NZ749545A - Composition for treatment and/or nutrition of poultry - Google Patents

Abstract

composition for the treatment and/or nutrition of poultry such as broiler chickens is disclosed as comprising (i) one more probiotics which are commensal selected from one or more of Bifidobacterium animalis, Collinsella tanakaei, Lactobacillus reuteri, Anaerostipes, Lactobacillus crispatus, Pediococcus acidilactici, Lactobacillus pontis, Faecalibacterium prausnitzii, Coprococcus catus, Roseburia intestinalis, Anaerostipes butyraticus, Butyricicoccus, Lactobacillus johnsonii, and Ruminococcus sp.; and (ii) a prebiotic material. The application also discloses the use of such a composition for the treatment of enteric disease in poultry, such as necrotic enteritis. coccus acidilactici, Lactobacillus pontis, Faecalibacterium prausnitzii, Coprococcus catus, Roseburia intestinalis, Anaerostipes butyraticus, Butyricicoccus, Lactobacillus johnsonii, and Ruminococcus sp.; and (ii) a prebiotic material. The application also discloses the use of such a composition for the treatment of enteric disease in poultry, such as necrotic enteritis.

Description

COMPOSITION FOR TREATMENT AND/OR NUTRITION OF POULTRY The present invention relates to itions for use in the treatment and/or nutrition of poultry, such as broiler chickens (Gallus gallus domesticus).

Broiler chickens are the most widely farmed animals. Around 50 billion chickens are reared each year for global consumption. Chicken g on an industrial scale ts significant challenges both of a practical and animal welfare nature. Birds which are densely stocked, even in a free—range environment, will be apt to transmit bacterial disease. Enteric bacterial infections such as Campylobacter jejuni are both prevalent and undesirable in broilers.

One of the major indications for the use of antibiotics in broilers is enteric disease (Journal of Antimicrobial herapy, Vol 61, Issue 4, Pp947-952).

Studies have demonstrated that certain commensal bacteria present in the microbiota of y such as broilers can have a beneficial effect upon their g, by improving their gut health and thereby their performance in terms of feed conversion ratio (FCR) and rate of weight gain (see for example, “Microbiota of the chicken gastrointestinal tract: influence on health, productivity and disease”, Stanley et al Appl, Microbiol. Biotechnol. (2014) 98:4301-4310, and Stanley D, Hughes RJ, Geier MS and Moore RJ(2016) Bacteria within the gastrointestinal tract microbiota correlated with improved growth and feed conversion: Challenges presented for the identification of performance enhancing probiotic bacteria. Front. Microbiol. 7:187. doi:10.3389/fmicb.2016.00187).

Reference herein to the bacteria as being commensal refers to their presence within the gastrointestinal tract of the majority of the broiler populations. However, it is the case that because of the environment, diet, broiler stock or other factors that either a particular broiler population or, for whatever reason, a proportion of broilers within a tion, have an altered iota or lack one or more of those bacteria.

It would therefore be desirable to identify specific probiotics for poultry such as broilers comprising one or more such ia. The use of such a probiotic will, ore, result in an improvement in the profile of commensal bacteria within a r chicken, since it will then include one or more of these ia shown to be beneficial to g, which have a beneficial effect upon broiler health and performance Therefore, according to the present invention, there is provided a composition comprising: (i) a tic selected from one or more of the bacteria bacterz’um animalis, Collinsella tanakaei, Lactobacillus reuteri, Anaerostipes, Lactobacillus crispatus, Pediococcus acidilactici, Lactobacillus pontis, ibacterium prausnitzii, Coprococcus catus, Roseburia intestinalis, Anaerostipes butyraticus, cicoccus, Lactobacillusjohnsonii, andRuminococcus Sp. , and (ii) a prebiotic al.

The composition of the invention may comprise the specific probiotic bacterial strain Lactobacillus crispatus DC2l.l (NCIlVfl3 42771), deposited on 23 June 2017 at NCIMB d, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA,. United Kingdom.

The composition of the invention may comprise the specific probiotic bacterial strain acillusjohnsonii DC22.2 (NCIMB 42772), deposited on 23 June 2017 at NCIlVfl3 Limited, Ferguson Building, Craibstone , Bucksburn, Aberdeen, AB21 9YA,. United Kingdom.

The composition of the invention may comprise the specific probiotic bacterial strain Lactobacillus i DClB4 (NCIMB 42773), deposited on 23 June 2017 at NCIMB Limited, Ferguson ng, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA,. United Kingdom.

The composition of the invention may comprise the specific probiotic bacterial strain Ruminococcus sp. DC3A4 (NCIlVfl3 42774), deposited on 23 June 2017 at NCIlVfl3 Limited, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen, AB21 9YA,. United Kingdom.

The probiotic bacteria used in the ion are typically sal bacteria.

An e of the performance objectives for broiler chickens can be found in Aviagen Ross 308 Broiler Performance Objectives 2014 documentation.

An example of the nutrition specifications for broiler chickens can be found in Aviagen Ross 308 Broiler Nutrition Specifications 2014 documentation.

Prebiotic materials are defined by the US Food and Drug Administration as being non- ible food ingredients that beneficially affect the host by selectively stimulating the growth and/or activity of one or a limited number of ia in the colon.

The definition provided by the US Food and Drug Administration has been reviewed and modified based on three criteria: (a) resistance to gastric acidity, hydrolysis by mammalian enzymes and intestinal absorption, (b) fermentation by intestinal microflora; (c) selective stimulation of the growth and/or activity of intestinal bacteria ated with health and well-being; In view of this, prebiotic materials are defined by Gibson et a]. (2004) (Gibson, G. R, Probert, H. M, Loo, J. V., Rastall, R. A., andRoberfroia’, M B. (2004) “Dietary modulation of the human colonic microbiota: updating the concept ofprebiotics ” Nutrition Research s, 17(2) 259-2 75) as being a selectively fermented ingredient that allows specific changes, both in the composition and/or activity in the gastrointestinal microflora that confers benefits upon host well—being and health.

Examples of prebiotics are inulin, fructo-oligosaccharides (also known as oligofructose) which is a partial hydrolysate of inulin, galacto—oligosaccharides (GOS) (also known as alacto-oligosaccharides), lactulose, lactosucrose, isomalto-oligosaccharides, xylo- oligosaccharides, arabinoxylo-oligosaccharides, gluco-oligosaccharides, mannan oligosaccharides (MOS), soyabean oligosaccharides, and pectic oligosaccharides.

Prebiotic definitions The following definitions provided by Gibson et a1. (2004) are ed as rd definitions of the mentioned examples of prebiotics: Inulin and fructo-oligosaccharides , or the hydrolysed fructo-oligosaccharides, are described as either an: o ucopyranosyl-[B—D-fructofuranosyl]n-1—B-D-fructofuranoside (GFn); or a o B-D—fructopyranosyl-[B-D -fructofi1ranosyl]n.1—B-D-fructofuranoside.

The fructosyl—glucose linkage is always B(2<—l) as in sucrose, but the fructosyl—fructose linkages are B(l<—2).

There are a number of sources of inulin. A major source of inulin is chicory. Chicory inulin is composed of a mixture of oligomers and polymers in which the degree of polymerisation (DP) varies from 2 - 60 with an average DP Z 12.

Fructo-oligosaccharides (oligofructose) are formed by the partial (enzyme catalysed or al) hydrolysis of inulin giving a mixture of both a—D-glucopyranosyl-[B-D- fructofuranosyl]nB-D-fructofuranoside (GFn) and B-D-fructopyranosyl-[B—D -fructofi1ranosyl]n_ 1-B-D-fructofiiranoside molecules with a DP of 2 - 7.

Galacto-oligosaccharides (GOS) GOS are a e of accharides formed by the enzyme (B-galactosidase) catalysed transglycosylation of lactose and uent galacto-oligosaccharides. The oligosaccharides are often considered to be of the form (gal)n-glc with DP = 2 - 8 and B(l—>6), ) and B(l—>4) mixed linkages; however, galactans with the same linkages can be present. The product mixtures depend upon the enzymes used and the reaction conditions.

GOS (galacto—oligosaccharide) is sold by Dairy Crest Ltd under the trade name Nutrabiotic® GOS for animal feed applications.

Lactulose Lactulose is manufactured by the isomerisation (often chemical isomerisation) of lactose to generate the disaccharide galactosyl-B(l—>4)-fructose.

Lactosucrose Lactosucrose is_produced from a mixture of lactose and sucrose in an enzyme (for example B-fructofuranosidase) catalysed lycosylation reaction. The fructosyl residue is transferred from sucrose to the C 1 position of the glucose moiety in the lactose, producing a non-reducing oligosaccharide.

Isomalto-oligosaccharides to-oligosaccharides are_manufactured from oligosaccharides, or maltose (both of which are produced from starch by the combined reactions catalysed by oz—amylase and pullulanase, or B-amylase and pullulanase). The malto-oligosaccharides and maltose are converted into 0t(l—>6)—linked isomalto—oligosaccharides by enzyme (u—glucosidase or transglucosidase) catalysed transglycosylation reactions.

Xylo-oligosaccharides and arabinoxylo-oligosaccharides ligosaccharides and arabinoxylo-oligosaccharides are_made from wood or cereal non- starch materials (corn cobs, wheat bran etc.). Depending upon various xylan s used, and the method of production, the structures vary in degree of polymerization, monomeric units, and types of linkages. Generally, xylo-oligosaccharides are es of oligosaccharides formed from xylose residues, typically DP = 2 - lO, linked through B(l—>4)-linkages. Xylan is usually found in combination with other side groups such as ucopyranosyl uronic acid or its thyl derivative, acetyl groups or arabinofiiranosyl (giving arabinoxylo-oligosaccharides) residues.

Xylo-oligosaccharides and arabinoxylo-oligosaccharides are produced by chemical methods, enzyme catalysed hydrolysis (e.g. the hydrolysis of arabinoxylans catalysed by combinations of endo-l,4-B-xylanases, B-xylosidases, arabinofuranosidases and yl esterases) or a combination of chemical and enzyme catalysed treatments.

Gluco-oligosaccharides Gluco—oligosaccharides are often referred to as a—GOS. These are mixed u—gluco- oligosaccharides produced in ons sed by dextran e in fermentation processes (fermentation of Leuconostoc mesenteroides) or in the enzyme catalysed transglycosylation reactions involving sucrose in the presence of maltose. This gives oligosaccharides with a range of oe—linkages (e. g. yl-OL( l —>2)-glucosyl-0t( l —>6)—glucosyl-0t( l —>4)-glucose).

Mannan oligosaccharides (MOS) Mannan accharides are normally obtained from the cell walls of the yeast Saccharomyces cerevisiae. and presented as products of different levels of purity. In the yeast cell wall, mannan oligosaccharides are present as: 0 complex molecules that are linked to the cell wall proteins as -O and -N glycosyl groups; 0 nnans made up of an 0t—(l,6)—D-mannose backbone to which are linked Ot-(l,2)- and 0t-(l,3)- D-mannose branches (1 - 5 mannosyl groups long).

Soyabean oligosaccharides Soyabean oligosaccharides are d—galactosyl sucrose derivatives (eg. raffinose, stachyose, verbascose). They are isolated from soya beans and concentrated for the final product formulation.

Pectic oligosaccharides Pectic oligosaccharides (POS) are obtained by pectin depolymerization by either enzyme (pectin hydrolases and lyases) catalysed reactions or acid (typically) hydrolysis. Given that pectins are x ramified heteropolymers made up of: o a smooth region of linear backbone of 4)—linked D-galacturonic acid units which can be randomly acetylated and/or methylated); o hairy regions of rhamnogalacturonan type I and rhamnogalacturonan type II; the structural diversity of the pectic oligosaccharides from pectin hydrolysis is high.

The prebiotic materials useful in the invention may be naturally or non-naturally occurring. The probiotics are responsive to prebiotics, with the populations of the probiotics sing due to the presence of the prebiotic material, and the presence of the prebiotic material correlates with improved r performance, including weight gain during rearing.

The one or more bacteria are typically selected from the more specific bacterial s, as fied as nearest cultural examples: Bifidobacz‘erium animalz's subsp. lactis str. V9, Collinsella tanakaei str. YIT 12064, Lactobacillus reulerl' str. BCSl36, Anaerostz'pes sp. str. 35-7, acillus crispalus str. STl, acillus crispaz‘us str. DC21, Lactobacillus crispatus str.

DC2l.l (NCIlVfl3 42771), Lactobacillus johnsonii str. DC22.2 (NCIlVfl3 42772), acz'llus reuterl' str. DClB4 (NCIMB , and Ruminococcus Sp. str. DC3A4 (NCIlVfl3 42774).

The probiotic bacteria used in the invention were identified as being up-regulated in a broiler trial treatment that contained galacto-oligosaccharides (GOS) in the feed, ed to a control feed.

The one or more bacteria may be selected from their nearest (based on sequence) equivalents. Identification of the bacteria included in the composition of the invention is based on Operational Taxonomic Units (OTUs) identified from 168 rDNA sequences from the V4 region of the microbiome. Specifically, 16S rRNA gene sequences were aligned against a nce alignment based on the SILVA rRNA database and clustered into OTUs with an average neighbor clustering algorithm. The nearest l6S rRNA gene sequence identities to the OTUs are reported on the basis of BLASTn searches if data matches are from type cultures with a BLAST identity 299%. The laboratory and bioinformatic techniques used to identify the bacteria included in the composition of the invention is described as follows: Histology Samples of ileum for histological assessment were examined from birds from each relevant treatment. The fixed tissue samples were ated through a series of alcohol solutions, cleared in , and finally embedded in paraffin wax (Microtechnical Services Ltd, Exeter, UK).

Sections (3 to 5 pm thick) were prepared and d with modified hematoxylin and eosin (H&E) using standard protocols. After staining, the slides were scanned by NanoZoomer Digital Pathology System (Hamamatsu, Welwyn Garden City, UK). Measurements of villus height and crypt depth were made using the NanoZoomer Digital Pathology Image Program atsu) of well-oriented villi d at 40 X magnification. Villus height was measured from the tip of the villus to the crypt opening and the associate crypt depth was measured from the base of the crypt to the level of the crypt opening. The ratio of villus height to relative crypt depth (V:C ratio) was calculated from these measurements.

RNA ion and RT-qPCR of the Cytokines and ines RNA was isolated from cecal and ileal tissue biopsies using NucleoSpin RNA isolation kit rey—Nagel, GmbH & co. KG, Duran DE) ing to the manufacturer’s protocol with the following modifications. Tissue samples were nized in Lysis buffer with 2.8 mm ceramic beads (MO BIO Laboratories Inc, Carlsbad, USA) using TissueLyser II (Qiagen, Hilden, DE) prior to subsequent purification as bed in the protocol. RNA was eluted in DEPC treated water (Ambion ThermoFisher Scientific, UK) and stored at —80°C. RNA quality and concentration were assessed using Nanodrop ND-lOOO Spectrophotometer (Labtech International Ltd, Uckfield, UK). The ratio 260/280 nm was in the range of 1.79 to 2.17 with the mean of 2. 12 ::0.01 for all RNA samples used.

Reverse Transcription was performed with lug of RNA using SuperScript II (Invitrogen Life Technologies, Carlsbad, USA.) and random hexamers (Untergasser’s Lab 2008 accessed online 16/12/2016; URL http://wwwuntergasser.de/lab/protocols/cdna_synthesis_superscript_ii_vl_0.htm). Quantitative PCR reaction was performed with cDNA template derived from 4 ng of total RNA in triplicate using SYBR Green Master mix (Applied Biosystems, ThermoFisher Scientific), Cytokines and chemokines fold change were calculated using the “comparative Cycle threshold (Ct) method” established by the manufacturer as described by Livak, KI, and Schmittgen, TD. .

Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2'AACT Method. Methods 24, 402-408.. The e of the triplicate Ct values was used for analysis and the target genes Ct values were normalized to those of the housekeeping gene encoding Glyceraldehyde 3-phosphate dehydrogenase ). The RNA level of expression was determined by qPCR using the Roche Diagnostics LightCycler 480 (Hoffmann La Roche AG, CH). The primers used for qPCR of GAPDH, IFN—y, IL-lB, IL-4, IL-6, IL—10, IL—17A, IL-17F, CXCLil and CXCLi2 are presented in Table 6.

DNA Extraction and PCR Amplification of 168 rRNA Gene Sequences and Microbiota Diversity Bacterial DNA was isolated from 0.25 g cecal content using the PowerSoil DNA Isolation Kit (MO Bio Laboratories) according to the manufacturer’s ctions. Using the isolated DNA as a template the V4 region of the bacterial 16S rRNA gene was PCR amplified using primers 515f (5' GTGCCAGCMGCCGCGGTAA 3 ') and 806r (5' GGACTACHVGGGTWTCTAAT 3 ’) as described by Caporaso, J.G., Lauber, C.L., s, W.A., yons, D., Lozupone, C,A., Turnbaugh, P.J., et al. (2011). Global ns of 16S rRNA diversity at a depth of millions of sequences per sample. Proc. Natl. Acad. Sci. USA. 108 Suppl 1, 4516-4522. doi: 10.1073/pnas.1000080107.

Amplicons were then ced on the Illumina MiSeq platform using 2 x 250 bp cycles.

Prior to metagenomic analysis sequence reads with a quality score mean below 30 were removed using q eder, R., and Edwards, R. (2011) Quality control and preprocessing of metagenomic datasets. Bioinformalics 27, 863-864. doi: 3/bioinformatics/btr026.). The 168 rRNA sequence analysis was performed using Mothur v. 1.37.4 (Schloss, P.D., Westcott, S.L., Ryabin, T., Hall, J.R., Hartmann, M., Hollister, E.B., et al. (2009). Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. iol. 75, 7537-7541. doi: 10.1128/AEM.0154l-09.).

Analysis was performed as according to the MiSeq SOP (accessed online 08/12/2016; Kozich, J.J and Schloss, PD. (2013). pment of a ., Westcott, S.L., Baxter, N.T., Highlander, SK, dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform. Appl. Environ. Microbiol. 79, 5112-5120.) with the ion that the screenseqs command used a maxlength option value similar to that of the 97.5 percentile length. The 168 rRNA gene ces were aligned against a reference alignment based on the SILVA rRNA database (Pruesse, E., Quast, C., Knittel, K, Fuchs, B.M., Ludwig, W.G., Peplies, J., et al. (2007). SILVA: a comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucl. Acids Res. 35, 7188-7196 doi: 10.1093/nar/gkm864) for use in Mothur (available at: https://www.mothur.org/wiki/Silva_reference_f11es), and clustered into operational taxonomic units (OTUs) with an average neighbor ring algorithm. The nearest 16S rRNA gene sequence identities to the OTUs are reported on the basis Tn searches if data matches are from type cultures with a BLAST identity 299%. If not, the consensus taxonomy ofthe OTUs is reported as generated using the classifyotu command in Mothur with reference data from the Ribosomal Database Project (version 14) (Cole, J. R., Wang, Q., Fish, J.A., Chai, B., McGarrell, D. M., Sun, Y., et al. (2014). Ribosomal Database Project: data and tools for high throughput rRNA analysis. Nucl. Acids Res. 42(Database , D633-D642., Wang, Q., Garrity, G, M., Tiedje, J. M., and Cole, J.R. (2007). Na'1've Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial my. Appl Environ Microbiol. 73, 5261-5267. doi: ,1128/AEM00062-07) adapted for use in mothur (available at: //www.mothur.org/wiki/RDP_reference_files).

Data Analysis ANOVA followed by Tukey's multiple comparisons test and Kruskal-Wallis test followed by Dunn's multiple comparisons test was performed using GraphPad Prism n 7.00 for Windows (GraphPad Software, La Jolla, USA, wwwgraphpadcom). Metastats were implemented within Mothur (White, J.R., Nagarajan, N., and Pop, M. . Statistical methods for detecting differentially abundant features in clinical nomic samples. PLoS Comput.

Biol. 03 52. doi: 10.1371/journal.pcbi. 1000352). Data processing and ordination were performed using R project (R Development Core Team, 2008. R: A language and environment for statistical ing. R Foundation for tical Computing, Vienna, a. ISBN 3- 9000510, URL http://www.R-project.org). Heatmaps were d using the heatmap.2 function ofR package gplots (Warnes, G.R., Bolker, B., Bonebakker, L., Gentleman, R., Huber, W., Liaw, A, et a1. (2016). gplots: Various R Programming Tools for Plotting Data. R package version 3.0.1. https://CRAN.R—project.org/package=gplots).

Ethics Statement Studies were carried out under license and in ance with UK Animals (Scientific Procedures) Act 1986. All procedures were approved by the Local Ethics Committee of the University ofNottingham.

The most preferred one or more bacteria are selected from the c bacterial strains Lactobacillus crispatus str. DC21.1 fl3 42771), Lactobacillus johnsonii str. DC22.2 (NCIlVfl3 42772), Lactobacillus reuteri str. DC1B4 (NCIlVfl3 42773), and coccus sp. str.

DC3A4 (NCIMB 42774).

Preferable compositions of the present invention are Lactobacillus crispatus str. DC21.1 (NCIlVfl3 42771) with a galacto-oligosaccharide, such as Nutrabiotic® GOS, Lactobacillus johnsonii str. DC22.2 (NCIlVfl3 42772) with a galacto-oligosaccharide, such as Nutrabiotic® GOS, Lactobacillus reuteri str. DC1B4 (NCIMB 42773) with a galacto-oligosaccharide, such as Nutrabiotic® GOS, and Ruminococcus sp. str. DC3A4 (NCIMB 42774) with a ooligosaccharide , such as Nutrabiotic® GOS.

The strains Lactobacillus tus str. DC21.1 (NCIMB , Lactobacillusjohnsonii str. DC22.2 (NCIlVfl3 42772), Lactobacillus reuteri str. DC1B4 fl3 42773), and Ruminococcus sp. str. DC3A4 (NCIMB 42774), are all commensal to Ross 308 broilers grown on a standard wheat-based feed that also contains Nutrabiotic® GOS (galacto—oligosaccharide) and produced in the poultry facility, University of Nottingham, Sutton Bonington campus, and were isolated from digesta taken from the caecum.

The specific ial strains, as well as the bacteria (not ced), have been identified from the microbiome of the same.

It is reported in Stanley, 0, Hughes, R. J., and Moore, R. J. (2014) “A/[icrobiota of the chicken gastrointestinal tract: influence on health, productivity and disease” Applied Microbiology and Biotechnology, 98 310 and Stanley D, Hughes RJ, Geier MS and Moore RJ(2016) Bacteria within the gastrointestinal tract microbiota correlated with improved growth andfeed conversion: Challenges ted for the fication of performance enhancing probiotic bacteria. Frontiers in Microbiology, 7:187. doi:10.3389/fmicb.2016. 00187 that the bacteria and specific bacterial strains are associated with good es, and/or are associated with the microbiota of broilers that display high performance.

According to one embodiment of the invention, the composition may comprise two or more probiotics. For example, a first probiotic preparation may be taken from a group comprising specific facultative anaerobic commensal bacteria, for example Lactobacillus spp. and Bifidobacterium spp., which produce acetate and lactate when acting on a tic, and a second probiotic preparation may be taken from a group comprising specific strictly anaerobic sal bacteria which produce butyrate ng” on the acetate and lactate produced by the probiotic preparation of the first group. A ‘probiotic preparation’ is considered to comprise one or more probiotic bacteria taken from the respective facultative anaerobic or strictly anaerobic group.

According to another embodiment of the invention, the ition may comprise the two or more probiotics in combination with only one prebiotic material. An example of a potential combination of a composition according to this embodiment may be a first probiotic, for example Lactobacillus spp. or acl‘erium spp., taken from a group comprising specific facultative anaerobic commensal bacteria which e acetate and lactate when acting on the prebiotic, and a second probiotic taken from a group comprising specific strictly anaerobic commensal bacteria which produce butyrate ng” on the acetate and lactate produced by the first probiotic, in combination with a tic, for example, Nutrabiotic® GOS.

The bacteria may comprise facultative anaerobic bacteria or strictly anaerobic bacteria According to another embodiment of the invention, the composition may comprise facultative anaerobic bacteria in ation with a prebiotic. The combination may create acetate and lactate.

According to another embodiment of the ion, the composition may comprise strictly anaerobic bacteria in combination with acetate and lactate. The combination may create organic acids. The organic acids may be, for example, butyrate.

The prebiotic material used in the composition of the invention is typically substantially stible in the gastrointestinal system of a chicken. r aspect of the t invention was to identify specific probiotics which respond favourably to the use of polymeric saccharide, such as an accharide sugar, as a prebiotic material; and whose populations with the broiler intestinal tract can, therefore, be increased by the use of such prebiotics. Therefore, the prebiotic al is typically a ric saccharide, such as an oligosaccharide.

The oligosaccharide used in the composition of the invention may be selected from one or more of fructooligosaccharide (also known as oligofructose) which is a partial hydrolysate of inulin, mannanoligosaccharide (MOS), galactooligosaccharide (GOS), xylooligosaccharide, arabinoxylanoligosaccharide, soyoligosaccharide, lactulose, lactosucrose, isomalto- oligosaccharides, gluco-oligosaccharides, pectic oligosaccharides, and . lly, the oligosaccharide is a galactooligosaccharide.

Galactooligosaccharides (GOS) have the general form (galactosyl)n-lactose and typically range in size from trisaccharides to octasaccharides. Structural complexity is uced by the different intermolecular bonds. Products said to comprise GOS therefore typically contain a mixture of ooligosaccharides, lactose, glucose and galactose, and the term GOS is used herein in a manner intended to encompass such products.

GOS (galacto—oligosaccharide) is sold by Dairy Crest under the trade name Nutrabiotic® GOS for animal feed.

Typically, Nutrabiotic® GOS L is used as the prebiotic in the composition of the present invention. Nutrabiotic® GOS L es with UK and EU Regulations and recommended purity specifications, including heavy metals, for feed and food ingredients. An analysis of iotic® GOS L is provided in Table 21.

The recommended inclusion, or dose, rate ofNutrabiotic® GOS in animal feed diets depends on a number of factors. For example: 0 the animal (e. g. broiler (chicken for fattening) or piglet), 0 life cycle and the feeding regime (e. g. the different feeds being used and the duration of their use; use, and commencement of use, of a creep (pre—starter) feed; age of s at weaning etc); o formulation of the Nutrabiotic® GOS product and, to a lesser extent, the batch of the Nutrabiotic® GOS product being used, The data presented in Table 22 are recommendations based on typical feeding regimes and ones that have been used in both research and cial trials. They can be modified as required.

The data presented in Table 24 es an estimate of the metabolizable energy values of Nutrabiotic® GOS L in rs and piglets.

Nutrabiotic® GOS contains no significant quantities of protein or fat, or vitamins, minerals etc. as shown in Table 21. Nutrabiotic® GOS contains a range of carbohydrates that are either digested as , or fermented as soluble fibre. In the context of energy value for animal feed applications and specific animals, the definition of what is considered fibre is complicated as an appreciable number of disaccharides present in Nutrabiotic® GOS L are fermented. Moreover the proportion of disaccharides that are fermented will differ depending on the animal (e. g. piglets compared to y).

Starter, grower and finisher refer to the diets at the different stages of the broiler tion cycle. The diets correspond to the following periods (day 0 is defined as the day the broiler chicks are “placed” in the y shed, although at day 0 the broiler chicks are usually 1 day old): 0 0 - 10 days Starter feed (sieved crumb, but can alternatively be in the form of a mash feed) 0 11-24 days Grower feed (pellets 3 mm diam.) 0 25-35 days Finisher feed ts 3 mm diam.) The feeds, after the mixing of all the raw materials are pelleted (after steam injection and treatment) are extruded through a defined die to typically give a 3 mm pellet, that is the final broiler feed.

The pelleting process may follow typical methods known to a person skilled in the art.

Suitable feed and pellet size may be known to a person skilled in the art.

Crumb refers to a crumbed (broken into crumb) pelleted feed — typically to give smaller feed pieces that the broiler chicks can manage. A mash feed (a feed mixture that has not been pelleted) may be used instead of a crumb feed for the started feed.

The production cycle in this e is 35 days, which is reasonably common for experiments involving male (we only use the faster growing males to decrease the statistical variation in experimental systems) Ross 308 birds. Poultry cycles are more complex with birds being “harvested” at 35 — 42 days to get different weight ranges for commercial purposes.

Typically, the production cycle is 35 days, which is reasonably common for experiments involving male Aviagen Ross 308 birds, as typically used in the present ion.

The composition of the ion typically includes an amount of between about 104 colony forming units (Cfil) to 1012 cfu, typically between about 105 cfi1 to 1010 cfu, more typically n about 106 cfu to 108cfu, and most typically 107 cfu. CFU is essentially the number of live bacteria added at day 9 of a trial. Preferably, the addition of CFU should not preclude the tic being added at different times, or continuously, as part of the feed, in a cial operation.

The composition of the invention includes a prebiotic, lly Nutrabiotic® G08.

Typically, a starter feed includes an amount of prebiotic, for example Nutrabiotic® GOS, between about 55% to 95% (w/w) solids concentration syrup, typically between about 65% to 85% (w/w) solids concentration syrup, more typically between about 70% to 80% (w/w) solids concentration syrup, and most lly about 75% (w/w) solids concentration syrup.

Typically, in the r feed the tic, for example Nutrabiotic® GOS, is added at a dose rate between about 0.50% to 5.00% (w/w complete starter feed), typically between about 1.50% to 3.50% (w/w complete starter feed), more typically between about 2.00% to 3.00%, even more typically between about 2.20% to 2.60% (w/w complete starter feed), even more typically between about 2.40% to 2.50%, and most typically about 2.47% (w/w complete starter feed).

Typically, a grower feed includes an amount of prebiotic, for example Nutrabiotic® GOS, between about 55% to 95% (w/w) solids concentration syrup, lly between about 65% to 85% (w/w) solids concentration syrup, more lly between about 70% to 80% (w/w) solids concentration syrup, and most typically about 75% (w/w) solids concentration syrup. lly, in the grower feed the prebiotic, for example Nutrabiotic® GOS, is added at a dose rate between about 0.20% to 5.00% (w/w complete grower feed), typically between about 0.60% to 3.50% (w/w complete grower feed), more typically between about 0.90% to 2.80%, even more lly between about 1.10% to 2.00% (w/w complete grower feed), even more typically between about 1.15% to 1.60%, even more typically between about 1.20% to 1.40%, and most lly about 1.24% (w/w complete grower feed).

Typically, the prebiotic, for example, iotic® GOS, is not added to the finisher feed.

In a typical trial experiment, the addition of the bacteria is lly made in 0.10ml of MRD (Maximum Recovery Diluent), giving 107 cfu (colony forming units) or viable cells, by cloacal gavage.

A further aspect of the present ion relates to a composition as defined hereinabove for the treatment and/or nutrition of poultry, such as broiler chickens, to which at least one of the probiotics responds to produce an increase in population.

The composition of the invention may also fithher comprise a nutrient food source. The nutrient food source may contain a source of protein, starch, amino acids, fat, or a combination of any two or more thereof. The nutrient food source may also contain one or more food additives which can be found in y feed, such as, but not limited to, vaccines, antibiotics, and iostats, or a combination thereof. The antibiotics may be those used in treatment or as growth promoters.

The composition of the invention, containing the tic bacteria which are responsive to the prebiotics, and whose presence correlates with improved broiler performance, is able to impart benefits to the development of the poultry compared with poultry which is not exposed to the composition, such as an increased rate of growth, and/or a higher final weight, and/or a larger ratio of kilograms of feed ed per kilogram of growth of the poultry.

The inventors have been able to show that intestinal populations of the tic bacteria d to the administration of prebiotics, such as oligosaccharides; and that increases in populations of one or more of the tic bacteria correlate to improved weight gain within broilers.

Also provided by the t invention is a composition for use in the treatment of enteric bacterial disease in poultry, the composition comprising: (i) a probiotic selected from one or more of the bacteria baclerz’um animalis, Collinsella Zanakaei, Lactobacillus reuteri, Anaerostipes, Lactobacillus crispatus, Pediococcus acidilactici, Lactobacillus ponlis, ibaclerium prausnilzii, Coprococcus cams, Roseburia intestinalis, Anaeroslipes bulyraticus, Buzfyricicoccus, Lactobacillusjohnsonii, and Ruminococcus sp.; and (ii) a prebiotic material.

The definitions and embodiments defined above for the composition of the invention also apply to the composition for use in the treatment of enteric bacterial disease in poultry.

The c bacterial disease is infection by one or more of the following: Clostridium perfringens, Salmonella spp, pathogenic and toxigenic Escherichia coli (EPEC and ETEC).

The composition of the invention may be administered in any suitable manner, including, but not limited to, orally (via feed, which may need to be encapsulated in order to protect the probiotic from the acidic environment in a chicken’s stomach), via intracloacal delivery (Arsi, Donoghue, Woo-Ming, Blore and Donoghue: Intracloacal Inoculation, an Effective Screening Method for ining the Efficacy of Probiotic Bacterial Isolates against Campylobacter sation in Broiler Chickens, Journal of Food Protection, Vol 78, No. l 2015, Pages 209- 213), or via a spray, such as onto chicks so they consume the ition by licking their feathers.

A r aspect of the present invention is a composition for the treatment and/or nutrition of poultry, such as a broiler chicken, comprising one or more specific probiotics and a prebiotic material which produce c acids in the gastrointestinal tract, which impart benefits to the health of the broiler chickens.

All of the probiotics listed hereinabove are able to act in an strictly anaerobic manner, while some are also able to act in a facultative anaerobic manner.

It is those (e.g. Lactobacz'llus spp. and Bg’fidobacterium spp.) which act in a facultative anaerobic manner which produce organic acids, such as acetic and lactic acids, in the gastrointestinal tract such as acetic and lactic acids, when fermenting the prebiotic. The probiotics which are strict anaerobes, produce butyrate and other c acids when ed with a prebiotic and the acetate and lactate. These probiotics include, for example, Coprococcus cams, Roseburia inlestinalis, and Anaerostipes butyralicus, Ruminococcus Sp., Butyricz'coccus, and Faecalibacz‘erium prausnil‘zz'i.

These bacteria are known to feed upon fibre in the gastrointestinal tract of a broiler chicken. That feeding process generates the organic acids which are beneficial in at least two ways. Firstly, they reduce the pH within the tract which, lly speaking, tends to assist the growth of ial gut flora whilst simultaneously inhibiting the growth of more harmful flora.

Secondly, the acids are directly beneficial per se as nutrients to the r and so the presence of one or more of these bacteria produces useable sources of energy.

The probiotics used in the ion serve the additional benefit of reducing populations of harmful gut flora. Examples of such l flora are Clostridium perfringens which is known to cause necrotic enteritis, and ella whose presence is extremely harmful to humans and so desirably eliminated from broilers.

Although one or more of the compositions set out above can be used to treat, for example, the presence of undesirable gut flora in broiler chickens, they may advantageously also be used in feed compositions for prophylactic purposes.

The invention will now be described further by way of e with reference to the following examples, which are intended to be illustrative only and in no way limiting upon the scope of the invention.

Examples An example of a trial experiment using the composition of the invention included the following: o prebiotic (Nutrabiotic® GOS) at the following dose rates: - starter feed: Nutrabiotic® GOS a 75 %(w/w) solids concentration syrup added at a dose rate of 2.47 %(w/w complete starter feed) ° grower feed: Nutrabiotic® GOS a 75 %(w/w) solids concentration syrup added at WO 02671 2017/051949 a dose rate of 1.235 %(w/w complete grower feed) finisher feed: Nutrabiotic® GOS is not added to the finisher feed; 0 Single addition of a probiotic preparation of 107 Cfil, added at day 9 of the trial.

Addition was made in 0.10 ml of MRD (Maximum Recovery Diluent) by cloacal gavage. This method of addition was solely for the purpose to ensure proof of concept. It is not envisaged that this method of addition would be used in a production environment.

Table 1 provides a list of the ients in a commercially available poultry feed mixture, with which the composition of the invention may be combined for stration to the poultry.

Table 1 EXT. HIPRO SOYA MEAL 32.5 30.8 25.3 LIMESTONE GRANULES 0.60 0.40 0.40 SOYABEAN OIL 3.65 5.52 5.60 LYSINE HCL 0.296 0.119 0.123 METHIONINE DL 0362 0.263 0.231 DICALCIUM PHOSPHATE 1.59 1.28 1.12 SODIIHVI BICARBONATE 0.269 0.188 0.193 SALT 0.150 0.210 0.210 THREONINE 0.134 0.054 0.054 TM — Blank Premix for Broiler Formulation 0.400 0.400 0.400 RONOZYME® P5000 (CT) 0030 0.030 0.030 Ronozyme® WX (Xyl) 0.02d 0.02d 0.02d RM - Raw al Ext. Hipro Soya Meal - Extruded Hipro soya meal (and extruded high protein soybean meal) Lysine HCl - (lysine hydrochloride) and Methionine DL (a racemic e of the methionine D and L isomers) amino acids Threonine - an amino acid Dicalcium phosphate, sodium bicarbonate, and salt (sodium chloride) are ly used nutrients TM — Blank Premix for Broiler Formulation is the premix of vitamins and trace elements listed in Table 2.

Ronozyme® P5000 (CT) and Ronozyme® WX (Xyl) are commercial names for enzymes that are commonly used in wheat-based feeds, specifically: Ronozyme® P5000 (CT) is a coated phytase enzyme Ronozyme® WX is a xylanase Reference is also made to Aviagen Ross 308 Broiler Nutrition Specifications 2014 documentation as examples of r diets Table 2 provides the details of the TM Blank Premix for Broiler Formation listed in the ingredients in Table l.

Table 2 Nutrient Analysis USAGE 4.0000 VIT A 13.5000 VIT D3 5.0000 VIT E 100.0000 VIT B1 3 .0000 VIT B2 10.0000 VIT B6 3.0000 VIT B12 30.0000 HETRA 5.0000 NICO 60.0000 PANTO 15,0000 FOLIC 1.5000 BIOTIN 251.0000 CHOLCHL 250.0000 FE 0 MN 100.0000 CU 10.0000 ZN 80.0000 I 1.0000 SE 0.2500 MO 0.5000 *CA/USA 24.9103 *ASH/USA 74.3901 Tables 3 - 8 provide information regarding a trial experiment (Trial 1) carried out by the Applicant. Trial 1 concerned the performance and the up-regulation of certain commensal bacteria in GOS test treatments.

Trial 1 Trial design, measures and analysis o Objective(s): Indicate optimum %(w/w) inclusion rate of galacto-oligosaccharides, reduce and vary the galacto-oligosaccharides %(w/w) inclusion rate in the different feed periods over the lifetime of the bird. The initial objective of the trial was to investigate the effect of NutrabioticTM GOS L on the broiler microbiota by NGS and metagenomic is (along with analyses of gut morphology and changes in immune fiinction se).

Samples for the analysis of gut morphology are stored in dehyde ng Results from NGS and metagenomic analysis of the caecal microbiota, along with changes in immune fiJnction response (as ined through the up/down regulation of cytokines and chemokines) will be available in the coming weeks. 0 Product: Nutrabiotic® GOS L — a G08 50% syrup containing approximately 72 %(w/w) dry solids 0 Base diet: wheat-based (xylanase and phytase included), no coccidiostat 0 Type of bird: male Ross 308 (good chicks from strong 35 week old breeders) 0 Number of treatments: 1 X control + 5 X GOS tests y Control 0 Feed screened for Salmonella prior to arrival of birds to ensure no contamination at feed mill. 0 Birds screened on l for Salmonella and during the trial for both Campylobacter and Salmonella.

Relevant facts/observations General 0 Bird health was good with one bird suffering from hip dislocation and another suffering from sudden death. No comments were received concerning gut lesions.

Performance 0 NutrabioticTM GOS L improved performance in terms of rate of weight gain with overall the best performance appearing to be for the higher GOS inclusion rate being fed throughout the growth period (P < 0.05). These improvements are maintained in the Test treatments.

° The nce intervals of the weight data are quite wide, especially when sample numbers are sed. 0 It appears NutrabioticTM GOS L es FCR for all treatments.

Standard microbiological analyses 0 rd microbiological methods were used to analyse on caecal samples, by standard microbiological methods: ° obacler counts (CCDA plates, micro-aerobic incubation at 42 0C for 48 h, using the Miles and Misra method); ° lactic bacteria counts (MRS plates, anaerobic incubation at 30 °C for 48 h); ° coliform counts (MacConkey no.3 plates, incubation at 37 °C for 24 h).

Microbiota analyses 0 DNA was extracted from the caecal microbiota, targeted amplicon sequencing was employed using 16S RDNA (the gene for bacterial 16S rRNA) as a marker and molecular phylogenetic methods (amplification, sequencing, grouping sequences into OTUs, and the identification of OTUs) are used to infer the composition of the microbial community. 0 Alpha-diversity (number or richness) of taxa were quantified by the Simpson Index for each treatment with good precision (as shown by asymptotic ction curves) and showed no difference between each ent, as was expected. 0 Beta-diversity, which describes how many taxa are shared between treatments (a similarity score and represented by the Yue and n theta similarity coefficient), gave different results: 0 there was a significant difference (P < 0.0010) was found between the GOS[+] and GOS[—] groups (taken as a whole); , ° other es, including AMOVA (analysis of molecular variance) ed these significant differences with the magnitude of the ity being: GOS 3.37% > GOS 1.685% > control with corresponding significance: (GOS 3.37% - GOS 1.685%) > (GOS 1.685% - control); a graphical representation of dissimilarities were shown as non-metric multidimensional scaling plots based on dissimilarity es built from the Yue and Clayton theta coefficients. 0 Metastats (White el al., 2009) was used to determine whether there are any OTUs that are differentially represented between the different treatments: ° between the GOS[+] and GOS[-] groups (taken as a whole) 42 OTUs were identified as significant.

Subsequent bioinformatics analyses The major different OTUs in GOS[+] and GOS[—] groups have been identified, with the following candidate organisms identified as being GOS responsive. Identification was based on OTUs identified from 16S rDNA sequences from the V4 region of the microbiome. It is not possible to obtain more information of exact bacterial subspecies, and in some cases species, without a more complete analysis of the specific ial genome. The identification ed represents the nearest match from the SILVA rRNA database (16S rRNA gene sequences were aligned against a reference ent based on the SILVA rRNA database and red into operational taxonomic units (OTUs) with an average neighbor clustering thm. The nearest 16S rRNA gene sequence identities to the OTUs are reported on the basis of BLASTn searches if data matches are from type cultures with a BLAST identity 299%.): o bacierium animalis subsp. lactis str. V9 0 Collinsella Zanakaei str. YIT 12064 0 Ruminococcus s str, ATCC 27756 0 Lactobacillus reuteri str. BCS 136 o Anaeroslipes sp. str. 35-7 0 Lactobacillus crispatus str. ST] 0 Pediococcus actici o Faecalibacterium prausnitzil' Conclusions In conclusion it was shown that: 0 there was an improvement in performance data, against the control, was seen in test treatments containing Nutrabiotic® GOS Syrup, particularly at the higher dose rate of 3.37 %(w/w); - there was no significant difference n the "richness" of taxa (alpha—diversity) for each treatment, which is to be expected; 0 there was a significant different n the number of taxa shared between between groups (beta-diversity) based on the inclusion of GOS in the diet. this allowed identification of bacteria that were “responsive to Nutrabiotic® G08.

Table 3 provides a list of ients used in a poultry feed as part of Trial 1 Table 3 CON CON CON GOS GOS GOS GOS GOS GOS TR TR TR 3.37 3.37 3.37 1.68 1.68 1.68 L: L: L: 0%: 0%: 0%: 5%: 5%: 5%: ROS ROS ROS ROS ROS ROS ROS ROS ROS S S S S S S S S S 308 308 308 308 308 308 308 308 308 BROI BROI BROI BRO BRO BRO BRO BRO BRO LER LER LER ILER ILER ILER ILER ILER ILER 2015 2015 2015 2015 2015 2015 2015 2015 2015 STA GRO FINIS STA GRO FINI STA GRO FINI RTE WER HER RTE WE SHE RTE WE SHE R R R R R R R 59.99 60.71 66.31 54.0 54.7 60.3 57.0 57.7 63.3 2 WHEAT 9 6 9 16 23 37 03 19 24 EXT. HIPRO SOYA 54 MEAL 32.5 30.8 25.3 33.9 32.2 26.7 33.2 31.5 26.0 LIMESTONE 60 GRANULES 0.60 0.40 0.40 0.60 0.40 0.40 0.60 0.40 0.40 69 SOYABEAN OIL 3.65 5.52 5.60 4.88 6.76 6.84 4.27 6.14 6.22 0.26 0.08 0.09 0.28 0.10 0.10 106 LYSINE HCL 0.296 0.119 0.123 4 7 2 0 3 7 0.36 0.26 0.23 0.36 0.26 0.23 107 METHIONINE DL 0.362 0.263 0.231 6 7 4 4 5 2 DICALCIUM 110 PHOSPHATE 1.59 1.28 1.12 1.61 1.30 1.14 1.60 1.29 1.13 SODIUM 0.24 0.16 0.17 0.25 0.17 0.18 126 BICARBONATE 0.269 0.188 0.193 9 9 3 9 9 3 0.17 0.23 0.22 0.16 0.22 0.22 273 SALT 0.150 0.210 0.210 0 0 0 0 0 0 0.12 0.04 0.04 0.12 0.04 0.04 275 THREONINE 0.134 0.054 0.054 5 4 4 9 9 9 TMB TM - Blank Premix 0.40 0.40 0.40 0.40 0.40 0.40 LANK for Broiler Formulation 0.400 0.400 0.400 0 0 0 0 0 0 PROM NUTRABIOTIC 3.37 3.37 3.37 1.68 1.68 1.68 OV GOS SYRUP 0.000 0.000 0.000 0 0 0 5 5 5 RONO_ RONOZYME 0.03 0.03 0.03 0.03 0.03 0.03 P5 P5000 (CT) 0.030 0.030 0.030 0 0 0 0 0 0 RONO_ me WX 0.02 0.02 0.02 0.02 0.02 0.02 WX (XyI) 0.020 0.020 0.020 0 0 0 0 0 0 Specification [VOLUME] 100 100 100 100 100 100 100 100 100 88.10 88.18 88.06 87.7 87.7 87.6 87.9 87.9 87.8 Dry matter 5 9 6 05 90 67 05 90 67 6.84 8.67 8.71 6.28 8.09 8.13 Oil 'B' 5.707 7.526 7.566 4 2 3 0 9 9 Crude Protein (GP) 22.00 21.00 19.01 21.9 20.9 19.0 21.9 20.9 19.0 (%) 2 4 9 91 90 08 95 97 12 2.63 2.60 2.61 2.70 2.67 2.68 Fibre (%) 2.775 2.745 2.749 7 8 1 6 7 0 .81 5.23 4.85 5.80 5.23 4.85 Ash (%) 5.808 5.236 4.858 0 9 0 9 8 9 1.42 1.23 1.09 1.42 1.23 1.09 Lysine (%) 1.430 1.240 1.091 9 9 1 9 9 1 0.69 0.58 0.52 0.69 0.58 0.52 Methionine (%) 0.691 0.582 0.521 5 6 4 3 4 2 Methionine + 1.07 0.95 0.86 1.07 0.95 0.86 Cystine (M+C) (%) 1.070 0.950 0.861 0 0 0 0 0 0 0.27 0.26 0.23 0.27 0.26 0.23 Tryptophan (%) 0.270 0.261 0.235 1 2 6 0 1 5 0.94 0.82 0.74 0.93 0.83 0.74 Theonine (%) 0.940 0.830 0.741 0 9 0 9 0 0 1.05 0.89 0.83 1.05 0.88 0.83 m (%) 1.047 0.886 0.834 2 2 9 0 9 6 Total Phosphorus 0.67 0.60 0.56 0.67 0.61 0.56 (T:PHOS) (%) 0.677 0.613 0.565 2 7 0 5 0 2 Available Phosphorus (AzPHOS) 0.50 0.45 0.42 0.50 0.45 0.42 (%) 0.500 0.450 0.420 0 0 0 0 0 0 0.32 0.32 0.32 0.32 0.32 0.32 Salt (%) 0.319 0.322 0.326 3 6 1 1 4 8 0.16 0.16 0.15 0.15 0.16 0.16 Sodium (%) 0.158 0.160 0.161 0 2 9 9 1 2 2.90 3.84 3.89 2.61 3.54 3.59 Linoleic acid (%) 2.318 3.251 3.302 3 0 1 3 5 7 0.96 0.92 0.82 0.95 0.92 0.82 Potassium (%) 0.955 0.920 0.822 2 7 9 8 4 5 0.20 0.20 0.19 0.19 0.20 0.20 Chloride (%) 0.198 0.200 0.201 1 2 8 9 1 3 Broiler ME inc. enzyme contribution 12.65 13.20 13.40 12.6 13.2 13.4 12.6 13.2 13.4 (MJ) 2 4 3 49 03 04 52 04 03 a poultry digestible amino acid values 1.30 1.12 0.98 1.30 1.12 0.98 Lysine (%) 1.306 1.122 0.984 5 1 4 6 2 4 0.63 0.53 0.47 0.63 0.52 0.47 Methionine (%) 0.635 0.528 0.473 8 1 5 6 9 4 Methionine + 0.94 0.83 0.75 0.94 0.83 0.75 Cystine (M+C) (%) 0.949 0.834 0.761 7 2 7 8 3 9 0.78 0.68 0.61 0.78 0.68 0.61 Theonine (%) 0.790 0.686 0.614 8 3 1 8 4 3 0.24 0.23 0.20 0.24 0.23 0.20 Tryptophan (%) 0.239 0.230 0.205 0 2 7 0 1 6 0.82 0.79 0.70 0.81 0.78 0.70 lsoleucine (%) 0.814 0.785 0.703 0 0 8 7 8 5 0.87 0.84 0.76 0.87 0.84 0.76 Valine (%) 0.874 0.843 0.759 7 7 2 5 5 0 0.49 0.48 0.43 0.49 0.48 0.43 Histidine (%) 0.496 0.479 0.429 9 1 2 7 0 1 1.29 1.24 1.09 1.28 1.23 1.08 Arginine(%) 1.275 1.225 1.077 3 3 5 4 4 6 Table 4 provides a comparison of the difference in speciation and Degussa y digestible amino acid values from Table 3 Table 4 Differences Specification Control - GOS_3.370% diets Control - GOS_1.685% diets [VOLUME] Starter Grower Finisher Starter Grower Finisher Dry matter 0.39934 0.39814 0.39946 3 1 0.19925 Oil 'B' 1.13654 4 1.14646 0.57313 0.57311 0.57315 0.01150 0.01328 0.00669 7 Crude Protein (CP) (%) 5 5 0.01178 0.00659 5 5 Fibre (%) 0.13749 0.13779 0.13746 0.06888 0.06891 0.06885 0.00262 0.00306 0.00726 - 0.00183 - Ash (%) 8 2 6 0.00123 2 0.00124 0.00116 0.00119 7 0.00059 0.00059 Lysine (%) 6 7 3 7 0.0006 4 2 0.00371 0.00274 0.00185 0.00185 0.00086 Methionine (%) 9 2 1 7 5 9 0.00032 0.00028 0.00065 0.00014 4 Methionine + e (M+C) (%) 8 8 8 6 2 0.00084 0.00092 0.00090 0.00092 0.00045 0.00045 0.00045 Tryptophan (%) 1 9 2 5 4 6 0.00016 0.00085 0.00082 0.00042 0.00043 0.00042 Theonine (%) 1 9 6 8 1 5 0.00570 0.00570 0.00570 0.00285 0.00285 0.00285 Calcium (%) 8 4 9 2 2 2 0.00524 0.00527 0.00524 0.00263 0.00264 0.00263 Total Phosphorus (T:PHOS) (%) 9 9 6 8 1 5 Available Phosphorus (AzPHOS) 0.00012 0.00013 2 (%) 3 3 2 6.6E-05 6.7E-05 6.5E-05 0.00430 0.00429 0.00527 - 0.00214 0.00215 Salt (%) 9 9 1 0.00215 9 1 0.00188 0.00215 8 0.00094 0.00121 0.00094 Sodium (%) 8 6 2 3 3 3 0.58484 8 0.58984 0.29489 0.29488 Linoleic acid (%) 2 2 8 4 8 -0.2949 Potassium (%) 0.00686 0.00682 0.00687 0.00341 0.00341 0.00342 WO 02671 0.00292 0.00291 0.00296 0.00145 0.00145 0.00145 Chloride (%) 3 6 3 9 7 9 Broiler ME inc. enzyme contribution 0.00298 0.00074 0.00066 0.00030 0.00043 0.00037 (MJ) 5 1 1 5 6 9 Degussa poultry digestible amino acid values 0.00082 0.00085 0.00042 0.00042 0.00042 Lysine (%) 9 5 4.8E-05 6 9 3 - 0.00296 0.00198 8 0.00148 0.00049 Methionine (%) 8 4 8 4 1 1 0.00234 0.00333 0.00118 9 0.00217 Methionine + Cystine (M+C) (%) 3 0.00238 3 8 2 8 0.00205 0.00304 0.00153 0.00153 0.00153 Theonine (%) 3 0.00307 3 4 6 2 0.00171 0.00170 0.00171 0.00085 0.00085 0.00085 Tryptophan (%) 7 7 8 4 3 5 0.00506 0.00510 0.00253 - 0.00253 Isoleucine (%) 1 4 4 5 0.00253 8 0.00336 0.00332 0.00337 0.00166 0.00166 - Valine (%) 8 8 2 6 2 0.00167 0.00251 0.00249 0.00251 0.00124 0.00124 0.00125 ine (%) 7 6 9 9 7 1 0.01809 - 0.01809 0.00902 0.00902 0.00903 Arginine (%) 3 0.01805 7 7 3 1 Table 5 provides a summary of the treatments used in Trial 1 Table 5 Group 1 l starter 1 to 10 days Control grower l l to 24 days finishe Control r 25 to 3 5 days Group 2 3 .3 7 %(w/w) GOS r l to 10 days Control feed grower l l to 24 days finishe Control feed r 25 to 3 5 days WO 02671 Group 3 3.37 %(w/w) GOS starter 1 to 10 days 3.37 %(w/w) GOS grower 11 to 24 days finishe Control feed r 25 to 35 days Group 4 3.37 %(w/w) GOS starter 1 to 10 days 3.37 %(w/w) GOS grower 11 to 24 days finishe 3.37 %(w/w) GOS r 25 to 35 days Group 5 Control feed starter 1 to 10 days Control feed grower 11 to 24 days finishe 3.37 %(w/w) GOS r 25 to 35 days Group 6 1.685 %(w/w) GOS starter 1 to 10 days 1.685 %(w/w) GOS grower 11 to 24 days finishe 1.685 %(w/w) GOS r 25 to 35 days Table 6 provides the weight (g) of the broilers used in Trial 1 Table 6 Group Weight (g) 0 8 15 22 28 35 Days G1 40.8 180.0 498.7 934.5 1411.5 2012.0 (g) mean Total 2.87 13.61 56.25 105.33 176.08 213.64 stdeV G2 40.9 188.0 556.4 1032.9 1623.7 2270.7 (g) mean Total 2.85 13.76 61.16 138.65 168.04 253.01 stdeV G3 40.9 190.1 531.6 1009.1 1554.1 2126.6 (g) mean Total 2.96 15.80 54.51 119.53 190.86 210.33 stdeV G4 41.3 183.5 562.5 1030.5 1608.8 2360.8 (g) mean Total 2.88 14.97 64.93 120.45 155.29 144.36 stdeV G5 40.2 185.2 517.0 923.1 1491.1 2197.5 (g) mean T0 at l 2.71 20.25 58.53 127.35 165.93 344.96 stdeV G6 40.5 187.9 526.2 974.8 1540.0 2173.5 (g) mean Total 3.14 22.36 57.52 119.99 170.21 216.79 stdeV Table 7 provides the feed consumption of the broilers used in Trial 1 Table 7 Group Feed consumption (g) 0 10 15 22 25 28 35 Days G1 230 273 657 411 453 1093 Interval (g) mean 12 39 86 70 109 1 17 Total stdev 230 503 1160 1571 2024 3117 Cumm. (g) G2 230 305 725 452 500 1209 Interval (g) mean 26 9O 35 85 102 Total stdev 230 535 1260 1712 2212 3421 Cumm. (g) G3 236 270 713 415 468 1292 Interval (g) mean 13 33 82 62 92 71 Total stdev 236 506 1219 1634 2102 3394 Cumm. (g) G4 224 300 740 461 515 1356 Interval (g) mean 8 22 82 59 69 55 Total stdev 224 524 1264 1725 2240 3596 Cumm. (g) G5 222 289 717 428 495 1225 Interval (g) mean 12 32 84 58 93 105 Total stdev 222 511 1228 1656 2151 3376 Cumm. (g) G6 238 241 719 450 502 1188 al (g) mean 18 42 76 56 91 54 Total stdev 238 479 1198 1648 2150 3338 Cumm. (g) Table 8 provides the cumulative feed consumption ratio of the broilers used in Trial 1 Table 8 Weight Group (g) 0 8 15 22 28 35 Days G1 0.890 1.000 1.240 1.434 1.549 Total G2 0.850 0.962 1.220 1.363 1.507 Total G3 0.870 0.953 1.210 1.353 1.596 Total G4 0.860 0.948 1.220 1.393 1.524 Total G5 0.850 0.990 1.330 1.442 1.537 Total G6 0.880 0.897 1.230 1.396 1.536 Total Tables 9 — 20 provide information regarding a trial experiment (Trial 2) carried out by the Applicant. Trial 2 ned the use obacillus crispatus DC21.1 (NCIlVfl3 42771) as a probiotic Trial 2 Objectives To test the persistence and efficacy of Lactobacillus crispatus was provided as a probiotic to male Ross 308 broilers fed a standard wheat-based feed in the presence and absence of the galacto-oligosaccharide contain product - Nutrabiotic® GOS.

Design 4 ents each ning 20 —24 male Ross 308 broiler that were fed a rd wheat—based starter, grower and finisher feed. The feeds contained no antibiotic or coccidiostat products, but Nutrabiotic® G08 and Lactobacillus crispatus DC21.1 (NCIlVfl3 42771). Details of the feed are given below and in the associated files. The trial was carried out for 35 days, and the acillus crispaz‘us was added on day 9 by cloacal gavage with 107 cfi1 (viable cells) being administered in 0.10 ml MRD (maximum recovery diluent) from a syringe that had been preloaded in an anerobic cabinet. 0 Group 1: Pen 6 iotic® GOS Lactobacillus crispalus 0 Group 2: Pen 7 iotic® GOS not added 0 Group 3: Pen 8 not added not added 0 Group 4: Pen 9 not added Lactobacillus tus Results There was only a single addition of the Lactobacillus crispatus was added on day 9 after bird placement. Persistence of the Lactobacillus crispatus was determined as follows: 0 DNA extractions were made from from caeca contents (MPBio kit) with concentration ranges of 80-250 ng/ul, 0 DNA concentrations were normalised; o qPCR was used, with absolute quantification using a standard curve based on extracted Lactobacillus crispatus DNA at different dilutions.

The concentration of the Laclobacillus crispalus, which is a commensal strain, when administered on day 9 after bird placement was present at the end of the trial at 1.9 - 2.9 X the concentration in treatments where it had not been added by oral gavage.

Whilst this was not a large trial, lacking statistical power, and the s were not significant in that P > 0.05, the increase in bird weight at 35 days was greatest for group 1 (Nutrabiotic® GOS + Lactobacillus tus) with, in some comparisons P < 0.10.

Conclusions Lactobacillus crispatus DC2l.l (NCIMB 42771) persists in the broiler caecum at the end of the ment period, at day 35, when administered at day 9. The probiotic was present a concentrations of 1.9 - 2.9 x the concentration in control treatments. Whilst the trial lacked statistical power, and the results were not significant in that P > 0.05, the increase in bird weight at 35 days was greatest the test group (Nutrabiotic® GOS + Lactobacillus crispatus) with, in some comparisons P < 0.10.

Table 9 Table 9 provides the performance data of Trial 2 — Group 1, Pen 6 WO 02671 Group Lactobacillu 1 Pen 6 GOS2 s crispatus 08/11/1 18/11/1 28/11/1 05/12/1 13/12/1 Date 6 15/11/16 6 6 6 6 Time (days) 0 7 10 20 27 35 Bird Weight Weight Weight Weight Weight Weight (g) (g) (g) (g) (g) (g) 1 41 214 262 740 2 40 198 345 985 1321 1931 3 35 189 323 803 4 39 198 313 876 1159 1745 38 219 332 937 1432 2270 6 3 7 181 297 715 7 40 183 282 758 1298 1803 8 41 185 302 792 1379 2240 9 34 218 299 782 41 171 292 742 1240 1958 11 43 173 313 925 1202 1998 12 38 191 272 746 13 3 5 186 276 717 14 39 203 230 862 39 196 298 867 16 37 147 204 617 17 39 177 263 862 1372 2260 18 41 171 319 986 1361 2080 19 40 196 330 828 1294 2040 41 149 251 779 average weight 38.9 187.3 290.2 816.0 1305.8 2032.5 st. deV. 2.4 19.6 35.8 96.5 85.5 184.4 RSD (%) 6.1% 10.5% 12.3% 11.8% 6.5% 9.1% cum. feed per bird (g) 163 339 1023 1896 3196 FCR 0.870 1.168 1.254 1.452 1.572 Table 10 provides the performance data of Trial 2 — Group 2, Pen 7 Table 10 Grou Pen 7 GOS2 201 18/11/201 28/11/201 05/12/201 13/12/201 Date 08/11/16 6 6 6 6 6 Time (days) 0 7 10 20 27 35 Bird Weight Weight Weight Weight Weight Weight (g) (g) (g) (g) (g) (g) 1 36 178 295 782 2 33 148 248 621 3 35 179 262 757 1042 1567 4 35 148 234 628 38 179 256 799 1317 2018 6 40 189 254 892 7 41 168 256 766 1112 1787 8 41 175 263 792 1282 1946 9 38 168 299 717 38 172 275 778 11 41 164 329 788 12 37 161 308 746 1082 1632 13 38 166 282 781 14 39 201 320 862 1192 1769 40 197 324 898 1186 1738 16 39 154 294 728 1132 1670 17 38 166 242 719 18 43 207 276 986 1372 2149 19 42 204 355 978 1524 2289 40 176 251 779 averag weight 38.6 175.0 281.2 789.9 1224.1 1856.5 st. dev. 2.5 17.4 33.3 95.7 149.3 236.2 (%) 6.6% 9.9% 11.8% 12.1% 12.2% 12.7% cum. feed per bird (g) 158 336 939 1699 2945 FCR 0.900 1.193 1.189 1.388 1.586 Table 11 provides the mance data of Trial 2 — Group 3, Pen 8 Table 11 Grou p 3 Pen 8 08/11/20 15/11/20 18/11/20 28/11/20 05/12/20 13/12/20 Date 16 16 16 16 16 16 Time (days) 0 7 10 20 27 35 Bird Weight Weight Weight Weight Weight Weight (g) (g) (g) (g) (g) (g) 1 40 214 319 900 1492 2172 2 43 198 364 985 1424 2020 3 39 189 294 658 1156 1932 4 39 198 249 626 1154 2002 36 219 264 626 1176 1780 6 37 181 290 705 7 37 183 264 692 8 39 185 293 772 1294 1789 9 39 218 294 737 1094 1693 43 171 285 870 1482 2109 11 44 173 307 930 1374 2039 12 38 191 256 705 13 42 186 283 930 1336 1720 14 42 203 314 893 38 196 258 753 1161 1803 16 41 147 310 857 17 42 177 303 870 1294 1720 18 41 171 287 802 19 40 196 297 840 1424 2123 38 169 283 781 21 37 149 249 589 22 41 182 287 802 23 30 190 282 858 1482 2163 24 42 171 267 799 average weight 39.5 185.7 287.5 790.8 1310.2 1933.2 st. deV. 3.0 18.5 25.8 107.3 141.0 177.6 RSD (%) 7.6% 10.0% 9.0% 13.6% 10.8% 9.2% cum. feed per bird (g) 158 328 999 1760 2932 FCR 0.848 1.142 1.263 1.344 1.517 Table 12 provides the mance data of Trial 2 — Group 4, Pen 9 Table 12 Lactobacill Grou us p 4 Pen 9 crispatus 08/11/20 18/11/20 28/11/20 05/12/20 13/12/20 Date 16 15/11/2016 16 16 16 16 Time (days) 0 7 10 20 27 35 Bird Weight Weight Weight Weight Weight Weight (g) (g) (g) (g) (g) (g) 1 41 214 272 720 wo 2018/002671 2017/051949 2 40 198 230 715 1084 1718 3 35 189 244 739 4 39 198 315 703 38 219 261 658 1078 1700 6 37 181 266 679 1061 1676 7 40 183 237 691 8 41 185 274 668 1180 1890 9 34 218 306 714 1089 1525 41 171 315 802 11 43 173 287 791 1324 2015 12 38 191 343 920 1422 2080 13 35 186 350 952 1548 2300 14 39 203 330 872 1361 2052 39 196 290 819 1248 1825 16 37 147 272 719 1261 1932 17 39 177 263 720 18 41 171 297 752 19 40 196 280 742 1214 1840 41 149 281 779 21 38 185 309 799 1312 1970 22 36 152 244 791 23 40 188 276 801 1328 1890 24 41 207 311 895 average weight 38.9 186.5 285.5 768.4 1250.7 1886.6 st. deV. 2.3 19.7 32.3 79.6 144.4 197.2 RSD (%) 5.9% 10.6% 11.3% 10.4% 11.5% 10.5% cum. feed per bird (g) 158 323 938 1719 2872 FCR 0.847 1.131 1.221 1.375 1.522 #44444 Table 13 provides the t—Test data from Trial 2 Table 13 t-Test Test Time (days) 0 7 10 20 27 3 5 P—values vs 2 0.7011 0.0433 0.4151 0.3959 0.1506 0.0797 Gp 1 vs 3 0.4711 0.7901 0.7737 0.4232 0.9308 0.1974 Gp 1 vs 4 0.9718 0.9058 0.6559 0.0801 0.2940 0.0802 Table 14 provides the feed consumption data from Trial 2 — Group 1, Pen 6 Table 14 Group 1 Pen 6 GOSZ acillus crispatus Date Age feed feed feed cum. feed no of feed cum. start end consumed consumed birds per feed bird per bird (daYS) (g) (g) (g) (g) (g) (g) (55) 08/11/2016 0 4000 740 /11/2016 7 5000 1480 3260 3260 20 163 163 18/11/2016 10 14600 920 3520 6780 20 176 339 28/11/2016 20 12000 3274 13680 20460 20 684 1023 05/12/2016 27 16000 3000 8726 29186 10 873 1896 13/12/2016 35 13000 42186 10 1300 3196 Table 15 provides the feed consumption data from Trial 2 — Group 2, Pen 7 Table 15 Group 2 Pen 7 GOSZ Date Age feed feed feed cum. feed no of feed cum. start end consume consume birds per feed d d bird per bird (dayS) (g) (g) (g) (g) (g) (g) (g) 08/11/201 6 0 4000 850 6 7 5000 1440 3150 3150 20 158 158 18/11/201 6 10 14600 2526 3560 6710 20 178 336 28/11/201 6 20 12000 4400 12074 18784 20 604 939 05/12/201 6 27 16000 3540 7600 263 84 10 760 1699 13/12/201 6 35 12460 38844 10 1246 2945 Table 16 provides the feed consumption data from Trial 2 — Group 3, Pen 8 Table 16 Group 3 Pen 8 Date Age feed feed feed cum. feed no of feed cum. start end consume consume birds per feed d d bird per bird (dayS) (g) (g) (g) (g) (g) (g) (g) 6 0 4000 220 /11/201 6 7 5000 900 3780 3780 24 158 158 18/11/201 6 10 16200 109 4100 7880 24 171 328 28/11/201 6 20 12000 1338 16091 23971 24 670 999 05/12/201 6 27 20000 3599 10662 34633 14 762 1760 13/12/201 6 35 16401 51034 14 1172 2932 Table 17 provides the feed consumption data from Trial 2 — Group 4, Pen 9 Table 1 7 Group 4 Pen 9 Lactobacillus crispatus Date Age feed feed feed cum. feed no of feed cum. start end consumed consumed birds per feed bird per bird (den/S) (g) (g) (g) (g) (g) (g) (g) 08/11/2016 0 4000 210 2016 7 5000 1040 3790 3790 24 158 158 18/11/2016 10 16200 1433 3960 7750 24 165 323 28/11/2016 20 12000 1063 14767 22517 24 615 938 05/12/2016 27 20000 3865 10937 33454 14 781 1719 13/12/2016 35 16135 49589 14 1153 2872 Table 18 is the feed formulation used in Trial 2, days 0 — 10 Table 18 Group 0 - 10 days Starter feed (sieved crumb) L. crispatus GOS N0. . intake Cumm. intake birds (kg/te) (kg/bird) (kg/trt) (kg/bird) (kg/trt) 2 23.860 20 0.294 5.88 0.294 5.88 3 24 0.294 7.06 0.294 7.06 4 + 24 0.294 7.06 0.294 7.06 Totals 88 25.9 25.9 Table 19 provides the feed formulation used in Trial 2, days 11 - 24 Table 19 Group 1 1-24 days Grower feed (pellets 3 mm diam.) L. No. crispatus GOS birds Intake Cumm. intake (kg/te) (kg/bird) (kg/trt) (kg/bird) (kg/trt) 1 + 11.93 20 1.312 26.24 1.606 32.12 2 - 11.93 20 1.312 26.24 1.606 32.12 3 - 24 1.312 31.488 1.606 38.544 4 + 24 1.312 31.488 1.606 38.544 Totals 88 115.456 141.328 Table 20 is the feed formulation used in Trial 2, days 25 - 35 Table 20 Group 25-35 days Finisher feed (pellets 3 mm diam.) L. No. crispatus GOS birds Intake Cumm. intake (kg/te) (kg/bird) (kg/trt) (kg/bird) (kg/trt) 1 + 0 20 1.904 38.08 3.51 70.2 2 - 0 20 1.904 38.08 3.51 70.2 3 - 24 1.904 45.696 3.51 84.24 4 + 24 1.904 45.696 3.51 84.24 Totals 88 167.552 308.88 Table 21 provides a ption ofNutrabiotic® GOS L with which the composition of the invention may comprise as a tic.

Table 21 Nutrabiotic® GOS L 2017/051949 Description : galacto-oligosaccharide syrup.

Typical analysis : dry matter: 75 %(w/w) of which galacto—oligosaccharides: 59 %(w/w DM), lactose: 17%(w/w DM), glucose: 17%(w/w DM), galactose: 7%(w/w DM) Sensorial : clear yellow to colourless liquid syrup, slightly sweet taste.

Specification Method of analysis Chemical and physical: Dry matter 74 :: 2 %(w/w) IDF 26A (1993), 21/2 h 102i2°C Galacto-oligosaccharides 2 57 %(w/w DM) Lactose S 23 %(w/w DM) Dairy Crest methods: , issue 01, Aug-2014 Glucose S 22 %(w/w DM) C-T. 10, issue 06, Mar-2016 Galactose 2 0.8 %(w/w DM) Total Nitrogen S 0.1 %(w/w DM) IDF 20B , Kjeldahl Sulphated ash S 0.3 %(w/w DM) AOAC 17 ed. (2000) 930.30, sulphated = 550°C to constant weight 1000-5000 mPas HAAKE 3.1 - 38 ISO 10523 (1994), potentiometric (10 % w/w) Microbiological: Total plate count S 1000 cfu/g IDF 100B (1991), PCMA 72h 30°C Yeasts S 50 cfu/g IDF 94B (1990), OGYE 5 days 25°C Moulds S 50 cfii/g IDF 94B (1990), OGYE 5 days 25°C Enierobacteriaceae absent in 1 g BDI 23, VRBG 24h 30°C Escherichia coli absent in 5 g IDF l7OA—l (1999), LSTB 48h 37°C, ECB 48h 44°C elleae absent in 25 g IDF 93B (1995) Packaging: 1200 kg IBC Storage: keep in clean, dry and dark conditions, keep away from strongly odorous materials.

Shelf life: 18 months after production date.

Table 22 provides recommendations based on typical feeding regimes and ones that have been used in both research and commercial trials. They can be modified as required. A comparison between broilers and piglets is also provided.

Table 22 Batch number - Nutrabiotic® GOS L batch no. AQ6215 Dry matter 74.2 %(w/w) Water 25.8 %(w/w) Broilers Starter feed day 0 - 10 24.70 kg per metric tonne of complete feed Grower feed day 11 - 24 12.35 kg per metric tonne of complete feed er feed day 25 - not generally required Piglets Creep (pre—starter) feed day 10 - weaning 15.1 kg per metric tonne of te feed Weaning day 28 Starter feed day 28 - 35 9.1 kg per metric tonne of complete feed Link feed day 35 — 49 91 kg per metric tonne of complete feed Grower feed day 49 - 63 as required Notes Dose rates for iotic® GOS L are given for the syrup product as is.

Table 23 provides primers sequence 5’-3’ for the genes expression determined by qPCR.

Table 23 Target gene Primer sequence ) Product size NCBI Accession Reference (bp) number GAPDH F: 343 NM_204305.1 Nang er a].

GACGTGCAGCAGGAACACTA (2011) R: TCTCCATGGTGGTGA AGACA IFN—y F 152 }U%_2051491 TJang a al TGAGCCAGATTGTTTCGATG (2011) RgCTTGGCCAGGTCCATGATA IL-lB F 272 DUM_2045241 GGATTCTGAGCACACCACAGT Iqang a al (2011) TCTGGTTGATGTCGAAGATGT 11r4 F 186 bflfl_0010070791 CATCCGGATAGTGA Tqang et al R: (2011) TGACGCATGTTGAGGAAGAG IL-10 F 203 }U%_0010044142 Nag a al GCTGCGCTTCTACACAGATG (2011) RJTCCCGTTCTCATCCATCTTC IL-6 F:GCTCGCCGGCTTCGA 71 46281 Biaiser a al R: (2003) GGTAGGTCTGAAAGGCGAAC IL17-A F 68 }U%_2044601 I{eid a al CATGGGATTACAGGATCGATG (2016) RgGCGGCACTGGGCATCA IL17-F F 78 )flfl_4262235 I{eid a a[ TGACCCTGCCTCTAGGATGAT (2016) GGGTCCTCATCGAGCCTGTA ChCXCLil F:CCGATGCCAGTGCATAGAG 191 }U%_2050181 Rasoli a al R: (2015) CCTTGTCCAGAATTGCCTTG ChCXCLi2 F: TTCAGCTGCTCTGT 128 NM_205498.1 Rasoli er R: (2015) GCGTCAGCTTCACATCTTGA Table 24 provides an estimate ofthe metabolizable energy values ofNutrabiotic® GOS L in broilers and piglets.

Table 24 Batch number Nutrabiotic® GOS L batch no. AQ6215 Dry matter 74.2 %(w/w) Water 25.8 %(w/w) Net Metabolizable Energy (NME): broilers 6.06 kJ/g Nutrabiotic® GOS L syrup product 1.45 kcal/g Nutrabiotic® GOS L syrup product Net Metabolizable Energy (NME): piglets 7.26 kJ/g Nutrabiotic® GOS L syrup product 1.74 kcal/g iotic® GOS L syrup product Notes The NlVIE values are expressed per weight of the Nutrabiotic® GOS L product as is, i.e. the syrup product that is added.

It is of course to be understood that the present invention is not intended to be cted to the foregoing examples which are described by way of e only.

The present invention relates to compositions for use in the treatment and/or nutrition of poultry, such as broiler chickens (Gallus gallus icus). However it is not beyond the scope of the invention that the present invention may also relate to game birds such as grouse, pheasant or quail, for example.

Claims (18)

1. A composition comprising: (i) a probiotic selected from one or more of the bacteria Bifz’dobacterium animalz’s, Collinsella Zanakaei, Lactobacillus reuteri, Anaerostipes, Laclobacillus crispatus, Pediococcus acidilactici, Lactobacillus pontis, Faecalz'bacz‘erium prausnitzz'i, Coprococcus cams, Roseburia inlestinalis, Anaeroslipes licus, Bulyricicoccus, Lactobacillusjohnsonii, andRuminococcus sp., and (ii) a prebiotic material.

2. A composition according to claim 1, wherein the one or more bacteria are ed from 15 Bifidobacterium animalis subsp. lactis str. V9, Collinsella tanakaei str. YIT 12064, Laclobacillus ri str. BCSl36, Anaeroslipes sp. str. 35-7, Lactobacillus z‘us str. STl, Lactobacillus crispaz‘us str. DC21, Lactobacillus crispaz‘us str. DC21.l (NCIlVIB 42771), Laclobacz'llus johnsonii DC22.2 (NCIMB 42772), Laclobacillus reuleri DClB4 (NCIlVfl3 42773), and Ruminococcus sp. DC3A4 (NCIlVfl3 42774).

3. A composition according to claim 1 or claim 2, wherein the composition ses two or more probiotics.

4. A composition according to claim 3, wherein the composition comprises two or more 25 probiotics in combination with only one prebiotic material.

5. A composition according to claim 4, wherein a first probiotic is taken from a group comprising specific ative anaerobic commensal bacteria, and a second probiotic is taken from a group comprising specific strictly anaerobic commensal bacteria.

6. A composition ing to any ing claim, wherein the tic material is substantially indigestible in the gastrointestinal system of a chicken.

7. A composition according to any preceding claim, wherein the prebiotic material is a polymeric saccharide.

8. A composition according to claim 7, wherein the polymeric saccharide is an oligosaccharide.

9. A composition according to claim 7 or claim 8, wherein the polymeric saccharide is selected from one or more of fructo-oligosaccharide, isomaltooligosaccharide, oligosaccharide, galactooligosaccharide, xylo-oligosaccharide, arabinoxylo- 10 oligosaccharide, glucooligosaccharide, soyoligosaccharide, pectic oligosaccharide, and

10. A composition according to any preceding claim, further comprising a nutrient food source.

11. A composition according to claim 10, wherein the nutrient food source is a source of protein, , amino acids, fat, or a combination of any one or more thereof.

12. A composition according to any preceding claim, n the composition is a starter feed 20 or grower feed,

13. A composition according to 12, n a starter feed comprises a prebiotic in an amount between 55% to 95% (w/w) solids concentration syrup. 25

14. A composition according to any of claims 12 or 13, wherein a starter feed comprises a tic added at a dose rate between 0.50% to 5.00% (w/w complete starter feed).

15. A ition according to claim 12, wherein a grower feed comprises a prebiotic in an amount between 55% to 95% (w/w) solids concentration syrup.

16. A composition according to any of claims 12 or 15, wherein a grower feed comprises a tic added at a dose rate between 0.20% to 5.00% (w/w complete grower feed). WO 02671

17. A composition according to any preceding claim for use in the treatment of c bacterial disease in poultry.

18. A composition according to claim 17, wherein the enteric bacterial disease is infection by one or more of the following: Clostridium perfringens, Salmonella spp, pathogenic and toxigenic Escherichia coli (EPEC and ETEC). 19‘ A method of producing a composition according to any of the preceding claims.