NZ754272B2 - Heterocyclic compounds and use thereof - Google Patents

Heterocyclic compounds and use thereof Download PDF

Info

Publication number
NZ754272B2
NZ754272B2 NZ754272A NZ75427218A NZ754272B2 NZ 754272 B2 NZ754272 B2 NZ 754272B2 NZ 754272 A NZ754272 A NZ 754272A NZ 75427218 A NZ75427218 A NZ 75427218A NZ 754272 B2 NZ754272 B2 NZ 754272B2
Authority
NZ
New Zealand
Prior art keywords
compound
alkyl
aryl
heteroaryl
cycloalkyl
Prior art date
Application number
NZ754272A
Other versions
NZ754272A (en
Inventor
Ming Chen Choi
Kak Shan Shia
Chuan Shih
Jen Shin Song
Yun Wang
Chien Huang Wu
Original Assignee
National Health Research Institutes
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National Health Research Institutes filed Critical National Health Research Institutes
Priority claimed from PCT/US2018/012748 external-priority patent/WO2018132326A1/en
Publication of NZ754272A publication Critical patent/NZ754272A/en
Publication of NZ754272B2 publication Critical patent/NZ754272B2/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/496—Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene or sparfloxacin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A61K31/52—Purines, e.g. adenine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D473/00—Heterocyclic compounds containing purine ring systems
    • C07D473/02—Heterocyclic compounds containing purine ring systems with oxygen, sulphur, or nitrogen atoms directly attached in positions 2 and 6
    • C07D473/16—Heterocyclic compounds containing purine ring systems with oxygen, sulphur, or nitrogen atoms directly attached in positions 2 and 6 two nitrogen atoms

Abstract

Heterocyclic compounds of Formula (I) shown herein. Also disclosed is a pharmaceutical composition containing one of the heterocyclic compounds. Further disclosed are methods of using one of the heterocyclic compounds for mobilizing hematopoietic stem cells and endothelial progenitor cells into the peripheral circulation, and for treating tissue injury, cancer, inflammatory disease, and autoimmune disease. peripheral circulation, and for treating tissue injury, cancer, inflammatory disease, and autoimmune disease.

Description

This data, for application number 8366, is current as of 202023 21:00 AEST . 160:1353-1360 (2002)), ischemic disease (Huang et al., Stroke. 44:190-197 ; Wu et al., J. Med. Chem. 5-2325 (2015); Wu et al., Cell Transplantation. in press (2017)), cancer (Chen et al., Hepatology. 59:1435-1447 (2014)), and autoimmune disease (Matthys et al., J. Immunol. 167:4686-4692 (2001)).
There is a need to develop new compounds that can effectively disrupt the interaction between CXCR4 and CXCL12.
SUMMARY The present invention is based on an unexpected discovery that certain heterocyclic compounds can effectively bind to CXCR4, thus disrupting the interaction between CXCR4 and CXCL12.
In one aspect, this invention relates to heterocyclic compounds of Formula (1): R2 NARg (I).
In this a, each of R1 and R2, independently, is H, halo, N02, CN, NHZ, C1_6 alkyl, C1_6 alkoxyl, €3-10 cycloalkyl, €1-10 cycloalkyl, aryl, or heteroaryl; or R1 and R2, er with the two carbon atoms to which they are bonded, are €5-10 cycloalkyl, €3-10 heterocycloalkyl, aryl, or heteroaryl, each of the C1_6 alkyl, C1_6 alkoxyl, €3-10 cycloalkyl, €1-10 heterocycloalkyl, €5-10 cycloalkyl, €3-10 heterocycloalkyl, aryl, and heteroaryl being optionally substituted with halo, N02, CN, NHZ, C1_6 alkyl, C1_6 alkoxyl, aryl, heteroaryl, or C(O)ORa, in which Ra is H, C1. alkyl, €3-10 cycloalkyl, €3-10 cycloalkyl, aryl, or heteroaryl; and each of R3 L1 \ In; N MR7 JVW F’B n 1 | \ a A—B /N A /E I \ \D D\ and R4, independently, 1s. . R5 \H' ’F\R6 m E or , , kl?! ,L3\N/R1O R8 I in which R5 is H, C1_6 alkyl, €3-10 cycloalkyl, €1-10 heterocycloalkyl, aryl alkyl, heteroaryl alkyl, aryl, or heteroaryl, each of the C1_6 alkyl, C340 cycloalkyl, C140 heterocycloalkyl, aryl alkyl, heteroaryl alkyl, aryl, and heteroaryl being optionally substituted with halo, nitro, cyano, amino, C1_6 alkyl, C1_6 alkoxyl, €3-10 cycloalkyl, €1-10 cycloalkyl, aryl, or heteroaryl; R6 is deleted, H, C1_6 alkyl, C1_6 alkoxyl, €3-10 cycloalkyl, €1-10 heterocycloalkyl, aryl, or heteroaryl, each of the C1_6 alkyl, C1_6 alkoxyl, €3-10 cycloalkyl, €1-10 heterocycloalkyl, aryl, and aryl being optionally substituted with hydroxy, hydroxy C1_6 alkyl, halo, nitro, cyano, or amino; R7 is H, C1. 6 alkyl, C1_6 alkoxyl, €3-10 cycloalkyl, €1-10 heterocycloalkyl, aryl, or heteroaryl, each of the C1_6 alkyl, C1_6 alkoxyl, €3-10 cycloalkyl, €1-10 heterocycloalkyl, aryl, and heteroaryl being optionally tuted with hydroxy, hydroxy C1_6 alkyl, halo, nitro, cyano, amino, amino C1_6 alkyl, amino €3-10 cycloalkyl, amino €1-10 cycloalkyl, C340 cycloalkyl, C140 cycloalkyl, aryl, or heteroaryl; each of A and B, independently, is C or N; each of D, E and F, independently, is C, N, O, or S; each of L1 and L2, independently, is aryl, €1-10 heterocycloalkyl, or NRd, in which Rd is H or C(O)(CH2)2CHNH2COZRC, Re being H, C1_6 alkyl, C340 lkyl, C340 heterocycloalkyl, aryl, or heteroaryl; each of m, n, and 0, ndently, is l, 2, 3, 4, , or 6; each of R8 and R9, independently, is H, C1_6 alkyl, €3-10 cycloalkyl, €1-10 heterocycloalkyl, aryl, or heteroaryl, each of the C1_6 alkyl, €3-10 cycloalkyl, €1-10 heterocycloalkyl, aryl, and heteroaryl being optionally substituted with C(O)0Rf, in which Rf is H, €1-10 alkyl, €3-20 cycloalkyl, €3-20 heterocycloalkyl, aryl, or heteroaryl; or R8 and R9, together with the nitrogen atoms to which they are bonded, are €3-10 heterocycloalkyl; L3 is C1_6 alkyl; or L3, together with R8 or R9 and the nitrogen atom to which they are bonded, is €4-10 heterocycloalkyl or heteroaryl; and R10 is H, C1_6 alkyl, C1_6 l, €3-10 cycloalkyl, €1-10 heterocycloalkyl, aryl, O O heteroaryl, or NJHAR11 in which L4 is deleted or C1_6 alkylamino; L5 is C1_6 alkyl, C1_6 alkylamino, or di-C1_6 alkylamino; and R11 is hydroxyl or C1_6 alkylamino; each of the C1_6 alkyl, C1_6 alkoxyl, €3-10 cycloalkyl, €1-10 heterocycloalkyl, C1_6 alkylamino; di-C1_6 alkylamino, aryl, and heteroaryl being ally substituted with hydroxyl, amino, C(O)OR12, or P(O)(OR13)2, in which each of R12 and R13, independently, is H or C1_6 alkyl.
The term “alkyl” herein refers to a saturated, linear or ed hydrocarbon moiety, such as -CH3 or branched -C3H7. The term “cycloalkyl” refers to a non- aromatic, clic, bicyclic, tricyclic, or tetracyclic hydrocarbon moiety, such as cyclohexyl, cyclohexenyl, or adamantyl. The term “alkoxyl” refers to an —O-alkyl radical. Examples of alkoxy include, but are not limited to, methoxy, , n- propoxy, isopropoxy, n-butoxy, iso-butoxy, sec-butoxy, and tert-butoxy. The term “heterocycloalkyl” refers to a non-aromatic, monocyclic, bicyclic, tricyclic, or tetracyclic moiety having one or more ring heteroatoms (e. g., N, O, or S), such as 4-tetrahydropyranyl or 4-pyranyl. The term “aryl” refers to a hydrocarbon moiety having one or more aromatic rings. Examples of aryl e, but are not limited to, phenyl (Ph), ene, naphthyl, naphthylene, pyrenyl, anthryl, and phenanthryl.
The term “heteroaryl” refers to a moiety having one or more aromatic rings that contain at least one heteroatom (e.g., N, O, or S). Examples of heteroaryl include, but are not limited to, furyl, furylene, fluorenyl, pyrrolyl, thienyl, oxazolyl, olyl, thiazolyl, pyridyl, pyrimidinyl, quinazolinyl, quinolyl, isoquinolyl and indolyl. The term “aryl alkyl” refers to an alkyl that is substituted with at least one aryl group.
Examples of aryl alkyl include benzyl (Bn) and l-naphthylmethyl. The term “heteroaryl alkyl” refers to an alkyl that is substituted with at least one heteroaryl group. Examples of heteroaryl alkyl include nyl-methyl and 2- thienylmethyl. The term “amino alkyl” or “alkylamino” refers to an alkyl that is substituted with at least one amino group. Examples of amino alkyl or alkylamino include aminomethyl and 2-aminoethyl. The term “dialkylamino” refers to an amino group that is substituted with two alkyl . Examples of dialkylamino e methylamino and l-methyl-l-ethylamino. The term “amino cycloalkyl” refers to a lkyl that is tuted with at least one amino group. Examples of amino cycloalkyl include amino cyclopropyl and amino cyclopentyl. The term “amino heterocycloalkyl” refers to a heterocycloalkyl that is substituted with at least one amino group. Examples of amino heterocycloalkyl include amino pyrrolidinyl and amino piperidinyl. The term “hydroxyl alkyl” refers to an alkyl that is substituted with at least one hydroxyl group. Examples of hydroxyl alkyl include hydroxyl methyl and hydroxyl ethyl.
Alkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, aryl alkyl, and heteroaryl alkyl mentioned herein include both substituted and unsubstituted moieties, unless specified otherwise. le substituents on cycloalkyl, heterocycloalkyl, aryl, and heteroaryl include €1-10 alkyl, €2-10 alkenyl, €2-10 alkynyl, €3-20 cycloalkyl, €3-20 cycloalkenyl, C1_20 heterocycloalkyl, C1_20 heterocycloalkenyl, C140 alkoxy, aryl, aryloxy, aryl, heteroaryloxy, amino, €1-10 alkylamino, €1-20 lamino, arylamino, diarylamino, hydroxyl, n, thio, €1-10 alkylthio, arylthio, €1-10 alkylsulfonyl, arylsulfonyl, acylamino, aminoacyl, hioacyl, amidino, guanidine, ureido, cyano, nitro, acyl, thioacyl, acyloxy, carboxyl, and carboxylic ester. On the other hand, possible substituents on alkyl include all of the above- recited substituents except €1-10 alkyl, €2-10 alkenyl, and €2-10 alkynyl. lkyl, heterocycloalkyl, aryl, and heteroaryl can also be fused with each other.
The cyclic compounds described above include the compounds themselves, as well as their salts, prodrugs, and solvates, if able. A salt, for e, can be formed between an anion and a positively d group (e.g., amino) on a heterocyclic compounds. Suitable anions include chloride, bromide, iodide, sulfate, nitrate, phosphate, citrate, methanesulfonate, trifluoroacetate, acetate, malate, tosylate, tartrate, fumurate, glutamate, glucuronate, lactate, glutarate, and maleate. Likewise, a salt can also be formed between a cation and a negatively d group (e.g., carboxylate) on a heterocyclic compound. Suitable cations include sodium ion, potassium ion, magnesium ion, calcium ion, and an ammonium cation such as ethylammonium ion. The heterocyclic compounds also include those salts containing quaternary nitrogen atoms. Examples of prodrugs e esters and other pharmaceutically acceptable tives, which, upon administering to a subject, are capable of providing active heterocyclic compounds. A solvate refers to a complex formed between an active heterocyclic compound and a pharmaceutically acceptable solvent. Examples of a pharmaceutically acceptable solvent include water, ethanol, isopropanol, ethyl acetate, acetic acid, and ethanolamine.
The heterocyclic compounds may contain non-aromatic double bonds, which can occur as cis- or trans- isomeric forms. Such isomeric forms are contemplated.
Another aspect of this invention is d to a method for mobilizing hematopoietic stem cells (HSC) and endothelial progenitor cells (EPC) into the eral circulation. The method includes contacting HSC and EPC with an effective amount of one or more of the heterocyclic compounds of Formula (I) described above.
An additional aspect of this invention relates to a method for treating tissue injury, , inflammatory disease, and autoimmune disease. The method includes administering to a subject in need thereof an effective amount of one or more of the heterocyclic compounds of Formula (I) described above. Examples of tissue injury e egenerative disease, retinal pigment epithelium dysfunction, heart and myocardial infarction, ic e (e.g., ischemic stroke and limb ischemia), wound, bone re, pancreatic injury, kidney injury, inal injury, and lung injury. Examples of cancer include acute myeloid leukemia, non-small cell lung cancer, multiple myeloma, and pancreatic cancer. es of inflammatory disease include inflammatory bowel disease, allergic asthma, and ocular uveitis. An exemplary autoimmune disease is rheumatoid arthritis.
In a particular example, the method is performed to treat a kidney injury (e.g., acute kidney injury). The method es administering to a subject suffering from kidney injury an effective amount of one or more of the cyclic compounds described above.
Also within the scope of this invention is a pharmaceutical composition containing one or more of the above-described heterocyclic compounds of Formula (I). The pharmaceutical composition can be used for treating tissue injury (e. g., acute kidney injury), cancer, inflammatory disease, and autoimmune disease.
This invention also features use of one or more of the above-described heterocyclic compounds of Formula (I) for the manufacture of a medicament for treating tissue injury (e.g., acute kidney injury), cancer, inflammatory disease, and autoimmune disease.
The term “treating” or “treatment” refers to administering one or more of the heterocyclic compounds to a subject, who has an above-described e, a symptom of such a disease, or a predisposition toward such a disease, with the purpose to confer a therapeutic effect, e.g., to cure, relieve, alter, affect, ameliorate, or prevent the above-described disease, the m of it, or the predisposition toward it. “An effective amount” refers to the amount of an active compound that is required to confer the therapeutic effect. Effective doses will vary, as recognized by those skilled in the art, depending on the types of disease d, route of stration, excipient usage, and the possibility of co-usage with other therapeutic treatment.
To practice the method of the present ion, a composition having one or more of the above-described heterocyclic compounds can be administered parenterally, orally, nasally, rectally, topically, or buccally. The term “parenteral” as used herein refers to subcutaneous, intracutaneous, intravenous, intraperitoneal, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional, or intracranial injection, as well as any le infusion technique.
A sterile inj ectable composition can be a solution or suspension in a non-toxic parenterally acceptable diluent or solvent, such as a solution in tanediol.
Among the acceptable vehicles and solvents that can be employed are mannitol, water, ’s solution, and isotonic sodium chloride solution. In on, fixed oils are conventionally ed as a solvent or suspending medium (e.g., synthetic mono- or di-glycerides). Fatty acid, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically acceptable oils, such as olive oil and castor oil, especially in their polyoxyethylated versions.
These oil solutions or suspensions can also contain a long chain alcohol diluent or dispersant, carboxymethyl cellulose, or similar dispersing agents. Other commonly used surfactants such as Tweens and Spans or other similar emulsifying agents or ilability enhancers which are commonly used in the manufacture of pharmaceutically acceptable solid, liquid, or other dosage forms can also be used for the purpose of ation.
A composition for oral administration can be any orally acceptable dosage form including capsules, tablets, emulsions and aqueous suspensions, dispersions, and solutions. In the case of tablets, commonly used carriers include lactose and corn starch. Lubricating agents, such as magnesium stearate, are also typically added. For oral administration in a capsule form, useful diluents include lactose and dried corn starch. When aqueous suspensions or emulsions are administered , the active ingredient can be suspended or dissolved in an oily phase combined with emulsifying or suspending . If desired, certain sweetening, flavoring, or coloring agents can be added.
A nasal l or inhalation composition can be prepared according to techniques well known in the art of ceutical formulation. For example, such a composition can be prepared as a solution in saline, employing any suitable vative or absorption promoter (e. g., benzyl l) or any solubilizing or dispersing agent (e.g., fluorocarbon).
A composition having one or more of the above-described heterocyclic compounds can also be stered in the form of suppositories for rectal administration.
The carrier in the pharmaceutical composition must be “acceptable” in the sense that it is compatible with the active ingredient of the composition (and preferably, capable of stabilizing the active ingredient) and not deleterious to the subject to be treated. One or more lizing agents can be utilized as pharmaceutical ents for delivery of an active l,5-diphenyl-penta-1,4-dienone compound. Examples of other carriers include colloidal silicon oxide, magnesium stearate, cellulose, sodium lauryl sulfate, and D&C Yellow # 10.
The details of one or more embodiments of the invention are set forth in the description below. Other features, objects, and advantages of the invention will be nt from the description and from the claims.
ED DESCRIPTION Disclosed in detail below are heterocyclic compounds of Formula (1): R2 N R3 (1).
R1 — R4 are defined in the SUMMARY section above.
One subset of the heterocyclic compounds of formula (1) includes those in which each of R1 and R2, independently, is H, NH2, C1_6 alkyl, or €1-10 heterocycloalkyl (e.g., morpholine, piperidine, or piperazine) optionally tuted with C1_6 alkyl or C(O)ORa, in which Ra is H or €1-10 alkyl. Exemplary compounds in this subset include those in which each of R1 and R2, independently, is H or C1_6 alkyl; and those in which each of R1 and R2, independently, is H, NH2, or C140 heterocycloalkyl optionally substituted with C1_6 alkyl or C(O)ORa.
Another subset of the heterocyclic compounds of formula (I) of this invention includes those in which R1 and R2, together with the two carbon atoms to which they are bonded, are aryl or aryl. Exemplary compounds in this subset include those in which R1 and R2, together with the two carbon atoms to which they are bonded, are dag/ fiiffillk; 2&1; Still r subset of the heterocyclic compounds of formula (I) of this ion includes those in which each of R3 and R4, independently, is L!/ IOLZ R6 [/ 1 JT \ (B IfO\ {KN zl—3\ /R10 N E | N Rs/ \H' A \D/ R8 I or R9 in which R5 is H; R6 is deleted; each of m, n, and 0, independently, is l, 2, 3, or 4; and each of L1 and L2 is NRd. In this subset, compounds can have C as each of their A and B and have C, N, or S as each of their D, E, and F. They also can have each of R1 and R2, independently, being H or C1_6 alkyl (e.g., R1 being H and R2 being C1_6 alkyl); or R1 and R2, together with the two carbon atoms to which they are bonded, are aryl or heteroaryl. For example, this subset includes compounds haVing R1 and R2, together with the two carbon atoms to which they are bonded, being d&//r<Ni; ,or Céx//Ne” A further subset of the heterocyclic compounds of formula (1) includes those EmL1 R6 N’ 3\ /R1o A ' N . . . Nm\H'F?)E . R8 II; . . in which R3 is is 9 is H; R6 is , R4 , R5 deleted; each of m, n, and 0, independently, is l, 2, 3, or 4; and each of L1 and L2 is NRd. In this subset, compounds can have each of their R1 and R2, independently, as H or C1_6 alkyl (e.g., R1 being H and R2 being C1_6 alkyl); or R1 and R2, together with the two carbon atoms to which they are bonded, are aryl or heteroaryl. For example, this subset includes nds haVing R1 and R2, together with the two carbon atoms CELIN W / / N </ IN \ \ to which they are bonded, being \NJBf NJ\§I N NR C(LI” . In particular, compounds can have their R1 and R2, together with the two carbon atoms to which they are bonded, as NJ}? They also can have C as each of their A and B and have C, N, or S as each of their D, E, and F. Also in this , compounds can have L3, together with R8 or R9 and the nitrogen atom to which they are , being C440 heterocycloalkyl; and R10 being H or O O . Compounds in this subset can have R8 being H and L3, together with R9 and the nitrogen atom to which they are bonded, being C440 heterocycloalkyl.
An exemplary compound in this subset has R1 being H and R2 being C1_6 alkyl, or R1 and R2, together with the two carbon atoms to which they are bonded, being /N O O \NJY fix ; R10 being 11 ; each of A and B being C; and each of D, E and F, independently, being C, N, or S.
Also within this invention is a pharmaceutical composition containing one or more of the heterocyclic compounds of Formula (I) described above for treating tissue injury (e.g., acute kidney injury), cancer, atory disease, and autoimmune disease.
Further covered by this invention is a method for treating tissue injury (e.g., acute kidney injury), cancer, inflammatory disease, and autoimmune e, the method including administering to a subject in need thereof an effective amount of a compound of Formula (I).
The heterocyclic compounds of Formula (I) described above can be prepared according to methods well known in the field. See, for example, R. Larock, Comprehensive Organic Transformations (2r1d Ed., VCH Publishers 1999); P. G. M.
Wuts and T. W. Greene, Greene’s Protective Groups in Organic Synthesis (4th Ed., John Wiley and Sons 2007); L. Fieser and M. Fieser, Fieser and Fieser’s Reagents for Organic Synthesis (John Wiley and Sons 1994); L. Paquette, ed., Encyclopedia of ts for Organic Synthesis (2nd ed., John Wiley and Sons 2009); and G. J. Yu et al., J. Med. Chem. 2008, 51, 054.
The compounds mentioned herein may contain a omatic double bond and one or more asymmetric centers. Thus, they can occur as tes or racemic mixtures, single enantiomers, individual diastereomers, diastereomeric es, or cis- or trans- isomeric forms. All such isomeric forms are contemplated.
The compounds of Formula (I) thus prepared can be initially screened using in vitro assays, e.g., the igand binding assay described in Example 2 below, for their potency in inhibiting binding of CXCL12 to CXCR4. They can be subsequently ted using in viva assays, e. g., a colony-forming assay, for their efficacy in enhancing hematopoietic stem cell mobilization in a mammal. The selected compounds can be further tested to verify their efficacy in treating tissue injury (e.g., acute kidney injury), cancer, inflammatory disease, and autoimmune disease. For example, a compound can be administered to an animal (e. g., a mouse) having ischemic acute kidney injury and its eutic effects are then assessed. Based on the results, an appropriate dosage range and administration route can be determined.
Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. The ing specific examples are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference.
Shown immediately below are the structures of 86 exemplary compounds of Formula (I). The methods for preparing these compounds, as well as the analytical data for the compounds thus prepared, are set forth in EXAMPLE 1 below. The procedures for testing these compounds are described in EXAMPLES 2-5 also below. 1 Q \N N/ N WNMN NAN wNMN H / S H / H H H H H N_N H H H NV H H 7 8 HN HN 1 O 1 H / / N N NWNMN N NR N/\/\NO N‘NH H H N‘N H H 9 10 \N \N A N O A N“? ~N/\/\N/\/\NN N NV \N/\/\N/\/\N N O N:/ H H N:,\j H H 11 12 H H \N / N \/\/N A N O \NkN NW N ”/Y :NMNMN \ MN U N:N H H N—N 13 14 HN HN \N \N | A | A N NWNMN/O N NX\\ >A/\HN/\/\N/I::| H H N‘o H H H 17 18 /\«N7/\V/\N/\V/\NJ::]/N /J::J\N/\Efg/\V/\H/\V/\HJ::]/N 19 20 H H 21 22 HNOH HN \N \N l A ' N/\W7N O / H N N/\V/\N/\V/\N N O H \ y/\V/\N/\V/\N N=N H H ~N H H 23 24 HN HN IA 8 N N \ MO HW\[€/\/\H \NkN/YNNMNMNO/ H H N=N’ H H 26 HN HN / H O ' A H “W” H HTNN N N ‘NH H H 27 28 0 o OMCOZHNH2 HN OMCOZHNH2 \N \N A I A N NWM O 1 N N N N/\[N\ /\/\ H N N N\o H H H \ éY/\V/\H O o OMco H2NH2 HN ZH 1 O \N / N N N NMN NAN /N H / N/\/\N s H H H OW H H 31 32 o o NH 2 0 NH2 HN HN CQ\ N 0 CG\ O N 0 H/\( *NNMN N H \ WNMN N—o H H N—N H H 33 34 N—N H H H Ni/ H H 36 0 o NJVYCOZH NH 2 HNOMCOZH 1 Q 1 H / ”/Y NMNMN/~ N N N N O \ />/\/\NMN N=N H H H N~N H H 37 38 0 o 45 46 H NHe H H NH2 H ONNMprowzO O ONNMNWPOBHZO O HN HN 1 Q I 1 / / N N NWM N /\/\ 0 1 N N ‘ QWHN N H H N—O H H NX\ H 47 48 H NHe H H [\‘H2 H ONNM WPO3H2N ONNMN$PO3H2_ O O o o HN HN 1 o I 1 N N/YNK NMN N/ NWNMNO s H / H H o H H 49 50 H [\le H ONNWMNWPogHzNH2H NNNM e' N O O o HN HN A o \ J\ N O C? ”KW WNMN /\/\N/\/\NO N N / N H H N~N H H H N\N/,N 51 52 HN HN / \N I N H N=N/ H H H / o H H 53 54 HNAKNNMNMNO HN@NH N \N N=Nl H H 55 56 N HNOH ' N1 fl H2N N/YNNMNMN0 N/ N/\(NNMNMN0 N:N H H H N:N H H NMNV002H INN/ONjL/Tcogsn dfiN NFNNNMNMNQ/N (fijiMNNNMNO 59 60 O O H OMNACOZH HN FIN/ONJk/VNVCOZH @kN NMNO/N /|:‘\j\J\N NENNMNMN/O/N H H 61 62 V3?”OMNACOZH JCNMNVCOZH NSNNMNMNO / N /N VfigkN/YNNMNMNO H H H N:N H H 63 64 o o OwwNH2 OwwNH2 HN HN I1/ N N Q lg” O N / N/\/\N/\/\N *N/YNWNMN N=N H H N‘N 65 66 o o NJVYCOH2 ON 002H NH2 H N HN H H H ii a” W 0N N w W ””0 N N \ N \N N \ N H N—N H 67 68 HNOMCOZH HNJCIM A002 / N / N \NJ\N S /\/\ \NJ\N H N] W” N H/Y WN/\/\N N / H N N /\V/\ HN\iy/\H H FgCfiNI\NxN/YN‘NMNMN I J / /\/\ Q H I N=N H H O O N HMNNMNO HN\N H H HN Div \NAN| N / \NMNMN0 H N:N H H O OH NJkV/\N \NJ\N| N / \N/\/\N/\/\NQ H sz H H O O /[::?JL\/fl\m/\WrOHO \ N H N:/ H H 0 H We H JJW OH HN/ON NfirOH O M/\/N N\/\. ;O 0 o 0 OH P“ O \N NA /N NAN /N MO HNQNJLAEAIJOH WOWOH \gflNXIllN/\/\N/\/\NQ iN/Y:[liNMNMNO 85 86 bed below are the procedures for preparing thirteen side chains, i.e., side chains S-I — S-XIII, used to synthesize the above 86 exemplary compounds.
Note that all the side chains were prepared in different manners. The structures of side chain compounds S-I — S-XIII are shown below: HzN/WANMN/O HZN/flWNMN/O N—O Boc Boc o BOC BOC $4 8-" N N H N / /\/\ ON H N / 2 XWN 2 KWNMN/O Boc Boc Boc Boc S-III S-IV HZNW—NEMNMNO HzN/YOOWN/SANG Boc Boc Boc S-V S-Vl O Boc Boc Boc Boc Na \O S-VII S—VIII HZNWNMN’:: H N NMON /N—N Boc Boc 2 NN_7/V\Boc S-VIIII S-X H2N /N\IN/\/\N/\/\N/© N\/\/\N/\/\N H N Boc Boc N=N Boc Boc ZN/Y S-XI S-XII H2N /N\N/\/\N/\/\N/© N:J Boc Boc S-XIII Preparation ofS-I Side chain 8-1 was prepared according to the schemes shown below: / HOANHz o O o \ HCI o N/YOCHS N/\¢o OCH3 o O o s.|.| 8+" 0 o HZNOH-HCI NCS N \ N/V N/\|//N —> ‘OH —> | \OH 0 o l S-l-IV A solution of phthalic anhydride (10.00 g), aminoacetaldehyde (7.81 g) and N,N—diisopropylethylamine (13.09 g) in toluene under an here of nitrogen was heated at 120 0C for 16 h and then quenched with NH4Cl(aq) (100 mL, 2 M). The aqueous phase was extracted with ethyl acetate (3x50 mL). The combined organic extracts were washed with water and brine, dried over anhydrous sodium sulfate, filtered. The filtrate was concentrated to get the crude residue S-I—I (15.49 g, y: 98%).
To a solution of 81 (15.49 g) in ZO (20 mL/40 mL) was added HCl(aq) (120 mL, 6 N) under an atmosphere of nitrogen. The mixture was heated at 80 0C for 16 h and then concentrated. The residue was extracted with ethyl acetate (3x50 mL). The combined organic extracts were washed with NaHC03(aq) and brine, dried over anhydrous sodium sulfate, filtered. The filtrate was concentrated to get the crude residue S-I-II (6.26 g, y: 50%).
To a solution of S-I-II (6.26 g) and TEA (10.04 g) in romethane (100 mL) at 5-10 0C was added hydroxylamine hydrochloride (2.53 g). The mixture was stirred at room temperature for 15 h and then ed with NH4Cl(aq) (50 mL, 2M).
The aqueous phase was extracted with CHzClz (2x50 mL). The combined organic extracts were washed with NaHC03(aq) and brine, dried over anhydrous sodium sulfate, filtered. The te was concentrated to get the crude t S-I—III (4.01 g, y: 59%).
A solution of S-I—III (4.01 g) and N—chlorosuccinimide (2.75 g) in DMF (100 mL) was heated at 50 0C for 5 h and then poured into water. The resulting mixture was extracted with ethyl acetate (3x100 mL). The combined organic extracts were washed with water and brine, dried over anhydrous sodium e, filtered. The te was concentrated to get the crude product S-I-IV (3.64 g, y: 78%).
DMP O H Boczo ///\/\OH NH > , S-l-V WEMON 00 Boc S-l-Vl To a solution of 4-pentynol (0.30 g) in dichloromethane (20 mL) at 0 0C was added Dess-Martin periodinane (1.66 g) under an atmosphere of nitrogen. The mixture was stirred at 0 0C for 2 h and then quenched with (aq) (50 mL, 2 M) and sodium thiosulfate Na2S203(aq) (50 mL, 2 M). The s phase was extracted with dichloromethane (3x50 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered. The filtrate was concentrated to get the crude S-I—V (0.26 g, y: 87%).
To a magnetically stirred solution of S-I-V (0.26 g) in MeOH (30 mL) was added N-cyclohexyl-1,3-propanediamine (0.54 g). After the mixture was d at 25 0C for 1 h, NaBH4 (0.24 g) was added to the mixture slowly. The resulting mixture was stirred for another 15 h and then quenched with NH4Cl(aq) (50 mL, 2M). The mixture was trated. The residue was extracted with CHzClz (2x150 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, and filtered. To a magnetically stirred filtrate was added Boc20 anhydride (0.84 g) in one potion. The mixture was stirred at room temperature for 15 h and then concentrated. The residue was purified by flash column chromatography over silica gel with ne/ethyl acetate (2:1) to afford the product S-I-VI (0.48 g, y: 36% over 2 steps).
WNMN/O :N/\I/I/N OH—>Boo B06 0 s-|-VI N~o Boo B06 S- I- IV S—I-VII NHZNHZHZO HEN/YWNMNQ N\o Boo Boo A on of S-I-IV (0.27 g), S-I-VI (0.48 g), and triethylamine (0.34 g) in chloroform (30 mL) under an atmosphere of nitrogen was stirred at 25 0C for 15 h and then quenched with aq) (50 mL, 2 M). The s phase was extracted with CHzClz (3X50 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue thus obtained was purified by flash chromatography on silica gel with n-hexane/ethyl acetate (4: 1) to afford compound S-I-VII (0.09 g, y: 13%).
A solution of S-I-VII (0.09 g) and hydrazine monohydrate (0.02 g) in MeOH/CHzClz (20 mL/20 mL) was stirred at 25 0C for 15 h and then filtrated. The filtrate was concentrated to get the crude product 8-1 (0.07 g, y: 98%).
Preparation ofS-H Side chain S-II was prepared according to the scheme shown below: 8000 MB —H- BOMNWw _2- S-I-II 0 Boo Boo MNWN Boo Boo EtO UK HOMNWN ethyl chloroformate S-II-II S-II-III Boo Boo Cl /\|]AC| M phthalimide N\/\/N 0 H2N N potassium salt —> CIWSWN/\/\N Boo Boo S-II-V [ I :NN/TNOWBOC NH NHHO2 2 2 M N 2 XWN O o Bee Boo 8- II-VI S To a solution of N-cyclohexyl-l,3-propanediamine (4.22 g) and K2C03 (7.09 g) in acetonitrile (100 mL) at 0 0C was added ethyl 4-bromobutyrate (5.00 g). The mixture was stirred at 25 0C for 15 h and then poured into water. The resulting mixture was extracted with ethyl acetate (3x100 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, and filtered. To a magnetically stirred filtrate of S-II—I was added Boc20 anhydride (11.11 g) in one potion. The mixture was stirred at room temperature for 15 h and then concentrated.
The residue thus ed was purified by flash column chromatography on silica gel with n-hexane/ethyl acetate (4:1) to afford product S-II-II (3.60 g, y: 30% over 2 steps).
To a solution of 811 (3.60 g) in THF (30 mL) under an atmosphere of nitrogen was added a on of KOH (2.14 g) in H20 (10 mL). The mixture was stirred at 25 0C for 15 h and then ied with ) (38 mL, 1 N). The aqueous phase was extracted with ethyl acetate (3x50 mL). The combined organic extracts were washed with water and brine, dried over ous sodium e, filtered. The filtrate was concentrated to get the crude residue S-II-III (3.36 g, y: 99%).
To a solution of II (3.36 g) and TEA (1.16 g) in THF (30 mL) was added ethyl chloroformate (1.00 g) at 0 0C. After the mixture was stirred at 0 0C for 5 h, NH4OH(aq) (50 mL, 2M) was added to the mixture at 0 0C slowly and then stirred at 0C for another 15 h. The resulting mixture was extracted with ethyl acetate (2x50 mL). The combined organic extracts were washed with water and brine, dried over anhydrous sodium sulfate, and ed. The filtrate was trated to afford crude S-II-IV (2.94 g, y: 88%).
A solution of S-II-IV (2.94 g) and 1,3-dichloroacetone (1.10 g) in isopropyl alcohol (25 mL) was heated at 100 0C for 15 h and then concentrated. The residue thus obtained was purified by flash column chromatography over silica gel with n- hexane/ethyl acetate (4:1) to afford compound S-II-V (0.70 g, y: 20%).
A solution of S-II-V (0.70 g) and phthalimide potassium salt (1.27 g) in DMF (20 mL) was stirred at 25 0C for 15 h and then poured into water. The ing mixture was extracted with ethyl acetate (2x50 mL). The combined organic extracts were washed with water and brine, dried over anhydrous sodium sulfate, ed, and concentrated. The residue thus obtained was purified by flash chromatography on silica gel with n-hexane/ethyl acetate (4:1) to afford S-II—VI (0.28 g, y: 33%).
A solution of I (0.28 g) and hydrazine monohydrate (0.04 g) in MeOH/CHzClz (20 mL/20 mL) was heated at 25 0C for 15 h and then poured into water. The resulting mixture was ted with ethyl acetate (3x50 mL). The combined organic extracts were washed with water and brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The filtrate was concentrated to get the crude product S-II (0.19 g, y: 86%).
Preparation I Side chain S-III was prepared according to the scheme shown below: CI CN EoJfiASH t N OE Y a t N + CI NaN3 N3%; CI V4; HCI S-S|||-| s_|||_|| 1. PPhS triphenylphosphoran D'BALH 2. Cbz-CI N eacetaldehyde CbZ/ J; CbZ’N\/<S\\ S-lll-lll s-"I_IV \ O H HzN/Vx N BoogO Cbz \ O CbZ’NV<S\ —H_» NWNMN Boo Boo 3"'V VI H2’—Pd/C. HZNWNMN/O Boo Boo S-III To a magnetically stirred solution of sodium ethoxide (1.0 mL, 4.4 M in EtOH) in DCM (300 mL) and EtOH (35 mL) at 0 0C was added dichloroacetonitrile (50.1 g) over 45 min. After the e stirred at 0 0C for 1 h, L-cysteine ethyl ester hydrochloride (84.51 g) was added to the resulting mixture. The reaction mixture was stirred at 25 0C for 15 h and then quenched with water (50 mL). The resulting mixture was concentrated and then the residue was extracted with dichloromethane (3x50 mL). The extracts were washed with water and brine, dried over anhydrous sodium sulfate, filtered, and concentrated. A solution of residue and DIPEA (119 mL) in DCM (500 mL) was stirred at 50 0C for 15 h and then quenched with NH4Cl(aq) (500 mL, 2M). The separated aqueous phase was extracted with DCM (2x100 mL). The combined c extracts were washed with water and brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was then concentrated to afford crude S-III-I (93.62 g, y: 100%).
A solution of the S-III-I (93.62 g) and sodium azide (148.12 g) in DMF (500 mL) was stirred at 25 0C for 15 h and then ed with NH4Cl(aq) (50 mL, 2M).
The resulting solution was extracted with EtZO (3x50 mL). The ed extracts were washed with water and brine, dried over ous sodium sulfate, and filtered.
The filtrate was then concentrated to afford crude S-III—II (77.11 g, y: 80%).
A mixture of S-III-II (77.11 g), triphenylphosphine (96.02 g), and water (20 mL) in THF (1820 mL) was stirred at 25 0C for 15 h. The resulting mixture was extracted with ethyl acetate (3x500 mL). The extracts were washed with water and brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by flash column chromatography over silica gel with H4OH(aq) (9: 1) to afford the amino t. To a mixture of amino product in romethane (1000 mL) and (aq) (400 mL, 2N) at 5-10 0C was added benzyl chloroformate (49.13 g). The mixture was stirred at room temperature for 15 h and then quenched with aqueous aq) (400 mL, 2 M). The aqueous phase was extracted with dichloromethane (3x400 mL). The extracts were washed with water and brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by flash column chromatography over silica gel with n- hexane/ethyl acetate (3:1) to afford the product S-III-III (74.35 g, y: 64% over 2 steps).
To a solution of S-III-III (7.02 g) in dry CHzClz (100 mL) was added DIBAL- H (28.5 mL, 1.0 M in toluene) at -78 oC. The e was stirred at -78 0C for 2 h and then ed with methanol (15 mL) at -78 oC. HCl(aq) (80 mL, 1N) was added to the mixture and the mixture was stirred at 00C for 1 h. The separated aqueous layer was extracted with dichloromethane (2 x100 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, and ed. The filtrate was then concentrated to afford crude S-III-IV. A sion of the S-III-IV and triphenylphosphoranylideneacetaldehyde (4.38 g) in toluene (100 mL) was heated at 80 0C for 5 h and then poured into water (100 mL). The aqueous phase was extracted with ethyl acetate (3x100 mL). The ed organic extracts were washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was then concentrated to afford crude S-III-V (5.28 g, y: 80% over two steps).
A mixture of S-III-V (6.02 g), N-cyclohexyl-1,3-propanediamine (3.12 g), and MgSO4 (4.82 g) in CHzClz (50 mL) was stirred at 25 0C for 2 h and then filtrated and concentrated. To a solution of residue in MeOH (40 mL) at 5-10 0C was added NaBH4 (1.11 g). The mixture was stirred vigorously at 25 0C for 1 h and then poured into H20. The resulting e was concentrated and then the residue was extracted with CHzClz (2x150 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, and filtered. To the filtrate was added Boc20 anhydride (8.72 g) and TEA (5 mL) in one potion. The mixture was stirred at room temperature for 2 h and then trated. The residue was purified by flash column chromatography over silica gel with n-hexane/ethyl acetate (3:1) to afford the product VI (7.72 g, y: 60% over 2 steps).
A solution of S-III-VI (7.72 g) and Pd/C (0.77 g) in ethanol (200 mL) was d under H2(g) at 25 0C for 5 h. The resulting e was filtered and then concentrated to give the product S-III (5.51 g, y: 90%) Preparation of S-IV Side chain S-IV was prepared according to the scheme shown below in a manner similar to that used to e 8-111.
CIYCN 7 steps + 30on —> HzN/th NMN/O NH, 0”. .
CI Boo Boo S-IV Preparation ofS-V Side chain S-V was prepared according to the schemes shown below: No2 N02 N02 H2N 0 _ o — 9 NHZOH \—CN+ é—CI » \ / 8 NH —» é—NH \ / NH H H \_ H o 0 CN 0 L‘/( NHOH SVI S-V-ll HOZCMNMN’C 800 800 NH NOD H s-n-m Nfl,0 /\/\ Q —. —. s\ N WN N \O H O 000 000 S-V-III To a on of aminoacetonitrile hydrochloride salt (5.02 g) and TEA (16.38 g) in EtOH (100 mL) at 5-10 0C was added a solution of 2-nitrobenene sulfonyl chloride (11.43 g) in dry THF (20 mL) dropwise over 5 min. The mixture was stirred at 25 0C for 15 h and then concentrated. The residue was poured into water and the mixture was extracted with ethyl acetate (3x100 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered. The filtrate was concentrated to afford crude S-V-I (9.43 g, y: 72%).
A solution of S-V-I (4.49 g) and NHZOH (5.02 g, 50% in H20 w/w) in MeOH (50 ml) was heated at 40 0C for 1 h and then concentrated. The resulting mixture was extracted with ethyl acetate (3x100 mL). The combined organic extracts were washed with brine, dried over ous sodium sulfate, and filtered. The filtrate was concentrated to afford crude S-V-II (4.14 g, y: 81%) A solution of S-V-II (10.02 g), S-II—III (24.32 g), EDCI (10.50 g), and DMAP (6.71 g) in dry THF (120 mL) was stirred at 25 0C for 6 h and then poured into water.
The ing e was extracted with ethyl acetate (3x120 mL). The combined organic extracts were washed with NaHC03(aq) and brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by flash column chromatography over silica gel with n-hexane/ethyl acetate (9: 1) to afford the product S-V-III (12.02 g, y: 47%).
A solution of S-V-III (5.00 g) in toluene (30 mL) was heated at 120 0C for 8 h and then poured into water. The resulting mixture was extracted with ethyl acetate (3x50 mL). The ed organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by flash column chromatography over silica gel with n-hexane/ethyl acetate (3: 1) to afford the nd S-V-IV (2.03 g, y: 42%).
A solution of S-V-IV (5.56 g), thiophenol (0.9 mL), and CszCO3 (7.95 g) in dry THF (40 mL) was stirred at 25 0C for 15 h and then poured into water. The resulting mixture was extracted with ethyl acetate (3x50 mL). The ed organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by flash column chromatography over silica gel with MeOH/ NH4OH (9:1) to afford compound S-V (2.80 g, y: 69%).
Preparation ofS-VI Side chain S-VI was prepared according to the schemes shown below: S-ll-ll S-Vl-l A solution of 811 (42.05 g) and hydrazine monohydrate (31.31 g) in ethanol (420 mL) under an atmosphere of nitrogen was heated at 70 0C for 15 h and then concentrated. The e was purified by flash column chromatography over silica gel with MeOH/DCM (1/19) to afford the product S-VI-I (25.30 g, y: 62%).
O O H2N/\\\N _>Cbzc' OANACN 2N HCI H —> GAOkE/Y0\ S-VHI S-VI-III To a solution of aminoacetonitrile hydrochloride (25.27 g) and K2C03 (109.80 g) in THF/HZO (200 mL/400 mL) at 5-10 0C was added benzyl chloroformate (45.22 g) under an atmosphere of nitrogen. The mixture was stirred at room temperature for 15 h and then quenched with NH4Cl(aq) (100 mL, 2 M). The resulting mixture was extracted with ethyl acetate (3x200 mL). The combined organic extracts were washed with water and brine, dried over anhydrous sodium sulfate, and filtered.
The filtrate was concentrated to get the crude product S-VI-II (46.88 g, y: 90%).
To a solution of S-VI-II (7.01 g) in methanol (3 mL) was added HCl (50 ml, 2N in ether) dropwise. The mixture was stirred at 25 0C for 2 h and then filtered. The filtrated cake was dried to give the S-VI-III (8.02 g, y: 98%). 0 I306 1306 ©flOJLN/YNHH O\ H2N\NJl\/\/N\/\/N\O fl ©/\OJLN/YO/—W\g06Mg0!) H S-VI-I V H2 0 Pd/C HZNNOWNMN Boo Boo S-VI A solution of S-VI-I (3.71 g) and S-VI—III (8.02 g) in ACN (80 mL) was stirred at 60 0C for 48 h and then concentrated. The residue thus obtained was purified by flash chromatography on silica gel with n-hexane/ethyl acetate (1:1) to afford S- VI-IV (3.20 g, y: 63%).
A on of S-VI-IV (3.20 g) and Pd/C (0.32 g) in EtOH (20 mL) was stirred under H2(g) at 25 0C for 16 h. The resulting mixture was filtered and concentrated to afford S-VI (2.15 g, y: 85%).
Preparation OfS-VII Side chain S-VII was prepared according to the scheme shown below: N020 N02 0 / \/ KOH ’ N/\n/O\/ —’ H (i85\N/\n/OHH S-Vll- | S-Vll- II To a solution of glycine ethyl ester hloride (29.81 g) and triethylamine (64.74 g) in ethanol (600 mL) at 5-10 0C under an here of nitrogen was added to a solution of obenene sulfonyl chloride (47.22 g) in tetrahydrofuran (600 mL).
The mixture was stirred at room temperature for 15 h and then concentrated. The residue was poured into water and the resulting mixture was extracted with ethyl acetate (3x500 mL). The combined organic extracts were washed with water and brine, dried over anhydrous sodium e, filtered. The filtrate was concentrated to get the crude t S-VII-I (54.22 g, y: 88 %).
To a magnetically stirred solution of compound I (54.22 g) in MeOH/THF (300 mL/300 mL) under an atmosphere of nitrogen was added a solution of KOH (31.63 g) in H20 (100 mL). The reaction mixture was stirred at 25 0C for 15 h and then acidified with aqueous 4N HCl (140 mL). The resulting mixture was concentrated and the residue was extracted with ethyl acetate (3x300 mL). The combined organic ts were washed with water and brine, dried over ous sodium sulfate, and filtered. The filtrate was concentrated to get the crude t S- VII-II (39.10 g, y: 80 %).
N020 H NHN O (>6 ”/71;s. N02 (I? 2 N’\/\N s, N—N VII || /\/\ o (.5 ”/j]; VN N Boo Boo Boo Boo S—Vl-l S-Vll-lll L , awesson s reagent s 0 '8“wa WNMN OSH OH N—N Boo Boo —> S-Vll-IV s Q H2N/\« WNMN N—N Boo Boo S-Vll To a magnetically stirred solution of S-VII—II (6.10 g) in dichloromethane (120 mL) under an atmosphere of nitrogen was added EDCI (4.93 g) at 25 0C. After the mixture was stirred at 25 0C for 1 h, a solution of compound S-VI-I (8.23 g) in dichloromethane (20 mL) was added the mixture in one potion. The reaction mixture was stirred for another 6 h and then poured into water. The resulting mixture was extracted with dichloromethane (2x50 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium e, filtered, and concentrated.
The residue thus obtained was ed by flash chromatography on silica gel with MeOH/DCM (1/19) to afford the product S-VII-III (8.52 g, y: 68%).
To a magnetically stirred solution of compound S-VII-III (8.52 g) in dichloromethane (200 mL) was added Lawesson’s reagent (6.90 g). The mixture was stirred at room temperature for 15 h and then concentrated. The residue was purified by flash column chromatography on silica gel with n-hexane/ethyl acetate (1:1) to afford the product S-VII-IV (4.85 g, y: 57%).
A solution of S-VII-IV (6.40 g), cesium carbonate (5.97 g) and thiophenol (2.02 g) in itrile (120 mL) under an atmosphere of nitrogen was stirred at 25 0C for 15 h and then concentrated. The residue was poured into water and then the aqueous layer was extracted with dichloromethane (3x120 mL). The combined organic ts were washed with water and brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by flash tography on silica gel with MeOH/NH4OH (9:1) to afford the product S-VII (4.55 g, y: 97%).
Preparation ofS- VIII Side chain S-VIII was prepared according to the schemes shown below: VOWNMN/O fl» HO\/\/\N/\/\N/(j —S>' M CI Boo Boo Boo Boo s-||-|| S-Vlll-l Mol. Wt.: 506.70 0 MSO\/\/\N/\/\N Boo Boo To a solution of LAH (1.14 g) in THF (94 mL) at 5-10 0C was added S-II-II (4.72 g) under an atmosphere of en. The mixture was d at room temperature for 6 h and then quenched with ammonium chloride NH4Cl(aq) (5.7 mL, 2 M). After adding ous sodium sulfate (5.71 g), the resulting mixture was stirred at 25 0C for another 1 h and then filtered. The filtrate was concentrated to get the crude product S-VIII-I (3.85 g y: 90%).
To a solution of S-VIII-I (3.85 g) and TEA (2.02 g) in dichloromethane (180 mL) at 5-10 0C was added MsCl (1.14 g) dropwise. The mixture was stirred at room temperature for 15 h and then quenched with aq). The aqueous phase was extracted with CHzClz (2x50 mL). The combined organic extracts were washed with NaHC03(aq) and brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated to get the crude product S-VIII-II (3.64 g, y: 80%).
MSONNMNO N02 9 N02 9 Boo Boo H2N / S-CI s\ NH + n _, u N / NH S—Vlll-ll S-VIII-III N02 9 E100 E100 Boo Boo §\N/—\(\N/\/\/ W —> o H NH HZNMNWNWN S—Vlll-IV S-VIII To a solution of histamine (1.02 g) and triethylamine (2.01 g) in dry THF (200 mL) at 5-10 0C was added a solution of obenene sulfonyl chloride (2.21 g) in dry THF (5 mL) dropwise over 5 min. The e was stirred at 25 0C for 15 h and then concentrated. The residue was poured into water and the resulting mixture was extracted with ethyl acetate (3x100 mL). The combined organic extracts were washed with water and brine, dried over anhydrous sodium sulfate, and filtered. The te was concentrated to get the crude product S-VIII-III (1.61 g, y: 60%).
A solution of S-VIII-III (1.61 g), K2C03 (3.73 g), and S-VIII-II (4.01 g) in DMF (30 mL) was heated at 80 0C for 15 h and then poured into water. The resulting mixture was extracted with ethyl acetate (3x100 mL). The combined organic extracts were washed with water and brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by flash tography on silica gel with MeOH/DCM (1/19) to afford the product S-VIII-IV (0.76 g, y: 20%).
A on of S-VIII-IV (0.76 g), cesium carbonate (0.41 g), and thiophenol (0.18 g) in acetonitrile (15 mL) under an atmosphere of nitrogen was stirred at 25 0C for 15 h and then concentrated. The residue was poured into water and the ing mixture was extracted with dichloromethane (3x50 mL). The combined c extracts were washed with water and brine, dried over anhydrous sodium sulfate, ed, and concentrated. The residue was purified by flash chromatography on silica gel with MeOH/NH4OH (9:1) to afford the product S-VIII (0.51 g, y: 91%).
Preparation ofS- VIIII Side chain S-VIIII was prepared according to the scheme shown below: O COOEI COOMe OEt ‘ -0 _ o / EN DIBAL-H 0% Wide 0\ / )N NaBH; HO / \N N N N N/ E10 lTHP ITHP lTHP ‘THP S-VIIII-I S—VIIII-II S-VIIII-III S-VIIII-IV COOMe COOMe OH TBDMSCI NICIz/NaBHa- \N / \/N LAH \ TBDMSO / TBDMSO TBDMSO /N/N N’ N lTHP lTHP THP I-V S-VIIII-VI S—VIIII-VII artin RNH2 30020 TBDMSOMMN/\/\NJO TBDMSO / \ /N N‘N I I ll\J THP/ Boo Boo S-Vllll-Vllll S-VIIII-VIII 1. phthalimide, PPh3 H2N / Ho / 2. N2H4 O TBAF / NMN —> //\A,I\JM,I\J | | /N‘N N‘N Boo Boo Boo Boo TH P THP/ S-Vllll-X S-Vllll To a solution of S-VIIII-I (10.02 g) in dry CHzClz (160 mL) was added DIBAL-H (70 mL, 1.0 M in toluene) at -78 oC. The mixture was stirred at -780C for 1 h and then quenched with methanol (100 mL) at -78 oC. The resulting mixture was filtrated and the filtrate was then concentrated to afford crude S-VIIII-II. A suspension of the (etboxycarbonylmethylidenefiriphenylphosphmane (6.91 g) and S- VIIII-II in e (160 mL) was heated at 80 0C for 2 h and then poured into water (100 mL). The aqueous phase was extracted with ethyl acetate (3x100 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was then trated to afford crude S-VIIII-III. A solution of the compound S-VIIII-III and NaBH4 (3.22 g) in MeOH (210 mL) was stirred at 25 0C for 15 h and then quenched with NH4Cl(aq) (100 mL, 2M). The e was concentrated and residue was extracted with dichloromethane (3x100 mL). The combined organic extracts were washed with water and brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by flash tography on silica gel with n-hexane/ethyl acetate (1:1) to afford I- IV (3.51 g, y: 39% over three steps) A solution of S-VIIII—IV (3.5 g), imidazole (1.81 g), and TBDMSCl (2.38 g) in DCM (160 mL) was stirred at 25 0C for 15 h and then poured into water. The aqueous phase was extracted with dichloromethane (3x100 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was then concentrated to afford crude S-VIIII-V. To a solution of S-VIIII-V in MeOH (70 mL) at 0 0C was added with NiClz (18 mg) and NaBH4 (1.06 g). The mixture was stirred at 0 0C for 1 h and then ed with NH4Cl(aq) (1 mL, 2M). The resulting mixture was filtrated and the filtrate was concentrated to afford crude S-VIIII-VI. To a solution of the S-VIIII-VI in THF (70 mL) at 0 0C was added LAH (1.06 g). The mixture was d at 0 0C for 1 h and then quenched with NaOH(aq) (4 mL, 10% w/w). The resulting mixture was filtered and trated.
The residue was purified by flash column chromatography on silica gel with n- hexane/ethyl acetate (1:1) to afford S-VIIII-VII (2.03 g, y: 43% over three steps).
To a solution of S-VIIII-VII (2.03 g) in dichloromethane (28 mL) at 0 0C was added Dess-Martin periodinane (2.51 g) under an atmosphere of nitrogen. The mixture was stirred at 0 0C for 1 h and then quenched with NaHC03(aq) (30 mL, 2 M) and Na2S203(aq) (30 mL, 2 M). The aqueous phase was extracted with dichloromethane (3x100 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated to get the crude S-VIIII-VIII. A solution of S-VIIII-VIII, N-cyclohexyl-1,3- propanediamine (1.07 g) and sodium triacetoxyborohydride (2.43 g) in dichloromethane (28 mL) was stirred at 25 0C for 15 h and then poured into NaHC03(aq) (30 mL, 2M). The aqueous layer was extracted with CHzClz (2x50 mL).
The combined organic extracts were washed with brine, dried over ous sodium e, and ed. To a magnetically stirred filtrate and TEA (1.41 g) was added Boc20 anhydride (3.26 g) in one potion. The mixture was stirred at room temperature for 15 h and then concentrated. The residue was purified by flash column chromatography on silica gel with n-hexane/ethyl acetate (3: 1) to afford the t S-VIIII-VIIII. (2.27 g, y: 57% over 2 steps).
A solution of the compound S-VIIII-VIIII (2.27 g) and TBAF (4.9 mL, 1M in THF) in THF (16 mL) was stirred at 25 0C for 1 h and then poured into NaHC03(aq) (30 mL, 2M). The resulting mixture was extracted with ethyl e (2x100 mL). The combined c extracts were washed with brine, dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to get the crude S-VIIII-X. To a on of S-VIIII-X, phthalimide (0.51 g), and PPh3 (0.91 g) in dry THF (15 mL) at 0 0C was added a solution of DEAD (0.72 g) in dry THF (1.5 mL) dropwise. The reaction mixture was stirred under nitrogen at 25 0C for 15 h and then trated. A solution of the residue and hydrazine monohydrate (0.8 mL) in MeOH (20 mL) was stirred at 25 0C for 15 h and then filtrated. The filtrated was concentrated and the resultant residue was purified by flash column chromatography on silica gel with MeOH/NH4OH (9:1) to afford the S-VIIII (1.71 g, y: 90% over two steps) Preparation ofS-X Side chain S-X was prepared according to the scheme shown below: \\ 2N HCI CszN/YNH N ) S-Vl-ll 3-x-| To a solution of S-VI-II (10.02 g) in ethanol (3 mL) was added HCl (50 ml, 2N in ether) dropwise. The resulting mixture was stirred at 25 0C for 2 h and then filtered. The filtrated cake was dried under reduced re to give the S-X-I (8.02 g, y: 64%).
HN Mr2 WU W12“: n ‘N s-x-I“ O CszNAfi WNMN H N—N Boo Boo S-Vl-l S-X-ll H2, Pd/C H 0 N—N Boo Boo A solution of S-VI-I (4.22 g), CH3COZK (4.13 g), and S-X-I (4.73 g) in n- BuOH (80 mL) was stirred at 80 0C for 1 h, then 125 0C for 16 h and then concentrated. The residue was ed by flash chromatography over silica gel with n-hexane/ethyl acetate (1/1) to afford S-X-II (2.76 g, y: 30%).
A solution of S-X-II (1.82 g) and 10% Pd/C (0.18 g) in EtOH (20 mL) was stirred under H2(g) at 25 0C for 16 h. The resulting mixture was filtered and concentrated to afford S-X (1.20 g, y: 84%).
Preparation ofS-XI and S-XII Side chains S-XI and S-XII were ed according to the scheme shown below: CszN/\\\N NaNa _> CszN / ‘NH —>/ N=r\i S-Vl-ll S_XH CszN /N‘NMO CszN Boczo \ H H N=l\i + N—‘N —> S-XI-II S-XII-I N O NMNMN/O CszN / ‘N/\/\N/\/\N + CszN :N Boo Boo N=l\i Boo Boo N—hi S-XI-III S-XII-II N\ N\ 0 CszN / [NMNMN %Q H2N / [NMNMN N=N Boo Boo N=N Boo Boo S-Xl-lll S-Xl L 1 H2, Pd/C , O CszN/Y ”N Boc Boc H2N \ ,,N Boc Boc N‘N N—N S-Xll-ll S-Xll A solution of S-VI-II (37.10 g), sodium azide (31.73 g), and zinc bromide (30.75 g) in IPA/H20 (300 mL/600 mL) under an atmosphere of nitrogen was stirred at 75 0C for 15 h. To the mixture at room temperature was added HCl(aq) (4 M) slowly until all solid has ved. The resulting e was extracted with ethyl acetate (3x200 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium e, and filtered. The filtrate was concentrated to get the crude product S-XI-I (43.22 g, y: 95%).
To a solution of S-XI-I (17.10 g) and TEA (29.65 g) in a solvent of CHzClZ/MeOH (320 mL/32 mL) at 5-10 0C was added acrolein (16.43 g) dropwise.
The resulting mixture was stirred at room temperature for 4 h and then ed with NH4Cl(aq) (50 mL). The resulting mixture was concentrated and then the residue was extracted with CHzClz (3x200 mL). The combined organic extracts were washed with (aq) and brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by flash column chromatography over silica gel with MeOH/DCM (1/32) to afford the e product S-XI-II and S-XII-I (16.90 g, y: 80%).
To the mixture of S-XI-II and S-XII-I (25.10 g) in MeOH (250 mL) was added N-(3-aminopropyl)cyclohexylamine (16.26 g) under an atmosphere of nitrogen. The mixture was stirred at 0 0C for 2 h and NaBH4 (2.78 g) was added to the mixture slowly. The resulting mixture was stirred for another 1 h and then quenched with NH4Cl(aq). The mixture was concentrated and the residue was ted with dichloromethane (3x150 mL). The combined organic extracts were washed with NaHC03(aq) and brine, dried over anhydrous sodium sulfate, and filtered. To the filtrate was added Boc20 anhydride (45.44 g) in one potion. The mixture was stirred at room temperature for 15 h and then concentrated. The residue was purified by flash column chromatography over silica gel with n-hexane/ethyl acetate (1:1) to afford the product S-XI—III (12.82 g, y: 24% over 2 steps) and S-XII-II (11.20 g, y: 21% over 2 steps).
A solution of II (15.80 g) and 10% Pd/C (1.58 g) in 2-propanol (158 mL) was d under H2(g) at 60 0C for 15 h. The resulting mixture was filtered and the filtrate was concentrated under reduced pressure to give the t S-XI (12.10 g, y: 97 %) A solution of II (11.20 g) and 10% Pd/C (1.12 g) in 2-propanol (112 mL) was stirred under H2(g) at 60 0C for 15 h. The resulting mixture was filtered and the filtrate was concentrated under reduced pressure to give the product S-XII (8.37 g, y: 95 %).
Preparation ofS-XIII Side chain S-XIII was prepared ing to the scheme shown below: \H N N CszN% \/0 CszN / ‘NH O N CszN / H ‘N/\/\\0 N:/ —>/ Nd S-X-l S-Xlll-l S-Xlll-ll H NMNL N\ B0020 O H CszN / N/\/\N/\/\N H2, Pd/C —> —> N:/ Boo Boo —> S—Xlll-lll To a solution of S-X-I (10.02 g) in (100mL) at 0°C was added KOH(aq) (100 mL, 2.4% w/w). The mixture was stirred at 0 °C for 10 min and then ted with dichloromethane (3x50 mL). The combined organic extracts were washed with water and brine, dried over anhydrous sodium sulfate, filtered and concentrated. A solution of the residue, formohydrazide (3.31 g), and CH3C02K (3.33 g) in n-BuOH (100 mL) was stirred at 80 0C for 1 h, then 125 0C for 16 h and then concentrated. The residue was crystallization with n-Hexane/ethyl acetate (1/1) to afford S-XIII-I (7.21 g, y: 73%).
To a on of S-XIII-I (4.05 g) and TEA (0.8 mL) in a solvent of MeOH (20 mL) at -10 0C was added acrolein (2 mL) dropwise. The resulting mixture was stirred at -10 0C for 3 h and then ed with NH4Cl(aq) (50 mL). The ing mixture was concentrated and then the residue was extracted with ethyl acetate (3x50 mL). The combined organic extracts were washed with NaHC03(aq) and brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue was purified by flash column chromatography over silica gel with MeOH/ethyl acetate (1:10) to afford S-XIII-II (2.08 g, y: 42%).
To the mixture of S-XIII-II (2.08 g) in MeOH (20 mL) at 0 0C was added N- (3-aminopropyl) cyclohexylamine (1.6 mL) under an atmosphere of nitrogen. The e was stirred at 0 0C for 2 h and NaBH4 (0.45 g) was added to the mixture slowly. The resulting mixture was stirred for another 1 h and then quenched with NH4Cl(aq). The mixture was concentrated and the e was extracted with dichloromethane (3x150 mL). The combined organic ts were washed with NaHC03(aq) and brine, dried over anhydrous sodium sulfate, ed. To the filtrate was added Boc20 anhydride (1.58 g) in one potion. The mixture was d at room temperature for 15 h and then concentrated. The residue was purified by flash column chromatography over silica gel with n-hexane/ethyl acetate (1 :2) to afford the product S-XIII-III (2.42 g, y: 54% over 2 steps).
A solution of S-XIII-III (5.41 g) and 10% Pd/C (0.54 g) in EtOH (20 mL) was stirred under H2(g) at 25 0C for 15 h. The resulting mixture was filtered and the filtrate was concentrated under reduced pressure to give the product S-XIII (3.69 g, y: 87 %) ed below are starting materials, i.e., 2,4-dichloro heterocyclic derivatives, for preparing Compounds 1-86.
\ N / \ N N \ N \ N . w kmI .
NACI I I \N NACI “A“ S “A“ CI CI CI \ N \ N | NACI | | H2N ACI NACI Depicted below is a synthetic route that was followed for synthesizing certain compounds of Formula (I) as shown in EXAMPLE 1 below. Compound A containing two halo groups d with an amino compound R4-H to give compound B, which reacted with another amino compound R3-H (which can be the same as R4-H) to give compound C, i.e., a compound of Formula (1).
R4 R4 R2 \N CI R2 NACI R2 N/ R3 A B C The compounds thus synthesized were purified by a method such as column chromatography, high-pressure liquid chromatography, or recrystallization.
The intermediates used in the synthesis described above were either cially available or could be ed by methods known in the art. The methods could also include onal steps, either before or after the steps bed specifically herein, to add or remove suitable protecting groups if necessary to facilitate synthesis of the compounds. In addition, various tic steps could be performed in an alternate sequence or order to give the desired compounds.
All chemicals and solvents were purchased from commercial suppliers and used as received. All reactions were carried out under an atmosphere of dry nitrogen.
Reactions were monitored by TLC using Merck 60 F254 silica gel glass backed plates (5 x 10 cm); and zones were ed visually under ultraviolet irradiation (254 nm) or by spraying with phosphomolybdic acid reagent (Aldrich) followed by heating at 80 0C. All flash column chromatography was performed with Merck Kieselgel 60, No. 9385, 230-400 mesh ASTM silica gel as the stationary phase. Proton (1H) nuclear magnetic nce spectra were measured on a Varian y-300 or Varian Mercury-400 spectrometer. Chemical shifts were recorded in parts per million (ppm) on the delta (5) scale relative to the resonance of the solvent peak. The following abbreviations were used to describe coupling: s = singlet; d = doublet; t = triplet; q = quartet; quin = quintet; br = broad; and m = multiplet. LCMS data were measured on an AgilentMSD-1100 ESI—MS/MS, Agilent 1200 series LC/MSD VL, and Waters Acquity UPLC-ESI-MS/MS system.
EXAMPLE 1: Synthesis of Compounds 1-86 Compounds 1-86 were synthesized by assembling ng materials and side chain compounds set forth below: ation of Compound 1 Shown below is a scheme for synthesizing compound 1 Via intermediates 1-1 and 1-H.
CI @NBOC @NBOC HN HZNWNMN0 N—O Boo Boo / \ N | H2N / N S-l \ NJ\C|/ \NkCI > QNBOC OH HN HN / N HCI/ether / N \ '1 \ k N NWNMNO N NWNMN N‘O 800 800 H N‘O H H 1-|| compound 1 A solution of 2,4-dichloro-quinazoline (1.01 g), 4-amino-piperidine carboxylic acid tert-butyl ester (1.05 g) and triethylamine (1.01 g) in THF (30 mL) under an atmosphere of nitrogen was stirred at 25 0C for 15 h and then quenched with aqueous NH4Cl (50 mL, 2 M). The resulting e was extracted with ethyl acetate (3x100 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, ed, and concentrated. The residue thus obtained was purified by flash tography over silica gel with n-hexane/ethyl acetate (1:1) to afford compound 1-1 (1.31 g, y: 71%).
A solution of compound 1-I (120.1 mg) and 8-1 (160.2 mg) in 1-pentanol (1.4 mL) was heated at 120 0C for 15 min using microwave radiation and then concentrated. The e thus obtained was purified with flash chromatography on silica gel with CM (1/32) to afford compound 1-II (150.1 mg, y: 55%).
A solution of 1N ethyl ether (3 mL) was added to the solution of compound 1-II (150.1 mg) in dichloromethane (6 mL). The reaction mixture was stirred at 25 0C for 15 h and then concentrated to afford hydrochloride salt of compound 1 (98.6 mg, y: 86%). 1H NMR (400 MHz, D20) 5 8.04 (d, 1H), 7.83 (dd, 1H), 7.49-7.43 (m, 2H), 6.38 (s, 1H), 4.77 (s, 2H), 4.46 (m, 1H), 3.58 (m, 2H), 3.25- 3.13 (m, 8H), 2.93 (t, 2H), 2.21-2.03 (m, 8H), .81 (m, 4H), 1.69 (m, 1H), 1.41- 1.17 (m, 6H); EI-MS: 521.5 (M+1).
Preparation of Compound 2 Compound 2 was prepared in a manner similar to that used to prepare compound 1. 1H NMR (400 MHz, D20) 5 8.07 (d, 1H), 7.87-7.80 (m, 2H), 7.51-7.43 (m, 2H), 4.69 (s, 2H), 4.58 (m, 1H), 3.56 (m, 2H), 3.20-3.02 (m, 8H), 2.96 (t, 2H), 2.33 (m, 2H), 2.21-2.03 (m, 6H), 2.01-1.81 (m, 4H), 1.70 (m, 1H), 1.41-1.17 (m, 6H); EI—MS: 521.5 (M+1).
Preparation of Compound 3 Compound 3 was prepared in a manner r to that used to prepare compound 1. 1H NMR (400 MHz, D20) 5 8.01 (d, 1H), 7.79 (dd, 1H), 7.73 (s, 1H), .39 (m, 2H), 4.81 (s, 2H), 4.38 (m, 1H), 3.56 (m, 2H), 3.20-3.02 (m, 8H), 2.61 (t, 2H), 2.21- 2.02 (m, 6H), 2.00-1.80 (m, 6H), 1.67 (m, 1H), 1.40-1.17 (m, 6H); EI-MS: 537.5 (M+1).
Preparation of Compound 4 Compound 4 was prepared in a manner similar to that used to e compound 1. 1H NMR (400 MHz, D20) 5 8.06 (d, 1H), 7.84 (dd, 1H), 7.52-7.43 (m, 2H), 7.24 (s, 1H), 5.03 (s, 2H), 4.42 (m, 1H), 3.56 (m, 2H), 3.20-3.01 (m, 8H), 2.87 (t, 2H), 2.18- 2.02 (m, 8H), 1.96-1.79 (m, 4H), 1.69 (m, 1H), 1.40-1.17 (m, 6H); EI-MS: 521.5 (M+1).
Preparation of Compound 5 nd 5 was prepared in a manner similar to that used to prepare compound 1. 1H NMR (400 MHz, D20) 5 8.05 (d, 1H), 7.83 (dd, 1H), 7.48-7.42 (m, 2H), 4.89 (s, 2H), 4.48 (m, 1H), 3.60 (m, 2H), 3.28-3.08 (m, 10H), 2.30-2.02 (m, 8H), 2.00-1.80 (m, 4H), 1.69 (m, 1H), 1.40-1.17 (m, 6H); EI-MS: 522.5 (M+1). ation of Compound 6 Compound 6 was prepared in a manner similar to that used to prepare compound 1. 1H NMR (400 MHz, D20) 5 8.08 (d, 1H), 7.86 (m, 1H), 7.53-7.45 (m, 2H), 4.58 (m, 1H), 4.38 (s, 2H), 3.60 (m, 2H), 3.24-3.12 (m, 8H), 2.49 (t, 2H), 2.39 (m, 2H), 2.14- 1.80 (m, 10H), 1.69 (m, 1H), 1.40-1.16 (m, 6H); EI-MS: 522.5 (M+1).
Preparation of Compound 7 Compound 7 was prepared in a manner similar to that used to prepare compound 1. 1H NMR (400 MHz, D20) 5 8.07 (d, 1H), 7.86 (dd, 1H), 7.53-7.45 (m, 2H), 5.13 (s, 2H), 4.40 (m, 1H), 3.58 (m, 2H), 3.30-3.11 (m, 10H), 2.24-2.02 (m, 8H), 2.00-1.82 (m, 4H), 1.69 (m, 1H), 1.40-1.16 (m, 6H); EI-MS: 538.5 (M+1).
Preparation of Compound 8 Compound 8 was prepared in a manner similar to that used to prepare compound 1. 1H NMR (400 MHz, D20) 5 8.80 (s, 1H), 8.06 (d, 1H), 7.82 (dd, 1H), 7.50-7.40 (m, 3H), 4.58 (m, 1H), 4.20 (t, 2H), 3.90 (t, 2H), 3.64 (m, 2H), .10 (m, 8H), 2.95 (m, 2H), 2.38 (m, 2H), 2.19-2.00 (m, 6H), 1.97-1.62 (m, 7H), 1.42-1.17 (m, 6H); EI- MS: 548.5 (M+1).
Preparation of Compound 9 Compound 9 was prepared in a manner similar to that used to prepare compound 1. 1H NMR (400 MHz, D20) 5 8.05 (d, 1H), 7.83 (dd, 1H), .44 (m, 2H), 6.33 (s, 1H), 4.80 (s, 2H), 4.45 (m, 1H), 3.54 (m, 2H), .06 (m, 8H), 2.80 (t, 2H), 2.20- 2.02 (m, 8H), 2.00-1.80 (m, 4H), 1.69 (m, 1H), 1.40-1.17 (m, 6H); EI-MS: 520.5 (M+1).
Preparation of Compound 10 Compound 10 was prepared in a manner similar to that used to e compound 1. 1H NMR (400 MHz, D20) 5 8.02 (d, 1H), 7.82 (dd, 1H), 7.47-7.44 (m, 2H), 4.90 (s, 2H), 4.36 (m, 1H), 3.57 (m, 2H), 3.22-3.08 (m, 8H), 2.97 (t, 2H), 2.20-2.02 (m, 8H), 2.00-1.80 (m, 4H), 1.69 (m, 1H), 1.40-1.17 (m, 6H); EI—MS: 521.5 (M+1).
Preparation of Compound 11 nd 11 was prepared in a manner similar to that used to prepare nd 1. 1H NMR (400 MHz, D20) 5 8.57 (s, 1H), 8.06 (d, 1H), 7.85 (m, 1H), 7.53-7.44 (m, 2H), 4.86 (s, 2H), 4.43 (m, 1H), 4.37 (t, 2H), 3.57 (m, 2H), 3.21-3.04 (m, 8H), 2.28 (m, 2H), 2.20-2.01 (m, 6H), 1.98-1.80 (m, 4H), 1.69 (m, 1H), 1.40-1.16 (m, 6H); EI- MS: 521.5 (M+1).
Preparation of Compound 12 Compound 12 was prepared in a manner similar to that used to prepare compound 1.
EI-MS: 508.5 (M+1).
Preparation of Compound 13 Compound 13 was prepared in a manner similar to that used to prepare compound 1. 1H NMR (400 MHz, D20) 5 8.08 (d, 1H), 7.87 (dd, 1H), 7.54-7.46 (m, 2H), 5.08 (s, 2H), 4.47 (m, 1H), 3.59 (m, 2H), .15 (m, 10H), 2.45 (m, 2H), .01 (m, 6H), .81 (m, 4H), 1.71 (m, 1H), 1.39-1.17 (m, 6H); EI-MS: 522.5 (M+1).
Preparation of nd 14 Compound 14 was prepared in a manner similar to that used to prepare compound 1.
EI—MS: 522.5 (M+1).
Preparation of Compound 15 Shown below is a scheme for synthesizing compound 15 Via intermediates 15- I and 15-11.
CI OBOC HZNWN\ /\/\ O 08°C N N—O Boo Boo I A H N / N S-l \NXCI| > -I HNO” fix 0 HCI/ether f4/ N O N WNMN N NWNMN \ H N—o H H -ll compound 15 A solution of 2,4-dichloromethylpyrimidine (5.00 g), 4-amino-piperidine carboxylic acid tert-butyl ester (8.36 g), and TEA (4.64 g) in THF (100 mL) under an atmosphere of nitrogen was stirred at 25 0C for 15 h and then quenched with aqueous NH4Cl (50 mL, 2 M). The resulting mixture was extracted with ethyl acetate (3x100 mL) and the combined organic ts were washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue thus obtained was purified by flash chromatography on silica gel with n-hexane/ethyl acetate (3: 1) to afford compound 15-1 (4.75 g, y: 47%).
A solution of 15-1 (70.2 mg) and S-I (110.3 mg) in 1-pentanol (1.4 mL) was heated at 140 0C for 4 h and then concentrated. The residue thus obtained was ed with flash chromatography on silica gel with MeOH/DCM (1/32) to afford compound 15-11 (100.1 mg, y: 59%).
A solution of 1N HCl/ diethyl ether (2 mL) was added to the solution of compound 15-11 (100.1 mg) in dichloromethane (4 mL). The mixture was stirred at 0C for 15 h and then concentrated to afford hydrochloride salt of compound 15 (67.8 mg, y: 89%). 1H NMR (400 MHz, D20) 5 6.33 (s, 1H), 5.95 (s, 1H), 4.69 (s, 2H), 4.16 (m, 1H), 3.49 (m, 2H), .07 (m, 8H), 2.93 (t, 2H), 2.28 (s, 3H), 2.19- 1.99 (m, 8H), 1.87 (m, 2H), 1.79-1.64 (m, 3H), 1.42-1.17 (m, 6H); EI-MS: 485.5 (M+1).
Preparation of Compound 16 Compound 16 was prepared in a manner similar to that used to prepare nd 15. 1H NMR (400 MHz, D20) 5 7.78 (s, 1H), 5.95 (s, 1H), 4.56 (s, 2H), 4.27 (m, 1H), 3.49 (m, 2H), 3.22-3.14 (m, 8H), 2.95 (t, 2H), 2.26 (s, 3H), 2.20-2.04 (m, 8H), 1.90- 1.77 (m, 4H), 1.64 (m, 1H), 1.40-1.16 (m, 6H); EI—MS: 485.5 (M+1).
Preparation of Compound 1 7 Compound 17 was prepared in a manner similar to that used to e compound 15. 1H NMR (400 MHz, D20) 5 7.31 (s, 1H), 5.97 (s, 1H), 4.95 (s, 2H), 4.11 (m, 1H), 3.43 (m, 2H), 3.21-3.00 (m, 8H), 2.88 (t, 2H), 2.35 (s, 3H), 2.18-1.99 (m, 8H), 1.85 (m, 2H), 1.76-1.62 (m, 3H), 1.41-1.17 (m, 6H); EI-MS: 501.5 (M+1).
Preparation of Compound 18 nd 18 was prepared in a manner similar to that used to prepare compound 15. 1H NMR (400 MHz, D20) 5 7.71 (s, 1H), 5.96 (s, 1H), 4.72 (s, 2H), 4.15 (m, 1H), 3.46 (m, 2H), 3.23-3.03 (m, 8H), 2.61 (t, 2H), 2.28 (s, 3H), 2.18-1.96 (m, 8H), 1.86 (m, 2H), 1.79-1.64 (m, 3H), 1.41-1.18 (m, 6H); EI-MS: 485.5 (M+1).
Preparation of Compound 19 Compound 19 was prepared in a manner similar to that used to prepare compound 15. 1H NMR (400 MHz, D20) 5 5.96 (s, 1H), 4.77 (s, 2H), 4.15 (m, 1H), 3.50 (m, 2H), 3.24-3.08 (m, 10H), 2.28 (s, 3H), 2.26-2.03 (m, 8H), 1.87 (m, 2H), 1.80-1.63 (m, 3H), 1.40-1.17 (m, 6H); EI—MS: 486.4 (M+1).
Preparation of Compound 20 Compound 20 was prepared in a manner r to that used to prepare compound 15. 1H NMR (400 MHz, D20) 5 6.00 (s, 1H), 4.25 (s, 2H), 4.17 (m, 1H), 3.50 (m, 2H), 3.25-3.06 (m, 10H), 2.29 (s, 3H), 2.26-2.02 (m, 8H), 1.90-1.73 (m, 4H), 1.68 (m, 1H), 1.40-1.17 (m, 6H); EI—MS: 486.4 (M+1).
Preparation of Compound 21 Compound 21 was prepared in a manner similar to that used to prepare compound 15. 1H NMR (400 MHz, D20) 5 5.98 (s, 1H), 5.01 (s, 2H), 4.16 (m, 1H), 3.47 (m, 2H), .06 (m, 10H), 2.29 (s, 3H), 2.25-1.97 (m, 8H), 1.87 (m, 2H), 1.78-1.62 (m, 3H), 1.40-1.16 (m, 6H); EI—MS: 502.5 (M+1).
Preparation of nd 22 Compound 22 was prepared in a manner similar to that used to e compound 15. 1H NMR (400 MHz, D20) 5 8.74 (s, 1H), 7.40 (s, 1H), 5.94 (s, 1H), 4.39-4.25 (m, 3H), 3.80 (m, 2H), 3.54 (m, 2H), 3.27-3.05 (m, 10H), 2.29 (m, 2H), 2.26 (s, 3H), 2.19-2.02 (m, 4H), 2.00-1.79 (m, 8H), 1.70 (m, 1H), 1.42-1.17 (m, 6H); EI—MS: 512.5 (M+1).
Preparation of Compound 23 Compound 23 was prepared in a manner similar to that used to prepare compound 15. 1H NMR (400 MHz, D20) 5 5.96 (s, 1H), 4.95 (s, 2H), 4.13 (m, 1H), 3.49 (m, 2H), 3.28-3.09 (m, 10H), 2.45 (m, 2H), 2.28 (s, 3H), 2.19-2.00 (m, 6H), 1.87 (m, 2H), 1.79-1.64 (m, 3H), 1.42-1.16 (m, 6H); EI-MS: 486.4 (M+1).
Preparation of Compound 24 Compound 24 was prepared in a manner similar to that used to prepare compound 15. 1H NMR (400 MHz, D20) 5 5.95 (s, 1H), 4.75 (s, 2H), 4.03 (m, 1H), 3.46 (m, 2H), 3.22-3.01 (m, 8H), 2.91 (m, 2H), 2.28 (s, 3H), .02 (m, 6H), 1.93 (m, 2H), 1.86 (m, 2H), 1.77-1.62 (m, 3H), 1.41-1.17 (m, 6H); EI-MS: 485.4 (M+1).
Preparation of Compound 25 Compound 25 was prepared in a manner similar to that used to prepare compound 15. 1H NMR (400 MHz, D20) 5 6.01 (s, 1H), 5.03 (s, 2H), 4.09 (m, 1H), 3.48 (m, 2H), 3.26-3.04 (m, 10H), 2.60 (q, 2H), 2.24-1.96 (m, 9H), 1.84 (m, 2H), 1.70 (m, 2H), 1.41-1.13 (m, 9H); EI—MS: 516.5 (M+1).
Preparation of nd 26 Compound 26 was prepared in a manner similar to that used to prepare nd 15. 1H NMR (400 MHz, D20) 5 5.98 (s, 1H), 4.97 (s, 2H), 4.14 (m, 1H), 3.46 (m, 2H), 3.22-3.12 (m, 10H), 2.58 (q, 2H), 2.46 (m, 2H), 2.20-2.02 (m, 6H), 1.88 (m, 2H), 1.80-1.66 (m, 3H), 1.41-1.13 (m, 9H); EI-MS: 500.5 (M+1).
Preparation of Compound 27 Compound 27 was ed in a manner similar to that used to e compound 15. 1H NMR (400 MHz, D20) 5 5.98 (s, 1H), 4.77 (s, 2H), 4.06 (m, 1H), 3.47 (m, 2H), 3.28-3.02 (m, 8H), 2.93 (m, 2H), 2.58 (q, 2H), 2.20-1.96 (m, 8H), 1.87 (m, 2H), 1.69 (m, 3H), 1.41-1.13 (m, 9H); EI—MS: 499.5 (M+1).
Preparation of Compound 28 Compound 28 was prepared in a manner similar to that used to prepare compound 15. 1H NMR (400 MHz, D20) 5 6.38 (br s, 1H), 5.96 (s, 1H), 4.72 (s, 2H), 4.16 (m, 1H), 3.48 (m, 2H), 3.21-3.04 (m, 8H), 2.82 (m, 2H), 2.29 (s, 3H), 2.17-2.00 (m, 8H), 1.87 (m, 2H), 1.77-1.64 (m, 3H), 1.42-1.17 (m, 6H); EI-MS: 484.5 (M+1).
Preparation of Compound 29 Shown below is a scheme for synthesizing compound 29 Via intermediates 29- I — 29-IV. i Jk Q 0' NO H2N HCI HN / IN / N \NJ\CI \N CI 29-I Boo 800 N—O H [El-O Boo Boo NHBoc / N O HCI/ether \NA| WNMN O O co\NkNW /\/\ O H H IZ compound 29 A solution of 2,4-dichloro-quinazoline (1.02 g), hydrochloride salt of 1-(4- amino-piperidinyl)-2,2,2-trifluoro-ethanone (1.21 g), and TEA (1.02 g) in THF (30 mL) under an atmosphere of nitrogen was stirred at 25 0C for 15 h and then quenched with s NH4Cl (50 mL, 2 M). The ing mixture was extracted with ethyl acetate (3x100 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The e thus obtained was purified by flash chromatography on silica gel with n-hexane/ethyl acetate (1:1) to give compound 29-1 (1.37 g, y: 75%).
A solution of compound 29-1 (0.26 g) and S-I (0.36 g) in 1-pentanol (2 mL) was heated at 120 0C for 15 min using microwave radiation and then concentrated. The residue thus obtained was purified by flash tography on silica gel with MeOH/DCM (1:32) to afford compound 29-11 (0.29 g, y: 49%).
To a magnetically stirred solution of compound 29-11 (0.29 g) in MeOH/THF (2.6 mL/2.6 mL) under an atmosphere of en was added a solution of KOH (0.05 g) in H20 (0.52 mL). The e was stirred at 25 0C for 15 h and then concentrated. The residue thus obtained was extracted with dichloromethane (3x50 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated to give the crude compound 29-III (0.24 g, y: 94%).
To a magnetically stirred on of 2-tert-butoxycarbonylamino-pentanedioic acid 1-tert-butyl ester (300.2 mg) in dichloromethane (20 mL) under an atmosphere of en was added EDCI (120.3 mg) and HOBt (96.2 mg) at 25 0C. After the mixture was stirred at 25 0C for 1 h, a solution of 29-111 (240.2 mg) in dichloromethane (10 mL) was added to the mixture in one potion. The reaction mixture was stirred for another 6 h and then poured into water. The resulting mixture was extracted with dichloromethane (2x50 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue thus obtained was purified by flash chromatography on silica gel with MeOH / DCM (1:19) to give 29-IV (170.1 mg, y: 51%).
A solution of 4N oxane (0.85 mL) was added to the solution of 29-IV (170.1 mg) in dichloromethane/1,4-dioxane (3.4 mL/3.4 mL). The mixture was stirred at 25 0C for 15 h and trated to afford hydrochloride salt of compound 29 (115.7 mg, y: 90%). 1H NMR (400 MHz, D20) 5 7.98 (d, 1H), 7.79 (t, 1H), 7.47-7.38 (m, 2H), 6.36 (s, 1H), 4.77 (s, 2H), 4.45 (m, 1H), 4.38 (m, 1H), .96 (m, 2H), 3.30 (m, 1H), 3.26-3.12 (m, 6H), 2.93 (m, 2H), 2.80 (m, 1H), 2.72 (m, 2H), 2.22 (m, 2H), .79 (m, 10H), 1.66 (m, 2H), 1.51 (m, 1H), 1.39-1.15 (m, 6H); EI—MS: 650.5 (M+1).
Preparation of Compound 30 Compound 30 was prepared in a manner similar to that used to prepare compound 29. 1H NMR (400 MHz, D20) 5 7.94 (m, 1H), 7.82-7.71 (m, 2H), 7.42—7.42 (m, 2H), 4.64 (s, 2H), 4.48-4.40 (m, 2H), .99 (m, 2H), 3.30-3.06 (m, 7H), 2.93 (m, 2H), 2.84 (m, 1H), 2.72 (m, 2H), 2.23-1.98 (m, 9H), 1.90-1.79 (m, 3H), 1.67 (m, 2H), 1.56 (m, 1H), 1.41-1.15 (m, 6H); EI-MS: 650.5 (M+1).
Preparation of Compound 31 Compound 31 was prepared in a manner similar to that used to e compound 29. 1H NMR (400 MHz, D20) 5 7.97 (d, 1H), 7.78 (t, 1H), 7.48 (s, 1H), 7.44-7.38 (m, 2H), 5.15 (d, 1H), 5.11 (d, 1H), 4.42 (m, 1H), 4.31 (m, 1H), 4.14 (m, 1H), 4.01 (m, 1H), 3.21-3.04 (m, 7H), 2.94 (m, 2H), 2.75-2.66 (m, 3H), 2.25 (m, 2H), 2.19-1.78 (m, 10H), 1.67 (m, 2H), 1.49 (m, 1H), 1.40-1.17 (m, 6H); EI—MS: 666.5 (M+1).
Preparation of Compound 32 Compound 32 was prepared in a manner similar to that used to prepare compound 29. 1H NMR (400 MHz, D20) 5 8.00 (d, 1H), 7.81 (t, 1H), 7.73 (s, 1H), 7.46-7.41 (m, 2H), 4.81 (s, 2H), 4.46 (m, 1H), 4.31 (m, 1H), 4.08-3.99 (m, 2H), 3.23 (m, 1H), 3.18- 3.04 (m, 6H), 2.78-2.73 (m, 3H), 2.62 (m, 2H), 2.24 (m, 2H), 2.11-1.78 (m, 10H), 1.64 (m, 2H), 1.53 (m, 1H), 1.40-1.17 (m, 6H); EI—MS: 650.5 (M+1).
Preparation of Compound 33 Compound 33 was prepared in a manner r to that used to prepare compound 29. 1H NMR (400 MHz, D20) 5 8.01 (d, 1H), 7.82 (t, 1H), 7.47-7.42 (m, 2H), 4.81 (s, 2H), 4.50 (m, 1H), 4.39 (m, 1H), 4.04-3.96 (m, 2H), 3.26-3.12 (m, 9H), 2.83 (m, 1H), 2.71 (m, 2H), 2.24-2.18 (m, 4H), 2.17-1.81 (m, 8H), 1.68 (m, 2H), 1.53 (m, 1H), 1.40- 1.17 (m, 6H); EI-MS: 651.5 (M+1).
Preparation of nd 34 Compound 34 was ed in a manner similar to that used to prepare compound 29. 1H NMR (400 MHz, D20) 5 8.00 (d, 1H), 7.80 (t, 1H), .38 (m, 2H), 4.56-4.42 (m, 2H), 4.33 (s, 2H), 4.06-4.00 (m, 2H), 3.27 (m, 1H), 3.20-3.10 (m, 6H), 2.86 (m, 1H), 2.72 (m, 2H), 2.47 (m, 2H), 2.24-1.98 (m, 9H), 1.86-1.58 (m, 6H), 1.40-1.14 (m, 6H); EI—MS: 651.5 (M+1).
Preparation of Compound 35 nd 35 was prepared in a manner similar to that used to prepare compound 29. 1H NMR (400 MHz, D20) 5 8.01 (d, 1H), 7.83 (t, 1H), 7.49-7.43 (m, 2H), 5.11 (d, 1H), 5.07 (d, 1H), 4.46 (m, 1H), 4.32 (m, 1H), 4.06-3.98 (m, 2H), 3.36-3.12 (m, 9H), 2.72-2.66 (m, 3H), 2.24-2.04 (m, 8H), 1.98-1.76 (m, 4H), 1.66 (m, 2H), 1.53 (m, 1H), 1.40-1.17 (m, 6H); EI—MS: 667.5 (M+1).
Preparation of Compound 36 Compound 36 was ed in a manner r to that used to prepare compound 29. 1H NMR (400 MHz, D20) 5 8.74 (s, 1H), 8.03 (d, 1H), 7.83 (t, 1H), 7.51-7.39 (m, 3H), 4.57-4.41 (m, 2H), 4.17 (m, 2H), 4.15-4.02 (m, 2H), 3.91 (m, 2H), 3.35-3.12 (m, 7H), 3.01-2.81 (m, 3H), 2.77 (m, 2H), .03 (m, 8H), 1.99-1.60 (m, 9H), 1.40- 1.17 (m, 6H); EI-MS: 677.6 (M+1).
Preparation of Compound 37 Compound 37 was prepared in a manner similar to that used to prepare compound 29. 1H NMR (400 MHz, D20) 5 8.02 (d, 1H), 7.83 (t, 1H), .41 (m, 2H), 5.07 (d, 1H), 5.03 (d, 1H), 4.47 (m, 1H), 4.37 (m, 1H), 4.07-3.96 (m, 2H), 3.35-3.12 (m, 9H), 2.87 (m, 1H), 2.73 (m, 2H), 2.46 (m, 2H), 2.23 (m, 2H), 2.17-2.01 (m, 4H), 2.00-1.80 (m, 4H), 1.68 (m, 2H), 1.57 (m, 1H), 1.40-1.17 (m, 6H); EI-MS: 651.5 (M+1).
Preparation of Compound 38 Compound 38 was prepared in a manner similar to that used to prepare compound 29. 1H NMR (400 MHz, D20) 5 7.95 (d, 1H), 7.42 (t, 1H), 7.42-7.38 (m, 2H), 4.92 (d, 1H), 4.87 (d, 1H), 4.41 (m, 1H), 4.22 (m, 1H), 4.11 (m, 1H), 4.02 (m, 1H), 3.22-3.08 (m, 7H), 2.99 (t, 2H), 2.75 (m, 2H), 2.62 (m, 1H), 2.30-2.00 (m, 8H), 1.99-1.72 (m, 4H), 1.67 (m, 2H), 1.49 (m, 1H), 1.40-1.17 (m, 6H); EI—MS: 650.6 (M+1).
Preparation of Compound 39 Shown below is a scheme for synthesizing compound 39 Via intermediates 39- I — 39-V. o Jok CI NACF3 O CF3 H2NW\/\N/\/\N£ j o Boo Boo / N H2N \ J\ / N N 0' N CI HCI/ether \NAN/WWNMN| 0 H H H compound 39 A solution of 2,4-dichloromethylpyrimidine (0.82 g), hydrochloride salt of 1-(4-Amino-piperidinyl)-2,2,2-trifluoro-ethanone (1.21 g), and TEA (1.02 g) in THF (30 mL) under an atmosphere of nitrogen was stirred at 25 0C for 15 h and then quenched with aqueous NH4Cl (50 mL, 2 M). The ing mixture was extracted with ethyl acetate (3x100 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue thus ed was purified by flash chromatography on silica gel with n-hexane/ethyl acetate (1:1) to give compound 39-1 (1.07 g, y: 66%).
A solution of compound 39-1 (0.24 g) and S-I (0.36 g) in 1-pentanol (2 mL) was heated at 120 0C for 15 min using microwave radiation and then concentrated. The residue thus ed was purified by flash chromatography on silica gel with MeOH/DCM (1:32) to afford compound 39-11 (0.33 g, y: 57%).
To a magnetically stirred solution of compound 39-11 (0.33 g) in MeOH/THF (2.6 mL/2.6 mL) under an atmosphere of nitrogen was added a on of KOH (0.05 g) in H20 (0.52 mL). The mixture was stirred at 25 0C for 15 h and then concentrated.
The e thus obtained was extracted with dichloromethane (3x50 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated to give the crude compound 39-III (0.23 g, y: 79%).
To a magnetically d solution of 3-(tert-Butoxycarbonyl- ethoxycarbonylmethyl-amino)-propionic acid (280.1 mg) in romethane (20 mL) under an atmosphere of nitrogen was added EDCI (116.4 mg) and HOBt (92.5 mg) at 0C. After the mixture was stirred at 25 0C for 1 h, a solution of 39-111 (232.8 mg) in dichloromethane (20 mL) was added to the mixture in one potion. The reaction mixture was stirred for another 6 h and then poured into water. The resulting mixture was ted with dichloromethane (2x50 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated.
The residue thus obtained was purified by flash chromatography on silica gel with MeOH/DCM (1:19) to give 39-IV (231.4 mg, y: 72%).
To a solution of 39-IV (231.4 mg) in THF (30 mL) under an atmosphere of nitrogen was added a on of LiOH(aq) (1 mL, 1N). The e was d at 0C for 15 h and then ed with NH4Cl(aq) (20 mL, 2M). The s phase was extracted with ethyl acetate (3x50 mL). The combined organic extracts were washed with water and brine, dried over anhydrous sodium sulfate, filtered. The filtrate was concentrated to get the crude residue 39-V (200.4 mg, y: 89%).
A solution of 4N HCl/dioxane (1 mL) was added to the solution of 39-V (200.4 mg) in dichloromethane/1,4-dioxane (4 mL/4 mL). The mixture was stirred at 0C for 15 h and concentrated to afford hydrochloride salt of compound 39 (154.7 mg, y: 98%). 1H NMR (400 MHz, D20) 5 6.34 (s, 1H), 5.92 (s, 1H), 4.73 (d, 1H), 4.65 (d, 1H), 4.30 (m, 1H), 4.10 (m, 1H), 3.90 (s, 2H), 3.88 (m, 1H), 3.41 (t, 2H), 3.31-3.12 (m, 7H), 3.00-2.82 (m, 5H), 2.30 (s, 3H), 2.18-2.00 (m, 7H), 1.98-1.77 (m, 4H), 1.70 (m, 1H), 1.53 (m, 1H), 1.46-1.16 (m, 6H); EI—MS: 614.5 (M+1).
Preparation of Compound 40 Compound 40 was prepared in a manner similar to that used to prepare compound 39. 1H NMR (400 MHz, D20) 5 7.78 (s, 1H), 5.91 (s, 1H), 4.58 (d, 1H), 4.52 (d, 1H), 4.32-4.20 (m, 2H), 3.97 (s, 2H), 3.92 (m, 1H), 3.44 (m, 2H), 3.36-3.12 (m, 7H), 3.04- 2.90 (m, 5H), 2.26 (s, 3H), 2.21-1.80 (m, 10H), 1.69 (m, 1H), 1.57 (m, 1H), 1.46 (m, 1H),1.40-1.16 (m, 6H); EI—MS: 614.5 (M+1).
Preparation of Compound 41 Compound 41 was ed in a manner similar to that used to prepare compound 39. 1H NMR (400 MHz, D20) 5 7.39 (s, 1H), 5.92 (s, 1H), 5.00 (d, 1H), 4.92 (d, 1H), 4.22 (m, 1H), 4.04 (m, 1H), 3.93 (s, 2H), 3.84 (m, 1H), 3.41 (t, 2H), 3.22-3.10 (m, 7H), 2.96 (t, 2H), 2.91 (t, 2H), 2.83 (m, 1H), 2.27 (s, 3H), 2.18-2.03 (m, 7H), 1.93- 1.80 (m, 3H), 1.70 (m, 2H), 1.50 (m, 1H), 1.41-1.17 (m, 6H); EI-MS: 632.5 (M+1).
Preparation of Compound 42 Compound 42 was prepared in a manner similar to that used to prepare compound 39. 1H NMR (400 MHz, D20) 5 7.71 (s, 1H), 5.92 (s, 1H), 4.74 (d, 1H), 4.67 (d, 1H), 4.27 (m, 1H), 4.02 (m, 1H), 3.93 (m, 1H), 3.91 (s, 2H), 3.42 (m, 2H), .04 (m, 7H), 2.97 (m, 2H), 2.90 (m, 1H), 2.63 (t, 2H), 2.27 (s, 3H), 2.19-1.78 (m, 11H), 1.69 (m, 1H), 1.53 (m, 1H), 1.42-1.17 (m, 6H); EI-MS: 614.5 (M+1).
Preparation of Compound 43 Compound 43 was prepared in a manner similar to that used to e compound 39. 1H NMR (400 MHz, D20) 5 5.93 (s, 1H), 4.80 (d, 1H), 4.73 (d, 1H), 4.29 (m, 1H), 4.08 (m, 1H), 3.89 (m, 1H), 3.87 (s, 2H), 3.41 (t, 2H), 3.30-3.10 (m, 9H), 2.98 (t, 2H), 2.91 (m, 1H), 2.27 (s, 3H), 2.25-2.04 (m, 7H), 1.98-1.78 (m, 4H), 1.68 (m, 1H), 1.54 (m, 1H), 1.41-1.17 (m, 6H); EI—MS: 615.5 (M+1).
Preparation of Compound 44 Compound 44 was prepared in a manner r to that used to prepare compound 39. 1H NMR (400 MHz, D20) 5 5.98 (s, 1H), 4.38-4.20 (m, 4H), 3.92 (m, 1H), 3.84 (s, 2H), 3.42 (t, 2H), 3.38-3.16 (m, 7H), 3.06 (m, 1H), 2.99 (t, 2H), 2.51 (t, 2H), 2.29 (s, 3H), 2.22-2.01 (m, 7H), 1.97-1.81 (m, 3H), 1.70 (m, 1H), 1.62-1.43 (m, 2H), 1.41- 1.17 (m, 6H); EI-MS: 615.5 (M+1).
Preparation of nd 45 Compound 45 was prepared in a manner similar to that used to prepare compound 39. 1H NMR (400 MHz, D20) 5 5.94 (s, 1H), 5.04 (d, 1H), 4.95 (d, 1H), 4.28 (m, 1H), 4.02 (m, 1H), 3.96-3.84 (m, 3H), 3.41 (t, 2H), 3.28-3.16 (m, 9H), 2.98 (t, 2H), 2.83 (m, 1H), 2.27 (s, 3H), 2.24-2.04 (m, 7H), 1.92-1.80 (m, 3H), 1.70 (m, 2H), 1.51 (m, 1H), 1.41-1.17 (m, 6H); EI-MS: 631.5 (M+1).
Preparation of Compound 46 Compound 46 was prepared in a manner similar to that used to prepare compound 39. 1H NMR (400 MHz, D20) 5 5.94 (s, 1H), 4.99 (d, 1H), 4.92 (d, 1H), 4.28 (m, 1H), 4.05 (m, 1H), 3.93 (s, 2H), 3.90 (m, 1H), 3.43 (t, 2H), 3.31-3.15 (m, 9H), 2.99 (t, 2H), 2.92 (m, 1H), 2.47 (m, 2H), 2.28 (s, 3H), 2.19-2.03 (m, 5H), 1.92-1.80 (m, 3H), 1.71 (m, 2H), 1.53 (m, 1H), 1.41-1.17 (m, 6H); EI-MS: 615.5 (M+1). ation of Compound 47 Shown below is a scheme for synthesizing compound 47 Via intermediates 47- I — 47-III.
/ IN 0 / N \ /|\ N NWN/\/\ \ J\ N N NWNMNO H N-O Boo Boo H N-O/ Boo Boo 29-III 47 I 13NNNHZ o o NH2NH2H20 (:63: NHBOC \N NWNMNO N—o Boo Boo 47-II NHBoc H H H [Q‘Hz H O”M wPOsEteN N UNNMN$P03H2' O O O o HN HN / IN TMSBI’ / |N N N/YWNMN/|::| \N NWNMNO H N—O Boo Boo H N-O H H 47-lll compound 47 To a magnetically stirred solution of compound 29-111 (241 mg) and K2C03 (241 mg) in acetonitrile (50 mL) under an atmosphere of en was added 2-(2- bromo-ethyl)-isoindole-1,3-dione (135 mg). The reaction e was stirred at 60 0C for 15 h and then quenched with NH4Cl(aq) (50 mL, 2 M). The resulting mixture was extracted with dichloromethane (3x100 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated.
The residue thus obtained was purified by flash chromatography on silica gel with MeOH/DCM (1:19) to afford 47-1 (215 mg, y: 72%).
To a stirred solution of compound 47-1 (215 mg) in methanol (5 mL) at 5 0C was added 85% OHZO (40 mg) dropwise. The resulting mixture was stirred at 0C for 15 h and then concentrated. The residue was poured into K2C03 (aq) (50 mL, 10% w/w) and the mixture was ted with CHzClz (3x100 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue thus obtained was purified by flash tography on silica gel with MeOH/NH4OH (9:1) to afford 47-11 (182.3 mg, y: 99%).
To a ically stirred solution of 4-tert-Butoxycarbonylamino[2- (diethoxy-phosphoryl)-ethylcarbamoyl]-butyric acid (300.6 mg) in dichloromethane (50 mL) under an atmosphere of en was added EDCI (91.2 mg) and HOBt (72.9 mg) at 25 0C. After the mixture was d at 25 0C for 1 h, a solution of compound 47-11 (182.3 mg) in dichloromethane (10 mL) was added to the mixture in one potion.
The reaction mixture was stirred for another 6 h and then poured into water. The resulting mixture was extracted with dichloromethane (2x50 mL). The combined organic extracts were washed with brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The residue thus obtained was purified by flash chromatography on silica gel with MeOH/DCM (1:19) to give 47-III (241.2 mg, 87% yield).
TMSBr (0.8 mL) was added to the solution of compound 47-III (241.2 mg) in dichloromethane (15 mL). The reaction mixture was d at 25 0C for 15 h and concentrated to afford hydrobromide salt of compound 47 (175.3 mg, y: 81%). 1H NMR (400 MHz, D20) 5 7.97 (d, 1H), 7.79 (dd, 1H), 7.42-7.36 (m, 2H), 6.40 (s, 1H), 4.78 (s, 2H), 4.42 (m, 1H), 4.07 (m, 1H), 3.81 (m, 2H), 3.69 (m, 2H), 3.52 (m, 2H), 3.40 (m, 2H), 3.30-3.10 (m, 8H), 2.94 (t, 2H), 2.50 (m, 2H), 2.24-1.93 (m, 14H), 1.85 (m, 2H), 1.68 (m, 1H), 1.41-1.17 (m, 6H); EI-MS: 800.5 (M+1).
Preparation of Compound 48 Compound 48 was prepared in a manner r to that used to prepare compound 47. 1H NMR (400 MHz, D20) 5 8.02 (d, 1H), 7.84 (s, 1H), 7.80 (dd, 1H), 7.48-7.40 (m, 2H), 4.68 (s, 2H), 4.59 (m, 1H), 4.05 (m, 1H), 3.82 (m, 2H), 3.67 (m, 2H), 3.52 (m, 2H), 3.38 (m, 2H), 3.31-3.14 (m, 8H), 2.97 (t, 2H), 2.50 (m, 2H), 2.39 (m, 2H), 2.23- 2.01 (m, 12H), 1.85 (m, 2H), 1.68 (m, 1H), 1.41-1.17 (m, 6H); EI—MS: 800.5 (M+1).
Preparation of Compound 49 Compound 49 was prepared in a manner similar to that used to prepare nd 47. 1H NMR (400 MHz, D20) 5 8.02 (d, 1H), 7.81 (dd, 1H), 7.48-7.40 (m, 2H), 7.24 (s, 1H), 5.01 (s, 2H), 4.42 (m, 1H), 3.99 (m, 1H), 3.69 (m, 2H), 3.65 (m, 2H), 3.54 (m, 1H), 3.45 (m, 1H), 3.34 (m, 2H), .04 (m, 8H), 2.87 (t, 2H), 2.47 (m, 2H), 2.24- 1.97 (m, 12H), 1.92-1.80 (m, 4H), 1.68 (m, 1H), 1.41-1.17 (m, 6H); EI—MS: 816.5 (M+1).
Preparation of Compound 50 nd 50 was prepared in a manner similar to that used to prepare compound 47. 1H NMR (400 MHz, D20) 5 8.00 (d, 1H), 7.80 (dd, 1H), 7.75 (s, 1H), 7.46-7.40 (m, 2H), 4.82 (s, 2H), 4.40 (m, 1H), 4.01 (m, 1H), 3.73 (m, 2H), 3.67 (m, 2H), 3.54 (m, 1H), 3.43 (m, 1H), 3.38 (m, 2H), 3.22-3.08 (m, 8H), 2.62 (t, 2H), 2.48 (m, 2H), 2.25- 1.96 (m, 14H), 1.84 (m, 2H), 1.68 (m, 1H), 1.41-1.17 (m, 6H); EI—MS: 800.6 (M+1).
Preparation of Compound 51 Compound 51 was prepared in a manner similar to that used to prepare compound 47. 1H NMR (400 MHz, D20) 5 8.07 (d, 1H), 7.87 (dd, 1H), 7.54-7.46 (m, 2H), 5.01 (s, 2H), 4.39 (m, 1H), 4.05 (m, 1H), 3.84 (m, 2H), 3.69 (m, 2H), 3.51 (m, 2H), 3.41 (m, 2H), 3.36-3.02 (m, 10H), 2.51 (m, 2H), 2.32-1.96 (m, 14H), 1.87 (m, 2H), 1.69 (m, 1H), 1.41-1.17 (m, 6H); EI-MS: 801.6 (M+1).
Preparation of nd 52 Compound 52 was prepared in a manner similar to that used to prepare compound 47. 1H NMR (400 MHz, D20) 5 8.07 (d, 1H), 7.86 (dd, 1H), .43 (m, 2H), 5.17 (s, 2H), 4.69 (t, 2H), 4.46 (m, 1H), 4.06 (m, 1H), 3.82 (m, 2H), 3.69 (m, 2H), 3.56-3.12 (m, 12H), 2.53-2.38 (m, 4H), 2.32-1.80 (m, 14H), 1.69 (m, 1H), 1.41-1.17 (m, 6H); EI—MS: 801.6 (M+1).
Preparation of Compound 53 Compound 53 was prepared in a manner similar to that used to prepare compound 1.
EI—MS: 523.5 (M+1). ation of nd 54 Compound 54 was prepared in a manner similar to that used to e compound 29. 1H NMR (400 MHz, D20) 5 8.02 (d, 1H), 7.83 (t, 1H), 7.75 (s, 1H), 7.50-7.42 (m, 2H), 4.82 (s, 2H), 4.47 (m, 1H), 4.40-4.24 (m, 2H), 4.06 (m, 1H), 3.25 (m, 1H), 3.20- 3.04 (m, 6H), 2.80 (m, 1H), 2.70-2.60 (m, 4H), 2.20-1.78 (m, 9H), 1.92-1.80 (m, 3H), 1.71 (m, 2H), 1.53 (m, 1H), 1.40-1.17 (m, 6H); EI—MS: 651.5 (M+1).
Preparation of Compound 55 Shown below is a scheme for synthesizing compound 55 Via intermediates 55- 1— 55-111.
Boo Boo Cl CI H2N’YN~N’\/R°\C/\/R°c HN/Y ‘IN/\/N\/\/N N \ N N=N \N \O N N=N «11—»wi \N s-xn «11 N N N c. N Cl N N CI CO55-. CO 55-" Boo Boo H H / NNNWNU HN HN /N‘N/\/N\/\/N HN K/NH N=N <N / N=N HCI/ether N U —> I </N / IN N \NJ‘N/fi H \N N do NH K/NH 55.||| compound 55 To a magnetically stirred solution of 2,6-dichloropurine (10 g) in ethyl acetate (100 mL) was added p-toluenesulfonic acid monohydrate (0.08 g). The resultant mixture was heated to 50 0C under an atmosphere of nitrogen and 3,4-dihydro-2H— pyran (7.5 mL) was added over a period of 2 h. The mixture was stirred at 25 0C for h and filtrated to give crude solid. The solid was washed with n-hexane/ethyl acetate (1:1) to afford compound 55-1 (14.4 g, y: 100%) To a magnetically stirred on of compound 55-1 (0.65 g) in ethyl acetate (35 mL) under an atmosphere of en was added compound S-XI (1.15 g) and TEA (0.75 g). The mixture was heated to 50 0C for 4 h, cooled down to 25 0C, and then quenched with aqueous NH4Cl (50 mL, 2 M). The ing solution was extracted with ethyl acetate (3x100 mL). The ed extracts were washed with brine, dried over anhydrous sodium sulfate, ed, and concentrated. The residue thus obtained was purified by flash chromatography on silica gel with CM (1:9) to afford compound 55-11 (1.16 g, y: 68%) as a light yellow solid.
A solution of compound 55-11 (1.05 g) and piperazine (1.00 g) in 1-pentanol (6 mL) was heated at 100 0C for 15 h, and then concentrated. The residue thus obtained was purified with flash chromatography on silica gel with CM (1:1) to afford compound 55-III (0.67 g, y: 60%).
A solution of 1N HCl/diethyl ether (5.3 mL) was added to the solution of compound 55-111 (264 mg) in dichloromethane (10.6 mL). The reaction mixture was stirred for 15 h and concentrated to afford hydrochloride salt of compound 55 (204 mg, 94% yield). EI—MS: 498.5 (M+1).
Preparation of Compound 56 nd 56 was prepared in a manner similar to that used to prepare compound 1.
EI-MS: 528.5 (M+1).
Preparation of Compound 57 Compound 57 was prepared in a manner similar to that used to prepare compound 15.
EI—MS: 473.5 (M+1).
Preparation of Compound 58 Compound 58 was prepared in a manner similar to that used to prepare compound 15.
EI—MS: 472.5 (M+1).
Preparation of nd 59 Compound 59 was prepared in a manner similar to that used to prepare compound 39. 1H NMR (400 MHz, D20) 5 8.02 (d, 1H), 7.83 (t, 1H), 7.46-7.41 (m, 2H), 5.10 (d, 1H), 5.02 (m, 1H), 4.47 (m, 1H), 4.36 (m, 1H), 4.05 (m, 1H), 3.95 (s, 2H), .12 (m, 9H), 2.84 (m, 1H), 2.69 (t, 2H), 2.58 (t, 2H), 2.47 (m, 2H), 2.17-2.00 (m, 7H), 1.94-1.80 (m, 3H), 1.71 (m, 2H), 1.51 (m, 1H), 1.41-1.17 (m, 6H); EI-MS: 665.6 (M+1). ation of Compound 60 Compound 60 was prepared in a manner similar to that used to prepare nd 29.
EI—MS: 767.6 (M+1).
Preparation of Compound 61 Compound 61 was prepared in a manner similar to that used to prepare compound 39. 1H NMR (400 MHz, D20) 5 8.03 (d, 1H), 7.84 (t, 1H), 7.51-7.45 (m, 2H), 5.11 (d, 1H), 5.02 (d, 1H), 4.48 (m, 1H), 4.28 (m, 1H), 4.01-3.83 (m, 3H), 3.45 (t, 2H), 3.31- 3.11 (m, 7H), 3.02 (t, 2H), 2.95-2.81 (m, 3H), 2.48 (m, 2H), 2.15-1.97 (m, 5H), 1.92- 1.81 (m, 3H), 1.71 (m, 2H), 1.57 (m, 1H), 1.41-1.17 (m, 6H); EI-MS: 651.5 (M+1).
Preparation of nd 62 Compound 62 was prepared in a manner similar to that used to prepare compound 39. 1H NMR (400 MHz, D20) 5 5.93 (s, 1H), 4.99 (d, 1H), 4.92 (d, 1H), 4.28 (m, 1H), 4.05 (m, 1H), 3.96 (m, 1H), 3.87 (s, 2H), 3.34-3.14 (m, 11H), 2.90 (m, 1H), 2.66 (t, 2H), 2.47 (m, 2H), 2.28 (s, 3H), 2.19-2.00 (m, 7H), 1.94-1.81 (m, 3H), 1.71 (m, 2H), 1.51 (m, 1H), .17 (m, 6H); EI—MS: 629.5 (M+1).
Preparation of Compound 63 Compound 63 was prepared in a manner similar to that used to prepare compound 39. 1H NMR (400 MHz, D20) 5 5.95 (s, 1H), 4.98 (d, 1H), 4.91 (d, 1H), 4.29 (m, 1H), 4.04 (m, 1H), 3.98-3.86 (m, 3H), 3.43 (t, 2H), 3.38-3.18 (m, 9H), 2.99 (t, 2H), 2.92 (m, 1H), 2.59 (q, 2H), 2.46 (m, 2H), 2.32-1.64 (m, 10H), 1.52 (m, 1H), 1.41-1.17 (m, 9H); EI—MS: 629.5 (M+1).
Preparation of Compound 64 Compound 64 was prepared in a manner similar to that used to prepare compound 39. 1H NMR (400 MHz, D20) 5 5.94 (s, 1H), 4.99 (d, 1H), 4.92 (d, 1H), 4.28 (m, 1H), 4.05 (m, 1H), 3.99-3.84 (m, 3H), 3.34-3.14 (m, 11H), 2.89 (m, 1H), 2.65 (t, 2H), 2.58 (q, 2H), 2.46 (m, 2H), 2.19-2.00 (m, 7H), 1.94-1.81 (m, 3H), 1.70 (m, 2H), 1.51 (m, 1H), 1.41-1.17 (m, 9H); EI-MS: 643.6 (M+1).
Preparation of Compound 65 Compound 65 was prepared in a manner r to that used to prepare compound 29. 1H NMR (400 MHz, D20) 5 5.94 (s, 1H), 4.98 (d, 1H), 4.93 (d, 1H), 4.29 (m, 1H), 4.12-4.01 (m, 2H), 3.93 (m, 1H), 3.30-3.14 (m, 9H), 2.90 (m, 1H), 2.72 (m, 2H), 2.58 (q, 2H), 2.46 (m, 2H), 2.26-2.05 (m, 7H), 1.92-1.82 (m, 3H), 1.69 (m, 2H), 1.51 (m, 1H), 1.40-1.17 (m, 9H); EI-MS: 629.5 (M+1).
Preparation of Compound 66 Compound 66 was prepared in a manner similar to that used to prepare compound 29. 1H NMR (400 MHz, D20) 5 5.94 (s, 1H), 4.82 (s, 2H), 4.28 (m, 1H), 4.10-3.83 (m, 3H), 3.18-3.12 (m, 7H), 2.95 (m, 2H), 2.83 (m, 1H), 2.71 (m, 2H), 2.58 (q, 2H), 2.26- 2.04 (m, 9H), .78 (m, 3H), 1.69 (m, 2H), 1.50 (m, 1H), 1.40-1.17 (m, 9H); EI- MS: 628.5 (M+1).
Preparation of Compound 67 nd 67 was prepared in a manner similar to that used to prepare compound 29. 1H NMR (400 MHz, D20) 5 8.04 (d, 1H), 7.86 (t, 1H), 7.51-7.43 (m, 2H), 5.12 (s, 2H), 4.70 (t, 2H), 4.47 (m, 1H), 4.27 (m, 1H), 4.12-4.01 (m, 2H), 3.31-3.13 (m, 7H), 2.86 (m, 1H), 2.75 (m, 2H), 2.43 (m, 2H), 2.28 (m, 2H), 2.17-2.04 (m, 4H), 1.95-1.80 (m, 4H), 1.71 (m, 2H), 1.57 (m, 1H), .17 (m, 6H); EI-MS: 651.5 (M+1).
Preparation of Compound 68 Compound 68 was prepared in a manner similar to that used to prepare compound 39. 1H NMR (400 MHz, D20) 5 8.04 (d, 1H), 7.84 (t, 1H), 7.51-7.42 (m, 2H), 5.15 (s, 2H), 4.69 (t, 2H), 4.49 (m, 1H), 4.30 (m, 1H), 4.01-3.90 (m, 3H), 3.44 (t, 2H), 3.36- 3.13 (m, 7H), 3.02 (t, 2H), 2.90 (m, 1H), 2.43 (m, 2H), 2.18-2.05 (m, 4H), 1.94-1.81 (m, 4H), 1.71 (m, 2H), 1.58 (m, 1H), 1.41-1.17 (m, 6H); EI-MS: 651.5 (M+1).
Preparation of Compound 69 Compound 69 was prepared in a manner similar to that used to prepare compound 29. 1H NMR (400 MHz, D20) 5 5.95 (s, 1H), 5.02 (d, 1H), 5.00 (d, 1H), 4.31 (m, 1H), 4.09-3.86 (m, 3H), 3.30-3.12 (m, 9H), 2.85 (m, 1H), 2.70 (m, 2H), 2.58 (q, 2H), 2.28- 2.05 (m, 9H), 1.92-1.80 (m, 3H), 1.70 (m, 2H), 1.50 (m, 1H), 1.40-1.17 (m, 9H); EI- MS: 645.5 (M+1).
Preparation of Compound 70 Compound 70 was prepared in a manner similar to that used to prepare compound 39. 1H NMR (400 MHz, D20) 5 5.96 (s, 1H), 5.05 (d, 1H), 4.97 (d, 1H), 4.29 (m, 1H), 4.03 (m, 1H), 3.98-3.84 (m, 3H), 3.43 (t, 2H), 3.32-3.13 (m, 9H), 2.99 (t, 2H), 2.86 (m, 1H), 2.58 (q, 2H), 2.28-2.04 (m, 7H), .80 (m, 3H), 1.71 (m, 2H), 1.52 (m, 1H), 1.41-1.17 (m, 9H); EI-MS: 645.5 (M+1).
Preparation of Compound 71 Compound 71 was prepared in a manner similar to that used to e compound 15. 1H NMR (300 MHz, D20) 5 8.67 (s, 1H), 5.94 (s, 1H), 4.76 (s, 2H), 4.36 (t, 2H), 4.10 (m, 1H), 3.44 (m, 2H), .02 (m, 8H), 2.32 (m, 2H), 2.26 (s, 3H), 2.19-1.98 (m, 6H), 1.84 (m, 2H), 1.79-1.60 (m, 3H), 1.42-1.16 (m, 6H); EI-MS: 485.6 (M+1).
Preparation of Compound 72 Compound 72 was prepared in a manner similar to that used to prepare compound 1.
EI-MS: 492.6 (M+1).
Preparation of Compound 73 Compound 73 was prepared in a manner similar to that used to prepare compound 15. 1H NMR (300 MHz, D20) 5 7.66 (s, 1H), 6.01 (s, 1H), 4.97 (s, 2H), 4.41 (s, 2H), 4.05 (m, 1H), 3.45 (m, 2H), 3.28- 3.03 (m, 6H), 2.29 (s, 3H), 2.18-1.96 (m, 6H), 1.86 (m, 2H), .60 (m, 3H), 1.41-1.18 (m, 6H); EI-MS: 456.6 (M+1).
Preparation of Compound 74 Compound 74 was prepared in a manner similar to that used to prepare nd 15. 1H NMR (300 MHz, D20) 5 8.21 (s, 1H), 5.05 (s, 2H), 4.08 (m, 1H), 3.49 (m, 2H), 3.21-3.06 (m, 10H), 2.43 (m, 2H), 2.19-2.00 (m, 7H), 1.90-1.62 (m, 7H), 1.42-1.16 (m, 6H); EI-MS: 540.7 (M+1).
Preparation of Compound 75 Compound 75 was prepared in a manner similar to that used to prepare compound 15.
EI—MS: 486.6 (M+1).
Preparation of Compound 76 Compound 76 was prepared in a manner similar to that used to prepare compound 29. 1H NMR (300 MHz, D20) 5 7.94 (d, 1H), 7.76 (t, 1H), 7.42-7.36 (m, 2H), 6.52 (s, 1H), 4.81 (s, 2H), 4.41 (m, 1H), 4.27 (m, 1H), 4.08 (m, 1H), 3.99 (m, 1H), 3.22-3.06 (m, 7H), 2.86 (t, 2H), 2.80-2.66 (m, 3H), 2.22 (m, 2H), 2.16-2.00 (m, 6H), 1.99-1.59 (m, 66 (m, 2H), 1.49 (m, 1H), 1.39-1.15 (m, 6H); EI-MS: 649.6 (M+1).
Preparation of Compound 77 Compound 77 was prepared in a manner similar to that used to prepare compound 29. 1H NMR (300 MHz, D20) 5 8.65 (s, 1H), 7.93 (d, 1H), 7.76 (t, 1H), 7.41-7.34 (m, 2H), 4.80 (m, 2H), 4.44 (m, 1H), 4.37 (t, 2H), 4.25 (m, 1H), 4.11 (m, 1H), 3.99 (m, 1H), .02 (m, 7H), 2.77 (m, 1H), 2.73 (m, 2H), 2.31-2.20 (m, 4H), 2.17-2.01 (m, 4H), 2.00-1.80 (m, 4H), 1.68 (m, 2H), 1.57 (m, 1H), 1.40-1.17 (m, 6H); EI-MS: 650.6 (M+1). ation of Compound 78 Compound 78 was prepared in a manner similar to that used to prepare compound 39. 1H NMR (300 MHz, D20) 5 7.93 (d, 1H), 7.77 (t, 1H), 7.41-7.35 (m, 2H), 5.05 (d, 1H), 4.97 (d, 1H), 4.43 (m, 1H), 4.29 (m, 1H), 4.19 (m, 1H), 3.90 (m, 1H), 3.58 (m, 2H), 3.31-3.06 (m, 9H), 2.98 (m, 2H), 2.81 (m, 1H), 2.55-2.38 (m, 4H), 2.22-1.77 (m, 12H), 1.71 (m, 2H), 1.57 (m, 1H), 1.41-1.17 (m, 6H); EI—MS: 691.6 (M+1). ation of Compound 79 Compound 79 was prepared in a manner similar to that used to prepare compound 29. 1H NMR (300 MHz, D20) 5 8.02 (d, 1H), 7.83 (t, 1H), 7.76 (s, 1H), 7.50-7.42 (m, 2H), 5.09 (m, 2H), 4.44 (s, 2H), 4.40 (m, 1H), 4.23 (m, 1H), .99 (m, 2H), 3.23- 3.04 (m, 5H), 2.78-2.73 (m, 3H), 2.22 (m, 2H), 2.18-2.00 (m, 4H), 1.94-1.70 (m, 4H), 1.64 (m, 2H), 1.53 (m, 1H), 1.40-1.17 (m, 6H); EI—MS: 621.7 (M+1).
Preparation of Compound 80 nd 80 was prepared in a manner similar to that used to prepare compound 39. 1H NMR (300 MHz, D20) 5 7.92 (d, 1H), 7.74 (t, 1H), 7.41-7.35 (m, 2H), 5.00 (m, 2H), 4.43 (m, 1H), 4.29 (m, 1H), 4.02-3.95 (m, 2H), 3.42 (m, 2H), 3.31-3.06 (m, 9H), 2.99 (m, 2H), 2.81 (m, 1H), 2.42 (m, 2H), 2.14-2.00 (m, 5H), 1.98-1.60 (m, 8H), 1.53 (m, 1H), 1.41-1.17 (m, 6H), 0.99 (d, 6H); EI—MS: 707.7 (M+1).
Preparation of Compound 81 Compound 81 was prepared in a manner similar to that used to prepare compound 39. 1H NMR (300 MHz, D20) 5 8.76 (s, 1H), 5.91 (s, 1H), 4.77 (m, 2H), 4.39 (t, 2H), 4.22 (m, 1H), 4.05 (m, 1H), 3.99 (s, 2H), 3.84 (m, 1H), 3.43 (t, 2H), 3.24-3.08 (m, 7H), 2.97 (t, 2H), 2.87 (m, 1H), 2.31 (m, 2H), 2.25 (s, 3H), 2.19-2.03 (m, 5H), 1.92- 1.61 (m, 5H), 1.53 (m, 1H), 1.41-1.17 (m, 6H); EI—MS: 614.6 (M+1).
Preparation of Compound 82 Compound 82 was prepared in a manner similar to that used to prepare compound 39.
EI—MS: 641.7 (M+1).
Preparation of Compound 83 Compound 83 was prepared in a manner similar to that used to e compound 39.
EI—MS: 585.6 (M+1).
Preparation of Compound 84 Compound 84 was ed in a manner similar to that used to prepare compound 47.
EI—MS:788.6 (M+1).
Preparation of Compound 85 Compound 85 was prepared in a manner similar to that used to prepare compound 39. 1H NMR (300 MHz, D20) 5 7.45 (s, 1H), 4.92 (m, 2H), 4.40 (m, 1H), 4.16 (m, 1H), 3.95 (s, 2H), 3.91 (m, 1H), 3.42 (t, 2H), 3.25-3.10 (m, 9H), 2.99 (t, 2H), 2.76 (m, 1H), 2.44 (m, 2H), 2.19-2.03 (m, 4H), 1.96 (s, 3H), 1.92-1.61 (m, 6H), 1.53 (m, 1H), 1.41- 1.17 (m, 6H); EI-MS: 615.6 (M+1).
Preparation of nd 86 Compound 86 was prepared in a manner similar to that used to e compound 29. 1H NMR (300 MHz, D20) 5 7.44 (s, 1H), 4.92 (m, 2H), 4.40 (m, 1H), 4.21 (m, 1H), 4.06 (m, 1H), 3.96 (m, 1H), 3.26-3.10 (m, 9H), 2.80-2.64 (m, 3H), 2.41 (m, 2H), 2.22 (m, 2H), 2.16-2.02 (m, 4H), 1.95 (s, 3H), 1.90-1.60 (m, 6H), 1.51 (m, 1H), 1.40-1.17 (m, 6H); EI-MS: 615.6 (M+1).
EXAMPLE 2: Inhibition of Radioligand Binding in Human CXCR4-Transfected HEK293 Cells Binding competition between the compounds of Formula (I) and human CXCL12 was assessed using a radioligand binding assay as described below.
Membranes (2-4 pg) prepared from human CXCR4-transfected HEK293 cells in 40 uL of assay buffer (50 mM NaOH, pH 7.4, 100 mM NaCl, 5 mM MgC12, 1 mM CaClz, 0.5% bovine serum albumin) were incubated with 20 uL of radio-labeled 125I—CXCL12 (0.16 nM) and 20 uL of a test compound in an assay plate r Corning, Cambridge, MA). After 60 minutes at 30 0C, the incubation was terminated by transferring the resulting reaction mixture to a 96-well GF/B filter plate pore Corp., Billerica, MA) and filtered Via a ld. The plate was washed with 100 uL of ice-cold wash buffer (50 mM HEPES-NaOH, pH 7.4, 100 mM NaCl) four times. The radioactivity bound to the filter was measured by Topcount (PerkinElmer Inc., Waltham, MA).
It was unexpectedly observed that the concentration required to inhibit binding of 125I-CXCL12 to CXCR4 by 50% (ICso) 0f 25 tested nds was lower than 50 nM, 33 tested compounds had IC50 values of 50-100 nM, and 28 tested compounds had IC50 values of 100-1000 nM. More specifically, the list of compounds showing IC50 values lower than 50 nM includes Compounds 1-7, 9, 12, 13, 15-19, 21, 23, 25, 28-30, 40, 42, 59, and 75; the list of compounds showing IC50 values of 50-100 nM includes Compounds 8, 10, 11, 14, 20, 22, 24, 26, 27, 31-35, 37-39, 43, 45-50, 58, 61, 62, 66, 72, 73, 76, 78, and 82; and the list of compounds showing IC50 values of 100- 1000 nM es nds 36, 41, 44, 51-57, 60, 63-65, 67-71, 74, 77, 79-81 and 83-86.
These results indicate that compounds of Formula (I) have high binding affinities toward CXCR4.
EXAMPLE 3: Inhibition of axis in Lymphoblastic Leukemia Cells The response of cancer cells to compounds of Formula (I) was ted using the chemotaxis assay as set forth below.
T-cell acute lymphoblastic leukemia (CCRF-CEM) cells in Roswell Park Memorial Institute medium (RPMI) 1640 supplemented with10% bovine serum n were incubated with 250 uL of a test compound. The assay was performed using Millicell Hanging Cell Culture Inserts (pore size 5 pm; 24-well plate; Millipore, Bedford, MA, USA). After 10 minutes at 37 0C, 250 uL of cells pre-incubated with a test compound were plated per well in the upper chambers of the inserts at a density of 2.5 ><105 well. 300 uL/well medium containing CXCL12 (10 nM) and a test compound were plated in the lower chamber of the insert. After 2.5 h at 37 0C, cells in both chambers of inserts were ed by flow cytometry (Guava Technologies, d, CA, USA).
It was observed that 39 tested compounds unexpectedly showed concentrations required to inhibit chemotaXis by 50% (EC50) with values of lower than 50 nM and 4 tested compounds showed EC50 values of 50-150 nM. More specifically, the list of compounds showing EC50 values lower than 50 nM includes Compounds 1-8, 10, 13-18, 20-24, 26, 29-32, 35, 37-42, 45, 47-49, 59, 61, and 62; and the list of compounds showing EC50 values of 50-150 nM includes Compounds 33, 34, 46, and 50.
These results indicate that compounds of Formula (I) have high efficacy in inhibiting the chemotaXis of certain cancer cells.
EXAMPLE 4: Effect on Mobilization of Stem Cells in Mice 38 compounds of Formula (I) were tested to assess their efficacy in enhancing stem/progenitor cell mobilization as follows. The list of these 38 compounds includes nds 1-3, 13, 15, 17, 24, 26, 29-31, 33, 35, 36, 38-43, 45, 46, 49, 50, 54, 59-68, 76, 78, and 83.
Each of the 38 nds was dissolved in saline to form a solution. The on was administered to C57BL/6 male mice (National Laboratory Animal Center, Taipei, Taiwan) subcutaneously. Mice d with saline were used as controls. Whole blood was collected 2 h after subcutaneous injection and labeled with the following antibodies: (i) APC-conj ugated anti-CXCR4 (clone 2B 1 l; ience), (ii) FITC-conjugated anti-CD34 (clone RAM34; eBioscience), (iii) PE-conjugated anti-CD133 (clone l3A4; eBioscience), (iv) anti-c-kit (clone 2B8; eBioscience), (v) anti-Sca-l (clone D7; eBioscience), (vi) anti-linage (Mouse Hematopoietic Lineage Biotin Panel, ience), and (vii) Streptavidin PE-Cy7 (eBioscience).
Hematopoietic stem cells (CD34+) and endothelial progenitor cells (CD133+) were quantified using antibody surface staining and flow cytometry (Guava Technologies, Hayward, CA, USA).
Unexpectedly, these 38 compounds significantly enhanced mobilization of CD34+ hematopoietic stem cells (up to 3.7 folds) and CD133+ endothelial progenitor cells (up to 4.5 folds) into peripheral blood as compared to saline controls. In addition, 4 tested compounds, i.e., Compounds 40, 45, 49, and 50, combined with G- CSF were found to unexpectedly mobilize hematopoietic stem cells synergistically as evidenced by the significant increase of CFU-GM numbers.
These results indicate that nds of Formula (I) have high efficacy in enhancing stem/progenitor cell mobilization.
E 5: Treatment of Ischemia-Reperfusion Injury of kidney In Rats The efficacy of five compounds of Formula (I) in ng Ischemia- Reperfusion injury was assessed using both an acute kidney injury model, an ischemic stroke model, and a limb ischemia model. These five compounds are Compounds 13, , 40, 45, and 46.
In an acute Kidney Injury (AKI) model, each of the five compounds was dissolved in saline to form a solution. The solution was administered to male Sprague-Dawley rats (National Laboratory Animal Center, Taipei, Taiwan) subcutaneously at a dosage of 6 mg/Kg. 40 s after the subcutaneous injection, AKI was induced in the rats by clamping their ral renal vein and artery for one hour followed by releasing the vessel clips to allow 24-h reperfusion. Whole blood was ted at 24-h after induction of AKI. Blood urea nitrogen (BUN) and serum creatinine (Scr), two markers that increase upon kidney , were measured using a FUJI DRI—CHEM 3500s analyzer (Fujifilm, Tokyo, Japan). Non-AKI rats and AKI rats treated with saline were used as controls.
It was observed that the AKI rats dosed with the tested compounds unexpectedly had levels of BUN and Scr, tively, 11-25% and 10-56% of those levels induced in saline-treated AKI rats. More specifically, AKI rats dosed with Compounds 13, 35, 40, 45, and 46 had respective BUN levels of 25%, 15%, 20%, 11%, and 22% of those levels induced in saline-treated AKI rats; and had respective Scr levels of 56%, 22%, 36%, 10%, and 22% of those levels induced in saline-treated AKI rats.
These results indicate that compounds of Formula (I) have high efficacy in treating kidney injury.
EXAMPLE 6: Treatment of hepatocellular carcinoma (HCC) in mice The efficacy of a compound of Formula (I), i.e., Compounds 42, in treating HCC was assessed using a eic mouse model as follows.
C3H mouse-derived HCC cell line HCA-l was used. HCA-l cells were orthotopically implanted in C3H mice for 10 days. The mice were uently treated with sorafenib (a small molecule drug for treating hepatocellular carcinoma; 40 mg/kg) daily for two weeks or treated with vehicle (PBS) alone as a control.
Tested compounds, e.g., AMD3100 (10 day) and Compound 42 (10 mg/kg/day), were each administered continuously to those mice treated with sorafenib using an Alzet osmotic pump (DURECT ation, Cupertino, CA) for two weeks.
It was observed that mice treated with nd 42 and sorafenib unexpectedly decreased the tumor size from about 400 mm3 (control) to about 50 mm3, as compared to AMD3100 combined with sorafenib, which decreased the tumor size from about 400 mm3 (control) to about 250 m3. Importantly, no significant body weight loss was observed in s treated with nd 42.
These results indicate that Compound 42 has unexpectedly higher cy in treating HCC, as compared with AMD3100.
EXAMPLE 7: Treatment of mild traumatic brain injury in mice Traumatic brain injury (TBI), also known as ranial injury, occurs when an external force injures the brain. It can be classified based on severity, mechanism, or other features (e.g., occurring at a specific location or over a widespread area).
TBI results in physical, cognitive, social, emotional, and behavioral symptoms.
The efficacy of a compound of Formula (I), i.e., Compound 42, in treating mild traumatic brain injury (mTBI) was assessed using a mouse mTBI model as follows.
Mild traumatic brain injury (mTBI) model Adult CD1 mice were housed in a 12-h dark (7 pm to 7 am) and 12 h light (7 am to 7 pm) cycle. They were anesthetized with isoflurane. mTBI was ted by dropping a 30 g metal tile onto the temporal skull, anterior the right ear.
Anesthetized mice were laid on their side. A metal tube (13 mm in inner diameter) was placed vertically over the head and a metal tile was dropped from 80 cm height down the tube to strike the temporal region of the skull anterior to the right ear.
The rod-shaped projectile was made of metal with a slightly rounded end in order to enable a smooth t with the skull without any external damage at the site of the weight drop. A sponge immobilization pad (L: 4—5 in; W: 2.7 in; H: 1.8 in) was employed, allowing head movements during the injury. At around 5-minute after the mTBI, mice were treated with Compound 42 or vehicle (saline). Control (no-mTBI) animals ed isoflurane but no mTBI.
Locomotor behavioral measurement At 15-minute and day 5 after the injury and recovery from the anesthesia, mice were individually placed in locomotor activity chambers (Accuscan, Columbus, OH) for up to 24 hours (12-h light and 12-h dark/day). Food and water were constantly provided in the chambers, which contained 16 horizontal and 8 al infrared sensors spaced 2.5 cm apart. Each mouse was placed in a 42x42><3l cm plexiglass open box. See, e.g., Airavaara et al., J Comp Neurol, 2009, 6-124. Motor activities were measured by the number and order of beams broken by the animals.
Four locomotor ters, i.e., horizontal activity, total distance ed, vertical activity, and vertical time, were recorded.
Quantitative Reverse Transcription —PCR (qRTPCR) Cerebral cortex from each mouse was collected on day 5 after mTBI for qRTPCR is. See, e. g., Luo et al., Ann , 2009, 65:520-530; Luo et al., Ann Neurol, 2013, 65:520-530; and Shen et al., J Neurosci Res, 2009, 87:545-555.
Total RNAs were isolated using TRIZOL Reagents (Life Technologies, -026) and cDNAs were synthesized from 1ug total RNA using a RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, #Kl622). TaqMan Gene Expression Assays (primer and probe set) for specifically detecting IBA1 (#Rn00574125_g1) were purchased from Thermo Scientific. Primer probes used in the quantitative RT-PCR for reference genes are as follows: beta actin forward primer (5’- CATTGCTGACAGGATGCAGAAGG); reverse primer (5’- TGCTGGAAGGTGGACAGTGAGG); GAPDH forward primer (5’- CATCACTGCCACCCAGAAGACTG); e primer (5’- ATGCCAGTGAGCTTCCCGTTCAG). Quantitative Real-Time PCR (qRT-PCR) was carried out using TaqMan Fast Advanced Master Mix (Life Technologies, #4444557) and Applied Biosystems 7500 Fast Real-Time PCR System. Expression and normalization of the target gene IBA1 was calculated relative to the endogenous reference gene (Beta-actin + GAPDH) with a modified delta-delta-Ct algorithm that takes specific gene ic amplification efficiency into account for accurate calculation. All experiments were duplicated.
Adult CD1 mice were anesthetized with isoflurane followed by mTBI as ed in Shen et al., Clinical mics, 2014, 11:11. Compound 42 or vehicle was given systemically after mTBI. Early post-treatment with Compound 42 significantly improved locomotor ty after mTBI. The expression of inflammatory marker ionized calcium-binding adapter molecule 1 (IBA1) in the lesioned cortex was examined by qRTPCR. It was observed that treatment with nd 42 significantly reduced IBA1 expression in the mTBI brains.
More specifically, 22 mice were divided into two groups: a group of mTBI mice treated with vehicle (n=14) and a group of mTBI mice treated with Compound 42 (3 mg/kg, n=8). Behavior was analyzed every 3 hour for 24 hours starting from 15-minute after injury. A significant reduction in all locomotor activity was observed in mTBI mice, as compared to the BI mice (p<0.001, two way analysis of variance or ANOVA). Treatment with nd 42 at a dosage of 3 mg/kg significantly improved vertical activity in mTBI mice (vertical activity, (p=0.009, F15140=6.969); and vertical movement time, (p=0.007, F15140=8.662). r, 15 mice were used to evaluate the effect of Compound 42 on neuroinflammation, in which 7 mice received the vehicle and 8 mice were treated with Compound 42 at a dosage of 3 mg/kg. Cerebral cortices were collected on day 5 after mTBI. The expression of neuroinflammatory marker IBAl and reference genes (GAPDH actin and beta-actin) was measured for qRTPCR is. It was observed that the expression of both IBAl (GAPDH actin) and IBAl (beta-actin) in the ed side cortex was significantly suppressed in mTBI mice treated with nd 42 (p=0.030, t-test).
These results, exhibition by Compound 42 of a neuroprotective effect in a mice model of mTBI, indicate that it is efficacious in ng mild traumatic brain injury.
E 8: Effect on myocardial tion in rat The efficacy of a compound of Formula (I), i.e., Compound 42, in protecting against dial infarction was assessed in a rat ischemic myocardial infarction model as follows.
Male SD rats (400-500 gram each) received a single subcutaneous injection of Compound 42 at a dosage of 5 mg/kg or an equal volume of saline (n = 18-20 per group) 30 minutes before surgery was conducted. Left anterior descending artery (LAD) was transiently ligated using a 6-0 nylon suture for a 30-minute ischemic period in this surgery. After 24 hours, each rat was anesthetized and the LAD was ligated again. 2 mL of 5 % Evan’s Blue was then injected into the tail vein and allowed to perfuse for 2 minutes. The heart was immediately excised, washed with saline, froze at -80 °C, and cut in semi-frozen state into 2-mm thick sections. Slices were then incubated in 1% tri-phenyltetrazolium chloride solution for 10 s at 37 °C and fixed in 10% formalin. t size was recorded after staining. It was observed that treatment with Compound 42 prior to surgery-induced ischemia/reperfusion protected heart against ischemic damage to a large degree.
The results indicate that Compound 42 is effective in protecting against myocardial infarction in rats.
OTHER EMBODIMENTS All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature g the same, equivalent, or similar purpose. Thus, unless expressly stated ise, each feature disclosed is only an example of a generic series of equivalent or similar features.
From the above description, one skilled in the art can easily ascertain the essential characteristics of the present invention, and without departing from the spirit and scope thereof, can make various s and modifications of the invention to adapt it to various usages and conditions. Thus, other embodiments are also within the scope of the following claims.
References: 1. Schols D, Struyf S, Van Damme J, Este JA, Henson G, De Clercq E. Inhibition of T-tropic HIV strains by selective antagonization of the chemokine receptor CXCR4. J. Exp. Med. 186:1383—1388 (1997). 2. Wu CH, Wang CJ, Chang CP, Cheng YC, Song JS, Jan JJ, Chou MC, Ke YY, Ma J, Wong YC, Hsieh TC, Tien YC, Gullen EA, Lo CF, Cheng CY, Liu YW, Sadani AA, Tsai CH, Hsieh HP, Tsou LK, Shia KS. Function-oriented development of CXCR4 antagonists as selective human immunodeficiency virus (HIV)-1 entry inhibitors. J. Med. Chem. 58:1452-1465 (2015). 3. Lenoir M, Djerdjouri B, Perianin A. Stroma cell-derived factor 1alpha mediates itization of human phil respiratory burst in synovial fluid from rheumatoid tic ts. J. Immunol. 172:7136-7143 (2004). 4. Gonzalo JA, Lloyd CM, Peled A, Delaney T, Coyle AJ, Gutierrez-Ramos JC.
Critical involvement of the chemotactic axis CXCR4/stromal cell-derived factor-1 alpha in the inflammatory ent of allergic airway disease. J. l. 165:499-508 (2000).
. Muller A, Homey B, Soto H, Ge N, Catron D, Buchanan ME, McClanahan T, Murphy E, Yuan W, Wagner SN, Barrera JL, Mohar A, Verastegui E, Zlotnik A. Involvement of chemokine receptors in breast cancer metastasis.
Nature. -56 (2001). 6. Liang Z, Yoon Y, Votaw J, Goodman MM, Williams L, Shim H. Silencing of CXCR4 blocks breast cancer metastasis. Cancer Res. 65:967-971 (2005).
Lin Q, Wesson RN, Maeda H, Wang Y, Cui Z, Liu JO, Cameron AM, Gao B, Montgomery RA, Williams GM, Sun Z. Pharmacological mobilization of endogenous stem cells significantly promotes skin regeneration after full- thickness excision: the synergistic activity of AMD3100 and tacrolimus. J. Invest.
Dermatol. 134:2458-2468 (2014).
Lukacs NW, Berlin A, Schols D, Skerlj RT, Bridger GJ. AMD3100, a CXCR4 antagonist, attenuates allergic lung inflammation and airway hyperreactivity. Am.
J. Pathol. 160:1353-1360 (2002).
Huang J, Li Y, Tang Y, Tang G, Yang GY, Wang Y. CXCR4 antagonist AMD3100 protects blood-brain barrier integrity and reduces inflammatory response after focal ischemia in mice. Stroke. 44:190-197 .
. Wu CH, Song JS, Chang KH, Jan JJ, Chen CT, Chou MC, Yeh KC, Wong YC, Tseng CT, Wu SH, Yeh CF, Huang CY, Wang MH, Sadani AA, Chang CP, Cheng CY, Tsou LK, Shia KS. Stem cell zers targeting ine receptor CXCR4: renoprotective application in acute kidney injury. J. Med.
Chem. 58:2315-2325 (2015). 11. Wu KJ, Yu SJ, Shia KS, Wu CH, Song JS, Kuan HH, Yeh KC, Chen CT, Bae E, Wang Y. A novel CXCR4 antagonist CX549 induces neuroprotection in stroke brain. Cell transplantation. in press (2017). 12. Chen Y, Huang Y, Reiberger T, Duyverman AM, Huang P, Samuel R, Hiddingh L, Roberge S, Koppel C, Lauwers GY, Zhu AX, Jain RK, Duda DG.
Differential effects of sorafenib on liver versus tumor fibrosis mediated by stromal-derived factor 1 alpha/C-X- C receptor type 4 axisand d differentiation antigen- positive myeloid cell infiltration in mice. logy. 59: 1435-1447 (2014). 13. Matthys P, Hatse S, re K, Wuyts A, Bridger G, Henson GW, De Clercq E, Billiau A, Schols D. AMD3100, a potent and specific antagonist of the stromal cell-derived -1 chemokine or CXCR4, inhibits mune joint inflammation in IFN-gamma receptor-deficient mice. J. Immunol. 167:4686-4692 (2001).

Claims (31)

1. A compound of formula (I): (I), wherein each of R1 and R2, independently, is H, halo, NO2, CN, NH2, C1-6 alkyl, C1-6 alkoxyl, C3-10 lkyl, C1-10 heterocycloalkyl, aryl, or heteroaryl; or R1 and R2, together with the two carbon atoms to which they are bonded, are C5-10 cycloalkyl, C3-10 heterocycloalkyl, aryl, or heteroaryl, each of the C1-6 alkyl, C1-6 alkoxyl, C3-10 cycloalkyl, C1-10 cycloalkyl, C5-10 cycloalkyl, C3-10 cycloalkyl, aryl, and heteroaryl being optionally substituted with halo, NO2, CN, NH2, C1-6 alkyl, C1-6 alkoxyl, aryl, heteroaryl, or C(O)ORa, in which Ra is H, C1-10 alkyl, C3-10 cycloalkyl, C3-10 heterocycloalkyl, aryl, or heteroaryl; and each of R3 and R4, independently, is , , or , in which at least one of R3 and R4 is or , R5 is H, C1-6 alkyl, C3-10 cycloalkyl, C1-10 heterocycloalkyl, aryl alkyl, heteroaryl alkyl, aryl, or heteroaryl, each of the C1-6 alkyl, C3-10 cycloalkyl, C1-10 heterocycloalkyl, aryl alkyl, heteroaryl alkyl, aryl, and heteroaryl being optionally substituted with halo, nitro, cyano, amino, C1-6 alkyl, C1-6 alkoxyl, C3-10 cycloalkyl, C1-10 heterocycloalkyl, aryl, or heteroaryl; R6 is deleted, H, C1-6 alkyl, C1-6 alkoxyl, C3-10 cycloalkyl, C1-10 cycloalkyl, aryl, or heteroaryl, each of the C1-6 alkyl, C1-6 alkoxyl, C3-10 cycloalkyl, C1-10 heterocycloalkyl, aryl, and heteroaryl being optionally substituted with hydroxy, hydroxy C1-6 alkyl, halo, nitro, cyano, or amino; R7 is H, C1-6 alkyl, C1-6 alkoxyl, C3-10 cycloalkyl, C1-10 heterocycloalkyl, aryl, or heteroaryl, each of the C1-6 alkyl, C1-6 alkoxyl, C3-10 cycloalkyl, C1-10 heterocycloalkyl, aryl, and heteroaryl being optionally tuted with y, hydroxy C1-6 alkyl, halo, nitro, cyano, amino, amino C1-6 alkyl, amino C3-10 cycloalkyl, amino C1-10 heterocycloalkyl, C3-10 cycloalkyl, C1-10 heterocycloalkyl, aryl, or heteroaryl; each of A and B in , independently, is C or N; and each of D, E and F in , independently, is C, N, O, or S; in which when B is C and R3 is , then at least one of D and E is C, O, or S; and when B is N and R3 is , then D is N; and in is , , , , , , , , , , , , , or ; each of L1 and L2, ndently, is heteroaryl, C1-10 heterocycloalkyl, or NRd, in which Rd is H or C(O)(CH2)2CHNH2CO2Re, Re being H, C1-6 alkyl, C3-10 cycloalkyl, C3-10 heterocycloalkyl, aryl, or heteroaryl; each of m, n, and o, independently, is 1, 2, 3, 4, 5, or 6; each of R8 and R9, independently, is H, C1-6 alkyl, C3-10 cycloalkyl, C1-10 heterocycloalkyl, aryl, or heteroaryl, each of the C1-6 alkyl, C3-10 cycloalkyl, C1-10 heterocycloalkyl, aryl, and aryl being optionally substituted with C(O)ORf, in which Rf is H, C1-10 alkyl, C3-20 cycloalkyl, C3-20 heterocycloalkyl, aryl, or heteroaryl; or R8 and R9, together with the nitrogen atoms to which they are bonded, are C3-10 cycloalkyl; L3 is C1-6 alkyl; or L3, together with R8 or R9 and the nitrogen atom to which they are bonded, is C4-10 heterocycloalkyl or heteroaryl; and R10 is H, C1-6 alkyl, C1-6 alkoxyl, C3-10 cycloalkyl, C1-10 cycloalkyl, aryl, heteroaryl, or , in which L4 is deleted or C1-6 alkylamino; L5 is C1-6 alkyl, C1-6 alkylamino, or di-C1-6 alkylamino; and R11 is hydroxyl or C1-6 alkylamino; each of the C1-6 alkyl, C1-6 alkoxyl, C3-10 cycloalkyl, C1-10 heterocycloalkyl, C1-6 mino; di-C1-6 alkylamino, aryl, and heteroaryl being optionally substituted with hydroxyl, amino, C(O)OR12, or P(O)(OR13)2, in which each of R12 and R13, independently, is H or C1-6 alkyl.
2. The compound of claim 1, wherein each of R1 and R2, independently, is H or C1-6 alkyl.
3. The compound of claim 1, n each of R1 and R2, independently, is H, NH2, or C1-10 heterocycloalkyl ally substituted with C1-6 alkyl or C(O)ORa, in which Ra is H or C1-10 alkyl.
4. The compound of claim 1, wherein R1 and R2, together with the two carbon atoms to which they are bonded, are aryl or heteroaryl.
5. The compound of claim 4, wherein R1 and R2, together with the two carbon atoms to which they are bonded, are , , , or .
6. The compound of claim 1, wherein each of R3 and R4, independently, is or , in which R5 is H; R6 is deleted; each of m, n, and o, independently, is 1, 2, 3, or 4; and each of L1 and L2 is NRd.
7. The compound of claim 6, wherein in is , , , , , or
8. The compound of claim 6, wherein each of R1 and R2, independently, is H or C1-6 alkyl.
9. The compound of claim 8, n R1 is H and R2 is C1-6 alkyl.
10. The compound of claim 6, wherein R1 and R2, together with the two carbon atoms to which they are bonded, are aryl or heteroaryl.
11. The compound of claim 10, wherein R1 and R2, together with the two carbon atoms to which they are bonded, are , , , or
12. The compound of claim 1, wherein R3 is and R4 is , in which R5 is H; R6 is deleted; each of m, n, and o, independently, is 1, 2, 3, or 4; and each of L1 and L2 is NRd.
13. The compound of claim 12, wherein each of R1 and R2, independently, is H or C1-6 alkyl.
14. The nd of claim 13, wherein R1 is H and R2 is C1-6 alkyl.
15. The compound of claim 12, n R1 and R2, together with the two carbon atoms to which they are bonded, are aryl or heteroaryl.
16. The compound of claim 15, wherein R1 and R2, together with the two carbon atoms to which they are bonded, are , , , or
17. The compound of claim 16, wherein R1 and R2, together with the two carbon atoms to which they are bonded, are .
18. The compound of claim 16, wherein in is , , , , , or
19. The compound of claim 12, wherein L3, together with R8 or R9 and the nitrogen atom to which they are bonded, is C4-10 heterocycloalkyl.
20. The nd of claim 19, wherein R8 is H and L3, together with R9 and the nitrogen atom to which they are bonded, is C4-10 heterocycloalkyl.
21. The compound of claim 20, wherein R1 is H and R2 is C1-6 alkyl.
22. The nd of claim 20, wherein R1 and R2, together with the two carbon atoms to which they are bonded, are .
23. The compound of claim 22, wherein in is , , , , , or
24. The compound of claim 20, wherein R10 is H or .
25. The compound of claim 24, n R1 is H and R2 is C1-6 alkyl or R1 and R2, together with the two carbon atoms to which they are bonded, are ; R10 is ; and in is , , , , , or .
26. The compound of claim 1, wherein the compound is one of the following compounds: NH NH HN HN N N N N N N N N N H N N N O H H H O H H 1 2 NH NH HN HN N N N N N N N N N N N N H S H H H O H H 3 4 NH NH HN HN N N N O N N N N N N N N H N H H O H N N H H 5 6 NH NH HN HN N N N N N N N N N H N N H H H N N N H H 7 8 NH NH HN HN N N N N N N N N N N H N H NH H H N N H H 9 10 HN N N N N N N N N N N N N N N N H N H H H N N H H 11 12 NH NH HN HN H H N N N N N N N N N N N N N H H N N H H N N 13 14 NH NH HN HN N N N N N N N N N N H N H H H O O H H 15 16 NH NH HN HN N N N N N N N N N N N N H H S H H O H H 17 18 NH NH HN HN N N N O N N N N N N N N H N O H H H N N H H 19 20 NH NH HN HN N N N N N N N H N N N N H H H N N N H H 21 22 NH NH HN HN N N N N N N N N N N N N N H N H N H H N N H H 23 24 NH NH HN HN N N S N N N N N N N N N N H H N H N N H N H H 25 26 NH NH HN HN H N N N N N N N H N N N H N H H N NH H H 27 28 O O CO 2H CO 2H N N NH 2 HN NH 2 N N N N N N N N N H N N N O H H H O H H 29 30 O O CO 2H CO 2H N N NH 2 NH 2 HN HN N N N N N N N N N H N N S H H H O H H 31 32 O O CO 2H CO 2H N N NH 2 NH 2 HN HN N N N O N N N N N N N N H N O H H H N N H H 33 34 O O CO 2H CO 2H N N NH 2 NH 2 HN HN N N N N N N N N N H N N H H H N N N H H 35 36 O O CO 2H CO 2H N N NH 2 NH 2 HN HN N N N N N N N N N N H N N N N H H H N N H H 37 38 O O N N CO 2H N N CO 2H H H HN HN N N N N N N N N N H N N N H O H H O H H 39 40 O O N N CO 2H N N CO 2H H H HN HN N N N N N N N N N N N N H S H H H O H H 41 42 O O N N CO 2H N N CO 2H H H HN HN N N N O N N N N N N N N H H N H H O H H N N 43 44 O O N N CO 2H N N CO 2H H H HN HN N N S N N N N N N N N N N H N N H H H N N H H 45 46 H NH 2 H H NH 2 H N N N N N PO 3H 2 N PO 3H 2 O O O O HN HN N N N N N N N N N N H N H O H H O H H 47 48 H NH 2 H H NH 2 H N N N PO 3H 2 N N N PO 3H 2 O O O O HN HN N N N N N N N N N N N N H S H H H O H H 49 50 H NH 2 H H NH 2 H N N N PO 3H 2 N N N PO 3H 2 O O O O HN HN N N N N N N N N N N N H H H N H N H H N N 51 52 CO2H NH N HN HN N N N N N N N N N N N H N N N H H N H O H H 53 54 N N N HN N H H N N N N N N N S N N H N N N NH H N N H H 55 56 N HN N N H 2N N N N N N N N N H N N N N H N H H N N H H 57 58 O H O N CO 2H CO 2Bn N N NH 2 HN HN N N N N N N N N N H N N N H H H N N N H H 59 60 O O H N CO 2H N N CO 2H N HN HN N N N N N N N N N N N N N N H N N H H H N N H H 61 62 O O H N CO2H N N CO2H N HN HN N N N N N N N N N N N N N N H H H H N N N N H H 63 64 O O CO 2H CO 2H N N NH 2 NH 2 HN HN N N N N N N N N N N N N N H H N N H H N N H H 65 66 O O CO2H N N N CO2H NH2 H H HN H H H N N N N N N N N N N N N N H N N H N N 67 68 O O CO 2H N N N CO 2H NH 2 H HN HN N N S S N N N N N N N N H N N H H H N N H H 69 70 NH NH HN HN N N N N N N N N N N N H H N N N H H HN H H 71 72 NH NH HN HN N N N N N N N N N H N N H N N H H HN H H 73 74 O O NH N OH NH 2 HN HN N N N N N N N N N N N H N N H H H HN N H H 75 76 O O O N OH N N NH 2 O HN HN N N N N N N N N N N N N N N H N H H H N N H H 77 78 O O O OH N OH N N NH 2 H HN HN N N N N N N N N N N N H N N HN H N N H H H H 79 80 O O OH O N N N N H O H O HN HN N N N N N N N N N N N H N H H H HN N H H 81 82 O H NH 2 H OH OH N N O N N N P H O O O OH HN HN N N N N N N N N N N N N H HN H H H S H H 83 84 O O O N N N OH H O NH 2 HN HN N N N N N N N N N N N N N N H N N H H H N N H H 85 86
27. The nd of claim 1, wherein the compound is one of the following compounds: NH NH HN HN N N N N N N N N N N N N N H S H H H N N H H 3 13 O O CO2H CO2H N N NH2 NH2 HN HN N N O N N N N N N N N N H N H H H N N N H H 34 38 O O N N CO 2H N N CO 2H H H HN HN N N N N N N N N N N N N O H H H S H H 40 41 O O N N CO 2H N N CO 2H H H HN HN N N N S N N N N N N N N H O H H H N N H H 42 45 O H NH 2 H N N N N CO 2H N PO 3H 2 H O O HN HN N N N N N N N N N N N N N H H H H N N S H H 46 49 H NH 2 H O N N N PO 3H 2 N N CO 2H O O H HN HN N N N N N N N N N N N N H O H H H N N H H 50 63
28. A pharmaceutical composition sing a compound according to any one of claims 1 to 27 and a ceutically acceptable carrier thereof.
29. Use of a compound according to any one of claims 1 to 27 or a pharmaceutical composition according to claim 28, in the manufacture of a medicament for mobilizing hematopoietic stem cells (HSC) and endothelial progenitor cells (EPC) into the peripheral circulation.
30. Use of a compound according to any one of claims 1 to 27 or a pharmaceutical composition according to claim 28, in the manufacture of a medicament for treating hepatocellular carcinoma, rheumatoid arthritis, kidney injury, myocardial infarction, or mild traumatic brain injury.
31. The use according to claim 30, in the cture of a ment for treating hepatocellular carcinoma.
NZ754272A 2017-01-10 2018-01-08 Heterocyclic compounds and use thereof NZ754272B2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201762444601P 2017-01-10 2017-01-10
US62/444,601 2017-01-10
PCT/US2018/012748 WO2018132326A1 (en) 2017-01-10 2018-01-08 Heterocyclic compounds and use thereof

Publications (2)

Publication Number Publication Date
NZ754272A NZ754272A (en) 2021-05-28
NZ754272B2 true NZ754272B2 (en) 2021-08-31

Family

ID=

Similar Documents

Publication Publication Date Title
JP5632910B2 (en) Hepatitis C virus inhibitor
JP5558556B2 (en) Hepatitis C virus inhibitor
JP5596861B2 (en) Hepatitis C virus inhibitor
ES2934227T3 (en) Isoindolinone inhibitors of mdm2-p53 interaction with anticancer activity
KR20180129783A (en) Carboxamide derivatives useful as RSK inhibitors
AU2015321654B2 (en) Heterocyclic compounds and use thereof
WO2006022454A1 (en) Compound containing basic group and use thereof
WO2007049771A1 (en) Compound containing basic group and use thereof
UA129029C2 (en) PYROL COMPOUNDS
AU2018208366B2 (en) Heterocyclic compounds and use thereof
NZ754272B2 (en) Heterocyclic compounds and use thereof
BR112019013493B1 (en) HETEROCYCLIC COMPOUNDS AND THEIR USES, PHARMACEUTICAL COMPOSITION AND METHOD OF MOBILIZATION OF HEMATOPOIETIC STEM CELLS AND ENDOTHELIAL PROGENITOR CELLS IN THE PERIPHERAL CIRCULATION
HK40010586A (en) Heterocyclic compounds and use thereof
HK40010586B (en) Heterocyclic compounds and use thereof