NZ753001B2 - Nutritional compositions providing dietary management of colic - Google Patents

Abstract

method for reducing the incidence of colic in a pediatric subject is presented, the method including administering to a subject a nutritional composition having about 1 x 10^3 to about 1 x 10^12cfu/100 kcal of LA metabolizing probiotic; up to about 7 g/100 kcal of a fat or lipid; up to about 5 g/100 kcal of a protein or protein equivalent source; about 0.06 g/100 kcal to about 1.5 g/100 kcal of enriched milk product; about 5mg/100 kcal to about 90 mg/100 kcal of a source of long chain polyunsaturated fatty acids; and about 0.015 g/100 kcal to about 1.5 g/100 kcal of a prebiotic composition. In particular, the present invention relates to an infant nutritional composition comprising Bifidobacterium breve (B. breve) for treating colic, wherein the number of B. breve is at least one logarithm higher than the number of Blautia bacteria in the gut of the infant following administration of the composition. 00 kcal of a protein or protein equivalent source; about 0.06 g/100 kcal to about 1.5 g/100 kcal of enriched milk product; about 5mg/100 kcal to about 90 mg/100 kcal of a source of long chain polyunsaturated fatty acids; and about 0.015 g/100 kcal to about 1.5 g/100 kcal of a prebiotic composition. In particular, the present invention relates to an infant nutritional composition comprising Bifidobacterium breve (B. breve) for treating colic, wherein the number of B. breve is at least one logarithm higher than the number of Blautia bacteria in the gut of the infant following administration of the composition.

Description

(12) Granted patent specificaon (19) NZ (11) 753001 (13) B2 (47) Publicaon date: 2021.12.24 (54) NUTRITIONAL COMPOSITIONS PROVIDING DIETARY MANAGEMENT OF COLIC (51) aonal Patent Classificaon(s): A61K 35/745 A23L 33/00 A23L 33/135 A23L 33/21 (22) Filing date: (73) Owner(s): 2017.10.19 MJN U.S. Holdings LLC (23) Complete specificaon filing date: (74) t: 2017.10.19 Pizzeys Patent and Trade Mark Attorneys P ty Ltd (30) Internaonal Priority Data: US ,538 2016.11.14 (72) Inventor(s): I, Lorenzo (86) Internaonal Applicaon No.: SAGHEDDU, Valeria VAN DAEL, Peter (87) aonal Publicaon number: WO/2018/086843 (57) ct: A method for reducing the incidence of colic in a pediatric subject is presented, the method including administering to a subject a onal composion having about 1 x 10^3 to about 1 x 10^12cfu/100 kcal of LA metabolizing probioc; up to about 7 g/100 kcal of a fat or lipid; up to about 5 g/100 kcal of a protein or protein equivalent source; about 0.06 g/100 kcal to about 1.5 g/100 kcal of enriched milk product; about 5mg/100 kcal to about 90 mg/100 kcal of a source of long chain polyunsaturated fay acids; and about 0.015 g/100 kcal to about 1.5 g/100 kcal of a prebioc composion. In parcular, the present invenon relates to an infant nutrional composion comprising Bifidobacterium breve (B. breve) for treang colic, wherein the number of B. breve is at least one logarithm higher than the number of Blaua bacteria in the gut of the infant following administraon of the composion.

NZ 753001 B2 2017/076797 IONAL COMPOSITIONS PROVIDING DIETARY MANAGEMENT OF COLIC TECHNICAL FIELD The presen’r disclosure reldles ’ro melhods of mdndging colic in Cl pedidiric subjeci ’rhrough modifying ’rhe gul microbiome of The subjecl vid ddminisirdiion of ihe nuiriiiondl composi’rion disclosed herein. Some embodimen’rs of The disclosure ore direcied ’ro enhdncing or promoiing on incredse in The concen’rrdiion of beneficial bdcierid in Cl pedidlric subjecl, such 0s The delobdcillus dnd Bifidobdcierium s, while ’ring ’rhe growih of bdcieridl species which con fdcilildle ’rhe onsel of colic, especidlly ’rhe BIClUIICl genus, including Ruminococcus gndvus. coccus gndvus is on bic Grdm posi’rive coccus, belonging To The Lochnospirdcede fdmily (idxonomy of This species is under revision and ii now believed mm This species belong To The BIClUIICl genus insledd of Ruminococccus) IhClI con be found in The gdsiroiniesiindl ’rrdc’rs of animals and humans; ii is Cl non—bu’ryrdle producer, but if is Cl hydrogen producer dnd Cl mucin degrdder. The incredse of BIClUIICl bdc’rerid, especidlly Ruminococcus gndvus, in colicky infdnls is ossocidled with Cl se of Bifidobdclerium breve.

In some embodimenls, ’rhe nulriliondl composi’rion ses Cl prebioiic blend which includes polydexlrose dnd goldclo—oligosdcchorides. The disclosed nulriliondl composilions con dlso include on enriched milk produc’r, such as on ed whey prolein concenird’re (eWPC), and long chdin polyunsd’rurd’red folly dcids, ndlly also in combindiion wi’rh one or more of locioferrin dnd shori chdin folly dcids.

OUND ART |nfanfile colic is painful fo infanfs and can cause significanf emofional disfress and discomforf for parenfs, and as such is considered a major issue during infancy. lvlefhods and composifions which can reduce or prevenf infanfile colic will provide relief for bofh s and parenfs. s wifh colic have been reporfed fo have a differenf guf microbiofa as compared fo healfhy infanfs, buf no causal relafionship has fo dafe been ished. However, if has now been suggesfed fhaf fhe specificify of fhe modified guf microbiome of colicky infanfs, which is unable fo mefabolize diefary linoleic acid (LA) fo conjugafed |ino|eic acid (CLA), is associafed wifh increased producfion of hydrogen and flammafory subsfances. Confrariwise, species of Bifidobacferium, such as Bifidobacferium breve, Bifidobacferium cafenulafum, Bifidobacferium pseudocafenulafum, or fhe like, can mefabolize LA fo CLA and, fhus, reduce hydrogen fion.

Member of fhe a genus, such as Ruminococcus gnavus, cannof mefabolize LA fo CLA; as such, an abundance of fhe Bifidobacferium species, fo fhe exclusion of fhe Blaufia species, can reduce fhe producfion of hydrogen and ofher pro— inflammafory subsfances and reduce colic.

Recenfly, if has been found fhaf increasing fhe rafio of bacferia capable of mefabolizing fhe lipid fracfion of a nufrifional ifion so as fo converf LA info CLA and ifs derivafives (“LA mefabolizing probiofic”) fo fhe Blaufia genus, including Ruminococcus gnavus, in fhe guf of a pediafric subjecf, especially an infanf, will lead fo ed mefabolysis or conversion of LA fo CLA and, fhus, reduce fhe incidence of colic. The rafio of LA mefabolizing fic fo Blaufia/Ruminococcus gnavus can be increased by increasing fhe presence of beneficial bacferia in fhe infanf guf, such as by providing a nufrifional composifion which includes Bifidobacferium breve, preferably in combinafion wifh prebiofics such as polydexfrose and o— oligosaccharides; and by decreasing fhe presence of Blaufia bacferia in fhe guf, fhrough fhe presence of ifive bacferia such as Bifidobacferia and/or Lacfobacilli fhrough compefifion for fhe same nufrienfs, by eifher supplementing with the CLA converting bacteria or by stimulating the growth of the CLA converting gut microbiota selectively with tics. Accordingly, it would be beneficial to provide a nutritional composition for pediatric subjects, as well as pregnant or lactating women, that contains such a combination.

BRIEF SUMMARY Briefly, the t sure relates to methods of managing colic in ric subjects through modifying the gut microbiome of the t via administration to the pediatric t or a pregnant or lactating woman of a ional composition which can increase the ratio of LA metabolizing probiotic to the Blautia genus, including Ruminococcus gnavus, in the gut of the subject. In certain embodiments, the number of LA metabolizing probiotic, such as Bifidobacterium breve, is at least one log higher than the number of Blautia bacteria. In other embodiments, the ratio of LA metabolizing probiotic, such as Bifidobacterium breve, to Blautia bacteria is at least 8:]; in other embodiments, the ratio of LA metabolizing probiotic, such as Bifidobacterium breve, to Blautia bacteria is at least 10:] . In still other embodiments, the ratio of LA metabolizing probiotic, such as Bifidobacterium breve, to Blautia bacteria is at least 12:].

In certain ments, the nutritional composition further comprises an enriched lipid fraction derived from milk, such as an enriched whey protein concentrate (eWPC). In some embodiments the nutritional composition may e an enriched lipid fraction derived from milk that includes milk fat es. The addition of the milk fat globules provides an enriched fat and lipid source to the infant that may be more fully digested by a pediatric subject. The nutritional composition can also e long chain polyunsaturated fatty acids, optionally in combination with one or more of lactoferrin and short chain fatty acids in some embodiments.

In certain embodiments, the enriched lipid fraction and/or the milk fat globules may include saturated fatty acids, trans—fatty acids, monounsaturated fatty acids, polyunsaturated fatty acids, cholesterol, branched chain fatty acids “BCFAs”, conjugated linoleic acid “CLA”, phospholipids, or milk fat globule membrane protein, and es thereof.

[0009] More particularly, in certain embodiments, the nutritional ition of the present disclosure comprises: about i X l03 to about i x to12 cfu/lOO kcal of LA metabolizing probiotic; up to about 7 g/lOO kcal of a fat or lipid: up to about 5 g/lOO kcal of a protein or protein equivalent : about 0.06 g/lOO kcal to about 1.5 g/l 00 kcal of enriched milk product: about 5 mg/lOO kcal to about 90 mg/lOO kcal of long chain polyunsaturated fatty acids (“LCPUFAs”); and about 0.015 g/l 00 kcal to about 1.5 g/lOO kcal of a prebiotic.

In some ments, the LA lizing probiotic comprises Bifidobacterium breve. In other embodiments, the LA lizing probiotic comprises Bifidobacterium catenulatum or Bifidobacterium pseudocatenulatum. Moreover, the LA metabolizing probiotic can include combinations of Bifidobacterium breve, bacterium catenulatum, and Bifidobacterium pseudocatenulatum; combinations of Bifidobacterium breve and Bifidobacterium catenulatum; combinations of Bifidobacterium breve with Bifidobacterium pseudocatenulatum; or the combination of Bifidobacterium catenulatum with Bifidobacterium pseudocatenulatum. [001 1] Further, in some embodiments, the enriched milk product ses an eWPC. Also, in some embodiments, the nutritional composition further comprises about 5 mg/lOO kcal to about 300 mg/lOO kcal of lactoferrin. The pediatric subject may be an infant, and the nutritional composition may be ed ds on infdnf formuld. ed milk producf means, in fhe confexf of fhe presenf disclosure, Cl milk producf enriched wifh milk fdf globule membrdne (MFGM) componenfs, such ds MFlel profeins dnd lipids. The enriched milk producf con be formed by, e.g., frdcfiondfion of non—humdn (e.g., bovine) milk. Enriched milk producfs hove Cl fofdl profein level which con rdnge befween 20% dnd 90%, more preferably befween 68% dnd 80%, of which befween 3% dnd 50% is MFGM profeins; in some embodimenfs, MFGM profeins make up from 7% fo 13% of fhe enriched milk producf profein confenf. Enriched milk producfs dlso comprise from 0.5% fo 5% (dnd, of fimes, 1.2% fo 2.8%) sidlic dcid, from 2% fo % (dnd, in some menfs, 4% fo 10%) phospholipids, from 0.4% fo 3% sphingomyelin, from 0.05% To 1.8%, 0nd, in cerfdin embodimenfs 0.10% To 0.3%, gongliosides 0nd from 0.02% fo dbouf 1.2%, more preferably from 0.2% fo 0.9%, cholesferol. Thus, enriched milk producfs include desirdble componenfs of levels higher fhdn found in bovine dnd ofher non—humdn milks.

Milk, such ds bovine milk, is Cl complex emulsion fhdf confdins severdl cldsses of componenfs which fulfill nufrifiondl requiremenfs dnd/or deliver specidl hedlfh benefifs fo fhe consumer. The fdf enf of milk exisfs in fhe form of globules which rdnge in size from 0.1 fo 10 microns. The fdf globules comprise dbouf 98% fridcylglycerols (TAGs, which ore fhe mdjor sfordge form of energy in s) dnd ore surrounded dnd ized by fhe milk fdf e membrdne, which is derived from endopldsmic reficulum ne dnd cell membrdne.

The milk fdf globule ne is comprised of Cl frildyer lipid sfrucfure fhdf includes Cl complex mixfure of phospholipids, profeins, glycoprofeins, friglycerides, poldr lipids, cholesferol, s dnd ofher componenfs which dre generdlly nof dbunddnf in convenfiondl infdnf formulds dnd growing—up milks.

The poldr lipids found in MFlel ore composed of: (i) Glycerophospholipids such as phosphatidylcholine (PC), phosphatidylethanolamine (PE), atidylserine (PS), and phosphatidylinositol (PI), and their derivatives and (ii) Sphingoids or sphingolipids such as sphingomyelin (SM) and glycosphingolipids comprising cerebrosides (neutral glycosphingolipids containing uncharged sugars) and the gangliosides (GG, acidic phingolipids containing sia|ic acid) and their derivatives.

[0016] Phosphatidylethanolamine is a olipid found in biological membranes, particularly in nervous tissue such as the white matter of brain, nerves, neural tissue, and in spinal cord, where it makes up 45% of all phospholipids. Sphingomyelin is a type of sphingolipid found in animal cell membranes, especially in the membranous mye|in sheath that surrounds some nerve cell axons. It usually consists of phosphochoIine and ceramide, or a phosphoethanolamine head group; therefore, sphingomyelins can also be classified as sphingophospholipids. In humans, Slvl represents ~85% of all sphingolipids, and lly makes up 10—20 mol % of plasma membrane lipids.

Sphingomyelins are t in the plasma membranes of animal cells and are especially prominent in mye|in, a nous sheath that surrounds and insulates the axons of some neurons.

LCPUFAs such as docosahexaenoic acid (“DHA”) are omega—3 fatty acids that are a primary structural component of the human brain, cerebral cortex, skin, sperm, testicles and . DHA can be synthesized from alpha— linolenic acid or ed directly from maternal milk or fish oil. DHA is the most nt omega—3 fatty acid in the brain and retina. DHA comprises 40% of the polyunsaturated fatty acids (PUFAs) in the brain and 60% of the PUFAs in the retina. Fifty percent of the weight of a neuron's plasma membrane is composed of DHA. DHA is richly supplied during breastfeeding, and DHA levels can be high in human milk. DHA concentrations in human milk range from 0.07% to greater than l.0% of total fatty acids, with a mean of about 0.32%. DHA levels in human milk are higher if a mother's diet is high in fish.

It is to be understood that both the foregoing general description and the following detailed description t embodiments of the disclosure and are ed to provide an overview or ork for understanding the nature and character of the disclosure as it is claimed. The description serves to explain the principles and operations of the claimed subject matter. Other and further features and advantages of the present disclosure will be readily apparent to those skilled in the art upon a reading of the ing disclosure.

BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 illustrates the metabolomics profiles of fecal samples taken from a single subject during colic (upper double bars) and non-colic states (upper double boxes) in accordance with Example 1.

Fig. 2 illustrates the separation of the triplicates of feces of colicky babies (red) and controls (blue) analyzed by GC-MS using the PLSDA analysis g in consideration all compounds and all infants) in accordance with Example 2.

Fig. 3 reports the Denaturing Gradient Gel Electrophoresis (DGGE) output obtained when a specific bacterial population was analyzed; every band in the gel represents a different population and colicky infants harbor a more complex microbiota compared to control infants in accordance with Example 3.

Fig. 4 illustrates the presence of the Blautia genus, including coccus gnavus, (blue arrow) in 4 out of 7 and Ruminococcus gnavus (red arrow) in 6 out of 7 y infants and respectively in 1 out of 7 and in 3 out of 7 control infants in ance with Example 3.

Fig. 5 illustrates the clustering analyses at the family level in accordance with Example 6. NA cluster es at the family level: colicky fecal samples analyzed do not show an increased presence of Enterobacteriaceae but there is a high inter-individual variation.

Fig. 6 illustrates the clustering analyses at the species level ted a role for Ruminococcus gnavus in causing infantile colic (see violet bars for the ce of Ruminococcus gnavus in a number of samples, especially in samples 24, 25 and 32, which all are from colicky infants (Colicky samples are marked by a red circle: 10, 24, 25, 3t, 32, 35, and 38) in accordance with Example 6.

Fig. 7 illustrates the differential abundances of species in the two groups; beside Ruminococcus gnavus also Haemophilus, Akkermansia and Bifidobacterium breve seem to differ deeply n the two groups in accordance with Example 6.

DETAILED DESCRIPTION Reference now will be mode in detdil to the embodiments of the present disclosure, one or more exomples of which ore set forth herein below.

Each e is provided by woy of explonotion of the nutritiondl composition of the present disclosure dnd is not Cl limitdtion. ln fdct, it will be dppdrent to those skilled in the drt thot vorious modificotions and variations con be mode to the teachings of the present disclosure without deporting from the scope of the disclosure. For instance, es illustrdted or described as port of one embodiment, con be used with dnother embodiment to yield 0 still further embodiment.

Thus, it is intended that the present disclosure covers such modificotions and variations as come within the scope of the oppended claims and their equivolents. Other objects, features and ospects of the present sure ore disclosed in or ore obvious from the following detailed description. It is to be understood by one of ordinary skill in the drt thot the present discussion is 0 description of exemplory embodiments only ond is not ed ds limiting the brooder ospects of the present disclosure.

The present disclosure reldtes generdlly to iondl compositions thot ore suitable for administration to Cl pedidtric subject, especiolly on infont.

Alternotively, the disclosed nutritiondl compositions con be administered to Cl pregndnt or ldctoting womon, so as to provide the described benefits to her infdnt. Additionolly, the disclosure relotes to methods of managing colic in pediatric subjects through ing the gut microbiome of the t vid odministrdtion of the iondl composition disclosed herein. Some embodiments of the disclosure ore directed to enhdncing or promoting on increase in the concentrotion of beneficiol bdcterio in o pedidtric t, such as the detobdcillus dnd Bifidobdcterium species, while inhibiting the growth of iol species which con tdte or couse the development of colic, especidlly members of the Bldutid genus, ing Ruminococcus gnovus.

“Nutritional composition” means a substance or formulation that ies at least a portion of a subject’s nutrient requirements. The terms “nutritional(s) , ional formula(s) , enteral nutritional(s)”, and “nutritional supplement(s)” are used as non— limiting examples of nutritional composition(s) throughout the present sure. lvloreover, “nutritional composition(s) may refer to s, powders, gels, pastes, solids, concentrates, suspensions, or ready—to—use forms of enteral formulas, oral formulas, formulas for infants, formulas for pediatric subjects, formulas for children, growing—up milks and/or formulas for adults. tile colic” or “colic” is defined as paroxysmal (sudden, brief and repetitive), excessive, inconsolable crying for more than three hours a day, at least three days a week, for one week or more in an ise healthy baby. It is most frequently observed in s between two weeks and four months of age. It is recognized as a functional gastrointestinal disorder of infancy by the Rome lll classification. Persistent infantile colic can contribute to parental fatigue and distress and may result in strained parental relationships, and poor parental engagement with their infant.

[0031] The term “enteral” means rable through or within the gastrointestinal, or digestive, tract. “Enteral administration” includes oral feeding, intragastric feeding, transpyloric administration, or any other administration into the digestive tract. “Administration” is r than “enteral administration” and includes parenteral stration or any other route of administration by which a substance is taken into a subject’s body.

“Pediatric subject” means a human no greater than 13 years of age. In some embodiments, a pediatric subject refers to a human subject that is between birth and 8 years old. In other embodiments, a pediatric subject refers to a human subject between i and 6 years of age. In still further embodiments, a pediatric t refers to a human subject between 6 and 12 years of age. The term tric subject” may refer to infants (preterm or full term) and/or children, as described below.

“Infant” means a human t ranging in age from birth to not more than one year and es infants from 0 to 12 months ted age. The phrase “corrected age” means an infant’s chronological age minus the amount of time that the infant was born premature. Therefore, the corrected age is the age of the infant if it had been carried to full term. The term infant includes low birth weight infants, very low birth weight infants, extremely low birth weight infants and preterm infants. “Preterm” means an infant born before the end of the 37Jrh week of gestation. “Late preterm” means an infant form between the 34Jrh week and the 3<$Jrh week of gestation. “Full term” means an infant born after the end of the 37Jrh week of gestation. “Low birth weight infant” means an infant born weighing less than 2500 grams (approximately 5 lbs, 8 ounces). “Very low birth weight infant” means an infant born weighing less than 1500 grams ximately 3 lbs, 4 ounces). mely low birth weight infant” means an infant born weighing less than 1000 grams (approximately 2 lbs, 3 ounces).

“Child” means a subject ranging in age from 12 months to 13 years. In some embodiments, a child is a subject n the ages of l and 12 years old. In other embodiments, the terms “children” or “child” refer to subjects that are between one and about six years old, or between about seven and about 12 years old. In other embodiments, the terms “children” or “child” refer to any range of ages between 12 months and about 13 years.

The term “degree of hydrolysis” refers to the extent to which peptide bonds are broken by a hydrolysis method. The degree of n hydrolysis for purposes of characterizing the hydrolyzed protein component of the nutritional composition is easily determined by one of ordinary skill in the formulation arts by quantifying the amino nitrogen to total nitrogen ratio (AN/TN) of the protein component of the selected formulation. The amino nitrogen component is fied by USP titration methods for determining amino nitrogen content, while the total en component is determined by the Tecator Kjeldahl method, all of which are well known methods to one of ordinary skill in the analytical chemistry art.

WO 86843 The ferm “parfially hydrolyzed” means having a degree of hydrolysis which is r fhan 0% buf less fhan abouf 50%.

The ferm “exfensively yzed” means having a degree of hydrolysis which is r fhan or equal fo abouf 50%.

The ferm “profein—free” means confaining no measurable amounf of profein, as measured by sfandard n defecfion mefhods such as sodium dodecyl (lauryl) sulfafe—polyacrylamide gel elecfrophoresis (SDS—PAGE) or size exclusion chromafography. In some menfs, fhe nufrifional composifion is subsfanfially free of profein, n “subsfanfially free” is defined herein below. “lnfanf formula” means a composifion fhaf safisfies af leasf a porfion of fhe nufrienf requiremenfs of an infanf. ln fhe Unifed Sfafes, fhe confenf of an infanf formula is dicfafed by fhe federal regulafions sef forfh af 2] C.F.R. ns 100, 106, and 107. These regulafions define macronufrienf, vifamin, mineral, and ofher ingredienf levels in an efforf fo simulafe fhe nufrifional and ofher properfies of human breasf milk.

“Follow—up formula” means a composifion fhaf safisfies af leasf a porfion of fhe nf requiremenfs of infanf from fhe 6fh monfh onwards and for young children 1—3 years of age. The Codex Sfandard for Follow—Up Formula (CODEX STAN 156—1987) defines fhe composifional requiremenfs of a follow—up a in in Secfion 3.

] “Milk—based” means comprising of leasf one componenf fhaf has been drawn or exfracfed from fhe mammary gland of a mammal. In some embodimenfs, a mill<— based nufrifional composifion comprises componenfs of milk fhaf are derived from domesficafed ungulafes, ruminanfs or ofher mammals or any combinafion fhereof.

Moreover, in some embodimenfs, milk—based means comprising bovine casein, whey, lacfose, or any combinafion fhereof. Furfher, “milk—based nutritiondl composition” mdy refer to dny composition comprising dny milk— derived or milk—bdsed product known in the ort.

“Milk” medns Cl component thdt hos been drown or ted from the mdmmdry gldnd of Cl mommdl. In some ments, the nutritiondl composition ses components of milk thdt ore derived from domesticoted unguldtes, rumindnts or other mommdls or dny combination

[0043] iondtion procedure” includes any process in which Cl certdin qudntity of Cl mixture is divided up into Cl number of r qudntities known as fractions. The frdctions mdy be different in composition from both the mixture and other frdctions. Exomples of frdctiondtion procedures include but ore not limited to, melt frdctiondtion, t frdctiondtion, supercriticol fluid frdctiondtion dnd/or combinations thereof. “th globule” refers to Cl smdll moss of fat surrounded by phospholipids and other membrdne dnd/or serum proteins, where the fdt itself con be Cl combination of any vegetable or onimdl fdt.

“Poldr lipids” ore the mdin constituents of l membrdnes, occurring in oil living orgdnisms. The poldr lipids in milk (i.e., milk poldr lipids) ore mdinly situated in the milk fdt globule membrdne. Poldr lipids ore also present in sources other than milk such as eggs, meet and plants.

Polar lipids ore generdlly d into phospholipids dnd sphingolipids (including gongliosides), which ore dmphiphilic molecules with Cl hydrophobic toil and Cl hydrophilic hedd group. The glycerophospholipids consist of Cl glycerol bdckbone on which two fatty acids ore esterified on positions sn—l dnd sn—2. These fatty acids ore more unsdturdted than the triglyceride fraction of milk. On the third hydroxyl, Cl phosphdte residue with different orgdnic groups (choline, serine, ethdnoldmine, etc.) may be linked. Generally, the fdtty dcid chdin on the sn—l position is more ted compdred with thdt of the sn—2 position. Lysophospholipids contdin only one dcyl group, WO 86843 predominantly situdted of the sn—l position. The hedd group remdins simildr.

The chqrqcteristic structurql unit of sphingolipids is the sphingoid bose, 0 long— chdin (l2—22 corbon dtoms) tic omine contdining two or three hydroxyl groups. Sphingosine (dl8:l), is the most prevqlent sphingoid bqse in mommdlidn sphingolipids, ning l8 corbon dtoms, two hydroxyl groups ond one double bond. A ceromide is formed when the omino group of this sphingoid bose is linked with, usuolly, o soturoted fotty ocid. On this ceromide unit, on orgonophosphote group con be bound to form 0 sphingophospholipid (e.g., phosphocholine in the cqse of sphingomyelin) or q ride to form the sphingoglycolipids (glycosylceromides). lvlonoglycosylceromides, like glucosylceromide or goloctosylceromide ore often denoted os cerebrosides while tri— ond tetroglycosylceromides with q terminql goloctosomine residue ore denoted os globosides. Finolly, gongliosides ore highly complex oligoglycosylceromides, contoining one or more siolic ocid groups in oddition to glucose, goloctose ond goloctosomine. tionqlly complete” meons o composition thot moy be used os the sole source of nutrition, which would supply essentiqlly oil of the required dqily omounts of vitqmins, minerols, ond/or troce elements in qtion with proteins, ydrotes, ond lipids. Indeed, tionolly complete” describes q nutritionql composition that provides odequote omounts of corbohydrotes, lipids, essentiol fotty ocids, proteins, essentiol omino qcids, conditionqlly iql omino qcids, vitqmins, minerols ond energy required to t normql growth and development of d subject.

Therefore, Cl nutritiondl composition thdt is “nutritiondlly complete” for Cl m infdnt will, by definition, provide qudlitdtively dnd tdtively odequote omounts of corbohydrotes, lipids, essentiql fqtty qcids, proteins, essentiol omino ocids, conditionolly essentiol omino ocids, vitqmins, ls, dnd energy required for growth of the preterm infdnt.

A nutritiondl composition thdt is “nutritiondlly complete” for Cl full term infqnt will, by definition, provide quqlitqtively qnd quontitotively odequote omounts of OH corbohydrotes, lipids, essentiol fotty ocids, proteins, essentiol amino acids, conditionally essential amino acids, vitamins, minerals, and energy required for growth of the full term .

A nutritional composition that is “nutritionally complete” for a child will, by definition, provide qualitatively and quantitatively adequate amounts of all carbohydrates, lipids, essential fatty acids, proteins, essential amino acids, conditionally essential amino acids, vitamins, minerals, and energy required for growth of a child.

[005]] As applied to nutrients, the term “essential” refers to any nutrient that cannot be synthesized by the body in amounts sufficient for normal growth and to maintain health and that, ore, must be supplied by the diet. The term “conditionally essential” as applied to nutrients means that the nutrient must be supplied by the diet under conditions when adequate amounts of the precursor compound is unavailable to the body for endogenous synthesis to occur.

“Probiotic” means a live microorganism which when consumed in adequate amounts as part of food confer a health benefit on the host. A probiotic should also be scientifically substantiated as being safe for use by The term “inactivated tic” means a probiotic wherein the metabolic activity or reproductive ability of the referenced probiotic has been reduced or destroyed. The “inactivated probiotic” does, however, still retain, at the cellular level, its cell structure or other structure associated with the cell, for example exopolysaccharide and at least a portion its biological glycol—protein and A structure. As used herein, the term ivated” is synonymous with “non—viable”. otic” means a non—digestible food ingredient that beneficially affects the host by selectively stimulating the growth and/or activity of one or a limited number of ia in the digestive tract that can improve the health of ihe hosl.

“Branched Chain Fally Acid” (“BCFA”) means a fairy acid coniaining a carbon consliluen’r branched off The carbon chain. Typically The branch is an alkyl , especially a meihyl group, but e’rhyl and propyl branches are also known. The on of lhe melhyl branch lowers lhe melling poinl compared wilh lhe equivalenl hl chain fally acid. This includes branched chain fally acids wilh an even number of carbon aloms in The carbon chain. Examples of These can be isomers of le’rradecanoic acid, hexadecanoic acid.

“Trans—fa’r’ry acid” means an unsaluraled far with a irans—isomer. Trans— fals may be monounsaluraled or polyunsaluraled. Trans refers To The arrangemen’r of The Two en a’roms bonded To The carbon a’roms ed in a double bond. In The irans arrangemenl, ’rhe hydrogens are on opposile sides of The bond. Thus a Trans—fairy acid is a lipid molecule iha’r ns one or more double bonds in Trans geomeiric uraiion.

“Phospholipids” means an organic molecule lha’r coniains a diglyceride, a phosphale group and a simple organic molecule. es of phospholipids include bui are noi limiied io, phosphalidic acid, phosphalidylelhanolamine, phosphalidylcholine, phosphalidylserine, phosphalidylinosilol, phosphalidylinosilol phosphale, phosphalidylinosilol biphosphale and phosphalidylinosilol lriphosphale, ceramide phosphorylcholine, ceramide phosphorylelhanolamine and ceramide phosphorylglycerol. This definilion furlher includes sphingolipids, glycolipids, and gangliosides.

“Phylonulrien’r” means a chemical compound iha’r occurs na’rurally in planis. uirien’rs may be included in any plan’r—derived nce or exiraci. The ’rerm “phy’ronuirien’r(s)” encompasses several broad calegories of compounds produced by planls, such as, for example, polyphenolic compounds, anlhocyanins, proanlhocyanidins, and flavan—3—ols (i.e. calechins, epicalechins), and may be derived from, for example, fruii, seed or fed exfrocfs. Furfher, fhe ferm phyfonufrienf includes all corofenoids, phyfosferols, fhiols, ond ofher derived compounds. Moreover, as o d drfisdn will fdnd, pldnf exfrdcfs mdy include phyfonufrienfs, such as polyphenols, in dddifion fo profein, fiber or ofher pldnf—derived componenfs. Thus, for exomple, opple or grope seed exfrocf(s) may include beneficidl phyfonufrienf componenfs, such ds polyphenols, in dddifion fo ofher plonf—derived subsfonces.

“LB—glucon” meons oll fi—glucon, including specific fypes of on, such as 0—],3—glucon or fi—l,3;l,6—glucon. lvloreover, [B—l,3;l,6—glucon is o fype of [73—] ,3—glucon. Therefore, fhe ferm “LB—1,3—glucon” includes 0—] ,3;T ,6—glucon.

“Pecfin” meons ony lly—occurring oligosocchoride or polysocchoride fhdf comprises golocfuronic ocid fhdf moy be found in fhe cell woll of Cl pldnf. Differenf ies dnd grddes of pecfin hdving voried physicol dnd chemicol properfies ore known in fhe drf. lndeed, fhe sfrucfure of pecfin con vory significonfly befween plonfs, befween fissues, and even wifhin 0 single cell woll. Generolly, pecfin is mode up of negofively chorged ocidic sugors (golocfuronic ocid), and some of fhe ocidic groups ore in fhe form of o mefhyl esfer group. The degree of esferificofion of pecfin is o meosure of fhe percenfoge of fhe corboxyl groups offoched fo fhe golocfopyronosyluronic ocid unifs fhdf ore esferified wifh mefhonol. [006T] Pecfin hoving 0 degree of esferificofion of less fhon 50% (i.e., less fhon 50% of fhe corboxyl groups ore mefhylofed fo form mefhyl esfer groups) ore clossified os low—esfer, low mefhoxyl, or low mefhylofed (“lel”) pecfins, while fhose hoving 0 degree of esferificofion of 50% or r (i.e., more fhon 50% of fhe corboxyl groups ore mefhylofed) ore clossified os high—esfer, high yl or high mefhylofed (“HM”) pecfins. Very low (“VL”) pecfins, o subsef of low mefhyldfed pecfins, hove Cl degree of ficofion fhdf is less fhdn opproximofely 15%.

As used herein, “locfoferrin from o non—humon source” meons locfoferrin which is produced by or obfoined from 0 source ofher fhon humon breosf milk. For e, locfoferrin for use in fhe presenf disclosure includes humon locfoferrin produced by Cl geneficolly modified orgdnism as well as non—humon locfoferrin. The ferm “orgonism”, as used herein, refers fo dny uous living sysfem, such as onimol, plonf, fungus or micro—orgdnism.

As used herein, “non—humon locfoferrin” medns locfoferrin fhdf hos on omino ocid ce fhdf is differenf fhon fhe omino ocid sequence of humdn locfoferrin.

[0064] “Pdfhogen” medns on orgdnism fhdf couses Cl diseose sfofe or pofhologicol me. Exomples of pofhogens may include bocferio, viruses, porosifes, fungi, microbes or combinofion(s) fhereof. “lvlodulofe” or “modulofing” medns exerfing Cl modifying, confrolling dnd/or reguldfing influence. In some embodimenfs, fhe ferm “modulofing” medns exhibifing on incredsing or sfimuldfory effecf on fhe dmounf of Cl uldr componenf. ln ofher embodimenfs, “moduldfing” medns exhibifing Cl sing or inhibifory effecf on fhe level/dmounf of Cl porficulor componenf.

All percenfoges, porfs ond rofios as used herein ore by weighf of fhe fofdl formulofion, unless ofherwise specified.

All omounfs specified as ddminisfered “per doy” may be delivered in one unif dose, in Cl single serving or in fwo or more doses or servings ddminisfered over fhe course of Cl 24 hour period.

The nufrifionol composifion of fhe presenf disclosure may be subsfonfiolly free of any opfiondl or selecfed ingredienfs described herein, provided fhdf fhe remdining nufrifiondl composifion sfill confdins dll of fhe required ingredienfs or es described herein. In fhis confexf, and unless ofherwise specified, fhe ferm “subsfdnfiolly free” medns fhdf fhe selecfed ifion moy confoin less fhdn Cl funcfiondl dmounf of fhe opfiondl ingredienf, fypicqlly less fhdn 0.l% by weighf, ond olso, including zero f by weighf of such opfiondl or selecfed ingredienf.

All references fo singulor chorocferisfics or fions of fhe presenf disclosure sholl include fhe corresponding plurol chorocferisfic or limifofion, and vice verso, unless ofherwise specified or cleorly implied fo fhe confrory by fhe confexf in which fhe reference is mode.

All combinofions of mefhod or s sfeps as used herein con be performed in ony order, unless ofherwise specified or cleorly implied fo fhe confrory by fhe confexf in which fhe referenced combinofion is mode.

] The mefhods ond composifions of fhe presenf disclosure, including componenfs fhereof, con comprise, consisf of, or consisf essenfiolly of fhe essenfiol fs ond limifofions of fhe embodimenfs described , as well ds dny dddifiondl or opfiondl ingredienfs, componenfs or limifdfions described herein or ise useful in nufrifionol composifions.

As used herein, fhe ferm ” should be consfrued fo refer fo bofh of fhe numbers specified as fhe endpoinf(s) of ony ronge. Any reference fo 0 ronge should be ered as providing supporf for any subsef wifhin fhof ronge.

The presenf disclosure is direcfed fo nufrifionol composifions which con incredse fhe rdfio of LA mefdbolizing probiofic fo Ruminococcus gndvus in fhe guf of fhe subjecf. In on embodimenf, fhe nufrifiondl composifions ore infdnf formulds which e Cl LA mefdbolizing probiofic dnd Cl prebiofic ifion including golocfo— oligosocchorides ((303) and xfrose (PDX). The nufrifionol composifions of fhe presenf disclosure supporf overoll heolfh ond developmenf in o pediofric humon subjecf, such as on infonf (preferm ond/or ferm), and con prevenf or reduce colic.

The unique combindfion of nufrienfs in fhe disclosed nufrifiondl composifion is believed fo be e of providing novel and unexpecfed benefifs for infdnfs in reducfion of colic, ds well ds providing relief for porenfs of colicky infdnts.

The combindtion of nutrients in the nutritiondl composition e in synergistic woys to provide the foregoing benefits. For instdnce, providing Cl LA metdbolizing probiotic with Cl prebiotic comprising polydextrose ond o— o|igosocchorides con isticolly increose specific beneficiol species of bacteria in the gastrointestinal tract, including Bifidobocterium species such as Bifidobocterium breve while also competitively reducing the presence of non— LA metdbolizing io such as Ruminococcus gnovus. This increose in the rotio of B. breve or other LA metdbolizing probiotic to Ruminococcus gnovus results in C1 e incredse in the production of CLA from LA in the infdnt gut, Ieoding to Cl morked decreose in colic. The presence of Bifidobocterium breve or other LA metdbolizing tic(s) dnd the Bloutio genus, including Ruminococcus gnovus, in the gut of on infont (ond, thus, the woy to meosure the rotio of one to the other) con be determined using fecol somples from the infdnt, by dndlysis of fecol microbiotd. Protocols used to extrdct DNA from fecol somples of s, DGGE analysis and Quontitotive PCR ore those described by Sogheddu et 01, 2016.DNA tion for sequencing and sequence analysis hove been performed occording to Poyne AN, Chossord C, Bdnz Y, Locroix C. The composition dnd metdbolic dctivity of child gut microbiotd demonstrdte differentidl dddptdtion to voried nt loods in on in vitro model of colonic fermentdtion. FEMS Ivlicrobiol Ecol (2012) 80:608—23. doi:10.1111/j.1574— 6941.2012.01330.x Other probiotics con also be included in the nutritionol composition of the present disclosure, in order to compete with the Bloutio species for nutrients, and thus reduce the presence of the Bloutio bacteria in the gut; these may be selected from Bifidobocterium species or Loctobdcillus species, and con include Loctobdcillus rhomnosus GG (LOG) (ATCC number 53103), Bifidobocterium species other than Bifidobocterium breve, such as bocterium Iongum BB536 (BL999, ATCC: BAA—999), bocterium longum AH1206 (NCIMB: 41382), Bifidobocterium infdntis 35624 (NCIMB: 41003), and Bifidobacterium animalis subsp. lactis BB—l2 (DSIvl No. 10140), or any combination thereof.

The daily amount of LA metabolizing probiotic to be administered to a pediatric t, or to a pregnant or lactating woman, may in some embodiments vary from about 1 x 104 to about 1 x 10H cfu. In certain embodiments, the ional composition of the t disclosure may include LA metabolizing probiotic at a level of about i X l04 to about i X l01 1 cfu per l00 g of powder (when the nutritional composition is provided in powder form for later reconstitution). Or, in embodiments, the nutritional composition of the present disclosure may include LA metabolizing probiotic at a level of about i x 103 to about i x 1012 cfu of probiotic(s) per 100 kcal. In other embodiments, the ional composition of the present disclosure may include LA lizing probiotic at a level of about i X l04 to about i X l01O cfu of probiotic(s) per 100 kcal; in yet other embodiments, LA metabolizing tic is present at a level of about i X lO<S to about i X 109 cfu per 100 kcal.

Moreover, since the tic comprises viable cells, it may be desirable to provide a protective matrix for the probiotic to ensure continued viability during processing, storage and transport, by blending together at least one phospholipid and at least one glyceride; combining the probiotic, the protective matrix and water to produce a mixture; and drying the mixture of step to a final re content of about 4% or less. This method may comprise the additional step of adding the dried mixture to a powdered nutritional product or enclosing the dried mixture in a e.

As noted, the nutritional composition also contains one or more prebiotics (also referred to as a prebiotic component) in certain embodiments.

Prebiotics exert health ts, which may include, but are not limited to, selective ation of the growth and/or activity of one or a limited number of beneficial gut bacteria such as the LA metabolizing probiotic, stimulation of the growth and/or activity of ingested probiotic microorganisms, selective reduction in gut pathogens, and favorable influence on gut short chain fatty acid profile. Such tics may be naturally—occurring, synthetic, or developed through the genetic manipulation of organisms and/or plants, whether such new source is now known or developed later. Prebiotics useful in the present disclosure may include oligosaccharides, polysaccharides, and other prebiotics that contain fructose, xylose, soya, galactose, glucose and mannose.

More specifically, prebiotics useful in the present disclosure may include polydextrose, polydextrose powder, ose, lactosucrose, raffinose, gluco— accharide, inulin, fructo—oligosaccharide, isomalto—oligosaccharide, soybean oligosaccharides, lactosucrose, xylo—oligosaccharide, chito— oligosaccharide, manno—oligosaccharide, aribino—oligosaccharide, siallyl— oligosaccharide, ligosaccharide, galacto—oligosaccharides and gentio— oligosaccharides.

In an embodiment, the total amount of prebiotics present in the nutritional composition may be from about 1.0 g/L to about 10.0 g/L of the composition. More preferably, the total amount of prebiotics present in the nutritional ition may be from about 2.0 g/L and about 8.0 g/L of the composition. In some embodiments, the total amount of prebiotics present in the nutritional ition may be from about 0.01 g/100 kcal to about 1.5 g/100 kcal. In certain embodiments, the total amount of prebiotics t in the nutritional composition may be from about 0.15 g/100 kcal to about 1.5 g/100 kcal. Moreover, the nutritional composition may comprise a tic ent comprising polydextrose. In some ments, the prebiotic component comprises at least 20% w/w polydextrose or a mixture thereof.

The amount of polydextrose in the nutritional composition may, in an embodiment, be within the range of from about 0.015 g/100 kcal to about 1.5 g/100 kcal. In another embodiment, the amount of polydextrose is within the range of from about 0.2 g/100 kcal to about 0.6 g/100 kcal. In some embodiments, polydextrose may be included in the nutritional composition in an amount ient to provide between about 1.0 g/L and 10.0 g/L. ln dnother embodiment, the nutritiondl ition contdins on dmount of polydextrose that is between about 2.0 g/L and 8.0 g/L. And in still other embodiments, the dmount of xtrose in the nutritiondl composition mdy be from about 0.05 g/IOO kcol to about 1.5 g/I 00 kcol.

The prebiotic ent also ses goIocto—oligosocchorides. The omount of golocto—oligosocchdrides in the nutritionol composition may, in on embodiment, be from about 0.015 g/IOO kcol to about 1.0 g/IOO kcol. In another embodiment, the omount of golocto—oligosdcchdrides in the nutritionol composition may be from about 0.2 g/IOO kcol to about 0.5 g/IOO kcol.

In CI porticuldr embodiment of the present invention, polydextrose is administered in combinotion with golocto—oligosocchorides.

In CI ulor ment, golocto—oligosdcchdrides ond polydextrose ore supplemented into the nutritionol composition in CI totdI omount of of Ieost about 0.015 g/IOO kcol or about 0.015 g/IOO kcol to about 1.5 g/IOO kcol. In some embodiments, the nutritionol composition may comprise golocto—oligosocchdrides ond polydextrose in CI totdl omount of from about 0.] to about 1.0 g/IOO kcol.

In certain embodiments, Ioctoferrin from CI non—humon source is also included in the nutritionol composition of the present disclosure. detoferrins ore single choin ptides of about 80 I<D contdining I — 4 glycons, ing on the species. The 3—D structures of Ioctoferrin of different species ore very similor, but not identicol. Eoch Ioctoferrin comprises two homologous Iobes, called the N— and C—Iobes, referring to the N—termindl ond C—termindl port of the molecule, respectively. Eoch Iobe further consists of two sub—lobes or domdins, which form CI cleft where the ferric ion (Fe3+) is tightly bound in istic cooperotion with Cl (bi)corbonote onion. These domoins ore coIIed NI, N2, CI dnd C2, respectively. The N—terminus of ldctoferrin hos strong cotionic peptide regions that ore responsible for CI number of importont binding chordcteristics. detoferrin hos CI very high isoelectric point (~pI 9) 0nd WO 86843 its cationic nature plays a major role in its ability to defend against bacterial, viral, and fungal pathogens. There are l clusters of ic amino acids residues within the N—terminal region of lactoferrin mediating the biological activities of lactoferrin t a wide range of microorganisms. For instance, the N—terminal residues l—47 of human lactoferrin (l—48 of bovine lactoferrin) are critical to the iron—independent biological activities of lactoferrin. In human errin, residues 2 to 5 (RRRR) and 28 to 3i (RKVR) are arginine—rich cationic domains in the N—terminus especially critical to the antimicrobial activities of lactoferrin. A similar region in the N—terminus is found in bovine lactoferrin ues 17 to 42; FKCRRWQWRMKKLGAPSITCVRRAFA).

Lactoferrins from different host s may vary in their amino acid sequences though commonly possess a relatively high isoelectric point with positively charged amino acids at the end terminal region of the al lobe.

Suitable non—human lactoferrins for use in the present disclosure include, but are not limited to, those having at least 48% homology with the amino acid sequence of human lactoferrin. For instance, bovine lactoferrin (“bLF”) has an amino acid composition which has about 70% sequence homology to that of human lactoferrin. In some embodiments, the non— human lactoferrin has at least 55% gy with human lactoferrin and in some embodiments, at least 65% homology. man lactoferrins acceptable for use in the present disclosure include, without limitation, bLF, porcine lactoferrin, equine lactoferrin, buffalo lactoferrin, goat lactoferrin, murine lactoferrin and camel lactoferrin.

In one embodiment, lactoferrin from a non—human source is present in the nutritional composition in an amount of at least about l5 mg/lOO kcal. In certain embodiments, the ional composition may include between about and about 300 mg lactoferrin per 100 kcal. In another embodiment, where the ional composition is an infant formula, the nutritional composition may comprise lactoferrin in an amount of from about 60 mg to about 150 mg lactoferrin per lOO l<cal; in yet another embodiment, the nutritional composition may comprise about 60 mg to about 100 mg lactoferrin per 100 kcal.

In some embodiments, the nutritional composition con include ldctoferrin in the qudntities of from dbout 0.5 mg to dbout 1.5 mg per milliliter of formuld. ln nutritiondl compositions repldcing humdn milk, ldctoferrin mdy be present in quontities of from dbout 0.6 mg to dbout 1.3 mg per milliliter of formuld. ln certdin embodiments, the nutritiondl composition mdy comprise n dbout 0.1 0nd dbout 2 grams ldctoferrin per liter. In some embodiments, the nutritional composition includes between dbout 0.6 0nd dbout 1.5 grams ldctoferrin per liter of formula.

The bLF thdt is used in certdin embodiments may be dny bLF isolated from whole milk dnd/or hdving Cl low c cell count, wherein “low somatic cell count” refers to Cl somatic cell count less than 0 cells/mL. By woy of exomple, suitdble bLF is ovoildble from Tdtuo Co—operdtive Ddiry Co. Ltd., in lvlorrinsville, New Zedldnd, from FriesldndCdmpind Domo in Amersfoort, ldnds or from Fonterrd Co—Operdtive Group Limited in Auckldnd, New Zedldnd. rrin from C1 non—humdn source for use in the t disclosure mdy be, for exomple, isoldted from the milk of Cl non—humdn dnimdl or produced by C1 geneticolly modified orgdnism. For exomple, in U.S. Potent No. 4,791,193, incorpordted by reference herein in its entirety, Okonogi et 01. discloses Cl process for producing bovine ldctoferrin in high purity. lly, the process as sed includes three steps. Row milk al is first contdcted with Cl wedkly dcidic cotionic exchdnger to obsorb ldctoferrin followed by the second step where woshing tokes pldce to remove orbed nces. A desorbing step follows where ldctoferrin is removed to produce purified bovine ldctoferrin. Other methods may include steps as described in U.S. Potent Nos. 141, 5,849,885, 5,919,913 and 5,861,491, the disclosures of which ore dll incorporated by reference in their entirety.

In certdin embodiments, ldctoferrin utilized in the present disclosure mdy be provided by on expdnded bed obsorption (“EBA”) process for isolating ns from milk sources. EBA, dlso sometimes colled ized fluid bed ddsorption, is Cl process for isoldting 0 milk protein, such as errin, from 0 milk source comprises estdblishing on expdnded bed ddsorption column comprising Cl pdrticuldte mdtrix, dpplying Cl milk source to the mdtrix, dnd eluting the ldctoferrin from the mdtrix with on elution buffer sing dbout 0.3 to dbout 2.0 M sodium chloride. Any mommdlidn milk source mdy be used in the present processes, dlthough in pdrticuldr embodiments, the milk source is 0 bovine milk source. The milk source comprises, in some embodiments, whole milk, reduced fdt milk, skim milk, whey, cosein, or mixtures thereof.

In pdrticuldr embodiments, the tdrget protein is ldctoferrin, though other milk proteins, such as ldctoperoxiddses or ldctdlbumins, dlso mdy be isoldted.

In some embodiments, the process comprises the steps of establishing on expdnded bed ddsorption column comprising 0 pdrticuldte mdtrix, applying 0 milk source to the mdtrix, dnd eluting the ldctoferrin from the mdtrix with dbout 0.3 to dbout 2.0M sodium de. In other embodiments, the ldctoferrin is eluted with dbout 0.5 to dbout 1.0 M sodium chloride, while in further embodiments, the ldctoferrin is eluted with dbout 0.7 to dbout 0.9 M sodium chloride.

The expdnded bed ddsorption column con be dny known in the drt, such as those bed in U.S. Potent Nos. 7,812,138, 6,620,326, dnd 6,977,046, the sures of which dre hereby incorporated by reference herein. In some embodiments, Cl milk source is dpplied to the column in on expdnded mode, and the elution is med in either expdnded or pocked mode. In pdrticuldr embodiments, the elution is performed in on expdnded mode. For exomple, the exponsion rotio in the expdnded mode mdy be dbout l to dbout 3, or dbout 1.3 to dbout l.7. EBA technology is further described in otiondl published dppliCdtion nos. WO 92/00799, WO 37, WO 32, which dre hereby incorpordted by reference in their entireties.

The isoelectric point of ldctoferrin is dpproximotely 8.9. Prior EBA methods of isoldting ldctoferrin use 200 mlvl sodium hydroxide ds on elution buffer. Thus, the pH of the system rises to over 12, 0nd the structure dnd bioacfivify of lacfoferrin may be sed, by irreversible sfrucfural changes.

If has now been discovered fhaf a sodium de solufion can be used as an elufion buffer in fhe isolafion of lacfoferrin from fhe EBA mafrix. ln n embodimenfs, fhe sodium chloride has a concenfrafion of abouf 0.3 lvl fo abouf 2.0 M. In ofher embodimenfs, fhe lacfoferrin elufion buffer has a sodium de concenfrafion of abouf 0.3 lvl fo abouf 1.5 M, or abouf 0.5 m fo abouf 1.0 M.

The nufrifional composifion of fhe disclosure can, in some embodimenfs, also confain a source of LCPUFAs; especially a source of LCPUFAs fhaf comprises docosahexaenoic acid. ther suifable LCPUFAs include, buf are nof limifed fo, a— linoleic acid, v—linoleic acid, linoleic acid, linolenic acid, eicosapenfaenoic acid (EPA) and arachidonic acid (ARA).

[0097] In an embodimenf, especially if fhe nufrifional composifion is an infanf formula, fhe nufrifional composifion is supplemenfed wifh bofh DHA and ARA. ln fhis embodimenf, fhe weighf rafio of ARA:DHA may be befween abouf 1:3 and abouf 9:1. In a ular embodimenf, fhe rafio of ARA:DHA is from abouf 1:2 fo abouf 4:1.

The amounf of long chain polyunsafurafed faffy acid in fhe ional composifion is advanfageously af leasf abouf 5 mg/100 kcal, and may vary from abouf 5 mg/100 kcal fo abouf 100 mg/100 kcal, more preferably from abouf 10 mg/100 kcal fo abouf 50 mg/100 l<cal.

The nufrifional composifion may be supplemenfed wifh oils confaining DHA and/or ARA using sfandard fechniques known in fhe arf. For example, DHA and ARA may be added fo fhe composifion by ing an equivalenf amounf of an oil, such as high oleic wer oil, normally presenf in fhe composifion. As anofher example, fhe oils confaining DHA and ARA may be added fo fhe composifion by replacing an equivalenf amounf of fhe resf of fhe overall faf blend normally presenf in fhe composifion wifhouf DHA and ARA.

If uTilized, The source of DHA dnd/or ARA may be any source known in The on such ds mdrine oil, fish oil, single cell oil, egg yolk lipid, dnd brdin lipid.

In some embodimenTs, The DHA dnd ARA dre sourced from single cell lvldrTek oils, DHASCO® dnd ARASCO®, or voridTions Thereof. The DHA dnd ARA con be in ndTurdl form, provided Tth The remainder of The LCPUFA source does noT resulT in any nTidl deleTerious effecT on The infdnT. AlTerndTively, The DHA dnd ARA con be used in refined form.

In on embodimenT, sources of DHA and ARA ore single cell oils ds ToughT in U.S. PdT. Nos. 5,374,567; 5,550,156; and 5,397,591, The disclosures of which dre incorpordTed herein in Their enTireTy by reference. However, The presenT disclosure is noT d To only such oils.

In some embodimenTs The nuTriTiondl composiTion mdy e on enriched lipid frdcTion derived from milk. ln ceerin menTs, The enriched lipid frdcTion comprises on enriched whey proTein concenTrdTe (eWPC). The enriched lipid frdcTion derived from milk may be produced by dny number of frdcTiondTion Techniques. These Techniques include buT ore noT limiTed To melTing poinT frdcTiondTion, orgdnic solvenT frdcTiondTion, super criTicdl fluid frdcTiondTion, dnd dny voridnTs dnd dTions Thereof. In some embodimenTs The nuTriTiondl composiTion mdy include on ed lipid frdcTion derived from milk Tth coanins milk de globules. AlTerndTively, eWPC is ovoildble cidlly, including under The Trdde ndme deproddn MFlel— . AnoTher sudeble enriched milk producT is ble commercidlly under The Trade ndme deproddn PL—20. deproddn MFGIvl—10 dnd deproddn PL—20 ore ovoildble from Arld Food lngredienTs of Viby, Denmdrk. WiTh The dddiTion of on enriched milk producT, The lipid composiTion of infdnT ds dnd oTher pedidTric iondl composiTions con more closely resemble Tth of human milk. For insTdnce, The TheoreTicol volues of phospholipids (mg/L) dnd gdngliosides (mg/L) in on exempldry infdnT formuld which includes deproddn MFlel—l 0 or deproddn PL—20 con be colculdTed as shown in Table 1: Tdble i Item Totdl Other milk PL Slvl PE PC PS PL GD3 PL: phospholipids; Slvl: sphingomyelin; PE: phosphdtidyl ethdnoldmine; PC: dtidyl choline; Pl: phosphdtidyl inositol; PS: dtidyl serine; GD3: gonglioside GD3.

In some embodiments, the enriched lipid fraction is included in the nutritional composition of the present disclosure dt Cl level of dbout 0.5 grams per liter (g/L) to dbout 10 g/L; in other embodiments, the enriched milk product is present at Cl level of dbout 1 g/L to dbout 9 g/L. In still other embodiments, enriched lipid frdction is present in the nutritiondl composition at Cl level of dbout 3 g/L to dbout 8 g/L. Alterndtively, in certdin embodiments, the enriched lipid frdction is included in the nutritiondl composition of the present disclosure dt Cl level of dbout 0.06 grams per 100 kcol (g/lOO kcol) to dbout l.5 g/l00 kcol; in other embodiments, the enriched lipid on is present at Cl level of dbout 0.3 g/lOO kcdl to dbout 1.4 g/lOO kcol. In still other embodiments, the enriched lipid frdction product is present in the nutritiondl composition at Cl level of dbout 0.4 g/l 00 kcol to dbout l g/ 100 kcol.

In certdin embodiments, the dddition of the ed lipid frdction or the enriched lipid fraction including milk fdt globules may provide Cl source of saturated fotty dcids, trons—fotty dcids, monounsdturdted fotty dcids, polyunsdturdted fotty dcids, BCFAs, CLA, cholesterol, phospholipids, dnd/or milk fdt globule ne ns to the nutritiondl ition.

The milk fdt globules mdy hove on average diameter (volume—surfdce dred overdge didmeter) of at least dbout 2 um. In some embodiments, the average diameter is in the rdnge of from dbout 2 pm to dbout 13 pm. In other embodiments, the milk fdt globules mdy rdnge from dbout 2.5 um to dbout 10 um. Still in other embodiments, the milk fot globules moy ronge in overoge diometer from obout 3 um to obout 6 um. The specific surfoce oreo of the globules is, in certoin ments, less than 3.5 m2/g, and in other embodiments is between obout 0.9 m2/g to obout 3 m2/g. t being bound by any porticulor theory, it is believed thot milk fot globules of the oforementioned sizes ore more occessible to liposes therefore leoding to better ion lipid digestion.

In some embodiments the enriched lipid froction ond/or milk fot globules contoin soturoted fotty ocids. The soturoted fotty ocids may be present in o concentrotion from obout 0.l g/lOO kcol to obout 8.0 g/lOO kcol. ln n embodiments the soturoted fotty ocids may be present from obout 0.5 g/l 00 kcol to obout 2.0 g/l 00 kcol. In still other embodiments the soturoted fotty ocids may be present from obout 3.5 g/l 00 kcol to obout 6.9 g/lOO kcol.

Exomples of soturoted fotty ocids le for inclusion include, but ore not d to, butyric, voleric, c, coprylic, deconoic, louric, myristic, polmitic, steroic, orochidic, behenic, olignoceric, tetrodeconoic, hexodeconoic, polmitic, ond octodeconoic ocid, ond/or otions and mixtures thereof.

Additionolly, the enriched lipid froction ond/or milk fot globules may comprise, in some embodiments, louric ocid. Louric ocid, also known as dodeconoic ocid, is o soturoted fotty ocid with o l2—corbon otom choin ond is believed to be one of the moin ontivirol ond ontibocteriol substonces currently found in humon breost milk. The milk fot globules may be enriched with triglycerides contdining louric dcid of either the Sn—l, Sn—2 ond/or Sn—3 positions. Without being bound by ony porticulor theory, it is believed thot when the ed lipid frdction is ingested, the mouth linguol lipase and poncredtic lipdse will hydrolyze the triglycerides to Cl mixture of glycerides including ouric and free louric ocid.

The concentrotion of louric ocid in the globules vories from 80mg/100ml to 800mg/100ml. The concentrotion of monolouryl n the globules con be in the range of 20mg/100ml fo 100ml feed. In some embodimenfs, fhe range is 60mg/100ml fo l30mg/100ml.

The enriched lipid frdcfion dnd/or milk fdf globules mdy confdin frdns— fdffy odds in cerfdin embodimenfs. The frdns—fdffy dcids included in fhe milk fdf globules may be monounsdfurdfed or polyunsdfurdfed fdffy dcids. In some embodimenfs fhe frdns—fdffy acids may be presenf in on dmounf from dbouf 0.2 g/100 kcol fo dbouf 7.0 g/100 kcol. ln ofher embodimenfs fhe frdns— fdffy acids may be f in on dmounf from dbouf 3.4 g/100 kcol fo dbouf 5.2 g/lOO kcol. ln yef ofher embodimenfs fhe frdns— fdffy acids may be presenf from dbouf l.2 g/100 kcol fo dbouf 4.3 g/100 kcol. [01 l l] Exomples of frdns—fdffy acids for inclusion include, buf ore nof limifed fo, voccenic, or eldidic acid, and mixfures fhererof. Moreover, when consumed, mommdls converf voccenic dcid info rumenic acid, which is Cl conjugdfed linoleic dcid fhdf exhibifs dnfic0rcinogenic properfies. Addifiondlly, Cl dief enriched wifh ic dcid mdy help lower fofdl cholesferol, LDL cholesferol dnd friglyceride levels.

[Ol 12] In some embodimenfs, fhe enriched lipid frdcfion dnd/or milk fdf globules may comprise BCFAs. In some embodimenfs fhe BCFAs ore presenf of Cl concenfrdfion from dbouf 0.2 g/100 kcol dnd dbouf 5.82 g/lOO kcol. ln dnofher embodimenf, fhe BCFAs dre presenf in on dmounf of from dbouf 2.3 g/l00 kcol fo dbouf 4.2 g/l00 kcol. ln yef dnofher embodimenf fhe BCFAs dre presenf from dbouf 4.2 g/lOO kcol fo dbouf 5.82 g/lOO kcol. ln sfill ofher embodimenfs, fhe milk fdf globules comprise of ledsf one BCFA.

[Ol 13] BCFAs fhdf dre idenfified in humdn milk dre preferred for inclusion in fhe nufrifiondl ifion. on of BCFAs fo infdnf or children’s formulds dllows such formulds fo mirror fhe composifion dnd funcfiondlify of humdn milk and fo promofe l hedlfh and well—being.

In cerfdin embodimenfs fhe enriched lipid frdcfion dnd/or milk fdf globules may se CLA. In some embodimenfs CLA may be presenf in Cl concentration from dbout 0.4 g/lOO kcol to dbout 2.5 g/lOO kcol. In other embodiments CLA mdy be present from dbout 0.8 g/lOO kcol to dbout l.2 g/lOO kcol. In yet other embodiments CLA moy be present from dbout l.2 g/lOO kcol to dbout 2.3 g/lOO kcol. In still other ments, the milk fot globules comprise of least one CLA.

CLAs thdt ore identified in humdn milk ore preferred for inclusion in the nutritiondl composition. Typicolly, CLAs ore dbsorbed by the infdnt from the humdn milk of Cl nursing . Addition of CLAs to infdnt or children’s formulds dllows such formulds to mirror the composition dnd functiondlity of humdn milk 0nd to promote generdl hedlth dnd wellbeing.

[Ollé] Exomples of CLAs found in the milk fdt es for the nutritiondl composition include, but ore not limited to, cis—9, trons—l l CLA, trons—lO, cis—l2 CLA, cis—9, trons—l 2 octddecodienoic dcid, dnd mixtures thereof.

The enriched lipid frdction dnd/or milk fdt globules of the present disclosure comprise sdturdted fdtty odds in some embodiments. The ed lipid frdction dnd/or milk fot globules mdy be formuldted to include sdturdted fdtty ocids from dbout 0.8 g/lOO kcol to dbout 2.5 g/lOO kcol. In other embodiments the milk fot globules mdy include monounsdturdted fdtty ocids from dbout l.2 g/lOO kcol to dbout 1.8 g/lOO kcol.

[Ol 18] Exomples of sdturdted fdtty dcids suitdble include, but ore not limited to, polmitoleic dcid, cis—voccenic dcid, oleic dcid, dnd mixtures thereof.

In certdin embodiments, the enriched lipid frdction dnd/or milk fdt globules of the present disclosure comprise polyunsdturdted fdtty odds from dbout 2.3 g/lOO kcol to dbout 4.4 g/lOO kcol. In other embodiments, the polyunsdturdted fdtty dcids ore present from dbout 2.7 g/lOO kcol to dbout 3.5 g/lOO kcol. In yet r embodiment, the polyunsdturdted fdtty dcids ore present from dbout 2.4 g/lOO kcol to dbout 3.3 g/l OO kcol.

WO 86843 In some embodimenfs, fhe enriched lipid frocfion dnd/or milk fdf globules of fhe presenf disclosure comprise polyunsdfurdfed fdffy acids, such os, for exomple linoleic acid, nic acid, ocfddecdfrienoic dcid, donic dcid (ARA), eicosdfefrdenoic dcid, eicopsdpenfdenoic dcid (EPA), docosdpenfdenoic dcid (DPA), dnd docosdhexoenoic acid (DHA).

Polyunsdfurdfed fdffy dcids ore fhe precursors for prosfdgldndins dnd eicosdnoids, which ore known fo provide numerous hedlfh benefifs, including, nflommofory response, cholesferol obsorpfion, and sed bronchidl funcfion.

The enriched lipid frdcfion dnd/or milk fdf globules of fhe presenf disclosure con also comprise cholesferol in some embodimenfs from dbouf 100 mg/100 kcdl fo dbouf 400 mg/100 kdl. ln onofher embodimenf, cholesferol is presenf from dbouf 200 mg/100 kcol fo dbouf 300 mg/100 kcol. As is r fo humdn milk dnd bovine milk, fhe cholesferol included in fhe milk fdf globules may be presenf in fhe oufer bildyer membrdne of fhe milk fdf globule fo provide sfobilify fo fhe globuldr membrdne.

[0122] In some embodimenfs, fhe enriched lipid frdcfion dnd/or milk fdf globules of fhe presenf disclosure comprise phospholipids from dbouf 50 mg/100 kcol fo dbouf 200 mg/100 kcol. ln ofher embodimenfs, fhe phospholipids ore presenf from dbouf 75 mg/100 kcol fo dbouf 150 mg/100 kcdl. ln yef ofher embodimenfs, fhe phospholipids ore presenf of Cl concenfrofion of from dbouf 100 mg/100 kcol fo dbouf 250 mg/100 kcol.

In cerfdin embodimenfs, phospholipids mdy be incorpordfed info The milk fdf globules fo sfdbilize fhe milk fdf globule by providing Cl phospholipid membrdne or bildyer olipid membrdne. Therefore, in some embodimenfs fhe milk fdf globules mdy be formuldfed wifh higher dmounfs of phospholipids fhdn fhose found in humdn milk.

The olipid ifion of humdn milk lipids, ds fhe weighf percenf of fofdl phospholipids, is phosphdfidylcholine(“PC”) 24.9%, phospthidyleThdnoldmine (“PE”) 27.7%, phospthidylserine (“P3”) 9.3%, phosphoTidylinosiTol (“Pl”) 5.4%, 0nd sphingomyelin (“SPGM”) 32.4%, r, G. eT dl., Am. J. Clin. NuTr., Vol. 37, pp. 612—621 (1983)). Thus in one embodimenT, The milk de globules comprise one or more of PC, PE, PS, Pl, SPlel, dnd mixTures Thereof. FurTher, The phospholipid composiTion included in The milk de globules mdy be formuldTed To provide ceerin heolTh benefiTs by incorpordTing desired phospholipids.

In ceerin embodimenTs, The enriched lipid frdcTion dnd/or milk de es of The presenT disclosure comprise milk de globule membrdne proTein. In some embodimenTs, The milk de globule membrdne proTein is presenT from dbouT 50 mg/lOO kcol To dbouT 500 mg/l OO kcol.

GoldcTolipids mdy be ed, in some embodimenTs, in The enriched lipid frdcTion dnd/or milk de globules of The presenT disclosure. For purposes of This disclosure “goldcTolipids” refer To dny ipid whose sugdr group is goldcTose. lvlore specificolly, goldcTolipids differ from glycosphingolipids in Tth They do noT hove nigTrogen in Their composiTion. GoldcTolipids pldy dn impoernT role in supporTing brdin developmenT dnd overdll neurondl heolTh.

AddiTionoIIy, The goldcTolipids, goldcTocerebroside dnd suldeides TuTe dbouT 23% 0nd 4% of Tonl myelin lipid conTenT Tively, dnd Thus mdy be incorpordTed info The milk de globules in some embodimenTs.

In some embodimenTs, The nuTriTiondl composiTion(s) of The disclosure may comprise of ledsT one proTein source oTher Thdn IdcToferrin (if presenT).

The proTein source con be dny used in The drT, e.g., nonde milk, whey proTein, cosein, soy proTein, hydrolyzed proTein, omino dcids, and The like. Bovine milk proTein sources useful in prdcTicing The presenT disclosure include, buT ore noT d To, milk n powders, milk proTein TrdTes, milk proTein es, nonde milk solids, nonde milk, nonde dry milk, whey proTein, whey proTein isoldTes, whey proTein concenTrdTes, sweeT whey, dcid whey, cosein, dcid , coseindTe (e.g. sodium coseindTe, sodium colcium coseindTe, colcium coseindTe) dnd dny combindTions Thereof.

In some embodiments, the proteins of the nutritiondl composition ore provided as intdct proteins. In other embodiments, the ns ore provided as o combination of both intdct ns and hydrolyzed proteins. In certain embodiments, the proteins mdy be portidlly hydrolyzed or extensively hydrolyzed. In still other embodiments, the n source comprises omino ocids. In yet another embodiment, the protein source may be supplemented with glutdmine—contdining es. In dnother embodiment, the protein component comprises extensively hydrolyzed protein. In still another embodiment, the protein component of the nutritiondl composition consists essentially of extensively hydrolyzed protein in order to ze the occurrence of food allergy. In yet another embodiment, the protein source may be mented with glutdmine— contdining peptides.

Accordingly, in some embodiments, the protein ent of the iondl composition comprises either portidlly or extensively hydrolyzed protein, such ds protein from cow’s milk. The hydrolyzed proteins may be treated with enzymes to break down some or most of the proteins that cause ddverse symptoms with the goal of reducing allergic reactions, intolerance, and sensitizdtion. Moreover, the proteins may be hydrolyzed by any method known in the ort.

The terms “protein hydrolysotes” or lyzed protein” ore used interchdngedbly herein dnd refer to yzed proteins, n the degree of hydrolysis is may be from about 20% to about 80%, or from about 30% to about 80%, or even from about 40% to about 60%.

When CI peptide bond in 0 protein is broken by enzymatic hydrolysis, one omino group is released for eoch peptide bond broken, cousing on incredse in omino nitrogen. It should be noted thdt even non—hydrolyzed protein would contain some exposed omino groups. Hydronzed proteins will also hove CI different molecular weight distribution thdn the non—hydrolyzed proteins from which they were formed. The ondl dnd nutritiondl properties of hydrolyzed proteins con be offected by the ent size peptides. A molecular weight profile is usudlly given by listing the percent by 2017/076797 weight of particular ranges of molecular weight (in Daltons) fractions (e.g., 2,000 to 5,000 Daltons, r than 5,000 Daltons).

In a particular embodiment, the nutritional composition is protein—free and contains free amino acids as a protein equivalent source. In this ment, the amino acids may comprise, but are not limited to, histidine, isoleucine, Ieucine, , methionine, ne, phenylalanine, tyrosine, threonine, tryptophan, valine, alanine, arginine, asparagine, aspartic acid, glutamic acid, glutamine, glycine, proline, serine, carnitine, taurine and mixtures thereof. In some embodiments, the amino acids may be ed chain amino acids. In other embodiments, small amino acid peptides may be included as the n ent of the nutritional composition. Such small amino acid peptides may be naturally occurring or synthesized. The amount of free amino acids in the nutritional composition may vary from about 1 to about 5 g/100 kcal. In an embodiment, 100% of the free amino acids have a lar weight of less than 500 Daltons. In this embodiment, the nutritional formulation may be lergenic.

In an embodiment, the protein source ses from about 40% to about 85% whey protein and from about 15% to about 60% casein.

In some embodiments, the nutritional composition comprises between about 1 g and about 7 g of a protein and/or protein equivalent source per 100 kcal. In other embodiments, the nutritional composition comprises between about 3.5 g and about 4.5 g of protein or protein equivalent per 100 kcal.

Moreover, the ional composition of the present disclosure may comprise at least one starch or starch component. A starch is a carbohydrate composed of two distinct polymer fractions: amylose and amylopectin.

Amylose is the linear fraction consisting of a—1,4 linked glucose units.

Amylopectin has the same structure as amylose, but some of the glucose units are combined in an a—1,6 linkage, giving rise to a branched structure.

Starches generally contain 17—24% amylose and from 76—83% amylopectin. Yet special genetic varieties of plants have been developed that produce starch wifh unusual amylose fo amylopecfin rafios. Some planfs produce sfarch fhaf is free of amylase. These mufanfs produce sfarch granules in fhe endosperm and pollen fhaf sfain red wifh iodine and fhaf n nearly 100% amylopecfin. Predominanf among such ecfin producing planfs are waxy corn, waxy sorghum and waxy rice sfarch.

The performance of sfarches under condifions of heaf, shear and acid may be modified or improved by chemical modificafions. lvlodificafions are y affained by infroducfion of subsfifuenf chemical groups. For e, viscosify of high femperafures or high shear can be increased or sfabilized by cross—linking wifh di— or polyfuncfional reagenfs, such as orus oxychloride.

In some insfances, fhe nufrifional composifions of fhe presenf disclosure comprise of leasf one sfarch fhaf is gelafinized or pregelafinized. As is known in fhe arf, gelafinizafion occurs when polymer molecules inferacf over a porfion of fheir lengfh fo form a l< fhaf enfraps solvenf and/or solufe molecules. lvloreover, gels form when pecfin molecules lose some wafer of ion owing fo compefifive hydrafion of cosolufe molecules. Facfors fhaf influence fhe occurrence of gelafion include pH, concenfrafion of cosolufes, concenfrafion and fype of cafions, femperafure and pecfin frafion.

Nofably, lel pecfin will gel only in fhe presence of divalenf cafions, such as calcium ions. And among lel pecfins, fhose wifh fhe lowesf degree of esferificafion have fhe highesf gelling femperafures and fhe greafesf need for divalenf cafions for crossbridging.

Meanwhile, pregelafinizafion of sfarch is a process of precooking sfarch fo e maferial fhaf hydrafes and swells in cold wafer. The precooked sfarch is fhen dried, for example by drum drying or spray drying. over fhe sfarch of fhe presenf disclosure can be chemically modified fo furfher exfend fhe range of ifs finished properfies. The nufrifional composifions of fhe presenf disclosure may comprise of leasf one afinized sfarch.

Nafive sfarch granules are insoluble in wafer, buf, when heafed in water, native starch es begin to swell when sufficient heat energy is present to overcome the bonding forces of the starch molecules. With continued g, the e swells to many times its original volume. The friction between these swollen granules is the major factor that contributes to starch paste viscosity.

The nutritional composition of the present disclosure may comprise native or modified es, such as, for example, waxy corn starch, waxy rice starch, corn starch, rice starch, potato starch, tapioca starch, wheat starch or any mixture f. lly, common corn starch comprises about 25% amylose, while waxy corn starch is almost totally made up of amylopectin. lvleanwhile, potato starch generally comprises about 20% amylose, rice starch comprises an amylose:amylopectin ratio of about 20:80, and waxy rice starch comprises only about 2% amylose. Further, tapioca starch lly comprises about 15% to about 18% amylose, and wheat starch has an amylose content of around 25%.

In some embodiments, the nutritional composition comprises nized and/or pre—gelatinized waxy corn starch. In other embodiments, the nutritional composition comprises gelatinized and/or pre—gelatinized tapioca starch. Other gelatinized or pre— nized starches, such as rice starch or potato starch may also be used.

Additionally, the nutritional compositions of the present disclosure comprise at least one source of . The source of pectin may comprise any variety or grade of pectin known in the art. In some embodiments, the pectin has a degree of esterification of less than 50% and is classified as low methylated (“lel”) pectin. In some embodiments, the pectin has a degree of esterification of greater than or equal to 50% and is classified as high—ester or high methylated (“HM”) pectin. In still other embodiments, the pectin is very low (“VL”) pectin, which has a degree of esterification that is less than approximately 15%. Further, the nutritional composition of the present disclosure may comprise lel pectin, Hlvl pectin, VL , or any mixture thereof. The nutritional composition may include pectin that is soluble in water.

And, ds known in The OH, The solubiliTy ond viscosiTy of o pecTin soluTion ore reldTed To The molecular weighT, degree of esTerificoTion, concenTroTion of The pecTin preporoTion ond The pH and presence of counTerions.

Moreover, pecTin hos Cl unique dbiliTy To form gels. Generdlly, under simildr condiTions, Cl pecTin’s degree of geldTion, The gelling TemperoTure, dnd The gel sTrengTh ore proporTionol To one onoTher, and each is lly proporTionol To The moleculdr weighT of The pecTin dnd inversely proporTionol To The degree of esTerificoTion. For exomple, 0s The pH of o pecTin soluTion is lowered, ionionion of The corboxyldTe groups is repressed, and, 0s Cl resulT of losing Their chdrge, socchdride les do noT repel edch oTher over Their enTire lengTh. Accordingly, The polysdcchdride molecules con ossocidTe over Cl n of Their lengTh To form Cl gel. YeT pecTins wiTh incredsing degrees of meThyldTion will gel dT somewth higher pH becouse They hove fewer corboxyldTe onions dT dny given pH. (J.N. er, An lnTroducTion To PecTins: STrucTure dnd ProperTies, ChemisTry ond FuncTion of s; Chdeer 1; 1986.) The nuTriTiondl composiTion may comprise Cl geldTinized dnd/or pregeloTinized sTorch TogeTher wiTh pecTin dnd/or geldTinized pecTin. While noT wishing To be bound by This or dny oTher Theory, iT is believed Tth The use of pecTin, such as lel , which is Cl hydrocolloid of large moleculdr weighT, TogeTher wiTh sTorch grdnules, provides Cl synergisTic effecT Tth incredses The moleculdr inTerndl fricTion wiThin Cl fluid derix. The corboxylic groups of The pecTin mdy dlso inTerdcT wiTh colcium ions presenT in The nuTriTiondl composiTion, Thus leoding To on increase in viscosiTy, 0s The corboxylic groups of The pecTin form 0 weol< gel ure wiTh The colcium ion(s), dnd dlso wiTh pepTides presenT in The nuTriTiondl composiTion. In some embodimenTs, The nuTriTiondl iTion comprises Cl rdTio of sTorch To pecTin Tth is beTween dbouT 12:1 and 20:1, Tively. ln oTher embodimenTs, The rdTio of sTorch To pecTin is dbouT 17:1. In some embodimenTs, The iondl composiTion may comprise beTween dbouT 0.05 and dbouT 2.0% w/w pecTin. ln 0 porTiculor menT, The nuTriTiondl composiTion may comprise dbouT 0.5% w/w pecTin. 2017/076797 Pecfins for use herein Typically have a peak molecular weighf of 8,000 Dalfons or r. The s of fhe presenf disclosure have a preferred peak molecular weighf of befween 8,000 and abouf 500,000, more preferred is befween abouf 10,000 and abouf 200,000 and mosf preferred is n abouf 15,000 and abouf 100,000 Dalfons. In some embodimenfs, fhe pecfin of fhe presenf disclosure may be hydrolyzed pecfin. ln cerfain embodimenfs, fhe nufrifional composifion comprises hydrolyzed pecfin having a molecular weighf less fhan fhaf of infacf or fied pecfin. The yzed pecfin of fhe presenf disclosure can be prepared by any means known in fhe arf fo reduce molecular weighf. Examples of said means are chemical hydrolysis, enzymafic hydrolysis and mechanical shear. A preferred means of reducing fhe molecular weighf is by alkaline or neufral hydrolysis of elevafed femperafure. In some embodimenfs, fhe nufrifional composifion comprises parfially hydrolyzed pecfin. ln cerfain embodimenfs, fhe lly hydrolyzed pecfin has a molecular weighf fhaf is less fhan fhaf of infacf or unmodified pecfin buf more fhan 3,300 Dalfons.

The nufrifional ifion may n af leasf one acidic polysaccharide. An acidic polysaccharide, such as negafively charged pecfin, may induce an anfi— adhesive effecf on pafhogens in a f’s gasfroinfesfinal fracf. lndeed, nonhuman milk acidic oligosaccharides derived from pecfin are able fo inferacf wifh fhe epifhelial surface and are known fo f fhe adhesion of pafhogens on fhe epifhelial surface.

[0147] In some embodimenfs, fhe nufrifional composifion comprises of leasf one pecfin— derived acidic oligosaccharide. Pecfin—derived acidic oligosaccharide(s) (pAOS) resulf from enzymafic pecfinolysis, and fhe size of a pAOS depends on fhe enzyme use and on fhe durafion of fhe reacfion. In such embodimenfs, fhe pAOS may beneficially affecf a f’s sfool viscosify, sfool frequency, sfool pH and/or feeding nce. The nufrifional composifion of fhe presenf disclosure may comprise befween abouf 2 g pAOS per lifer of formula and abouf 6 g pAOS per lifer of formula. In an embodimenf, fhe nufrifional composifion comprises abouf 0.2 g pAOS/dL, corresponding fo fhe concenfrafion of acidic oligosaccharides in human milk.

(Fanaro et al., “Acidic Oligosaccharides from Pectin Hydrolysate as New Component for Infant Formulae: Effect on lntestinal Flora, Stool Characteristics, and pH”, Journal of Pediatric Gastroenterology and Nutrition, 41: 186—190, August 2005) In some embodiments, the nutritional composition comprises up to about 20% w/w of a e of starch and pectin. In some ments, the nutritional composition comprises up to about 19% starch and up to about 1% . In other embodiments, the nutritional composition comprises about up to about 15% starch and up to about 5% pectin. In still other embodiments, the nutritional composition comprises up to about 18% starch and up to about 2% pectin. In some embodiments the nutritional composition comprises between about 0.05% w/w and about 20% w/w of a e of starch and pectin. Other embodiments e n about 0.05% and about 19% w/w starch and between about 0.05% and about 1% w/w pectin. Further, the nutritional ition may comprise between about 0.05% and about 15% w/w starch and between about 0.05% and about 5% w/w pectin.

In some embodiments, the ional composition comprises at least one additional carbohydrate source, that is, a carbohydrate component ed in addition to the aforementioned starch component. Additional carbohydrate sources can be any used in the art, e.g., lactose, glucose, fructose, corn syrup solids, maltodextrins, sucrose, starch, rice syrup solids, and the like. The amount of the additional carbohydrate component in the nutritional composition lly can vary from between about 5 g and about 22 g/100 kcal. In some embodiments, the amount of carbohydrate is between about 6 g and about 16 g/100 kcal. In other embodiments, the amount of ydrate is between about 12 g and about 14 g/100 kcal. In some embodiments, corn syrup solids are preferred. lvloreover, hydrolyzed, partially hydrolyzed, and/or extensively hydrolyzed carbohydrates may be desirable for inclusion in the nutritional composition due to their easy digestibility. Specifically, hydrolyzed carbohydrates are less likely to contain allergenic epitopes.

Non—limiting examples of ydrate materials suitable for use herein include hydrolyzed or intact, naturally or chemically ed, starches sourced from corn, tapioca, rice or potato, in waxy or xy forms. Non— limiting es of suitable carbohydrates include various yzed es characterized as hydrolyzed cornstarch, maltodextrin, maltose, corn syrup, dextrose, corn syrup , glucose, and various other glucose polymers and combinations thereof. Non—limiting examples of other suitable carbohydrates include those often ed to as e, lactose, fructose, high fructose corn syrup, indigestible oligosaccharides such as fructo— oligosaccharides and combinations thereof.

In one particular embodiment, the additional carbohydrate component of the nutritional composition is comprised of 100% lactose. In another embodiment, the additional carbohydrate component comprises between about 0% and 60% lactose. In another embodiment, the additional carbohydrate component comprises between about 15% and 55% lactose. In yet another embodiment, the additional carbohydrate component comprises between about 20% and 30% lactose. In these embodiments, the remaining source of carbohydrates may be any carbohydrate known in the art. In an embodiment, the carbohydrate component comprises about 25% e and about 75% corn syrup solids.

In some embodiments the nutritional composition comprises sialic acid.

Sialic acids are a family of over 50 members of 9—carbon sugars, all of which are derivatives of neuroaminic acid. The predominant sialic acid family found in humans is from the N— acetylneuraminic acid sub—family. Sialic acids are found in milk, such as bovine and caprine. In mammals, neuronal cell membranes have the highest concentration of sialic acid ed to other body cell membranes. Sialic acid residues are also ents of gangliosides.

If included in the nutritional composition, sialic acid may be present in an amount from about 0.5 mg/100 kcal to about 45 mg/100 kcal. In some embodiments sialic acid may be present in an amount from about 5 mg/100 kcol to about 30 mg/100 kcol. In still other embodiments, siolic ocid may be present in on amount from dbout 10 mg/100 kcol to about 25 mg/100 kcol.

As noted, the disclosed nutritionol composition may comprise Cl source of B— glucon. Glucons ore cchdrides, specificolly polymers of glucose, which ore ndturdlly occurring and may be found in cell wolls of bocterio, yedst, fungi, and plonts. Beto glucons (LS—glucons) ore themselves Cl diverse subset of glucose polymers, which ore mode up of chains of glucose monomers linked together vid betd—type glycosidic bonds to form complex carbohydrates. [5—1,3—glucons ore corbohydrote polymers purified from, for exomple, yedst, mushroom, io, olgde, or cereols. (Stone BA, Cldrke AE. Chemistry and Biology of (1—3)—Betd—Glucons. :Portldnd Press Ltd; 1993. ) The chemicol structure of [513— glucon depends on the source of the [5—1,3—glucon. over, vorious chemicol porometers, such as lity, primdry structure, moleculdr , dnd bronching, pldy Cl role in biologicol dctivities of —glucons. (Yddomoe T., Structure and biologicol activities of fungal ,3—glucons. deugoku Zosshi. 2000;120:413—431.) [5—1,3—glucons ore naturally occurring polysdcchdrides, with or without [5— 1,6— glucose side chains that ore found in the cell wolls of Cl voriety of plonts, yeosts, fungi and bacteria. [5—1,3;1,6—glucons ore those containing glucose units with (1,3) links hdving side chdins ottdched of the (1,6) on(s). [5— 1,3;1,6 glucons ore Cl heterogeneous group of glucose polymers that shore structurdl commondlities, including Cl bockbone of stroight chdin glucose units linked by C1 [5—1 ,3 bond with [516— linked glucose bronches extending from this bdckbone. While this is the basic structure for the presently bed class of [S—glucons, some voriotions may exist. For exomple, certdin yeost cons hove odditiondl regions of [3(1,3) bronching extending from the [3(1,6) bronches, which odd further complexity to their respective structures.

[S—glucons derived from baker’s yeast, Socchoromyces cerevisioe, ore mode up of chains of D—glucose molecules connected at the 1 and 3 WO 86843 posilions, hdving side chdins of glucose OTTClChed of The l and 6 posilions.

Yedsl—derived p—glucon is on insoluble, fiber—like, complex sugor hoving ’rhe generol slruclure of Cl linear chain of glucose uni’rs with Cl 04,3 bdcl<bone interspersed with 04,6 side chdins ThClT ore generdlly 6—8 glucose uni’rs in length. More specificolly, fi—glucon derived from baker’s yeast is poly—(l ,6HS—D— glucopyrdnosyl—(l ,3)—f)—D—glucopyrdnose.

Furthermore, p—glucons ore well ’rolerd’red and do not produce or couse excess gds, dbdomindl dislension, blooling or didrrhed in pediatric subjecls.

Addilion of f)— glucon ’ro Cl nulrilionol composi’rion for Cl pedidlric subjecl, such ds on infdnl formuld, Cl growing—up milk or dnolher children’s iondl product, will improve The subjecl’s immune response by sing rdnce dgdinsl invoding pdlhogens dnd lherefore mdinldining or improving overdll hedllh.

The nulrilionol ition of The ’r disclosure comprises f)— glucon. In some embodimenls, ’rhe p—glucon is fi—l,3;l,6—glucon. In some embodimenls, ’rhe p—l,3;l,6—glucon is derived from bdker’s yedsl. The iondl ilion mdy comprise whole glucon le fa—glucon, pClTTlCUlClTe p—glucon, PGG—glucon (poly—1,6—L’J—D— glucopyrdnosyl—l,3—L3—D— glucopyrdnose) or dny mixlure ’rhereof.

In some embodimenls, ’rhe omounl of fi—glucon present in The composi’rion is of belween ClbOUT 0.010 and ClbOUT 0.080 g per 100g of composilion. ln olher menls, lhe nulriliondl composilion comprises belween ClbOUT 10 0nd ClbOUT 30 mg fi—glucon per g. ln onolher embodiment, The nulrilionol composi’rion comprises belween ClbOUT 5 0nd ClbOUT 30 mg p—glucon per 8 fl. oz. (236.6 mL) serving. In other embodimenls, lhe nulriliondl composilion comprises on dmounl of p—glucon sufficienl To provide belween ClbOUT 15 mg and ClbOUT 90 mg p—glucon per ddy. The nulrilionol composition may be delivered in mulliple doses To reach Cl ldrge’r amount of fi—glucon delivered To The subjecl lhroughou’r ’rhe ddy.

[Olél] In some embodimenls, lhe dmounl of on in The nulriliondl composition is n obout 3 mg ond obout 17 mg per 100 kcol. |n dnother embodiment the omount of EJ—glucon is between obout 6 mg ond obout 17 mg per 100 kcol.

One or more vitdmins ond/or minerols moy olso be odded in to the nutritiondl composition in dmounts sufficient to supply the ddily nutritiondl ements of d subject. It is to be understood by one of ordindry skill in the drt thdt vitdmin dnd minerdl requirements will vory, for exomple, bosed on the oge of the child. For instdnce, on infdnt mdy hove different vitdmin dnd minerdl requirements thdn Cl child between the dges of one ond thirteen yeors. Thus, the embodiments ore not intended to limit the nutritional composition to o porticulor oge group but, rother, to provide 0 ronge of occeptoble vitomin ond minerdl ents.

[0163] The iondl composition mdy optiondlly include, but is not limited to, one or more of the following vitdmins or derivqtions f: vitdmin Bl (thidmin, thiomin pyrophosphdte, TPP, thiomin triphosphdte, TTP, thiomin hloride, n mononitrote), vitomin B2 (riboflovin, fldvin mononucleotide, FIle, fldvin ddenine dinucleotide, FAD, Idctoflovin, ovoflovin), vitomin B3 (niocin, nicotinic dcid, nicotinomide, niocinomide, nicotinomide ddenine dinucleotide, NAD, nicotinic dcid mononucleotide, NicIle, pyridine—3—corboxylic dcid), vitomin B3—precursor tryptophdn, vitomin Bé (pyridoxine, pyridoxol, pyridoxomine, pyridoxine hydrochloride), pontothenic dcid (pontothendte, ponthenol), folote (foIic dcid, folocin, gIutomic dcid), n Bl2 (cobolomin, methylcobolomin, deoxyodenosylcobolomin, cyonocobolomin, ycobolomin, ylcobolomin), biotin, vitomin C bic dcid), vitomin A (retinoI, l dcetdte, retinyl pdlmitdte, retinyl esters with other long— chdin fdtty ocids, retinol, retinoic dcid, retino| esters), vitomin D (colciferol, cho|eco|cifero|, vitomin D3, i,25,—dihydroxyvitdmin D), vitomin E (o—tocopherol, o— tocopheroI dcetdte, o—tocopherol succinote, o—tocopherol nicotinote, o—tocopherol), vitdmin K (vitdmin Kl, quinone, ndphthoquinone, vitdmin K2, menoquinone—7, vitomin K3, menoquinone—4, menodione, menoquinone—8, menoquinone—8H, menoquinone—9, menoquinone—9H, menoquinone—lO, 2017/076797 menaquinone—ll, menaquinone—l2, menaquinone—l3), choline, inositol, l5- carotene and any combinations thereof.

Further, the nutritional composition may optionally include, but is not limited to, one or more of the following minerals or derivations thereof: boron, calcium, m acetate, calcium ate, calcium chloride, calcium lactate, calcium phosphate, calcium sulfate, chloride, chromium, chromium chloride, chromium picolonate, copper, copper sulfate, copper gluconate, cupric sulfate, de, iron, carbonyl iron, ferric iron, ferrous fumarate, ferric orthophosphate, iron trituration, polysaccharide iron, iodide, iodine, ium, magnesium carbonate, magnesium hydroxide, magnesium oxide, magnesium stearate, magnesium sulfate, manganese, molybdenum, phosphorus, potassium, potassium phosphate, potassium iodide, potassium chloride, potassium acetate, um, sulfur, sodium, docusate sodium, sodium chloride, sodium selenate, sodium selenite, sodium molybdate, zinc, zinc oxide, zinc sulfate and mixtures f. Non—limiting exemplary derivatives of mineral compounds include salts, alkaline salts, esters and chelates of any mineral nd.

[0165] The minerals can be added to nutritional compositions in the form of salts such as calcium phosphate, m glycerol phosphate, sodium citrate, potassium chloride, potassium ate, magnesium phosphate, ferrous e, zinc sulfate, cupric sulfate, manganese sulfate, and sodium selenite. onal vitamins and minerals can be added as known within the art.

In an embodiment, the nutritional composition may contain between about to and about 50% of the maximum dietary recommendation for any given country, or between about 10 and about 50% of the average dietary recommendation for a group of countries, per serving of vitamins A, C, and E, zinc, iron, iodine, selenium, and choline. In r embodiment, the children’s nutritional composition may supply about to — 30% of the maximum dietary recommendation for any given country, or about 10 — 30% of the average dietary recommendation for a group of countries, per g of B— vitamins. In yet another ment, the levels of n D, calcium, magnesium, phosphorus, and potossium in the children’s nutritionol product may correspond with the overdge levels found in milk. In other embodiments, other nutrients in the children’s nutritionol composition may be present of about 20% of the moximum dietdry enddtion for dny given country, or about 20% of the overoge dietory recommendotion for 0 group of countries, per serving.

The nutritiondl compositions of the t disclosure moy optionolly include one or more of the following fldvoring dgents, including, but not limited to, fldvored ts, volotile oils, cocoo or chocolote flovorings, pednut butter fldvoring, cookie crumbs, vonilld or dny commercidlly ovoildble ing. Exomples of useful fldvorings include, but ore not limited to, pure onise extrdct, imitdtion bondnd extrdct, imitdtion cherry extrdct, chocoldte extrdct, pure lemon extroct, pure oronge extroct, pure peppermint extroct, honey, imitdtion pinedpple t, imitdtion rum extrdct, imitdtion strdwberry extrdct, or vanilla extroct; or le oils, such as bolm oil, boy oil, bergomot oil, cedorwood oil, cherry oil, cinndmon oil, clove oil, or peppermint oil; peonut butter, chocolote ing, vonillo cookie crumb, butterscotch, toffee, and mixtures thereof. The dmounts of fldvoring dgent con vory gredtly depending upon the fldvoring dgent used. The type dnd dmount of ing dgent con be selected as is known in the ort.

The iondl compositions of the present disclosure moy optionolly include one or more emulsifiers that may be odded for stobility of the finol product. Exomples of suitoble emulsifiers include, but ore not limited to, in (e.g., from egg or soy), olpho loctolbumin ond/or mono— and di— glycerides, and mixtures thereof. Other emulsifiers ore y dppdrent to the skilled ortison and selection of suitdble emulsifier(s) will depend, in port, upon the formuldtion ond finol product.

[0169] The nutritiondl compositions of the present disclosure moy optionolly include one or more preservotives that may also be odded to extend product shelf life. Suitdble preservotives include, but ore not limited to, potossium sorbote, sodium sorbote, ium benzoote, sodium benzoote, colcium disodium EDTA, dnd mixtures thereof.

The nutritiondl itions of the t sure mdy optiondlly include one or more stobilizers. Suitoble stdbilizers for use in practicing the nutritionol composition of the present sure include, but ore not limited to, gum drobic, gum ghotti, gum kordyo, gum trdgdconth, dgdr, furcelldrdn, guor gum, gelldn gum, locust bedn gum, pectin, low methoxyl pectin, geldtin, microcrystolline cellulose, ClvlC (sodium ymethylcellulose), methylcellulose hydroxypropyl methyl cellulose, hydroxypropyl cellulose, DATEIvl (diocetyl tortdric ocid esters of mono— and diglycerides), dextron, corrogeendns, and mixtures thereof.

The disclosed nutritionol composition(s) may be provided in any form known in the ort, such as Cl powder, Cl gel, Cl suspension, Cl poste, Cl solid, Cl liquid, Cl liquid trote, Cl reconstituteoble powdered milk substitute or Cl reody—to—use product. The nutritionol composition may, in certain embodiments, comprise Cl nutritionol supplement, children's nutritionol product, infdnt formuld, or dny other nutritiondl composition designed for on infant or Cl pediotric subject. ionol compositions of the present disclosure include, for exomple, ordlly—ingestible, heolth—promoting substances including, for exomple, foods, beveroges, tdblets, copsules and powders. Moreover, the ionol composition of the present disclosure may be stondordized to Cl specific coloric content, it may be provided as Cl reody—to—use product, or it may be provided in Cl trdted form. In some embodiments, the iondl composition is in powder form with Cl porticle size in the rdnge of 5 pm to 1500 pm, more preferably in the range of 10 um to 300 um.

If the nutritiondl composition is in the form of Cl reddy—to—use product, the osmololity of the nutritionol composition may be between about 100 and about 1100 mOsm/kg woter, more typicolly about 200 to about 700 mOsm/kg woter. le tot or lipid sources for the nutritionol composition of the present disclosure may be any known or used in the ort, including but not limited to, animal s, e.g., milk tot, butter, butter tot, egg yolk lipid; morine sources, such as fish oils, marine oils, single cell oils; ble and planf oils, such as corn oil, canola oil, sunflower oil, soybean oil, palm olein oil, coconuf oil, high oleic sunflower oil, evening primrose oil, rapeseed oil, olive oil, flaxseed (linseed) oil, seed oil, high oleic safflower oil, palm sfearin, palm kernel oil, wheaf germ oil; medium chain friglyceride oils and ons and esfers of faffy acids; and any combinafions fhereof.

The nufrifional composifions of fhe disclosure may provide minimal, parfial or fofal nufrifional supporf. The composifions may be nufrifional supplemenfs or meal emenfs. The composifions may, buf need nof, be nufrifionally complefe. In an embodimenf, fhe nufrifional composifion of fhe disclosure is nufrifionally fe and confains suifable fypes and amounfs of lipid, carbohydrafe, profein, vifamins and minerals. The amounf of lipid or faf fypically can vary from abouf i To abouf 7 g/lOO kcal. The amounf of profein fypically can vary from abouf i To abouf 7 g/lOO kcal. The amounf of carbohydrafe fypically can vary from abouf 6 fo abouf 22 g/l 00 kcal.

The nufrifional composifion of fhe presenf disclosure may furfher include af leasf one onal phyfonufrienf, fhaf is, anofher phyfonufrienf componenf in addifion fo fhe pecfin and/or sfarch componenfs described hereinabove. Phyfonufrienfs, or fheir derivafives, conjugafed forms or precursors, fhaf are idenfified in human milk are preferred for ion in fhe ional composifion. Typically, diefary sources of carofenoids and enols are absorbed by a nursing mofher and refained in milk, making fhem available fo nursing infanfs. Addifion of fhese phyfonufrienfs fo infanf or children’s as allows such formulas fo mirror fhe composifion and onalify of human milk and fo promofe general healfh and wellbeing.

For example, in some embodimenfs, fhe nufrifional composifion of fhe presenf disclosure may comprise, in an 8 fl. oz. (236.6 mL) serving, befween abouf 80 and abouf 300 mg anfhocyanins, befween abouf 100 and abouf 600 mg proanfhocyanidins, befween abouf 50 and abouf 500 mg flavan—3—ols, or any combinafion or mixfure fhereof. ln ofher embodimenfs, fhe nufrifional composifion comprises apple exfracf, grape seed exfracf, or a combinafion or mixture thereof. Further, the of ledst one phytonutrient of the nutritiondl composition may be derived from dny single or blend of fruit, grdpe seed dnd/or dpple or ted extrdct(s).

For the es of this disclosure, odditiondl utrients mdy be odded to Cl nutritiondl composition in notive, purified, encdpsuldted dnd/or chemicdlly or enzymdticdlly—modified form so 08 to r the desired y dnd stdbility properties. In the cose of encopsuldtion, it is desirable thdt the encdpsuldted phytonutrients resist dissolution with woter but ore reledsed upon ng the smdll intestine. This could be dchieved by the dppliCdtion of enteric cootings, such 08 cross—linked te dnd others.

Edeples of ddditiondl phytonutrients suitdble for the nutritiondl ition include, but ore not limited to, onthocydnins, proonthocydnidins, fldvon—3—ols (i.e.. cotechins, epicotechins, etc.), fldvdnones, fldvonoids, isofldvonoids, stilbenoids (i.e. resverdtrol, etc.), proonthocydnidins, onthocydnins, resverdtrol, quercetin, curcumin, dnd/or dny e thereof, 08 well 08 dny possible dtion of phytonutrients in Cl purified or ndturdl form.

Certdin components, especidlly pldnt—bdsed components of the iondl itions mdy provide Cl source of phytonutrients.

Some dmounts of phytonutrients mdy be inherently present in known ingredients, such 05 ndturdl oils, thdt ore commonly used to make nutritiondl compositions for pedidtric ts. These inherent phytonutrient(s) mdy be but ore not necessdrily considered port of the phytonutrient component described in the present disclosure. In some embodiments, the phytonutrient concentrdtions dnd rotios 08 described herein ore colculdted bdsed upon odded dnd inherent phytonutrient sources. In other embodiments, the utrient concentrdtions dnd rotios 08 described herein ore colculdted bdsed only upon odded phytonutrient sources.

In some embodiments, the nutritiondl composition comprises onthocydnins, such 08, for exomple, glucosides of ourdntinidin, cydnidin, delphinidin, europinidin, luteolinidin, peldrgonidin, mdlvidin, peonidin, WO 86843 petunidin, dnd rosinidin. These dnd other onthocydnins suitdble for use in the nutritiondl composition ore found in C1 voriety of pldnt sources. Anthocydnins may be derived from 0 single plont source or o combinotion of plont sources.

Non—limiting es of pldnts rich in onthocydnins suitdble for use in the inventive composition include: berries (ocoi, grope, bilberry, blueberry, lingonberry, block t, chokeberry, blockberry, rospberry, cherry, red curront, cronberry, crowberry, cloudberry, whortleberry, rowonberry), purple corn, purple pototo, purple corrot, red sweet pototo, red cobboge, eggplont.

[0181] In some embodiments, the nutritiondl composition of the present disclosure comprises proonthocyonidins, which include but ore not limited to flovon—3—ols and polymers of flovon—3—ols (e.g., cotechins, epicotechins) with s of polymerizotion in the ronge of 2 to 11. Such compounds may be derived from 0 single plont source or o combinotion of plont sources. Non— limiting exomples of pldnt s rich in proonthocyonidins suitdble for use in the inventive nutritionol ition include: grope, grope skin, grope seed, green tea, block ted, opple, pine bork, cinnomon, cocoo, bilberry, cronberry, block curront chokeberry.

[0182] Non—limiting exomples of fldvon—3—ols which ore suitdble for use in the inventive nutritionol composition include cotechin, epicotechin, gollocotechin, epigollocotechin, epicotechin gollote, epicotechin—3—gollote, epigollocotechin dnd gollote. Pldnts rich in the suitdble fldvon—3—ols include, but ore not limited to, teos, red gropes, cocoo, green tea, opricot ond opple.

Certoin enol compounds, in porticulor flovon—3—ols, may improve leorning and memory in o humon t by increosing broin blood flow, which is ossocioted with on increose ond sustoined broin energy/nutrient delivery as well as formotion of new s. enols may also provide neuroprotective octions and may se both broin synoptogenesis ond ontioxiddnt copdbility, thereby supporting optimdl brdin development in younger children.

Preferred sources of flovon—3—ols for the nutritionol ition include at least one apple extract, at least one grape seed extract or a mixture thereof. For apple extracts, flavan—3—ols are broken down into monomers occurring in the range 4% to 20% and polymers in the range 80% to 96%. For grape seed extracts flavan—3—ols are broken down into monomers (about 46%) and polymers (about 54%) of the total favan—3—ols and total polyphenolic content. Preferred degree of polymerization of polymeric flavan—3—ols is in the range of between about 2 and ii. Furthermore, apple and grape seed extracts may contain in, epicatechin, epigallocatechin, epicatechin gallate, epigallocatechin gallate, polymeric proanthocyanidins, stilbenoids (i.e. resveratrol), flavonols (i.e. quercetin, myricetin), or any mixture f. Plant sources rich in flavan—3—ols include, but are not limited to apple, grape seed, grape, grape skin, tea (green or black), pine bark, cinnamon, cocoa, bilberry, cranberry, black currant, chokeberry.

[0185] If the nutritional composition is administered to a pediatric subject, an amount of flavan—3—ols, including ric —3—ols, polymeric flavan—3— ols or a combination thereof, ranging from between about 0.01 mg and about 450 mg per day may be stered. In some cases, the amount of flavan—3— ols administered to an infant or child may range from about 0.01 mg to about 170 mg per day, from about 50 to about 450 mg per day, or from about 100 mg to about 300 mg per day.

In an embodiment of the disclosure, flavan—3—ols are present in the nutritional ition in an amount ranging from about 0.4 to about 3.8 mg/g nutritional composition (about 9 to about 90 mg/lOO kcal). In another embodiment, flavan—3—ols are present in an amount ranging from about 0.8 to about 2.5 mg/g nutritional composition (about 20 to about 60 mg/l 00 kcal).

In some ments, the nutritional composition of the present disclosure comprises flavanones. Non—limiting examples of le flavanones include butin, eriodictyol, hesperetin, hesperidin, homeriodictyol, isosakuranetin, enin, naringin, pinocembrin, poncirin, sakuranetin, sakuranin, in. Plant sources rich in flavanones include, but are not limited to orange, tangerine, grapefruit, lemon, lime. The nutritional composition may be formulated to deliver between about 0.01 and about 150 mg flavanones per day.

Moreover, the nutritional composition may also comprise flavonols.

Flavonols from plant or algae extracts may be used. Flavonols, such as ishrhametin, kaempferol, myricetin, quercetin, may be included in the nutritional composition in amounts sufficient to deliver between about 0.01 and 150 mg per day to a subject.

[0189] The phytonutrient component of the nutritional composition may also comprise phytonutrients that have been identified in human milk, including but not limited to naringenin, hesperetin, anthocyanins, quercetin, kaempferol, echin, epigallocatechin, epicatechin-gallate, epigallocatechin-gallate or any combination thereof. In certain embodiments, the nutritional composition comprises between about 50 and about 2000 nmol/L epicatechin, n about 40 and about 2000 nmol/L epicatechin e, between about 100 and about 4000 nmol/L epigallocatechin gallate, between about 50 and about 2000 nmol/L naringenin, between about 5 and about 500 nmol/L kaempferol, between about 40 and about 4000 nmol/L etin, between about 25 and about 2000 nmol/L anthocyanins, between about 25 and about 500 nmol/L quercetin, or a mixture f. Furthermore, the nutritional composition may comprise the metabolite(s) of a phytonutrient or of its parent compound, or it may comprise other classes of dietary phytonutrients, such as glucosinolate or sulforaphane.

In certain ments, the nutritional ition comprises noids, such as lutein, zeaxanthin, astaxanthin, lycopene, beta—carotene, alpha—carotene, gamma— carotene, and/or beta—cryptoxanthin. Plant sources rich in carotenoids include, but are not limited to kiwi, grapes, citrus, tomatoes, watermelons, papayas and other red fruits, or dark greens, such as kale, spinach, turnip , collard , e lettuce, broccoli, zucchini, garden peas and Brussels sprouts, spinach, carrots. [019i] Humans cannot synthesize carotenoids, but over 34 carotenoids have been idenfified in human breasf milk, including isomers and mefabolifes of cerfain carofenoids. In addifion fo fheir presence in breasf milk, diefary carofenoids, such as alpha and befa—carofene, lycopene, lufein, zeaxanfhin, nfhin, and crypfoxanfhin are f in serum of lacfafing women and breasffed infanfs. Carofenoids in general have been reporfed fo e cell— fo—cell communicafion, promofe immune funcfion, f healfhy respirafory healfh, profecf skin from UV lighf , and have been linked fo reduced risk of cerfain fypes of cancer, and all—cause morfalify. Furfhermore, diefary sources of carofenoids and/or polyphenols are absorbed by human fs, accumulafed and refained in breasf milk, making fhem available fo nursing infanfs. Thus, addifion of phyfonufrienfs fo infanf formulas or children’s producfs would bring fhe as closer in composifion and funcfionalify fo human milk.

[0192] Flavonoids, as a whole, may also be included in fhe nufrifional composifion, as flavonoids cannof be synfhesized by humans. over, flavonoids from planf or algae exfracfs may be useful in fhe monomer, dimer and/or polymer forms. In some embodimenfs, fhe nufrifional composifion ses levels of fhe monomeric forms of flavonoids similar fo fhose in human milk during fhe firsf fhree monfhs of lacfafion. gh flavonoid aglycones (monomers) have been idenfified in human milk samples, fhe conjugafed forms of flavonoids and/or fheir mefabolifes may also be useful in fhe nufrifional composifion. The flavonoids could be added in fhe following forms: free, glucuronides, mefhyl glucuronides, sulphafes, and mefhyl sulphafes.

The nufrifional composifion may also comprise isoflavonoids and/or isoflavones. Examples include, buf are nof d fo, genisfein (genisfin), daidzein (daidzin), glycifein, biochanin A, onefin, coumesfrol, irilone, orobol, pseudobapfigenin, anagyroidisoflavone A and B, calycosin, glycifein, irigenin, 5—O— mefhylgenisfein, prafensein, prunefin, psi—fecforigenin, refusin, fecforigenin, iridin, ononin, puerarin, fecforidin, derrubone, lufeone, one, alpinumisoflavone, barbigerone, di—O— alpinumisoflavone, and 4'—mefhyl—alpinumisoflavone. Planf sources rich in isoflavonoids, include, buf are nof limifed fo, soybeans, psoralea, kudzu, lupine, fava, chick pea, olfolfo, legumes ond peonuts. The nutritionol composition moy be formuloted to deliver n obout 0.0l ond obout 150 mg isoflovones ond/or isoflovonoids per doy.

In on ment, the nutritiondl composition(s) of the present sure comprises on effective omount of choline. Choline is o nutrient thot is essentiol for normol function of cells. It is o precursor for membrone phospholipids, ond it dccelerotes the synthesis ond releose of ocetylcholine, o neurotrdnsmitter involved in memory e. lvloreover, though not wishing to be bound by this or dny other theory, it is ed thot dietory choline ond docosohexoenoic ocid (DHA) oct synergisticolly to promote the biosynthesis of phosphdtidylcholine dnd thus help promote synoptogenesis in humdn subjects. Additionolly, choline ond DHA may exhibit the synergistic effect of promoting dendritic spine formdtion, which is importdnt in the mdintendnce of estoblished synoptic connections. In some ments, the nutritionol composition(s) of the present sure includes on effective omount of choline, which is obout 20 mg e per 8 fl. oz. (236.6 mL) serving to obout 100 mg per 8 fl. oz. (236.6 mL) g.

[0195] lvloreover, in some embodiments, the nutritionol composition is nutritionolly complete, contoining suitoble types ond omounts of lipids, corbohydrotes, proteins, vitomins ond minerols to be 0 subject’s sole source of nutrition. Indeed, the nutritiondl ition mdy optiondlly include dny number of proteins, peptides, omino ocids, fotty ocids, probiotics ond/or their metobolic by—products, prebiotics, ydrotes ond ony other nutrient or other compound thdt mdy provide mdny nutritiondl dnd physiologicol benefits to d subject. Further, the ionol composition of the present disclosure moy comprise flovors, flovor enhoncers, sweeteners, pigments, vitomins, minerols, therdpeutic ingredients, onol food ingredients, food ingredients, processing ingredients or combinotions f.

The present disclosure further provides 0 method for providing nutritiondl support to Cl subject. The method includes ddministering to the subject on effective omount of the nutritionol composition of the present disclosure.

The nutritiondl composition mdy be expelled ly into Cl subject’s intestindl trdct. In some embodiments, the nutritiondl composition is expelled directly into the gut. In some embodiments, the composition mdy be formuldted to be consumed or ddministered lly under the supervision of Cl physicidn dnd mdy be intended for the specific dietdry mdndgement of Cl disedse or condition, such 05 celidc disedse dnd/or food dllergy, for which distinctive nutritiondl requirements, bdsed on recognized scientific principles, ore estdblished by medicol evoludtion.

The nutritiondl composition of the present disclosure is not limited to compositions comprising nutrients specificolly listed herein. Any nutrients mdy be delivered 08 port of the composition for the purpose of g nutritiondl needs dnd/or in order to ze the nutritiondl stdtus in Cl subject.

In some ments, the nutritiondl composition may be red to on infdnt from birth until Cl time thdt mdtches full—term gestdtion. In some embodiments, the nutritiondl composition mdy be delivered to on infdnt until dt ledst dbout three months corrected dge. In another embodiment, the nutritiondl composition mdy be delivered to Cl subject 08 long 08 is necessdry to correct nutritiondl deficiencies. In yet r embodiment, the nutritiondl composition mdy be delivered to on infdnt from birth until dt ledst dbout six months corrected age. In yet another embodiment, the nutritiondl composition mdy be delivered to on infdnt from birth until dt ledst dbout one yedr corrected dge.

In still other embodiments, the sed nutritiondl composition mdy be delivered to Cl pregndnt or ldctdting womdn to provide colic relief to the children of the subject womdn. The nutritiondl ition may be red to Cl womdn 08 Cl liquid nutritiondl composition, including Cl reconstituted powder, or 08 Cl copsule or other dosdge form suitdble for on ddult.

] The nutritionol composition of the present disclosure may be stondordized to Cl specific coloric content, it may be provided 08 Cl reody—to— use product, or it may be provided in Cl concentroted form.

The exoct composition of Cl nutritiondl ition dccording to the present disclosure con vory from morket—to—morket, depending on locol reguldtions dnd dietdry intdke informdtion of the populdtion of interest. In some embodiments, nutritiondl compositions according to the disclosure consist of 0 milk protein source, such 08 whole or skim milk, plus odded sugar and sweeteners to dchieve desired sensory properties, and odded vitdmins dnd minerdls. The fdt composition is typicolly derived from the milk row dls. Totdl protein con be tdrgeted to mdtch thdt of humdn milk, cow milk or 0 lower volue. Totol corbohydrdte is usudlly targeted to provide 08 little odded sugdr, such 08 sucrose or fructose, 08 possible to dchieve on dcceptoble toste. lly, Vitdmin A, colcium ond Vitomin D ore odded of levels to mdtch the nutrient contribution of dl cow milk. Otherwise, in some embodiments, ns and minerols con be odded of levels thdt provide opproximdtely 20% of the dietory reference intoke (DRI) or 20% of the Ddily Volue (DV) per serving. lvloreover, nutrient volues con vory n mdrkets depending on the identified iondl needs of the intended populotion, row moteriol contributions ond regiondl reguldtions.

In n embodiments, the nutritiondl composition is hypoollergenic.

In other embodiments, the nutritiondl ition is kosher. In still further embodiments, the nutritiondl composition is Cl non—geneticolly modified product. In on embodiment, the nutritiondl formuldtion is sucrose—free. The nutritionol composition moy olso be ldctose— free. In other ments, the nutritiondl composition does not contdin dny medium— chdin triglyceride oil. In some embodiments, no corrogeendn is present in the composition. In other embodiments, the nutritiondl composition is free of OH gums.

In some embodiments, the disclosure is directed to Cl stdged nutritiondl feeding regimen for Cl pedidtric subject, such os on infont or child, which includes Cl ity of ent nutritiondl compositions dccording to the present disclosure. Edch nutritiondl composition comprises Cl hydrolyzed protein, of ledst one pre—geldtinized stdrch, 0nd of ledst one pectin. ln certdin embodiments, the nutritiondl compositions of the feeding regimen mdy dlso include Cl source of long chdin polyunsdturdted fdtty dcid, dt ledst one prebiotic, on iron source, Cl source of fi—glucon, vitamins or minerdls, lutein, zedxonthin, or dny other ient described hereindbove. The nutritiondl compositions described herein mdy be ddministered once per ddy or vid severdl ddministrdtions throughout the course of Cl ddy.

[0205] Further provided herein ore methods of monufdcturing Cl nutritiondl composition, such 08 on infant formuld, including of ledst one or Cl dtion of the following steps: selecting Cl LA metdbolizing probiotic, selecting Cl source of protein or n equivolent, selecting Cl source of fdt, selecting Cl source of enriched milk product, selecting Cl source of LCPUFAs, dnd combining the LA metdbolizing probiotic, protein or protein equivolent source, LCPUFA source dnd fdt source to produce Cl nutritiondl composition. In some embodiments, the method further comprises the step of ing certdin dmounts of edch ingredient to be incorporated in specific dmount bdsed on Cl 100 kcol serving of the nutritiondl composition or based on the weight percentdge of the nutritiondl composition.

In certdin embodiments, ddministrdtion of the nutritiondl compositions disclosed herein modify the microbiotd in the gut dnd reduce the nce of colic in tdrget subjects. Accordingly, administering the nutritiondl compositions disclosed herein to s, including premdture infdnts, or to pregndnt or ldctdting women, con prevent colic dnd improve on infdnt’s qudlity of life dnd reduce the emotiondl strdin dnd stress for porents.

In some embodiments, the method is directed to cturing Cl powdered nutritiondl composition. The term red nutritiondl composition" 08 used herein, unless ise specified, refers to dry—blended powdered nutritiondl formuldtions sing LA metdbolizing tic, protein or protein equivolent, fdt, enriched milk t dnd LCPUFAs, which ore reconstitutdble with on s liquid, dnd which ore suitdble for ordl WO 86843 ddministrdtion to Cl humdn.

Indeed, in some embodiments, the method ses the steps of dry— blending selected nutritionol powders of the nutrients selected to creote o bose nutritionol powder to which odditionol selected ingredients, such as probiotic, may be odded and further blended with the bose nutritionol . The term "dry—blended" as used , unless otherwise specified, refers to the mixing of components or ingredients to form Cl bdse nutritiondl powder or, to the oddition of 0 dry, powdered or gronuloted component or ingredient to o bose powder to form 0 ed ionol formulotion. In some embodiments, the bose nutritionol powder is o milk—bosed nutritionol powder. In some embodiments, the bose ionol powder includes at leost one fot and one protein or n equivolent source. The powdered nutritiondl formuldtions mdy hove Cl coloric density toilored to the nutritiondl needs of the torget subject.

The powdered nutritionol itions may be formuloted with sufficient kinds and omounts of nutrients so as to provide 0 sole, primory, or supplementol source of nutrition, or to e 0 speciolized powdered nutritiondl formuldtion for use in individudls ted with specific conditions such as colic. For exomple, in some embodiments, the nutritionol compositions disclosed herein may be suitoble for odministrotion to pediotric subjects and infonts in order provide exemplory heolth benefits disclosed herein.

[0210] The powdered nutritiondl compositions provided herein mdy r comprise other optiondl ingredients thot moy modify the physical, chemical, hedonic or processing characteristics of the products or serve as nutritionol components when used in the torgeted populdtion. Mdny such optionol ingredients ore known or ise suitoble for use in other nutritiondl products and may dlso be used in the powder-ed nutritiondl compositions described herein, provided thdt such optiondl ingredients dre sdfe dnd effective for oral odministrdtion ond ore compdtible with the essential ond other ingredients in the selected product form. Non—limiting exomples of such dl ingredients include preservotives, ontioxidonts, emulsifying ogents, buffers, odditiondl nuTrienTs os bed herein, colordnTs, flovors, Thickening ogenTs dnd sTdbilizers, and so TorTh. [021 l] The powdered nuTriTiondl composiTions of The presenT disclosure mdy be ed dnd sedled in single or mulTi—use coaniners, end Then sTored under dmbienT condiTions for up To obouT 36 monThs or longer, more lly from dbouT l2 To dbouT 24 monThs. For mulTi—use coaniners, These pdckdges con be opened end Then covered for repedTed use by The e user, provided ThoT The covered pdckdge is Then sTored under ombienT condiTions (e.g., dvoid exTreme TemperdTures) and The conTenTs used wiThin obouT one monTh or SO.

[O2l2] in some embodimenTs, The meThod furTher comprises The sTep of plocing The iondl composiTions in Cl sudeble pdckdge. A sudeble pdckdge mdy comprise d coaniner, Tub, pouch, socheT, , or any oTher coaniner known and used in The ed for coanining nuTriTiondl composiTion. In some embodimenTs, The package ning The nuTriTiondl composiTion is o pldsTic er. In some embodimenTs, The pdckoge coanining The nuTriTionol composiTion is o meTol, gloss, cooTed or Ted cordboord or pdper coaniner. Generdlly, These Types of pockdging deeridls ore sudeble for use wiTh ceerin sTeriliZdTion meThods uTilized during The mdnufdcTuring of nuTriTiondl iTions formuldTed for oral ddminisTrdTion. in some embodimenTs, The nuTriTiondl composiTions ore pdckoged in d coaniner. The coaniner for use herein may include any coaniner suiToble for use wiTh liquid nuTriTiondl producTs ThoT is also copdble of wiThsTdnding c processing condiTions (e.g., sTerilionion) ds described herein dnd known To Those of ordindry skill in The orT. A sudeble coaniner mdy be 0 single—dose coaniner, or may be 0 mulTi—dose resedldble, or recloseoble coaniner ThoT mdy or mdy noT hove o sedling , such ds 0 Thin foil seoling member locoTed below The cop. Non—limiTing exomples of such coaniners include bogs, pldsTic boTTles or conToiners, pouches, merl cons, gloss s, juice box—Type coaniners, foil pouches, pldsTic bogs sold in boxes, or any oTher conToiner meeTing The dbove—described criTerid. In some embodimenTs, The conTainer is a able mulTi—dose c ner. In n embodimenTs, The able mulTi— dose plasTic conTainer furTher comprises a foil seal and a plasTic resealable cap. ln some embodimenTs, The ner may include a direcT seal screw cap. ln oTher embodimenTs, The conTainer may be a flexible pouch.

In some embodimenTs, The nuTriTional composiTion is a liquid nuTriTional composiTion and is processed via a “reTorT packaging” or “reTorT sTerilizing” process. The Terms ”reTorT packaging” and "reTorT sT-erilizing” are used inTerchangeably herein, and unless oTherwise specified, refer To The common pracTice of filling a conTainer, mosT Typically a meTal can or oTher similar package, wiTh a nuTriTional liquid and Then Ting The —filled package To The necessary heaT sTerilizaTion sTep, To form a sTerilized, reTorT packaged, nuTriTional liquid producT.

In some embodimenTs, The nuTriTional composiTions disclosed herein are processed via an accepTable asepTic packaging m-eThod. The Term ”asepTic packaging” as used herein, unless oTherwise specified, refers To The manufacTure of a packaged producT wiThouT reliance upon The above— described reTorT ing sTep, wherein The nuTriTional liquid and package are sTerilized separaTely prior To filling, and Then are combined under sTerilized or asepTic processing condiTions To form a sTerilized, asepTically packaged, nuTriTional liquid producT.

[0216] Examples are provided To illusTraTe some embodimenTs of The ional composiTion of The presenT disclosure buT should noT be inTerpreTed as any limiTaTion Thereon. OTher embodimenTs wiThin The scope of The claims herein will be apparenT To one skilled in The arT from The consideraTion of The specificaTion or pracTice of The nuTriTional composiTion or meThods disclosed herein. IT is inTended ThaT The specificaTion, TogeTher wiTh The example, be considered To be exemplary only, wiTh The scope and spiriT of The sure being indicaTed by The claims which follow The e.

EXAMPLE 1 This example illustrates an embodiment of a nutritional composition according to the present disclosure.

Ingredientlist: Lactose (cow’s milk), blend of vegetable oils (palm o|ein oil, coconut oil, soybean oil and high o|eic sunflower oil) (plant), non fat milk powder (cow’s milk), whey protein concentrate (cow’s milk), galacto—oligosaccharide (cow’s milk), polydextrose (plant), minerals (calcium carbonate, calcium phosphate, cupric sulfate, ferrous sulfate, magnesium oxide, manganese sulfate, potassium chloride, ium citrate, sodium citrate, sodium iodide, sodium selenite, cium phosphate and zinc sulfate), emulsifier (soy in) (plant), single cell oils (Ivlortierella alpina oil, Crypthecodinium cohnii oil) as s of arachidonic acid (ARA) and hexaenoic acid (DHA), lactoferrin (cow’s milk), corn syrup solids (plant), Bifidobacterium breve, vitamins (alpha— tocopheryl acetate, biotin, calcium pantothenate, alciferol, choline chloride, cyanocobalamin, folic acid, niacinamide, phytonadione, pyridoxine hydrochloride, riboflavin, sodium ascorbate, thiamine hydrochloride and vitamin A ate), inositol, taurine, nucleotides (adenosine monophosphate, cytidine monophosphate, guanosine monophosphate and uridine osphate), L—carnitine and antioxidants (ascorbic acid and ascorbyI palmitate).

Nutritionalcomposition: Nutrient level Nutrient level Nutrient (per 100 kcal) (per 100 9) Energy* kcaI Linoleic acid (LA) mg Nutrient Nutrient level Nutrient level (per 100 kcol) (per 100 g) Docosohexoenoic acid (DHA) mg \0O CO 01 \l Lactose LO 01 l\)O 0\ l\) (A) O N.‘ [\D\O .‘0 O\ (A) O\ 00 01 IiO\ 00 \O 3°°oo~ooo'\l ~o # #0#00in ~o#Amo —'0\ NOW (I) 0\ MN°°\1 MO\ #01 mapo 01 J; (A) #00So 2017/076797 * Bacterial strain: about i x 103 to about i x 1012 cfu/lOO kcal of LA metabolizing probiotic EXAMPLE 2 The lomics profiles from fecal samples, taken from a single subject during one day with colic and in a day without colic were analyzed and the results provided in Fig. l. The results show a high presence of undigested lipid compounds in the sample taken during the day with colic as compared to the sample taken in the day without colic.

EXAMPLE 3 Fourteen (l4) fecal samples were obtained from 7 infants without colic (control infants) and from 7 infants with infantile colic (colicky infants). Six out of the seven samples of colicky s and the 7 control s were processed by GC— MS chromatography (shown in Fig. 2). The samples were processed in triplicates. The two groups are significantly different for a ct number of compounds. The compounds are lipids and are involved in the linoleic acid lism. The y infants and the control infants clustered separately as two different groups for the metabolites present in feces. In particular in the colicky infants LA and Resolvin E are present; both of them index of a possible state of inflammation. The is separates colicky infants from control, non— y, s in a distinct way.

EXAMPLE 4 A culture independent approach, namely Denaturing Gradient Gel Electrophoresis (DGGE), was used to study the fecal microbiota composition of the same 14 samples used in Example 3; one of the results is reported in Fig. 3, which reports the DGGE output obtained when a specific bacterial population was analyzed; every band in the gel represents a different tion and colicky infants harbor a more complex microbiota compared to control infants. In order to understand the different microorganisms present in the two groups, bonds of interest were excised, re—dmplified, sequenced (Blle Genomics, PCldOVCl, ltdly) and then compored by BLAST (Altschul et ol., T997) with sequences in Geannk (http://www.ncbi.nlm.nih.gov/) using the bldstn dlgorithm and in the Ribosomdl Database Project (Ivloiddk et ol., 1994). The olignment showed thdt the most ent species recovered were Bldutio luti, Bldutio producto, Bldutio wexlerde, Lochnoonderoboculum orole, Dored igenerdns ond Ruminococcus gnovus. Bldutio is Cl genus of the Lochnospiro. DGGE onolysis olso indicote thdt Ruminococcus gnovus dnd/or Bldutid wexlerde were present with prevolence in y infdnts (see Fig. 4).

EXAMPLE 5 For species—specific quantification of Ruminococcus gnovus, Cl probe RT—PCR ossoy with usly described species ic primers and probe F: (5 ’—TGGCGGCGTGCTTAACA—3’ ), R : (5 ’—TCCGAAGAAATCCGTCAAGGT—3 ’ ), probe: (FAlvl—5’— ATGCAAGTCGAGCGAAG—3’—TAlleA) (Joossens et ol., 201 l) was used on the some 14 somples os Exomple 3. Templote for stdnddrd curve was represented by ten—fold dilutions of the genomic DNA of Ruminococcus gnovus ATCC29T49. Redl—time PCR results indicoted thdt the medn number of 163 rRNA gene copies of the R. gnovus detected in colicky infonts was 9.66 i 9.87, and in non—colicky infonts 3.55 i 3.36 (log 163 rRNA gene copies of coccus gnovus per grdm of wet . These dotd suggest Cl difference between the two groups, but the limited number of replicotes (7 somples/group) makes it difficult to m the outcome with stdtisticdl dgnmcdnce.

The qudntificotion the Bldutid genus wos dchieved by using on RT—PCR with primers previously described (Kurokowo et ol., 2015). Bldutio genus was present of high level in colicky infdnts ed to control s, while Ruminococcus gnovus could or could not reoch high level in colicky infdnts.

Results then cledrly indicoted thdt dll colicky infdnts hove higher counts of Bldutio spp, some of them hove also on high presence of Ruminococcus gnovus while the presence of bdcterium breve is definitely low in colicky infonts when compored to non colicky ones. The t of these somples were Then analyzed as regards The ce of B. breve, an ecological compeTiTor of The Lachnospiraceae family. Real—Time PCR resulTs Ted ThaT The mean number of 163 rRNA gene copies of The BifidobacTerium breve deTecTed in colicky infanTs was 6,67 i 6,9], and in licky infanTs 8,46 i 8,63 (log T63 rRNA gene copies of BifidobacTerium breve per gram of weT feces); Therefore if could be concluded ThaT non colicky s harbor up To 2 log of BifidobacTerium breve more compared To y ones.

EXAMPLE 6 The T4 fecal s of Example 3 were processed by means of The na lvliSeq proTocol. This Technique involves The deep sequencing of The V3—V4 region of The T63 rRNA gene of bacTeria in The samples, allowing a full coverage of The analyzed diversiTy, wiTh a correcT classificaTion of mosT sequences up To The species level (Polka ef al., 2015). 187,467 sequences were obTained in ToTal, and were downscaled To a common number of 2083 per sample, corresponding To 33,328 sequences in ToTal. RarefacTion curves and coverage analyses showed very good resulTs, wiTh 99.71% of average coverage obTained, Ting ThaT The lllumina analyses capTured The T parT of The bacTerial diversiTy in The samples.

ClusTering analyses was carried ouT, as firsT sTep, on The Taxonomical resulTs of The family level (Fig. 5). This analysis does noT allow a clear cuT separaTion beTween The colicky and conTrol, non—colicky fecal samples; however if is clear ThaT EnTerobacTeriaceae (green bars) are noT dominanT in The colicky babies (colicky samples are marked by a red circle: 10, 24, 25, 3], 32, 35, and 38). The good coverage of The species level of The 14 samples, r, allows To obTain a clearer picTure of The microbioTa of The Two groups (Fig. 6).

To furTher confirm of a quanTiTaTive level This ouTcome, a lvleTasTaTs model was used, which is specifically ed To assess significanT differences in The relaTive abundance of T63 rRNA daTa originaTed wiTh high—ThroughpuT sequencing meThods (Paulson ef al., 20] l). The model was run on The 10 mosT WO 86843 dbunddnf species (including Ruminococcus gndvus) representing fhe 90% of oil ed diversify (lvlefdsfdfs is dimed fo differenfidfed species dnd generd or fdmilies of bdcferid, fhis is why in fhis dndlysis only Ruminococcus gndvus is fdken in considerdfion): p—volue obfdined for Ruminococcus gndvus wos 0.06, which is near fo sfdfisficdl significdnce. The grdph of differenfidl dbunddnces of fhese species in fhe fwo groups shows indeed Cl sfrong incredse in fhe colicky infdnfs (Fig. 7).

The surprising resulf of oil fhe dbove sfudies wos fhdf se of Ruminococcus gndvus in colicky infdnfs is dlso ossocidfed fo Cl decredse of Bifidobdcferium breve; bofh fhe voridfions hove fo occur in order fo hove colic; fhese microbidl imbdldnce is dlso fhe couse of moldigesfion of LA, which is nof converfed fo CLA, odding on ondl proinfldmmdfory compounds fo fhe sysfem. This inverse ossocidfion con expldin fhe oppedrdnce of colic ClS Ruminococcus gndvus dnd bifidobdcferid shore fhe some mefdbolic pdfthys for some . The Ruminococcus gndvus, which is dble fo use indl lidl mucin 08 Cl fermenfdfion subsfrdfe, dnd shore wifh B. breve, mefdbolic pdfthys for sugdr degrdddfion, fhey ore fhen compefifors for fhe some ecologicol niche dnd fermenfdfion subsfrdfes.

However, while Bifidobdcferium breve does nof e gds dnd if is dble fo f fhe pro—infldmmdfory LA info fhe dnfi—infldmmdfory CLA, Ruminococcus gndvus is Cl hydrogen producing species, undble fo converf LA info CLA. Therefore fhe presence of high levels of Bifidobdcferium breve con limif fhe presence of R. gndvus fo levels less hormful for infdnfs.

EXAMPLE 7 An infervenfion sfudy hos been performed in Cl colicky, 4 monfhs bdby.

The bdby wos bredsf fed dnd his dief hos been supplemenfed ddily wifh 109 of Cl sfrdin of Bifidobdcferium breve. Fecol sdmples were collecfed before fhe sfrdfion of fhe probiofic sfrdin during fhe fussy colic sympfoms dnd offer 14 days wifh fhe probiofic. Genomic dndlyses showed fhdf fhis bdby hdd Cl high level of Bldufid genus (107) while fhe presence of Ruminococcus gndvus was under the ion limit for the RT—PCR. RT— PCR showed that Bifidobacterium breve was t at the concentration of 108 before the treatment, but it reaches lO9 after the treatment. After the treatment with Bifidobacterium breve, the a genus concentration decreased of one logarithm and the presence of Bifidobacterium breve increased by a logarithm.

All references cited in this ication, including without limitation, all papers, publications, patents, patent ations, presentations, texts, reports, manuscripts, brochures, books, et postings, journal articles, periodicals, and the like, are hereby orated by reference into this specification in their entireties. The discussion of the references herein is intended merely to ize the assertions made by their authors and no admission is made that any reference constitutes prior art. Applicants reserve the right to challenge the accuracy and pertinence of the cited references.

Although embodiments of the disclosure have been described using specific terms, s, and methods, such description is for illustrative purposes only. The words used are words of description rather than of limitation. It is to be understood that changes and variations may be made by those of ordinary skill in the art without departing from the spirit or the scope of the present disclosure, which is set forth in the following claims. In addition, it should be tood that aspects of the various embodiments may be interchanged in whole or in part. For example, while methods for the production of a commercially sterile liquid nutritional supplement made according to those methods have been exemplified, other uses are contemplated. Therefore, the spirit and scope of the appended claims should not be limited to the description of the versions contained therein.

Claims (8)

1. Use o f : 1 x 103 to 1 x 1012 cfu/100 kcal of Bifidobacterium breve; up to 7 g/100 kcal of a fat or lipid; 10 up to 5 g/100 kcal of a protein or free amino acids as a protein equivalent source; 0.06 g/100 kcal to 1.5 g/100 kcal of a milk product enriched with milk fat globule membrane (MFGM) components; 5 mg/100 kcal to 90 mg/100 kcal of a source of long chain polyunsaturated fatty acids; and 0.015 g/100 kcal to 1.5 g/100 kcal of a prebiotic composition, in the manufacture of a ional composition for reducing the incidence of colic in a pediatric t, wherein the number of Bifidobacterium breve is at least one log higher than the number of Blautia bacteria in the gut of the pediatric subject after administration of the nutritional composition.

2. The use of claim 1, wherein the source of long chain polyunsaturated fatty acids includes at least one of docosahexaenoic acid, arachidonic acid, and combinations thereof. 30

3. The use of claim 1 or 2, wherein the MFGM further ses gangliosides and phospholipids.

4. The use of any one of the preceding claims, n the nutritional composition comprises at least 15 mg/100 kcal of lactoferrin from a man source.

5. The use of claim 4, wherein lactoferrin is present at a level of 10 mg/100 kcal to 5 200 mg/100 kcal, optionally wherein the errin is bovine lactoferrin.

6. The use of any one of the preceding claims wherein the prebiotic ition comprises polydextrose and a galacto-oligosaccharides. 10

7. The use of claim 6, wherein polydextrose and galactooligosaccharides comprise at least 20% of the prebiotic composition.

8. The use of any one of the preceding claims, wherein the nutritional composition is an infant formula.