxopyridin- 1 (2H)- yl]methyl}phenyl)amino]-1,l-dimethyl-Z-oxoethyl acetate; [00 1563] {l- [3 -(aminocarbonyl)phenyl] - 5-chloro[(2,4-difluorobenzyl)oxy]oxo-1,6- dihydropyridin-Z-yl}methyl acetate; [00 1564] or pharmaceutically acceptable salts thereof. 43. A compound of claim 1 which is [00 1566] 3 -bromo[(2,4-difluorobenzyl)oxy] methyl- l - { [2-(methylthio)pyrimidin-5 - yl]methyl} pyridin-2(1H)-one; 3 -bromo[(2,4-difluorobenzyl)oxy] hyl-l - {[2-(methylsulfonyl)pyrimidin yl]methyl} pyridin-2(1H)-one; [00 1568] Ethyl 2-( {[3 -bromo- l -(5 - ydroxyethyl)amino] carbonyl} methylphenyl) methyloxo-l ,2-dihydropyridinyl]oxy} methyl)fluorobenzylcarbamate; 3 -bromo[(2,4-difluorobenzyl)oxy] - l -[5-(lH-imidazol-Z-yl)methylphenyl] methylpyridin-2(1H)-one trifluoroacetate; 3 -bromo[(2,4-difluorobenzyl)oxy]-l -[5-(5-hydroxy- lH-pyrazolyl) methylphenyl]methylpyridin-2( lH)-one; 3 -bromo[(2,4-difluorobenzyl)oxy]- l -[5-(5-hydroxylsoxazol-3 - methylphenyl]methylpyridin-2( lH)-one; 5- {[3-bromo[(2,4-difluorobenzyl)oxy] methyloxopyridin-l l]methyl} - 2-furamide; 5-[3-bromo[(2,4-difluorobenzyl)oxy]methyloxopyridin-l l] furamide; 4] l-[3; 5-bis(hydroxymethyl)phenyl]bromo[(2,4-difluorobenzyloxy] methylpyridin-2(1H)-one; 5-[3-bromo[(2,4-difluorobenzyl)oxy]methyloxopyridin-l (2H)- yl]isophthalamide; l-[3; 5-bis(l -hydroxy- l -methylethyl)phenyl]-3 -bromo[(2,4-difluorobenzyl)oxy] methylpyridin-2(1H)-one; WO 71147 [00 1577] 3 -bromo[(2,4-difluorobenzyl)oxy] - l - [4-(hydroxymethyl)phenyl] methylpyridin- one; [00 1578] 3 -bromo[(2,4-difluorobenzyl)oxy] - l - [4-(l -hydroxy-l -methylethyl)phenyl] methylpyridin-2( l H)-one; [00 1579] l-(5-aminofluorophenyl)-3 -bromo[(2,4-difluorobenzyl)oxy]methylpyridin- 2(1H)-one hydrochloride; N— {3- [3-bromo[(2,4-difluorobenzyl)oxy]methyloxopyridin- l (2H)-yl] phenyl} hydroxyacetamide; N— {3- [3-bromo[(2,4-difluorobenzyl)oxy]methyloxopyridin- l (2H)-yl] fluorophenyl} hydroxymethylpropanamide; 4-[3-bromo[(2,4-difluorobenzyl)oxy]methyloxopyridin-l (2H)-yl] fluoro- N,N—dimethylbenzamide; 3 o[(2,4-difluorobenzyl)oxy] - l -[( l -glycoloyl-2,3 -dihydro- lH-indol hyl] methylpyridin-2(lH)-one; [00 1584] 3 -chloro [(2,4-difluorobenzyl)oxy] - l - {[l-(2-hydroxymethylpropanoyl)-2,3 - dihydro-lH-indol-S-yl]methyl} methylpyridin-2(lH)-one; 3 -chloro[(2,4-difluorobenzyl)oxy]- l - {[l-(methoxyacetyl)-2,3-dihydro- ol yl]methyl} methylpyridin-2(lH)-one; [00 1586] 5 - {[3 -chloro [(2,4-difluorobenzyl)oxy] hyloxopyridin- l (2H)-yl]methyl} - N,N—dimethylindoline- l xamide; and 3 -(3-bromo((2,4-difluorobenzyl)oxy)methyloxopyridin-l (2H)-yl)-N,4- dimethylbenzamide (“PH-797804”), Formula X’.
In one embodiment, the p3 8 kinase inhibitor is 3-(3 -bromo((2,4- difluorobenzyl)oxy)methyloxopyridin- l (2H)-yl)-N,4-dimethylbenzamide (“PH-797804”), Formula X’.
Genus XDefinitions As used herein, the term “alkenyl” refers to a straight or branched hydrocarbon of a designed number of carbon atoms containing at least one carbon-carbon double bond. Examples of “alkenyl” include Vinyl, allyl, and 2-methylheptene.
The term “alkoxy” represents an alkyl attached to the parent molecular moiety through an oxygen bridge. Examples of alkoxy groups e, for example, methoxy, ethoxy, propoxy and isopropoxy.
The term “thioalkoxy” represents an alkyl attached to the parent lar moiety through a sulfur atom. Examples of thioalkoxy groups include, for e, thiomethoxy, thioethoxy, thiopropoxy and opropoxy.
As used herein, the term “alkyl” includes those alkyl groups of a designed number of carbon atoms. Alkyl groups may be straight or ed. es of “alkyl” include methyl, ethyl, propyl, isopropyl, butyl, iso-, sec- and tert-butyl, pentyl, hexyl, heptyl, 3-ethylbutyl, and the like. “Cx-Cy alkyl” represents an alkyl group of the specified number of s. For example, C1-C4 alkyl includes all alkyl groups that include at least one and no more than four carbon atoms. It also contains subgroups, such as, for e, C2-C3 alkyl or Cl-C3 alkyl.
The term “aryl” refers to an aromatic hydrocarbon ring system containing at least one aromatic ring. The aromatic ring may optionally be fused or otherwise attached to other aromatic hydrocarbon rings or non-aromatic hydrocarbon rings. Examples of aryl groups include, for example, phenyl, naphthyl, l,2,3,4-tetrahydronaphthalene, indanyl, and biphenyl. Preferred es of aryl groups include phenyl and naphthyl. The most preferred aryl group is phenyl.
The aryl groups herein are unsubstituted or, as specified, tuted in one or more substitutable positions with various groups. Thus, such aryl groups can be optionally substituted with groups such as, for example, Cl-C6 alkyl, Cl-C6 , halogen, hydroxy, cyano, nitro, amino, mono- or di-(Cl-C6)alkylamino, C2-C6 l, C2-C6 alkynyl, Cl-C6 haloalkyl, Cl-C6 haloalkoxy, amino(Cl-C6)alkyl, mono- or di(Cl-C6)alkylamino(Cl-C6)alkyl.
The term lkyl” refers to an aryl group, as defined above, attached to the parent molecular moiety h an alkyl group, as defined above. Preferred arylalkyl groups include, benzyl, phenethyl, phenpropyl, and phenbutyl. More preferred arylalkyl groups include benzyl and phenethyl. The most preferred arylalkyl group is benzyl. The aryl portions of these groups are unsubstituted or, as specified, substituted in one or more substitutable positions with various groups. Thus, such aryl groups can be optionally substituted with groups such as, for example, Cl-C6alkyl, Cl-C6 alkoxy, halogen, hydroxy, cyano, nitro, amino, mono- or di-(Cl- C6)alkylamino, C2-C6 alkenyl, C2-C6 alkynyl, Cl-C6 haloalkyl, Cl-C6 haloalkoxy, amino(Cl- C6)alkyl, mono- or di(Cl-C6)alkylamino(Cl-C6)alkyl.
The term “arylalkoxyl” refers to an aryl group, as defined above, attached to the parent molecular moiety through an alkoxy group, as defined above. Preferred arylaloxy groups include, benzyloxy, phenethyloxy, phenpropyloxy, and phenbutyloxy. The most preferred arylalkoxy group is benzyloxy.
The term “cycloalkyl” refers to a C3-C8 cyclic arbon. Examples of cycloalkyl include cyclopropyl, utyl, cyclopentyl, cyclohexyl, eptyl and cyclooctyl. More preferred cycloalkyl groups include cyclopropyl.
The term alkylalkyl,” as used herein, refers to a C3-C8 cycloalkyl group attached to the parent molecular moiety through an alkyl group, as defined above. Examples of cycloalkylalkyl groups include cyclopropylmethyl and cyclopentylethyl.
The terms “halogen” or “halo” indicate fluorine, ne, bromine, or iodine.
The term “heterocycloalkyl,” refers to a non-aromatic ring system containing at least one heteroatom selected from nitrogen, oxygen, and sulfur, wherein the non-aromatic heterocycle is attached to the core. The cycloalkyl ring may be optionally fused to or ise attached to other heterocycloalkyl rings, aromatic heterocycles, aromatic hydrocarbons and/or non-aromatic hydrocarbon rings. Preferred heterocycloalkyl groups have from 3 to 7 members. Examples of cycloalkyl groups include, for example, zine, 1,2,3,4- tetrahydroisoquinoline, morpholine, piperidine, tetrahydrofuran, pyrrolidine, and pyrazole.
Preferred heterocycloalkyl groups include piperidinyl, piperazinyl, morpholinyl, and pyrolidinyl.
The heterocycloalkyl groups herein are unsubstituted or, as specified, tuted in one or more substitutable positions with various . Thus, such heterocycloalkyl groups can be optionally substituted with groups such as, for example, C1-C6 alkyl, Cl-C6 alkoxy, halogen, hydroxy, cyano, nitro, amino, mono- or di-(Cl-C6)alkylamino, C2-C6 alkenyl, C2-C6 alkynyl, C1- C6haloalkyl, Cl-C6 haloalkoxy, amino(Cl-C6)alkyl, mono- or di(Cl-C6)alkylamino(Cl- C6)alkyl.
The term “heteroaryl” refers to an aromatic ring system containing at least one heteroatom selected from nitrogen, oxygen, and sulfur. The heteroaryl ring may be fused or otherwise attached to one or more aryl rings, aromatic or omatic hydrocarbon rings or heterocycloalkyl rings. es of heteroaryl groups include, for example, pyridine, furan, thiophene, 5,6,7,8-tetrahydroisoquinoline and pyrimidine. Preferred examples of aryl groups include thienyl, hienyl, pyridyl, quinolyl, pyrazinyl, pyrimidyl, imidazolyl, idazolyl, furanyl, benzofuranyl, thiazolyl, benzothiazolyl, isoxazolyl, oxadiazolyl, isothiazolyl, benzisothiazolyl, triazolyl, tetrazolyl, pyrrolyl, indolyl, pyrazolyl, and benzopyrazolyl. Preferred heteroaryl groups include pyridyl. The heteroaryl groups herein are unsubstituted or, as specified, substituted in one or more substitutable positions with various groups. Thus, such heteroaryl groups can be optionally substituted with groups such as, for example, C1-C6 alkyl, Cl-C6alkoxy, halogen, hydroxy, cyano, nitro, amino, mono- or di-(Cl- C6)alkylamino, C2-C6alkenyl, C2-C6 alkynyl, Cl-C6 haloalkyl, Cl-C6 haloalkoxy, amino(Cl- yl, mono- or di(Cl-C6)alkylamino(Cl-C6)alkyl.
The term “heteroarylalkyl” refers to a heteroaryl group, as defined above, attached to the parent molecular moiety h an alkyl group, as defined above. Preferred heteroarylalkyl groups include, pyrazolemethyl, pyrazoleethyl, lmethyl, pyridylethyl, thiazolemethyl, thiazoleethyl, imidazolemethyl, imidazoleethyl, thienylmethyl, thienylethyl, furanylmethyl, furanylethyl, isoxazolemethyl, isoxazoleethyl, nemethyl and neethyl. More preferred heteroarylalkyl groups include pyridylmethyl and pyridylethyl. The heteroaryl portions of these groups are tituted or, as specified, tuted in one or more substitutable positions with various groups. Thus, such heteroaryl groups can be ally substituted with groups such as, for example, Cl-C6 alkyl, Cl-C6 alkoxy, halogen, hydroxy, cyano, nitro, amino, mono- or di- (Cl-C6)alkylamino, C2-C6 l, C2-C6alkynyl, Cl-C6 haloalkyl, Cl-C6 haloalkoxy, amino(Cl-C6)alkyl, mono- or di(Cl-C6)alkylamino(Cl-C6)alkyl.
If two or more of the same substituents are on a common atom, e.g., di(Cl- C6)alkylamino, it is understood that the nature of each group is independent of the other.
As used herein, the term “p38 mediated disorder” refers to any and all disorders and disease states in which p38 plays a role, either by control of p38 itself, or by p38 causing another factor to be released, such as but not limited to IL-1 IL-6 or IL-8. A disease state in which, for instance, IL-1 is a major component, and whose production or action, is exacerbated or secreted in response to p3 8, would therefore be considered a disorder mediated by p3 8.
As TNF-beta has close structural gy with "INF-alpha (also known as cachectin), and since each induces similar biologic responses and binds to the same cellular receptor, the synthesis of both pha and TNF-beta are inhibited by the nds of the present invention and thus are herein ed to tively as “”TNF unless specifically delineated otherwise.
The nds of the invention may exist as atropisomers, i.e., chiral rotational isomers. The invention encompasses the racemic and the resolved atropisomers. The following illustration generically shows a compound (Z) that can eXist as somers as well as its two possible atropisomers (A) and (B). This ration also shows each of atropisomers (A) and (B) in a Fischer proj ection. In this illustration, R1, R2, and R4 carry the same definitions as set forth for Formula I, Rp’ is a substituent within the tion of R5, and Rp is a non-hydrogen substituent within the definition of R5.
Rp R3 RF, 0 R1 Rp R3 Rpr R3 R; o” 'Rp 0” \Rl (A) 03) R3 R3 R17+Rp, :7é5 Rp Rp,/+/ (A) |C|) (B) (|)| When the compounds bed herein contain olefinic double bonds or other centers of geometric asymmetry, and unless otherwise specified, it is intended that the compounds include the cis, trans, Z- and E- configurations. Likewise, all tautomeric forms are also intended to be included.
Genus XI Description Compounds of Genus X[ can be prepared according to the disclosures of US 881 US 7,323,472, and US 8,058,282, which are herein orated herein by reference in their entireties.
Genus X[ is characterized by compounds of Formula XL x \ N O I}! NAX R3 (XI), or stereoisomers thereof, isotopically-enriched compounds thereof, prodrugs thereof, solvates thereof, and pharmaceutically acceptable salts thereof; wherein: : is a single or double bond; R1 is an optionally substituted aryl or an optionally tuted heteroaryl ring, R2 is a moiety selected from hydrogen, (ii—m aila'yl, {273.7 cycloalkyl, (Encyclrralkylihwalliyi, aryl, arlerm , heteroaryl, heteroaryli‘mo alkyl, heterocyclic, and heterocycllemo alkyl, wherein each moiety, excluding lijy'rlrogen, is. optionally substitute-:1, or R2 is X1(CR10R20)qC(A1)(A2)(A3) or C(A1}{Az)(A3); A1 is an optionally substituted C1—1o alkyl, A2 is an ally tuted C1—1o alkyl, A3 is hydrogen or is an optionally substituted C1.1o alkyl, and wherein A1, A2, and A3, excluding hydrogen, are ally substituted 1 to 4 times by (CR10R20)nOR6; R3 is an 040 alkyl, C3.7 cycloalkyl, C3-7 cycloalkle1.4alkyl, aryl, arle1.1oalkyl, heteroaryl, heteroarle1-1o alkyl, heterocyclic, or a heterocyclle1.1oalkyl moiety, which moieties are optionally substituted; R6 is hydrogen, or C1—1o alkyl, R10 and R20 are ndently ed from hydrogen or C1—4alkyl; X 15 R2, {4351.7 SaablmRL {CH7};T‘V{KJG)§“)31~R? (illfluw(R10){({}Bl{7 {{:ll?)rle{~R14, 0}” X1 is N(Rio), O, S(O)m, or CRioRzo; n is O or an integer having a value of l to 10; m is O or an integer having a value of l or 2; and q is O or an integer having a value of l to 10.
In one embodiment, the p38 kinase inhibitor from Genus X[ is ed from the following: 4-Chloromethylsulfanylphenylamino-pyrimidinecarbaldehyde; 4-Chloro(2,6-difluoro-phenylamino)methylsulfanyl-pyrimidinecarbaldehyde; ro(2-chloro-phenylamino)methylsulfanyl-pyrimidinecarbaldehyde; 4-Chloro(2-fluoro-phenylamino)methylsulfanyl-pyrimidinecarbaldehyde; [00 1614] 4-Chloro(1-ethyl-propylamino)methylsulfanyl-pymidinecarbaldehyde; 4-Chloroisopropylaminomethylsulfanyl-pyrimidinecarbaldehyde; 4-Chlorocyclopropylaminomethylsulfanyl-pyimidinecarbaldehyde; 4-Chloro(cyclopropylmethyl-amino)methylsulfanyl-pyrimidinecarbaldehyde; 2-Methylsulfanylphenylphenylamino-pyrimidinecarbaldehyde; [00 1619] 4-(2-Chlorophenyl)(l -ethyl-propylamino)methylsulfanyl-pyrimidine carbaldehyde; 4-(2-Chlorophenyl)(2-chloro-phenylamino)methylsulfanyl-pyrimidine carbaldehyde; 4-(2-Fluorophenyl)(2-chloro-phenylamino)methylsulfanyl-pyrimidine carbaldehyde; luoro-phenyl)isopropyl aminomethylsulfanyl-pyrimidinecarbaldehyde; 4-Chloromethylsulfanylcyclohexylaminopyrimidinecarboxaldehyde; 2-Methylsulfany1(2-methylfluoropheny1)cyclohexylaminopyrimidine carbaldehyde; ] 4-Amino(2-fluoro-pheny1)methylsulfany1-pyrimidinecarbaldehyde; 4-Cyclopropylamino(2-fluoro-phenyl)methylsulfany1-pyrimidine dehyde; 4-(Cyclopropylmethy1-amino)(2-fluoro-phenyl)methy1sulfanyl-pyrimidine carbaldehyde; 4-(2,6-Difluoro-phenylamino)(2-fluoro-pheny1)methylsulfany1-pyrimidine carbaldehyde; 4-(2-Fluorophenyl)(2-fluoro-pheny1amino)methylsulfanyl-pyrimidine carbaldehyde; 4-sec-Butylamino(2-fluoro-pheny1)methy1sulfanyl-pyrimidinecarbaldehyde; 4-(4-F1uoromethy1-pheny1)isopropylamino-Z-methylsulfany1-pyrimidine carbaldehyde; 4-Cyclopropylamino(4-fluor0methy1-pheny1)methy1sulfanyl-pyrimidine carbaldehyde; 4-(Cyclopropylmethyl-amino)(4-fluoromethyl-pheny1)methylsulfany1- pyrimidinecarba1dehyde; 4] 4-(4-Fluoromethy1-pheny1)(2-fluoro-pheny1 amino)methylsulfany1- pyrimidinecarba1dehyde; ] 4-sec-Butylamino(4-fluoromethy1-pheny1)methylsulfanyl-pyrimidine carbaldehyde; 4-Amino(2-fluoro-pheny1)methylsulfany1-pyrimidinecarbaldehyde; 4-Aminochlor0methylsulfanyl-pyrimidinecarbaldehyde; 4-sec-Butylaminochlor0methylsu1fany1-pyrimidinecarba1dehyde; 4-(2,6-Difluoro-pheny1amino)(4-fluoromethy1-pheny1)methylsulfanyl- pyrimidinecarba1dehyde; 4-(1-Ethy1propylamino)(4-fluoromethy1-pheny1)methylsulfanyl-pyrimidine- aldehyde; 2-Methylsulfany1(2-methylfluoropheny1)cyclohexylaminopyrimidine carbaldehyde; 4-Chloromethylsulfanylcyclohexylaminopyrimidinecarboxaldehyde; and 8-(2,6-difluorophenyl)((l,3-dihydroxypropanyl)amino)(4-fluoro methylphenyl)pyrido[2,3-d]pyrimidin-7(8H)-one apimod”), Formula XV.
In one embodiment, the p38 kinase tor is 8-(2,6-difluorophenyl)((l,3- dihydroxypropanyl)amino)(4-fluoromethylphenyl)pyrido[2,3-d]pyrimidin-7(8H)-one (“Dilmapimod”), Formula Xl’.
Genus XI Definitions As used herein, “optionally substituted” unless specifically defined shall mean such groups as halogen, such as fluorine, chlorine, bromine or iodine; hydroxy; hydroxy substituted Ci—ioalkyl; C1-1o alkoxy, such as methoxy or ethoxy; bstituted C1-1o alkoxy; S(O)m alkyl, such as methyl thio, methylsulfinyl or methyl sulfonyl; —C(O); 4', wherein R4' and R14' are each independently hydrogen or C14 alkyl, such as amino or mono or -disubstituted C1— 4 alkyl or wherein the ' can cyclize together with the nitrogen to which they are attached to form a 5 to 7 membered ring which optionally contains an additional atom selected from O/N/S; C1—1oalkyl, C3.7cycloalkyl, or C3.7cycloalkyl C1-1o alkyl group, such as methyl, ethyl, propyl, isopropyl, l, etc. or cyclopropyl methyl; halosubstituted C1-1o alkyl, such CF2CF2H, or CF3; an optionally substituted aryl, such as phenyl, or an optionally substituted arylalkyl, such as benzyl or hyl, n these aryl containing moieties may also be substituted one to two times by halogen; hydroxy; hydroxy substituted alkyl; C1-1o alkoxy; S(O)malkyl; amino, mono & stituted C14 alkyl amino, such as in the NR4R14 group; C14 alkyl, or CF3.
Suitable pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of inorganic and organic acids, such as hydrochloric acid, hydrobromic acid, sulphuric acid, phosphoric acid, methane nic acid, ethane sulphonic acid, acetic acid, malic acid, tartaric acid, citric acid, lactic acid, oxalic acid, succinic acid, fumaric acid, maleic acid, benzoic acid, salicylic acid, phenylacetic acid and mandelic acid.
In addition, pharmaceutically acceptable salts of compounds of Formula (X[) may also be formed with a pharmaceutically acceptable cation, for instance, if a substituent group ses a carboxy moiety. Suitable pharmaceutically acceptable s are well known to those skilled in the art and include alkaline, alkaline earth, ammonium and quaternary ammonium cations.
The term “halo” or “halogens” is used herein to mean the halogens, chloro, fluoro, bromo and iodo.
The term alkyl” or “alkyl” or “alkyll-lO” is used herein to mean both straight and branched chain radicals of l to 10 carbon atoms, unless the chain length is otherwise limited, including, but not limited to, methyl, ethyl, n-propyl, iso-propyl, l, sec-butyl, tyl, tert-butyl, yl and the like.
The term “cycloalkyl” is used herein to mean cyclic radicals, preferably of 3 to 8 carbons, including but not limited to cyclopropyl, cyclopentyl, exyl, and the like.
The term “cycloalkenyl” is used herein to mean cyclic radicals, preferably of 5 to 8 carbons, which have at least one bond including but not limited to cyclopentenyl, cyclohexenyl, and the like.
The term “alkenyl” is used herein at all occurrences to mean straight or branched chain radical of 2-10 carbon atoms, unless the chain length is limited thereto, including, but not d to l, l-propenyl, enyl, 2-methyl-l-propenyl, l-butenyl, 2-butenyl and the like.
The term “aryl” is used herein to mean phenyl and naphthyl.
The term “heteroaryl” (on its own or in any combination, such as “heteroaryloxy”, or “heteroaryl alkyl”) is used herein to mean a 5-10 membered aromatic ring system in which one or more rings contain one or more heteroatoms selected from the group consisting of N, O or S, such as, but not limited, to pyrrole, pyrazole, furan, pyran, thiophene, quinoline, isoquinoline, quinazolinyl, pyridine, pyrimidine, pyridazine, pyrazine, , oxadiazole, oxazole, isoxazole, oxathiadiazole, thiazole, isothiazole, thiadiazole, ole, triazole, indazole, imidazole, or benzimidazole.
The term “heterocyclic” (on its own or in any combination, such as “heterocyclylalkyl”) is used herein to mean a saturated or partially unsaturated 4-10 membered ring system in which one or more rings contain one or more heteroatoms selected from the group consisting of N, O, S, or S(O)m, and m is O or an integer having a value of l or 2; such as, but not limited to, the saturated or partially saturated versions of the heteroaryl moieties as defined above, such as tetrahydropyrrole, tetrahydropyran, tetrahydrofuran, tetrahydrothiophene (including oxidized versions of the sulfur moiety), pyrrolidine, piperidine, piperazine, line, thiomorpholine ding oxidized versions of the sulfur moiety), or imidazolidine.
WO 71147 2018/054642 The term “aralkyl” or “heteroarylalkyl” or “heterocyclicalkyl” is used herein to mean Cl-4 alkyl as defined above attached to an aryl, heteroaryl or heterocyclic moiety as also defined herein unless otherwise indicate.
The term “sulfinyl” is used herein to mean the oXide 8(0) of the corresponding sulfide, the term “thio” refers to the sulfide, and the term “sulfonyl” refers to the fully oxidized S (0)2 moiety.
The term “aroyl” is used herein to mean , n Ar is as phenyl, naphthyl, or aryl alkyl derivative such as defined above, such group include but are not limited to benzyl and phenethyl.
The term “alkanoyl” is used herein to mean C(O)Cl-l 0 alkyl wherein the alkyl is as defined above.
Genus XII Description Compounds of Genus XII can be prepared according to the disclosure of US 6,147,080, which is herein incorporated herein by reference in its entirety.
Genus XII is characterized by compounds of Formula XII: R R Q1 Y:Yl o¥‘<N-<A>n Q2 ~ / X, R1 (XII), or stereoisomers f, isotopically-enriched nds thereof, prodrugs f, solvates thereof, and pharmaceutically acceptable salts thereof; wherein: each of Q1 and Q2 are independently selected from phenyl and 5-6 membered heteroaryl ring systems having one nitrogen heteroatom; Q1 is tuted with l to 4 substituents, independently selected from halo; C1—C3 alkyl; C1—C3 alkyl substituted with —NR'2, —OR', —C02R', or —CONR'2 ; —O—(C1-C3)-alkyl; WO 71147 —O—(C1 -C3)-alkyl substituted with —NR'2, —OR', —C02R', or —CONR'2; —NR'2; —OCF3; —CF3; —N02; —C02R', —CONR'; —SR'; —S(02)N(R')2; —SCF3; or —CN; and Q2 is optionally substituted with up to 4 substituents, independently selected from halo; C1— C3 straight or ed alkyl, C1—C3 straight or branched alkyl substituted with —NR', —NR'2, —OR', —C02R', or —CONR'2 ; —O—(C1 -C3)-alkyl; —0— (C1 -C3)-alkyl substituted with —NR', — NR'2, —OR', —C02R', or —CONR'2; NR'2; OCF3; CF3; N02 ; COzR'; —CONR'; —SR'; — S(02)N(R')2; —SCF3; or —CN; wherein R' is selected from hydrogen, (C1—C3)-alkyl or (C2 -C3)-alkenyl or alkynyl, and Xis selected from S O or , , S(O)2 , S(O) , C(O) , N(R) , C(R)2 ; each R is independently ed from hydrogen or ) alkyl, Y is C; A is CR'; 11 is 1, and R1 is selected from hydrogen, (C1—C3)-alkyl, —OH, or —O— (C1—C3)-alkyl.
In one embodiments, the p38 kinase inhibitor from Genus XII is selected from the following: WO 71147 and 5-(2,6-dichloropheny1)((2,4-difluorophenyl)thio)-6H-pyrimido[1 ,6-b]pyridazinone (“Neflamapimod”), Formula XII’.
In one embodiment, the p38 kinase inhibitor is 5-(2,6-dichloropheny1)((2,4- difluoropheny1)thio)-6H-pyrimido[1,6-b]pyridazinone mapimod”), Formula XII’.
Genus XIII Description Compounds of Genus XIII can be ed according to the disclosure of US 7,521,447, which is herein incorporated herein by reference in its ty.
Genus XIII is characterized by compounds of a XIII: 1 (XIII), or stereoisomers thereof, isotopically-enriched compounds f, prodrugs thereof, solvates thereof, and pharmaceutically acceptable salts thereof; wherein: Ar1 is aryl or heteroaryl, each of which may be substituted or tituted; A is —H, —OH, an amine protecting group, —Zn'NR2R3, 2(C=O)R2, —Zn'SO2R2, —Zn' SOR2, —Zn'SR2, —Zn'OR2, —Zn'(C=O)R2, —Zn'(C=O)OR2, —Zn'O—(C=O)R2, alkyl, allyl, alkenyl, alkynyl, heteroalkyl, heteroallyl, alkenyl, heteroalkynyl, alkoxy, heteroalkoxy, —Zn-cycloalkyl, —Zn-heterocycloalkyl, or —Zn-Ar1, wherein said alkyl, allyl, alkenyl, alkynyl, heteroalkyl, heteroallyl, heteroalkenyl, heteroalkynyl, alkoxy, heteroalkoxy, —Zn-cycloalkyl, —Zn-heterocycloalkyl, or —Zn-Ar1 may be substituted or unsubstituted; Z is ne of from 1 to 4 carbons, or alkenylene or alkynylene each of from 2 to 4 carbons, wherein said alkylene, alkenylene, or alkynylene may be substituted or unsubstituted; R2 and R3 are independently —H, —OH, an amine protecting group, an alcohol protecting group, an acid protecting group, a sulfur protecting group, alkyl, allyl, alkenyl, alkynyl, heteroalkyl, heteroallyl, heteroalkenyl, heteroalkynyl, , heteroalkoxy, —Zn-cycloalkyl, —Zn- heterocycloalkyl, or —Zn-Ar1, wherein said alkyl, allyl, alkenyl, alkynyl, heteroalkyl, heteroallyl, heteroalkenyl, heteroalkynyl, , heteroalkoxy, —Zn-cycloalkyl, —Zn-heterocycloalkyl, or Zn-Ar1 may be substituted or unsubstituted, or WO 71147 R2 together with R3 and N forms a saturated or partially unsaturated heterocycle ring of l or more heteroatoms in said ring, wherein said heterocycle may be substituted or unsubstituted and wherein said heterocycle may be fused to an aromatic ring; B is —H, —NH2, or substituted or unsubstituted methyl; E is —Zn-NR2R3, —Zn-(C=O)R4, —Zn-(C=O)R5, —Zn-NR5(C=O)R5, —Zn-O(C=O)R5, —Zn-OR5, — Zn-802R5, —Zn-SOR5, —Zn-SR5, or —Zn-NH(C=O)NHR5; R4 is R6)(CH2)mOR5, wherein m is an integer from 1 to 4, or —NR2R3; R5 is —H, —OH, an amine protecting group, an alcohol protecting group, an acid protecting group, a sulfur protecting group, alkyl, allyl, alkenyl, alkynyl, heteroalkyl, heteroallyl, heteroalkenyl, heteroalkynyl, alkoxy, heteroalkoxy, —Zn-cycloalkyl, —Zn-heterocycloalkyl, or —Zn-AI'1, wherein said alkyl, allyl, alkenyl, l, heteroalkyl, allyl, heteroalkenyl, heteroalkynyl, alkoxy, heteroalkoxy, —Zn-cycloalkyl, —Zn-heterocycloalkyl, or —Zn- Ar1 may be substituted or tituted; R6 is a natural amino acid side chain, —Zn'NR2R3, Zn'ORS, Zn'SO2R5, Zn'SORS, or Zn'SRS; and In one embodiment, the p3 8 kinase inhibitor from Genus XIII is selected from the following: [00 1667] 5 -(4-fluorophenoxy)-l-isobutyl-1H-indazolecarboxylic acid (2- ylaminoethyl)amine; N—(2-(dimethylamino)ethyl)-N-((5-(4-fluorophenoxy)- l -isobutyl- l zol yl)methyl)methanesulfonamide; N—(2-(dimethylamino)ethyl)-N-((5-(4-fluorophenoxy)- l -isobutyl- l H-indazol yl)methyl)acetamide [5-(4-fluorophenoxy)- l -isobutyl-lH-indazolyl]morpholinyl-methanone; 1] [5-(4-fluorophenoxy)isobuty1-1H-indazoly1]-(4-methy1piperazin y1)methanone; [00 1672] 5 -(4-fluorophenoxy)isobuty1-1H-indazolecarboxylic acid (1 -benzylpiperidin y1)amide; [00 1673] 5 -(4-fluorophenoxy)isobuty1-1H-indazolecarboxylic acid methyl-(1- piperidiny1)amide; 3 - {[5-(4-fluorophenoxy)-1 -isobuty1-1H-indazolecarbony1]-amino} -pyrrolidine-1 - ylic acid tert—butyl ester (S)(2,4-difluorophenoxy)isobuty1-1H-indazolecarboxy1ic acid (1 -carbamoy1- 3-dimethylaminopropy1)amide (S)-methy1 2,4-difluorophenoxy)isobuty1-1H-indazolecarboxamido) (dimethylamino)butanoate; [00 1677] (S)(2,4-difluorophenoxy)-N—(4-(dimethy1amino)-1 -hydroxybutany1)-1 -isobuty1- 1H-indazolecarboxamide; (S)(2,4-difluorophenoxy)isobuty1-1H-indazolecarboxy1ic acid (1 - hydroxymethy1isopropylaminopropy1)amide; (S)(2,4-difluorophenoxy)isobuty1-1H-indazolecarboxy1ic acid (3- dimethylamino-l -dimethylcarbamoylpropy1)amide; (S)(2,4-difluorophenoxy)isobuty1-1H-indazolecarboxy1ic acid (3- dimethylamino-l -methy1carbamoy1propy1)amide; 5-(2,4-difluorophenoxy)isobuty1-1H-indazolecarboxy1ic acid; (2,4-difluorophenoxy)isobuty1-1H-indazolyloxy]-propy1}dimethylamine; 5-(2,4-difluorophenoxy)isobutyl(piperidiny1methoxy)-lH-indazole; 5-(2,4-difluorophenoxy)isobuty1(3 -piperaziny1-propoxy)-lH-indazole; 5-(2,4-difluorophenoxy)-1 -isobuty1(morpholin-Z-ylmethoxy)-1H-indazole; 1-[5-(2,4-difluorophenoxy)isobuty1-1H-indazolyloxy]pyrrolidiny1-propan- 2-01; {3-[5-(2,4-difluorophenoxy)isobuty1-1H-indazolyloxy]-propy1}dimethylamine; 5-(2,4-difluorophenoxy)isobutyl(piperidiny1methoxy)-lH-indazole; 5-(2,4-difluorophenoxy)-1 -isobuty1(morpholin-Z-ylmethoxy)-1H-indazole; N’-[5- (2,4-difluorophenoxy)isobuty1-1H-indazoly1]-N,N-dimethy1propane-1,3-diamine; 2018/054642 [5-(2,4-difluorophenoxy)- l -isobutyl-lH-indazolyl]-piperidinyl-amine; [5-(2,4-difluorophenoxy)- l -isobutyl-lH-indazolyl]-piperidin-3 hylamine; [00 1692] (S) {[5-(2,4-difluorophenoxy)-l -isobutyl- lH-indazolecarbonyl]-amino} dimethylaminobutyric acid; (S)(2,4-difluorophenoxy)isobutyl-1H-indazolecarboxylic acid (1 - hydroxymethylpiperidin- l -ylpropyl)amide; (S)(2,4-difluorophenoxy)isobutyl-1H-indazolecarboxylic acid [1 -(2- dimethylaminoethyl)hydroxymethylpropyl]amide; (S)(2,4-difluorophenoxy)isobutyl-1H-indazolecarboxylic acid {1- hydroxymethyl[(2-methoxyethyl)methylamino]propyl } amide; (S)(2,4-difluorophenoxy)isobutyl-1H-indazolecarboxylic acid [3 - ylamino(2-hydroxyethylcarbamoyl)propyl]amide; and (5-(2,4-difluorophenoxy)- l -isobutyl-lH-indazolyl)((2-(dimethylamino)ethyl) azaneyl)methanone (“ARRY-797”), Formula XIII’.
In one embodiment, the p3 8 kinase inhibitor is (5-(2,4-difluorophenoxy)- l -isobutyl- lH-indazolyl)((2-(dimethylamino)ethyl)azaneyl)methanone (“ARRY-797”), Formula Xfll’.
Genus XIII tions 9] The term “alkyl” as used herein refers to a saturated linear or branched-chain lent hydrocarbon radical of one to twelve carbon atoms, wherein the alkyl radical may be optionally substituted independently with one or more substituents described below. Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, butyl, isobutyl, sec-butyl, tert—butyl, , isopentyl, tert-pentyl, hexyl, isohexyl, and the like.
“Alkylene” means a linear or branched saturated nt hydrocarbon radical of one to twelve carbon atoms, e.g., methylene, ethylene, propylene, 2-methylpropylene, pentylene, and the like.
The term “alkenyl” refers to linear or branched-chain monovalent hydrocarbon radical of two to twelve carbon atoms, containing at least one double bond, e. g, ethenyl, propenyl, and the like, wherein the l radical may be optionally substituted independently with one or more substituents described herein, and includes radicals having “cis” and “trans” orientations, or alternatively, “”E and “Z” ations.
The term “alkenylene” refers to a linear or branched divalent hydrocarbon radical of two to twelve carbons containing at least one double bond, n the alkenylene radical may be optionally substituted independently with one or more tuents described herein.
Examples include, but are not limited to, ethenylene, propenylene, and the like.
The term “alkynyl” refers to a linear or branched monovalent arbon radical of two to twelve carbon atoms containing at least one triple bond. Examples include, but are not limited to, ethynyl, propynyl, and the like, wherein the alkynyl radical may be ally substituted independently with one or more substituents described herein.
The term “alkynylene” to a linear or branched divalent hydrocarbon l of two to twelve carbons containing at least one triple bond, wherein the alkynylene radical may be optionally substituted independently with one or more substituents described herein.
The term ” refers to a radical having the Formula RC=CHCHR, n R is alkyl, alkenyl, l, cycloalkyl, heterocycloalkyl, aryl, aryl, or any substituent as defined herein, wherein the allyl may be optionally substituted independently with one or more substituents described herein.
The term alkyl” refers to saturated or partially unsaturated cyclic hydrocarbon radical having from three to twelve carbon atoms, wherein the cycloalkyl may be optionally substituted ndently with one or more substituents described herein. The term “cycloalkyl” further includes bicyclic and tricyclic cycloalkyl structures, wherein the bicyclic and tricyclic structures may include a saturated or lly unsaturated lkyl fused to a saturated or partially unsaturated cycloalkyl or heterocycloalkyl ring or an aryl or heteroaryl ring. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and the like.
The term “heteroalkyl” refers to saturated linear or branched-chain monovalent hydrocarbon radical of one to twelve carbon atoms, wherein at least one of the carbon atoms is replaced with a heteroatom selected from N, O, or S, and wherein the radical may be a carbon l or heteroatom radical (i.e., the heteroatom may appear in the middle or at the end of the radical). The heteroalkyl radical may be optionally substituted independently with one or more substituents described herein. The term “heteroalkyl” encompasses alkoxy and heteroalkoxy radicals.
The term “heterocycloalkyl” refers to a saturated or partially unsaturated cyclic radical of 3 to 8 ring atoms in which at least one ring atom is a heteroatom selected from nitrogen, oxygen and sulfur, the remaining ring atoms being C where one or more ring atoms may be optionally substituted independently with one or more substituent described below and wherein the cycloalkyl ring can be saturated or partially unsaturated. The radical may be a carbon radical or heteroatom radical. “Heterocycloalkyl” also includes radicals where heterocycle radicals are fused with aromatic or heteroaromatic rings. Examples of heterocycloalkyl rings e, but are not limited to, pyrrolidine, piperidine, piperazine, tetrahydropyranyl, morpholine, thiomorpholine, homopiperazine, phthalimide, and derivatives thereof. 9] The term “heteroalkenyl” refers to linear or branched-chain lent hydrocarbon radical of two to twelve carbon atoms, containing at least one double bond, e. g., ethenyl, propenyl, and the like, wherein at least one of the carbon atoms is replaced with a atom selected from N, O, or S, and wherein the radical may be a carbon radical or atom l (i.e., the heteroatom may appear in the middle or at the end of the radical). The heteroalkenyl radical may be optionally substituted ndently with one or more substituents described , and includes radicals having “cis” and “trans” orientations, or atively, “”E and “Z” orientations.
The term “heteroalkynyl” refers to a linear or branched monovalent hydrocarbon radical of two to twelve carbon atoms containing at least one triple bond. es include, but are not limited to, ethynyl, propynyl, and the like, wherein at least one of the carbon atoms is replaced with a heteroatom selected from N, O, or S, and wherein the radical may be a carbon radical or heteroatom radical (i.e., the atom may appear in the middle or at the end of the radical). The heteroalkynyl radical may be optionally tuted independently with one or more substituents described herein.
The term “heteroallyl” refers to radicals having the Formula RC=CHCHR, wherein R is alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkyl, aryl, heteroaryl, or any substituent as defined herein, wherein at least one of the carbon atoms is replaced with a heteroatom selected from N, O, or S, and wherein the radical may be a carbon radical or heteroatom radical (i.e., the heteroatom may appear in the middle or at the end of the l). The heteroallyl may be optionally substituted independently with one or more substituents described herein. 2] “Aryl” means a monovalent aromatic hydrocarbon monocyclic radical of 6 to 10 ring atoms or a polycyclic aromatic hydrocarbon, optionally substituted independently with one or more substituents described herein. More specifically the term aryl includes, but is not limited to, phenyl, l-naphthyl, 2-naphthyl, and derivatives thereof. 3] “Heteroaryl” means a monovalent monocyclic aromatic l of 5 to 10 ring atoms or a polycyclic aromatic l, containing one or more ring heteroatoms ed from N, O, or S, the remaining ring atoms being C. The aromatic radical is optionally substituted independently with one or more substituents described herein. Examples include, but are not limited to, furyl, thienyl, pyrrolyl, pyridyl, pyrazolyl, pyrimidinyl, imidazolyl, pyrazinyl, indolyl, thiophenyl, quinolyl, benzopyranyl, thiazolyl, and derivatives thereof.
The term “halo” represents fluoro, , bromo or iodo.
“Amino protecting groups” refers to those organic groups intended to protect en atoms against undesirable reactions during synthetic procedures and include, but are not d to, benzyl, benzyloxycarbonyl (CBZ), tert—butoxycarbonyl (Boc), oroacetyl, and the like.
“Alcohol protecting groups” refers to those organic groups ed to protect l groups or substituents against undesirable reactions during synthetic procedures and include, but are not limited to, thylsilyl)ethoxymethyl (SEM), tert-butyl, methoxymethyl (MOM), and the like.
“Sulfur protecting groups” refers to those organic groups intended to protect sulfur groups or substituents t undesirable reactions during synthetic procedures and include, but are not limited to, , (trimethylsilyl)ethoxymethyl (SEM), tert-butyl, trityl and the like.
“Acid protecting groups” refers to those organic groups intended to protect acid groups or substituents against undesirable reactions during synthetic procedures and include, but are not limited to, , (trimethylsilyl)ethoxymethyl (SEM), methylethyl and tert-butyl esters, and the like.
In one embodiment, the p38 kinase inhibitor may be selected from the following: 2- (4-Chlorophenyl)(fluorophenyl)pyridin yl-l,2-dihydropyrazol one, RWJ-67657, RDP-58, Scios-469 (talmapimod), SB- 210313, SB-220025, SB-23 8039, HEP-689, SB-203580, SB-239063, SB-239065, SB-242235, VX-702 and VX-745, 8, BIRB-796 (Doramapimod), RO 7 (Pamapimod), FR-167653, SB-681323 (Dilmapimod), SB- 281832, SC-040, SC-XX906, CP- 64131, CNI-1493, RPR—200765A, Ro1195, AIK-3, AKP-OOl, LL Z1640-2, ARRY-614, ARRY-797, AS-1940477, AVE-9940, AZD- 7624, BCT- 197, BIRB-1017BS, BMS-582949, CAY10571, CBS-3595, CCT-196969, CCT-241161, CDP- 146, CGH 2466, CHR—3 620, Chlormethiazole ate, and CM PD-l.
In one embodiment, the p38 kinase inhibitor is selected from the following: Doramapimod, EO 1428, FY-101C, , GSK-610677 6, HSB-13, JX 401, KC-706, KC-706 061), LEO-15520, 06, Losmapimod, LP- 590, LY-30007113, LY2228820, M L 3403, OXNO, NP-202, pexmetinib, PF-03715455, PH-797804, PS- 540446, ralimetinib, regorafenib, RO-3201195, RWJ 67657, RWJ-67657,SB 202190, SB 203580, SB 203580 hydrochloride, SB202190, SB202190 hydrochloride, SB-681323, SB- , SC-80036, SCD-282, SCIO-323, SCIO-469, SD-06, semapimod, SKF 86002, SX Oil, SYD-003, TA-5493, TAK 715, TOP-1210, TOP-1630, UR-13870, UR—13870, VGX-102727, 8-(2,6-difluorophenyl)(l,3-dihydroxypropanylamino)(4-fluoro methylphenyl)pyrido[2,3-d]pyrimidinone (Dilmapimod), and GSK-610677.
In one embodiment, the p38 kinase inhibitor is selected from the ing: 6-[5- (cyclopropylcarbamoyl)fluoromethylphenyl]-N-(2,2-dimethylpropyl)pyridine carboxamide (Losmapimod), 5-[(2-chlorofluorophenyl)acetylamino](4-fluorophenyl)(4- pyrimidinyl)isoxazole (AKP-001), KC—706, (l-[5-tert-butyl(3-chloro hydroxyphenyl)pyrazol yl]—3-[[2-[[3-[2-(2-hydroxyethylsulfanyl)phenyl]-[l,2,4]triazolo[4,3- a]pyridin yl]sulfanyl]phenyl]methyl]urea) (PF-0371 545 5), (3-[3-bromo[(2,4- difluorophenyl)methoxy] methyloxopyridin-l-yl]-N,4-dimethylbenzamide) (PH-797804), RV-7031.29, oxy-1 -{4-[(4- {3 -[5-(tert-butyl)(p—tolyl)-2H-pyrazol-3 -yljureido} -1, AMG-548, BIRB-796 (Doramapimod), RO 4402257 (Pamapimod), FR—167653 SB-681323 (Dilmapimod), SB-281832, , and 06, CP- 64131, CNI-1493, RPR—200765A, Ro- 95, AIK-3, AKP-OOl, LL Z1640-2, ARRY-614, ARRY-797, AS-1940477, AVE-9940, AZD- 7624, BCT-197, BIRB-1017BS, BMS-582949, CAY10571, CBS-3595, CCT-196969, CCT-241161, CDP-146, CGH 2466, CHR—3 620, ethiazole edisylate, and CM PD-l. 2] In one embodiment, the p38 kinase inhibitor is selected from the following: Doramapimod, EO 1428, FY-101C, FX-005, GSK-610677 HE-3286, HSB-13, JX 401, KC-706, KC-706 (ITX-5061), LEO-15520, LEO-1606, imod, LP- 590, LY-30007113, LY2228820, M L 3403, OXNO, NP-202, inib, PF-03715455, PH-797804, PS- 540446, ralimetinib, regorafenib, RO-3201195, RWJ 67657, 657,SB 202190, SB 203580, SB 203580 hydrochloride, SB202190, SB202190 hydrochloride, 323, SB- 856553, SC-80036, SCD-282, SCIO-323, SCIO-469, SD-06, mod, SKF 86002, SX Oil, SYD-003, TA-5493, TAK 715, TOP-1210, TOP-1630, UR-13870, UR—13870, and VGX-1027, SB 203580, SB 203580 hydrochloride, SB68l323 (Dilmapimod), and LY2228820 late.
In one embodiment, the p38 kinase inhibitor is selected from the following: BIRB 796 (Doramapimod), BMS-582949, Pamapimod, GW856553, ARRY-797AL 8697, AMG 548, CMPD-l, EO 1428, JX 401, RWJ 67657, TA 01, TA 02, VX 745, DBM 1285 dihydrochloride, ML 3403, SB 202190, SB 239063, SB , SCIO 469 hydrochloride, SKF 86002 dihydrochloride, SX Oil, TAK 715, VX 702, and PH797804.
In one embodiment, the p38 kinase inhibitor is characterized by a compound of Genus XXX.
In one embodiment, the p38 kinase inhibitor is characterized by a nd of Formula (XXX’): HOKCDH0.0 HQ F , or stereoisomers thereof, isotopically-enriched compounds thereof, prodrugs thereof, solvates thereof, and pharmaceutically acceptable salts thereof.
Genus XXX Description Compounds of Genus XXX can be prepared according to the disclosure of US 312 which is herein incorporated herein by reference in its entirety.
Genus XXX is characterized by compounds of Formula (XXX’): R1 o R (XXX), or stereoisomers thereof, isotopically-enriched compounds thereof, gs thereof, solvates f, and pharmaceutically acceptable salts thereof; wherein: one ofthe ring atoms X and Y represents CH2 and the other represents 0, 55', SO, 862 or NR5, or -quuyu... is "nu-(7H2------CE—iz------- or ------{7}-{:=Citt------; R1 is seieeted from: A) Rt)------ wherein R is chosen from: a) Ci—Cs—Mkyi, whieh is substituted by 1, 2 or 3 hydroxyi er Crikeaikoxy groups; h} Ciuilsuaikyt, which is substituted by a saturated or unsaturated, rieriuaroiriatie hetereeyeiie radical having 5 or 6 ring atoms, which eorttaiiis 1, 2 or 3 hetero atoms which are chosen irittepehdentty of each other from t), N and 5%, wherein the hetereeyeiie radicai eaii {ration-titty contain t or 2 hydroxy, Cietfwalkoxy or (:J‘ijé‘fliiiyi sabstittients and can he condensed with a pheiiyi ring or a saturated or unsaturated earhocyeiie ratheai having 5 er 6 ring atoms, c) a iionuarornatie heteroeyoiio radical having 5 or 6 ring atoms, which contains 1 or 2 hetero atoms which are chosen independently of each other from O and N; d} Ci—Ct—aikyi; e) H; ff; Ci—Cegnaikyi, which is substituted, by NRQR7; g) —; h) Ci{Ks-a}kytearbonytoxyvtjivCa—aikyt; and i) (C3~C7~eyeioathvaCi—Ca—aikyi, whieh can optionally contain 1 or 2 hydroxy, C i—Cis-aikoxy or aik}ri stihstituents on the ikyi radicai; B) 3.115%;ng C) tetrazoto; and D) NRsCONRme; 2018/054642 R3 is H 01' C1"Ct3-31Ry1; R3 is seiected frem: —|fl\R10 —NR8—C1—C6-a1kylenefl — |fl\R10 —NR80/“ f—|fl\R10R9 R11 and e) -NH-------{I7 1~Ce~alkyiene—NReR7 R4 is H, haiegen er {:7 kyh R5 is H or CPCéffllR‘jh n the C143,: ethyl is substituted by 1, 2 01' 5 hydrexyi or {Ct—Cs—eikexy groups; R5 and R1: are each independently H or thCe—alkyl, which is substituted hf; 1., 12 er 3 hydroxyl er CtnCe—aikoxy groups; R2 is H or CPCG-fiikyi; R9, R10, and R11, are each independently selected from H NH2, 111011:an 1—C6—alkyiaminow (ii—Cr Cwaihylamine, CtnCe—alkyl, C1—C6~afl«:exy, hydrexyi, halogen, C1~C6~3ihyh which is substituted by ’1 2 er 3 n atoms; CONRsRi; and N02; R12 represents H 0!“ N82; RI} and R14, are independently Selected item H et CtvCa—alkyi, er R13 and R14 are taken together with the nitrogen atom to which they ate bonded to farm a ntm—aremetie hetemeyehe radical having, 5 er 6 ring, atoms, whieh {tetttaihs 1 or 2 hetere :3me which are ehegen indepemtently of each other from O and N In one embodiment, the p3 8 kinase inhibitor from Genus XXX is selected from the following: (1) 2-(2-aminoanilino)methoxydibenzosuberone; (2) 2-(2-aminofluoroanilino)methoxydibenzosuberone; (3) 2-(2,4-difluoroanilino)methoxydibenzosuberone; (4) hlorofluoroanilino)methoxydibenzosuberone; (5) 2-(2,4,5-trifluoroanilino)methoxydibenzosuberone; (6) 2-(2-trifluoromethylanilino)methoxydibenzosuberone; ] (7) 2-(anilino)methoxydibenzosuberone; (8) 2-(2-methoxyanilino)methoxydibenzosuberone; (9) ethylfluoroanilino)methoxydibenzosuberone; (10) 2-(2-aminotrifluoromethylanilino)methoxydibenzosuberone; (1 1) 2-(phenyl)methoxydibenzosuberone; (12) 2-(2,4-difluoroanilino)methoxydibenzosuberenone; (13) 2-(2,4-difluoroanilino)(S-1,2-isopropylideneglyceryl)-10,11- dihydrodibenzo[a,d]-cyclohepten-S-one; (14) 2-(2,4-difluoroanilino)(R—1,2-isopropylideneglyceryl)-10,1 1- dihydrodibenzo[a,d]-cyclohepten-S-one; (15) 2-(2-aminoanilino)(S-1,2-isopropylideneglyceryl)-10,11- dihydrodibenzo[a,d]-cyclohepten-S-one; (16) 2-(2-aminoanilino)(R-1,2-isopropylideneglycer-3 -yl)-10,1 1- dihydrodibenzo[a,d]-cycloheptenone; (17) 2-(2,4-difluoroanilino) [ZR-,3 -dihydroxypropoxy]-10,1 1-dihydrodibenzo [a,d] - cyclohepten-S-one; (18) -difluoroanilino) [ZS-,3 -dihydroxypropoxy]-10,1 1-dihydrodibenzo[a,d] - cyclohepten-S-one; 7] (19) 2-(2-aminoanilino [ZR-,3 -dihydroxypropoxy]-10,1 1-dihydrodibenzo[a, d] - cyclohepten-S-one; (20) 2-(2-aminoanilino [ZS-,3 -dihydroxypropoxy]-10,1 drodibenzo[a,d] - cyclohepten-S-one, (21) 2-(2,4-difluoroanilino)(2-hydroxy-ethoxy)-10,1 1-dihydrodibenzo[a,d] - cyclohepten-S-one; (22) 2-(2,4-difluoroanilino)(3-hydroxy-propoxy)-10,1 1-dihydrodibenzo [a, d] - cyclohepten-S-one; (23) 2-(2,4-difluoroanilino)(2-morpholiny1—ethoxy)-10,1 1-dihydrodibenzo[a,d]- cyclohepten-S-one; (24) 2-(2-aminoanilino)(2-morpholiny1-ethoxy)-10,1 drodibenzo [a,d] - cyclohepten-S-one; (25) 2-(2,4-difluoroanilino)(2-tetrahydropyrany1—oxy)-10, 1 1- dihydrodibenzo[a,d]-cyclohepten-S-one; (26) (S)(2,4-difluorophenylamino)(2,2-dimethy1-[1,3]dioxolanylmethoxy)- ,1 1-dihydrodibenzo[a,d] cyclohepten-S-one; (27) (R)(2,4-difluorophenylamino)(2,3 -dihydroxypropoxy)-10,1 1- odibenzo[a,d]cyclohepten-S-one; (28) (S)(2-aminophenylamino)(2,2-dimethy1-[1,3]dioxolanylmethoxy)- ,1 drodibenzo[a,d] cyclohepten-S-one; (29) (R)(2-aminophenylamino)(2,3 -dihydroxypropoxy)-10,1 1- dihydrodibenzo[a,d]cyclohepten-S-one; (30) 2-(2,4-difluorophenylamino)(2-morpholiny1—ethoxy)- 1 0,1 1- odibenzo[a,d]cyclohepten-S-one; 9] (31) 8-(2,4-difluorophenylamino)hydroxy-10, 1 1-dihydrodibenzo [a,d] cyclohepten- -one; (32) 8-(2,4-difluorophenylamino)methoxy-10, 1 drodibenzo [a,d]cyclohepten- -one; (3 3) 8-(2-aminophenylamino)methoxy-10, 1 1-dihydrodibenzo [a, d] cyclohepten-S - one; (34) (S)(2,4-difluorophenylamino)(2,2-dimethy1-[1,3]dioxolanylmethoxy)- ,1 1-dihydrodibenzo[a,d] cyclohepten-S-one; (3 5) (R)(2,4-difluorophenylamino)(2,3 -dihydroxypropoxy)-10,1 1- dihydrodibenzo-[a,d]cycloheptenone; (3 6) (S)(2-aminophenylamino)(2,2-dimethy1-[1, 3 ] dioxolanylmethoxy)- ,1 1-dihydrodibenzo[a,d] cyclohepten-S-one; (3 7) (R)- minophenylamino)(2,3 -dihydroxypropoxy)-10,1 1-dihydrodibenzo- [a,d]cyclo-heptenone, (3 8) 8-(2,4-difluorophenylamino)(tetrahydropyranyloxy)-10,1 1- dihydrodibenzo[a,d]cyclohepten-S-one; (39) 8-(2,4-difluorophenylamino)(2-morpholinyl-ethoxy)-10,1 1- dihydrodibenzo-[a,d]cyclo-hepten-S-one; (40) -difluorophenylamino)amino-6H-dibenzo[b,e]oxepin- 1 1-one; (41) 3-(2-aminophenylamino)amino-6H-dibenzo[b,e]oxepin-1 1-one; (42) 8-amino(2-methoxyphenylamino)-6H-dibenzo[b,e]oxepin-1 1-one; (43) 8-amino(4-fluoromethoxyphenylamino)-6H-dibenzo [b,e]-oxepin-1 1-one; 2] (44) 8-amino(2-aminotrifluoromethylphenylamino)-6H-dibenzo[b,e]oxepin-l 1- one; (45) 8-amino-3 -(tetrazoly1)-6H-dibenzo[b,e]oxepin-1 1-one; (46) 3-(2,4-difluorophenylamino)tetrazoly1-6H-dibenzo[b,e]oxepin-l 1-one; (47) 2-(2-methy1Fluoroanilino)methoxydibenzosuberone; (48) 2-(2-chloroanilino)methoxydibenzosuberone; (49) 2-(2-aminofluoroanilino)hydroxy-10,1 1-dihydrodibenzo[a,d]-cyclohepten- -one; 8] (50) -difluoroanilino)hydroxy-10,1 1-dihydrodibenzo [a, d] -cyclohepten-5 - one; (51) 2-(2-chlor0fluoroanilino)hydroxy-10, 1 1-dihydrodibenzo[a,d] -cyclohepten- -one; (52) 2-(2-chloroanilino)hydroxy-10, 1 1-dihydrodibenzo [a,d] -cyclohepten-5 -one; (53) 2-(anilino)hydroxy-10,1 1-dihydrodibenzo[a,d] -cycloheptenone; (54) 2-(2,4-difluoroanilino)hydroxy-dibenzo[a,d]-cycloheptenone; (5 5) 2-(2,4-difluoroanilino) [3 -(4-Hydroxypiperidiny1-propoxy)]-10, 1 1- dihydrodibenzo[a,d]-cycloheptenone; 4] (56) 3 -(2-aminofluorophenylamino)nitro-6H-dibenzo [b,e]oxepin- 1 1-one; (57) morpholinecarboxylic acid [3-(2,4-difluorophenylamino)-l -oxo-6,l l- dihydrodibenzo[b,e]oxepinyl]amide; and (R)((2,4-difluorophenyl)amino)(2,3 -dihydroxypropoxy)- l 0,1 l-dihydro-5H- dibenzo[a,d][7]annulenone (“skepinone-L”), a XXX’.
In one embodiment, the p38 inhibitor is (R)((2,4-difluorophenyl)amino)(2,3- dihydroxypropoxy)-lO,l l-dihydro-5H-dibenzo[a,d] [7]annulenone (“skepinone-L”), Formula XXX’.
Genus VDetmitions 8] The expression “alkyl” (also in combination with other , such as alkoxy, haloalkyl etc.) es ht-chain and branched alkyl groups having preferably 1 to 6 or 1 to 4 carbon atoms, such as methyl, ethyl, n- and i-propyl, n-, i- and t-butyl, sec-butyl, n-pentyl and The expression “halogen” stands for a fluorine, chlorine, bromine or iodine atom, in particular for a fluorine or ne atom.
C1-C6-Alkoxy which is substituted by l, 2 or 3 hydroxyl or alkoxy groups is preferably alkoxy, in particular 2-hydroxyethoxy, 3-hydroxypropoxy, 2-hydroxypropoxy, l,2-dihydroxyethoxy, 2,3-dihydroxypropoxy or 2,3-dimethoxypropoxy.
A saturated non-aromatic heterocyclic radical is, in particular, pyrrolidinyl, piperidinyl, hydroxypiperidinyl, piperazinyl, tetrahydropyranyl, ydrofuranyl, dioxolanyl, 2,2-dimethyldioxolanyl, dioxanyl, morpholinyl or thiomorpholinyl. The piperidinyl radical can be substituted by l, 2, 3 or 4 Cl-C4-alkyl groups, in particular methyl groups. A preferred piperidinyl radical is 2,2,6,6-tetramethylpiperidinyl. The nitrogen-containing heterocyclic radicals can be bonded via a nitrogen atom or a carbon atom.
An unsaturated non-aromatic heterocyclic radical is, in particular, pyrrolinyl, di- or tetrahydropyridinyl. 3] An aromatic heterocyclic radical is, in particular, l, preferably 3- or 4-pyridyl, pyrimidinyl, pyrrolyl, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, furyl, thienyl, thiazolyl, thiadiazolyl, isothiazolyl or the corresponding benzo derivatives thereof. 4] In several ments, a method for treating a disorder sive to p38 kinase inhibition is provided. The method may include administering to a subject in need thereof, an ive amount of a p38 agent, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof. The method includes the treatment of disorders associated with DUX4 gene expression, wherein the inhibition of p38 kinase with a p38 agent may reduce DUX4 expression levels and/or the expression of one or more downstream genes in cells of the subject.
In some embodiments, the p38 agent may be selected from any of the p38 kinase inhibitors described herein, and/or selected from the compounds described in any of the following patents and publications, or ponding US. patents and publications that were available at the time that the priority application was filed, i.e., October 5, 2017: WO 71147 WO 2002092087 WO 2009103336 WO 2004014870 WO 2003049742 US 6147080 WO 8096 WO 20040143 87 WO 2310 US 20080207684 WO 2005085206 WO 2002064594 US 20060079461 US 20080146590 EP 1538201 WO 20020183 80 US 20060058296 WO 2007023111 US 20050107408 WO 2002018379 US 20060052390 WO 71147 WO 2005009965 WO 2004020440 WO 2007075896 WO 2004014900 US 20050026952 WO 2004020438 WO 2007056016 WO 2002094833 US 20040157877 WO 2004100946 EP 1609789 US 8044083 US 20040092547 WO 2008089034 WO 20050803 80 WO 2009015000 US 20040087615 WO 2008021388 WO 2005075478 WO 2007126871 US 20040077682 WO 2007146712 WO 6871 WO 2007089646 WO 71147 2018/054642 WO 2015121444 WO 2017134053 WO 4956 US 2011250197 WO 2015092423 WO 2017108736 US 20140069419 US 2015232449 WO 1997035856 WO 2005018624 WO 2016159301 _WO 2001021591 W0 2005091891 _W0 2003041644 W0 2006127678 _W0 2004019873 W0 1999001130 _W0 2004021988 W0 2002064594 _W0 2005032551 W0 2005023201 _W0 2006055302 W0 2000071535 _W0 2007005863 WO 2008072079 US 20040192653 WO 2013130573 WO 2005023761 WO 2014181213 WO 2006122230 WO 2014134313 WO 2007103839 WO 2017110093 WO 2007126871 WO 2005009973 WO 2009158446 ___- ___- The above-listed s and publications are incorporated herein by reference herein in their ties.
The present disclosure proVides methods of ng the eXpression a DUX4-fl mRNA, a DUX4 polypeptide, or a polypeptide encoded by a downstream target gene of DUX4, in cells, comprising contacting the cells with a p38 agent that s in a reduction of active p38 protein in the cell, thereby reducing eXpression the DUX4 polypeptide or the polypeptide WO 71147 encoded by the downstream target gene of DUX4. These methods may be ced using a variety of different types of p38 agents, and for modulating a variety of different biological processes in the cell, such as inhibiting apoptosis, as well as for treating subjects for diseases associated with aberrant DUX4 expression, such as FSHD. In particular embodiments, the p38 protein is p3 8-(1 and/or p3 8-B. In particular embodiments, the p38 n is not p3 8-7. In n embodiments, the p38 agent binds a p38 protein, e.g., p3 8-(1 or p3 8-B, or binds a polynucleotide encoding the p38 protein, e.g., p3 8-(1 or p3 8-B, or an antisense polynucleotide f 8] In certain embodiments of any of the methods disclosed herein, the cell is a muscle cell, optionally a terminally differentiated muscle cell. In some embodiments, the cell has an increased sion level of the DUX4-fl mRNA, the DUX4 ptide, or the polypeptide encoded by the downstream target gene, as compared to the expression level of the DUX4-fl mRNA, the DUX4 polypeptide, or the polypeptide encoded by the downstream target gene, in a control cell, e.g., a cell obtained from a healthy subject. In some embodiments, the increased sion level of the DUX4-fl mRNA, the DUX4 polypeptide, or the polypeptide encoded by the ream target gene, is due to reduced repression at a D424 locus in the cell. In certain embodiments, the cell is associated with facioscapulohumeral muscular dystrophy , e.g., it was obtained from a subject sed with FSHD or is present within a subject diagnosed with FSHD. In some embodiments, the cell comprises a deletion of one or more macrosatellite D4Z4 repeats in the subtelomeric region of chromosome 4q35, optionally wherein the cell comprises <7 macrosatellite D4Z4 repeats in the subtelomeric region of chromosome 4q35. In some embodiments, the cell comprises one or more mutations in a Structural Maintenance Of Chromosomes Flexible Hinge Domain Containing l (SMCHDl) gene. In some embodiments, the cell ses at least one non-deleted 4qA allele. In certain embodiments of the methods disclosed herein, the p38 agent inhibits the expression or activity, or reduces the amount, of the p38 protein, wherein the activity is ally kinase activity.
In some embodiments, the p38 agent inhibits the expression of the p38 protein. In ular embodiments, the p38 agent binds a polynucleotide encoding the p38 protein, or binds an antisense polynucleotide thereof. In particular embodiments, the p38 agent comprises or consists of a nucleic acid, optionally a DNA, RNA, guide RNA (gRNA), short hairpin RNA (shRNA), small interfering RNA (siRNA), or antisense oligonucleotide.
In some embodiments, the p38 agent inhibits the activity of the p38 protein. In particular embodiments, the p38 agent binds the p38 n. In particular embodiments, the p38 agent comprises or consists of a polypeptide, optionally a protein, a e, a protein mimetic, a omimetic, or an antibody or functional nt thereof. In some ments, the p38 agent comprises a small molecule, optionally a small organic molecule or a small inorganic molecule.
In certain embodiments of any of the methods disclosed herein, the downstream target gene is RFPLZ, CCNAl, SLC34A2, TPRXl, KHDClL, ZSCAN4, PRAIVIEFZO, TRIM49, PRAlVlEF4, PRAlVlE6, PRAIVIEFlS or ZNF280A.
In particular embodiments of any of the methods disclosed herein, the expression or the activity of the p38 protein, or the amount of the p38 protein, is d by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%.
In a related embodiment, the present disclosure provides a method of treating or preventing a disease or disorder associated with increased expression of a DUX4-fl mRNA, a DUX4 protein, or a polypeptide encoded by a downstream target gene of DUX4, in a t in need thereof, comprising providing to the t a pharmaceutical composition comprising an p38 agent that results in a reduction in the amount of active p38 protein in one or more tissue of the subject, thereby reducing expression of the DUX4-fl mRNA, the DUX4 protein, or the polypeptide encoding the downstream target gene in one or more tissue of the subject.
In many embodiments, the cells are muscle cells. In some embodiments, the cells are terminally-differentiated muscle cells.
] In some embodiments, the cells include one or more mutations in a Structural Maintenance Of Chromosomes Flexible Hinge Domain ning l (SMCHDl) gene. In some embodiments, the cells may include at least one non-deleted 4qA allele.
In many embodiments, the cells may include an increased expression level of a DUX4 polypeptide, or a polypeptide d by one or more downstream target genes, as compared to the expression level of a DUX4 ptide, or a polypeptide encoded by one or more downstream target genes in a control cell.
In many embodiments, the DUX4 is a DUX4 full length (DUX4-fl).
In some ments, the cells may be associated with FSHD.
In some embodiments, the disorder is associated with DUX4 gene expression.
In some ments, the disorder is associated with DUX4 gene expression and the DUX4 gene sion may result from the subject haVing less than 10 D4Z4 repeats in the omeric region of chromosome 4q35. In some embodiments, the cells may include a deletion of one or more macrosatellite D4Z4 repeats in the subtelomeric region of chromosome 4q35. In other embodiments, the cells may include less than 7 macrosatellite D4Z4 repeats in the omeric region of chromosome 4q35.
In some embodiments, the cells may include a ulated D4Z4 array at chromosome 4q35 prior to administration of the p38 agent. In one embodiment, the cells may include a dysregulated D4Z4 array including fewer than 11 repeat units. In some embodiments, the dysregulated D4Z4 array may include fewer than 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 repeat units.
In some ments, the cells are muscle cells and the cells may include a dysregulated D4Z4 array at chromosome 4q35 prior to administration of the p38 agent. In one embodiment, the muscles cells may e a dysregulated D4Z4 array including fewer than 11 repeat units. In some embodiments, the dysregulated D4Z4 array may include fewer than 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 repeat units.
In some embodiments, the disorder is FSHD. FSHD may e one or more of FSHDl and FSHDZ. In one embodiment, the disorder is FSHDl. In another embodiment, the disorder is FSHDZ. In one embodiment, the disorder is FSHDl and FSHDZ.
In one embodiment, the disorder is ICF.
In one embodiment, the disorder is ALS.
In one embodiment, the disorder is IBM.
In one embodiment, the disorder is cancer. The cancer may be selected from Ewing’s sarcoma, soft tissue sarcoma, rhabdomyosarcoma, and adult and pediatric B-cell acute lymphoblastic leukemia.
In some embodiments, the disorder may be selected from one or more of: FSHDl, FSHDZ, ICF, ALS, IBM, Ewing’s sarcoma, soft tissue sarcoma, rhabdomyosarcoma, and adult and pediatric B-cell acute lymphoblastic leukemia.
In one embodiment, the subject is identified as haVing FSHD based upon the ce of a transcriptionally active DUX4. In another ment, the subject is identified as haVing FSHD based upon the presence of one or more downstream genes ZSCAN4, LEUTX, WO 71147 PRAMEFZ, TRIM43, l\/fl3D3L2, , RFPLZ, CCNAI, SLC34A2, TPRXl, PRAMEFZO, TRIM49, PRAMEF4, PRAME6, PRAMEFlS, and ZNF280A in muscle. In another embodiment, the subject is identified as having FSHD based upon the presence of increased expression levels of one or more downstream genes ZSCAN4, LEUTX, PRAMEFZ, TRIM43, l\/fl3D3L2,KHDC1L,RFPL2, CCNAI, SLC34A2, TPRX1,PRAMEF20, TRIM49, PRAMEF4, PRAME6, PRAMEFl 5, and A relative to a healthy control. In another embodiment, the subject is identified as having FSHD based upon the presence of a transcriptionally active DUX4 and the presence of ream genes ZSCAN4, LEUTX, PRAMEFZ, TRIM43, l\/fl3D3L2,KHDC1L,RFPL2, CCNAI, 2, PRAMEF20, TRIM49, PRAMEF4, PRAlVlE6, PRAlVlEFl 5, and ZNF280A.
In another embodiment, the method may include measuring the expression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAIVIEFZ, TRIM43, lVfl3D3L2, KHDClL, RFPLZ, CCNAI, SLC34A2, TPRXl, PRAMEFZO, TRIM49,PRA1VIEF4,PRA1VIE6,PRA1VIEF15, and ZNF280A in the subject prior to the administration of the p38 agent. The method may further include determining that the t is in need of treatment if the expression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAIVIEFZ, TRIM43, lVfl3D3L2, KHDClL, RFPLZ, CCNAl, 2, TPRXl, PRAIVIEFZO, TRIM49, PRAIVIEF4, PRAIVIE6, EFl 5, and ZNF280A is/are elevated relative to a healthy control.
In another embodiment, the method may include measuring the expression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAIVIEFZ, TRIM43, lVfl3D3L2, KHDClL, RFPLZ, CCNAI, SLC34A2, TPRXl, PRAMEFZO, TRIM49,PRA1VIEF4,PRA1VIE6,PRA1VIEF15, and ZNF280A in the cells of the subject before and after the administration of the p38 agent. The method may include comparing the expression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAMEFZ, TRIM43, l\/fl3D3L2,KHDC1L,RFPL2, CCNAI, SLC34A2, TPRXl, PRAIVIEFZO, , EF4, PRAlVlE6, PRAlVlEFlS, and ZNF280A in the subject before and after the administration of the p38 agent. The method may e determining the effectiveness of treatment by the comparing of the expression level of one or more of: DUX4, ZSCAN4, LEUTX, PRAIVIEFZ, TRIM43, lVfl3D3L2, KHDClL, RFPLZ, CCNAl, SLC34A2, TPRXl, PRAIVIEFZO, , PRAIVIEF4, PRAlVlE6, EFlS, and ZNF280A before and after the administration of the p38 agent, wherein a decrease in the expression level(s) is indicative of effective treatment.
In some embodiments, the p38 agent reduces one or more downstream genes ed from ZSCAN4, LEUTX, PRAIVIEFZ, TRIM43, lVfl3D3L2, KHDClL, RFPLZ, CCNAl, 2, TPRXl, PRAIVIEFZO, TRIM49, PRAlVlEF4, PRAlVlE6, PRAlVlEFl 5, and ZNF280A.
In one embodiment, the p38 agent reduces MBD3L2.
In one embodiment, the p38 agent reduces ZSCAN4.
] In one ment, the p38 agent reduces LEUTX. 6] In one embodiment, the p38 agent reduces PRAMEFZ.
In one embodiment, the p38 agent reduces TRIM43.
In one embodiment, the p38 agent reduces KHDClL.
In one embodiment, a transcriptional modulator of DUX4 and downstream genes ZSCAN4, LEUTX, PRAIVIEFZ, TRIM43, lVfl3D3L2, KHDClL, RFPLZ, CCNAl, SLC34A2, TPRXl, PRAIVIEFZO, TRIM49, PRAlVlEF4, PRAlVlE6, PRAIVIEFlS, and ZNF280A are inhibited by p38 kinase.
In some embodiments, the stering may be combined with clinical ment ing physical therapy, aerobic exercise, respiratory function y, orthopedic interventions.
In some embodiments, the administering includes administering of the p38 agent with another ceutical agent. 2] In some embodiments, the administering includes administering of the p38 agent with another pharmaceutical agent for the treatment of FSHD.
In some embodiments, the administering causes a decrease in muscle degeneration.
In some embodiments, the administering causes a reduction in apoptosis of muscle cells in the subject. In one embodiment, the muscles cells are terminally differentiated.
In several embodiments, a method for treating facioscapulohumeral muscular dystrophy (FSHD) is provided. The method may include administering to a subject in need f, an ive amount of a p38 agent described herein, or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof.
In some embodiments, the disorder is FSHD. FSHD may include one or more of FSHDl and FSHDZ. In one embodiment, the disorder is FSHDl. In another embodiment, the disorder is FSHDZ. In one embodiment, the disorder is FSHDl and FSHDZ.
Modified nds of the Invention 7] A modified nd of any one of such compounds including a modification having an improved, e.g., enhanced, greater, pharmaceutical solubility, ity, bioavailability and/or therapeutic index as a compared to the unmodified compound is also contemplated. The examples of modifications include by not limited to the prodrug derivatives, and isotopically- d compounds, e.g., deuterium-enriched compounds.
Prodrug derivatives: prodrugs, upon administration to a subject, will converted in vivo into active compounds of the t invention (Nature Reviews of Drug Discovery, 2008, 7:255). It is noted that in many instances, the prodrugs themselves also fall within the scope of the range of compounds according to the present invention. The prodrugs of the compounds of the present invention can be prepared by rd organic reaction, for e, by reacting with a carbamylating agent (e.g., yloxyalkylcarbonochloridate, para-nitrophenyl carbonate, or the like) or an acylating agent. Further examples of s and strategies of making prodrugs are described in Bioorganic and Medicinal Chemistry Letters, 1994, 4: 1985.
Certain isotopically-labelled compounds of the various ae (e.g., those labeled with 3H and 14C) are useful in compound and/or substrate tissue distribution assays. ted (i.e., 3H) and carbon-14 (i.e., 14C) isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with heavier isotopes such as deuterium (1'.e., 2H) may afford certain therapeutic ages resulting from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements) and hence may be preferred in some circumstances. Isotopically labelled compounds of the various Formulae can generally be prepared by following procedures ous to those disclosed in the Schemes and/or in the Examples herein below, by substituting an appropriate isotopically labelled reagent for a non- ically labelled reagent.
Deuterium-enriched compounds: deuterium (D or 2H) is a stable, non-radioactive isotope of hydrogen and has an atomic weight of 2.0144. Hydrogen naturally occurs as a e of the isotopes xH (hydrogen or protium), D (2H or deuterium), and T (3H or tritium). The natural abundance of deuterium is 0.015%. One of ordinary skill in the art recognizes that in all chemical compounds with a H atom, the H atom actually represents a mixture ofH and D, with about 0.015% being D. Thus, compounds with a level of deuterium that has been enriched to be greater than its natural abundance of 0.015%, should be considered unnatural and, as a result, novel over their nonenriched counterparts.
The present disclosure is intended to include all isotopes of atoms occurring in the present compounds. Isotopes include those atoms having the same atomic number but different mass numbers. In particular one, some, or all hydrogens may be deuterium. Radioactive isotopes may be used, for ce for structural analysis or to facilitate tracing the fate of the compounds or their lic products after administration. By way of general example and without limitation, isotopes of hydrogen include deuterium and tritium and isotopes of carbon include C- 13 and C- l 4.
It should be ized that the compounds of the present invention may be present and optionally administered in the form of salts, and solvates. For example, it is within the scope of the present invention to convert the nds of the present invention into and use them in the form of their ceutically acceptable salts derived from various organic and inorganic acids and bases in accordance with ures well known in the art. 3] When the compounds of the present ion possess a free base form, the compounds can be prepared as a pharmaceutically acceptable acid addition salt by reacting the free base form of the nd with a pharmaceutically acceptable inorganic or organic acid, e.g., hydrohalides such as hydrochloride, hydrobromide, hydroiodide; other l acids such as e, nitrate, phosphate, etc.; and alkyl and ylsulfonates such as ethanesulfonate, toluenesulfonate and benzenesulfonate; and other organic acids and their corresponding salts such as acetate, tartrate, e, succinate, citrate, benzoate, salicylate and ascorbate. Further acid addition salts of the present invention include, but are not limited to: adipate, alginate, arginate, aspartate, bisulfate, bisulfite, bromide, butyrate, camphorate, camphorsulfonate, caprylate, chloride, chlorobenzoate, cyclopentanepropionate, digluconate, dihydrogenphosphate, dinitrobenzoate, dodecylsulfate, fumarate, galacterate (from mucic acid), galacturonate, glucoheptaoate, gluconate, glutamate, glycerophosphate, hemisuccinate, hemisulfate, heptanoate, hexanoate, hippurate, 2-hydroxyethanesulfonate, iodide, isethionate, tyrate, lactate, lactobionate, malonate, mandelate, metaphosphate, methanesulfonate, benzoate, monohydrogenphosphate, 2-naphthalenesulfonate, nicotinate, e, oleate, pamoate, pectinate, persulfate, phenylacetate, 3-phenylpropionate, phosphonate and ate. It should be recognized that the free base forms will typically differ from their respective salt forms somewhat in physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free base forms for the purposes of the present invention. 4] When the compounds of the present invention possess a free acid form, a ceutically acceptable base addition salt can be prepared by reacting the free acid form of the compound with a pharmaceutically acceptable inorganic or organic base. es of such bases are alkali metal hydroxides including potassium, sodium and lithium hydroxides; alkaline earth metal hydroxides such as barium and m hydroxides; alkali metal alkoxides, e.g., ium ethanolate and sodium propanolate; and various organic bases such as ammonium hydroxide, piperidine, diethanolamine and N—methylglutamine. Also ed are the aluminum salts of the compounds of the present invention. r base salts of the present invention include, but are not limited to: copper, ferric, ferrous, lithium, magnesium, manganic, manganous, potassium, sodium and zinc salts. Organic base salts include, but are not d to, salts of primary, secondary and tertiary amines, substituted amines including naturally occurring tuted amines, cyclic amines and basic ion exchange resins, e.g., arginine, betaine, caffeine, chloroprocaine, choline, N,N' -dibenzylethylenediamine (benzathine), dicyclohexylamine, diethanolamine, 2-diethylaminoethanol, thylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N—ethylpiperidine, glucamine, amine, histidine, hydrabamine, iso-propylamine, ine, lysine, meglumine, N—methyl-D-glucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethanolamine, triethylamine, trimethylamine, tripropylamine and tris- (hydroxymethyl)-methylamine (tromethamine). It should be recognized that the free acid forms will typically differ from their respective salt forms somewhat in physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acid forms for the purposes of the present invention.
In one aspect, a pharmaceutically acceptable salt is a hydrochloride salt, hydrobromide salt, esulfonate, toluenesulfonate, acetate, fumarate, e, bisulfate, ate, citrate, phosphate, maleate, nitrate, te, benzoate, bicarbonate, carbonate, sodium hydroxide salt, calcium ide salt, potassium hydroxide salt, tromethamine salt, or mixtures thereof.
Compounds of the present invention that comprise tertiary nitrogen-containing groups may be quaternized with such agents as (Ci-4) alkyl halides, e.g., methyl, ethyl, iso-propyl and tert—butyl chlorides, bromides and iodides; di-(Cl_4) alkyl sulfates, e.g., dimethyl, diethyl and diamyl sulfates; alkyl halides, e.g., decyl, dodecyl, lauryl, myristyl and stearyl chlorides, es and s; and aryl (Ci-4) alkyl halides, e.g., benzyl de and phenethyl bromide.
Such salts permit the preparation of both water- and oil-soluble compounds of the invention.
Amine oxides, also known as N—oxide and N—oxide, of anti-cancer agents with tertiary nitrogen atoms have been ped as prodrugs (Mal. Cancer Therapy, 2004 Mar, 3(3):233-244 ). nds of the present invention that comprise tertiary en atoms may be oxidized by such agents as hydrogen peroxide (H202), Caro's acid or peracids like meta-Chloroperoxybenzoic acid (mCPBA) to from amine oxide.
Pharmaceutical Compositions The invention encompasses pharmaceutical compositions comprising the compound of the t invention and ceutical excipients, as well as other tional ceutically inactive agents. Any inert excipient that is commonly used as a carrier or diluent may be used in compositions of the present invention, such as sugars, polyalcohols, e polymers, salts and lipids. Sugars and cohols which may be employed include, without limitation, lactose, sucrose, mannitol, and sorbitol. Illustrative of the soluble polymers which may be employed are polyoxyethylene, poloxamers, polyvinylpyrrolidone, and dextran.
Useful salts include, without limitation, sodium chloride, magnesium chloride, and calcium chloride. Lipids which may be employed include, without limitation, fatty acids, glycerol fatty acid esters, glycolipids, and phospholipids.
In addition, the pharmaceutical compositions may further comprise binders (e.g., acacia, cornstarch, gelatin, carbomer, ethyl cellulose, guar gum, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, povidone), disintegrating agents (e.g., cornstarch, potato starch, alginic acid, silicon dioxide, croscarmellose sodium, crospovidone, guar gum, sodium starch ate, Primogel), s (e.g., tris-HCL, acetate, phosphate) of various pH and ionic strength, additives such as albumin or gelatin to prevent absorption to surfaces, detergents (e.g., Tween 20, Tween 80, Pluronic F68, bile acid salts), protease inhibitors, surfactants (e.g., sodium lauryl sulfate), permeation enhancers, lizing agents (e.g., glycerol, polyethylene glycerol, cyclodextrins), a glidant (e.g., colloidal silicon dioxide), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite, butylated hydroxyanisole), stabilizers (e.g., ypropyl cellulose, ypropylmethyl cellulose), viscosity increasing agents (e.g., er, colloidal silicon dioxide, ethyl cellulose, guar gum), sweeteners (e.g., sucrose, aspartame, citric acid), flavoring agents (e.g., peppermint, methyl salicylate, or orange flavoring), preservatives (e.g., Thimerosal, benzyl alcohol, parabens), lubricants (e.g., stearic acid, magnesium stearate, polyethylene glycol, sodium lauryl sulfate), flow-aids (e.g., dal silicon dioxide), plasticizers (e.g., diethyl phthalate, triethyl citrate), fiers (e.g., carbomer, hydroxypropyl cellulose, sodium lauryl sulfate, methyl cellulose, hydroxyethyl cellulose, carboxymethylcellulose sodium), polymer coatings (e.g., poloxamers or poloxamines), coating and film forming agents (e.g., ethyl ose, acrylates, polymethacrylates) and/or adjuvants. 0] In one embodiment, the pharmaceutical compositions are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, ing implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for ation of such ations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal sions ding liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable rs. These can be prepared according to methods known to those skilled in the art, for example, as described in US. Pat. No. 4,522,811.
Additionally, the invention encompasses pharmaceutical compositions comprising any solid or liquid physical form of the compound of the invention. For example, the compounds can be in a crystalline form, in ous form, and have any particle size. The particles may be micronized, or may be agglomerated, particulate granules, powders, oils, oily suspensions or any other form of solid or liquid physical form.
When compounds according to the present invention exhibit insufficient solubility, methods for solubilizing the compounds may be used. Such methods are known to those of skill in this art, and include, but are not limited to, pH adjustment and salt formation, using co-solvents, such as ethanol, propylene glycol, polyethylene glycol (PEG) 300, PEG 400, DMA (10-30%), DMSO (10-20%), NMP (10-20%), using tants, such as polysorbate 80, rbate 20 (1-10% ), cremophor EL, Cremophor RH40, Cremophor RH6O (5-lO% ), ic F68/Poloxamer 188 (20-50%), Solutol HS15 (20-50%), Vitamin E TPGS, and d-a- tocopheryl PEG 1000 succinate (20-50%), and using advanced approaches such as micelle, addition of a polymer, nanoparticle suspensions, and liposome formation.
A wide variety of administration methods may be used in conjunction with the compounds of the present invention. Compounds of the present invention may be administered or nistered topically, orally, eritoneally, intravenously, intraarterially, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomally, via inhalation, vaginally, intraoccularly, via local delivery (for example by catheter or , subcutaneously, intraadiposally, intraarticularly, intrathecally, transmucosally, pulmonary, or parenterally, for example, by injection, including subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, racheal, subcuticular, intraarticular, subarachnoid, and intrasternal; by implant of a depot or reservoir, for example, subcutaneously or intramuscularly.
For e, the administering may be ed with myostatin inhibitors, nflammatory agents, and gene therapy to reduce pathogenic DUX4 protein production in FSHD by controlling D424 methylation, suppressing DUX4 mRNA, and inhibiting DUX4 pathways. For example, the administering may be combined with small interfering RNA (siRNA), small hairpin RNA (shRNA), NA (miRNA), CRISPR gene editing, and antisense oligonucleotides directed at DUX4 and downstream transcripts.
The compounds according to the invention may also be administered or coadministered in slow release dosage forms. Compounds may be in gaseous, liquid, semi-liquid or solid form, formulated in a manner suitable for the route of administration to be used. For oral administration, suitable solid oral formulations include tablets, capsules, pills, granules, s, sachets and escent, powders, and the like. Suitable liquid oral ations include solutions, suspensions, dispersions, syrups, ons, oils and the like. For parenteral stration, reconstitution of a lyophilized powder is typically used.
] Suitable doses of the compounds for use in treating the diseases or disorders bed herein can be determined by those skilled in the relevant art. Therapeutic doses are generally identified through a dose ranging study in humans based on preliminary evidence derived from the animal studies. Doses must be sufficient to result in a desired therapeutic benefit without causing unwanted side effects. Mode of administration, dosage forms and suitable pharmaceutical excipients can also be well used and adjusted by those skilled in the art.
All changes and cations are envisioned within the scope of the present patent ation. 6] In some embodiments, a compound described herein may be administered at a dosage from about 1 mg/kg to about 60 mg/kg, or more. For example, the compound may be administered to a subject at a dosage of 5, 10, 15, 20, 25, 40, 35, 40, 45, 50, 55, or 60 mg/kg, or within a range between any of the proceeding values, for example, between about 30 mg/kg and about 40 mg/kg, between about 5 mg/kg and about 20 mg/kg, and the like. In another ment, a compound described herein may be administered at a dosage from about 1 mg/kg to about 20 mg/kg. For example, the compound may be administered to a subject at a dosage of l, 2, 3, 4, 5, 6, 7, 8, 9,10,11,12,l3,l4,15,16,17,l8,l9 or 20 mg/kg, or within a range between any of the proceeding values, for e, between about 10 mg/kg and about 15 mg/kg, between about 6 mg/kg and about 12 mg/kg, and the like. In r embodiment, a compound described herein is administered at a dosage of 515 mg/kg. For example, a compound may be administered at 15 mg/kg per day for 7 days for a total of 105 mg/kg per week. For example, a compound may be administered at 10 mg/kg twice per day for 7 days for a total of 140 mg/kg per week.
In many embodiments, the dosages described herein may refer to a single dosage, a daily dosage, or a weekly dosage.
In one embodiment, a compound may be administered up to 120 mg/kg per day.
In one embodiment, a compound may be administered up to 840 mg/kg per week In one embodiment, a compound may be administered once per day. In another ment, a compound may be administered twice per day. In some embodiments, a compound may be stered three times per day. In some embodiments, a compound may be four times per day.
In some embodiments, a nd described herein may be administered 1, 2, 3, 4, , 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 times per week. In other embodiments, the compound is administered once biweekly.
In some embodiments, a compound described herein may be administered orally.
In some embodiments, a compound described herein may be administered orally at a dosage of £15 mg/kg once per day.
In some embodiments, the nd of Formula (V’) may be administered orally at a dosage of £15 mg/kg once per day.
In some ments, a compound described herein is stered orally at 515 mg/kg twice per day.
In some ments, the compound of Formula (V’) may be administered orally at a dosage of £15 mg/kg twice per day.
The actual dosage employed may be varied depending upon the requirements of the patient and the severity of the condition being treated. ination of the proper dosage regimen for a particular situation is within the skill of the art. For convenience, the total daily dosage may be divided and administered in ns during the day as required.
The dosage n utilizing the disclosed compound is selected in accordance with a variety of factors including type, species, age, weight, seX and medical condition of the patient; the severity of the condition to be treated; the route of administration; the renal or c function of the patient; and the particular disclosed compound employed. A physician or veterinarian of ordinary skill in the art can readily determine and prescribe the effective amount of the drug required to prevent, counter or arrest the ss of the ion.
The amount and frequency of administration of the compounds of the invention and/or the pharmaceutically acceptable salts thereof will be regulated according to the judgment of the attending clinician considering such factors as age, condition and size of the patient as well as severity of the symptoms being treated.
ASO antisense oligonucleotides DAPI 4’,6-diamidinophenylindole (dihydrochloride) DMSO dimethyl sulfoxide DUX4 double homeobox 4 DUX4-fl double homeobox 4 full length FSHD facioscapulohumeral muscular dystrophy gRNA guide RNA MBD3L2 methyl CpG g domain protein 3 like 2 WO 71147 MHC myosin heavy chain MPAK14 mitogen-activated protein kinase 14 mRNA ger RNA MYOG myogenin (myogenic factor 4) p HSP27 orylated heat shock protein 27 PCR polymerase chain reaction pLAM polyadenylation signal sequence POLRZA RNA Polymerase ll Subunit A qPCR quantitative polymerase chain reaction RNA ribonucleic acid ngNA single guide RNA siRNA small interfering RNA EXAMPLES The disclosure is further illustrated by the ing examples, which are not to be construed as limiting this disclosure in scope or spirit to the specific procedures herein described. It is to be understood that the examples are provided to rate certain embodiments and that no limitation to the scope of the disclosure is intended thereby. It is to be further understood that resort may be had to various other embodiments, modifications, and equivalents thereof which may suggest themselves to those skilled in the art without deparating from the spirit of the present disclosure.
MATERIALS AND METHODS Materials: Human skeletal muscle myoblasts: 0] FTCE01 (immortalized FSDH myoblast line, 6.3 repeats) and isogenic lines A4 control healthy normal and C12 FSHD myoblasts were used for all studies (as bed in Mamchaoui et al., 2011; Thorley et al., 2016). Four distinct patient myoblast lines, FTCE-016, - 020, -197, -196 were provided by R. Tawil. The FSHD myoblasts were shown to express aberrant DUX4 Via ylation of the D4Z4 on chromosome 4q3 5.
Media components and tissue culture materials included: Skeletal Muscle Growth Medium (PromoCell, C-23160) supplemented with 15% FBS (Hyclone, SH30071) and Pen/Strep (Gibco, 15140148). Skeletal Muscle Cell Differentiation Medium (PromoCell, C-23061) supplemented with 20% KnockOut Serum Replacement (Gibco, 10828010) and Pen/Strep (Differentiation media). EmbryoMaX 0.1% Gelatin Solution (EMDmillipore -B). PBS (Gibco, 10010023),Tissue culture d 96- well microplate ng, CLS3595),TC-Treated Multiwell Cell Culture Plat (Falcon, 353046).
Real Time PCR reagents and kits: Lysis buffer-Roche Realtime Ready lysis buffer 19.5 uL. (for 20 uL) (Roche, 07248431001), DNAse I (Ambion, ) 0.25 uL, Protector RNase Inhibitor , 3335402001) 0.25 uL,. RNeasy Micro Kit n, 74004), Taqman Preamp Master MiX (ThermoFisher Scientific, 4391128), Taqman Multiplex Master MiX oFisher Scientific, 4484262), ZSCAN4 Taqman Assay (ThermoFisher Scientific, Hs00537549_m1, FAM-MGB), MY0G Taqman Assay (ThermoFisher Scientific, Hs01072232_m1, JUN-QSY), RPLPO Taqman Assay (ThermoFisher Scientific, Hs99999902_m1), LEUTX Taqman Assay (ThermoFisher ific, Hs00418470_m1).
Antisense Oligonucleotides (ASOs) ASOs were purchased from EXiqon: FTSE-000001 (DUX4 ASO from EXiqon, CAGCGTCGGAAGGTGG (SEQ ID NO: 1), 300610)), Non-targeting ASO (EXiqon, AACACGTCTATACGC (SEQ ID NO: 2), 300610) Gelatin Coating of Tissue Culture Dishes: med three days prior to ent, 0.1% gelatin on was made by combining 1 g gelatin (e. g. Sigma G9391) and 1 L tissue culture grade water; autoclave for 30 minutes to dissolve and sterilize. Sufficient 0.1% gelatin to coat the using a sterile pipette, aspirate the solution until all of the dishes have been coated. Air dried and store in original sleeve at room temperature.
] Cell Plating: Performed three days prior to ent, 10000 cells were plated per well on gelatinized 96-well , or 100000 cells on gelatinized 6-well plates.
Antisense Oligonucleotide and compound treatment: For ASO or compound treatments cells were plate into 100 uL of Promocell growth medium containing ASO or compounds at the described concentrations.
Skeletal muscle myotube differentiation: On day 0, change to differentiation media. Remove plates from the incubator and aspirate the growth medium, Wash once with PBS, 100 [L for 96-wells and 1 mL for a 6-well plate, Add 100 [L or 2 mL of differentiation medium per well, 96- or 6-well respectively. Add antisense oligonucleotides or drug at the desire concentration and put back in the incubator.
Fusion should start within day 1-2. te for 3-4 days.
RNA preparation: Cells were removed from the incubator and media aspirated. Quickly lysed ing one of the following protocols: For lysis in 96-well plates direct lysis and one-step RT-Preamp qPCR protocol described below. For each 96-well prepare a mix containing: 19. 5 [LL Roche Realtime Ready lysis buffer, 0.25 uL RNAse inhibitor, 0.25 uL DNAseI (from Thermo not the included one in the kit). 20 uL of the miX was added to each well, miX 5 times and incubated 5 minutes at RT or alternatively shaken vigorously for 15 s. Lysis was observed under the microscope. Samples were frozen -80 CC at least for 15 minutes, qPCR One Step: For qPCR, dilute 1:10 and use 2 [L for a 10 [LL 1-step RT-qPCR reaction. For detection of GAPDH, RPLPO, TBP, MY0G, FRGl, MYH3, ACTN2, etc.). Per 10 [LL reaction: RNA (1:10 dilution lysate) 2 uL, Fast Advanced Taqman Master Mix (2X) 5 uL, RT enzyme mix (40X) 0.25 uL, Taqman probe set (20X) 0.5 uL, H20 2.25 uL. The following reaction protocol was run on the QuantStudio 7: 48 CC for 15 min, 50 °C for 2 min, 95 °C for 30 sec, 40x, 95 CC for 5 sec, 60 °C for 30 sec, then plates were read as specified by the manufacturer (Thermo). For 1-step RT-Preamplification used for detection of DUX4 ream genes, i.e. 1Vfl3D3L2, ZSCAN4, LEUTX, TRIM43, KHDClL. POL2RA-VIC was used as Endogenous control). Per 10 uL reaction: RNA (1: 10 dilution lysate) 2.25 uL, Taqman Pre-Amp Master Mix (2X) 5 uL, RT enzyme mix (40X) 0.25 uL, Taqman probe set (0.2X)* 2.5 uL, * g the TaqMan Assays: equal s of each 20X TaqMan® Gene Expression Assay, up to 100 assays were combined. For example, to pool 50 TaqMan assays, 10 uL of each assay were combined in a microcentrifuge tube.. The pooled TaqMan assays were diluted using 1X TE buffer so that each assay is at a final concentration of 0.2X. For the above example, add 500 uL of IX TE buffer to the pooled TaqMan assays for a total final volume of 1 mL. The QuantStudio7 protocol was used 48 CC 15 min, 95 °C 10 min, 10 : 95 CC 15 sec, 60 CC 4 min, 4 °C infinite. Samples were then diluted to 50 uL and continue with the qPCR step.
Per 10 uL reaction: Preamp dilution 2 uL, Fast Advanced Taqman Master Mix (2X) 5 uL, Taqman probe set (20X) 0.5 uL, H20 2.5 uL. When multiplexing the volume was adjusted to 10 uL total). The following program was run on the QuantStudio7: 50 CC for 2 min, 95 CC for 30 sec, 40x, 95 CC for 5 sec, 60 CC for 30 sec, plates were read as per the cturers specifications (Thermo).
Methods for total RNA extraction from myotubes using RNeasy Micro Plus Kit: In a 6 well plate, 450 uL Buffer RLT Plus was added. Lysate was nized by transfer the lysate to a gDNA Eliminator spin column placed in a 2 mL collection tube (supplied), centrifuged for 30 s at 28000 x g (210,000 rpm) and discarded column while saving the flow-through. Then 250 uL of Ethanol (3 5% final) was added to the rough, and mixed well by ing, not centrifuged. Then samples were transferred, including any precipitate that may have formed, to an RNeasy MinElute spin column placed in a 2 mL collection tube (supplied). Then fuged for 15 s at 28000 x g. Flow-through was discarded or collected for Protein precipitation. 700 uL Buffer RWl to the RNeasy MinElute spin column was added then fuge for 15 s at 28000 X g. and discard the flow-through. DNAse treatment was performed by gently mixing 10 uL DNAseI with 70 uL of Buffer RDD and added directly to the column, incubated at room temperature for 20 min. Then, 700 uL Buffer RWl (per manufactures specification) to the RNeasy MinElute spin column, centrifuged for 15 s at 28000 X g. and the flow-through discarded. 500 uL Buffer RPE was added to the RNeasy MinElute spin column centrifuged for 15 s at 28000 X g and discarded the flow-through. 500 uL of 80% ethanol was added to the RNeasy MinElute spin column, centrifuged for 2 min at 28000 X g to wash the spin column ne and the collection tube was discarded with the flow-through. The RNeasy MinElute spin column was placed in a new 2 mL collection tube (supplied) centrifuged at full speed for 5 min to dry the membrane and the collection tube was discarded with the flow through. RNeasy MinElute spin column was placed in a new 1.5 mL collection tube (supplied). 14 uL RNase-free water was added directly to the center of the spin column ne, and centrifuged for 1 min at full speed to elute the RNA. You should end up with about 12 uL of eluted RNA.
Detection of l using method bed by Himeda et a1. 2015: cDNA preparation. Per 10 uL reaction: RNA (1 pg) 1 uL, Oligo dT 0.5 uL, 10 mM dNTPs 0.5 uL, H20 4.5 uL, Samples were Incubated at 65 CC for 2 min and quickly move to ice and held at least 1 min before adding the enzyme miX, 5X First strand Buffer 2 uL, 0.1M DTT 0.5 uL, RNAse inhibitor 0.5 uL, SSIV RT 0.5 uL, s were incubated at 55 CC for 20 min and 80 CC for 10 min, with cool down to 4 CC. DUX4 pre-amplification was med: Per 10 uL reaction, RT reaction 1 uL, 5X GC buffer 2 uL, DMSO 0.8 uL, 10 mM dNTPs 0.2 uL, 10 uM TJ38F 0.2 uL, 10 uM TJ40R 0.2 uL, Phusion II DNA pol 0.1 uL, H20 5.5 uL. The following protocol was run on the QuantStudio 7: 98 CC 2 min, 10 cycles of 98 CC, 15 seconds, 64 CC, 20 seconds, 72 CC, 15 seconds, 4 CC infinite. DUX4 qPCR with nested primers: per 10 uL reaction, DUX4 pre amplification DNA 1 “L, 2X IQ SYBR MiX 5 “L, 10 uM TJ3 8F 0.4 “L, 10 uM TJ41R 0.4 uL, H20 3.2 uL. The following protocol was run on the QuantStudio7 95 CC 3 min, 40 cycles of, 95 CC 10 seconds, 64 CC 15 seconds, 72 CC 20 seconds, 86 CC 10 seconds then read plate on QuantStudio7 as per manufactures ction ( Thermo). Ct values were eXtracted from the QuantStudio Realtime PCR software and Genedata was used to calculate relative levels of eXpression using POLR2A as a housekeeping gene. 2018/054642 FSHD Myotube Immunocytochemistry Briefly, cells were fixed in 4% paraformaldehyde and permeabilized in 4% paraformaldehyde (PFA) for 10 min at room temperature. Cells were bilized with PBST (1 X PBS solution with 0.1% Triton X-l 00) before ng with 10% Normal Donkey Serum or 3% BSA (NDS) in PBST. Cells were then incubated with appropriately d primary antibodies in PBST with 5% NDS for 1 hours at room temperature or 12 hours at 4 CC, washed with PBST for 3 times at room temperature and then incubated with desired secondary antibodies in TBST with 5% NDS and DAPI to counter stain the nuclei. DUX4 was detected by immunocytochemistry using the E5-5 antibody in differentiated FSHD myotubes. Activated e-3 was detected cell signaling antibody that we’re using for ICC, Asp175 (https://www. cellsignal. com/products/primary-antibodies/cleaved-caspase-3 -asp175- antibody/9661).
RNAseq Methods The 40 bp single-end reads from Illumina had good quality by checking with FastQC (http://www.bioinformatics.babraham.ac.uk/proj ects/fastqc/). Reads were mapped to hg19 using TopHat v2.1.1. The gene model for TopHat was created by merging known Gene in gtf format with ngref table. Both known Gene and ngref were downloaded from UCSC table browser in th9 assembly. The read counts were obtained using feature Counts function from Subread package with ness option as —r 2. Reads were normalized with DESqu. The biological replicates in the neuron samples, processed at different time periods, have batch effect as ted by principle component analysis. Consequently, Combat was used for reducing this batch effect. Calculated standard RPKM expression values. Total gene signature is very small and defined at standard statistical s: 86/19,799 mRNA genes. DUX4-regulated gene signature is majority of total signature: 77/86 mRNA genes = 90%. Non-DUX4 regulated genes is minority of total ure with moderate fold changes: 9/86 mRNA genes = 10%, 2-2.7X logFC.
Methods for siRNA and Cas9/ngNA RNP transduction of FSHD myotubes: Synthetic chNAs were purchased from Thermo Fisher Scientific and annealing to trachNAs was performed according to specifications. In short, chNAs and trachNA were resuspended in TE buffer at 100 uM, mixed, and diluted 5-fold in annealing . Annealing was performed in a ProFlex PCR system following manufacturers recommendation. 100 ng of assembled chNAztrachNA were incubated with 500 ng of TrueCut Cas9 (ThermoFisher, #A36497) in the resuspension buffer ed with the Neon transfection system kit (ThermoFisher, #MPK10096). After 15 minute incubation the reaction was used to transfect 50.000 myoblasts according to the methods bed. ces used for the targeting of MAPK14 (3 ngNAs) and pLAM region (polyadenylation sequence of DUX4, 4 gRNAs) were: NT-CTRL, GTATTACTGATATTGGTGGG (SEQ ID NO: 3); MAPK14, GCTGAACAAGACAATCTGGG (SEQ ID NO: 4), CTGCTTTTGACACAAAAACG (SEQ ID NO: 5), CTTATCTACCAAATTCTCCG (SEQ ID NO: 6); pLAM, AGAATTTCACGGAAGAACAA (SEQ ID NO: 7), CAGGTTTGCCTAGACAGCGT (SEQ ID NO: 12), ATGCCCCCTCCCTG (SEQ ID NO: 8), AATCTTCTATAGGATCCACA (SEQ ID NO: 9). siRNA MAPK14, Antisense: UAGAUUACUAGGUUUUAGGTC (SEQ ID NO: 10), ACCUAGUAAUCUATT (SEQ ID NO: 11) EXPERIMENTAL EXAMPLE 1 REPRESSION OF DUX4 USING SEQUENCE ED ANTISENSE OLIGONUCLEOTIDE REDUCES DOWNSTREAM TARGET GENES Wild type myotubes were treated with DMSO control vehicle, and mature patientderived FSHD myotubes that express DUX4 protein were treated with DMSO vehicle control or 1 uM of a DUX4 sequence-directed antisense oligonucleotide (ASO; FTX-2) purchased from . After treatment, the myotubes were lysed in 19.5 ML of Roche Real Time Ready Lysis Buffer, 0.25 ML of DNAsel n, AM2222), 0.25 ML of Protector RNase tor (Roche, 3335402001), and the RNA was collected in an RNeasy Micro Kit Master Mix. Expression levels of DUX4-regulated downstream genes (ZSCAN4, TRIM43, MBD3L2, LEUTX, and KHDClL) was determined by real time PCR (ThermoFisher Scientific, 4484262), ZSCAN4 Taqman Assay (ThermoFisher Scientific, Hs00537549_ml, FAM-MGB), MY0G Taqman Assay (ThermoFisher Scientific, HsOlO72232_ml, IUN—QSY), RPLPO Taqman Assay (ThermoFisher Scientific, Hs99999902_ml), and/or LEUTX Taqman Assay (ThermoFisher Scientific, 8470_m1). Ct values were ted from QuantStudio Realtime PCR software, and Genedata was used to calculate relative levels of expression using POLRZA as a housekeeping gene.
The results showed that FSHD es treated with DUX4 sequence directed ASO express reduced amounts of DUX4 and the DUX4 downstream transcription factor target genes, ZSCAN4, TRIM43, L2, LEUTX, and KHDClL, as compared to FSHD es treated with DMSO vehicle control (.
The data in are grouped plate y control data comparing expression of MBD3L2 mRNA in FSHD myotubes treated with DMSO control or 1 uM DUX4 ASO, and healthy normal isogenic control myotubes. shows pharmacologic quality control data and dose ent reduction of DUX4 and the downstream gene, MBD3L2, using different dilutions of the DUX4 ASO. shows plate based assay tics comparing FSHD myotubes treated with DMSO to WT: Z’ is 0.512 and Signal to Noise (S/N) is 5.1, and FSHD myotubs d with DMSO or DUX4 ASO:Z’ is 0.319 and Signal to Noise (S/N) is 4.6.
EXAMPLE 2 P3 8 SMALL MOLECULE INHIBITORS REDUCEMBD3L2 MRNA EXPRESSION Wild type myotubes and mature patient-derived FSHD myotubes that express DUX4 protein were treated with DMSO vehicle control or multiple concentrations of various p3 8(1/B inhibitors with different ranges of isoform and kinome selectivity, including SB23 9063 (; ICso = 15 nM), VX-702 (), Pamapimod (), and TAK-715 (). After treatment, the control and treated cells were processed for realtime PCR quantification of MBD3L2 mRNA (DUX4 downstream gene) and myogenin (MY0G) mRNA (control) expression. These p3 8(1/B inhibitors showed potent (ICSO approximately <10 nM, FIGS. 4A-D) reduction ofMBD3L2 mRNA sion with no impact to MY0G mRNA expression in FSHD myotubes.
In FSHD myotubes, p38 kinase inhibitors (e.g., Pamapimod) dose-dependently reduced DUX4 mRNA and DUX4 downstream gene MBD3L2 mRNA sion without 2018/054642 impacting myotube formation. When compared to DMSO treatment, 10, 100, and 1000 nM FTX000839 imod) dose-dependently reduced both DUX4-fl and MBD3L2 downstream gene mRNA levels normalized to POLR2A mRNA, as ed by qPCR and Taqman in FSHD myotubes () without impacting differentiation into myotubes (). The data show that p38 kinase tors ependently reduce MBD3L2 mRNA expression without impacting myogenin mRNA expression.
EXAMPLE 3 P38 MAPK14 MRNA ANDMBD3L2 MRNA REDUCTION VIA s1RNA KNOCKDOWN p3 801 MAPK14 85 and p3 801 MAPK14 86 siRNAs were transfected into patient FSHD myotubes as described in Materials and Methods. Each of p3 801 MAPK14 85 siRNA and p3 801 MAPK14 86 siRNA (to a lesser extent) reduced p38 MAPK14 expression, as shown in , and MBD3L2 mRNA (DUX4 target gene) expression, as shown in , as compared to non-target control siRNAs (NT CTRL 1 and NT CTRL 2). The data shows that c reduction of p3 80L MAPK14 >50% specifically reduced DUX4 and downstream target genes, as exemplified by MBD3L2.
EXAMPLE 4 MBD3L2 MRNA REDUCTION VIA P38a KINASE CAS9/SGRNA RNPs CRISPR gRNA targeting of MAPK14 or pLAM (polyadenylation signal sequence for DUX4) was conducted as described in Materials and Methods. CRISPR gRNA targeted to MAPK14 or pLAM (polyadenylation signal sequence for DUX4) resulted in a reduction in expression ofMBD3L2 but no MY0G. The data indicates that c ion of p3 80L MAPK14 specifically reduced DUX4 and downstream target genes, as exemplified by MBD3L2.
EXAMPLE 5 FTX-l 821 DOWNREGULATES DUX4 PROTEIN ANDMBD3L2 MRNA Patient-derived FSHD myotubes (with 6 repeats ofD4Z4 arrays) were treated with DMSO vehicle control and ent FTX-1821 concentrations, and DUX4 protein and MBD3L2 mRNA levels were determined as described in Methods and Materials. For DUX4 and MBD3L2, four ical replicates were analyzed. In addition, pHSP27 levels were determined.
For pHSP27 quantification, three replicates were obtained in two independent experiments.
Treatment of the FSHD t derived myotubes with FTX 1821 resulted in a concentration-dependent reduction of DUX4 protein (ICso = 25nM) and MBD3L2 mRNA (ICso = 25nM) that correlated with the changes observed in phospho HSP27 levels (ICso = lOnM) as evidence of target engagement (. The results were indicative of a concentration-dependent reduction of DUX4 protein (ICso = 25 nM) and MBD3L2 mRNA (ICso = 10 nM). The reductions in DUX4 protein and MBD3L2 mRNA correlated with the observed changes in p-HSP27 levels (ICso = 10 nM) as ce of target ment. These results indicate that p3 80L pathway tion by FTX-1821 results in potent DUX4 protein and MBD3L2 mRNA downregulation.
EXAMPLE 6 FTX-1821 DOES NOT AFFECT E FORMATION Immortalized FHSD myotubes were differentiated and treated with DMSO vehicle control or FTX-1821 at concentrations of 1 uM, 0.33 uM, 0.11 uM, or 0.037 uM. After 4 days, the cells were fixed and stained with antibodies directed against MHC or DAPI. See .
The nuclei in myotubes were fied according to MHC ng (). The results showed no changes in myotube formation or fusion after treatment with FTX-1821 at concentrations tested.
EXAMPLE 7 FTX-1821 REDUCES APOPTOSIS IN FSHD MYOTUBES Apoptosis was measured by active Caspase—3 levels in FSHD es in vitro as described in Materials and Methods. Apoptosis was detected in a sporadic manner in a subset of myotubes in culture as shown by the white circles and magnified region in . Active e-3 signal was quantified in FSHD myotubes that had been treated with FTX-1821 at different concentrations (). The results showed a ependent ion of apoptotic signal, as indicated by the reduction in detection of active e 3 (ICso = 45 nM), and this effect was specific to FSHD myotubes compared to control es. No change in active Caspase-3 signal was observed following DMSO treatment.
EXAMPLE 8 FTX-l 821 REDUCES PATHOLOGIC DUX4 TRANSCRIPTIONAL PROGRAM SION Studies were conducted as described in Methods and Materials to identify genes in the DUX4 pathway whose eXpression in down-regulated by in FSHD myotubes treated with FTX-1821 as compared to FSHD myotubes treated with DMSO vehicle control. In addition, gene eXpression was also determined in wild type myotubes treated with DMSO. Three replicates for each condition were analyzed by RNA-seq and genes were clustered by the direction and intensity of change.
As shown in the heatmap of A, a number of differentially eXpressed genes were identified by RNA-seq profiling. The bar indicates the normalized changes ed, e.g., genes that were downregulated by FTX-1821 are enriched in samples treated with only DMSO.
The eXpression of these genes was normalized upon treatment with FTX-1821 (1 uM) and closer resembled the observations in wild type cells. ated using standard RPKM sion values, the total gene ure was very small and defined at standard statistical cutoffs: 86/19,799 mRNA genes. DUX4-regulated gene signature was a majority of the total signature, and these genes are listed in FIG. lOA. Non-DUX4-regulated genes were minority of the total signature with moderate fold s: 9/86 mRNA genes = 10%, 2-2.7X logFC. B shows the normalized reads, as described in Materials and Methods, of the DUX4 target genes that were downregulated upon treatment with FTX-1821. Three independent replicates per group were analyzed.
EXAMPLE 9 REDUCTION OFMBD3L2 MRNA IN VARIOUS FSHDI GENOTYPES AND PHENOTYPES The ability of p38 kinase inhibitors to reduce expression of DUX4 target genes in cells obtained from patients having various different FSHDl genotypes was conducted as described in s and Materials. Four distinct FSHD patient myoblast lines, i.e., FTCE-Ol6, -020, -l97, and -l96 (kindly provided Rabi Tawil) were treated with FTX-1821 (1 uM) or FTX- 839 (1 uM), and mRNA levels of the DUX4 target gene, MBD3L2, were determined following treatment.
MBD3L2 expression levels were reduced in all of the FSHD lines, resulting in levels similar to those measured in y controls, FTCE-3 96 and FTCE-Ol4 (). This is evidence of DUX4 target gene reduction by p38 kinase inhibitors across myotubes derived from diverse FSHDl genotypes and phenotypes ar results were observed for FSHDZ, data not shown).
EXAMPLE 10 REDUCTION OFMBD3L2 MRNA FROM FSHDl AND FSHDZ PES AND PHENOTYPES To assess the treatment effect of p38 selective inhibition using 21 in FSHDl and FSHDZ cells, primary myoblast lines were kindly provided by Rabi Tawil at the University of Rochester. summarizes the genotypes and phenotypes of 13 FSHDl and 3 FSHDZ patient myoblasts used in the study. The s FSHDl and FSHDZ sts were treated with DMSO, 21 or FTX-839 (1 uM), and following treatment, mRNA expression levels of the DUX4 target gene, MBD3L2, were determined. In addition, apoptosis was determined by measuring active caspase-3 in the FSHDl and FSHDZ lines.
Each of the s FSHDl and FSHDZ myoblasts showed a reduction ofMBD3L2 (A, top 11 lines). The reduction resulted in expression levels similar to those in healthy control lines (CTRL- FTCE-Ol4) (A, bottom 2 lines). In on, treatment with FTX- 839 showed a reduction in sis across both FSHDl and FSHDZ lines, to a level that was similar to the amount determined in a healthy control line (CTRL- FTCE-Ol4) (B).
These results indicate that clinical FSHD biopsy myoblasts, when differentiated into myotubes, show a reduction in both pathologic DUX4 downstream gene expression and resulting cell death across both FSHDl and FSHDZ genotypes and phenotypes.
EXAIVIPLE 11 WO 71147 TARGET ENGAGEMENT IN MUSCLE OF WILD TYPE RATS FOLLOWING TREATMENT WITH A POTENT AND SELECTIVE P3 8 KINASE INHIBITOR 2] The pharmacokinetic ties of FTX-1821 were studied in an animal model. FTX- 1821 was orally dosed to fasted or unfasted male Sprague-Dawley rats (N=6 s per time point and treatment group), and phospho p3 80L : total p3 80L levels were determined.
Pharmacodynamic analysis of p38 system target ement in muscle tissue was performed by measuring the change in phosphor MAP -activated protein kinase 2 (MKZ) to total MKZ ratio before and after drug treatment. All methods used are described in the Materials and Methods section.
FTX-1821 exhibited plasma pharmacokinetic properties similar to those described previously (Aston et al., 2009; data not shown). These studies additionally demonstrated rapid distribution of FTX-1821 to multiple muscles and plasma. Muscle to plasma exposure ratios were equal to or greater than 1 in the rat when clinically nt plasma exposures were achieved.
Pharmacodynamic analysis demonstrated that a single, oral dose of FTX-l 821 (0.3mg/kg) resulted in clinically relevant plasma concentrations (Barbour et al., 2012) and significantly decreased the phospho MKZ to total MKZ ratio in rat trapezius muscle within 1- hour of drug treatment e 15). P38 system target engagement ted for at least 12 hours following the single dose of FTX-1821 (Figure 15). P38 system target engagement in trapezius muscel was maximal when plasma and muscle concentrations of FTX-l 821 were greater than 20 ng/mL or ng/g and declined at timepoints when exposures decreased. The muscle concentrations of FTX-l 821 achieved in the rat study are predicted to result in >70% reduction at Cmax in DUX4 dependent target genes in FSHD patient muscle biopsies based upon in vitro data in FSHD myotubes (above).
This pharmacokinetic and pharmacodynamic is indicated that maximal inhibition of the p38 system in muscle was achieved when plasma FTX-1821 concentrations were greater than 20 ng/mL and that significant p38 pathway inhibition would be expected, in human muscle, with clinical doses of 7.5 or 15 mg BID (Barbour et al., 2012).
EXAMPLE 12 INHIBITION OF THE DUX4 GENOMIC PROGRAM IN FSHD XENOGRAFTED MICE FOLLOWING TREATMENT WITH A POTENT AND SELECTIVE P38 KINASE INHIBITOR FSHD and l muscle xenograft mice were ted by xenografting C6 (FSHD) and A4 (control) erived human immortalized isogeneic myoblast cell lines into the bilateral tibialis anterior (TA) muscles of approximately 8-week old male Nod-Rag mice as described by Sakellariou et al., 2016. Following the 4-week long engraftment and INMES procedure, the FSHD xenografted animals were treated with BID injections of either vehicle or FTX-2865 (10 mg/kg) for 8 days (a total of 14 injections) and were sacrificed at approximately the time of maximal plasma concentrations (Tmax) l-hour after the final morning injection on Day 8. At sacrifice, plasma, trapezius muscle and bilateral tibialis anterior muscles were collected and flash frozen for analysis of pharmacokinetic endpoints, target engagement and DUX4 dependent mRNAs. lVfl3D3L2 was ed by qPCR using a human specific probe and was normalized to the housekeeping gene CDKNlB. pMKZ and MKZ protein concentrations were assessed by a quantitative MSD assay.
Analysis of TA tissue by qPCR from animals engrafted for 4-6 weeks with A4 or C6 myoblast tissues demonstrated a significant (p<0.05) and >lO-fold increase in MBD3L2 and other Dux4 dependent genes (not shown) in the FSHD (C6) vs control (A4) xenografted TA muscles (). N=8 TA samples per group. 8] Treatment of FSHD xenografted animals with the potent and selective p38 kinase inhibitor, FTX-2865, produced p38 system target engagement, as measured by a change in phospho MAP -activated protein kinase 2 (MKZ) to total MKZ ratio of >50% in the TA and trapezius muscles of wild-type mice ing repeated BID administration of a lOmg/kg dose given via intraperitoneal (IP) injection (data not shown). FTX-2865 treatment significantly (p<0.05) decreased the ratio of phospho to total MKZ in mouse ius muscle, indicating significant p38 system engagement and also indicating sufficient drug concentrations in the al muscles of the animals to inhibit the p38 system by >80% (; N=8 ius samples per group). In on, FTX-286 treatment icantly (p<0.05) decreased the expression ofMBD3L2 in the FSHD xenografted TA muscles compared to vehicle treated animals, indicating suppression of the pathologic DUX4 gene m by p38 inhibition (, N=5-7 TA s per group). 2018/054642 Equivalents While the present invention has been bed in ction with the specific embodiments set forth above, many alternatives, modifications and other ions thereof will be apparent to those of ordinary skill in the art. All such alternatives, cations and variations are intended to fall within the spirit and scope of the present invention.
Furthermore, it is intended any method described herein may be rewritten into Swiss- type format for the use of any p38 kinase inhibitor or agent described herein, for the manufacture of a medicament, in treating any of the disorders described herein. Likewise, it is intended for any method described herein to be rewritten as a compound for use claim.
For example, use of a p38 kinase inhibitor, for the manufacture of a medicament, for treating a er responsive to p38 kinase tion, wherein the p38 kinase inhibitor is characterized by Formula (V’): AN NI \ ”X F (V’), or a stereoisomer thereof, an isotopically-enriched compound thereof, a prodrug thereof, a solvate thereof, or a pharmaceutically acceptable salt thereof; wherein the disorder is associated with DUX4 gene expression, and the p38 kinase inhibitor reduces DUX4 expression levels and/or the expression of one or more downstream genes in cells of the subject.

Claims (15)

1. Use of a p38 kinase inhibitor for the manufacture of a medicament for treating facioscapulohumeral muscular dystrophy (FSHD), wherein treatment comprises administration of an effective amount of the medicament to a subject in need f, wherein the p38 kinase inhibitor is ed from: H O N N O O N N N N O F (I') (IIIa') "TAK-715" " , , H NH2 OH F N N N N N N N N O F (IIIb') (VI') "pamapimod" or "RO 4492257" "LY2228820" or "ralimetinib" , , F O O N NH N NH O Cl N N N HN (VII') (IX") "SCIO-469" or "talmapimod" "BMS-582949" or "PS-5404446" , , H H H Br N N N F N O O O N N O N (X') HO (XI') "PH-797804" , "pexmetinib" or "ARRY-614" , F F OH O OH O N O N N N F F N (XII') (XIV') "dilmapimod" or "SB-681323" "ARRY-797" or "ARRY-371797" , , N NH2 N N N OH O OH (XVI') (XVIII') 7657" "RO-3201195" , , N NH O O N N N O N N N O N H N NH2 Cl (XX') (XXI') (XXIV') "SCIO-323" 48" "SD-0006" or "SD-06" , , , N O O N S N O H O NH F N (XXVI') (XXVII') "CBS-3595" or "ML-3595" , "acumapimod" or "BCT-197" , O N OH H N S NH O O N N N O N N H F OH "AZD-7624" "PF-03715455" , , NH • HCl O N N N O S N N H H N O O O OH , , SC80036 ITX-5061 O Cl N N Br N N N 8 , and F UR-13870 or a pharmaceutically able salt thereof; and wherein administration of the medicament reduces expression levels of a DUX4 polypeptide and/or a polypeptide encoded by a DUX4 downstream gene in muscle cells of the subject.
2. The use of claim 1, wherein the DUX4 ream gene is selected from the group consisting of: ZSCAN4, LEUTX, PRAMEF2, TRIM43, MBD3L2, , RFPL2, CCNA1, SLC34A2, TPRX1, PRAMEF20, TRIM49, PRAMEF4, PRAME6, PRAMEF15, and ZNF280A.
3. The use of claim 1, wherein the muscle cells are terminally differentiated muscle cells.
4. The use of claim 1, wherein the muscle cells comprise a dysregulated D4Z4 array at chromosome 4q35.
5. The use of claim 1, wherein the facioscapuloumeral muscular dystrophy is FSHD type 1 (FSHD1).
6. The use of claim 5, wherein the muscle cells comprise a deletion of one or more macrosatellite D4Z4 repeats in the subtelomeric region of chromosome 4q35.
7. The use of claim 6, wherein the muscle cell comprises less than 11 macrosatellite D4Z4 repeats in the subtelomeric region of chromosome 4q35.
8. The use of claim 1, wherein the capuloumeral muscular dystrophy is FSHD type 2 (FSHD2).
9. The use of claim 8, wherein the muscle cells comprise one or more ons in a Structural Maintenance Of Chromosomes Flexible Hinge Domain ning 1 (SMCHD1) gene.
10. The use of claim 1, wherein the muscle cells comprise at least one non-deleted 4qA allele.
11. The use of claim 1, wherein administration causes a decrease in muscle degeneration in the subject.
12. The use of claim 1, wherein administration causes a reduction in apoptosis of muscle cells in the subject.
13. The use of claim 1, n the medicament is formulated for parenteral stration to the subject.
14. The use of claim 1, wherein the medicament is formulated for oral administration to the subject.
15. The use of claim 1, wherein the medicament is formulated for administration to the subject via inhalation.
NZ765534A 2017-10-05 2018-10-05 P38 kinase inhibitors reduce dux4 and downstream gene expression for the treatment of fshd NZ765534B2 (en)

Applications Claiming Priority (9)

Application Number Priority Date Filing Date Title
US201762568754P 2017-10-05 2017-10-05
US201762568673P 2017-10-05 2017-10-05
US62/568,754 2017-10-05
US62/568,673 2017-10-05
US201862682565P 2018-06-08 2018-06-08
US201862682563P 2018-06-08 2018-06-08
US62/682,565 2018-06-08
US62/682,563 2018-06-08
NZ762856A NZ762856A (en) 2017-10-05 2018-10-05 P38 kinase inhibitors reduce dux4 and downstream gene expression for the treatment of fshd

Publications (2)

Publication Number Publication Date
NZ765534A NZ765534A (en) 2021-04-30
NZ765534B2 true NZ765534B2 (en) 2021-08-03

Family

ID=

Similar Documents

Publication Publication Date Title
CA3077499C (en) P38 kinase inhibitors reduce dux4 and downstream gene expression for the treatment of fshd
TWI827646B (en) Ptpn11 inhibitors
JP5478262B2 (en) Anticancer drug
CA2934553C (en) Benzodiazepine derivatives, compositions, and methods for treating cognitive impairment
US10537560B2 (en) P38 kinase inhibitors reduce DUX4 and downstream gene expression for the treatment of FSHD
US20180170941A1 (en) Benzodiazepine derivatives, compositions, and methods for treating cognitive impairment
JP2022506898A (en) Compounds and compositions for treating conditions associated with NLRP activity
TW202116301A (en) Medicinal composition and application thereof
US11505555B2 (en) Benzodiazepine derivatives, compositions, and methods for treating cognitive impairment
NZ765534B2 (en) P38 kinase inhibitors reduce dux4 and downstream gene expression for the treatment of fshd
EP4313052A1 (en) Alk-5 inhibitors and uses thereof
KR20220132538A (en) Methods and compositions for inhibiting dihydroorotate dehydrogenase
WO2020087565A1 (en) Indazole kinase inhibitor and use thereof
JP2024511801A (en) (furopyrimidin-4-yl)piperazine compounds and their uses