NZ751577B2 - Methods And Compositions For Increasing Efficiency Of Targeted Gene Modification Using Oligonucleotide-Mediated Gene Repair - Google Patents

Abstract

The invention provides to improved methods for the modification of genes in plant cells, and plants and seeds derived therefrom. More specifically, the invention relates to the increased efficiency of targeted gene mutation by combining gene repair oligonucleotides with approaches that enhance the availability of components of the target cell gene repair mechanisms. In particular, the invention provides a method for introducing a gene repair oligonucleobase (GRON)-mediated mutation into a target DNA sequence in a plant cell, comprising delivery of a GRON and a site-specific nuclease selected from the group consisting of a zinc finger nuclease (ZFN), a CRISPR complex, and meganuclease into a plant cell. The GRON hybridizes at the target DNA sequence to create a mismatched base-pair(s), which acts as a signal to attract the cell's gene repair system to the site where the mismatched base-pair(s) is created, and is degraded after designated nucleotide(s) within the target DNA sequence is corrected by the cell's gene repair system such that the plant cell introduces the GRON-mediated mutation into the target DNA sequence and the plant cell is non-transgenic following the introduction. The GRON comprises one or more alterations from conventional RNA and DNA nucleotides at the 5' or 3' end. availability of components of the target cell gene repair mechanisms. In particular, the invention provides a method for introducing a gene repair oligonucleobase (GRON)-mediated mutation into a target DNA sequence in a plant cell, comprising delivery of a GRON and a site-specific nuclease selected from the group consisting of a zinc finger nuclease (ZFN), a CRISPR complex, and meganuclease into a plant cell. The GRON hybridizes at the target DNA sequence to create a mismatched base-pair(s), which acts as a signal to attract the cell's gene repair system to the site where the mismatched base-pair(s) is created, and is degraded after designated nucleotide(s) within the target DNA sequence is corrected by the cell's gene repair system such that the plant cell introduces the GRON-mediated mutation into the target DNA sequence and the plant cell is non-transgenic following the introduction. The GRON comprises one or more alterations from conventional RNA and DNA nucleotides at the 5' or 3' end.

Description

(12) Granted patent specificaon (19) NZ (11) 751577 (13) B2 (47) Publicaon date: 2021.12.24 (54) Methods And Composions For Increasing Efficiency Of Targeted Gene Modificaon Using Oligonucleode-Mediated Gene Repair (51) Internaonal Patent Classificaon(s): A01H 1/00 A01H 5/00 (22) Filing date: (73) Owner(s): 2014.03.14 CIBUS US LLC CIBUS EUROPE B.V. (23) Complete specificaon filing date: 3.14 (74) t: Wrays Pty Ltd (62) Divided out of 711145 (72) Inventor(s): (30) Internaonal Priority Data: SCHOPKE, Christian US 61/801,333 3.15 SAUER, Noel, Joy PEARCE, James SEGAMI, Rosa, E.

MOZORUK, Jerry GOCAL, Gregory, F.w.

BEETHAM, Peter, R. (57) Abstract: The invenon provides to ed methods for the modificaon of genes in plant cells, and plants and seeds derived therefrom. More cally, the invenon relates to the increased efficiency of targeted gene mutaon by combining gene repair oligonucleodes with approaches that enhance the availability of components of the target cell gene repair isms. In parcular, the invenon provides a method for introducing a gene repair oligonucleobase (GRON)- mediated mutaon into a target DNA sequence in a plant cell, comprising delivery of a GRON and a site-specific nuclease selected from the group ng of a zinc finger nuclease (ZFN), a CRISPR complex, and meganuclease into a plant cell. The GRON hybridizes at the target DNA sequence to create a mismatched base-pair(s), which acts as a signal to aract the cell's gene repair system to the site where the mismatched base-pair(s) is created, and is degraded aer 751577 B2 designated nucleode(s) within the target DNA sequence is ted by the cell's gene repair system such that the plant cell introduces the GRON-mediated mutaon into the target DNA sequence and the plant cell is ansgenic following the introducon. The GRON comprises one or more alteraons from convenonal RNA and DNA nucleodes at the 5' or 3' end.

METHODS AND COMPOSITIONS FOR INCREASING EFFICIENCY OF ED GENE MODIFICATION USING OLIGONUCLEOTIDE—NLEDIATED GENE REPAIR The present application claims priority to US. Provisional Patent Application 61/801,333 filed March 15, 2013, which is hereby incorporated by nce.

FIELD OF THE INVENTION This invention generally relates to novel methods to e the efficiency of the targeting of modifications to c locations in c or other nucleotide sequences.

Additionally, this invention relates to target DNA that has been modified, mutated or marked by the approaches disclosed herein. The invention also relates to cells, tissue, and organisms which have been modified by the invention's methods.

BACKGROUND OF THE INVENTION The following discussion of the background of the invention is merely provided to aid the reader in understanding the ion and is not admitted to describe or constitute prior art to the present invention.

The modification of genomic DNA is central to advances in biotechnology, in general, and biotechnologically based medical advances, in particular. nt methods for site— directed genomic ations are desirable for research and possibly for gene therapy applications. One approach es triplex—forming oligonucleotides (TFO) which bind as third strands to duplex DNA in a sequence—specific manner, to mediate directed mutagenesis.

Such TFO can act either by delivering a tethered mutagen, such as psoralen or chlorambucil (Havre et al., Proc Nat’l Acad Sci, USA. 90:7879—7883, 1993; Havre et al., J Virol 67:7323- 7331, 1993; Wang et al., Mol Cell Biol 15: 1759~1768, 1995; Takasugi et al., Proc Nat’l Acad Sci, USA. 88:5602-5606, 1991; Belousov et al., Nucleic Acids Res 25:3440—3444, 1997), or by binding with sufficient affinity to provoke error—prone repair (Wang eta1., Science 271 :802—805, 1996). r strategy for genomic modification involves the induction of homologous recombination n an exogenous DNA fragment and the targeted gene. This approach has been used successfully to target and disrupt selected genes in mammalian cells and has enabled the tion of transgenic mice carrying specific gene knockouts chi et al., Science 244: 1288-1292, 1989; US. Pat. No. 4,873,191 to Wagner). This approach, however, relies on the transfer of selectable markers to allow isolation of the desired recombinants. Without selection, the ratio of homologous to non- homologous ation of transfected DNA in typical gene transfer experiments is low, usually in the range of 1:1000 or less (Sedivy et al., Gene Targeting, W. H. Freeman and Co., New York, 1992). This low efficiency of homologous integration limits the utility of gene transfer for experimental use or gene therapy. The frequency of homologous ination can be enhanced by damage to the target site from UV irradiation and selected carcinogens (Wang et al., Mol Cell Biol 8:196—202, 1988) as well as by site— ic endonucleases (Sedivy et a1, Gene Targeting, W. H. n and Co., New York, 1992; Rouet et al., Proc Nat’l Acad Sci, U.S.A. 91:6064-6068, 1994', Sega] et al., Proc Nat’l Acad Sci, USA. 92:806-810, 1995). In addition, DNA damage induced by triplex—directed psoralen dducts can ate recombination within and between extrachromosomal vectors (Segal et al., Proc Nat’l Acad Sci, USA. 92:806—810, 1995; Faruqieta1., Mol Cell Biol 16:6820-6828, 1996; US. Pat. No. 5,962,426 to Glazer).

Other work has helped to define parameters that influence recombination in mammalian cells. In general, linear donor fragments are more recombinogenic than their circular counterparts (Folger eta1., Mol Cell Biol 2:1372-1387, 1982). Recombination is also influenced by the length of uninterrupted homology between both the donor and target sites, with short fragments appearing to be ineffective ates for ination (Rubnitz et al., Mol Cell Biol —2258, 1984). Nonetheless, several recent efforts have focused on the use of short fragments of DNA or DNA/RNA hybrids for gene correction. (Kunzelmann et al., Gene Ther 3:859—867, 1996).

The sequence~specific binding properties of TFO have been used to r a series of different molecules to target sites in DNA. For example, a diagnostic method for examining triplex interactions utilized TFO coupled to Fe—EDTA, a DNA cleaving agent (Moser et al., Science 238:645~650, 1987). Others have linked biologically active demonstrated enzymes like micrococcal nuclease and ococcal nuclease to TFO and site—specific cleavage of DNA (Pei et al., Proc Nat’l Acad Sci USA. 87:9858—9862, 1990; Landgraf et al., Biochemistry 33:10607—10615, 1994). Furthermore, site—directed DNA damage and mutagenesis can be achieved using TFO conjugated to either psoralen (Havre et al., Proc Nat’l Acad Sci USA. 9—7883, 1993; Takasurgi et al., Proc Natl Acad Sci U.S.A. 2—5606, 1991) or alkylating agents (Belousov et al., Nucleic Acids Res 25:3440—3444, 1997; Posvic eta1., J Am Chem Soc 112:9428-9430, 1990).

PCT/U82014/029566 WIPO Patent Application WO/2001/025460 describes methods for mutating a target DNA sequence of a plant that include the steps of (l) electroporating into a microspore of the plant a recombinagenic oligonucleobase that contains a first gous region that has a sequence identical to the sequence of at least 6 base pairs of a first fragment of the target DNA sequence and a second homologous region which has a of the sequence identical to the sequence of at least 6 base pairs of a second fragment target DNA sequence, and an intervening region which contains at least 1 nucleobase heterologous to the target DNA sequence, which intervening region connects the first homologous region and the second homologous region; (2) culturing the pore to produce an embryo; and (3) producing from the embryo a plant having a on located between the first and second fragments of the target DNA sequence, e. g., by culturing the microspore to produce a somatic embryo and regenerating the plant from the embryo. In s embodiments of the ion, the recombinagenic oligonucleobase is an MDON and each of the homologous regions contains an RNA segment of at least 6 RNA—type nucleotides; the intervening region is at least 3 nucleotides in length; the first and or second RNA segment contains at least 8 contiguous stituted ribonucleotides.

One of the major goals of ical research is the targeted modification of the genome. As noted above, although methods for delivery of genes into mammalian cells are well developed, the frequency of modification and/or gous recombination is limited (Hanson et al., Mol Cell Biol 15:45-51 1995). As a result, the modification of genes is a time consuming process. Numerous methods have been plated or ted to enhance modification and/or recombination between donor and genomic DNA. However, the present techniques often exhibit low rates of modification and/or ination, or istency in the modification and/or recombination rate, thereby hampering research and gene therapy technology.

SUMMARY OF THE INVENTION The present invention provides novel s and compositions for improving the efficiency of the targeting of modifications to specific locations in genomic or other nucleotide sequences. As described hereinafter, nucleic acids which direct specific changes to the genome may be combined with s approaches to enhance the availability of components of the natural repair systems present in the cells being targeted for modification.

PCT/USZOl4/029566 In a first aspect, the ion relates to methods for introducing a gene repair oligonueienbase (GROW-mediated mutation into. a target deoxyribonucleic acid (DNA) cell under ce in a plant cell. The methods comprise, inter alia, culturing the plant conditions that increase one or more cellular DNA repair processes prior to, and/or coincident with, delivery of a GRON into the plant cell; and/or ry of a GRON into the plant cell greater than 55 bases in length, the GRON optionally comprising two or more mutation sites for introduction into the target DNA.

In certain embodiments, the conditions that increase one or more cellular DNA repair ses comprise one or more of: introduction of one or more sites into the GRON or into the plant cell DNA that are s for base excision repair, introduction of one or more sites into the GRON or into the plant cell DNA that are targets for non— homologous end joining, uction of one or more sites into the GRON or into the plant cell DNA that are targets for microhomology—mediated end joining, uction of one or more sites into the GRON or into the plant cell DNA that are targets for homologous recombination, and introduction of one or more sites into the GRON or into the plant cell DNA that are targets for pushing repair.

As described after, GRONs for use in the present invention can comprises one or more of the following alterations from conventional RNA and DNA nucleotides: one or more abasic nucleotides; one or more 8’oxo dA and/or 8’oxo dG nucleotides; a reverse base at the 3’ end thereof; one or more 2’ O—methyl nucleotides; one or more 2’O—methyl RNA nucleotides at the 5’ end thereof, and preferably 2, 3, 4, 5, 6, 7, 8, 9, 10, or more; an intercalating dye; a 5’ terminus cap; a backbone modification selected from the group consisting of a phosphothioate modification, a methyl phosphonate modification, a locked nucleic acid (LNA) PCT/U82014/029566 modification, a O —(2~methoxyethyl) (MOE) modification, a di PS modification, and a peptide nucleic acid (PNA) modification; one or more intrastrand crosslinks; one or more cent dyes conjugated o, eably at the 5’ or 3’ end of the GRON; and one or more bases which increase hybridization energy. This list is not meant to be limiting.

As described after, in certain embodiments GRON quality and conversion efficiency may be ed by synthesizing all or a portion of the GRON using nucleotide multimers, such as dimers, trimers, tetramers, etc improving its purity.

In certain embodiments, the target deoxyribonucleic acid (DNA) sequence is within the plant cell genome. The plant cell may be non-transgenic or transgenic, and the target DNA sequence may be a transgene or an endogenous gene of the plant cell.

In n embodiments, the conditions that increase one or more cellular DNA repair processes comprise introducing one or more compounds which induce single or double DNA strand breaks into the plant cell prior to or coincident with delivering the GRON into the plant cell. Exemplary nds are bed hereinafter.

The methods and compositions described herein are applicable to plants generally. By way of example only, a plant species may be selected from the group consisting of canola, sunflower, corn, tobacco, sugar beet, cotton, maize, wheat, barley, rice, alfafa, barley, sorghum, tomato, mango, peach, apple, pear, strawberry, banana, melon, potato, carrot, lettuce, onion, soy bean, soya spp, sugar cane, pea, chickpea, field pea, faba bean, lentils, turnip, rutabaga, brussel sprouts, lupin, cauliflower, kale, field beans, poplar, pine, eucalyptus, grape, , triticale, alfalfa, rye, oats, turf and forage grasses, flax, oilseed rape, mustard, cucumber, morning glory, balsam, pepper, eggplant, marigold, lotus, cabbage, daisy, carnation, tulip, iris, and lily. These may also apply in whole or in part to all other biological systems including but not limited to ia, fungi and mammalian cells and even their organelles (e.g., mitochondria and chloroplasts).

In certain embodiments, the methods further comprise regenerating a plant having a mutation introduced by the GRON from the plant cell, and may comprise collecting seeds from the plant.

In related aspects, the present invention relates to plant cells comprising a genomic modification introduced by a GRON according to the methods bed herein, a plant sing a genomic modification introduced by a GRON according to the methods described herein, or a seed comprising a genomic ation introduced by a GRON according to the methods described herein.

Other embodiments of the invention will be apparent from the following detailed description, exemplary embodiments, and claims.

BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 depicts BFP to GFP sion mediated by phosphothioate (PS) labeled GRONs g 3 PS moieties at each end of the GRON) and 5'Cy3/ 3'idC labeled GRONs.

Fig. 2 s GRONs sing RNA/DNA, referred to herein as "Okazaki Fragment GRONs." [0022a] Fig 3 depicts the native complex and the chimera reproduced from Cong ez‘ al., (2013) e, Vol. 339 (6120), pp 819—823. [0022b] Fig 4 depicts a schematic of the expression vector for chimeric chNA.

DETAILED DESCRIPTION OF THE ION Developed over the past few years, targeted genetic modification mediated by oligonucleotides has been shown to be a le technique for use in the specific alteration of short stretches ofDNA to create deletions, short insertions, and point mutations. These methods involve DNA pairing/annealing, followed by a DNA repair/recombination event.

First, the nucleic acid s with its complementary strand in the double—stranded DNA in a located process mediated by cellular protein factors. This annealing creates a centrally mismatched base pair (in the case of a point mutation), resulting in a structural perturbation that most likely stimulates the endogenous protein machinery to te the second step in the repair process: site—specific modification of the chromosomal sequence and even their organelles (e.g., mitochondria and chloroplasts). This newly introduced mismatch induces the DNA repair machinery to perform a second repair event, g to the final on of the target site. The present methods improve these methods by providing novel approaches which increase the WC 2014/144951 PCT/USZOI4/029566 bility of DNA repair components, thus increasing the efficiency and reproducibility of gene —mediated modifications to targeted nucleic acids.

Definitions To facilitate understanding of the invention, a number of terms are defined below.

“Nucleic acid sequence,3’ ‘4nucleotide sequence” and “polynucleotide sequence” as used herein refer to an oligonucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin which may be single— or double—stranded, and ent the sense or antisense strand.

As used herein, the terms “oligonucleotides” and “oligomers” refer to a nucleic acid sequence of at least about 10 nucleotides and as many as about 201 nucleotides, preferably about 15 to 30 nucleotides, and more ably about 20—25 nucleotides, which can be used as a probe or amplimer.

The terms “DNA-modifying molecule” and “DNA—modifying reagent” as used herein refer to a molecule which is capable of recognizing and ically binding to a nucleic acid sequence in the genome of a cell, and which is capable of modifying a target nucleotide sequence within the genome, wherein the ition and specific g of the difying molecule to the nucleic acid sequence is protein—independent. The term “protein-independent” as used herein in connection with a difying molecule means that the DNA-modifying molecule does not require the ce and/or activity of a protein and/or enzyme for the recognition of, and/or specific g to, a nucleic acid sequence. DNA—modifying molecules are exemplified, but not limited to triplex g oligonucleotides, peptide nucleic acids, polyamides, and oligonucleotides which are intended to promote gene conversion. The DNA—modifying molecules of the invention are distinguished from the prior art‘s nucleic acid sequences which are used for homologous recombination [Wong & Capecchi, Molec. Cell. Biol. 7:2294—2295, 1987] in that the prior art‘s nucleic acid sequences which are used for homologous recombination are protein-dependent. The term “protein—dependent” as used herein in connection with a molecule means that the molecule requires the presence and/or activity of a protein and/or enzyme for the recognition of, and/or specific binding of the molecule to, a nucleic acid sequence. Methods for determining whether a DNA—modifying le requires the presence and/or activity of a protein and/or enzyme for the recognition of, and/or specific WO 44951 ZOI4/029566 binding to, a nucleic acid sequence are within the skill in the art [see, e. g., Dennis et al.

Nucl. Acids Res. 27:47344742, 1999]. For example, the DNA—modifying molecule may be ted in. vitro with the nucleic acid sequence in the absence of any proteins and/or enzymes. The detection of specific binding between the DNA-modifying molecule and the nucleic acid sequence demonstrates that the difying molecule is protein- independent. On the other hand, the absence of specific binding between the DNA- modifying molecule and the nucleic acid sequence demonstrates that the DNA—modifying molecule is protein-dependent and/or requires additional factors.

“Triplex g oligonucleotide” (TFO) is defined as a sequence of DNA or RNA that is capable of binding in the major grove of a duplex DNA or RNA helix to form a triple helix. Although the TFO is not d to any particular , a red length of the TFO is 200 nucleotides or less, more preferably 100 nucleotides or less, yet more preferably from 5 to 50 nucleotides, even more preferably from 10 to 25 nucleotides, and most preferably from 15 to 25 nucleotides. Although a degree of sequence specificity between the TFO and the duplex DNA is necessary for formation of the triple helix, no particular degree of specificity is ed, as long as the triple helix is capable of forming. se, no specific degree of avidity or affinity between the TF0 and the duplex helix is required as long as the triple helix is capable of forming. While not intending to limit the length of the nucleotide sequence to which the TFO specifically binds in one embodiment, the nucleotide sequence to which the TFO specifically binds is from 1 to 100, more preferably from 5 to 50, yet more ably from 10 to 25, and most preferably from 15 to 25, nucleotides. Additionally, “triple helix” is defined as a double- helical nucleic acid with an oligonucleotide bound to a target sequence within the double— helical nucleic acid, The “double—helical” c acid can be any double—stranded c acid including double—stranded DNA, double—stranded RNA and mixed duplexes of DNA and RNA. The double—stranded nucleic acid is not limited to any particular length. However, in red embodiments it has a length of greater than 500 bp, more preferably r than 1 kb and most preferably greater than about 5 kb. In many applications the double—helical nucleic acid is cellular, genomic nucleic acid. The triplex forming oligonucleotide may bind to the target sequence in a parallel or anti-parallel manner.

“Peptide Nucleic Acids,” “polyamides” or “PNA” are nucleic acids wherein the phosphate backbone is replaced with an N-aminoethylglycine—based polyamide structure. PNAs have a higher affinity for complementary nucleic acids than their l counter parts following the Watson—Crick base—pairing rules. PNAs can form highly stable triple helix ures with DNA of the following stoichiometry: (PNA)2.DNA. gh the peptide c acids and polyamides are not limited to any particular length, a preferred length of the peptide nucleic acids and polyamides is 200 nucleotides or less, more ably 100 nucleotides or less, and most preferably from 5 to 50 nucleotides long. While not intending to limit the length of the nucleotide sequence to which the peptide nucleic acid and polyamide specifically binds, in one embodiment, the nucleotide sequence to which the peptide nucleic acid and polyamide specifically bind is from 1 to 100, more preferably from 5 to 50, yet more preferably from 5 to 25, and most preferably from 5 to 20, nucleotides.

The term “cell” refers to a single cell. The term “cells” refers to a population of cells. The population may be a pure population sing one cell type. Likewise, the population may comprise more than one cell type. In the present invention, there is no limit on the number of cell types that a cell population may comprise.

The term “synchronize” or “synchronized,” when referring to a sample of cells, or “synchronized cells” or “synchronized cell population” refers to a plurality of cells which have been d to cause the population of cells to be in the same phase of the cell cycle. It is not necessary that all of the cells in the sample be synchronized. A small percentage of cells may not be synchronized with the majority of the cells in the sample. A preferred range of cells that are synchronized is between lO—lOO%. A more preferred range is between ISO—100%. Also, it is not ary that the cells be a pure population of a single cell type. More than one cell type may be contained in the sample.

In this regard, only one of cell types may be synchronized or may be in a different phase of the cell cycle as compared to another cell type in the sample.

The term “synchronized cell” when made in reference to a single cell means that the cell has been manipulated such that it is at a cell cycle phase which is different from the cell cycle phase of the cell prior to the manipulation. atively, a “synchronized cell” refers to a cell that has been manipulated to alter (i.e., increase or se) the duration of the cell cycle phase at which the cell was prior to the manipulation when compared to a control cell (e.g., a cell in the absence of the manipulation). 2014/029566 The term “cell cycle” refers to the physiological and morphological ssion of changes that cells undergo when ng (i.e. proliferating). The cell 7) (6 cycle is generally ized to be composed of phases termed “interphase, prophase,” “metaphase,” “anaphase,” and “telophase”. Additionally, parts of the cell cycle may be termed “M is),” “S (synthesis),” “G0,” “G1 (gap 1)” and “G2 (gap2)”.

Furthermore, the cell cycle includes periods of progression that are intermediate to the above named phases.

The term “cell cycle inhibition” refers to the cessation of cell cycle progression in a cell or population of cells. Cell cycle inhibition is usually induced by re of the cells to an agent (chemical, naceous or otherwise) that interferes with aspects of cell physiology to prevent continuation of the cell cycle.

“Proliferation” or “cell growth” refers to the ability of a parent cell to divide into two daughter cells ably thereby resulting in a total increase of cells in the population. The cell population may be in an organism or in a culture apparatus.

The term “capable of modifying DNA” or “DNA modifying means” refers to procedures, as well as endogenous or exogenous agents or reagents that have the ability to induce, or can aid in the induction of, s to the nucleotide sequence of a targeted t of DNA. Such changes may be made by the deletion, addition or substitution of one or more bases on the targeted DNA segment. It is not necessary that the DNA sequence changes confer functional s to any gene encoded by the targeted sequence. Furthermore, it is not necessary that changes to the DNA be made to any particular portion or percentage of the cells.

The term “nucleotide sequence of st” refers to any nucleotide sequence, the manipulation of which may be deemed desirable for any reason, by one of ordinary skill in the art. Such nucleotide sequences include, but are not limited to, coding sequences of structural genes (e. g., reporter genes, selection marker genes, oncogenes, drug resistance genes, growth s, etc), and non—coding regulatory sequences that do not encode an mRNA or protein product (e. g., promoter sequence, enhancer sequence, polyadenylation sequence, termination sequence, regulatory RNAs such as miRNA, etc.).

“Amino acid sequence,’3 Npolypeptide sequence,3’ (4peptide sequence” and “peptide” are used interchangeably herein to refer to a sequence of amino acids.

PCT/USZOl4/029566 “Target sequence,” as used herein, refers to a double-helical nucleic acid comprising a sequence preferably greater than 8 nucleotides in length but less than 201 nucleotides in length. In some embodiments, the target sequence is preferably between 8 to 30 bases. The target sequence, in general, is defined by the nucleotide sequence on one of the strands on the double-helical c acid.

As used herein, a “purine—rich sequence” or “polypurine sequence” when made in reference to a nucleotide sequence on one of the strands of a double—helical nucleic acid sequence is defined as a contiguous sequence of nucleotides wherein greater than 50% of the nucleotides of the target sequence contain a purine base. However, it is preferred that the purine—rich target sequence n greater than 60% purine nucleotides, more preferably greater than 75% purine nucleotides, next most preferably greater than 90% purine nucleotides and most preferably 100% purine nucleotides.

As used herein, a “pyrimidine-rich sequence” or “polypyrimidine sequence” when made in reference to a nucleotide sequence on one of the strands of a —helical nucleic acid ce is defined as a contiguous sequence of tides n greater that 50% of the nucleotides of the target ce contain a pyrimidine base. However, it is preferred that the pyrimidine—rich target sequence contain r than 60% pyrimidine nucleotides and more preferably greater than 75% pyrimidine nucleotides. In some ments, the sequence contains preferably greater than 90% pyrimidine nucleotides and, in other embodiments, is most ably 100% pyrimidine nucleotides.

A “variant” of a first nucleotide sequence is defined as a nucleotide sequence which differs from the first nucleotide sequence (e. g., by having one or more deletions, insertions, or substitutions that may be detected using hybridization assays or using DNA sequencing). Included within this definition is the detection of alterations or cations to the genomic sequence of the first nucleotide sequence. For example, hybridization assays may be used to detect (1) alterations in the pattern of restriction enzyme fragments capable of hybridizing to the first nucleotide sequence when comprised in a genome (i.e., RFLP analysis), (2) the ity of a selected portion of the first nucleotide sequence to hybridize to a sample of genomic DNA which contains the first nucleotide sequence (e.g., using allele-specific oligonucleotide ), (3) er or unexpected ization, such as hybridization to a locus other than the normal chromosomal locus for the first tide sequence (e. g., using fluorescent in situ ZOI4/029566 hybridization (FISH) to metaphase chromosomes s, etc). One example of a variant is a mutated wild type sequence.

The terms “nucleic acid” and “unmodified nucleic acid” as used herein refer to any one of the known four deoxyribonucleic acid bases (i.e., guanine, adenine, cytosine, and e). The term “modified nucleic acid” refers to a nucleic acid whose structure is altered relative to the structure of the unmodified nucleic acid. Illustrative of such modifications would be replacement covalent modifications of the bases, such as tion of amino and ring nitrogens as well as saturation of double bonds.

As used herein, the terms “mutation” and ication” and grammatical equivalents thereof when used in reference to a nucleic acid sequence are used interchangeably to refer to a deletion, insertion, substitution, strand break, and/or introduction of an adduct. A “deletion” is defined as a change in a nucleic acid sequence in which one or more tides is absent. An “insertion” or “addition” is that change in a nucleic acid sequence which has ed in the addition of one or more nucleotides. A “substitution” results from the replacement of one or more tides by a molecule which is a different molecule from the replaced one or more nucleotides. For e, a nucleic acid may be replaced by a different c acid as exemplified by replacement of a e by a cytosine, adenine, guanine, or uridine. Pyrimidine to pyrimidine (e. g. C to T or T to C nucleotide substitutions) or purine to purine (e.g. G to A or A to G nucleotide substitutions) are termed transitions, whereas pyrimidine to purine or purine to pyrimidine (e. g. G to T or G to C or A to T or A to C) are termed transversions. Alternatively, a nucleic acid may be replaced by a modified nucleic acid as exemplified by ement of a thymine by thymine glycol. Mutations may result in a mismatch. The term tch” refers to a non—covalent interaction between two nucleic acids, each nucleic acid residing on a different polynucleic acid sequence, which does not follow the base—pairing rules.

For example, for the partially complementary ces 5’-AGT—3’ and 5’-AAT—3’, a GA mismatch (a transition) is present. The terms “introduction of an adduct” or “adduct formation” refer to the covalent or non~c0valent linkage of a molecule to one or more nucleotides in a DNA sequence such that the linkage results in a reduction (preferably from 10% to 100%, more preferably from 50% to 100%, and most preferably from 75% to 100%) in the level of DNA replication and/or ription.

The term “strand break” when made in reference to a double stranded nucleic acid sequence includes a single—strand break and/or a double—strand break. A single— PCT/USZOI4/029566 strand break (a nick) refers to an interruption in one of the two s of the double stranded c acid sequence. This is in contrast to a double—strand break which refers to an interruption in both strands of the double stranded nucleic acid sequence. Strand breaks may be introduced into a double ed nucleic acid sequence either directly (e. g., by ionizing ion or treatment with certain chemicals) or indirectly (e.g., by enzymatic incision at a nucleic acid base).

The terms “mutant cell” and “modified cell” refer to a cell which contains at least one modification in the cell‘s genomic sequence.

The term “portion” when used in reference to a nucleotide sequence refers to fragments of that tide ce. The nts may range in size from 5 nucleotide residues to the entire nucleotide sequence minus one nucleic acid e.

DNA molecules are said to have “5’ ends” and “3’ ends” because mononucleotides are reacted to make oligonucleotides in a manner such that the 5’ phosphate of one mononucleotide pentose ring is attached to the 3’ oxygen of its neighbor in one direction via a phosphodiester linkage. Therefore, an end of an oligonucleotide is referred to as the “5’ end” if its 5’ phosphate is not linked to the 3’ oxygen of a mononucleotide pentose ring. An end of an ucleotide is referred to as the “3’ end” if its 3’ oxygen is not linked to a 5’ phosphate of another mononucleotide pentose ring.

As used herein, a nucleic acid sequence, even if internal to a larger oligonucleotide, also may be said to have 5’ and 3’ ends. In either a linear or circular DNA molecule, discrete elements are ed to as being “upstream” or 5' of the “downstream” or 3’ elements.

This terminology reflects that transcription proceeds in a 5’ to 3’ direction along the DNA strand. The promoter and enhancer elements which direct transcription of a linked gene are generally located 5’ or upstream of the coding region. However, enhancer elements can exert their effect even when located 3’ of the promoter element and the coding region.

Transcription termination and polyadenylation signals are located 3’ or downstream of the coding region.

The term binant DNA molecule” as used herein refers to a DNA molecule which is comprised of segments of DNA joined together by means of molecular biological techniques.

The term “recombinant protein” or “recombinant polypeptide” as used herein refers to a protein le which is expressed using a recombinant DNA molecule.

PCT/U82014/029566 As used herein, the terms “vector” and “vehicle” are used interchangeably in reference to nucleic acid molecules that transfer DNA segment(s) from one cell to another.

The terms “in le combination,9’ C"in operable order” and “operably linked” as used herein refer to the linkage of nucleic acid sequences in such a manner that a nucleic acid molecule capable of ing the transcription of a given gene and/or the synthesis of a desired protein molecule is produced The terms also refer to the linkage of amino acid sequences in such a manner so that a functional protein is produced.

The term “transfection” as used herein refers to the introduction of foreign DNA into cells. Transfection may be accomplished by a variety of means known to the art including calcium phosphate-DNA co—precipitation, DEAE—dextran—mediated transfection, polybrene~mediated transfection, electroporation, microinjection, liposome fusion, lipofectin, protoplast fusion, retroviral ion, biolistics (i.e., particle bombardment) and the like.

As used herein, the terms ementary” or “complementarity” are used in reference to “polynucleotides” and “oligonucleotides” (which are interchangeable terms that refer to a sequence of nucleotides) related by the base—pairing rules. For example, the sequence GT—3’,” is complementary to the ce “5’—ACTG~3’.” Complementarity can be “partia ” or “tota ”. “Partial” complementarity is where one or more nucleic acid bases is not matched according to the base pairing rules. “Total” or “complete” mentarity between nucleic acids is where each and every c acid base is matched with another base under the base pairing rules. The degree of complementarity between nucleic acid strands may have significant effects on the efficiency and strength of hybridization between nucleic acid strands. This may be of particular importance in amplification ons, as well as detection methods which depend upon binding between nucleic acids. For the sake of ience, the terms “polynucleotides” and “oligonucleotides” include molecules which include nucleosides.

The terms ogy” and “homologous” as used herein in reference to tide sequences refer to a degree of mentarity with other nucleotide When sequences. There may be partial homology or complete homology (i.e., ty). used in reference to a double-stranded nucleic acid sequence such as a cDNA or genomic clone, the term “substantially homologous” refers to any nucleic acid sequence (e.g., probe) which can ize to either or both s of the double—stranded nucleic acid sequence under conditions of low stringency as described above. A nucleotide sequence which is partially complementary, i.e., “substantially homologous,” to a nucleic acid sequence is one that at least lly inhibits a completely complementary sequence from hybridizing to a target nucleic acid sequence The inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or Northern blot, solution hybridization and the like) under conditions of low stringency. A ntially homologous sequence or probe will e for and inhibit the binding (i.e., the hybridization) of a completely homologous sequence to a target sequence under conditions of low stringency. This is not to say that ions of low stringency are such that non-specific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction. The absence of non—specific binding may be tested by the use of a second target sequence which lacks even a partial degree of complementarity (e. g., less than about 30% identity); in the absence of non—specific binding the probe will not hybridize to the second mplementary target.

Low stringency conditions comprise conditions equivalent to binding or hybridization at 68° C. in a solution consisting of SXSSPE (43.8 g/l NaCl, 6.9 g/l NaHZPO4-HZO and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.1% SDS, 5x Denhardt's reagent (50X Denhardt‘s ns per 500 ml: 5 g Ficoll (Type 400, Pharmacia), 5 g BSA (Fraction V; Sigma» and 100 ug/ml denatured salmon sperm DNA followed by washing in a solution comprising 2.0xSSPE, 0.1% SDS at room ature when a probe of about 100 to about 1000 nucleotides in length is employed.

In addition, conditions which promote hybridization under conditions of high stringency (e. g., increasing the ature of the hybridization and/or wash steps, the use of formamide in the hybridization on, etc.) are well known in the art. High stringency conditions, when used in reference to nucleic acid hybridization, comprise conditions equivalent to binding or hybridization at 68°C. in a solution consisting of SXSSPE, 1% SDS, SXDenhardt's reagent and 100 ug/ml denatured salmon sperm DNA followed by g in a solution comprising 0.l><SSPE and 0.1% SDS at 68°C. when a probe of about 100 to about 1000 nucleotides in length is employed.

It is well known in the art that us equivalent conditions may be employed to comprise low stringency conditions; factors such as the length and nature PCT/USZOI4/029566 (DNA, RNA, base composition) of the probe and nature of the target (DNA, RNA, base ition, present in solution or immobilized, etc.) and the tration of the salts and other components (e.g., the presence or absence of formamide, dextran sulfate, polyethylene glycol), as well as components of the hybridization solution may be varied to generate conditions of low stringency hybridization different from, but equivalent to, the above listed conditions.

The term “equivalent” when made in reference to a hybridization condition as it relates to a hybridization condition of interest means that the hybridization condition and the hybridization condition of interest result in hybridization of nucleic acid sequences which have the same range of percent (%) homology. For example, if a hybridization condition of interest s in hybridization of a first nucleic acid sequence with other c acid sequences that have from 50% to 70% homology to the first nucleic acid sequence, then another hybridization condition is said to be lent to the hybridization condition of interest if this other hybridization condition also results in hybridization of the first nucleic acid sequence with the other nucleic acid sequences that have from 50% to 70% homology to the first nucleic acid sequence.

As used herein, the term “hybridization” is used in reference to the pairing of mentary nucleic acids using any process by which a strand of nucleic acid joins with a complementary strand through base pairing to form a hybridization complex.

Hybridization and the th of hybridization (i.e., the strength of the association between the nucleic acids) is ed by such factors as the degree of complementarity between the nucleic acids, stringency of the conditions involved, the Tm of the formed hybrid, and the G:C ratio within the nucleic acids.

As used herein the term “hybridization complex” refers to a complex formed between two nucleic acid sequences by virtue of the formation of hydrogen bounds between complementary G and C bases and between complementary A and T bases; these en bonds may be further stabilized by base stacking ctions. The two complementary nucleic acid sequences hydrogen bond in an rallel configuration. A hybridization x may be formed in solution (e.g., Cot or Rot analysis) or between one c acid sequence present in solution and r nucleic acid sequence immobilized to a solid support (e.g., a nylon membrane or a nitrocellulose filter as employed in rn and Northern blotting, dot blotting or a glass slide as employed in in situ hybridization, including FISH (fluorescent in situ hybridization».

As used herein, the term “Tm” is used in reference to the “melting temperature.” The melting temperature is the temperature at which a population of double—stranded nucleic acid les becomes half iated into single strands. The equation for calculating the Tm of c acids is well known in the art. As indicated by standard references, a simple estimate of the Tm value may be calculated by the equation: Tm=8l.5+0.4l(% G+C), when a nucleic acid is in aqueous on at l M NaCl (see e.g., on and Young, tative Filter Hybridization, in Nucleic Acid Hybridization,1985). Other references include more sophisticated computations which take structural as well as sequence characteristics into account for the calculation of T111.

As used herein the term “stringency” is used in nce to the conditions of temperature, ionic strength, and the presence of other compounds such as organic solvents, under which nucleic acid hybridizations are conducted. “Stringency” lly occurs in a range from about Tm°C. to about 20°C. to 25 OC. below Tm. As will be understood by those of skill in the art, a ent ization can be used to identify or detect identical polynucleotide sequences or to fy or detect similar or related polynucleotide sequences.

The terms “specific binding,” “binding specificity,” and grammatical equivalents thereof when made in reference to the binding of a first nucleotide sequence to a second nucleotide sequence, refer to the preferential interaction between the first nucleotide sequence with the second nucleotide sequence as compared to the interaction between the second nucleotide sequence with a third tide sequence. Specific binding is a ve term that does not require absolute specificity of binding; in other words, the term “specific binding” does not require that the second nucleotide sequence interact with the first nucleotide sequence in the absence of an interaction n the second nucleotide sequence and the third nucleotide sequence. Rather, it is ient that the level of interaction between the first nucleotide sequence and the second nucleotide sequence is greater than the level of interaction between the second nucleotide sequence with the third nucleotide sequence. “Specific binding” of a first nucleotide sequence with a second nucleotide sequence also means that the interaction between the first nucleotide sequence and the second nucleotide sequence is dependent upon the presence of a particular structure on or within the first nucleotide sequence; in other words the second nucleotide sequence is recognizing and binding to a specific structure on or within the first nucleotide sequence rather than to nucleic acids or to nucleotide sequences in PCT/U82014/029566 general. For e, if a second tide sequence is specific for structure “A” that is on or within a first nucleotide sequence, the presence of a third nucleic acid sequence containing ure A will reduce the amount of the second nucleotide sequence which is bound to the first nucleotide sequence.

As used herein, the term “amplifiable nucleic acid” is used in reference to nucleic acids which may be amplified by any ication method. It is contemplated that “amplifiable nucleic acid” will usually comprise e template.” The terms “heterologous nucleic acid sequence” or ologous DNA” are used interchangeably to refer to a nucleotide sequence which is ligated to a nucleic acid sequence to which it is not ligated in nature, or to which it is ligated at a different location in nature. Heterologous DNA is not endogenous to the cell into which it is introduced, but has been obtained from another cell. Generally, although not necessarily, such heterologous DNA encodes RNA and proteins that are not normally produced by the cell into which it is expressed. Examples of heterologous DNA e reporter genes, transcriptional and translational regulatory sequences, selectable marker proteins (e.g., proteins which confer drug resistance), etc.

“Amplification” is defined as the production of additional copies of a c acid sequence and is generally carried out using polymerase chain reaction logies well known in the art (Dieffenbach C W and G S Dveksler (1995) PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview, N.Y.). As used , the term “polymerase chain reaction” (“PCR”) refers to the method of K. B. Mullis US. Pat.

Nos. 4,683,195, and 4,683,202, hereby incorporated by reference, which describe a method for increasing the concentration of a segment of a target ce in a mixture of genomic DNA without cloning or purification. The length of the amplified segment of the desired target sequence is determined by the ve positions of two ucleotide primers with respect to each other, and therefore, this length is a controllable parameter.

By Virtue of the repeating aspect of the process, the method is referred to as the “polymerase chain reaction” (hereinafter “PCR”). Because the desired amplified segments of the target sequence become the predominant sequences (in terms of concentration) in the mixture, they are said to be “PCR amplified.” With PCR, it is possible to amplify a single copy of a specific target sequence in genomic DNA to a level detectable by l different methodologies (e.g., PCT/U82014/029566 hybridization with a labeled probe; incorporation of biotinylated s followed by avidin—enzyme conjugate detection; incorporation of 32P—labeled deoxynucleotide triphosphates, such as dCTP or dATP, into the amplified segment). In addition to genomic DNA, any oligonucleotide sequence can be amplified with the appropriate set of primer molecules. In particular, the ied segments created by the PCR process itself are, themselves, efficient templates for subsequent PCR ications.

One such preferred method, particularly for commercial applications, is based on the widely used TaqMan® real-time PCR logy, and combines —Specific PCR with a Blocking reagent (ASB-PCR) to suppress ication of the wildype allele.

ASB-PCR can be used for ion of germ line or somatic mutations in either DNA or RNA extracted from any type of tissue, including formalin-fixed paraffin—embedded tumor specimens. A set of reagent design rules are developed enabling sensitive and selective detection of single point substitutions, insertions, or ons against a background of ype allele in thousand—fold or greater excess. (Morlan J, Baker J, opi D Mutation Detection by Real—Time PCR: A Simple, Robust and Highly Selective Method. PLoS ONE 4(2): e4584, 2009) The terms “reverse transcription polymerase chain reaction” and “RT—PCR” refer to a method for reverse transcription of an RNA sequence to generate a mixture of cDNA sequences, ed by increasing the concentration of a desired segment of the transcribed cDNA sequences in the mixture without cloning or purification. lly, RNA is e transcribed using a single primer (e. g., an oligo—dT primer) prior to PCR amplification of the desired segment of the transcribed DNA using two primers.

As used herein, the term “primer” refers to an oligonucleotide, whether ing naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, (i.e., in the presence of nucleotides and of an inducing agent such as DNA polymerase and at a suitable temperature and pH). The primer is preferably single stranded for maximum efficiency in amplification, but may alternatively be double stranded. If double stranded, the primer is first treated to te its strands before being used to prepare extension products. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the ng agent. The exact lengths of the primers PCT/USZOI4/029566 will depend on many factors, including temperature, source of primer and the use of the method.

As used herein, the term “probe” refers to an oligonucleotide (i.e., a sequence of nucleotides), whether occurring naturally as in a purified restriction digest or produced synthetically, recombinantly or by PCR amplification, which is e of hybridizing to another ucleotide of interest. A probe may be single—stranded or double-stranded.

Probes are useful in the detection, identification and isolation of ular gene sequences. It is contemplated that any probe used in the present invention will be d with any ter molecule,” so that it is detectable in any detection system, including, but not limited to enzyme (e. g., ELISA, as well as enzyme~based histochemical assays), fluorescent, ctive, and luminescent systems. It is not intended that the present invention be limited to any particular detection system or label.

As used herein, the terms “restriction endonucleases” and “restriction enzymes” refer to bacterial enzymes, each of which cut or nick double or single—stranded DNA at or near a specific tide sequence, for example, an endonuclease domain of a type HS restriction endonuclease (e. g., Fold) can be used, as taught by Kim et al., 1996, Proc. Nat’l. Acad. Sci. USA, 6:1 156-60).

As used herein, the term “an oligonucleotide having a nucleotide sequence encoding a gene” means a nucleic acid sequence comprising the coding region of a gene, i.e. the nucleic acid ce which encodes a gene product. The coding region may be t in either a CDNA, genomic DNA or RNA form. When present in a DNA form, the oligonucleotide may be single—stranded (i.e., the sense strand) or double—stranded.

Additionally “an ucleotide having a nucleotide sequence encoding a gene” may include suitable control elements such as enhancers, ers, splice junctions, polyadenylation signals, etc. if needed to permit proper initiation of transcription and/or correct processing of the y RNA ript. Further still, the coding region of the present invention may contain endogenous enhancers, splice junctions, intervening sequences, polyadenylation signals, etc.

Transcriptional control signals in eukaryotes comprise “enhancer” elements.

Enhancers consist of short arrays of DNA sequences that interact specifically with cellular proteins involved in transcription (Maniatis, T. et al., Science 236: 1237, 1987).

Enhancer ts have been isolated from a variety of eukaryotic sources including genes in plant, yeast, insect and mammalian cells and s. The selection of a ular enhancer depends on what cell type is to be used to express the protein of interest.

The presence of “splicing signals” on an expression vector often results in higher levels of expression of the recombinant transcript. Splicing signals mediate the removal of introns from the primary RNA transcript and consist of a splice donor and acceptor site (Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, New York, pp. 16.7—16.8, 1989). A commonly used splice donor and acceptor site is the splice junction from the 168 RNA of SV40.

Efficient expression of recombinant DNA sequences in eukaryotic cells requires expression of signals directing the efficient termination and polyadenylation of the resulting transcript. Transcription termination s are generally found downstream of the polyadenylation signal and are a few hundred nucleotides in length.

The term “poly A site” or “poly A ce” as used herein denotes a DNA ce which s both the termination and enylation of the t RNA transcript.

Efficient polyadenylation of the recombinant transcript is desirable as transcripts lacking a poly A tail are unstable and are rapidly degraded. The poly A signal utilized in an expression vector may be “heterologous” or “endogenous.” An endogenous poly A signal is one that is found naturally at the 3’ end of the coding region of a given gene in the genome. A heterologous poly A signal is one which is isolated from one gene and placed 3’ of another gene.

The term “promoter,” ter element” or “promoter sequence” as used herein, refers to a DNA sequence which when placed at the 5’ end of (Le, precedes) an oligonucleotide sequence is capable of controlling the transcription of the oligonucleotide sequence into mRNA. A promoter is typically located 5' (i.e., upstream) of an oligonucleotide sequence whose transcription into mRNA it controls, and provides a site for specific binding by RNA polymerase and for initiation of transcription.

The term “promoter activity” when made in nce to a nucleic acid sequence refers to the ability of the nucleic acid sequence to initiate transcription of an oligonucleotide ce into mRNA.

The term “tissue specific” as it applies to a promoter refers to a promoter that is capable of ing selective expression of an oligonucleotide sequence to a specific W0 2014/144951 PCT/USZOl4/029566 type of tissue in the relative absence of expression of the same oligonucleotide in a ent type of . Tissue specificity of a promoter may be evaluated by, for example, operably linking a reporter gene to the promoter sequence to generate a er construct, introducing the reporter construct into the genome of a plant or an animal such that the reporter construct is integrated into every tissue of the resulting transgenic animal, and detecting the expression of the reporter gene (e.g., detecting mRNA, protein, or the activity of a protein d by the reporter gene) in different tissues of the transgenic plant or . Selectivity need not be absolute. The detection of a greater level of expression of the reporter gene in one or more s relative to the level of expression of the reporter gene in other tissues shows that the promoter is ic for the tissues in which greater levels of expression are detected.

The term “cell type specific” as applied to a promoter refers to a promoter which is capable of ing selective expression of an oligonucleotide sequence in a specific type of cell in the relative absence of expression of the same oligonucleotide sequence in a ent type of cell within the same tissue. The term “cell type specific” when applied to a er also means a promoter capable of promoting selective expression of an oligonucleotide in a region within a single . Again, selectivity need not be absolute. Cell type specificity of a promoter may be assessed using methods well known in the art, e. g., immunohistochemical staining as described herein. Briefly, tissue sections are embedded in in, and paraffin sections are reacted with a primary antibody which is specific for the polypeptide product encoded by the oligonucleotide sequence whose expression is controlled by the promoter. As an alternative to paraffin ning, samples may be cryosectioned. For example, sections may be frozen prior to and during sectioning thus avoiding potential interference by residual paraffin. A labeled (e.g., peroxidase conjugated) secondary dy which is specific for the primary antibody is allowed to bind to the sectioned tissue and specific g detected (e.g., with avidin/biotin) by microscopy.

The terms “selective expression, 9’ (Gselectively express” and grammatical equivalents thereof refer to a comparison of relative levels of expression in two or more regions of interest. For example, “selective expression” when used in connection with tissues refers to a ntially r level of expression of a gene of interest in a particular tissue, or to a substantially greater number of cells which express the gene within that tissue, as compared, respectively, to the level of expression of, and the number of cells sing, the same gene in another tissue (i.e., selectivity need not be absolute).

Selective expression does not require, although it may include, expression of a gene of interest in a particular tissue and a total absence of expression of the same gene in r . Similarly, “selective expression” as used herein in reference to cell types refers to a substantially r level of expression of, or a ntially greater number of cells which express, a gene of interest in a particular cell type, when compared, respectively, to the expression levels of the gene and to the number of cells sing the gene in another cell type.

The term “contiguous” when used in reference to two or more nucleotide sequences means the nucleotide sequences are ligated in tandem either in the absence of intervening sequences, or in the presence of intervening sequences which do not comprise one or more control elements.

As used herein, the terms ic acid molecule encoding,7’ eotide encoding,” “DNA sequence encoding” and “DNA encoding” refer to the order or sequence of deoxyribonucleotides along a strand of deoxyribonucleic acid. The order of these deoxyribonucleotides determines the order of amino acids along the polypeptide (protein) chain. The DNA sequence thus codes for the amino acid sequence.

The term “isolated” when used in relation to a nucleic acid, as in “an isolated oligonucleotide” refers to a nucleic acid sequence that is separated from at least one contaminant nucleic acid with which it is ordinarily associated in its natural source.

Isolated nucleic acid is nucleic acid present in a form or setting that is different from that in which it is found in nature. In contrast, olated nucleic acids are nucleic acids such as DNA and RNA which are found in the state they exist in nature. For example, a given DNA sequence (e.g., a gene) is found on the host cell chromosome in proximity to neighboring genes; RNA sequences, such as a ic mRNA sequence encoding a specific protein, are found in the cell as a mixture with numerous other mRNAs which encode a multitude of proteins. However, isolated nucleic acid encoding a polypeptide of interest includes, by way of example, such c acid in cells ordinarily expressing the polypeptide of interest where the c acid is in a chromosomal or hromosomal location different from that of natural cells, or is otherwise flanked by a different nucleic acid sequence than that found in nature. The isolated nucleic acid or oligonucleotide may be t in single~stranded or double-stranded form. Isolated nucleic acid can be readily identified (if desired) by a variety of techniques (e.g., hybridization, dot blotting, W0 2014/144951 etc). When an isolated nucleic acid or oligonucleotide is to be utilized to express a protein, the oligonucleotide will contain at a minimum the sense or coding strand (i.e., the oligonucleotide may be single—stranded). Alternatively, it may n both the sense and anti-sense strands (i.e., the oligonucleotide may be double—stranded).

As used herein, the term “purified” or “to purify” refers to the removal of one or more (undesired) components from a sample. For example, where recombinant polypeptides are expressed in bacterial host cells, the ptides are purified by the removal of host cell ns thereby increasing the percent of recombinant ptides in the sample.

As used herein, the term antially purified” refers to molecules, either nucleic or amino acid sequences, that are removed from their natural nment, isolated or separated, and are at least 60% free, preferably 75% free and more preferably 90% free from other components with which they are naturally associated. An “isolated polynucleotide” is, ore, a ntially purified polynucleotide.

As used herein the term “coding region” when used in reference to a structural gene refers to the nucleotide sequences which encode the amino acids found in the nascent polypeptide as a result of translation of a mRNA le. The coding region is bounded, in eukaryotes, on the 5’ side generally by the nucleotide t “ATG” which encodes the initiator methionine and on the 3’ side by one of the three triplets which specify stop codons (i.e., TAA, TAG, TGA).

By "coding sequence" is meant a sequence of a nucleic acid or its complement, or a part thereof, that can be transcribed and/or translated to produce the mRNA for and/or the polypeptide or a nt thereof. Coding sequences include exons in a genomic DNA or immature y RNA transcripts, which are joined together by the cell's biochemical machinery to provide a mature mRNA. The anti-sense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom.

By "non~coding sequence" is meant a sequence of a nucleic acid or its complement, or a part thereof that is not transcribed into amino acid in Vivo, or where tRNA does not interact to place or attempt to place an amino acid. Non-coding sequences include both intron sequences in genomic DNA or immature primary RNA ripts, and gene—associated sequences such as promoters, enhancers, silencers, etc.

PCT/U82014/029566 As used herein, the term “structural gene” or “structural nucleotide sequence” refers to a DNA sequence coding for RNA or a protein which does not control the expression of other genes. In contrast, a “regulatory gene” or “regulatory sequence” is a structural gene which encodes products (e. g., transcription factors) which control the expression of other genes.

As used herein, the term “regulatory element” refers to a genetic element which controls some aspect of the expression of nucleic acid sequences. For example, a promoter is a regulatory element which facilitates the initiation of transcription of an operany linked coding region. Other regulatory ts e splicing s, polyadenylation s, ation signals, etc.

As used herein, the term “peptide transcription factor binding site” or “transcription factor binding site” refers to a nucleotide sequence which binds protein transcription factors and, thereby, controls some aspect of the expression of nucleic acid sequences. For example, Sp—l and APl (activator protein 1) binding sites are examples of peptide transcription factor binding sites.

As used herein, the term “gene” means the deoxyribonucleotide ces sing the coding region of a structural gene. A “gene” may also e non- translated sequences located adjacent to the coding region on both the 5’ and 3’ ends such that the gene corresponds to the length of the full-length mRNA. The sequences which are located 5’ of the coding region and which are present on the mRNA are referred to as ’ non-translated sequences. The sequences which are located 3’ or downstream of the coding region and which are present on the mRNA are referred to as 3’ non—translated sequences. The term “gene” encompasses both cDNA and genomic forms of a gene. A genomic form or clone of a gene contains the coding region interrupted with non—coding sequences termed ns” or “intervening regions” or “intervening sequences.” Introns are segments of a gene which are transcribed into heterogenous nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or “spliced out” from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) ript. The mRNA functions during translation to specify the ce or order of amino acids in a nascent polypeptide.

In addition to containing s, genomic forms of a gene may also include ces located on both the 5’ and 3’ end of the sequences which are present on the PCT/U82014/029566 RNA transcript. These sequences are ed to as “flanking” ces or regions (these flanking sequences are located 5’ or 3’ to the non—translated sequences present on the mRNA transcript). The 5’ g region may contain regulatory sequences such as promoters and enhancers which control or nce the transcription of the gene. The 3’ flanking region may contain sequences which direct the termination of transcription, post- transcriptional cleavage and polyadenylation.

A “non—human animal” refers to any animal which is not a human and includes vertebrates such as rodents, man primates, ovines, bovines, ruminants, rphs, porcines, caprines, equines, canines, felines, aves, etc. Preferred non-human animals are selected from the order Rodentia. “Non—human animal” additionally refers to amphibians (e.g. Xenopus), reptiles, insects (e.g. Drosophila) and other non-mammalian animal species.

As used herein, the term “transgenic” refers to an sm or cell that has DNA derived from another organism inserted into which becomes integrated into the genome either of somatic and/or germ line cells of the plant or animal. A “transgene” means a DNA sequence which is partly or entirely heterologous (i.e., not present in nature) to the plant or animal in which it is found, or which is homologous to an endogenous sequence (Le, a sequence that is found in the animal in nature) and is inserted into the plant’ or animal's genome at a location which differs from that of the naturally occurring ce. enic plants or animals which include one or more enes are within the scope of this invention. Additionally, a “transgenic” as used herein refers to an animal that has had one or more genes ed and/or “knocked out” (made non—functional or made to function at reduced level, Le, a “knockout” mutation) by the invention‘s methods, by homologous recombination, TFO mutation or by similar processes. For example, in some embodiments, a transgenic organism or cell includes inserted DNA that includes a foreign promoter and/or coding region.

A formed cell” is a cell or cell line that has acquired the ability to grow in cell culture for multiple generations, the ability to grow in soft agar, and/or the y to not have cell growth ted by o-cell contact. In this regard, transformation refers to the introduction of foreign genetic material into a cell or organism.

Transformation may be accomplished by any method known which permits the successful introduction of nucleic acids into cells and which results in the expression of the introduced nucleic acid. “Transformation” includes but is not limited to such methods as PCT/U82014/029566 transfection, microinjection, oporation, nucleofection and lipofection (liposome— ed gene transfer). Transformation may be accomplished through use of any expression vector. For example, the use of baculovirus to introduce foreign nucleic acid into insect cells is contemplated. The term “transformation” also includes methods such as P—element mediated germline transformation of whole insects. Additionally, transformation refers to cells that have been transformed naturally, usually through genetic mutation.

As used herein “exogenous” means that the gene encoding the protein is not ly expressed in the cell. Additionally, “exogenous” refers to a gene transfected into a cell to augment the normal (i.e. natural) level of expression of that gene.

A peptide sequence and nucleotide sequence may be “endogenous” or “heterologous” (i.e., gn”). The term enous” refers to a sequence which is naturally found in the cell into which it is introduced so long as it does not contain some modification relative to the naturally-occurring sequence. The term “heterologous” refers to a sequence which is not endogenous to the cell into which it is uced. For example, heterologous DNA includes a nucleotide ce which is ligated to, or is manipulated to become ligated to, a nucleic acid sequence to which it is not ligated in nature, or to which it is ligated at a different location in nature. Heterologous DNA also includes a nucleotide ce which is naturally found in the cell into which it is introduced and which contains some modification relative to the lly—occurring sequence. Generally, although not necessarily, heterologous DNA encodes heterologous RNA and heterologous proteins that are not normally produced by the cell into which it is introduced. Examples of heterologous DNA include reporter genes, transcriptional and translational regulatory sequences, DNA sequences which encode selectable marker proteins (e.g., proteins which confer drug resistance), etc. ucts The nucleic acid molecules disclosed herein (e.g., site specific nucleases, or guide RNA for CRISPRs) can be used in the production of inant nucleic acid constructs. In one embodiment, the nucleic acid molecules of the present disclosure can be used in the preparation of nucleic acid constructs, for example, sion cassettes for expression in the plant of interest. This expression may be transient for instance when the construct is not integrated into the host genome or ined under the control offered PCT/USZOI4/029566 by the promoter and the position of the construct within the host’s genome if it becomes integrated.

Expression cassettes may include regulatory sequences ly linked to the site specific nuclease or guide RNA sequences sed herein. The cassette may additionally contain at least one additional gene to be co—transformed into the organism.

Alternatively, the additional gene(s) can be provided on multiple expression cassettes.

The nucleic acid constructs may be provided with a plurality of restriction sites for insertion of the site specific nuclease coding sequence to be under the transcriptional regulation of the regulatory regions. The nucleic acid constructs may additionally contain nucleic acid molecules encoding for selectable marker genes.

Any promoter can be used in the production of the nucleic acid constructs.

The promoter may be native or ous, or n or heterologous, to the plant host c acid sequences disclosed herein. Additionally, the promoter may be the natural sequence or alternatively a synthetic sequence. Where the promoter is “foreign” or “heterologous” to the plant host, it is intended that the promoter is not found in the native plant into which the promoter is introduced. As used herein, a chimeric gene comprises a coding sequence operably linked to a ription initiation region that is heterologous to the coding sequence.

The site directed nuclease ces disclosed herein may be sed using heterologous promoters.

Any promoter can be used in the preparation of constructs to control the expression of the site ed nuclease sequences, such as promoters ing for constitutive, tissue~preferred, inducible, or other promoters for expression in plants.

Constitutive promoters e, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in W0 99/43 838 and U.S. Patent No. 6,072,050; the core CaMV 35S promoter (Odell et al. Nature 313:810-812; 1985); rice actin (McElroy et al., Plant Cell 2:163-171, 1990); ubiquitin (Christensen et al., Plant Mol. Biol. 12:619—632, 1989 and Christensen et al., Plant Mol. Biol. 182675—689, 1992); pEMU (Last et al., Theor. Appl. Genet. 81:581-588, 1991); MAS n et al., EMBO J. 322723—2730, 1984); ALS promoter (US. Patent No. 5,659,026), and the like. Other constitutive promoters include, for example, US. Patent Nos. 149; 144; ,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 142; and 6,177,611.

PCT/USZOl4/029566 Tissue~preferred promoters can be utilized to direct site directed nuclease expression within a particular plant tissue. Such tissue—preferred ers include, but are not limited to, leaf-preferred promoters, root—preferred promoters, seed—preferred ers, and stem-preferred promoters. Tissuetpreferred promoters e Yamamoto et al., Plant J. 12(2):255—265, 1997; Kawamata et al., Plant Cell Physiol. 38(7):792—803, 1997; Hansen et al., Mol. Gen Genet. 254(3):337—343, 1997; Russell et al., Transgenic Res. 6(2):157—168, 1997; Rinehart et al., Plant Physiol. 1 12(3):1331~134l, 1996; Van Camp et al., Plant Physiol. 1 12(2):525-535, 1996; Canevascini et al., Plant Physiol. 112(2): 513—524, 1996; Yamamoto et al., Plant Cell Physiol. 35(5):773—778, 1994; Lam, Results Prob]. Cell Differ. 20:181—196, 1994; Orozco et al. Plant Mol Biol. 23(6):1129~ 1138, 1993; Matsuoka et al., Proc Nat’l. Acad. Sci. USA 90(20):9586- 9590, 1993; and Guevara—Garcia et al., Plant J. 4(3):495~505, 1993.

The nucleic acid constructs may also include ription termination regions.

Where ription ations s are used, any termination region may be used in the preparation of the nucleic acid ucts. For e, the termination region may be derived from another source (i.e., foreign or heterologous to the promoter). Examples of termination regions that are available for use in the constructs of the present disclosure include those from the Ti—plasmid of A. tzmzefaciens, such as the ne synthase and nopaline synthase termination regions. See also Guerineau et al., Mol. Gen. Genet. 1-144, 1991; Proudfoot, Cell 642671-674, 1991; Sanfacon et al., Genes Dev. :141~149, 1991; Mogen et al., Plant Cell 2: 1261—1272, 1990; Munroe et al., Gene 91:151—158, 1990; Ballas et al., Nucleic Acids Res. 17:7891—7903, 1989; and Joshi et al., Nucleic Acid Res. 15:9627—9639, 1987.

In conjunction with any of the aspects, embodiments, methods and/or compositions disclosed herein, the nucleic acids may be optimized for increased expression in the transformed plant. That is, the nucleic acids encoding the site directed nuclease proteins can be synthesized using plant-preferred codons for improved expression. See, for example, Campbell and Gowri, (Plant Physiol. 92: 1-11, 1990) for a discussion of host—preferred codon usage. Methods are available in the art for synthesizing plant-preferred genes. See, for example, US. Patent Nos. 5,380,831, and ,436,391, and Murray et al., Nucleic Acids Res. 17:477—498, 1989.

In addition, other sequence modifications can be made to the nucleic acid sequences sed herein. For example, additional ce modifications are known 2014/029566 to enhance gene expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon/intron splice site signals, transposon-like repeats, and other such well-characterized sequences that may be deleterious to gene expression. The SC content of the sequence may also be adjusted to levels average for a target cellular host, as calculated by reference to known genes expressed in the host cell.

In addition, the sequence can be modified to avoid predicted hairpin secondary mRNA structures.

Other nucleic acid sequences may also be used in the ation of the constructs of the present disclosure, for example to enhance the expression of the site directed nuclease coding sequence. Such nucleic acid sequences include the introns of the maize Adhl, intronl gene (Callis et al., Genes and Development 121183-1200, 1987), and leader sequences, (W-sequence) from the Tobacco Mosaic virus (TMV), Maize Chlorotic Mottle Virus and Alfalfa Mosaic Virus (Gallie et al., Nucleic Acid Res. :8693-871 l, 1987; and Skuzeski et al., Plant Mol. Biol. 15:65—79, 1990). The first intron from the shrunken~l locus of maize has been shown to increase sion of genes in chimeric gene constructs. US. Pat. Nos. 5,424,412 and 874 se the use of specific introns in gene expression constructs, and Gallie et al. (Plant Physiol. 1062929939, 1994) also have shown that introns are useful for regulating gene expression on a tissue specific basis. To further e or to ze site directed se gene sion, the plant expression vectors disclosed herein may also contain DNA sequences containing matrix attachment regions (MARS). Plant cells transformed with such modified expression systems, then, may exhibit overexpression or constitutive expression of a nucleotide sequence of the sure.

The expression constructs disclosed herein can also include nucleic acid sequences capable of directing the expression of the site directed nuclease sequence to the chloroplast. Such nucleic acid sequences include plast targeting sequences that encodes a chloroplast transit peptide to direct the gene product of interest to plant cell plasts. Such transit peptides are known in the art. With respect to chloroplast- targeting sequences, “operably linked” means that the nucleic acid sequence encoding a transit e (i.e., the chloroplast-targeting sequence) is linked to the site directed nuclease nucleic acid molecules sed herein such that the two sequences are contiguous and in the same reading frame. See, for example, Von Heijne et al., Plant Mol. Biol. Rep. 126, 1991; Clark eta1., J. Biol. Chem. 264:17544—17550, 1989; WO 44951 PCT/USZOl4/029566 Della—Cioppa et al., Plant Physiol. 84:965-968, 1987; Romer et al., Biochem. Biophys.

Res. Connnun. 14—1421, 1993; and Shah et al., Science 233:478—481, 1986.

] Chloroplast targeting sequences are known in the art and e the chloroplast small subunit of ribulose—1,5—bisphosphate carboxylase (Rubisco) (de Castro Silva Filho et al., Plant Mol. Biol. 302769480, 1996; Schnell et al., J. Biol. Chem. 266(5):3335-3342, 1991); 5— (enolpyruvyl)shikimate—3phosphate synthase (EPSPS) (Archer eta1., J. Bioenerg. Biomemb. 22(6):789~810, 1990); tryptophan synthase (Zhao et al., J. Biol. Chem. 270(1 1):6081— 6087, 1995); plastocyanin (Lawrence eta1., J. Biol.

Chem. 272(33):20357~20363, 1997); chorismate synthase (Schmidt eta1., J. Biol. Chem. 268(3 6):27447-27457, 1993); and the light harvesting chlorophyll a/b binding protein (LHBP) (Lamppa et al., J. Biol. Chem. 263:14996—14999, 1988). See also Von Heijne et al., Plant Mol. Biol. Rep. 9:104~126, 1991; Clark eta1., J. Biol. Chem. 264:1754447550, 1989; Della—Cioppa et al., Plant Physiol. —968, 1987; Romer eta1., Biochem.

Biophys. Res. Commun. 196:1414—1421, 1993; and Shah et al., Science 233 81, 1986.

] In conjunction with any of the aspects, embodiments, methods and/or compositions disclosed herein, the nucleic acid constructs may be prepared to direct the expression of the mutant site directed se coding sequence from the plant cell chloroplast. Methods for transformation of chloroplasts are known in the art. See, for example, Svab eta1., Proc. Nat’l. Acad. Sci. USA 87:8526-8530, 1990; Svab and Maliga, Proc. Nat’l. Acad. Sci. USA 90:913-917. 1993; Svab and Maliga, EMBO J. 122601—606, 1993. The method relies on particle gun delivery of DNA containing a selectable marker and ing of the DNA to the plastid genome h homologous recombination.

Additionally, plastid transformation can be accomplished by transactivation of a silent plastid-borne transgene by tissue—preferred expression of a nuclear—encoded and plastid— directed RNA polymerase. Such a system has been reported in McBride et al. Proc.

Nat’l. Acad. Sci. USA 91:7301-7305, 1994.

The nucleic acids of interest to be targeted to the chloroplast may be optimized for expression in the chloroplast to account for differences in codon usage between the plant nucleus and this organelle. In this manner, the nucleic acids of interest may be sized using clfloroplast-preferred codons. See, for example, US. Patent No. ,3 , herein incorporated by reference.

PCTfUSZOl4/029566 The nucleic acid constructs can be used to transform plant cells and regenerate transgenic plants comprising the site directed nuclease coding sequences. Numerous plant transformation vectors and methods for transforming plants are available. See, for example, US. Patent No. 6,753,458, An, G. eta1., Plant l, 81 :301—305, 1986; Fry, J. et al., Plant Cell Rep. 6:321—325, 1987; Block, M., Theor. Appl Genet. 76:767—774, 1988; Hinchee et al., Stadler. Genet. 03212.203~212, 1990; Cousins et al., Aust. J.

Plant l. 18:481—494, 1991; Chee, P. P. and Slightom, J. L., 18:255~260, 1992; Christou et al., Trends. Biotechnol. 10:239—246, 1992; uin eta1., Bio/Technol. 10:309-3 14, 1992; Dhir eta1., Plant Physiol. 99:81—88, 1992; Casas et al., Proc. Nat’l. Acad Sci. USA 90:11212—11216, 1993; ou, P., In. Vitro Cell. Dev. lant 29le 19—124, 1993; Davies, et al., Plant Cell Rep. 12:180—183, 1993; Dong, J.

A. and Mc Hughen, A., Plant Sci. -148, 1993; Franklin, C. I. and Trieu, T. N., Plant. Physiol. 102:167, 1993; Golovkin et al., Plant Sci. 90:41-52, 1993; Guo Chin Sci.

Bull. 38:2072—2078; Asano, et al., Plant Cell Rep. 13, 1994; Ayeres N. M. and Park, W.

D., Crit. Rev. Plant. Sci. 13:219—239, 1994; Barcelo eta1., Plant. J. 5:583—592, 1994; Becker, eta1., Plant. J. 307, 1994; Borkowska eta1., Acta. Physiol Plant. 16:225- 230, 1994; Christou, P., Agro. Food. Ind. Hi Tech. 5:17—27, 1994; Eapen et al., Plant Cell Rep. 13:582—586, 1994; Hartman et al., Bio-Technology 12:919923, 1994; Ritala et al., Plant. Mol. Biol. -325, 1994; and Wan, Y. C. and Lemaux, P. 6., Plant Physiol. 10413748, 1994. The constructs may also be transformed into plant cells using homologous recombination.

The term “wild-type” when made in reference to a peptide sequence and nucleotide sequence refers to a peptide sequence and nucleotide sequence (locus/gene/allele), respectively, which has the characteristics of that peptide sequence and nucleotide sequence when isolated from a naturally occurring source. A wild—type peptide sequence and nucleotide sequence is that which is most frequently observed in a tion and is thus arbitrarily designated the “normal” or “wild—type” form of the peptide ce and nucleotide sequence, respectively. "Wild-type" may also refer to the sequence at a ic. nucleotide. position or positions, or the sequence at a particular codon position or positions, or the sequence at a particular amino acid position or positions.

“Consensus sequence” is d as a sequence of amino acids or nucleotides that contain identical amino acids or nucleotides or functionally equivalent amino acids or PCT/U82014/029566 nucleotides for at least 25% of the sequence. The identical or functionally equivalent amino acids or nucleotides need not be contiguous.

The term ica” as used herein refers to plants of the ca genus.

Exemplary Brassica species include, but are not limited to, B. carinata, B. te, B. fruticulosa, B. juncea, B. napus, B. narinosa, B. nigra, B. oleracea, B. perviridis, B. rapa (syn B. campestris), B. rupestris, B. septiceps, and B. tournefortii.

A nucleobase is a base, which in certain preferred ments is a purine, pyrimidine, or a derivative or analog thereof. Nucleosides are nucleobases that n a pentosefuranosyl moiety, e. g., an optionally substituted riboside or xyriboside.

Nucleosides can be linked by one of several linkage es, which may or may not contain phosphorus. Nucleosides that arc linked by unsubstituted phosphodiester linkages are termed nucleotides. The term "nucleobase" as used herein includes peptide nucleobases, the subunits of peptide nucleic acids, and morpholine nucleobases as well as nucleosides and nucleotides.

An oligonucleobase is a polymer comprising nucleobases; preferably at least a portion of which can hybridize by Watson—Crick base pairing to a DNA having the complementary sequence. An oligonucleobase chain may have a single 5' and 3‘ terminus, which are the te nucleobases of the polymer. A particular oligonucleobase chain can contain nucleobases of all types. An oligonucleobase compound is a compound sing one or more oligonucleobase chains that may be complementary and hybridized by Watson-Crick base pairing. Ribo—type nucleobases include pentosefuranosyl containing nucleobases wherein the 2’ carbon is a ene substituted with a hydroxyl, alkyloxy or halogen. ibo-type nucleobases are bases other than ribo—type nucleobases and include all nucleobases that do not contain a pentosefuranosyl moiety.

In n embodiments, an oligonucleobase strand may include both oligonucleobase chains and segments or regions of oligonucleobase chains. An oligonucleobase strand may have a 3' end and a 5' end, and when an oligonucleobase strand is coextensive with a chain, the 3' and 5' ends of the strand are also 3' and 5' termini of the chain.

PCT/USZOl4/029566 The term ” gene repair oligonucleobase" as used herein denotes oligonucleobases, including mixed duplex oligonucleotides, non~nucleotide containing molecules, single stranded oligodeoxynucleotides and other gene repair molecules.

As used herein the term "codon" refers to a sequence of three adjacent nucleotides (either RNA or DNA) constituting the genetic code that determines the insertion of a specific amino acid in a polypeptide chain during protein synthesis or the signal to stop protein synthesis. The term "codon" is also used to refer to the corresponding (and complementary) sequences of three nucleotides in the messenger RNA into which the original DNA is transcribed.

As used herein, the term "homology" refers to sequence similarity among proteins and DNA. The term ”homology" or "homologous" refers to a degree of identity.

There may be l homology or complete homology. A lly homologous sequence is one that has less than 100% sequence identity when compared to r ce.

“Heterozygous" refers to having different s at one or more genetic loci in homologous chromosome segments. As used herein "heterozygous” may also refer to a sample, a cell, a cell population or an organism in which different alleles at one or more genetic loci may be detected. zygous samples may also be determined Via methods known in the art such as, for example, nucleic acid sequencing. For example, if a sequencing electropherogram shows two peaks at a single locus and both peaks are roughly the same size, the sample may be characterized as heterozygous. Or, if one peak is smaller than r, but is at least about 25% the size of the larger peak, the sample may be characterized as heterozygous. In some embodiments, the smaller peak is at least about 15% of the larger peak. In other ments, the smaller peak is at least about % of the larger peak. In other embodiments, the smaller peak is at least about 5% of the larger peak. In other embodiments, a l amount of the smaller peak is detected.

As used herein, ”homozygous" refers to having cal alleles at one or more genetic loci in homologous some segments. ygous" may also refer to a sample, a cell, a cell tion or an organism in which the same alleles at one or more genetic loci may be detected. Homozygous samples may be determined Via methods known in the art, such as, for example, nucleic acid sequencing. For example, if a sequencing electropherogram shows a single peak at a particular locus, the sample may be termed "homozygous" with respect to that locus.

PCT/U82014/029566 The term "hemizygous" refers to a gene or gene segment being present only once in the genotype of a cell or an sm because the second allele is deleted. As used herein "hemizygous" may also refer to a sample, a cell, a cell population or an organism in which an allele at one or more genetic loci may be detected only once in the pe.

The term ”zygosity status" as used herein refers to a sample, a cell population, or an organism as appearing heterozygous, homozygous, or hemizygous as determined by testing methods known in the art and described herein. The term ”zygosity status of a nucleic acid" means determining whether the source of nucleic acid appears heterozygous, homozygous, or hemizygous. The "zygosity status" may refer to differences in a single tide in a sequence. In some methods, the zygosity status of a sample with respect to a single mutation may be categorized as homozygous wild~type, heterozygous (i.e., one wi1d~type allele and one mutant allele), homozygous mutant, or hemizygous (i.e., a single copy of either the wild-type or mutant allele).

As used herein, the term "RTDS" refers to The Rapid Trait pment SystemTM (RTDS) ped by Cibus. RTDS is a pecific gene modification system that is effective at making precise changes in a gene sequence without the incorporation of foreign genes or control sequences.

The term "about“ as used herein means in quantitative terms plus or minus %. For example, ”about 3%" would encompass 2.733% and "about 10%" would encompass 9—1 1%.

Repair Oligonucleotides This invention generally relates to novel methods to improve the efficiency of the targeting of modifications to specific locations in genomic or other nucleotide ces. Additionally, this invention s to target DNA that has been ed, mutated or marked by the ches disclosed herein. The invention also s to cells, tissue, and organisms which have been modified by the invention‘s methods. The present invention builds on the development of compositions and methods related in part to the successful conversion system, the Rapid Trait Development System (RTDSTM, Cibus US LLC).

RTDS is based on altering a targeted gene by utilizing the cell's own gene repair system to specifically modify the gene ce in situ and not insert foreign DNA and gene expression control sequences. This procedure effects a precise change in the PCT/U82014/029566 genetic sequence while the rest of the genome is left unaltered. In contrast to conventional transgenic GMOs, there is no integration of n genetic material, nor is any foreign genetic material left in the plant. The changes in the genetic sequence introduced by RTDS are not randomly inserted. Since affected genes remain in their native location, no random, uncontrolled or adverse pattern of expression occurs.

The RTDS that effects this change is a chemically sized ucleotide which may be composed of both DNA and modified RNA bases as well as other chemical moieties, and is designed to hybridize at the targeted gene location to create a mismatched base—pair(s). This mismatched base-pair acts as a signal to attract the cell's own natural gene repair system to that site and correct (replace, insert or delete) the designated nucleotide(s) within the gene. Once the tion process is complete the RTDS molecule is degraded and the dified or repaired gene is expressed under that gene‘s normal endogenous control mechanisms.

The methods and compositions disclosed herein can be practiced or made with gene repair oligonucleobases" (GRON) having the conformations and chemistries as described in detail below. The " gene repair oligonucleobases" as contemplated herein have also been described in published scientific and patent literature using other names including "recombinagenic oligonucleobases;” ”RNA/DNA ic oligonucleotides;" "chimeric oligonucleotides;” ”mixed duplex oligonucleotides" ); ”RNA DNA oligonucleotides (RDOS);" " H II II H gene targeting oligonucleotides; genoplasts; single stranded modified oligonucleotides;" "Single stranded oligodeoxynucleotide onal vectors" (SSOMVS); "duplex mutational vectors;" and ”heteroduplex mutational vectors." The gene repair oligonucleobase can be introduced into a plant cell using any method commonly used in the art, including but not limited to, microcarriers (biolistic delivery), microfibers, hylene glycol (PEG)-mediated uptake, oporation, and microinjection.

In one embodiment, the gene repair oligonucleobase is a mixed duplex oligonucleotides (MDON) in which the RNA-type nucleotides of the mixed duplex oligonucleotide are made RNase ant by replacing the 2‘~hydroxyl with a fluoro, chloro or bromo functionality or by placing a substituent on the 2‘—O. Suitable substituents include the substituents taught by the Kmiec II. Alternative substituents include the substituents taught by US. Pat. No. 71 l (Sproat) and the substituents taught by patent ations EP 629 387 and EP 679 657 (collectively, the Martin PCT/USZOl4/029566 ations), which are hereby incorporated by reference. As used herein, a 2'~fluor0, chloro or bromo derivative of a ribonucleotide or a ribonucleotide having a T— OH substituted with a substituent described in the Martin Applications or Sproat is termed a ”T~ Substituted Ribonucleotide." As used herein the term ”RNA—type nucleotide" means a T— yl or 2 '—Substituted Nucleotide that is linked to other nucleotides of a mixed duplex oligonucleotide by an unsubstituted odiester linkage or any of the non— natural linkages taught by Kmiec I or Kmiec 11. As used herein the term ribo-type nucleotide" means a nucleotide having a T—H, which can be linked to other nucleotides of a gene repair oligonucleobase by an tituted odiester linkage or any of the non-natural linkages taught by Kmiec I or Kmiec II.

In a particular embodiment of the t invention, the gene repair oligonucleobase is a mixed duplex oligonucleotide (MDON) that is linked solely by tituted phosphodiester bonds. In alternative embodiments, the linkage is by substituted phosphodiesters, phosphodiester derivatives and non—phosphorus-based linkages as taught by Kmiec II. In yet r embodiment, each RNA—type nucleotide in the mixed duplex oligonucleotide is a 2 ‘—Substituted Nucleotide. Particular preferred embodiments of 2‘-Substituted cleotides are 2'-fluoro, T— methoxy, 2‘-propyloxy, yloxy, 2'—hydroxylethyloxy, 2'~methoxyethyloxy, T— fluoropropyloxy and 2’— trifluoropropyloxy substituted ribonucleotides. More preferred embodiments of 2'- Substituted cleotides are 2‘~fluoro, 2‘-methoxy, 2'—methoxyethyloxy, and 2'- allyloxy substituted nucleotides. In another embodiment the mixed duplex oligonucleotide is linked by unsubstituted phosphodiester bonds, Although mixed duplex oligonucleotides (MDONs) having only a single type of 2'- substituted pe nucleotide are more conveniently synthesized, the methods of the invention can be practiced with mixed duplex oligonucleotides having two or more types of RNA-type nucleotides. The function of an RNA segment may not be affected by an interruption caused by the introduction of a deoxynucleotide between two RNA-type trinucleotides, accordingly, the term RNA segment encompasses terms such as ”interrupted RNA segment." An uninterrupted RNA segment is termed a contiguous RNA segment. In an alternative embodiment an RNA segment can n alternating RNase- resistant and unsubstituted 2'—OH nucleotides. The mixed duplex oligonucleotides preferably have fewer than 100 nucleotides and more preferably fewer than 85 nucleotides, but more than 50 nucleotides. The first and second strands are Watson—Crick base paired. In one embodiment the strands of the mixed duplex oligonucleotide are ntly bonded by a linker, such as a single stranded hexa, penta or tetranucleotide so that the first and second strands are segments of a single oligonucleotide chain having a single 3' and a single 5' end. The 3‘ and 5' ends can be protected by the addition of a "hairpin cap" whereby the 3‘ and 5‘ terminal nucleotides are Watson-Crick paired to adjacent tides. A second hairpin cap can, additionally, be placed at the junction between the first and second strands distant from the 3' and 5' ends, so that the Watson— Crick pairing between the first and second strands is ized.

The first and second strands n two regions that are homologous with two fragments of the target gene, i.e., have the same sequence as the target gene. A homologous region contains the nucleotides of an RNA segment and may contain one or more DNA-type nucleotides of ting DNA segment and may also contain DNA~ type nucleotides that are not within the ening DNA t. The two regions of gy are separated by, and each is adjacent to, a region having a sequence that differs from the sequence of the target gene, termed a "heterologous region." The heterologous region can contain one, two or three mismatched nucleotides. The mismatched nucleotides can be contiguous or alternatively can be separated by one or two nucleotides that are homologous with the target gene. Alternatively, the heterologous region can also contain an ion or one, two, three or of five or fewer nucleotides.

Alternatively, the sequence of the mixed duplex oligonucleotide may differ from the sequence of the target gene only by the deletion of one, two, three, or five or fewer nucleotides from the mixed duplex oligonucleotide. The length and position of the heterologous region is, in this case, deemed to be the length of the deletion, even though no nucleotides of the mixed duplex oligonucleotide are within the heterologous region.

The distance n the fragments of the target gene that are complementary to the two homologous regions is identical to the length of the heterologous region where a substitution or substitutions is intended. When the heterologous region contains an insertion, the gous regions are thereby separated in the mixed duplex ucleotide farther than their complementary homologous fragments are in the gene, and the converse is applicable when the heterologous region encodes a deletion.

The RNA ts of the mixed duplex oligonucleotides are each a part of a homologous region, i.e., a region that is identical in sequence to a fragment of the target gene, which segments together preferably contain at least 13 RNA~type nucleotides and WO 44951 PCT/USZOl4/029566 preferably from 16 to 25 RNA~type tides or yet more ably 18-22 pe nucleotides or most preferably 20 nucleotides. In one embodiment, RNA segments of the homology regions are separated by and adjacent to, i.e., "connected by" an intervening DNA segment. In one embodiment, each tide of the heterologous region is a nucleotide of the ening DNA segment. An intervening DNA segment that contains the heterologous region of a mixed duplex oligonucleotide is termed a "mutator segment." In another embodiment of the present invention, the gene repair oligonucleobase (GRON) is a single stranded oligodeoxynucleotide mutational vector (SSOMV), which is disclosed in International Patent Application PCT/USOO/23457, US. Pat. Nos. 6,271,360, 6,479,292, and 7,060,500 which is incorporated by reference in its entirety. The sequence of the SSOMV is based on the same principles as the mutational vectors described in US. Pat. Nos. 325; 5,871,984; 5,760,012; ,888,983; 5,795,972; 5,780,296; 5,945,339; 6,004,804; and 6,010,907 and in International Publication Nos. W0 98/49350; W0 99/07865; W0 99/58723; W0 99/5 8702; and W0 99/40789. The sequence of the SSOMV contains two regions that are gous with the target sequence separated by a region that contains the desired c alteration termed the mutator region. The mutator region can have a sequence that is the same length as the sequence that separates the homologous s in the target sequence, but having a different sequence. Such a mutator region can cause a substitution. Alternatively, the homologous regions in the SSOMV can be contiguous to each other, while the regions in the target gene having the same sequence are separated by one, two or more nucleotides. Such an SSOMV causes a deletion from the target gene of the nucleotides that are absent from the SSOMV. Lastly, the sequence of the target gene that is identical to the homologous regions may be adjacent in the target gene but separated by one, two, or more nucleotides in the sequence of the SSOMV. Such an SSOMV causes an insertion in the sequence of the target gene.

The nucleotides of the SSOMV are deoxyn'bonucleotides that are linked by unmodified phosphodiester bonds except that the 3' terminal and/or 5‘ terminal internucleotide linkage or alternatively the two 3' terminal and/or 5' terminal internucleotide linkages can be a phosphorothioate or phosphoamidate. As used herein an internucleotide e is the e between nucleotides of the SSOMV and does not e the linkage between the 3' end nucleotide or 5‘ end nucleotide and a blocking substituent. In a specific ment the length of the SSOMV is between 21 and 55 PCTfUSZOl4/029566 deoxynucleotides and the lengths of the homology regions are, accordingly, a total length of at least 20 deoxynucleotides and at least two homology regions should each have lengths of at least 8 deoxynucleotides.

The SSOMV can be designed to be complementary to either the coding or the non— coding strand of the target gene. When the desired mutation is a substitution of a single base, it is preferred that both the mutator nucleotide and the targeted nucleotide be a pyrimidine. To the extent that is consistent with achieving the desired functional result, it is preferred that both the mutator nucleotide and the targeted nucleotide in the complementary strand be pyrimidines. Particularly preferred are SSOMVs that encode transversion mutations, i.e., a C or T mutator nucleotide is mismatched, respectively, with a C or T nucleotide in the complementary strand. ing efficiency The present invention describes a number of approaches to increase the effectiveness of conversion of a target gene using repair oligonucleotides, and which may be used alone or in ation with one another. These include: 1. Introducing modifications to the repair oligonucleotides which t DNA repair ery to the targeted tch) site.

A. uction of one or more abasic sites in the oligonucleotide (e. g., within bases, and more preferably with 5 bases of the d mismatch site) generates a lesion which is an ediate in base excision repair (BER), and which attracts BER machinery to the vicinity of the site. targeted for sion by the repair oligonucleotide. dSpacer (abasic furan) modified ucleotides may be prepared as described in, for example, Takeshita et al., J. Biol. Chem, 171—79, 1987.

B. Inclusion of compounds which induce single or double strand breaks, either into the oligonucleotide or together with the oligonucleotide, generates a lesion which is repaired by non—homologous end joining (NHEJ), microhomology-mediated end joining (MMEJ), and homologous recombination. By way of example,the bleomycin family of antibiotics, zinc fingers, FokI (or any type 118 class of restriction enzyme) and other nucleases may be covalently coupled to the 3’ or 5’ end of repair ucleotides, in order to introduce double strand breaks in the vicinity of the site targeted for conversion by the repair oligonucleotide. The bleomycin family of antibiotics are DNA cleaving glycopeptides include bleomycin, zeocin, phleomycin, tallysomycin, pepleomycin and others.

C. Introduction of one or more 8’oxo dA or dG incorporated in the oligonucleotide (e.g., within 10 bases, and more preferably with 5 bases of the desired mismatch site) generates a lesion which is similar to lesions created by reactive oxygen species. These lesions induce the so—called “pushing repair” system. See, e.g., Kim et a1., , J. Biochem. Mol. Biol. 371657—62, 2004. 2. Increase stability of the repair oiigonucleotides: Introduction of a reverse base (idC) at the 3’ end of the oligonucleotide to create a 3’ blocked end on the repair oligonucieotide.

Introduction of one or more Z’O-methyl nucleotides or bases which increase hybridization energy (see, e.g., W02007/O73 149) at the 5' and/or 3’ of the repair oiigonucleotide.

Introduction of a ity of Z’O-methyl RNA nucleotides at the 5’ end of the repair ucleotide, leading into DNA bases which provide the desired mismatch site, thereby creating an Okazaki Fragment—like nucleic acid structure.

Conjugated (5’ or 3’) intercalating dyes such as acridine, psoralen, um e and Syber stains.

Introduction of a 5’ us cap such as a T/A clamp, a cholesterol moiety, SIMA (HEX), riboC and amidite.

Backbone modifications such as othioate, 2’-O methyl, methyl onates, locked nucleic acid (LNA), MOE(methoxyethy1), di PS and peptide c acid (PNA). inking of the repair oligonucleotide, eg, with intrastrand crosslinking reagents agents such as cisplatin and mitomycin C.

Conjugation with fluorescent dyes such as Cy3, DY547, Cy3.5, Cy3B, CyS and DY647.

PCT/U82014/029566 3. Increase hybridization energy of the repair oligenucieotide h incorporation of bases which increase hybridization energy (see, e.g, W02007/073149). 4. Increase the quality of repair oligonucleotide synthesis by using nucleotide multimers (dimers, trimers, tetramers, etc.) as building blocks for synthesis. This results in fewer coupling steps and easier separation of the full length products from building blocks.

. Use of long repair oligonucleotides (i.e., greater than 55 nucleotides in length, ably between 75 and 300 nucleotides in length, more preferably at least 100 nucleotides in length, still more preferably at least 150 nucleotides in length, and most preferably at least 200 nucleotides in length), preferably with two or more mutations targeted in the repair oligonucleotide.

Examples of the ing ches are provided in the following table Table 1. GRON chemistries to be tested. fliige type Metiiticatiens ‘ mods ’l‘lA clamp TIA clamp Backbone modifications Phosphothioate PS {morcaiating dyes 5' Acridine ’3' idC e, MC.

Ukasaki fragments A C323 replacements. DYSW Faeilitators ZOE/it?» oiigos designed 5’ E't'BMe and 3' of the converting 01ng Abasic Abasic site placed. in Abasic 2 varioua locations 5' and 3’ to the ting base. 44 mar Assist Assist approach {3373i itiC on one. none on rlap: the. other: 2 oiigos: l with illnyidC, l unmodified repair oligo Assist Assist approach only make the 'utm'iodified No overlap: oiigc 2 aligns: l with Cy3fidC, i. unmodified repair oligo PCTfU82014/029566 {Riga iym fiam Abasic THE“ site placed in various- "i‘ea‘rahydmfman (dspacer) ons 5‘ and 3‘ to the converting base. 44:1161‘ Backhanfi modifications 9 Z’QMe ’1‘rin‘mrs 1%ch amidites, C523. idC g repair S'oxo GA” 5’ {3511 MC } fishing “pair‘1 ‘ ' x v3 : B‘OXO (EA, 5' C1313, idC Double Strand braak Bieomycln Cmasfinker Cisplatin Crflsglizfizer Mitomycin C Facilitators super bases 5’ and 3' of Ci amim dA and. 2., £315 a "if converting oligo Super s Z'amixm CL 5' (3373, MC Supcsr (fligos Cathie T, 5' C312”), idC Super oligos 7-deaza A, 5’ (338, MC Super obi 30.9 aza {if Cy3, idC Super 01125133 pre-pzmyl (iii, 5‘ (13,73, idC Emercaiaiing dyes 5' Panama/’3' idC Psmaien, idC intercala‘ring dyes 5' Eihidium bmmific inflamed:1:ng (lyes 5' Sybez‘ stains ‘ mods 5' Chfl- ’3' MC Chit-fiestero} {Ecume- mutation Long, {:Iigo (:3 GO heme-s) w/ Unhnfiwn 2 mutation ’ mods ’JR ' SEMA HEX/B‘iciC SEMI-‘5 HEX, idC Backbene modifications KC? Methyl phosphonates Backbone: modificatiom ENA Backbone. modifications MUE (methgxyethyl) PCT/USZOl4/029566 {Riga type b’iedificafiens Cy3 replacements I Cy'fi 5 {13,13 repiacements CyS Backbone modifications di PS ' mods riboC for branch my: Backbone cations PNA €313 mpiacements ‘i‘l’Y64? ' mods 5' branch symmetric branch amidite/iL‘iC The ing modifications may also include known nucleotide modifications such as methylation, 5’ intercalating dyes, modifications to the 5’ and 3’ ends, ne modifiications, crosslinkers, cyclization and 'caps‘ and substitution of one or more of the lly occurring nucleotides with an analog such as inosine. Modifications of nucleotides include the addition of acridine, amine, biotin, cascade blue, cholesterol, Cy3@, Cy5 @, Cy5.5@ Daboyl, digoxigenin, dinitrophenyl, Edans, 6—FAM, scein, 3'— glyceryl, HEX, 0, IRD—SOO, JOE, phosphate psoralen, rhodamine, ROX, thiol (SH), spacers, TAMRA, TET, AMCA—S", SE, BODIPY°, Marina Blue@, Pacific Blue@, Oregon Green@, Rhodamine Green@, Rhodamine Red@, Rhodol Green@ and Texas Red@. Polynucleotide backbone modifications e methylphosphonate, 2‘-OMe- methylphosphonate RNA, orothiorate, RNA, RNA. Base modifications include 2-amino-dA, Z—aminopun'ne, 3'- (ddA), 3‘dA (cordycepin), 7—deaza—dA, 8-Br—dA, 8— oxo—dA, N6-Me—dA, abasic site (dSpacer), biotin dT, 2‘—OMe-5Me—C, 2'-OMe— propynyl-C, 3'- (5—Me—dC), 3'- (ddC), 5—Br—dC, c, C, S—F-dC, carboxy—dT, convertible dA, convertible dC, convertible dG, convertible dT, convertible dU, 7—deaza~ dG, 8—Br—dG, 8— oxo-dG, O6~Me~dG, S6-DNP—dG, 4-methyl~indole, 5-nitroindole, 2'— OMe—inosine, 2‘—dl, 06— phenyl-dl, 4—methy1—indole, 2'—deoxynebularine, S—nitroindole, 2- aminopurine, dP (purine ue), dK (pyrimidine analogue), 3—nitropyrrole, 2-thio—dT, 4-thio-dT, biotin-dT, carboxy~dT, 04—Me—dT, 04~triazol dT, 2'—OMe—propynyl—U, 5—Br— dU, 2‘-dU, 5—F—dU, 5-l-dU, 04-tn'azol dU. Said terms also encompass peptide nucleic acids (PNAS), a DNA analogue in which the backbone is a pseudopeptide consisting of N— (2—aminoethyl)—glycine units rather than a sugar. PNAS mimic the behavior of DNA PCT/U82014/029566 and bind complementary nucleic acid strands. The neutral backbone of PNA results in stronger binding and greater specificity than normally achieved. In addition, the unique chemical, al and biological ties of PNA have been exploited to produce powerful biomolecular tools, nse and antigene agents, molecular probes and biosensors.

Oligonucleobases may have nick(s), gap(s), modified nucleotides such as modified oligonucleotide backbones, abasic nucleotides, or other chemical moieties. In a further embodiment, at least one strand of the oligonucleobase includes at least one additional modified nucleotide, e.g., a 2’—O-methyl modified nucleotide such as a MOE (methoxyethyl), a nucleotide having a 5’-phosphorothioate group, a terminal nucleotide linked to a cholesteryl tive, a 2’—deoxy~2’—fluoro modified nucleotide, a 2’-de0xy— modified nucleotide, a locked nucleotide, an abasic tide (the nucleobase is missing or has a hydroxyl group in place thereof (see, e. g., Glen Research, http://www.glenresearch.com/GlenReports/GRZl —14.html)), a 2’—amino-modified nucleotide, a 2’—alkyl-modified nucleotide, a lino nucleotide, a phosphoramidite, and a non-natural base comprising nucleotide. Various salts, mixed salts and free acid forms are also included.

Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphoro—dithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl onates including 3’-alkylene phosphonates, ylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3’-amino phosphoramidate and aminoalkylphosphoramidates, phosphoramidates, thionoalkyl—phosphonates, thionoalkylphosphotriesters, selenophosphates and phosphates having normal 3’-5’ linkages, 2’—5’ linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3’ to 3’, 5’ to 5’ or 2’ to 2’ linkage. red oligonucleotides having ed polarity comprise a single 3' to 3’ linkage at the 3’—most intemucleotide linkage Le. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). The most common use of a linkage inversion is to add a 3‘-3‘ linkage to the end of an antisense oligonucleotide with a phosphorothioate backbone. The 3'—3' e further stabilizes the antisense oligonucleotide to exonuclease degradation by creating an oligonucleotide with two 5'— OH ends and no 3‘—OH end. Linkage inversions can be introduced into specific locations WO 44951 PCT/U82014/029566 during oligonucleotide synthesis through use of "reversed phosphoramidites". These reagents have the phosphoramidite groups on the 5‘—OH position and the dimethoxytrityl (DMT) protecting group on the 3‘—OH position. Normally, the DMT protecting group is on the 5'—OH and the phosphoramidite is on the 3'~OH.

Examples of modified bases include, but are not limited to, 2—an1inopurine, 2’- amino—butyryl pyrene—uridine, nouridine, 2’—deoxyuridine, 2’—fluoro~cytidine, 2’— fluoro-uridine, 2,6—diaminopurine, —uridine, o-uridine, 5-fluoro—cytidine, 5— ridine, 5—indo—uridine, 5—methy1—cytidine, inosine, N3—methyl-uridine, 7~deaza— guanine, 8-aminohexyl-amino—adenine, 6-thi0-guanine, 4—thio-thymine, 2~thio—thymine, —i0do—uridine, -cytidine, 8—bromo—guanine, o—adenine, 7—deaza-adenine, 7- diaza—guanine, 8—oxo-guanine, 5,6~dihydro—uridine, and 5—hydroxymethyl—u1idine. These synthetic units are commercially available; (for example, purchased from Glen Research Company) and can be incorporated into DNA by chemical synthesis.

Examples of modification of the sugar moiety are xylation, 2’— fluorination, and arabanosidation, however, it is not to be construed as being d o. Incorporation of these into DNA is also possible by chemical synthesis.

Examples of the 5’ end modification are 5’—amination, 5’-biotinylation, 5’— fluoresceinylation, 5'—tetrafluoro-fluoreceinyaltion, 5’—thionation, and 5’~dabsylation, however it is not to be construed as being limited thereto.

Examples of the 3’ end modification are 3’-amination, 3’—biotinylation, 2,3- dideoxidation, 3’-thionation, 3’—dabsylation, 3’—carboxylation, and 3’—cholesterylation, however, it is not to be construed as being d thereto.

In one preferred embodiment, the oligonucleobase can contain a 5' blocking substituent that is attached to the 5 ' terminal carbons through a linker. The chemistry of the linker is not critical other than its length, which should preferably be at least 6 atoms long and that the linker should be flexible. A variety of non—toxic substituents such as biotin, terol or other steroids or a non-intercalating cationic fluorescent dye can be used. Particularly preferred reagents to make oligonucleobases are the reagents sold as Cy3TM and Cy5TM by Glen Research, Sterling Va. (now GE Healthcare), which are d phosphoroamidites that upon incorporation into an oligonucleotide yield 3,3,3',3'— ethyl N,N'—isopropyl substituted nocarbocyanine and indodicarbocyanine dyes, respectively. Cy3 is particularly preferred. When the indocarbocyanine is N— PCT/U82014/029566 oxyalkyl substituted it can be conveniently linked to the 5' terminal of the eoxynucleotide as a phosphodiester with a 5' terminal phosphate. When the cially available Cy3 phosphoramidite is used as directed, the resulting 5‘ modification consists of a blocking substituent and linker together which are a N— ypropyl, N'—phosphatidylpropy1 ,3'—tetramethy1indomonocarbocyanine.

Other dyes contemplated include Rhodamine6G, Tetramethylrhodamine, Sulforhodamine 101, Merocyanine 540, Att0565, Att0550 26, Cy3.5, Dy547, Dy548, Dy549, Dy554, Dy555, Dy556, Dy560, mStrawberry and mCherry.

In a preferred embodiment the indocarbocyanine dye is tetra substituted at the 3 and 3' positions of the indole rings. Without limitations as to theory these substitutions prevent the dye from being an alating dye. The identity of the substituents at these positions is not critical.

The oligo designs herein described might also be used as more efficient donor templates in combination with other DNA editing or recombination logies ing, but not limited to, gene targeting using pecific homologous recombination by zinc finger nucleases, Transcription Activator~Like Effector Nucleases (TALENs) or Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRS).

The present invention generally relates to methods for the efficient modification of genomic cellular DNA and/or recombination of DNA into the genomic DNA of cells. Although not limited to any ular use, the methods of the present invention are useful in, for example, introducing a modification into the genome of a cell for the purpose of determining the effect of the modification on the cell. For example, a modification may be introduced into the nucleotide sequence which encodes an enzyme to ine r the cation alters the enzymatic activity of the enzyme, and/or determine the location of the enzyme's tic region. Alternatively, the cation may be introduced into the coding sequence of a DNA-binding protein to determine whether the DNA binding activity of the protein is altered, and thus to delineate the particular DNA-binding region within the protein. Yet another alternative is to introduce a modification into a ding regulatory sequence (e.g., promoter, enhancer, regulatory RNA sequence (miRNA), etc.) in order to determine the effect of the modification on the level of expression of a second sequence which is operably linked to the non~coding regulatory sequence. This may be desirable to, for example, define the particular sequence which possesses regulatory activity.

WO 44951 PCT/U82014/029566 One gy for producing targeted gene disruption is through the generation of single strand or double strand DNA breaks caused by site—specific endonucleases.

Endonucleases are most often used for targeted gene disruption in organisms that have traditionally been refractive to more conventional gene targeting methods, such as algae, plants, and large animal models, including . For example, there are currently human clinical trials ay involving zinc finger ses for the treatment and tion of HIV infection. Additionally, endonuclease engineering is currently being used in attempts to disrupt genes that produce undesirable phenotypes in crops.

The homing endonucleases, also known as meganucleases, are sequence specific endonucleases that generate double strand breaks in genomic DNA with a high degree of icity due to their large (e.g., >14 bp) ge sites. While the specificity of the homing endonucleases for their target sites allows for precise targeting of the induced DNA breaks, homing endonuclease cleavage sites are rare and the probability of finding a naturally occuiring Cleavage site in a targeted gene is low.

One class of artificial endonucleases is the zinc finger endonucleases. Zinc finger endonucleases combine a non—specific cleavage domain, typically that of Fold endonuclease, with zinc finger protein domains that are engineered to bind to specific DNA sequences. The r structure of the zinc finger endonucleases makes them a versatile platform for delivering site—specific double~strand breaks to the genome. One limitation of the zinc finger endonucleases is that low specificity for a target site or the presence of multiple target sites in a genome can result in off-target cleavage events. As FokI endonuclease cleaves as a dimer, one gy to prevent rget cleavage events has been to design zinc finger domains that bind at adjacent 9 base pair sites.

TALENs are targetable nucleases are used to induce single- and double—strand breaks into ic DNA sites, which are then repaired by mechanisms that can be exploited to create sequence alterations at the cleavage site.

] The fundamental building block that is used to er the DNA—binding region of TALENs is a highly conserved repeat domain derived from naturally occurring TALES encoded by Xanthomonas spp. proteobacteria. DNA binding by a TALEN is mediated by arrays of highly conserved 33—35 amino acid repeats that are flanked by additional TALE—derived domains at the amino-terminal and carboxy-terminal ends of the repeats.

WO 44951 PCT/U82014/029566 These TALE repeats specifically bind to a single base of DNA, the identity of which is determined by two hypervariable residues typically found at positions 12 and 13 of the , with the number of repeats in an array corresponded to the length of the desired target nucleic acid, the identity of the repeat selected to match the target nucleic acid sequence. The target nucleic acid is preferably between 15 and 20 base pairs in order to maximize selectivity of the target site. Cleavage of the target nucleic acid typically occurs within 50 base pairs of TALEN binding. Computer programs for TALEN recognition site design have been described in the art. See, e.g., Cermak et al., Nucleic Acids Res. 2011 July; : e82. ()nce designed to match the desired target sequence, TALENS can be expressed recombinantly and introduced into protoplasts as exogenous proteins, or expressed from a plasmid within the protoplast.

Another class of artificial endonucleases is the engineered meganucleases.

Engineered homing endonucleases are generated by modifying the specificity of existing homing endonucleases. In one approach, variations are introduced in the amino acid ce of naturally occurring homing endonucleases and then the resultant engineered homing endonucleases are screened to select onal ns which cleave a targeted binding site. In another approach, chimeric homing endonucleases are engineered by combining the recognition sites of two ent homing cleases to create a new recognition site composed of a half site of each homing endonuclease.

Other DNA—modifying molecules may be used in targeted gene recombination. For example, peptide c acids may be used to induce modifications to the genome of the target cell or cells (see, e.g., US. Pat. No. 5,986,053, to Ecker, herein orated by reference). In brief, synthetic tides comprising, at least, a partial peptide backbone are used to target a homologous genomic nucleotide ce.

Upon binding to the double-helical DNA, or through a mutagen ligated to the peptide nucleic acid, modification of the target DNA sequence and/or recombination is d to take place. Targeting specificity is determined by the degree of sequence homology between the targeting sequence and the genomic sequence.

] Furthermore, the present invention is not limited to the particular methods which are used herein to execute modification of genomic sequences. Indeed, a number of methods are contemplated. For example, genes may be targeted using triple helix PCT/U82014/029566 forming oligonucleotides (TFO). TFOs may be generated synthetically, for example, by PCR or by use of a gene synthesizer apparatus. onally, TFOs may be isolated from genomic DNA if suitable natural sequences are found. TFOs may be used in a number of ways, including, for example, by tethering to a mutagen such as, but not limited to, en or chlorambucil (see, e. g., Havre et al., Proc Nat’l Acad Sci, USA. 90:7879— 7883, 1993; Havre et al., J Virol 67:7323—7331, 1993; Wang et al., Mol Cell Biol :1759-1768, 1995; Takasugi et al., Proc Nat’l Acad Sci, USA. 88:5602—5606, 1991; Belousov et al., Nucleic Acids Res 25:3440—3444, 1997). Furthermore, for example, TFOs may be tethered to donor duplex DNA (see, e.g., Chan et al., J Biol Chem 272:11541—11548, 1999). TFOS can also act by binding with sufficient affinity to provoke error—prone repair (Wang et al., Science 271 05, 1996).

The invention‘s methods are not limited to the nature or type of DNA~ modifying reagent which is used. For example, such DNA-modifying reagents release radicals which result in DNA strand breakage. Alternatively, the reagents alkylate DNA to form adducts which would block replication and transcription. In another alternative, the reagents generate crosslinks or molecules that inhibit cellular enzymes leading to strand . Examples of DNA—modifying reagents which have been linked to oligonucleotides to form TFOS include, but are not limited to, carbazoles, napthalene diimide (NDI), transplatin, bleomycin, analogues of cyclopropapyrroloindole, and phenanthodihydrodioxins. In particular, indolocarbazoles are topoisomerase I inhibitors. tion of these enzymes results in strand breaks and DNA n adduct formation [Arimondo et al., Bioorganic and Medicinal Chem. 8, 777, 2000]. NDI is a photooxidant that can oxidize guanines which could cause mutations at sites of guanine residues , et al., Biochemistry, 39, 6190, 2000]. Transplatin has been shown to react with DNA in a triplex target when the TFO is linked to the t. This reaction causes the formation of DNA adducts which would be mutagenic [Columbier, et al., Nucleic Acids Research, 24: 4519, 1996]. Bleomycin is a DNA breaker, widely used as a radiation c. It has been linked to oligonucleotides and shown to be active as a breaker in that format [Sergeyev, c Acids Research 23, 4400, 1995; Kane, et al., mistry, 34, 16715, 1995]. Analogues of cyclopropapyrroloindole have been linked to TFOs and shown to alkylate DNA in a triplex target sequence. The alkylated DNA would then contain al adducts which would be mutagenic [Lukhtanov, et al., Nucleic Acids Research, 25, 5077, 1997]. Phenanthodihydrodioxins are masked quinones that release radical species upon photoactivation. They have been linked to TFOs and have been shown to introduce breaks into duplex DNA on photoactivation [Bendinskas et al., jugate Chem. 9, 555, 1998].

Other methods of inducing modifications and/or recombination are contemplated by the present invention. For example, another embodiment involves the ion of homologous recombination between an exogenous DNA fragment and the targeted gene (see e. g., hi et al., Science 244:1288~1292, 1989) or by using peptide nucleic acids (PNA) with affinity for the targeted site. Still other methods e Dervan et al., sequence specific DNA recognition and targeting by polyamides (see e. g., Curr Opin Chem Biol 3:688—693, 1999; mistry 38:2143~2151, 1999) and the use nucleases with site specific activity (e. g., zinc finger proteins, TALENs, Meganucleases and/0r CRISPRS).

The present invention is not limited to any particular frequency of modification and/or recombination. The invention’s methods result in a frequency of modification in the target nucleotide sequence of from 0.2% to 3%. Nonetheless, any frequency (i.e., between 0% and 100%) of modification and/or recombination is plated to be within the scope of the present invention. The frequency of modification and/or recombination is dependent on the method used to induce the modification and/0r recombination, the cell type used, the specific gene ed and the DNA mutating reagent used, if any. Additionally, the method used to detect the modification and/or recombination, due to limitations in the detection method, may not detect all occurrences of modification and/or recombination. Furthermore, some modification and/or recombination events may be silent, giving no detectable indication that the modification and/or recombination has taken place. The inability to detect silent modification and/or recombination events gives an artificially low estimate of cation and/or recombination. Because of these reasons, and , the invention is not limited to any particular modification and/or recombination ncy. In one ment, the frequency of modification and/or recombination is between 0.01% and 100%. In r embodiment, the frequency of modification and/or recombination is between 0.01 % and 50%. In yet another embodiment, the ncy of modification and/0r recombination is between 0.1% and 10%. In still yet another embodiment, the frequency of modification and/or recombination is between 0.1% and 5%.

PCT/U82014/029566 The term “frequency of mutation” as used herein in reference to a population of cells which are treated with a DNA—modifying molecule that is e of introducing a mutation into a target site in the cells‘ genome, refers to the number of cells in the treated population which contain the mutation at the target site as compared to the total number of cells which are treated with the difying molecule. For example, with respect to a population of cells which is treated with the difying molecule TFO tethered to psoralen which is designed to introduce a mutation at a target site in the cells' genome, a frequency of mutation of 5% means that of a total of 100 cells which are treated with TFO-psoralen, 5 cells contain a mutation at the target site.

Although the present invention is not limited to any degree of precision in the modification and/or recombination of DNA in the cell, it is contemplated that some embodiments of the present invention require higher degrees of precision, depending on the desired result. For example, the specific sequence s required for gene repair (e. g., particular base changes) require a higher degree of precision as compared to producing a gene ut wherein only the disruption of the gene is necessary. With the methods of the t invention, achievement of higher levels of precision in modification and/or homologous recombination techniques is greater than with prior art methods.

Delivery of Gene Repair Oligonucleobases into Plant Cells Any commonly known method used to transform a plant cell can be used for delivering the gene repair oligonucleobases. rative methods are listed below. The present invention plates many methods to ect the cells with the DNA— modifying reagent or reagents. Indeed, the present invention is not limited to any particular . Methods for the introduction of DNA modifying reagents into a cell or cells are well known in the art and e, but are not limited to, microinjection, electroporation, passive adsorption, calcium phosphate—DNA co—precipitation, DEAE— dextran—mediated transfection, polybrene—mediated transfection, liposome , lipofectin, nucleofection, protoplast fusion, retroviral infection, biolistics (i.e., particle bombardment) and the like.

The use of metallic microcarriers (microspheres) for introducing large fragments of DNA into plant cells having cellulose cell walls by projectile penetration is well known to those d in the nt art (henceforth biolistic delivery). US. Pat.

WO 44951 2014/029566 Nos. 4,945,050; 5,100,792 and 5,204,253 describe l techniques for selecting microcarriers and devices for projecting them.

Specific conditions for using microcaniers in the s of the present invention are described in International Publication WO 99/07865. In an illustrative technique, ice cold microcarriers (60 mg/mL), mixed duplex oligonucleotide (60 mg/mL) 2.5 M CaClz and 0.1 M dine are added in that order; the mixture gently agitated, e.g., by vortexing, for 10 s and then left at room ature for 10 minutes, whereupon the microcarriers are diluted in 5 volumes of ethanol, centrifuged and resuspended in 100% ethanol. Good results can be obtained with a concentration in the adhering solution of 8-10 ng/uL microcarriers, 14-17 ug/mL mixed duplex oligonucleotide, 1.1—1.4 M CaClz and 18—22 mM spermidine. Optimal results were observed under the conditions of 8 ug/uL microcarriers, 16.5 ug/mL mixed duplex oligonucleotide, 1.3 M CaClz and 21 mM spermidine.

Gene repair ucleobases can also be introduced into plant cells for the practice of the present invention using microfibers to penetrate the cell wall and cell membrane. US. Pat. No. 5,302,523 to Coffee et a1 describes the use of silicon carbide fibers to facilitate transformation of sion maize cultures of Black Mexican Sweet.

Any mechanical que that can be used to uce DNA for transformation of a plant cell using microfibers can be used to deliver gene repair oligonucleobases for utation.

An illustrative technique for microfiber delivery of a gene repair oligonucleobase is as follows: Sterile microfibers (2 pg) are suspended in 150 nL of plant culture medium containing about 10 ug of a mixed duplex oligonucleotide. A suspension culture is allowed to settle and equal volumes of packed cells and the sterile fiber/nucleotide suspension are vortexed for 10 minutes and plated. Selective media are applied immediately or with a delay of up to about 120 h as is appropriate for the particular trait.

In an alternative embodiment, the gene repair oligonucleobases can be delivered to the plant cell by electroporation of a protoplast derived from a plant part.

The protoplasts are formed by enzymatic treatment of a plant part, particularly a leaf, according to techniques well known to those skilled in the art. See, e.g., Gallois et a1, 1996, in Methods in lar Biology 55:89—107, Humana Press, Totowa, N.J.; Kipp et W0 2014/144951 2014/029566 al., 1999, in s in Molecular Biology 133:213—221, Humana Press, Totowa, NJ 4 The protoplasts need not be cultured in growth media prior to electroporation. Illustrative conditions for electroporation are 3. timele. sup.5 protoplasts in a total volume of 0.3 mL with a concentration of gene repair oligonucleobase of between 0.6—4 ng/mL.

In an alternative embodiment, nucleic acids are taken up by plant protoplasts in the presence of the membrane-modifying agent polyethylene glycol, according to ques well known to those skilled in the art. In another alternative embodiment, the gene repair oligonucleobases can be delivered by injecting it with a microcapillary into plant cells or into protoplasts.

In an alternative embodiment, nucleic acids are embedded in microbeads composed of calcium alginate and taken up by plant protoplasts in the presence of the membrane-modifying agent hylene glycol (see, e.g., Sone et al., 2002, Liu et al., 2004).

In an alternative ment, nucleic acids forzen in water and introduced into plant cells by bombardment in the form of microparticles (see, e.g., Gilmore, 1991, US. Patent 5,219,746; Brinegar et al.).

] In an alternative embodiment, nucleic acids attached to nanoparticles are introduced into intact plant cells by incubation of the cells in a suspension containing the nanoparticlethe (see, e.g., Pasupathy et al., 2008) or by delivering them into intact cells h particle bomardment or into protoplasts by co—incubation (see, e.g., Torney et al., 2007).

In an ative embodiment, nucleic acids complexed with penetrating peptides and delivered into cells by co—incubation (see, e.g., Chugh et al., 2008, WO 2008148223 A1; Eudes and Chugh.

In an alternative embodiment, nucleic acids are uced into intact cells through electroporation (see, e. g., He et al., 1998, US 2003/0115641 A1, Dobres et al.).

] In an alternative embodiment, nucleic acids are red into cells of dry embryos by soaking them in a solution with nucleic acids (by soaking dry embryos in (see, e.g., Topfer et al., 1989, Senaratna etal., 1991 ).

Selection of Plants PCT/U82014/029566 In various embodiments, plants as disclosed herein can be of any species of dicotyledonous, monocotyledonous or gymnospermous plant, including any woody plant species that grows as a tree or shrub, any herbaceous species, or any species that produces edible fruits, seeds or vegetables, or any species that produces colorful or aromatic . For e, the plant maybe selected from a species of plant from the group consisting of canola, sunflower, corn, tobacco, sugar beet, cotton, maize, wheat, , rice, alfafa, barley, sorghum, tomato, mango, peach, apple, pear, strawberry, banana, melon, potato, carrot, lettuce, onion, soy bean, soya spp, sugar cane, pea, ea, field field pea, faba bean, lentils, turnip, rutabaga, brussel sprouts, lupin, cauliflower, kale, beans, poplar, pine, eucalyptus, grape, citrus, tn'ticale, alfalfa, rye, oats, turf and forage grasses, flax, oilseed rape, mustard, cucumber, morning glory, balsam, pepper, eggplant, marigold, lotus, e, daisy, carnation, tulip, iris, lily, and nut producing plants insofar as they are not already specifically mentioned.

Plants and plant cells can be tested for resistance or nce to an herbicide using ly known s in the art, e.g., by growing the plant or plant cell in the ce of an herbicide and measuring the rate of growth as compared to the growth rate in the absence of the herbicide.

As used herein, substantially normal growth of a plant, plant organ, plant tissue or plant cell is defined as a growth rate or rate of cell on of the plant, plant organ, plant tissue, or plant cell that is at least 35%, at least 50%, at least 60%, or at least 75% of the growth rate or rate of cell division in a corresponding plant, plant organ, plant tissue or plant cell expressing the wild—type AHAS protein.

As used herein, substantially normal development of a plant, plant organ, plant tissue or plant cell is defined as the occurrence of one or more development events in the plant, plant organ, plant tissue or plant cell that are substantially the same as those ing in a corresponding plant, plant organ, plant tissue or plant cell expressing the wild—type protein.

In certain embodiments plant organs provided herein include, but are not limited to, leaves, stems, roots, vegetative buds, floral buds, meristems, embryos, cotyledons, endosperm, sepals, petals, pistils, carpels, stamens, anthers, microspores, pollen, pollen tubes, ovules, s and fruits, or sections, slices or discs taken therefrom. Plant tissues e, but are not limited to, callus tiSSues, ground tissues, PCT/U52014/029566 vascular tissues, storage tissues, meristematic tissues, leaf tissues, shoot tissues, root tissues, gall tissues, plant tumor tissues, and reproductive tissues. Plant cells include, but are not limited to, isolated cells with cell walls, variously sized aggregates thereof, and lasts.

Plants are substantially "tolerant" to a relevant herbicide when they are subjected to it and provide a dose/response curve which is shifted to the right when compared with that provided by rly ted non-tolerant like plant. Such dose/response curves have ”dose" plotted on the X—axis and ”percentage kill”, "herbicidal effect", etc., plotted on the y—axis. Tolerant plants will require more ide than non- tolerant like plants in order to produce a given herbicidal effect. Plants that are substantially "resistant" to the ide exhibit few, if any, necrotic, lytic, chlorotic or other lesions, when subjected to herbicide at concentrations and rates which are typically employed by the agrochemical community to kill weeds in the field. Plants which are resistant to an herbicide are also tolerant of the herbicide.

Generation of plants Tissue culture of various tissues of plant species and regeneration of plants therefrom is known. For example, the propagation of a canola cultivar by tissue culture is described in any of the following but not limited to any of the following: Chuong et al., "A Simple Culture Method for ca tyls Protoplasts," Plant Cell Reports 424— 6, 1985; Barsby, T. L., et al., "A Rapid and Efficient ative Procedure for the Regeneration of Plants from Hypocotyl Protoplasts of Brassica " Plant Cell Reports (Spring, 1996); Kartha, K., et al., "In vitro Plant Formation from Stem Explants of Rape,” Physiol. Plant, ~220, 1974; Narasimhulu, S., et al., ”Species Specific Shoot Regeneration Response of Cotyledonary ts of Brassicas," Plant Cell Reports (Spring 1988); n, E., "Microspore Culture in Brassica," Methods in Molecular Biology, Vol. 6, Chapter 17, p. 159, 1990.

Further reproduction of the variety can occur by tissue culture and regeneration. Tissue culture of various tissues of soybeans and regeneration of plants therefrom is well known and widely published. For example, nce may be had to Komatsuda, T. et al., ”Genotype X Sucrose Interactions for Somatic Embryogenesis in Soybeans," Crop Sci. 3l1333—337, 1991; Stephens, P. A., et al., "Agronomic Evaluation of Tissue-Culture~Derived n Plants,” Theor. Appl. Genet. 82:633—635, 1991; PCT/USZOI4/029566 Komatsuda, T. et a1., "Maturation and Germination of Somatic Embryos as Affected by Sucrose and Plant Growth tors in ns Glycine gracilis Skvortz and e max (L) Merr." Plant Cell, Tissue and Organ e, 28:103-113, 1992; Dhir, S. et al., ”Regeneration of Fertile Plants from Protoplasts of Soybean (Glycine max L. ; Genotypic Differences in Culture Response,” Plant Cell Reports 11:285-289, 1992; Pandey, P. et al., "Plant Regeneration from Leaf and Hypocotyl Explants of Glycine wightii (W. and A.) VERDC. var. longicauda," Japan J. Breed. 4221-5, 1992; and Shetty, K., et al., "Stimulation of In, Vitro Shoot Organogenesis in Glycine max (Merrill) by Allantoin and Amides," Plant Science 81:245-251, 1992. The disclosures of US Pat.

No. 5,024,944 issued Jun. 18, 1991 to Collins et al., and US. Pat. No. 5,008,200 issued Apr. 16, 1991 to Ranch et al., are hereby incorporated herein in their entirety by reference.

EXAMPLES Example 1: GRON length Sommer et al., (M01 Biotechnol. 33:115—22, 2006) describes a reporter system for the detection of in viva gene conversion which relies upon a single nucleotide change to convert n blue and green fluorescence in green cent protein (GFP) ts. This reporter system was adapted for use in the following ments using Arabidopsis thaliana as a model species in order to assess efficiency of GRON conversion following cation of the GRON length.

In short, for this and the subsequent examples an Arabidopsis line with multiple copies of a blue fluorescent protein gene was created by methods known to those skilled in the art (see, e. g., Clough and Brent, 1998). Root-derived meristematic tissue cultures were established with this line, which was used for protoplast isolation and culture (see, e.g., Mathur et al., 1995). GRON delivery into protoplasts was ed through polyethylene glycol (PEG) mediated GRON uptake into protoplasts. A method using a 96-well format, similar to that described by similar to that described by Fujiwara and Kate (2007) was used. In the following the protocol is briefly described. The volumes given are those applied to dual wells of a 96—well dish.

W0 2014/144951 1. Mix 6.25 pl of GRON (80 pM) with 25 pl ofArabidopsis BFP transgenic root meristematic tissue—derived protoplasts at 5x106 cells/ml in each well of a 96 well plate. 2. 31.25 pl of a 40% PEG solution was added and the protoplasts were mixed. 3. Treated cells were incubated on ice for 30 min. 4. To each well 200 pl of W5 solution was added and the cells mixed. 5. The plates were allowed to incubate on ice for 30 min allowing the protoplasts to settle to the bottom of each well. 6. 200 pl of the medim above the settled lasts was removed. 7. 85 pl of culture medium (MSAP, see Mathur et al., 1995) was added. 8. The plates were incubated at room temperate in the dark for 48 hours. The final concentration of GRON after adding culture medium is 8 pM.

Forty eight hours after GRON delivery samples were analyzed by flow cytometry in order to detect protoplasts whose green and yellow fluorescence is different from that of control protoplasts (BFPO tes rgeting GRONS with no change compared to the EFF target; C is the coding strand design and NC is the non—coding strand design). A single C to T nucleotide difference (coding strand) or G to A nucleotide targeted on (non-coding strand) in the center of the BFP4 les. The green fluorescence is caused by the introduction of a targeted mutation in the EFF gene, resulting in the synthesis of GFP. The results are shown in Figure 1.

The ing table shows the sequence of exemplary 10l—mer and 201—mer BFP4/NC 5’—3PS/ 3’—3PS GRONS designed for the conversion of a blue fluorescent protein (BFP) gene to green fluorescence. (3P8 indicates 3 othioate linkages at each of the 5’ and 3’ oligo ends).

PCT/U82014/029566 [11112131 Tame. 1: CG C TAG GTG AAG GTG WC. ACG AGG GTG GGC CAG (IKA. ACG GGC AGC‘. TTG CCG ,2/(/nnnnnnn/zn” ”4”,,”0,» ”EGG GTG AAG OTC: GTC‘. AC‘GAGT: G’Cz‘C: “SGC CAG GGC .ACG CvGC‘. AGCI'1"1'13 CCG / . 5:inAT GA[\ (ii/A G1Ct\1-j '1J*IA If«,,.,,.,I/,»-»,” \“Axsxxxsxx \s\\\~\\\\\\\\\\\rltlr((rrlrtrr IGTGC.

”Mu/”flflauu’, \\\\‘\s\\\\K\\\\\\\\\‘\\\\\k\\\/a\ururr Cl GAAGAAC‘fl‘CG’TG ACGAGCATGUCKC'AGGGLIACGKISCAiCTTL:CC(J(_11C3GTG(AGATGAACTTCAGULvTC'A Cm1-N“CM““w““mmmm‘u“ 1'30’Ni" 20‘ ~m‘ct l,»~;-»~:»,~ GAAGA A GTKIGTGC A(‘:{"1"'1Gf"‘C:GTC:Cz'1GC'AGATG-AAC‘TTCAGGG'1C.AG" "1'GAAGG’1'GG’1'Z‘A pp .4111wa Iri’rttzt’rttrtrrtrrllrlrrrrt(rtritrittir u»»»:»»~»»4/:uu”:»»””» ,- .GCII'GACC{ITGAAGT CATCTGC/CCACCG GCT-AAGC‘. CCCC‘:1GCC‘C".‘:’1( (:1I’CAC‘C‘C1CC:'1GACC‘ACC‘TIC‘ACCTACGCmCrlGCAC-I " 'V11C‘..IAC‘:(CGC'1ACC"(‘.C:AC.C'AC‘A'1GAACcC‘AGC‘ACGIAC1'1‘(‘.'1’1CAAG'1C‘C‘GC'CA1GCC.CGA ‘\(1{1( ‘ACG'1'CCAGGA GCGCACCAF * :TGCCCTC; 31111" ACCCTiGTGACCACCTTCACCC‘11.1.1131.(J1Ci(.z‘\(ITC3C..

ACCC‘.JGAAGF‘T‘AKJ(: ..A _,'-‘1\ CG C‘ZGCC "§TC.AGCCGC’E'ACCCCGACC‘ACA"E:GAAGCAGC‘ACGACTTC1TCAAGTCCGCCATGCCCGA AGGC1.ACGTCCIAGGA GC"CAC(IA’1‘*C‘* *T lrrlt7irritrlrrrl((lrrl(rrrrtlr(t \“\“\“~\C““CCCC“C~C““““““Cfls“~““““~\~“~“~“““s“~“»“\““‘\WM~WM“~“~»“~\~“-»“ : PS 11111§8g€ (phosphothioate) Exam 119 '3:i¢ Cs'awea‘ésian gates. 12: S’CVE/ 3’111C iabeied GRONS 1116 purpose of this series emf experiments 13 to e. the. encies of phoaphothioate (PS) Jahaled GRONS g 3 PS moimies at each end of the GRON) to 111(35 ’Cy3l' 3 id( labeled (IRONS The. 5’(y1! 3’ir1C1-absiad GRONS have: a 5’ Cy3 flum‘ophore (amidiie) and a 3’ MC reverse. base: Efficiancy lag assessed using Ciit-an'IIS1iiill 01' blue fluorescam pmtein (BF?) is green fluorescence In 9:11 three. expariments, done either by PEG delivery 01' GRONS into protoplasts in individual Falcon tubes (labeled ”Tubes") or in 96-well plates (1abeled “96 W811 dish”)> there \, 'as no signifiam. {1111L’10‘GLC bi-‘tw{n the different GRON 111011113111» in B??? to GP? conversion-f1"cie:ncy as. datennined by cytimwiry (171g. 1) .

Exampie 3: {30111133115911between the flame? BFPAI‘NC S’-3PS/ 3’~3P$ GRGN and ()kazaki Fragment GRGNS 16} The pui‘poge of (his series 01' ments is to compare the sion efficiencies of [he phosphofhioata (PS) labeled GRONS with 3P8 moietics at each and of U: \G SUBSTITUTE SHEET (RULE 26) PCT/USZOI4/029566 the GRON to “Okazaki fragment GRONs” in the presence and absence of a member of the bleomycin family, ZeocinTM (1 mg/ml) to induce DNA breaks. The design of these GRONs are depicted in Fig. 2. GRONS were delivered into Ambidopsis BFP protoplasts by PEG treatment and BFP to GFP conversion was determined at 24 h post treatment by cytometry. Samples treated with zeocin (1 mg/ml) were incubated with zeocin for 90 min on ice prior to PEG treatment.

In general the presence of zeocin (1 mg/ml) increased BFP to GFP conversion as determined by cytometry (Table 2). In both the presence and absence of zeocin, the NC Okazaki GRON containing one 2’—O Me group on the first RNA base at the 5’ end of the GRON was more cious at ting BFP to GFP when compared to the NC Okazaki GRON containing one 2’-O Me group on each of the first nine 5’ RNA bases (Fig. 2 and Table 2).

In all experiments, there was no icant difference between the 4l-n1er BFP4/NC 5’3PS/ 3’3PS and the 71—mer Okazaki Fragment BFP4/NC GRON that contains one 5’ 2’-O me group on the first 5’ RNA base (denoted as BFP4 71-mer (1) NC) in BFP to GFP conversion in both the ce or absence of 1 mg/ml of zeocin as determined by cytometry (Fig. 2 and Table 2). It is ant to note that in the presence of zeocin (and expected for bleomycin, phleomycin, tallysomycin, pepleomycin and other members of this family of otics) that conversion s strand independent (i.e., both C and NC GRONs with the designs tested in these experiments display approximately equal activity).

PCT/U82014/029566 {@219} Table. 2: Comparison of a rd GRON design with ()kazaki fragment GRON designs. in the presence and absence of a giycopeptide antibiotic zeooin. i Zeocin (+) 0001414 0.001061 0.001 ‘1:;» 0.00075 Exampie 4: Comparison betwgen iize 4141mm Tim-mar and 261-er BFPo‘i/NC S’- 35381 3’-SPS GRONS The purpose. of this series of experiments. was to compare the conversion efficissncies (in the. presence and absence of zeacin) of the at‘hioaie (PS) labeled GRONS with 3P8 es at each and m" the GRON of different Iengihs: iii finer, 101- mer and ZOE-mar Shawn in Table 1. Again, the pi'eSmice of zeocm {1 mg/ml) increased BFP to G??? cmwersimx rates as determined by symmetry (Tame 5) The avaiiaii trend in ail three expemnani‘s was linear with increasing NC GRON iength in both the. presence. and absence of 2600111. Except fo: the. BFP-ii/N If101 and BFP-4/C/101 in the. presence of 1600131, this had conversion rams that were (rinse. to cquai but iuwer than the 41mm: NC GRQN. This is in contrast to all us experiments in which the EFF—414] coding and SUBSTITUTE SHEET (RULE 26) PCT/U52014/029566 nml-«ccydmg GRONS were usede wherein the nonucoding was always far superior its the coding GRON. This asymn'letry in conversion frequency also applias 10 {he 201 GRONS uaed in this experimentai . [002,211] Ta bk: 3: Zeocin (+) Exp.

Name ham-35% 0.3225 API‘G66 0.713 0992 Mean 0.26825 0.4802857 d ‘ 01289(3-79 00795 .1 “'1‘- C.0"."8842-1L O.{‘13‘563 0.004390 711E 0.0015033 E 6.0557584 0.0110017 0.0032505 0OQSOO0.8 {0022?} Example 5: CRISPRS combined with GRONS to improve conversion in plants. [002231 Three design components must he considered when assembling a (TIRESPR camplex: (32139, gRNA (guide. RNA) and the target region (proto~s_pacer in endogenous target gene).

SUBSTITUTE SHEET (RULE 26) Gas 9 — Transient expression of Cas9 gene from ococcus pyogenes codon optimized for Arabidopsis or corn driven by 358 or corn ubiquidn respectively. Optimized genes synthesized by Genewiz or DNA 2.0. NB must ensure no cryptic introns are created.

- RBCSE9 terminator as per G1 155 - Single SV4O NLS (PKKRKV) as a C—terminal fusion — The vector backbone would be as per ail our transient expression systems - G1 155. gRNA — Propose to use a chimeric trachNA — pre—creRNA as per Le Cong et a1., 2013 and Jinek et al., 2013. Note that LeCong et al. showed that the native full length tracr + pre-chNA complex d much more ntly than the chimeric version. An option therefore would be to make a chimera using the full length (89bp) trachNA. - Sequence of gRNA ( (N)20 represents guide sequence). The bracketed sequence comprises the full length 89bp form.

NNNNNNNNNNNNNNNGT'VI‘TAGAGCTI‘A(MA«K'I‘AGUAAEH’TAAAATA AGCEC’I‘A(‘i'l‘('(3t’}ff’i‘:’\‘FGTT'(3’l"E’(iA1\AAA[\{E’l‘GAt’i’EY'}GRMTGAG'I’CGG’ETJG'I‘G r1‘11'ii} Figure 3 reproduced from Cong et al., shows the native complex and the chimera.

[Text continued on page 64] PCT/U82014/029566 — The gRN'A would he expressed under the AtUé RNA pol HI er in Arabia’opsis {sequence given below). in com the 2mm RNA pol HI promoter could be used.

These choices are based on Wang; et at. 2008" — RBCSEQ terminatm‘ as per @1155 or a String of T’s as per Wang ex (2]. 2.013. and the one~eomponent approach shown below.

At U6 promoter sequence from Wang e: an? {$62237} ’l’argetreglsm — The guide ce specificity is d by the target region sequence. lniespeetive of the choice. of model organism this will be the YGSH locus of BFP. A PAM (NGG) sequence in the Vicinity of Y66H is the only design t‘esli‘ictlen. A150, including the Y6<3H position in the '3’ 11;pr of the guide sequence (“seed ce") would mean. that once repair has been achieved the site will. not get IS~C~11§.

Te gt}; ace ace tie ace cac ggc VTTFTY 61 6'2 63 64 65 66 67 {$0228} A ct vector backbone item (5.1155 will be needed in order to enable co~ delivery of Can“) and gRNA. This problem will be circumvented with the. one—component approach: {@0229} One component approach Le Cong e! a}. (2013) used a simplified appreach, expressing both the gRNA and the C389 as a single transient construct, driven by the pol Ill U6 er, as outlined below. In this. way, for a given crop, multiple. genes could be targeted by Simply swapping in the guide insert sequence. We would replace the EFlcx promoter for one suitable for the crop (pMAS for At, Ubi fer Zm). For the terminatnr we would use.

RBCSHQ. ’llhe $11.3 used in plants. would be a single C—temlinai SV40 as outlined above.

SUBSTITUTE SHEET (RULE 26) Note that in the construct below a truncated gRNA is used where the tracer RNA region is not included. The authors showed that in humans that this was less effective at guiding the Cas9 that the full length version. It is therefore proposed that the full length gRNA to be used here. y in a subsequent paper using CRISPRs in yeast, DiCarlo et al. (2013) used the full length n. The cassette would be cloned into a G1 155 background.

Figur 4 shows a schematic of the expression vector for chimeric chNA. The guide sequence can be inserted between two BbsI sites using annealed oligonucleotides. The vector already ns the partial direct repeat (gray) and partial trachNA (red) sequences. WPRE, Woodchuck tis virus post transcriptional regulatory element.

In Vivo assay Transient option — One approach to confirm target recognition and nuclease activity in planta would be to emulate the YFP single stranded annealing assay which Zhang et al. (2013) used for TALENS. The spacer sequence (target sequence) plus PAM would need to be inserted into the YFP or equivalent gene.

- Transient option — The TALEN - BFP system could be used as a control.

- Whilst the above approach would be an on-going tool for ing functionality of a given CRISPR system for a given spacer sequence, proof of concept of the activity of CRISPRS in plants would be to use the GFP system.

[Text continued on page 66] PCT/U82014/029566 — Here the s used for FP could be co—transformed into At together with G1155 and no GRON. If cutting were efficient enough, a reduction in GFP expression could be apparent. This would likely require zation of plasmid loading.

— Once activity is confirmed a genomic BFP target would be targeted with a Visual and ce-based read-out.

In Vitro assay — In order to rapidly confirm activity of a CRISPR system, an in vitro assay could be used as per Jinek et a] 2012. Here a pre—made and purified S.pyogenes Cas9 is incubated with synthesized gRNA and a plasmid ning the recognition ce.

Successful cleavage is analysed by gel electrophoresis to look for out plasmids.

Detailed protocol: Plasmid DNA cleavage assay. Synthetic or in vino-transcribed trachNA and chNA were pre—annealed prior to the on by heating to 95°C and slowly cooling down to room temperature. Native or restriction digest—linearized plasmid DNA (300 ng (~8 nM)) was incubated for 60 min at 37°C with purified Cas9 protein (50~500 nM) and trachNAzchNA duplex (50-500 nM, 1:1) in a Cas9 plasmid cleavage buffer (20 mM HEPES pH 7.5, 150 mM KCl, 0.5 mM DTT, 0.1 mM EDTA) with or without 10 mM MgC12. The reactions were stopped with 5X DNA loading buffer containing 250 mM EDTA, resolved by 0.8 or 1% agarose gel electrophoresis and visualized by ethidium bromide staining. For the Cas9 mutant cleavage assays, the reactions were stopped with 5X SDS loading buffer (30% glycerol, 1.2% SDS, 250 mM EDTA) prior to loading on the agarose gel.

Trait targets in Crops Given the flexibility of the CRISPR recognition sequence it is not difficult to find potential pacer sequences as defined by a 3’ NGG PAM sequence.

ZmEPSPS The e below shows a suitable protospacer sequence (yellow) and PAM (blue) in order to create a DS break in the catalytic site of ZmEPSPS where mutations at PCT/USZOl4/029566 the T97 and P101 are known to cause glyphosate tolerance. Subsequent oligo-mediated repair (ODM) of the break would result in the desired changes.

T AM R P L T V A A V act gca atg cgg cca ttg ] The table below gives the protospacer sequences of genes of interest in crops of interest: Eastssssrtastggtgsa.............. ggctgcagttactgctgct , .......................................................................................... Eggstgsaatta959593.....__.__.-_.-._ 3ccastggagttagamete..-.........._.._E5 ,.steststaasaesegft___-.__..-.....§' sagttgstgtaest............ .i ssagsagttasaatasst.,............ : gtgcgcctcgctttgtcttgt Eattttacaggtgtttacgcc A limitation of the design constraints is that it is often hard to find a NGG sequence within 12 bp of the nucleotide being altered by ODM. This is significant because if this was the case, successful ODM would mean that subsequent cutting would not be possible because the protospacer seed sequence would be altered. Jinek et a1. (2012) showed this was detrimental to cutting efficiency.

References LeCong et al 2013 e : vol. 339 no. 6121 pp. 819—823.

Jinek et a] 2012 Science. 337:816-21 Wang et a] 2008 RNA 14: 903—913 Zhang et al2013. Plant l. 161: 20—27 ] One skilled in the art y iates that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The examples provided herein are representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention.

PCT/U82014/029566 It will be readily apparent to a person skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention.

All patents and publications mentioned in the specification are indicative of the levels of those of ry skill in the art to which the ion pertains. All patents and publications are herein incorporated by reference to the same extent as if each individual publication was ically and dually indicated to be incorporated by reference.

The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. Thus, for example, in each ce herein any of the terms “comprising”, “consisting essentially of” and “consisting of” may be replaced with either of the other two terms. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and sions of excluding any equivalents of the features shown and described or ns thereof, but it is recognized that s modifications are possible within the scope of the invention claimed Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and al features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims.

Other embodiments are set forth within the ing claims.

Claims (13)

1. A method for introducing a gene repair oligonucleobase (GRON)—mediated mutation into a target ibonucleic acid (DNA) sequence in the genome of a plant cell, comprising: delivering a GRON into the plant cell configured to mediate introduction of one or more targeted genetic changes within the DNA sequence in the plant cell genome, wherein the GRON ses a 3’ modifying substituent, a 5’ modifying substituent, or both a 3’ modifying substituent and a 5’ modifying substituent, and wherein the GRON hybridizes at the target DNA sequence to create a mismatched base-pair(s), which acts as a signal to attract the cell's gene repair system to the site where the mismatched base-pair(s) is created, and is degraded after ated nucleotide(s) within the target DNA sequence is corrected by the cell's gene repair system such that the plant cell introduces the ediated mutation into the target DNA sequence and the plant cell is non-transgenic following the introduction; culturing the plant cell under conditions that se one or more cellular DNA repair processes prior to or coincident with delivery of the GRON into the plant cell, wherein the conditions that increase one or more cellular DNA repair processes comprise introducing one or more site—specific ses which induce single stranded nicks or double stranded DNA strand breaks into the plant cell genome, wherein the one or more site—specific nucleases which induce single strand nicks or double DNA strand breaks are selected from the group consisting of: zinc finger endonucleases, CRISPR nucleases and meganucleases, and wherein the site—specific nuclease is designed to match the target DNA sequence; and selecting a plant cell comprising the one or more ed genetic changes within the DNA ce in the plant cell genome.

2. The method of claim 1, wherein the 3’ modifying substituent is present and is selected from the group consisting of a fluorescent dye, a reverse base, a 3’— dimethoxytriyl nucleotide, one or more phosphorothioate or phosphoamidate internucleotide linkages, one or more 2’—O—(2-methoxyethyl) nucleotides, and one or more 2’-O-methyl nucleotides.

3. The method of claim 1, wherein the 5’ modifying substituent is present and is ed from the group consisting of a fluorescent dye, one or more phosphorothioate or phosphoamidate internucleotide linkages, one or more 2’—O~(2—methoxyethyl) nucleotides, and one or more 2’—O—methyl nucleotides.

4. The method of claim 1, wherein the 3 ’ modifying substituent is present and is selected from the group consisting of a fluorescent dye, a reverse base, a 3’- dimethoxytrityl nucleotide, one or more phosphorothioate or phosphoamidate internucleotide linkages, one or more 2—methyoxyethyl) nucleotides, and one or more 2’—O—methyl nucleotides; and the 5’ modifying substituent is present and is ed from the group consisting of a fluorescent dye, one or more orothioate or phosphoamidate internucleotide linkages, one or more 2’—O—(2—methoxyethyl) nucleotides, and one or more 2’—O—methyl nucleotides.

5. The method of claim 4, wherein the 3’ modifying substituent ses one or more 2’-O-methyl nucleotides and the 5’ modifying substituent comprises one or more 2’—O—methyl nucleotides.

6. The method of claim 4, wherein the 3’ modifying substituent comprises a reverse base and the 5’ modifying substituent comprises a fluorescent dye.

7. The method of claim 4, wherein the 3 ’ modifying substituent comprises a reverse base and the 5’ modifying substituent comprises one or more 2’—O—(2- methoxyethyl) nucleotides.

8. The method of claim 4, n the 3 ’ modifying substituent comprises a reverse base and the 5’ modifying substituent comprises one or more 2’-O~methyl nucleotides.

9. The method of claim 4, wherein the 3 ’ modifying substituent ses one or more 2’~O—(2—methoxyethyl) tides and the 5’ modifying substituent comprises one or more 2’~O—(2—methoxyethyl) nucleotides.

10. The method of claim 1, wherein the DNA sequence is an endogenous gene in the plant cell genome.

11. The method of claim 1, wherein the plant cell is a cell from a plant selected from the group consisting of , sunflower, corn, tobacco, sugar beet, cotton, maize, wheat, barley, rice, , sorghum, tomato, mango, peach, apple, pear, strawberry, banana, melon, potato, carrot, lettuce, onion, soy bean, soya spp, sugar cane, pea, chickpea, field pea, faba bean, lentils, turnip, rutabaga, l s, lupin, cauliflower, kale, field beans, poplar, pine, eucalyptus, grape, citrus, triticale, alfalfa, rye, oats, turf and forage grasses, flax, oilseed rape, mustard, cucumber, morning glory, , pepper, eggplant, marigold, lotus, cabbage, daisy, carnation, tulip, iris, and lily.

12. The method of claim 1, further comprising regenerating a plant having the mutation introduced by the GRON from the selected plant cell.

13. The method of claim 12, further comprising collecting seeds from the plant.